Sample records for frequency dependent conductance

  1. Methods, computer readable media, and graphical user interfaces for analysis of frequency selective surfaces

    DOEpatents

    Kotter, Dale K [Shelley, ID; Rohrbaugh, David T [Idaho Falls, ID

    2010-09-07

    A frequency selective surface (FSS) and associated methods for modeling, analyzing and designing the FSS are disclosed. The FSS includes a pattern of conductive material formed on a substrate to form an array of resonance elements. At least one aspect of the frequency selective surface is determined by defining a frequency range including multiple frequency values, determining a frequency dependent permittivity across the frequency range for the substrate, determining a frequency dependent conductivity across the frequency range for the conductive material, and analyzing the frequency selective surface using a method of moments analysis at each of the multiple frequency values for an incident electromagnetic energy impinging on the frequency selective surface. The frequency dependent permittivity and the frequency dependent conductivity are included in the method of moments analysis.

  2. Effective conductivity and permittivity of unsaturated porous materials in the frequency range 1 mHz–1GHz

    PubMed Central

    Revil, A

    2013-01-01

    A model combining low-frequency complex conductivity and high-frequency permittivity is developed in the frequency range from 1 mHz to 1 GHz. The low-frequency conductivity depends on pore water and surface conductivities. Surface conductivity is controlled by the electrical diffuse layer, the outer component of the electrical double layer coating the surface of the minerals. The frequency dependence of the effective quadrature conductivity shows three domains. Below a critical frequency fp, which depends on the dynamic pore throat size Λ, the quadrature conductivity is frequency dependent. Between fp and a second critical frequency fd, the quadrature conductivity is generally well described by a plateau when clay minerals are present in the material. Clay-free porous materials with a narrow grain size distribution are described by a Cole-Cole model. The characteristic frequency fd controls the transition between double layer polarization and the effect of the high-frequency permittivity of the material. The Maxwell-Wagner polarization is found to be relatively negligible. For a broad range of frequencies below 1 MHz, the effective permittivity exhibits a strong dependence with the cation exchange capacity and the specific surface area. At high frequency, above the critical frequency fd, the effective permittivity reaches a high-frequency asymptotic limit that is controlled by the two Archie's exponents m and n like the low-frequency electrical conductivity. The unified model is compared with various data sets from the literature and is able to explain fairly well a broad number of observations with a very small number of textural and electrochemical parameters. It could be therefore used to interpret induced polarization, induction-based electromagnetic methods, and ground penetrating radar data to characterize the vadose zone. PMID:23576823

  3. Anomalous frequency-dependent ionic conductivity of lesion-laden human-brain tissue

    NASA Astrophysics Data System (ADS)

    Emin, David; Akhtari, Massoud; Fallah, Aria; Vinters, Harry V.; Mathern, Gary W.

    2017-10-01

    We study the effect of lesions on our four-electrode measurements of the ionic conductivity of (˜1 cm3) samples of human brain excised from patients undergoing pediatric epilepsy surgery. For most (˜94%) samples, the low-frequency ionic conductivity rises upon increasing the applied frequency. We attributed this behavior to the long-range (˜0.4 mm) diffusion of solvated sodium cations before encountering intrinsic impenetrable blockages such as cell membranes, blood vessels, and cell walls. By contrast, the low-frequency ionic conductivity of some (˜6%) brain-tissue samples falls with increasing applied frequency. We attribute this unusual frequency-dependence to the electric-field induced liberation of sodium cations from traps introduced by the unusually severe pathology observed in samples from these patients. Thus, the anomalous frequency-dependence of the ionic conductivity indicates trap-producing brain lesions.

  4. Dielectric and impedance spectral characteristics of bulk ZnIn2Se4

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Attia, A. A.; Salem, G. F.; Ali, H. A. M.; Ismail, M. I.

    2014-02-01

    The frequency and temperature dependence of ac conductivity, dielectric constant and dielectric loss of ZnIn2Se4 in a pellet form were investigated in the frequency range of 102-106 Hz and temperature range of 293-356 K. The behavior of ac conductivity was interpreted by the correlated barrier hopping (CBH) model. Temperature dependence of ac conductivity indicates that ac conduction is a thermally activated process. The density of localized states N(EF) and ac activation energy were estimated for various frequencies. Dielectric constant and dielectric loss showed a decrease with increasing frequency and an increase with increasing in temperature. The frequency dependence of real and imaginary parts of the complex impedance was investigated. The relaxation time decreases with the increase in temperature. The impedance spectrum exhibits the appearance of the single semicircular arc. The radius of semicircular arcs decreases with increasing temperature which suggests a mechanism of temperature-dependent on relaxation.

  5. Deformation of giant vesicles in AC electric fields —Dependence of the prolate-to-oblate transition frequency on vesicle radius

    NASA Astrophysics Data System (ADS)

    Antonova, K.; Vitkova, V.; Mitov, M. D.

    2010-02-01

    The electrodeformation of giant vesicles is studied as a function of their radii and the frequency of the applied AC field. At low frequency the shape is prolate, at sufficiently high frequency it is oblate and at some frequency, fc, the shape changes from prolate to oblate. A linear dependence of the prolate-to-oblate transition inverse frequency, 1/fc, on the vesicle radius is found. The nature of this phenomenon does not change with the variation of both the solution conductivity, σ, and the type of the fluid enclosed by the lipid membrane (water, sucrose or glucose aqueous solution). When σ increases, the value of fc increases while the slope of the line 1/fc(r) decreases. For vesicles in symmetrical conditions (the same conductivity of the inner and the outer solution) a linear dependence between σ and the critical frequency, fc, is obtained for conductivities up to σ=114 μS/cm. For vesicles with sizes below a certain minimum radius, depending on the solution conductivity, no shape transition could be observed.

  6. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    NASA Astrophysics Data System (ADS)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  7. Effect of Impedance Relaxation in Conductance Mechanisms in TiO2/ITO/ZnO:Al/p-Si Heterostructure

    NASA Astrophysics Data System (ADS)

    Nouiri, M.; El Mir, L.

    2018-03-01

    The electrical conduction of a TiO2/ITO/ZnO:Al/p-Si structure under alternating-current excitation was investigated in the temperature range of 80 K to 300 K. The frequency dependence of the capacitance and conductance revealed the response of a thermally activated trap characterized by activation energy of about 140 meV. The frequency dependence of the conductance obeyed the universal dynamic response according to the common relation G = Aωs . The temperature dependence of the frequency exponent s illustrates that, in the low frequency range, conduction is governed by the correlated barrier hopping (CBH) mechanism involving two distinct energy levels for all investigated temperatures. For the high frequency region, conduction takes place according to the overlapping large-polaron tunneling mechanism at low temperatures but the CBH mechanism becomes dominant in the high temperature region. This difference in electrical behavior between low and high temperatures can be attributed to the dominance of dielectric relaxation at low compared with high temperatures.

  8. The relation between temperature distribution for lung RFA and electromagnetic wave frequency dependence of electrical conductivity with changing a lung's internal air volumes.

    PubMed

    Yamazaki, Nozomu; Watanabe, Hiroki; Lu, Xiaowei; Isobe, Yosuke; Kobayashi, Yo; Miyashita, Tomoyuki; Fujie, Masakatsu G

    2013-01-01

    Radio frequency ablation (RFA) for lung cancer has increasingly been used over the past few years because it is a minimally invasive treatment. As a feature of RFA for lung cancer, lung contains air during operation. Air is low thermal and electrical conductivity. Therefore, RFA for this cancer has the advantage that only the cancer is coagulated, and it is difficult for operators to control the precise formation of coagulation lesion. In order to overcome this limitation, we previously proposed a model-based robotic ablation system using finite element method. Creating an accurate thermo physical model and constructing thermal control method were a challenging problem because the thermal properties of the organ are complex. In this study, we measured electromagnetic wave frequency dependence of lung's electrical conductivity that was based on lung's internal air volumes dependence with in vitro experiment. In addition, we validated the electromagnetic wave frequency dependence of lung's electrical conductivity using temperature distribution simulator. From the results of this study, it is confirmed that the electromagnetic wave frequency dependence of lung's electrical conductivity effects on heat generation of RFA.

  9. AC conductivity and dielectric behavior of bulk Furfurylidenemalononitrile

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.

    2012-06-01

    AC conductivity and dielectric behavior for bulk Furfurylidenemalononitrile have been studied over a temperature range (293-333 K) and frequency range (50-5×106 Hz). The frequency dependence of ac conductivity, σac, has been investigated by the universal power law, σac(ω)=Aωs. The variation of the frequency exponent (s) with temperature was analyzed in terms of different conduction mechanisms, and it was found that the correlated barrier hopping (CBH) model is the predominant conduction mechanism. The temperature dependence of σac(ω) showed a linear increase with the increase in temperature at different frequencies. The ac activation energy was determined at different frequencies. Dielectric data were analyzed using complex permittivity and complex electric modulus for bulk Furfurylidenemalononitrile at various temperatures.

  10. Anomalous Complex Electrical Conductivity of a Graphitic Black Schist From the Himalayas of Central Nepal

    NASA Astrophysics Data System (ADS)

    Börner, Jana H.; Girault, Frédéric; Bhattarai, Mukunda; Adhikari, Lok Bijaya; Deldicque, Damien; Perrier, Frédéric; Spitzer, Klaus

    2018-05-01

    We analyzed in the laboratory the frequency-dependent, complex-valued, electrical conductivity of a graphitic black schist and an augen gneiss, both collected in the Main Central Thrust shear zone in the Himalayas of central Nepal, which was heavily affected by the deadly Mw7.8 Gorkha earthquake in 2015. We focused on anisotropy and salinity dependence of both cores and crushed material as well as the impact of CO2 on conductivity. This black schist possesses an extraordinarily high polarizability and a highly frequency-dependent conductivity. Its anisotropy is very pronounced. The investigations can relate the main polarization feature to disseminated, aligned plates of graphite. By contrast, the augen gneiss shows low polarizability and a moderately anisotropic conductivity dominated by the pore-filling brine. We further demonstrate that neglecting the complex and frequency-dependent nature of conductivity can lead to serious misinterpretation of magnetotelluric data during inversion if highly polarizable rocks are present.

  11. The conduction block produced by oxcarbazepine in the isolated rat sciatic nerve: a comparison with lamotrigine.

    PubMed

    Guven, Mustafa; Kahraman, Ibrahim; Koc, Filiz; Bozdemir, Hacer; Sarica, Yakup; Gunay, Ismail

    2011-01-01

    Oxcarbazepine is an antiepileptic drug widely used for the treatment of neuropathic pain. In the present study, the effects of oxcarbazepine and lamotrigine on conduction properties in the rat sciatic nerves were examined. The experiments were conducted with in vitro sucrose-gap technique on the isolated wistar rat sciatic nerves. The compound action potentials were obtained by tonic (single) and phasic (10, 40, and 100 Hz) stimulation. Oxcarbazepine produced a significant concentration- and frequency-dependent reduction in the compound action potential amplitude. When the two drugs were applied at concentrations that produced equal levels of tonic (i.e., non-frequency-dependent) conduction block, oxcarbazepine produced the greatest phasic (i.e., frequency-dependent) conduction block, followed by lamotrigine. Oxcarbazepine and lamotrigine reduced the 4-aminopyridine-induced amplitude of delayed depolarization; however, oxcarbazepine had a significantly greater effect than lamotrigine. These results suggest that oxcarbazepine produces more potent frequency-dependent conduction block than lamotrigine, and suppresses the delayed depolarization which contributes to sensory signaling and may play a role in neuropathic pain. The findings provide insight into the mechanisms of action of oxcarbazepine and lamotrigine and may help in the development of novel therapies for neuropathic pain.

  12. Contactless measurement of alternating current conductance in quantum Hall structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drichko, I. L.; Diakonov, A. M.; Malysh, V. A.

    2014-10-21

    We report a procedure to determine the frequency-dependent conductance of quantum Hall structures in a broad frequency domain. The procedure is based on the combination of two known probeless methods—acoustic spectroscopy and microwave spectroscopy. By using the acoustic spectroscopy, we study the low-frequency attenuation and phase shift of a surface acoustic wave in a piezoelectric crystal in the vicinity of the electron (hole) layer. The electronic contribution is resolved using its dependence on a transverse magnetic field. At high frequencies, we study the attenuation of an electromagnetic wave in a coplanar waveguide. To quantitatively calibrate these data, we use themore » fact that in the quantum-Hall-effect regime the conductance at the maxima of its magnetic field dependence is determined by extended states. Therefore, it should be frequency independent in a broad frequency domain. The procedure is verified by studies of a well-characterized p-SiGe/Ge/SiGe heterostructure.« less

  13. Electrical properties of dispersions of graphene in mineral oil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Monteiro, O. R., E-mail: othon.monteiro@bakerhughes.com

    2014-02-03

    Dispersions of graphene in mineral oil have been prepared and electrical conductivity and permittivity have been measured. The direct current (DC) conductivity of the dispersions depends on the surface characteristics of the graphene platelets and followed a percolation model with a percolation threshold ranging from 0.05 to 0.1 wt. %. The difference in DC conductivities can be attributed to different states of aggregation of the graphene platelets and to the inter-particle electron transfer, which is affected by the surface radicals. The frequency-dependent conductivity (σ(ω)) and permittivity (ε(ω)) were also measured. The conductivity of dispersions with particle contents much greater than themore » percolation threshold remains constant and equal to the DC conductivity at low frequencies ω with and followed a power-law σ(ω)∝ ω{sup s} dependence at very high frequencies with s≈0.9. For dispersions with graphene concentration near the percolation threshold, a third regime was displayed at intermediate frequencies indicative of interfacial polarization consistent with Maxwell-Wagner effect typically observed in mixtures of two (or more) phases with very distinct electrical and dielectric properties.« less

  14. Bioelectrical Impedance and The Frequency Dependent Current Conduction Through Biological Tissues: A Short Review

    NASA Astrophysics Data System (ADS)

    Kanti Bera, Tushar

    2018-03-01

    Biological tissues are developed with biological cells which exhibit complex electrical impedance called electrical bioimpedance. Under an alternating electrical excitation the bioimpedance varies with the tissue anatomy, composition and the signal frequency. The current penetration and conduction paths vary with frequency of the applied signal. Bioimpedance spectroscopy is used to study the frequency response of the electrical impedance of biological materials noninvasively. In bioimpedance spectroscopy, a low amplitude electrical signal is injected to the tissue sample or body parts to characterization the sample in terms of its bioimpedance. The electrical current conduction phenomena, which is highly influenced by the tissue impedance and the signal frequency, is an important phenomena which should be studied to understand the bioimpedance techniques like bioelectrical impedance analysis (BIA), EIS, or else. In this paper the origin of bioelectrical impedance and current conduction phenomena has been reviewed to present a brief summary of bioelectrical impedance and the frequency dependent current conduction through biological tissues. Simulation studies are conducted with alternation current injection through a two dimensional model of biological tissues containing finite number of biological cells suspended in extracellular fluid. The paper demonstrates the simulation of alternating current conduction through biological tissues conducted by COMSOL Multiphysics. Simulation studies also show the frequency response of the tissue impedance for different tissue compositions.

  15. Fractional calculus applied to the analysis of spectral electrical conductivity of clay-water system.

    PubMed

    Korosak, Dean; Cvikl, Bruno; Kramer, Janja; Jecl, Renata; Prapotnik, Anita

    2007-06-16

    The analysis of the low-frequency conductivity spectra of the clay-water mixtures is presented. The frequency dependence of the conductivity is shown to follow the power-law with the exponent n=0.67 before reaching the frequency-independent part. When scaled with the value of the frequency-independent part of the spectrum the conductivity spectra for samples at different water content values are shown to fit to a single master curve. It is argued that the observed conductivity dispersion is a consequence of the anomalously diffusing ions in the clay-water system. The fractional Langevin equation is then used to describe the stochastic dynamics of the single ion. The results indicate that the experimentally observed dielectric properties originate in anomalous ion transport in clay-water system characterized with time-dependent diffusion coefficient.

  16. Heat transport by phonons in crystalline materials and nanostructures

    NASA Astrophysics Data System (ADS)

    Koh, Yee Kan

    This dissertation presents experimental studies of heat transport by phonons in crystalline materials and nanostructures, and across solid-solid interfaces. Particularly, this dissertation emphasizes advancing understanding of the mean-free-paths (i.e., the distance phonons propagate without being scattered) of acoustic phonons, which are the dominant heat carriers in most crystalline semiconductor nanostructures. Two primary tools for the studies presented in this dissertation are time-domain thermoreflectance (TDTR) for measurements of thermal conductivity of nanostructures and thermal conductance of interfaces; and frequency-domain thermoreflectance (FDTR), which I developed as a direct probe of the mean-free-paths of dominant heat-carrying phonons in crystalline solids. The foundation of FDTR is the dependence of the apparent thermal conductivity on the frequency of periodic heat sources. I find that the thermal conductivity of semiconductor alloys (InGaP, InGaAs, and SiGe) measured by TDTR depends on the modulation frequency, 0.1 ≤ f ≤ 10 MHz, used in TDTR measurements. Reduction in the thermal conductivity of the semiconductor alloys at high f compares well to the reduction in the thermal conductivity of epitaxial thin films, indicating that frequency dependence and thickness dependence of thermal conductivity are fundamentally equivalent. I developed the frequency dependence of thermal conductivity into a convenient probe of phonon mean-free-paths, a technique which I call frequency-domain thermoreflectance (FDTR). In FDTR, I monitor the changes in the intensity of the reflected probe beam as a function of the modulation frequency. To facilitate the analysis of FDTR measurements, I developed a nonlocal theory for heat conduction by phonons at high heating frequencies. Calculations of the nonlocal theory confirm my experimental findings that phonons with mean-free-paths longer than two times the penetration depth do not contribute to the apparent thermal conductivity. I employed FDTR to study the mean-free-paths of acoustic phonons in Si1-xGex. I experimentally demonstrate that 40% of heat is carried in Si1-xGe x alloys by phonons with mean-free-path 0.5 ≤ ℓ ≤ 5 mum, and phonons with > 2 mum do not contribute to the thermal conductivity of Si. I employed TDTR and frequency-dependent TDTR to study scattering of long- and medium-wavelength phonons in two important thermoelectric materials embedded with nanoscale precipitates. I find that the through-thickness lattice thermal conductivity of (PbTe)1-x/(PbSe)x nanodot superlattices (NDSLs) approaches the thermal conductivity of bulk homogenous PbTe1-x Sex alloys with the same average composition. On the other hand, I find that 3% of ErAs nanoparticles embedded in InGaAs is sufficient to scatter most of the phonons in InGaAs that have intermediate mean-free-paths, and thus reduces the thermal conductivity of InGaAs below the alloy limit. I find that scattering by nanoparticles approach the geometrical limit and can be readily accounted for by an additional boundary scattering which depends on the concentration of nanoparticles. Finally, I studied the thermal conductance of Au/Ti/Graphene/SiO 2 interfaces by TDTR. I find that heat transport across the interface is dominated by phonons. Even though graphene is only one atomic layer thick, graphene interfaces should be treated as two discrete interfaces instead of one diffuse interface in thermal analysis, suggesting that direct transmission of phonons from Au to SiO2 is negligible. My study is important for thermal management of graphene devices.

  17. Conduction mechanism in bismuth silicate glasses containing titanium

    NASA Astrophysics Data System (ADS)

    Dult, Meenakshi; Kundu, R. S.; Murugavel, S.; Punia, R.; Kishore, N.

    2014-11-01

    Bismuth silicate glasses mixed with different concentrations of titanium dioxide having compositions xTiO2-(60-x)Bi2O3-40SiO2 with x=0, 5, 10, 15 and 20 were prepared by the normal melt quench technique. The frequency dependence of the ac electrical conductivity of different compositions of titanium bismuth silicate glasses has been studied in the frequency range 10-1 Hz to 10 MHz and in the temperature range 623-703 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of titanium bismuth silicate glass system. The dc conductivity (σdc), so called crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. The conductivity data have been analyzed in terms of different theoretical models to determine the possible conduction mechanism. Analysis of the conductivity data and the frequency exponent shows that the correlated barrier hopping of electrons between Ti3+ and Ti4+ ions in the glasses is the most favorable mechanism for ac conduction. The temperature dependent dc conductivity has been analyzed in the framework of theoretical variable range hopping model (VRH) proposed by Mott which describe the hopping conduction in disordered semiconducting systems. The various polaron hopping parameters have also been deduced. Mott's VRH model is found to be in good agreement with experimental data and the values of inverse localization length of s-like wave function (α) obtained by this model with modifications suggested by Punia et al. are close to the ones reported for a number of oxide glasses.

  18. Simultaneous measurement of thermal conductivity and heat capacity of bulk and thin film materials using frequency-dependent transient thermoreflectance method.

    PubMed

    Liu, Jun; Zhu, Jie; Tian, Miao; Gu, Xiaokun; Schmidt, Aaron; Yang, Ronggui

    2013-03-01

    The increasing interest in the extraordinary thermal properties of nanostructures has led to the development of various measurement techniques. Transient thermoreflectance method has emerged as a reliable measurement technique for thermal conductivity of thin films. In this method, the determination of thermal conductivity usually relies much on the accuracy of heat capacity input. For new nanoscale materials with unknown or less-understood thermal properties, it is either questionable to assume bulk heat capacity for nanostructures or difficult to obtain the bulk form of those materials for a conventional heat capacity measurement. In this paper, we describe a technique for simultaneous measurement of thermal conductivity κ and volumetric heat capacity C of both bulk and thin film materials using frequency-dependent time-domain thermoreflectance (TDTR) signals. The heat transfer model is analyzed first to find how different combinations of κ and C determine the frequency-dependent TDTR signals. Simultaneous measurement of thermal conductivity and volumetric heat capacity is then demonstrated with bulk Si and thin film SiO2 samples using frequency-dependent TDTR measurement. This method is further testified by measuring both thermal conductivity and volumetric heat capacity of novel hybrid organic-inorganic thin films fabricated using the atomic∕molecular layer deposition. Simultaneous measurement of thermal conductivity and heat capacity can significantly shorten the development∕discovery cycle of novel materials.

  19. Ballistic heat conduction and mass disorder in one dimension.

    PubMed

    Ong, Zhun-Yong; Zhang, Gang

    2014-08-20

    It is well-known that in the disordered harmonic chain, heat conduction is subballistic and the thermal conductivity (κ) scales asymptotically as lim(L--> ∞) κ ∝ L(0.5) where L is the chain length. However, using the nonequilibrium Green's function (NEGF) method and analytical modelling, we show that there exists a critical crossover length scale (LC) below which ballistic heat conduction (κ ∝ L) can coexist with mass disorder. This ballistic-to-subballistic heat conduction crossover is connected to the exponential attenuation of the phonon transmittance function Ξ i.e. Ξ(ω, L) = exp[-L/λ(ω)], where λ is the frequency-dependent attenuation length. The crossover length can be determined from the minimum attenuation length, which depends on the maximum transmitted frequency. We numerically determine the dependence of the transmittance on frequency and mass composition as well as derive a closed form estimate, which agrees closely with the numerical results. For the length-dependent thermal conductance, we also derive a closed form expression which agrees closely with numerical results and reproduces the ballistic to subballistic thermal conduction crossover. This allows us to characterize the crossover in terms of changes in the length, mass composition and temperature dependence, and also to determine the conditions under which heat conduction enters the ballistic regime. We describe how the mass composition can be modified to increase ballistic heat conduction.

  20. Transport conductivity of graphene at RF and microwave frequencies

    NASA Astrophysics Data System (ADS)

    Awan, S. A.; Lombardo, A.; Colli, A.; Privitera, G.; Kulmala, T. S.; Kivioja, J. M.; Koshino, M.; Ferrari, A. C.

    2016-03-01

    We measure graphene coplanar waveguides from direct current (DC) to a frequency f = 13.5 GHz and show that the apparent resistance (in the presence of parasitic impedances) has an {ω }2 dependence (where ω =2π f), but the intrinsic conductivity (without the influence of parasitic impedances) is frequency-independent. Consequently, in our devices the real part of the complex alternating current (AC) conductivity is the same as the DC value and the imaginary part is ˜0. The graphene channel is modeled as a parallel resistive-capacitive network with a frequency dependence identical to that of the Drude conductivity with momentum relaxation time ˜2.1 ps, highlighting the influence of AC electron transport on the electromagnetic properties of graphene. This can lead to optimized design of high-speed analog field-effect transistors, mixers, frequency doublers, low-noise amplifiers and radiation detectors.

  1. Impedance Spectroscopy Analysis of Mg4Nb2O9 Ceramics with Different Additions of V2O5 for Microwave and Radio Frequency Applications

    NASA Astrophysics Data System (ADS)

    Filho, J. M. S.; Rodrigues Junior, C. A.; Sousa, D. G.; Oliveira, R. G. M.; Costa, M. M.; Barroso, G. C.; Sombra, A. S. B.

    2017-07-01

    The complex impedance spectroscopy study of magnesium niobate Mg4Nb2O9 (MN) ceramics with different additions of V2O5 (0%, 2%, 5%) was performed in this present paper. The preparation of MN samples were carried out by using the solid-state reaction method with a high-energy milling machine. Frequency and temperature dependence of the complex impedance, complex modulus analysis, and conductivity were measured and calculated at different temperatures by using a network impedance analyzer. A non-Debye type relaxation was observed showing a decentralization of the semicircles. Cole-Cole formalism was adopted here with the help of a computer program used to fit the experimental data. A typical universal dielectric response in the frequency-dependent conductivity at different temperatures was found. The frequency dependent ac conductivity at different temperatures indicates that the conduction process is thermally activated. The activation energy was obtained from the Arrhenius fitting by using conductivity and electrical modules data. The results would help to understand deeply the relaxation process in these types of materials.

  2. Study on the temperature-dependent coupling among viscosity, conductivity and structural relaxation of ionic liquids.

    PubMed

    Yamaguchi, Tsuyoshi; Yonezawa, Takuya; Koda, Shinobu

    2015-07-15

    The frequency-dependent viscosity and conductivity of three imidazolium-based ionic liquids were measured at several temperatures in the MHz region, and the results are compared with the intermediate scattering functions determined by neutron spin echo spectroscopy. The relaxations of both the conductivity and the viscosity agree with that of the intermediate scattering function at the ionic correlation when the relaxation time is short. As the relaxation time increases, the relaxations of the two transport properties deviate to lower frequencies than that of the ionic structure. The deviation begins at a shorter relaxation time for viscosity than for conductivity, which explains the fractional Walden rule between the zero-frequency values of the shear viscosity and the molar conductivity.

  3. Self-consistent modeling of terahertz waveguide and cavity with frequency-dependent conductivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Y. J.; Chu, K. R., E-mail: krchu@yahoo.com.tw; Thumm, M.

    The surface resistance of metals, and hence the Ohmic dissipation per unit area, scales with the square root of the frequency of an incident electromagnetic wave. As is well recognized, this can lead to excessive wall losses at terahertz (THz) frequencies. On the other hand, high-frequency oscillatory motion of conduction electrons tends to mitigate the collisional damping. As a result, the classical theory predicts that metals behave more like a transparent medium at frequencies above the ultraviolet. Such a behavior difference is inherent in the AC conductivity, a frequency-dependent complex quantity commonly used to treat electromagnetics of metals at opticalmore » frequencies. The THz region falls in the gap between microwave and optical frequencies. However, metals are still commonly modeled by the DC conductivity in currently active vacuum electronics research aimed at the development of high-power THz sources (notably the gyrotron), although a small reduction of the DC conductivity due to surface roughness is sometimes included. In this study, we present a self-consistent modeling of the gyrotron interaction structures (a metallic waveguide or cavity) with the AC conductivity. The resulting waveguide attenuation constants and cavity quality factors are compared with those of the DC-conductivity model. The reduction in Ohmic losses under the AC-conductivity model is shown to be increasingly significant as the frequency reaches deeper into the THz region. Such effects are of considerable importance to THz gyrotrons for which the minimization of Ohmic losses constitutes a major design consideration.« less

  4. Action Potential Broadening in Capsaicin-Sensitive DRG Neurons from Frequency-Dependent Reduction of Kv3 Current

    PubMed Central

    Liu, Pin W.; Blair, Nathaniel T.

    2017-01-01

    Action potential (AP) shape is a key determinant of cellular electrophysiological behavior. We found that in small-diameter, capsaicin-sensitive dorsal root ganglia neurons corresponding to nociceptors (from rats of either sex), stimulation at frequencies as low as 1 Hz produced progressive broadening of the APs. Stimulation at 10 Hz for 3 s resulted in an increase in AP width by an average of 76 ± 7% at 22°C and by 38 ± 3% at 35°C. AP clamp experiments showed that spike broadening results from frequency-dependent reduction of potassium current during spike repolarization. The major current responsible for frequency-dependent reduction of overall spike-repolarizing potassium current was identified as Kv3 current by its sensitivity to low concentrations of 4-aminopyridine (IC50 <100 μm) and block by the peptide inhibitor blood depressing substance I (BDS-I). There was a small component of Kv1-mediated current during AP repolarization, but this current did not show frequency-dependent reduction. In a small fraction of cells, there was a component of calcium-dependent potassium current that showed frequency-dependent reduction, but the contribution to overall potassium current reduction was almost always much smaller than that of Kv3-mediated current. These results show that Kv3 channels make a major contribution to spike repolarization in small-diameter DRG neurons and undergo frequency-dependent reduction, leading to spike broadening at moderate firing frequencies. Spike broadening from frequency-dependent reduction in Kv3 current could mitigate the frequency-dependent decreases in conduction velocity typical of C-fiber axons. SIGNIFICANCE STATEMENT Small-diameter dorsal root ganglia (DRG) neurons mediating nociception and other sensory modalities express many types of potassium channels, but how they combine to control firing patterns and conduction is not well understood. We found that action potentials of small-diameter rat DRG neurons showed spike broadening at frequencies as low as 1 Hz and that spike broadening resulted predominantly from frequency-dependent inactivation of Kv3 channels. Spike width helps to control transmitter release, conduction velocity, and firing patterns and understanding the role of particular potassium channels can help to guide new pharmacological strategies for targeting pain-sensing neurons selectively. PMID:28877968

  5. Action Potential Broadening in Capsaicin-Sensitive DRG Neurons from Frequency-Dependent Reduction of Kv3 Current.

    PubMed

    Liu, Pin W; Blair, Nathaniel T; Bean, Bruce P

    2017-10-04

    Action potential (AP) shape is a key determinant of cellular electrophysiological behavior. We found that in small-diameter, capsaicin-sensitive dorsal root ganglia neurons corresponding to nociceptors (from rats of either sex), stimulation at frequencies as low as 1 Hz produced progressive broadening of the APs. Stimulation at 10 Hz for 3 s resulted in an increase in AP width by an average of 76 ± 7% at 22°C and by 38 ± 3% at 35°C. AP clamp experiments showed that spike broadening results from frequency-dependent reduction of potassium current during spike repolarization. The major current responsible for frequency-dependent reduction of overall spike-repolarizing potassium current was identified as Kv3 current by its sensitivity to low concentrations of 4-aminopyridine (IC 50 <100 μm) and block by the peptide inhibitor blood depressing substance I (BDS-I). There was a small component of Kv1-mediated current during AP repolarization, but this current did not show frequency-dependent reduction. In a small fraction of cells, there was a component of calcium-dependent potassium current that showed frequency-dependent reduction, but the contribution to overall potassium current reduction was almost always much smaller than that of Kv3-mediated current. These results show that Kv3 channels make a major contribution to spike repolarization in small-diameter DRG neurons and undergo frequency-dependent reduction, leading to spike broadening at moderate firing frequencies. Spike broadening from frequency-dependent reduction in Kv3 current could mitigate the frequency-dependent decreases in conduction velocity typical of C-fiber axons. SIGNIFICANCE STATEMENT Small-diameter dorsal root ganglia (DRG) neurons mediating nociception and other sensory modalities express many types of potassium channels, but how they combine to control firing patterns and conduction is not well understood. We found that action potentials of small-diameter rat DRG neurons showed spike broadening at frequencies as low as 1 Hz and that spike broadening resulted predominantly from frequency-dependent inactivation of Kv3 channels. Spike width helps to control transmitter release, conduction velocity, and firing patterns and understanding the role of particular potassium channels can help to guide new pharmacological strategies for targeting pain-sensing neurons selectively. Copyright © 2017 the authors 0270-6474/17/379705-10$15.00/0.

  6. Influence of nanotube length and density on the plasmonic terahertz response of single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Karlsen, P.; Shuba, M. V.; Beckerleg, C.; Yuko, D. I.; Kuzhir, P. P.; Maksimenko, S. A.; Ksenevich, V.; Viet, Ho; Nasibulin, A. G.; Tenne, R.; Hendry, E.

    2018-01-01

    We measure the conductivity spectra of thin films comprising bundled single-walled carbon nanotubes (CNTs) of different average lengths in the frequency range 0.3-1000 THz and temperature interval 10-530 K. The observed temperature-induced changes in the terahertz conductivity spectra are shown to depend strongly on the average CNT length, with a conductivity around 1 THz that increases/decreases as the temperature increases for short/long tubes. This behaviour originates from the temperature dependence of the electron scattering rate, which we obtain from Drude fits of the measured conductivity in the range 0.3-2 THz for 10 μm length CNTs. This increasing scattering rate with temperature results in a subsequent broadening of the observed THz conductivity peak at higher temperatures and a shift to lower frequencies for increasing CNT length. Finally, we show that the change in conductivity with temperature depends not only on tube length, but also varies with tube density. We record the effective conductivities of composite films comprising mixtures of WS2 nanotubes and CNTs versus CNT density for frequencies in the range 0.3-1 THz, finding that the conductivity increases/decreases for low/high density films as the temperature increases. This effect arises due to the density dependence of the effective length of conducting pathways in the composite films, which again leads to a shift and temperature dependent broadening of the THz conductivity peak.

  7. Analysis of the conduction mechanism and dielectric properties of N, N', N" tris(4-methylphenyl)phosphoric triamide

    NASA Astrophysics Data System (ADS)

    Ali, H. A. M.

    2016-03-01

    The structure for the powder of N,N', N"-tris(4-methylphenyl)phosphoric triamide, TMP-TA, was characterized using X-ray diffraction (XRD) and differential thermal analysis (DTA) techniques. The ac conductivity and dielectric properties were measured in the frequency range of 42-105 Hz for the bulk TMP-TA in a pellet form at different temperatures. The frequency dependence of ac conductivity was expressed by a Jonscher's universal power law. The frequency exponent (s) was determined from the fitting of experimental data of ac conductivity. The correlated barrier hopping (CBH) model was found to be responsible for the ac conduction mechanism in TMP-TA. The activation energy was calculated from the temperature dependence of ac conductivity. The values of the density of states at the Fermi level were determined for different frequencies. The components of the electric modulus (M' and M") were calculated and used to estimate the relaxation time.

  8. Drude-jellium model for the microwave conductivity of electrolyte solutions

    NASA Astrophysics Data System (ADS)

    Nhan, Tran Thi; Theu, Luong Thi; Tuan, Le; Viet, Nguyen Ai

    2018-05-01

    The microwave conductivity characteristics of electrolyte solutions have attracted much interest of researchers because a good understanding of their properties plays a key role to study fundamental processes in biology and chemistry. In this work, we consider the solution of sodium chloride as a plasma consisting of ions with water background. Its plasmon frequency is calculated by the jellium theory. The linear dependence of the microwave conductivity on the ion concentration of the electrolyte solutions is explained by a microscopic approach and described by a combination of this plasmon relationship and the simplified Drude formula for dielectric constant. Furthermore, the dependence of the microwave conductivity on the frequency of the salt solution is also examined. We suggest that it obeys the logistic distribution. We found a good agreement between theoretical calculations and experimental data. The values of the damping coefficient γ for the conductive solutions at low frequencies and the cutting frequency are estimated. The linear dependence of the diffusion coefficient on the temperature of the salt solution is also shown, in similarity with the result in the other model. The application of the Drude-jellium model could be done for the other electrolyte solutions in order to study theirs electro-dynamic properties.

  9. FREQUENCY-DEPENDENT ABSORPTION OF ELECTROMAGNETIC ENERGY IN BIOLOGICAL TISSUE

    EPA Science Inventory

    The frequency-dependent absorption of electromagnetic energy in biological tissue is illustrated by use of the Debye equations, model calculations for different irradiation conditions, and measured electrical properties (conductivity and permittivity) of different tissues. Four s...

  10. Studies on frequency dependent electrical and dielectric properties of sintered zinc oxide pellets: effects of Al-doping

    NASA Astrophysics Data System (ADS)

    Tewari, S.; Ghosh, A.; Bhattacharjee, A.

    2016-11-01

    Sintered pellets of zinc oxide (ZnO), both undoped and Al-doped are prepared through a chemical process. Dopant concentration of Aluminium in ZnO [Al/Zn in weight percentage (wt%)] is varied from 0 to 3 wt%. After synthesis structural characterisation of the samples are performed with XRD and SEM-EDAX which confirm that all the samples are of ZnO having polycrystalline nature with particle size from 108.6 to 116 nm. Frequency dependent properties like a.c. conductivity, capacitance, impedance and phase angle are measured in the frequency range 10 Hz to 100 kHz as a function of temperature (in the range 25-150 °C). Nature of a.c. conductivity in these samples indicates hopping type of conduction arising from localised defect states. The frequency and temperature dependent properties under study are found to be as per correlated barrier hoping model. Dielectric and impedance properties studied in the samples indicate distributed relaxation, showing decrease of relaxation time with temperature.

  11. AC conductivity and Dielectric Study of Chalcogenide Glasses of Se-Te-Ge System

    NASA Astrophysics Data System (ADS)

    Salman, Fathy

    2004-01-01

    The ac conductivity and dielectric properties of glassy system SexTe79 - xGe21, with x = 11, 14, 17 at.%, has been studied at temperatures 300 to 450 K and over a wide range of frequencies (50 Hz to 500 kHz). Experimental results indicate that the ac conductivity and the dielectric constants depend on temperature, frequency and Se content. The conductivity as a function of frequency exhibited two components: dc conductivity s dc, and ac conductivity s ac, where s ac ˜ w s. The mechanism of ac conductivity can be reasonably interpreted in terms of the correlated barrier hopping model (CBH). The activation energies are estimated and discussed. The dependence of ac conductivity and dielectric constants on the Se content x can be interpreted as the effect of Se fraction on the positional disorder. The impedance plot at each temperature appeared as a semicircle passes through the origin. Each semicircle is represented by an equivalent circuit of parallel resistance Rb and capacitance Cb.

  12. Terahertz conductivity of MnSi thin films

    NASA Astrophysics Data System (ADS)

    Dodge, J.; Mohtashemi, Laleh; Farahani, Amir; Karhu, Eric; Monchesky, Theodore

    2013-03-01

    We present measurements of the low-frequency optical conductivity of MnSi thin films, using time-domain terahertz spectroscopy. At low temperatures and low frequencies, we extract the DC resistivity, scattering life time and plasma frequency from a Drude fit. We obtain a value of ωp ~= 1 . 0 eV, which can be used to estimate the renormalization coefficient through comparison with band theory. At higher temperatures, deviations from Drude behavior are observed, suggesting a loss of quasi-particle coherence. In the region of low temperatures and high frequencies, we see evidence for a crossover to the anomalous power law dependence observed by Mena et al. As the temperature increases, the anomalous frequency dependence becomes more pronounced, and the plasma frequency inferred from a Drude fit decreases dramatically. Above T ~ 50 K, σ2 (ω) develops a negative slope that is inconsistent with both a Drude model and the anomalous power law observed earlier, indicating a sharp pseudogap in the conductivity spectrum.

  13. Dielectric and AC conductivity studies on SrBi4Ti4O15

    NASA Astrophysics Data System (ADS)

    Jose, Roshan; Saravanan, K. Venkata

    2018-05-01

    The four layered SrBi4Ti4O15 ceramics which belong to the aurivillius family of oxide was prepared by conventional solid state reaction technique. Analysis of the dielectric data as a function of temperature and frequency revealed normal phase transition. The frequency dependent ac conductivity follows Jonscher's universal power law. Frequency exponent (n), pre-exponential factor (A), bulk dc conductivity (σdc), and hopping frequency (ωp) were determined from the fitting curves. The variation of frequency exponent with temperature indicates that large polaron hopping mechanism up to curie-temperature, then its changes to small polaron hopping. The activation energies were calculated from ac conductivity, bulk dc conductivity and hopping frequency. The activation energies revealed that conductivity had contributions from migrations of oxygen vacancies, bismuth ion vacancies and strontium ion vacancies.

  14. The effects of experimentally induced conductive hearing loss on spectral and temporal aspects of sound transmission through the ear.

    PubMed

    Eric Lupo, J; Koka, Kanthaiah; Thornton, Jennifer L; Tollin, Daniel J

    2011-02-01

    Conductive hearing loss (CHL) is known to produce hearing deficits, including deficits in sound localization ability. The differences in sound intensities and timing experienced between the two tympanic membranes are important cues to sound localization (ILD and ITD, respectively). Although much is known about the effect of CHL on hearing levels, little investigation has been conducted into the actual impact of CHL on sound location cues. This study investigated effects of CHL induced by earplugs on cochlear microphonic (CM) amplitude and timing and their corresponding effect on the ILD and ITD location cues. Acoustic and CM measurements were made in 5 chinchillas before and after earplug insertion, and again after earplug removal using pure tones (500 Hz to 24 kHz). ILDs in the unoccluded condition demonstrated position and frequency dependence where peak far-lateral ILDs approached 30 dB for high frequencies. Unoccluded ear ITD cues demonstrated positional and frequency dependence with increased ITD cue for both decreasing frequency (±420 μs at 500 Hz, ±310 μs for 1-4 kHz) and increasingly lateral sound source locations. Occlusion of the ear canal with foam plugs resulted in a mild, frequency-dependent conductive hearing loss of 10-38 dB (mean 31 ± 3.9 dB) leading to a concomitant frequency dependent increase in ILDs at all source locations. The effective ITDs increased in a frequency dependent manner with ear occlusion as a direct result of the acoustic properties of the plugging material, the latter confirmed via acoustical measurements using a model ear canal with varying volumes of acoustic foam. Upon ear plugging with acoustic foam, a mild CHL is induced. Furthermore, the CHL induced by acoustic foam results in substantial changes in the magnitudes of both the ITD and ILD cues to sound location. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. The effects of experimentally induced conductive hearing loss on spectral and temporal aspects of sound transmission through the ear

    PubMed Central

    Lupo, J. Eric; Koka, Kanthaiah; Thornton, Jennifer L.; Tollin, Daniel J.

    2010-01-01

    Conductive hearing loss (CHL) is known to produce hearing deficits, including deficits in sound localization ability. The differences in sound intensities and timing experienced between the two tympanic membranes are important cues to sound localization (ILD and ITD, respectively). Although much is known about the effect of CHL on hearing levels, little investigation has been conducted into the actual impact of CHL on sound location cues. This study investigated effects of CHL induced by earplugs on cochlear microphonic (CM) amplitude and timing and their corresponding effect on the ILD and ITD location cues. Acoustic and CM measurements were made in 5 chinchillas before and after earplug insertion, and again after earplug removal using pure tones (500 Hz to 24 kHz). ILDs in the unoccluded condition demonstrated position and frequency dependence where peak far-lateral ILDs approached 30 dB for high frequencies. Unoccluded ear ITD cues demonstrated positional and frequency dependence with increased ITD cue for both decreasing frequency (± 420 µs at 500 Hz, ± 310 µs for 1–4 kHz ) and increasingly lateral sound source locations. Occlusion of the ear canal with foam plugs resulted in a mild, frequency-dependent conductive hearing loss of 10–38 dB (mean 31 ± 3.9 dB) leading to a concomitant frequency dependent increase in ILDs at all source locations. The effective ITDs increased in a frequency dependent manner with ear occlusion as a direct result of the acoustic properties of the plugging material, the latter confirmed via acoustical measurements using a model ear canal with varying volumes of acoustic foam. Upon ear plugging with acoustic foam, a mild CHL is induced. Furthermore, the CHL induced by acoustic foam results in substantial changes in the magnitudes of both the ITD and ILD cues to sound location. PMID:21073935

  16. Heating-frequency-dependent thermal conductivity: An analytical solution from diffusive to ballistic regime and its relevance to phonon scattering measurements

    NASA Astrophysics Data System (ADS)

    Yang, Fan; Dames, Chris

    2015-04-01

    The heating-frequency dependence of the apparent thermal conductivity in a semi-infinite body with periodic planar surface heating is explained by an analytical solution to the Boltzmann transport equation. This solution is obtained using a two-flux model and gray mean free time approximation and verified numerically with a lattice Boltzmann method and numerical results from the literature. Extending the gray solution to the nongray regime leads to an integral transform and accumulation-function representation of the phonon scattering spectrum, where the natural variable is mean free time rather than mean free path, as often used in previous work. The derivation leads to an approximate cutoff conduction similar in spirit to that of Koh and Cahill [Phys. Rev. B 76, 075207 (2007), 10.1103/PhysRevB.76.075207] except that the most appropriate criterion involves the heater frequency rather than thermal diffusion length. The nongray calculations are consistent with Koh and Cahill's experimental observation that the apparent thermal conductivity shows a stronger heater-frequency dependence in a SiGe alloy than in natural Si. Finally these results are demonstrated using a virtual experiment, which fits the phase lag between surface temperature and heat flux to obtain the apparent thermal conductivity and accumulation function.

  17. Dielectric behavior and AC conductivity of Cr doped α-Mn2O3

    NASA Astrophysics Data System (ADS)

    Chandra, Mohit; Yadav, Satish; Singh, K.

    2018-05-01

    The complex dielectric behavior of polycrystalline α-Mn2-xCrxO3 (x = 0.10) has been investigated isothermally at wide frequency range (4Hz-1 MHz) at different temperatures (300-390K). The dielectric spectroscopy results have been discussed in different formulism like dielectric constant, impedance and ac conductivity. The frequency dependent dielectric loss (tanδ) exhibit a clear relaxation behavior in the studied temperature range. The relaxation frequency increases with increasing temperature. These results are fitted using Arrhenius equation which suggest thermally activated process and the activation energy is 0.173±0.0024 eV. The normalized tanδ curves at different temperatures merge as a single master curve which indicate that the relaxation process follow the similar relaxation dynamics in the studied temperature range. Further, the dielectric relaxation follows non-Debye behavior. The impedance results inference that the grain boundary contribution dominate at lower frequency whereas grain contribution appeared at higher frequencies and exhibit strong temperature dependence. The ac conductivity data shows that the ac conductivity increases with increasing temperature which corroborate the semiconducting nature of the studied sample.

  18. Equilibrium finite-frequency noise of an interacting mesoscopic capacitor studied in time-dependent density functional theory

    NASA Astrophysics Data System (ADS)

    Dittmann, Niklas; Splettstoesser, Janine; Helbig, Nicole

    2018-03-01

    We calculate the frequency-dependent equilibrium noise of a mesoscopic capacitor in time-dependent density functional theory (TDDFT). The capacitor is modeled as a single-level quantum dot with on-site Coulomb interaction and tunnel coupling to a nearby reservoir. The noise spectra are derived from linear-response conductances via the fluctuation-dissipation theorem. Thereby, we analyze the performance of a recently derived exchange-correlation potential with time-nonlocal density dependence in the finite-frequency linear-response regime. We compare our TDDFT noise spectra with real-time perturbation theory and find excellent agreement for noise frequencies below the reservoir temperature.

  19. ECON-KG: A Code for Computation of Electrical Conductivity Using Density Functional Theory

    DTIC Science & Technology

    2017-10-01

    is presented. Details of the implementation and instructions for execution are presented, and an example calculation of the frequency- dependent ...shown to depend on carbon content,3 and electrical conductivity models have become a requirement for input into continuum-level simulations being... dependent electrical conductivity is computed as a weighted sum over k-points: () = ∑ () ∗ () , (2) where W(k) is

  20. Spectrophotometric and electrical properties of imperatorin: an organic molecule

    NASA Astrophysics Data System (ADS)

    Mir, Feroz A.

    2015-09-01

    Imperatorin (molecular formula = C16H14O4, molecular mass = 270) an organic molecule was isolated from ethyl acetate extract of the root parts of the plant Prangos pabularia. The optical study was carried out by ultraviolet-visible spectroscopy, and this compound showed an indirect allowed transition. The optical band gap ( E g ) was found around 3.75 eV. Photoluminescence shows various good emission bands. The frequency-dependent real part of the complex ac conductivity was found to follow the universal dielectric response: σ ac ( ω) α ω s [where σ ac ( ω) is the frequency-dependent total conductivity, ω is the frequency, and s is the frequency exponent]. From ac conductivity data analysis, correlated barrier hopping charge-transport mechanism is the dominant electrical transport process shown by this compound. The good emission, less absorption, wide band gap and good electrical properties shown by this compound project them as a bright choice for organic electronic devices.

  1. Temperature and frequency dependent conductivity of bismuth zinc vanadate semiconducting glassy system

    NASA Astrophysics Data System (ADS)

    Punia, R.; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Kishore, N.

    2012-10-01

    The ac conductivity of bismuth zinc vanadate glasses with compositions 50V2O5. xBi2O3. (50-x) ZnO has been studied in the frequency range 10-1 Hz to 2 MHz and in temperature range 333.16 K to 533.16 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of bismuth zinc vanadate glass system. The dc conductivity (σdc), crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. It has been observed that mobility of charge carriers and ac conductivity in case of zinc vanadate glass system increases with increase in Bi2O3 content. In order to determine the conduction mechanism, the ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models based on classical hopping over barriers and quantum mechanical tunneling. The ac conduction takes place via tunneling of overlapping large polarons in all the compositions of presently studied vanadate glasses. The fitting of experimental data of ac conductivity with overlapping large polarons tunneling model has also been done. The parameters; density of states at Fermi level (N(EF)), activation energy associated with charge transfer between the overlapping sites (WHO), inverse localization length (α) and polaron radius (rp) obtained from fitting of this model with experimental data are reasonable.

  2. Measurements of temperature characteristics and estimation of terahertz negative differential conductance in resonant-tunneling-diode oscillators

    NASA Astrophysics Data System (ADS)

    Asada, M.; Suzuki, S.; Fukuma, T.

    2017-11-01

    The temperature dependences of output power, oscillation frequency, and current-voltage curve are measured for resonant-tunneling-diode terahertz (THz) oscillators. The output power largely changes with temperature owing to the change in Ohmic loss. In contrast to the output power, the oscillation frequency and current-voltage curve are almost insensitive to temperature. The measured temperature dependence of output power is compared with the theoretical calculation including the negative differential conductance (NDC) as a fitting parameter assumed to be independent of temperature. Very good agreement was obtained between the measurement and calculation, and the NDC in the THz frequency region is estimated. The results show that the absolute values of NDC in the THz region significantly decrease relative to that at DC, and increases with increasing frequency in the measured frequency range.

  3. Investigation of conduction and relaxation phenomena in BaZrxTi1-xO3 (x=0.05) by impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Mahajan, Sandeep; Haridas, Divya; Ali, S. T.; Munirathnam, N. R.; Sreenivas, K.; Thakur, O. P.; Prakash, Chandra

    2014-10-01

    In present study we have prepared ferroelectric BaZrxTi1-xO3 (x=0.05) ceramic by conventional solid state reaction route and studied its electrical properties as a function of temperature and frequency. X-ray diffraction (XRD) analysis shows single-phase formation of the compound with orthorhombic crystal structure at room temperature. Impedance and electric modulus spectroscopy analysis in the frequency range of 40 Hz-1 MHz at high temperature (200-600 °C) suggests two relaxation processes with different time constant are involved which are attributed to bulk and grain boundary effects. Frequency dependent dielectric plot at different temperature shows normal variation with frequency while dielectric loss (tanδ) peak was found to obey an Arrhenius law with activation energy of 1.02 eV. The frequency-dependent AC conductivity data were also analyzed in a wide temperature range. In present work we have studied the role of grain and grain boundaries on the electrical behaviour of Zr-doped BaTiO3 and their dependence on temperature and frequency by complex impedance and modulus spectroscopy (CIS) technique in a wide frequency (40 Hz-1 MHz) and high temperature range.

  4. Impedance Spectrum in Cortical Tissue: Implications for Propagation of LFP Signals on the Microscopic Level

    PubMed Central

    Miceli, Stéphanie

    2017-01-01

    Brain research investigating electrical activity within neural tissue is producing an increasing amount of physiological data including local field potentials (LFPs) obtained via extracellular in vivo and in vitro recordings. In order to correctly interpret such electrophysiological data, it is vital to adequately understand the electrical properties of neural tissue itself. An ongoing controversy in the field of neuroscience is whether such frequency-dependent effects bias LFP recordings and affect the proper interpretation of the signal. On macroscopic scales and with large injected currents, previous studies have found various grades of frequency dependence of cortical tissue, ranging from negligible to strong, within the frequency band typically considered relevant for neuroscience (less than a few thousand hertz). Here, we performed a detailed investigation of the frequency dependence of the conductivity within cortical tissue at microscopic distances using small current amplitudes within the typical (neuro)physiological micrometer and sub-nanoampere range. We investigated the propagation of LFPs, induced by extracellular electrical current injections via patch-pipettes, in acute rat brain slice preparations containing the somatosensory cortex in vitro using multielectrode arrays. Based on our data, we determined the cortical tissue conductivity over a 100-fold increase in signal frequency (5–500 Hz). Our results imply at most very weak frequency-dependent effects within the frequency range of physiological LFPs. Using biophysical modeling, we estimated the impact of different putative impedance spectra. Our results indicate that frequency dependencies of the order measured here and in most other studies have negligible impact on the typical analysis and modeling of LFP signals from extracellular brain recordings. PMID:28197543

  5. Impedance Spectrum in Cortical Tissue: Implications for Propagation of LFP Signals on the Microscopic Level.

    PubMed

    Miceli, Stéphanie; Ness, Torbjørn V; Einevoll, Gaute T; Schubert, Dirk

    2017-01-01

    Brain research investigating electrical activity within neural tissue is producing an increasing amount of physiological data including local field potentials (LFPs) obtained via extracellular in vivo and in vitro recordings. In order to correctly interpret such electrophysiological data, it is vital to adequately understand the electrical properties of neural tissue itself. An ongoing controversy in the field of neuroscience is whether such frequency-dependent effects bias LFP recordings and affect the proper interpretation of the signal. On macroscopic scales and with large injected currents, previous studies have found various grades of frequency dependence of cortical tissue, ranging from negligible to strong, within the frequency band typically considered relevant for neuroscience (less than a few thousand hertz). Here, we performed a detailed investigation of the frequency dependence of the conductivity within cortical tissue at microscopic distances using small current amplitudes within the typical (neuro)physiological micrometer and sub-nanoampere range. We investigated the propagation of LFPs, induced by extracellular electrical current injections via patch-pipettes, in acute rat brain slice preparations containing the somatosensory cortex in vitro using multielectrode arrays. Based on our data, we determined the cortical tissue conductivity over a 100-fold increase in signal frequency (5-500 Hz). Our results imply at most very weak frequency-dependent effects within the frequency range of physiological LFPs. Using biophysical modeling, we estimated the impact of different putative impedance spectra. Our results indicate that frequency dependencies of the order measured here and in most other studies have negligible impact on the typical analysis and modeling of LFP signals from extracellular brain recordings.

  6. Frequency shifts of an electric-dipole resonance near a conducting surface

    NASA Technical Reports Server (NTRS)

    Holland, W. R.; Hall, D. G.

    1984-01-01

    The resonance frequency of an electric dipole placed near a conducting surface is shifted by the dipole-surface interaction. The observation and measurement of these shifts at optical frequencies is reported for an experimental system that consists of a metal-island film spaced a distance d from a continuous Ag film. The dependence of the shift in the frequency of the island resonance on d shows good agreement with that predicted by a classical theory of the dipole-surface interaction.

  7. Evidence for power-law frequency dependence of intrinsic dielectric response in the Ca Cu3 Ti4 O12

    NASA Astrophysics Data System (ADS)

    Tselev, Alexander; Brooks, Charles M.; Anlage, Steven M.; Zheng, Haimei; Salamanca-Riba, Lourdes; Ramesh, R.; Subramanian, M. A.

    2004-10-01

    We investigated the dielectric response of CaCu3Ti4O12 (CCTO) thin films grown epitaxially on LaAlO3 (001) substrates by pulsed laser deposition. The dielectric response of the films was found to be strongly dominated by a power law in frequency, typical of materials with localized hopping charge carriers, in contrast to the Debye-like response of the bulk material. The film conductivity decreases with annealing in oxygen, and it suggests that oxygen deficit is a cause of the relatively high film conductivity. With increase of the oxygen content, the room temperature frequency response of the CCTO thin films changes from the response indicating the presence of some relatively low conducting capacitive layers to purely power law, and then toward a frequency independent response with a relative dielectric constant ɛ'˜102 . The film conductance and dielectric response decrease upon decrease of the temperature, with dielectric response being dominated by the power-law frequency dependence. Below ˜80K , the dielectric response of the films is frequency independent with ɛ' close to 102 . The results provide another piece of evidence for an extrinsic, Maxwell-Wagner type, origin of the colossal dielectric response of the bulk CCTO material, connected with electrical inhomogeneity of the bulk material.

  8. Investigation of dielectric properties of polymer composites reinforced with carbon nanotubes in the frequency band of 0.01 Hz - 10 MHz

    NASA Astrophysics Data System (ADS)

    Goshev, A. A.; Eseev, M. K.; Kapustin, S. N.; Vinnik, L. N.; Volkov, A. S.

    2016-08-01

    The goal of this work is experimental study of dielectric properties of polymer nanocomposites reinforced with multiwalled carbon nanotubes (MWCNTs) in alternating electric field in low frequency band of 0.01 Hz - 10 MHz. We investigated the influence, functionalization degree, aspect ratio, concentration of carbon nanotubes (CNTs) on dielectric properties of polymer sample. We also studied the dependence of dielectric properties on the polymerization temperature. The dependence of CNTs agglomeration on sample polymerization temperature and temperature's influence on conductivity has been shown. We conducted model calculation of percolation threshold and figured out its dependence on CNTs aspect ratio.

  9. Experimental Investigation of Electrical Conductivity and Permittivity of SC-TiO 2 -EG Nanofluids.

    PubMed

    Fal, Jacek; Barylyak, Adriana; Besaha, Khrystyna; Bobitski, Yaroslav V; Cholewa, Marian; Zawlik, Izabela; Szmuc, Kamil; Cebulski, Józef; Żyła, Gaweł

    2016-12-01

    The paper presents experimental studies of dielectric properties of nanofluids based on ethylene glycol and SC-TiO2 nanoparticles with average size of 15-40 nm with various mass concentrations. The dielectric permittivity both real part and imaginary part as a function of temperature and frequency were measured. Also, dependence ac conductivity on frequency, temperature, and mass concentration were investigated. Based on the curves of ac conductivity, dc conductivity was calculated, and 400 % enhancement in dc conductivity was exposed.

  10. Experimental Investigation of Electrical Conductivity and Permittivity of SC-TiO 2 -EG Nanofluids

    NASA Astrophysics Data System (ADS)

    Fal, Jacek; Barylyak, Adriana; Besaha, Khrystyna; Bobitski, Yaroslav V.; Cholewa, Marian; Zawlik, Izabela; Szmuc, Kamil; Cebulski, Józef; żyła, Gaweł

    2016-08-01

    The paper presents experimental studies of dielectric properties of nanofluids based on ethylene glycol and SC-TiO2 nanoparticles with average size of 15-40 nm with various mass concentrations. The dielectric permittivity both real part and imaginary part as a function of temperature and frequency were measured. Also, dependence ac conductivity on frequency, temperature, and mass concentration were investigated. Based on the curves of ac conductivity, dc conductivity was calculated, and 400 % enhancement in dc conductivity was exposed.

  11. Polymer nanocomposite dielectric and electrical properties with quantum dots nanofiller

    NASA Astrophysics Data System (ADS)

    Ahmed, R. M.; Morsi, R. M. M.

    2017-10-01

    Nanocomposite films of different contents of CdSe/ZnS quantum dots nanoparticles embedded in hosting matrix of polyvinyl chloride (PVC) were prepared by simple solution casting method. Electrical and dielectric properties of nanocomposites films were investigated in the temperature range 323-393 (K) and at frequencies (50-2000) kHz. The frequency dependence of AC conductivity was following the universal power law. The values of the frequency exponent, s, revealed that the conduction mechanism at low temperature is considered by small polaron tunneling model, whereas at high temperature, it is related to CBH model. The activation energy values (ΔE) were depending on nanoparticle concentration as well as frequency. Also, X-ray diffraction (XRD) enabled approximately estimating the average particle size of the nanoparticles incorporated in PVC.

  12. Optical spectroscopy of the Weyl semimetal TaAs

    DOE PAGES

    Xu, B.; Dai, Y. M.; Zhao, L. X.; ...

    2016-03-24

    Here, we present a systematic study of both the temperature and frequency dependence of the optical response in TaAs, a material that has recently been realized to host the Weyl semimetal state. Our study reveals that the optical conductivity of TaAs features a narrow Drude response alongside a conspicuous linear dependence on frequency. The weight of the Drude peak decreases upon cooling, following a T 2 temperature dependence, in good agreement with theoretical predictions. Two linear components with distinct slopes dominate the low-temperature optical conductivity. A comparison between our experimental results and theoretical calculations suggests that the linear conductivity belowmore » ~230 cm –1 arises purely from interband transitions near the Weyl points, providing rich information about the Weyl semimetal state in TaAs.« less

  13. Relaxation processes and conduction mechanism in bismuth ferrite lead titanate composites

    NASA Astrophysics Data System (ADS)

    Sahu, Truptimayee; Behera, Banarji

    2018-02-01

    In this study, samarium (Sm)-doped multiferroic composites of 0.8BiSmxFe1-xO3-0.2PbTiO3 where x = 0.05, 0.10, 0.15, and 0.20 were prepared via the conventional solid state reaction route. The electrical properties of these composites were analyzed using an impedance analyzer over a wide range of temperatures and frequencies (102-106 Hz). The impedance and modulus analyses confirmed the presence of both bulk and grain boundary effects in the materials. The temperature dependence of impedance and modulus spectrum indicated the negative temperature coefficient of resistance behavior. The dielectric relaxation exhibited non-Debye type behavior and it was temperature dependent. The relaxation time (τ) and DC conductivity followed an Arrhenius type behavior. The frequency-dependent AC conductivity obeyed Jonscher's power law. The correlated barrier hopping model was appropriate to understand the conduction mechanism in the composites considered.

  14. Thermal conductivity of nanocrystalline silicon: importance of grain size and frequency-dependent mean free paths.

    PubMed

    Wang, Zhaojie; Alaniz, Joseph E; Jang, Wanyoung; Garay, Javier E; Dames, Chris

    2011-06-08

    The thermal conductivity reduction due to grain boundary scattering is widely interpreted using a scattering length assumed equal to the grain size and independent of the phonon frequency (gray). To assess these assumptions and decouple the contributions of porosity and grain size, five samples of undoped nanocrystalline silicon have been measured with average grain sizes ranging from 550 to 64 nm and porosities from 17% to less than 1%, at temperatures from 310 to 16 K. The samples were prepared using current activated, pressure assisted densification (CAPAD). At low temperature the thermal conductivities of all samples show a T(2) dependence which cannot be explained by any traditional gray model. The measurements are explained over the entire temperature range by a new frequency-dependent model in which the mean free path for grain boundary scattering is inversely proportional to the phonon frequency, which is shown to be consistent with asymptotic analysis of atomistic simulations from the literature. In all cases the recommended boundary scattering length is smaller than the average grain size. These results should prove useful for the integration of nanocrystalline materials in devices such as advanced thermoelectrics.

  15. Capacitance and conductance-frequency characteristics of In-pSi Schottky barrier diode

    NASA Astrophysics Data System (ADS)

    Dhimmar, J. M.; Desai, H. N.; Modi, B. P.

    2015-06-01

    The Schottky barrier height (SBH) values have been calculated by using the reverse bias capacitance-voltage (C-V) characteristics at temperature range of 120-360K. The forward bias capacitance-frequency (C-f) and conductance- frequency (G-f) measurement of In-pSi SBD have been carried out from 0-1.0 V with a step up 0.05 V whereby the energy distribution of the interface state has been determined from the forward bias I-V data taking the bias dependence of the effective barrier height and series resistance (RS) into account. The high value of ideality factor (n=2.12) was attributing to high density of interface states and interfacial oxide layer at metal semiconductor interface. The interface state density (NSS) shows a decrease with bias from bottom of conduction band toward the mid gap. In order to examine frequency dependence NSS, RS, C-V and G(ω)/ω-f measurement of the diode were performed at room temperature in the frequency range of 100Hz-100KHz. Experimental result confirmed that there is an influence in the electrical characteristic of Schottky diode.

  16. Dielectric Relaxation In Complex Perovskite Sm(Ni{sub 1/2}Ti{sub 1/2})O{sub 3}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Nishant; Prasad, S.; Sinha, T. P.

    2011-11-22

    The complex perovskite oxide Samarium nickel titenate, Sm(Ni{sub 1/2}Ti{sub 1/2})O{sub 3}(SNT) is synthesized by a solid-state reaction technique. The X-ray diffraction of the sample at room temperature shows a monoclinic phase. The scanning micrograph of the sample shows the average grain size{approx_equal}0.6{mu}m The field dependence of dielectric response and the loss tangent of the sample are measured in a frequency range from 100Hz to 1MHz and in a temperature range from 313 K to 673 K. An analysis of the real and imaginary parts of the dielectric permittivity with frequency is performed, assuming a distribution of relaxation times as confirmedmore » by Cole-Cole plots. The frequency dependent electrical data are analyzed in the framework of conductivity formalism. The frequency dependent conductivity data are fitted to the universal power law. All these formalisms provided for qualitative similarities in the relaxation times.« less

  17. Electrical properties of praseodymium oxide doped Boro-Tellurite glasses

    NASA Astrophysics Data System (ADS)

    Jagadeesha Gowda G., V.; Devaraja, C.; Eraiah, B.

    2016-05-01

    Glasses of the composition xPr6O11- (35-x)TeO2-65B2O3 (x=0, 0.1 to 0.5 mol %) have been prepared using the melt quenching method. The ac and dc conductivity of glass have been measured over a wide range of frequencies and temperatures. Experimental results indicate that the ac conductivity depend on temperature, frequency and Praseodymium content. The conductivity as a function of frequency exhibited two components: dc conductivity (σdc), and ac conductivity (σac). The activation energies are estimated and found to be decreases with composition. The impedance plot at each temperature appeared as a semicircle passes through the origin.

  18. AC-conductance and capacitance measurements for ethanol vapor detection using carbon nanotube-polyvinyl alcohol composite based devices.

    PubMed

    Greenshields, Márcia W C C; Meruvia, Michelle S; Hümmelgen, Ivo A; Coville, Neil J; Mhlanga, Sabelo D; Ceragioli, Helder J; Quispe, Jose C Rojas; Baranauskas, Vitor

    2011-03-01

    We report the preparation of inexpensive ethanol sensor devices using multiwalled carbon nanotube-polyvinyl alcohol composite films deposited onto interdigitated electrodes patterned on phenolite substrates. We investigate the frequency dependent response of the device conductance and capacitance showing that higher sensitivity is obtained at higher frequency if the conductance is used as sensing parameter. In the case of capacitance measurements, higher sensitivity is obtained at low frequency. Ethanol detection at a concentration of 300 ppm in air is demonstrated. More than 80% of the sensor conductance and capacitance variation response occurs in less than 20 s.

  19. Nonlinear optical conductivity and subharmonic instabilities of graphene in a strong electromagnetic field

    NASA Astrophysics Data System (ADS)

    Sun, Zhiyuan; Basov, Dimitri; Fogler, Michael

    We study theoretically the second-order nonlinear optical conductivity σ (2) of graphene as a function of frequency and momentum. We distinguish two regimes. At frequencies ω higher than the temperature-dependent electron-electron collision rate γee- 1 , the conductivity σ (2) can be derived from the semiclassical kinetic equation. The calculation requires taking into account the photon drag (Lorentz force) due to the ac magnetic field. In the low-frequency hydrodynamic regime ω <<γee- 1 , the nonlinear conductivity has a different form and the photon drag effect is suppressed. As a consequence of the nonlinearity, a strong enough photoexcitation can cause spontaneous generation of collective modes in a graphene strip: plasmons in the high-frequency regime and energy waves (demons) in the hydrodynamic one. The dominant instability occurs at frequency ω / 2 .

  20. Strings on a Violin: Location Dependence of Frequency Tuning in Active Dendrites.

    PubMed

    Das, Anindita; Rathour, Rahul K; Narayanan, Rishikesh

    2017-01-01

    Strings on a violin are tuned to generate distinct sound frequencies in a manner that is firmly dependent on finger location along the fingerboard. Sound frequencies emerging from different violins could be very different based on their architecture, the nature of strings and their tuning. Analogously, active neuronal dendrites, dendrites endowed with active channel conductances, are tuned to distinct input frequencies in a manner that is dependent on the dendritic location of the synaptic inputs. Further, disparate channel expression profiles and differences in morphological characteristics could result in dendrites on different neurons of the same subtype tuned to distinct frequency ranges. Alternately, similar location-dependence along dendritic structures could be achieved through disparate combinations of channel profiles and morphological characteristics, leading to degeneracy in active dendritic spectral tuning. Akin to strings on a violin being tuned to different frequencies than those on a viola or a cello, different neuronal subtypes exhibit distinct channel profiles and disparate morphological characteristics endowing each neuronal subtype with unique location-dependent frequency selectivity. Finally, similar to the tunability of musical instruments to elicit distinct location-dependent sounds, neuronal frequency selectivity and its location-dependence are tunable through activity-dependent plasticity of ion channels and morphology. In this morceau, we explore the origins of neuronal frequency selectivity, and survey the literature on the mechanisms behind the emergence of location-dependence in distinct forms of frequency tuning. As a coda to this composition, we present some future directions for this exciting convergence of biophysical mechanisms that endow a neuron with frequency multiplexing capabilities.

  1. Macroscopic Models of Local Field Potentials and the Apparent 1/f Noise in Brain Activity

    PubMed Central

    Bédard, Claude; Destexhe, Alain

    2009-01-01

    The power spectrum of local field potentials (LFPs) has been reported to scale as the inverse of the frequency, but the origin of this 1/f noise is at present unclear. Macroscopic measurements in cortical tissue demonstrated that electric conductivity (as well as permittivity) is frequency-dependent, while other measurements failed to evidence any dependence on frequency. In this article, we propose a model of the genesis of LFPs that accounts for the above data and contradictions. Starting from first principles (Maxwell equations), we introduce a macroscopic formalism in which macroscopic measurements are naturally incorporated, and also examine different physical causes for the frequency dependence. We suggest that ionic diffusion primes over electric field effects, and is responsible for the frequency dependence. This explains the contradictory observations, and also reproduces the 1/f power spectral structure of LFPs, as well as more complex frequency scaling. Finally, we suggest a measurement method to reveal the frequency dependence of current propagation in biological tissue, and which could be used to directly test the predictions of this formalism. PMID:19348744

  2. Nature of Dielectric Properties, Electric Modulus and AC Electrical Conductivity of Nanocrystalline ZnIn2Se4 Thin Films

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Attia, A. A.; Ali, H. A. M.; Salem, G. F.; Ismail, M. I.

    2018-02-01

    The structural characteristics of thermally deposited ZnIn2Se4 thin films were indexed utilizing x-ray diffraction as well as scanning electron microscopy techniques. Dielectric properties, electric modulus and AC electrical conductivity of ZnIn2Se4 thin films were examined in the frequency range from 42 Hz to 106 Hz. The capacitance, conductance and impedance were measured at different temperatures. The dielectric constant and dielectric loss decrease with an increase in frequency. The maximum barrier height was determined from the analysis of the dielectric loss depending on the Giuntini model. The real part of the electric modulus revealed a constant maximum value at higher frequencies and the imaginary part of the electric modulus was characterized by the appearance of dielectric relaxation peaks. The AC electrical conductivity obeyed the Jonscher universal power law. Correlated barrier hopping model was the appropriate mechanism for AC conduction in ZnIn2Se4 thin films. Estimation of the density of states at the Fermi level and activation energy, for AC conduction, was carried out based on the temperature dependence of AC electrical conductivity.

  3. Pronounced low-frequency vibrational thermal transport in C60 fullerite realized through pressure-dependent molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Giri, Ashutosh; Hopkins, Patrick E.

    2017-12-01

    Fullerene condensed-matter solids can possess thermal conductivities below their minimum glassy limit while theorized to be stiffer than diamond when crystallized under pressure. These seemingly disparate extremes in thermal and mechanical properties raise questions into the pressure dependence on the thermal conductivity of C60 fullerite crystals, and how the spectral contributions to vibrational thermal conductivity changes under applied pressure. To answer these questions, we investigate the effect of strain on the thermal conductivity of C60 fullerite crystals via pressure-dependent molecular dynamics simulations under the Green-Kubo formalism. We show that the thermal conductivity increases rapidly with compressive strain, which demonstrates a power-law relationship similar to their stress-strain relationship for the C60 crystals. Calculations of the density of states for the crystals under compressive strains reveal that the librational modes characteristic in the unstrained case are diminished due to densification of the molecular crystal. Over a large compression range (0-20 GPa), the Leibfried-Schlömann equation is shown to adequately describe the pressure dependence of thermal conductivity, suggesting that low-frequency intermolecular vibrations dictate heat flow in the C60 crystals. A spectral decomposition of the thermal conductivity supports this hypothesis.

  4. Parametric electroconvection in a weakly conducting fluid in a horizontal parallel-plate capacitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kartavykh, N. N.; Smorodin, B. L., E-mail: bsmorodin@yandex.ru; Il’in, V. A.

    2015-07-15

    We study the flows of a nonuniformly heated weakly conducting fluid in an ac electric field of a horizontal parallel-plate capacitor. Analysis is carried out for fluids in which the charge formation is governed by electroconductive mechanism associated with the temperature dependence of the electrical conductivity of the medium. Periodic and chaotic regimes of fluid flow are investigated in the limiting case of instantaneous charge relaxation and for a finite relaxation time. Bifurcation diagrams and electroconvective regimes charts are constructed. The regions where fluid oscillations synchronize with the frequency of the external field are determined. Hysteretic transitions between electroconvection regimesmore » are studied. The scenarios of transition to chaotic oscillations are analyzed. Depending on the natural frequency of electroconvective system and the external field frequency, the transition from periodic to chaotic oscillations can occur via quasiperiodicity, a subharmonic cascade, or intermittence.« less

  5. Temperature dependent charge transport in poly(3-hexylthiophene) diodes

    NASA Astrophysics Data System (ADS)

    Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya

    2018-04-01

    In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.

  6. Interplay of activation kinetics and the derivative conductance determines resonance properties of neurons

    NASA Astrophysics Data System (ADS)

    Pena, Rodrigo F. O.; Ceballos, Cesar C.; Lima, Vinicius; Roque, Antonio C.

    2018-04-01

    In a neuron with hyperpolarization activated current (Ih), the correct input frequency leads to an enhancement of the output response. This behavior is known as resonance and is well described by the neuronal impedance. In a simple neuron model we derive equations for the neuron's resonance and we link its frequency and existence with the biophysical properties of Ih. For a small voltage change, the component of the ratio of current change to voltage change (d I /d V ) due to the voltage-dependent conductance change (d g /d V ) is known as derivative conductance (GhDer). We show that both GhDer and the current activation kinetics (characterized by the activation time constant τh) are mainly responsible for controlling the frequency and existence of resonance. The increment of both factors (GhDer and τh) greatly contributes to the appearance of resonance. We also demonstrate that resonance is voltage dependent due to the voltage dependence of GhDer. Our results have important implications and can be used to predict and explain resonance properties of neurons with the Ih current.

  7. Nonequilibrium simulations of model ionomers in an oscillating electric field

    DOE PAGES

    Ting, Christina L.; Sorensen-Unruh, Karen E.; Stevens, Mark J.; ...

    2016-07-25

    Here, we perform molecular dynamics simulations of a coarse-grained model of ionomer melts in an applied oscillating electric field. The frequency-dependent conductivity and susceptibility are calculated directly from the current density and polarization density, respectively. At high frequencies, we find a peak in the real part of the conductivity due to plasma oscillations of the ions. At lower frequencies, the dynamic response of the ionomers depends on the ionic aggregate morphology in the system, which consists of either percolated or isolated aggregates. We show that the dynamic response of the model ionomers to the applied oscillating field can be understoodmore » by comparison with relevant time scales in the systems, obtained from independent calculations.« less

  8. Nonequilibrium simulations of model ionomers in an oscillating electric field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ting, Christina L.; Sorensen-Unruh, Karen E.; Stevens, Mark J.

    Here, we perform molecular dynamics simulations of a coarse-grained model of ionomer melts in an applied oscillating electric field. The frequency-dependent conductivity and susceptibility are calculated directly from the current density and polarization density, respectively. At high frequencies, we find a peak in the real part of the conductivity due to plasma oscillations of the ions. At lower frequencies, the dynamic response of the ionomers depends on the ionic aggregate morphology in the system, which consists of either percolated or isolated aggregates. We show that the dynamic response of the model ionomers to the applied oscillating field can be understoodmore » by comparison with relevant time scales in the systems, obtained from independent calculations.« less

  9. Electrical conductivity and dielectric properties of TlInS2 single crystals

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.; Hassan, A.

    2011-07-01

    TlInS2 single crystals were grown by using Bridgman-Stockbauer technique. Measurements of DC conductivity were carried out in parallel (σ//) and perpendicular (σ⊥) directions to the c-axis over a temperature range from 303 to 463 K. The anisotropic behaviour of the electrical conductivity was also detected. AC conductivity and dielectric measurements were studied as a function of both frequency (102-106 Hz) and temperature (297-375 K). The frequency dependence of the AC conductivity revealed that σac(ω) obeys the universal law: σac(ω) = Aωs. The mechanism of the ac charge transport across the layers of TlInS2 single crystals was referred to the hopping over localized states near the Fermi level in the frequency range >3.5 × 103 Hz. The temperature dependence of σac(ω) for TlInS2 showed that σac is thermally activated process. Both of ɛ1 and ɛ2 decrease by increasing frequency and increase by increasing temperature. Some parameters were calculated as: the density of localized states near the Fermi level NF = 1.5 × 1020 eV-1 cm-3, the average time of charge carrier hoping between localized states τ = 3.79 μs and the average hopping distance R = 6.07 nm.

  10. Universal Behavior of Quantum Spin Liquid and Optical Conductivity in the Insulator Herbertsmithite

    NASA Astrophysics Data System (ADS)

    Shaginyan, V. R.; Msezane, A. Z.; Stephanovich, V. A.; Popov, K. G.; Japaridze, G. S.

    2018-04-01

    We analyze optical conductivity with the goal to demonstrate experimental manifestation of a new state of matter, the so-called fermion condensate. Fermion condensates are realized in quantum spin liquids, exhibiting typical behavior of heavy-fermion metals. Measurements of the low-frequency optical conductivity collected on the geometrically frustrated insulator herbertsmithite provide important experimental evidence of the nature of its quantum spin liquid composed of spinons. To analyze recent measurements of the herbertsmithite optical conductivity at different temperatures, we employ a model of strongly correlated quantum spin liquid located near the fermion condensation phase transition. Our theoretical analysis of the optical conductivity allows us to expose the physical mechanism of its temperature dependence. We also predict a dependence of the optical conductivity on a magnetic field. We consider an experimental manifestation (optical conductivity) of a new state of matter (so-called fermion condensate) realized in quantum spin liquids, for, in many ways, they exhibit typical behavior of heavy-fermion metals. Measurements of the low-frequency optical conductivity collected on the geometrically frustrated insulator herbertsmithite produce important experimental evidence of the nature of its quantum spin liquid composed of spinons. To analyze recent measurements of the herbertsmithite optical conductivity at different temperatures, we employ a model of a strongly correlated quantum spin liquid located near the fermion condensation phase transition. Our theoretical analysis of the optical conductivity allows us to reveal the physical mechanism of its temperature dependence. We also predict a dependence of the optical conductivity on a magnetic field.

  11. Dielectric relaxation in complex perovskite oxide In(Ni{sub 1/2}Zr{sub 1/2})O{sub 3}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agrawal, Lata, E-mail: lata_agrawal84@yahoo.com; Singh, B.P.; Sinha, T.P.

    2009-09-15

    The dielectric study of indium nickel zirconate, In(Ni{sub 1/2}Zr{sub 1/2})O{sub 3} (INZ) synthesized by solid state reaction technique is performed in a frequency range from 500 Hz to 1 MHz and in a temperature range from 303 to 493 K. The X-ray diffraction analysis shows that the compound is monoclinic. A relaxation is observed in the entire temperature range as a gradual decrease in {epsilon}'({omega}) and as a broad peak in {epsilon}''({omega}) in the frequency dependent real and imaginary parts of dielectric constant, respectively. The frequency dependent electrical data are analyzed in the framework of conductivity and electric modulus formalisms.more » The frequencies corresponding to the maxima of the imaginary electric modulus at various temperatures are found to obey an Arrhenius law with activation energy of 0.66 eV. The Cole-Cole model is used to study the dielectric relaxation of INZ. The scaling behaviour of imaginary part of electric modulus suggests that the relaxation describes the same mechanism at various temperatures. The frequency dependent conductivity spectra follow the universal power law.« less

  12. On corrected formula for irradiated graphene quantum conductivity

    NASA Astrophysics Data System (ADS)

    Firsova, N. E.

    2017-09-01

    Graphene membrane irradiated by weak activating periodic electric field in terahertz range is considered. The corrected formula for the graphene quantum conductivity is found. The obtained formula gives complex conjugate results when radiation polarization direction is clockwise or it is opposite clockwise. The found formula allows us to see that the graphene membrane is an oscillating contour. Its eigen frequency coincides with a singularity point of the conductivity and depends on the electrons concentration. So the graphene membrane could be used as an antenna or a transistor and its eigen frequency could be tuned by doping in a large terahertz-infrared frequency range. The obtained formula allows us also to calculate the graphene membrane quantum inductivity and capacitance. The found dependence on electrons concentration is consistent with experiments. The method of the proof is based on study of the time-dependent density matrix. The exact solution of von Neumann equation for density matrix is found for our case in linear approximation on the external field. On this basis the induced current is studied and then the formula for quantum conductivity as a function of external field frequency and temperature is obtained. The method of the proof suggested in this paper could be used to study other problems. The found formula for quantum conductivity can be used to correct the SPPs Dispersion Relation and for the description of radiation process. It would be useful to take the obtained results into account when constructing devices containing graphene membrane nanoantenna. Such project could make it possible to create wireless communications among nanosystems. This would be promising research area of energy harvesting applications.

  13. Modification of Akhieser mechanism in Si nanomembranes and thermal conductivity dependence of the Q-factor of high frequency nanoresonators

    NASA Astrophysics Data System (ADS)

    Chávez-Ángel, E.; Zarate, R. A.; Gomis-Bresco, J.; Alzina, F.; Sotomayor Torres, C. M.

    2014-12-01

    We present and validate a reformulated Akhieser model that takes into account the reduction of thermal conductivity due to the impact of boundary scattering on the thermal phonons’ lifetime. We consider silicon nanomembranes with mechanical mode frequencies in the GHz range as textbook examples of nanoresonators. The model successfully accounts for the measured shortening of the mechanical mode lifetime. Moreover, the thermal conductivity is extracted from the measured lifetime of the mechanical modes in the high-frequency regime, thereby demonstrating that the Q-factor can be used as an indication of the thermal conductivity and/or diffusivity of a mechanical resonator.

  14. Temperature-dependent ac conductivity and dielectric response of vanadium doped CaCu3Ti4O12 ceramic

    NASA Astrophysics Data System (ADS)

    Sen, A.; Maiti, U. N.; Thapa, R.; Chattopadhyay, K. K.

    2011-09-01

    Successful incorporation of vanadium dopant within the giant dielectric material CaCu 3Ti 4O12 (CCTO) through a conventional solid-state sintering process is achieved and its influence on the dielectric as well as electrical properties as a function of temperature and frequency is reported here. Proper crystalline phase formation together with dopant induced lattice constant shrinkage was confirmed through X-ray diffraction. The temperature dependence of the dielectric constant at different constant frequencies was investigated. We infer that the correlated barrier hopping (CBH) model is dominant in the conduction mechanism of the ceramic as per the temperature-dependent ac conductivity measurements. The electronic parameters such as density of the states at the Fermi level, N( E f) and hopping distance, R ω of the ceramic were also calculated using this model.

  15. Admittance–voltage profiling of Al{sub x}Ga{sub 1−x}N/GaN heterostructures: Frequency dependence of capacitance and conductance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Köhler, K.; Pletschen, W.; Godejohann, B.

    2015-11-28

    Admittance–voltage profiling of Al{sub x}Ga{sub 1−x}N/GaN heterostructures was used to determine the frequency dependent capacitance and conductance of FET devices in the frequency range from 50 Hz to 1 MHz. The nominally undoped low pressure metal-organic vapor-phase epitaxy structures were grown with an Al-content of 30%. An additional 1 nm thick AlN interlayer was placed in one structure before the Al{sub 0.3}Ga{sub 0.7}N layer growth. For frequencies below 10{sup 8} Hz it is convenient to use equivalent circuits to represent electric or dielectric properties of a material, a method widely used, for example, in impedance spectroscopy. We want to emphasize the relation betweenmore » frequency dependent admittance–voltage profiling and the corresponding equivalent circuits to the complex dielectric function. Debye and Drude models are used for the description of the frequency dependent admittance profiles in a range of depletion onset of the two-dimensional electron gas. Capacitance- and conductance-frequency profiles are fitted in the entire measured range by combining both models. Based on our results, we see contributions to the two-dimensional electron gas for our samples from surface states (80%) as well as from background doping in the Al{sub 0.3}Ga{sub 0.7}N barriers (20%). The specific resistance of the layers below the gate is above 10{sup 5} Ω cm for both samples and increases with increasing negative bias, i.e., the layers below the gate are essentially depleted. We propose that the resistance due to free charge carriers, determined by the Drude model, is located between gate and drain and, because of the AlN interlayer, the resistance is lowered by a factor of about 30 if compared to the sample without an AlN layer.« less

  16. Electrical conductivity and dielectric relaxation of 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile

    NASA Astrophysics Data System (ADS)

    El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.

    2014-03-01

    The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.

  17. Negative Differential Resistance (NDR) frequency conversion with gain

    NASA Technical Reports Server (NTRS)

    Hwu, R. J.; Alm, R. W.; Lee, S. C.

    1992-01-01

    The dependence of the I-V characteristic of the negative differential resistance (NDR) devices on the power level and frequency of the rf input signal has been theoretically analyzed with a modified large- and small-signal nonlinear circuit analysis program. The NDR devices we used in this work include both the tunnel diode (without the antisymmetry in the I-V characteristic) and resonant-tunneling devices (with the antisymmetry in the I-V characteristic). Absolute negative conductance can be found from a zero-biased resonant tunneling device when the applied pump power is within a small range. This study verifies the work of Sollner et al. Variable negative conductances at the fundamental and harmonic frequencies can also be obtained from both the unbiased and biased tunnel diodes. The magnitude of the negative conductances can be adjusted by varying the pump amplitude -- a very useful circuit property. However, the voltage range over which the negative conductance occurs moves towards the more positive side of the voltage axis with increasing frequency. Furthermore, the range of the pumping amplitude to obtain negative conductance varies with the parasitics (resistance and capacitance) of the device. The theoretical observation of the dependence of the I-V characteristic of the NDR devices on the power and frequency of the applied pump signal is supported by the experimental results. In addition, novel functions of a NDR device such as self-oscillating frequency multiplier and mixer with gain have been experimentally demonstrated. The unbiased oscillator have also been successfully realized with a NDR device with an antisymmetrical I-V characteristic. Finally, the applications of these device functions will be discussed.

  18. Nonreciprocity of spin waves in magnonic crystals created by surface acoustic waves in structures with yttrium iron garnet

    NASA Astrophysics Data System (ADS)

    Kryshtal, R. G.; Medved, A. V.

    2015-12-01

    Experimental results of investigations of nonreciprocity for surface magnetostatic spin waves (SMSW) in the magnonic crystal created by surface acoustic waves (SAW) in yttrium iron garnet films on a gallium gadolinium garnet substrate as without metallization and with aluminum films with different electrical conductivities (thicknesses) are presented. In structures without metallization, the frequency of magnonic gaps is dependent on mutual directions of propagation of the SAW and SMSW, showing nonreciprocal properties for SMSW in SAW - magnonic crystals even with the symmetrical dispersion characteristic. In metalized SAW - magnonic crystals the shift of the magnonic band gaps frequencies at the inversion of the biasing magnetic field was observed. The frequencies of magnonic band gaps as functions of SAW frequency are presented. Measured dependencies, showing the decrease of magnonic gaps frequency and the expansion of the magnonic band gap width with the decreasing of the metal film conductivity are given. Such nonreciprocal properties of the SAW - magnonic crystals are promising for signal processing in the GHz range.

  19. Axolemmal and septal conduction in the impedance of the earthworm medial giant nerve fiber.

    PubMed Central

    Krause, T L; Fishman, H M; Bittner, G D

    1994-01-01

    Ionic conduction in the axolemmal and septal membranes of the medial giant fiber (MGF) of the earthworm (EW) Lumbricus terrestris was assessed by impedance spectroscopy in the frequency range 2.5-1000 Hz. Impedance loci in the complex plane were described by two semi-circular arcs, one at a lower characteristic frequency (100 Hz) and the other at a higher frequency (500 Hz). The lower frequency arc had a chord resistance of 53 k omega and was not affected by membrane potential changes or ion channel blockers [tetrodotoxin (TTX), 3,4-diaminopyridine (3,4-DAP), 4-aminopyridine (4-AP), and tetraethylammonium (TEA)]. The higher frequency arc had a chord resistance of 274 k omega at resting potential, was voltage-dependent, and was affected by the addition of TTX, 3,4-DAP, 4-AP, and TEA to the physiological EW salines. When all four blockers were added to the bathing solution, the impedance locus was described by two voltage-independent arcs. Considering the effects of these and other (i.e., Cd and Ni) ion channel blockers, we conclude that: 1) the higher frequency locus reflects conduction by voltage-sensitive ion channels in the axolemmal membrane, which contains at least four ion channels selective for sodium, calcium, and potassium (delayed rectifier and calcium-dependent), and 2) the lower frequency locus reflects voltage-insensitive channels in the septal membrane, which separates adjacent MGFs. PMID:7524713

  20. Temperature dependence of the dielectric properties of rubber wood

    Treesearch

    Mohammed Firoz Kabir; Wan M. Daud; Kaida B. Khalid; Haji A.A. Sidek

    2001-01-01

    The effect of temperature on the dielectric properties of rubber wood was investigated in three anisotropic directions—longitudinal, radial, and tangential, and at different measurement frequencies. Low frequency measurements were conducted with a dielectric spectrometer, and high frequencies used microwave applied with open-ended coaxial probe sensors. Dielectric...

  1. Studies on a.c. conductivity behaviour of milled carbon fibre reinforced epoxy gradient composites

    NASA Astrophysics Data System (ADS)

    Nigrawal, Archana; Sharma, Arun Kumar; Ojha, Pragya

    2018-05-01

    Temperature and frequency dependence of a.c. conductivity (σa.c) of milled carbon fibre (MCF) reinforced epoxy gradient composites has been studied in a wide temperature (30 to 150°C) and frequency range (1 to 10kHz). It is observed that the ac conductivity of composites increases with increase in temperature. Activation energy decreases from 0.55 eV to 0.43 eV on increase of MCF content from 0.45to 1.66 Vol%.

  2. Superresolution imaging reveals activity-dependent plasticity of axon morphology linked to changes in action potential conduction velocity.

    PubMed

    Chéreau, Ronan; Saraceno, G Ezequiel; Angibaud, Julie; Cattaert, Daniel; Nägerl, U Valentin

    2017-02-07

    Axons convey information to nearby and distant cells, and the time it takes for action potentials (APs) to reach their targets governs the timing of information transfer in neural circuits. In the unmyelinated axons of hippocampus, the conduction speed of APs depends crucially on axon diameters, which vary widely. However, it is not known whether axon diameters are dynamic and regulated by activity-dependent mechanisms. Using time-lapse superresolution microscopy in brain slices, we report that axons grow wider after high-frequency AP firing: synaptic boutons undergo a rapid enlargement, which is mostly transient, whereas axon shafts show a more delayed and progressive increase in diameter. Simulations of AP propagation incorporating these morphological dynamics predicted bidirectional effects on AP conduction speed. The predictions were confirmed by electrophysiological experiments, revealing a phase of slowed down AP conduction, which is linked to the transient enlargement of the synaptic boutons, followed by a sustained increase in conduction speed that accompanies the axon shaft widening induced by high-frequency AP firing. Taken together, our study outlines a morphological plasticity mechanism for dynamically fine-tuning AP conduction velocity, which potentially has wide implications for the temporal transfer of information in the brain.

  3. Dipolar resonances in conductive carbon micro-fibers probed by near-field terahertz spectroscopy

    DOE PAGES

    Khromova, I.; Navarro-Cia, M.; Brener, I.; ...

    2015-07-13

    In this study, we observe dipole resonances in thin conductive carbon micro-fibers by detecting an enhanced electric field in the near-field of a single fiber at terahertz (THz) frequencies. Time-domain analysis of the electric field shows that each fiber sustains resonant current oscillations at the frequency defined by the fiber's length. Strong dependence of the observed resonance frequency and degree of field enhancement on the fibers' conductive properties enable direct non-contact probing of the THz conductivity in single carbon micro-fibers. We find the conductivity of the fibers to be within the range of 1– 5∙10 4 S/m. This approach ismore » suitable for experimental characterization of individual doped semiconductor resonators for THz metamaterials and devices.« less

  4. Study of dielectric relaxation and AC conductivity of InP:S single crystal

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; El-Shazly, E. A.

    2012-07-01

    The dielectric relaxation and AC conductivity of InP:S single crystal were studied in the frequency range from 100 to 5.25 × 105 Hz and in the temperature range from 296 to 455 K. The dependence of the dielectric constant (ɛ1) and the dielectric loss (ɛ2) on both frequency and temperature was investigated. Since no peak was observed on the dielectric loss, we used a method based on the electric modulus to evaluate the activation energy of the dielectric relaxation. Scaling of the electric modulus spectra showed that the charge transport dynamics is independent of temperature. The AC conductivity (σAC) was found to obey the power law: Aωs. Analysis of the AC conductivity data and the frequency exponent showed that the correlated barrier hopping (CBH) model is the dominant mechanism for the AC conduction. The variation of AC conductivity with temperature at different frequencies showed that σAC is a thermally activated process.

  5. Dynamics and relaxation of charge carriers in poly(methylmethacrylate)-lithium salt based polymer electrolytes plasticized with ethylene carbonate

    NASA Astrophysics Data System (ADS)

    Pal, P.; Ghosh, A.

    2016-07-01

    In this paper, we have studied the dynamics and relaxation of charge carriers in poly(methylmethacrylate)-lithium salt based polymer electrolytes plasticized with ethylene carbonate. Structural and thermal properties have been examined using X-ray diffraction and differential scanning calorimetry, respectively. We have analyzed the complex conductivity spectra by using power law model coupled with the contribution of electrode polarization at low frequencies and high temperatures. The temperature dependence of the ionic conductivity and crossover frequency exhibits Vogel-Tammann-Fulcher type behavior indicating a strong coupling between the ionic and the polymer chain segmental motions. The scaling of the ac conductivity indicates that relaxation dynamics of charge carriers follows a common mechanism for all temperatures and ethylene carbonate concentrations. The analysis of the ac conductivity also shows the existence of a nearly constant loss in these polymer electrolytes at low temperatures and high frequencies. The fraction of free anions and ion pairs in polymer electrolyte have been obtained from the analysis of Fourier transform infrared spectra. It is observed that these quantities influence the behavior of the composition dependence of the ionic conductivity.

  6. Dynamics and relaxation of charge carriers in poly(methylmethacrylate)-lithium salt based polymer electrolytes plasticized with ethylene carbonate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pal, P.; Ghosh, A., E-mail: sspag@iacs.res.in

    2016-07-28

    In this paper, we have studied the dynamics and relaxation of charge carriers in poly(methylmethacrylate)-lithium salt based polymer electrolytes plasticized with ethylene carbonate. Structural and thermal properties have been examined using X-ray diffraction and differential scanning calorimetry, respectively. We have analyzed the complex conductivity spectra by using power law model coupled with the contribution of electrode polarization at low frequencies and high temperatures. The temperature dependence of the ionic conductivity and crossover frequency exhibits Vogel-Tammann-Fulcher type behavior indicating a strong coupling between the ionic and the polymer chain segmental motions. The scaling of the ac conductivity indicates that relaxation dynamicsmore » of charge carriers follows a common mechanism for all temperatures and ethylene carbonate concentrations. The analysis of the ac conductivity also shows the existence of a nearly constant loss in these polymer electrolytes at low temperatures and high frequencies. The fraction of free anions and ion pairs in polymer electrolyte have been obtained from the analysis of Fourier transform infrared spectra. It is observed that these quantities influence the behavior of the composition dependence of the ionic conductivity.« less

  7. Cellular and Network Mechanisms Underlying Information Processing in a Simple Sensory System

    NASA Technical Reports Server (NTRS)

    Jacobs, Gwen; Henze, Chris; Biegel, Bryan (Technical Monitor)

    2002-01-01

    Realistic, biophysically-based compartmental models were constructed of several primary sensory interneurons in the cricket cercal sensory system. A dynamic atlas of the afferent input to these cells was used to set spatio-temporal parameters for the simulated stimulus-dependent synaptic inputs. We examined the roles of dendritic morphology, passive membrane properties, and active conductances on the frequency tuning of the neurons. The sensitivity of narrow-band low pass interneurons could be explained entirely by the electronic structure of the dendritic arbors and the dynamic sensitivity of the SIZ. The dynamic characteristics of interneurons with higher frequency sensitivity required models with voltage-dependent dendritic conductances.

  8. Electrical Conduction of Ba(Ti0.99Fe0.01)O3-δ Ceramic at High Temperatures

    NASA Astrophysics Data System (ADS)

    Yu, Zi-De; Chen, Xiao-Ming

    2018-03-01

    BaTiO3 and Ba(Ti0.99Fe0.01)O3-δ ceramics with dense microstructure have been synthesized by a solid-state reaction method, and their electrical conduction investigated by broadband electrical impedance spectroscopy at frequencies from 0.05 Hz to 3 × 106 Hz and temperatures from 200°C to 400°C. Compared with BaTiO3, the real part of the permittivity and the phase-transition temperature of Ba(Ti0.99Fe0.01)O3-δ decreased. Relaxation peaks appeared in the curves of the imaginary part of the permittivity as a function of frequency. With increase in frequency, the peaks gradually shifted towards higher frequency and their height increased. Conductivity was closely related to frequency and temperature. Frequency-dependent conductivity was analyzed using the Jonscher double power law. Compared with BaTO3, Ba(Ti0.99Fe0.01)O3-δ exhibited high impedance at given frequency and temperature. Impedance Cole-Cole plots displayed two semicircles, which could be well fit using two parallel RC equivalent circuit models. The conductivity activation energy was found to be around 1 eV. For Ba(Ti0.99Fe0.01)O3-δ , the electrical modulus curve versus frequency displayed two peaks.

  9. Electrical Conduction of Ba(Ti0.99Fe0.01)O3- δ Ceramic at High Temperatures

    NASA Astrophysics Data System (ADS)

    Yu, Zi-De; Chen, Xiao-Ming

    2018-07-01

    BaTiO3 and Ba(Ti0.99Fe0.01)O3- δ ceramics with dense microstructure have been synthesized by a solid-state reaction method, and their electrical conduction investigated by broadband electrical impedance spectroscopy at frequencies from 0.05 Hz to 3 × 106 Hz and temperatures from 200°C to 400°C. Compared with BaTiO3, the real part of the permittivity and the phase-transition temperature of Ba(Ti0.99Fe0.01)O3- δ decreased. Relaxation peaks appeared in the curves of the imaginary part of the permittivity as a function of frequency. With increase in frequency, the peaks gradually shifted towards higher frequency and their height increased. Conductivity was closely related to frequency and temperature. Frequency-dependent conductivity was analyzed using the Jonscher double power law. Compared with BaTO3, Ba(Ti0.99Fe0.01)O3- δ exhibited high impedance at given frequency and temperature. Impedance Cole-Cole plots displayed two semicircles, which could be well fit using two parallel RC equivalent circuit models. The conductivity activation energy was found to be around 1 eV. For Ba(Ti0.99Fe0.01)O3- δ , the electrical modulus curve versus frequency displayed two peaks.

  10. Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors

    NASA Astrophysics Data System (ADS)

    Marple, M. A. T.; Avila-Paredes, H.; Kim, S.; Sen, S.

    2018-05-01

    A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.

  11. Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors.

    PubMed

    Marple, M A T; Avila-Paredes, H; Kim, S; Sen, S

    2018-05-28

    A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.

  12. Soil permittivity response to bulk electrical conductivity for selected soil water sensors

    USDA-ARS?s Scientific Manuscript database

    Bulk electrical conductivity can dominate the low frequency dielectric loss spectrum in soils, masking changes in the real permittivity and causing errors in estimated water content. We examined the dependence of measured apparent permittivity (Ka) on bulk electrical conductivity in contrasting soil...

  13. Effect of pH on the electrical properties and conducting mechanism of SnO2 nanoparticles

    NASA Astrophysics Data System (ADS)

    Periathai, R. Sudha; Abarna, S.; Hirankumar, G.; Jeyakumaran, N.; Prithivikumaran, N.

    2017-03-01

    Semiconductor nanoparticles have attracted more interests because of their size-dependent optical and electrical properties.SnO2 is an oxygen-deficient n-type semiconductor with a wide band gap of 3.6 eV (300 K). It has many remarkable applications as sensors, catalysts, transparent conducting electrodes, anode material for rechargeable Li- ion batteries and optoelectronic devices. In the present work, the role of pH in determining the electrical and dielectric properties of SnO2 nanoparticles has been studied as a function of temperature ranging from Room temperature (RT) to 114 °C in the frequency range of 7 MHz to 50 mHz using impedance spectroscopic technique. The non linear behavior observed in the thermal dependence of the conductance of SnO2 nanoparticles is explained by means of the surface property of SnO2 nanoparticles where proton hopping mechanism is dealt with. Jonscher's power law has been fitted for the conductance spectra and the frequency exponent ("s" value) gives an insight about the ac conducting mechanism. The temperature dependence of electrical relaxation phenomenon in the material has been observed. The complex electric modulus analysis indicates the possibility of hopping conduction mechanism in the system with non-exponential type of conductivity relaxation.

  14. Dielectric and ac ionic conductivity investigation of Li2SrP2O7

    NASA Astrophysics Data System (ADS)

    Ajili, O.; Louati, B.; Guidara, K.

    2018-07-01

    The pyrophosphate Li2SrP2O7 compound has been synthesized by the classic ceramic method and characterized by X-ray diffraction, IR, Raman and electrical impedance spectroscopy. Detailed electrical properties of the compound were analyzed as a function of frequency (209 Hz-1 MHz) and temperature (519-628) K. Impedance analysis exhibits the grain and grain boundary contribution to the electrical response of the sample. The temperature dependence of these contribution obey the Arrhenius law with activation energies (1.03 ± 0.05) and (1.25 ± 0.05) eV, respectively. The ac conductivity for grain contribution was interpreted using the universal Jonscher's power law. The temperature dependence of frequency exponent s was investigated to understand the conduction mechanism. The correlated barrier hopping model was found to be the best model describing the conduction mechanism.

  15. Dielectric and ac ionic conductivity investigation of Li2SrP2O7

    NASA Astrophysics Data System (ADS)

    Ajili, O.; Louati, B.; Guidara, K.

    2018-02-01

    The pyrophosphate Li2SrP2O7 compound has been synthesized by the classic ceramic method and characterized by X-ray diffraction, IR, Raman and electrical impedance spectroscopy. Detailed electrical properties of the compound were analyzed as a function of frequency (209 Hz-1 MHz) and temperature (519-628) K. Impedance analysis exhibits the grain and grain boundary contribution to the electrical response of the sample. The temperature dependence of these contribution obey the Arrhenius law with activation energies (1.03 ± 0.05) and (1.25 ± 0.05) eV, respectively. The ac conductivity for grain contribution was interpreted using the universal Jonscher's power law. The temperature dependence of frequency exponent s was investigated to understand the conduction mechanism. The correlated barrier hopping model was found to be the best model describing the conduction mechanism.

  16. Frequency and temperature dependence of electrical breakdown at 21, 30, and 39 GHz.

    PubMed

    Braun, H H; Döbert, S; Wilson, I; Wuensch, W

    2003-06-06

    A TeV-range e(+)e(-) linear collider has emerged as one of the most promising candidates to extend the high energy frontier of experimental elementary particle physics. A high accelerating gradient for such a collider is desirable to limit its overall length. Accelerating gradient is mainly limited by electrical breakdown, and it has been generally assumed that this limit increases with increasing frequency for normal-conducting accelerating structures. Since the choice of frequency has a profound influence on the design of a linear collider, the frequency dependence of breakdown has been measured using six exactly scaled single-cell cavities at 21, 30, and 39 GHz. The influence of temperature on breakdown behavior was also investigated. The maximum obtainable surface fields were found to be in the range of 300 to 400 MV/m for copper, with no significant dependence on either frequency or temperature.

  17. Frequency and Temperature Dependence of Electrical Breakdown at 21, 30, and 39GHz

    NASA Astrophysics Data System (ADS)

    Braun, H. H.; Döbert, S.; Wilson, I.; Wuensch, W.

    2003-06-01

    A TeV-range e+e- linear collider has emerged as one of the most promising candidates to extend the high energy frontier of experimental elementary particle physics. A high accelerating gradient for such a collider is desirable to limit its overall length. Accelerating gradient is mainly limited by electrical breakdown, and it has been generally assumed that this limit increases with increasing frequency for normal-conducting accelerating structures. Since the choice of frequency has a profound influence on the design of a linear collider, the frequency dependence of breakdown has been measured using six exactly scaled single-cell cavities at 21, 30, and 39GHz. The influence of temperature on breakdown behavior was also investigated. The maximum obtainable surface fields were found to be in the range of 300 to 400 MV/m for copper, with no significant dependence on either frequency or temperature.

  18. Instabilities of thin layers of conducting fluids produced by time dependent magnetic fields

    NASA Astrophysics Data System (ADS)

    Burguete, Javier

    2011-11-01

    We present the recent results of an experiment where thin layers of conducting fluids are forced by time-dependent magnetic fields perpendicular to their surface. We use as conducting fluid an In-Ga-Sn alloy, immersed in a 5% hydrocloric acid solution to prevent oxidation. The conducting layers have a circular shape, and are placed inside a set-up that produces the vertical magnetic field. Due to MHD effects, the competition between the Lorentz force and gravity triggers an instability of the free surface. The shape of this surface can adopt many different configurations, with a very rich dynamics, presenting azimuthal wave numbers between 3 and 8 for the explored parameters. The magnetic field evolves harmonically with a frequency up to 10Hz, small enough to not to observe skin depth effects and with a magnitude up to 0.1 T. Different resonant regions have been observed, for narrow windows of the forcing frequency. We have analysed the existence of thresholds for these instabilities, depending on the wave number and experimental parameters. These results are compared with others present in the literature.

  19. Electric conductivity analysis and dielectric relaxation behavior of the hybrid polyvanadate (H{sub 3}N(CH{sub 2}){sub 3}NH{sub 3})[V{sub 4}O{sub 10}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nefzi, H.; Sediri, F., E-mail: faouzi.sediri@ipeit.rnu.tn; Faculté des Sciences de Tunis, Université Tunis El Manar, 2092 El Manar, Tunis

    2013-05-15

    Highlights: ► Plate-like crystals (H{sub 3}N(CH{sub 2}){sub 3}NH{sub 3})[V{sub 4}O{sub 10}] were synthesized. ► Frequency and temperature dependence of AC conductivity indicate CBH model. ► The temperature dependence of DC conductivity exhibits two conduction mechanisms. - Abstract: Layered hybrid compound (H{sub 3}N(CH{sub 2}){sub 3}NH{sub 3})[V{sub 4}O{sub 10}] has been synthesized via hydrothermal method. Techniques X-ray powder diffraction, scanning electron microscopy, Fourier transform infrared spectroscopy, and impedance spectroscopy have been used to characterize the hybrid material. Electrical and dielectric properties dependence on both temperature and frequency of the compound have been reported. The direct current conductivity process is thermally activated andmore » it is found to be 12.67 × 10{sup −4} Ω{sup −1} m{sup −1} at 523 K. The spectra follow the Arrhenius law with two activation energy 0.25 eV for T < 455 K and 0.5 eV for T > 455 K.« less

  20. Electrical conductivity and dielectric behavior in sodium zinc divanadates

    NASA Astrophysics Data System (ADS)

    Sallemi, F.; Louati, B.; Guidara, K.

    2014-11-01

    The Na2ZnV2O7 compound was obtained by the conventional solid-state reaction. The sample was characterized by X-ray powder diffraction, Raman and impedance spectroscopy. The ac electrical conductivity and dielectric properties have been investigated in the frequency and temperature range of 200 Hz-1 MHz and 513 K-729 K, respectively. The direct current conductivity process is thermally activated. The frequency dependence of the conductivity is interpreted using the power law. The close values of activation energies obtained from the analysis of hopping frequency and dc conductivity implies that the transport is due to Na+ cation displacement parallel to (0 0 1) plane located between ZnO4 and VO4 tetrahedra. The evolution of the complex permittivity as a function of angular frequency was investigated. Several important parameters such as charge carrier concentration, ionic mobility and diffusion coefficient were determined. Thermodynamic parameters such as the free energy of activation ∆F, the enthalpy ∆H, and the change in entropy ∆S have been calculated.

  1. Relaxation dynamics in AgI-doped silver vanadate superionic glasses.

    PubMed

    Bhattacharya, S; Ghosh, A

    2005-09-22

    Relaxation dynamics of Ag+ ions in several series of AgI-Ag2O-V2O5 superionic glasses has been studied in the frequency range from 10 Hz to 2 MHz and in the temperature range from 93 to 323 K. The composition dependence of the dc conductivity and the activation energy of these glasses has been compared with those of AgI-doped silver phosphate and borate glasses. The frequency-dependent electrical data have been analyzed in the framework of conductivity formalism. We have obtained the mobile ion concentration and the power-law exponent from the analysis of the conductivity spectra. We have observed that the concentration of Ag+ ions is independent of temperature and the conductivity is primarily determined by the mobility. A fraction of the Ag+ ions in the glass compositions are involved in the dynamic process. We have also shown that the power-law exponent is independent of temperature. The results are also supported by the temperature and composition independence of the scaling of the conductivity spectra.

  2. Source conductance scaling for high frequency superconducting quasiparticle receivers

    NASA Technical Reports Server (NTRS)

    Ke, Qing; Feldman, M. J.

    1992-01-01

    It has been suggested that the optimum source conductance G(sub s) for the superconductor-insulator-superconductor (SIS) quasiparticle mixer should have a l/f dependence. This would imply that the critical current density of SIS junctions used for mixing should increase as frequency squared, a stringent constraint on the design of submillimeter SIS mixers, rather than in simple proportion to frequency as previously believed. We have used Tucker's quantum theory of mixing for extensive numerical calculations to determine G(sub s) for an optimized SIS receiver. We find that G(sub s) is very roughly independent of frequency (except for the best junctions at low frequency), and discuss the implications of our results for the design of submillimeter SIS mixers.

  3. Temperature-dependent thermal conductivities of one-dimensional nonlinear Klein-Gordon lattices with a soft on-site potential

    NASA Astrophysics Data System (ADS)

    Yang, Linlin; Li, Nianbei; Li, Baowen

    2014-12-01

    The temperature-dependent thermal conductivities of one-dimensional nonlinear Klein-Gordon lattices with soft on-site potential (soft-KG) are investigated systematically. Similarly to the previously studied hard-KG lattices, the existence of renormalized phonons is also confirmed in soft-KG lattices. In particular, the temperature dependence of the renormalized phonon frequency predicted by a classical field theory is verified by detailed numerical simulations. However, the thermal conductivities of soft-KG lattices exhibit the opposite trend in temperature dependence in comparison with those of hard-KG lattices. The interesting thing is that the temperature-dependent thermal conductivities of both soft- and hard-KG lattices can be interpreted in the same framework of effective phonon theory. According to the effective phonon theory, the exponents of the power-law dependence of the thermal conductivities as a function of temperature are only determined by the exponents of the soft or hard on-site potentials. These theoretical predictions are consistently verified very well by extensive numerical simulations.

  4. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    NASA Astrophysics Data System (ADS)

    Demirezen, S.; Kaya, A.; Yerişkin, S. A.; Balbaşı, M.; Uslu, İ.

    In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε‧, ε‧, tanδ, electric modulus (M‧ and M″) and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε‧, ε‧, tanδ, M‧, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε‧, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε‧ and ε″ values at low frequencies may be attributed to the Maxwell-Wagner and space charge polarization. The high values of ε‧ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M‧ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M‧ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε‧, ε″, tanδ, M‧, M″ and ac electric conductivity (σac) is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization.

  5. Time-Frequency Distribution Analyses of Ku-Band Radar Doppler Echo Signals

    NASA Astrophysics Data System (ADS)

    Bujaković, Dimitrije; Andrić, Milenko; Bondžulić, Boban; Mitrović, Srđan; Simić, Slobodan

    2015-03-01

    Real radar echo signals of a pedestrian, vehicle and group of helicopters are analyzed in order to maximize signal energy around central Doppler frequency in time-frequency plane. An optimization, preserving this concentration, is suggested based on three well-known concentration measures. Various window functions and time-frequency distributions were optimization inputs. Conducted experiments on an analytic and three real signals have shown that energy concentration significantly depends on used time-frequency distribution and window function, for all three used criteria.

  6. Frequency and temperature dependent dielectric properties of TiO2-V2O5 nanocomposites

    NASA Astrophysics Data System (ADS)

    Ray, Apurba; Roy, Atanu; De, Sayan; Chatterjee, Souvik; Das, Sachindranath

    2018-03-01

    In this manuscript, we have reported the crystal structure, dielectric response, and transport phenomenon of TiO2-V2O5 nanocomposites. The nanocomposites were synthesized using a sol-gel technique having different molar ratios of Ti:V (10:10, 10:15, and 10:20). The phase composition and the morphology have been studied using X-ray diffraction and field emission scanning electron microscope, respectively. The impedance spectroscopy studies of the three samples over a wide range of temperature (50 K-300 K) have been extensively described using the internal barrier layer capacitor model. It is based on the contribution of domain and domain boundary, relaxations of the materials, which are the main crucial factors for the enhancement of the dielectric response. The frequency dependent ac conductivity of the ceramics strongly obeys the well-known Jonscher's power law, and it has been clearly explained using the theory of jump relaxation model. The temperature dependent bulk conductivity is fairly recognized to the variable-range hopping of localized polarons. The co-existence of mixed valence state of Ti ions (Ti3+ and Ti4+) in the sample significantly contributes to the change of dielectric property. The overall study of dielectric response explains that the dielectric constant and the dielectric loss are strongly dependent on temperature and frequency and decrease with an increase of frequency as well as temperature.

  7. Eddy current spectroscopy for near-surface residual stress profiling in surface treated nonmagnetic engine alloys

    NASA Astrophysics Data System (ADS)

    Abu-Nabah, Bassam A.

    Recent research results indicated that eddy current conductivity measurements can be exploited for nondestructive evaluation of near-surface residual stresses in surface-treated nickel-base superalloy components. Most of the previous experimental studies were conducted on highly peened (Almen 10-16A) specimens that exhibit harmful cold work in excess of 30% plastic strain. Such high level of cold work causes thermo-mechanical relaxation at relatively modest operational temperatures; therefore the obtained results were not directly relevant to engine manufacturers and end users. The main reason for choosing peening intensities in excess of recommended normal levels was that in low-conductivity engine alloys the eddy current penetration depth could not be forced below 0.2 mm without expanding the measurements above 10 MHz which is beyond the operational range of most commercial eddy current instruments. As for shot-peened components, it was initially felt that the residual stress effect was more difficult to separate from cold work, texture, and inhomogeneity effects in titanium alloys than in nickel-base superalloys. In addition, titanium alloys have almost 50% lower electric conductivity than nickel-base superalloys; therefore require proportionally higher inspection frequencies, which was not feasible until our recent breakthrough in instrument development. Our work has been focused on six main aspects of this continuing research, namely, (i) the development of an iterative inversion technique to better retrieve the depth-dependent conductivity profile from the measured frequency-dependent apparent eddy current conductivity (AECC), (ii) the extension of the frequency range up to 80 MHz to better capture the peak compressive residual stress in nickel-base superalloys using a new eddy current conductivity measuring system, which offers better reproducibility, accuracy and measurement speed than the previously used conventional systems, (iii) the lift-off effect on high frequency eddy current spectroscopy, (iv) the development of custom-made spiral coils to allow eddy current conductivity characterization over the whole frequency range of interest with reduced coil sensitivity to lift off, (v) the benefits of implementing a semi-quadratic system calibration in reducing the coil sensitivity to lift-off, and (vi) the feasibility of adapting high-frequency eddy current residual stress characterization for shot-peened titanium alloys.

  8. Ionic-to-electronic conductivity of glasses in the P2O5-V2O5-ZnO-Li2O system

    NASA Astrophysics Data System (ADS)

    Langar, A.; Sdiri, N.; Elhouichet, H.; Ferid, M.

    2016-12-01

    Glasses having a composition 15V2O5-5ZnO-(80- x P2O5- xLi2O ( x = 5 , 10, 15 mol%) were prepared by the conventional melt quenching. Conduction and relaxation mechanisms in these glasses were studied using impedance spectroscopy in a frequency range from 10 Hz to 10 MHz and in a temperature range from 513 K to 566 K. The structure of the amorphous synthetic product was corroborated by X-ray diffraction (disappearance of nacrite peaks). The DC conductivity follows the Arrhenius law and the activation energy determined by regression analysis varies with the content of Li2O. Frequency-dependent AC conductivity was analyzed by Jonscher's universal power law, which is varying as ωn, and the temperature-dependent power parameter supported by the Correlated Barrier Hopping (CBH) model. For x = 15 mol%, the values of n ≤ 0.5 confirm the dominance of ionic conductivity. The analysis of the modulus formalism with a distribution of relaxation times was carried out using the Kohlrausch-Williams-Watts (KWW) stretched exponential function. The stretching exponent, β, is dependent on temperature. The analysis of the temperature variation of the M" peak indicates that the relaxation process is thermally activated. Modulus study reveals the temperature-dependent non-Debye-type relaxation phenomenon.

  9. Comprehensive analysis of structure and temperature, frequency and concentration-dependent dielectric properties of lithium-substituted cobalt ferrites (Li x Co1- x Fe2O4)

    NASA Astrophysics Data System (ADS)

    Anjum, Safia; Nisa, Mehru; Sabah, Aneeqa; Rafique, M. S.; Zia, Rehana

    2017-08-01

    This paper has been dedicated to the synthesis and characterization of a series of lithium-substituted cobalt ferrites Li x Co1- x Fe2O4 ( x = 0, 0.2, 0.4, 0.6, 0.8, 1). These samples have been prepared using simple ball milling machine through powder metallurgy route. The structural analysis is carried out using X-ray diffractometer and their 3D vitalization is simulated using diamond software. The frequency and temperature-dependent dielectric properties of prepared samples have been measured using inductor capacitor resistor (LCR) meter. The structural analysis confirms that all the prepared samples have inverse cubic spinel structure. It is also revealed that the crystallite size and lattice parameter decrease with the increasing concentration of lithium (Li+1) ions, it is due to the smaller ionic radii of lithium ions. The comprehensive analysis of frequency, concentration and temperature-dependent dielectric properties of prepared samples is described in this paper. It is observed that the dielectric constant and tangent loss have decreased and conductivity increased as the frequency increases. It is also revealed that the dielectric constant, tangent loss and AC conductivity increase as the concentration of lithium increases due to its lower electronegativity value. Temperature plays a vital role in enhancing the dielectric constant, tangent loss and AC conductivity because the mobility of ions increases as the temperature increases.

  10. Effect of Frequency and Waveform on Inactivation of Escherichia coli O157:H7 and Salmonella enterica Serovar Typhimurium in Salsa by Ohmic Heating

    PubMed Central

    Lee, Su-Yeon; Ryu, Sangryeol

    2013-01-01

    The effect of frequency of alternating current during ohmic heating on electrode corrosion, heating rate, inactivation of food-borne pathogens, and quality of salsa was investigated. The impact of waveform on heating rate was also investigated. Salsa was treated with various frequencies (60 Hz to 20 kHz) and waveforms (sine, square, and sawtooth) at a constant electric field strength of 12.5 V/cm. Electrode corrosion did not occur when the frequency exceeded 1 kHz. The heating rate of the sample was dependent on frequency up to 500 Hz, but there was no significant difference (P > 0.05) in the heating rate when the frequency was increased above 1 kHz. The electrical conductivity of the sample increased with a rise in the frequency. At a frequency of 60 Hz, the square wave produced a lower heating rate than that of sine and sawtooth waves. The heating rate between waveforms was not significantly (P > 0.05) different when the frequency was >500 Hz. As the frequency increased, the treatment time required to reduce Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium to below the detection limit (1 log CFU/g) decreased without affecting product quality. These results suggest that ohmic heating can be effectively used to pasteurize salsa and that the effect of inactivation is dependent on frequency and electrical conductivity rather than waveform. PMID:23023752

  11. Effect of frequency and waveform on inactivation of Escherichia coli O157:H7 and Salmonella enterica Serovar Typhimurium in salsa by ohmic heating.

    PubMed

    Lee, Su-Yeon; Ryu, Sangryeol; Kang, Dong-Hyun

    2013-01-01

    The effect of frequency of alternating current during ohmic heating on electrode corrosion, heating rate, inactivation of food-borne pathogens, and quality of salsa was investigated. The impact of waveform on heating rate was also investigated. Salsa was treated with various frequencies (60 Hz to 20 kHz) and waveforms (sine, square, and sawtooth) at a constant electric field strength of 12.5 V/cm. Electrode corrosion did not occur when the frequency exceeded 1 kHz. The heating rate of the sample was dependent on frequency up to 500 Hz, but there was no significant difference (P > 0.05) in the heating rate when the frequency was increased above 1 kHz. The electrical conductivity of the sample increased with a rise in the frequency. At a frequency of 60 Hz, the square wave produced a lower heating rate than that of sine and sawtooth waves. The heating rate between waveforms was not significantly (P > 0.05) different when the frequency was >500 Hz. As the frequency increased, the treatment time required to reduce Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium to below the detection limit (1 log CFU/g) decreased without affecting product quality. These results suggest that ohmic heating can be effectively used to pasteurize salsa and that the effect of inactivation is dependent on frequency and electrical conductivity rather than waveform.

  12. Electrical conductivity and modulus formulation in zinc modified bismuth boro-tellurite glasses

    NASA Astrophysics Data System (ADS)

    Dhankhar, Sunil; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Punia, R.; Kishore, N.

    2016-09-01

    The ac conductivity of zinc modified tellurium based quaternary glasses having composition 60 TeO2-10 B2O3-(30 - x) Bi2O3-x ZnO; x = 10, 15, 20, 25 and 30 has been investigated in the frequency range 10-1-105 Hz and in temperature range 483-593 K. Frequency and temperature dependent ac conductivity found to obey Jonscher power law modified by Almond-West. DC conductivity, crossover frequency and frequency exponent have been estimated from the fitting of the experimental data of conductivity with Jonscher power law modified by Almond-West. The ac conductivity and its frequency exponent have been analyzed by various theoretical models. In presently studied glasses ac conduction takes place via tunneling of overlapping large polaron tunneling. Activation energy is found to be increased with increase in zinc content and dc conduction takes place via variable range hopping proposed by Mott with some modification suggested by Punia et al. The value of the stretched exponent ( β) obtained by fitting of M^' ' }} reveals the presence of non-Debye type relaxation. Scaling spectra of ac conductivity and electric modulus collapse into a single master curve for all compositions and temperatures, reveals the presence of composition and temperature independent conduction and relaxation process in these glasses. Activation energy of conduction ( W) and electric modulus ( E R ) are nearly equal, indicating that polaron have to overcome the same energy barrier during conduction as well as relaxation processes.

  13. PGE(2) activation of apical membrane Cl(-) channels in A6 epithelia: impedance analysis.

    PubMed Central

    Păunescu, T G; Helman, S I

    2001-01-01

    Measurements of transepithelial electrical impedance of continuously short-circuited A6 epithelia were made at audio frequencies (0.244 Hz to 10.45 kHz) to investigate the time course and extent to which prostaglandin E(2) (PGE(2)) modulates Cl(-) transport and apical membrane capacitance in this cell-cultured model epithelium. Apical and basolateral membrane resistances were determined by nonlinear curve-fitting of the impedance vectors at relatively low frequencies (<50 Hz) to equations (Păunescu, T. G., and S. I. Helman. 2001. Biophys. J. 81:838--851) where depressed Nyquist impedance semicircles were characteristic of the membrane impedances under control Na(+)-transporting and amiloride-inhibited conditions. In all tissues (control, amiloride-blocked, and amiloride-blocked and furosemide-pretreated), PGE(2) caused relatively small (< approximately 3 microA/cm(2)) and rapid (<60 s) maximal increase of chloride current due to activation of a rather large increase of apical membrane conductance that preceded significant activation of Na(+) transport through amiloride-sensitive epithelial Na(+) channels (ENaCs). Apical membrane capacitance was frequency-dependent with a Cole-Cole dielectric dispersion whose relaxation frequency was near 150 Hz. Analysis of the time-dependent changes of the complex frequency-dependent equivalent capacitance of the cells at frequencies >1.5 kHz revealed that the mean 9.8% increase of capacitance caused by PGE(2) was not correlated in time with activation of chloride conductance, but rather correlated with activation of apical membrane Na(+) transport. PMID:11463630

  14. Radio frequency self-resonant coil for contactless AC-conductivity in 100 T class ultra-strong pulse magnetic fields

    NASA Astrophysics Data System (ADS)

    Nakamura, D.; Altarawneh, M. M.; Takeyama, S.

    2018-03-01

    A contactless measurement system of electrical conductivity was developed for application under pulsed high magnetic fields over 100 T by using a self-resonant-type, high-frequency circuit. Electromagnetic fields in the circuit were numerically analysed by the finite element method, to show how the resonant power spectra of the circuit depends on the electrical conductivity of a sample set on the probe-coil. The performance was examined using a high-temperature cuprate superconductor, La2-x Sr x CuO4, in magnetic fields up to 102 T with a high frequency of close to 800 MHz. As a result, the upper critical field could be determined with a good signal-to-noise ratio.

  15. AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

    PubMed

    Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

    2015-06-01

    In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

  16. Theoretical and experimental study of AC electrical conduction mechanism in the low temperature range of p-CuIn3Se5

    NASA Astrophysics Data System (ADS)

    Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.

    2018-05-01

    In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.

  17. Ultrafast Spectral Photoresponse of Bilayer Graphene: Optical Pump-Terahertz Probe Spectroscopy.

    PubMed

    Kar, Srabani; Nguyen, Van Luan; Mohapatra, Dipti R; Lee, Young Hee; Sood, A K

    2018-02-27

    Photoinduced terahertz conductivity Δσ(ω) of Bernal stacked bilayer graphene (BLG) with different dopings is measured by time-resolved optical pump terahertz probe spectroscopy. The real part of photoconductivity Δσ(ω) (Δσ Re (ω)) is positive throughout the spectral range 0.5-2.5 THz in low-doped BLG. This is in sharp contrast to Δσ(ω) for high-doped bilayer graphene where Δσ Re (ω) is negative at low frequency and positive on the high frequency side. We use Boltzmann transport theory to understand quantitatively the frequency dependence of Δσ(ω), demanding the energy dependence of different scattering rates such as short-range impurity scattering, Coulomb scattering, carrier-acoustic phonon scattering, and substrate surface optical phonon scattering. We find that the short-range disorder scattering dominates over other processes. The calculated photoconductivity captures very well the experimental conductivity spectra as a function of lattice temperature varying from 300 to 4 K, without any empirical fitting procedures adopted so far in the literature. This helps us to understand the intraband conductivity of photoexcited hot carriers in 2D materials.

  18. Effect of confinement on anharmonic phonon scattering and thermal conductivity in pristine silicon nanowires

    NASA Astrophysics Data System (ADS)

    Rashid, Zahid; Zhu, Liyan; Li, Wu

    2018-02-01

    The effect of confinement on the anharmonic phonon scattering rates and the consequences thereof on the thermal transport properties in ultrathin silicon nanowires with a diameter of 1-4 nm have been characterized using atomistic simulations and the phonon Boltzmann transport equation. The phonon density of states (PDOS) for ultrathin nanowires approaches a constant value in the vicinity of the Γ point and increases with decreasing diameter, which indicates the increasing importance of the low-frequency phonons as heat carriers. The anharmonic phonon scattering becomes dramatically enhanced with decreasing thickness of the nanowires. In the thinnest nanowire, the scattering rates for phonons above 1 THz are one order of magnitude higher than those in the bulk Si. Below 1 THz, the increase in scattering rates is even much more appreciable. Our numerical calculations revealed that the scattering rates for transverse (longitudinal) acoustic modes follow √{ω } (1 /√{ω } ) dependence at the low-frequency limit, whereas those for the degenerate flexural modes asymptotically approach a constant value. In addition, the group velocities of phonons are reduced compared with bulk Si except for low-frequency phonons (<1 -2 THz depending on the thickness of the nanowires). The increased scattering rates combined with reduced group velocities lead to a severely reduced thermal conductivity contribution from the high-frequency phonons. Although the thermal conductivity contributed by those phonons with low frequencies is instead increased mainly due to the increased PDOS, the total thermal conductivity is still reduced compared to that of the bulk. This work reveals an unexplored mechanism to understand the measured ultralow thermal conductivity of silicon nanowires.

  19. Dielectric properties and electrical conductivity of the hybrid organic-inorganic polyvanadates (H{sub 3}N(CH{sub 2}){sub 4}NH{sub 3})[V{sub 6}O{sub 14}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nefzi, H.; Sediri, F., E-mail: faouzi.sediri@ipeit.rnu.tn; Faculte des Sciences de Tunis, Universite Tunis El Manar, 2092 El Manar, BP 94 CEDEX 1068, Cite Rommana Tunis

    2012-06-15

    Plate-like crystals of the polyvanadate (H{sub 3}N(CH{sub 2}){sub 4}NH{sub 3})[V{sub 6}O{sub 14}] have been synthesized via an hydrothermal treatment. X-ray powder diffraction, scanning electron microscope, Fourier transform infrared spectroscopy, electron spin resonance and complex impedance spectroscopy were used to analyze the hybrid material. The frequency dependence of AC conductivity at different temperatures indicates that the CBH model is the probable mechanism for the AC conduction behavior. The conductivity was measured by complex impedance spectroscopy which is equal to 31.10{sup -3} {Omega}{sup -1} m{sup -1} at 443 K. The Arrhenius diagram is not linear, it presents a rupture situated at 357more » K and the activation energies' average values are 0.22 eV and 0.14 eV, deduced from the Arrhenius relation. - Graphical abstract: At high temperature {epsilon} Double-Prime increases more rapidly which is due to the increasing conduction loss which rises with the increment in the DC conductivity. Highlights: Black-Right-Pointing-Pointer Rectangular plate-like crystals (H{sub 3}N(CH{sub 2}){sub 4}NH{sub 3})[V{sub 6}O{sub 14}] were synthesized. Black-Right-Pointing-Pointer frequency and temperature dependence of AC conductivity indicate CBH model. Black-Right-Pointing-Pointer The temperature dependence of DC conductivity exhibits two conduction mechanisms.« less

  20. Dynamic conductivity from audio to optical frequencies of semiconducting manganites approaching the metal-insulator transition

    NASA Astrophysics Data System (ADS)

    Lunkenheimer, P.; Mayr, F.; Loidl, A.

    2006-07-01

    We report the frequency-dependent conductivity of the manganite system La1-xSrxMnO3 (x0.2) when approaching the metal-insulator transition from the insulating side. Results from low-frequency dielectric measurements are combined with spectra in the infrared region. For low doping levels the behavior is dominated by hopping transport of localized charge carriers at low frequencies and by phononic and electronic excitations in the infrared region. For the higher Sr contents the approach of the metallic state is accompanied by the successive suppression of the hopping contribution at low frequencies and by the development of polaronic excitations in the infrared region, which finally become superimposed by a strong Drude contribution in the fully metallic state.

  1. Structural, electrical and magnetic characteristics of improper multiferroic: GdFeO3

    NASA Astrophysics Data System (ADS)

    Sahoo, Sushrisangita; Mahapatra, P. K.; Choudhary, R. N. P.; Nandagoswami, M. L.; Kumar, Ashok

    2016-06-01

    Studies of dielectric, impedance, conductivity, magnetic and magneto-electric (ME) properties of GdFeO3 ceramics fabricated by chemical method are reported here. The synthesized powder is phase-pure and crystallizes in the orthorhombic crystal structure. Below 50 °C, the impedance has only grain contribution, while at higher temperatures, it has both grain and grain boundary contributions. Based on the depression angle of the Nyquist plot, the inhomogeneity of the sample is estimated. The capacitance data reveal that at low temperatures, the sample behaves as a leaky capacitor while at higher temperatures the sample shows the effect of the diffusion of thermally excited charge carriers across a barrier. In the low-frequency domain, the dielectric characteristics were explained on the basis of the Maxwell-Wagner mechanism, while in the high-frequency range those were correlated to the grain effect. The frequency dependent characteristic of the tangent loss is explained as a combined contribution from the Debye-like relaxation and dc conductivity related mechanism at higher temperatures. The temperature dependence of the dielectric characteristic and data are found to fit with two Gaussian peaks centered at 148 °C and 169 °C. While the first peak is explained on the basis of the Maxwell-Wagner mechanism, the second has its origin in magnetic reordering and the shifting of Gd3+ ions along the c-axis. The magnetic reordering also results in a sharp decrease of conductivity between 169 °C and 243 °C. The frequency dependent ac conductivity is explained on the basis of the correlated barrier hopping model and the quantum mechanical hopping model for the different frequency domain. The existence of P-E and M-H loops support its improper ferroelectric behavior and canted anti-ferromagnetism respectively. The ME coefficient of the sample is found to be 1.78 mV cm-1 Oe-1.

  2. The association between e-cigarette use characteristics and combustible cigarette consumption and dependence symptoms: Results from a national longitudinal study.

    PubMed

    Buu, Anne; Hu, Yi-Han; Piper, Megan E; Lin, Hsien-Chang

    2018-09-01

    Existing longitudinal surveys focused on the association between ever use of e-cigarettes and combustible cigarette consumption, making it difficult to infer what characteristics of e-cigarette use could potentially change combustible cigarette use behavior, which may have long-term health consequences. Although e-cigarettes' efficacy of alleviating dependence symptoms was supported by studies conducted in laboratory settings, whether the results can be translated into symptom reduction in the real world and over time is an open question. This study conducted secondary analysis on the Waves 1-2 data of the Population Assessment of Tobacco and Health (PATH) Study to examine the association between e-cigarette use characteristics (frequency, flavoring, and voltage adjustment) and combustible cigarette use outcomes (frequency, quantity, and symptoms), using the Heckman 2-step selection procedure with the selection bias controlled. The inclusion criteria ensured that we followed an adult cohort of exclusive combustible cigarette users at Wave 1. The result shows that higher frequency of e-cigarette use was associated with lower combustible cigarette consumption and dependence symptoms, controlling for the corresponding baseline cigarette use variable and other confounders. Given the frequency of e-cigarette use, the feature of voltage adjustment was not significantly associated with any of the cigarette use outcomes. Flavoring, on the other hand, was associated with lower quantity of cigarette use. Exclusive smokers who start using e-cigarettes do indeed change the frequency and quantity with which they smoke cigarettes. E-cigarette use may also help reduce dependence symptoms. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Time-domain Response of a Metal Detector to a Target Buried in Soil with Frequency-dependent Magnetic Susceptibility

    DTIC Science & Technology

    2016-07-06

    The work reported in this paper is a part of on-going studies to clarify how and to what extent soil electromagnetic properties affect the...metallic sphere buried in a non-conducting soil half-space with frequency-dependent complex magnetic susceptibility. The sphere is chosen as a simple...prototype for the small metal parts in low-metal landmines, while soil with dispersive magnetic susceptibility is a good model for some soils that are

  4. Frequency, pressure and strain dependence of nonlinear elasticity in Berea Sandstone

    DOE PAGES

    Riviere, Jacques; Johnson, Paul Allan; Marone, Chris; ...

    2016-04-14

    Acoustoelasticity measurements in a sample of room dry Berea sandstone are conducted at various loading frequencies to explore the transition between the quasi-static ( f → 0) and dynamic (few kilohertz) nonlinear elastic response. We carry out these measurements at multiple confining pressures and perform a multivariate regression analysis to quantify the dependence of the harmonic content on strain amplitude, frequency, and pressure. The modulus softening (equivalent to the harmonic at 0f) increases by a factor 2–3 over 3 orders of magnitude increase in frequency. Harmonics at 2f, 4f, and 6f exhibit similar behaviors. In contrast, the harmonic at 1fmore » appears frequency independent. This result corroborates previous studies showing that the nonlinear elasticity of rocks can be described with a minimum of two physical mechanisms. This study provides quantitative data that describes the rate dependency of nonlinear elasticity. Furthermore, these findings can be used to improve theories relating the macroscopic elastic response to microstructural features.« less

  5. Impact of oxide thickness on the density distribution of near-interface traps in 4H-SiC MOS capacitors

    NASA Astrophysics Data System (ADS)

    Zhang, Xufang; Okamoto, Dai; Hatakeyama, Tetsuo; Sometani, Mitsuru; Harada, Shinsuke; Iwamuro, Noriyuki; Yano, Hiroshi

    2018-06-01

    The impact of oxide thickness on the density distribution of near-interface traps (NITs) in SiO2/4H-SiC structure was investigated. We used the distributed circuit model that had successfully explained the frequency-dependent characteristics of both capacitance and conductance under strong accumulation conditions for SiO2/4H-SiC MOS capacitors with thick oxides by assuming an exponentially decaying distribution of NITs. In this work, it was found that the exponentially decaying distribution is the most plausible approximation of the true NIT distribution because it successfully explained the frequency dependences of capacitance and conductance under strong accumulation conditions for various oxide thicknesses. The thickness dependence of the NIT density distribution was also characterized. It was found that the NIT density increases with increasing oxide thickness, and a possible physical reason was discussed.

  6. Electronic transport coefficients in plasmas using an effective energy-dependent electron-ion collision-frequency

    NASA Astrophysics Data System (ADS)

    Faussurier, G.; Blancard, C.; Combis, P.; Decoster, A.; Videau, L.

    2017-10-01

    We present a model to calculate the electrical and thermal electronic conductivities in plasmas using the Chester-Thellung-Kubo-Greenwood approach coupled with the Kramers approximation. The divergence in photon energy at low values is eliminated using a regularization scheme with an effective energy-dependent electron-ion collision-frequency. Doing so, we interpolate smoothly between the Drude-like and the Spitzer-like regularizations. The model still satisfies the well-known sum rule over the electrical conductivity. Such kind of approximation is also naturally extended to the average-atom model. A particular attention is paid to the Lorenz number. Its nondegenerate and degenerate limits are given and the transition towards the Drude-like limit is proved in the Kramers approximation.

  7. Impedance spectroscopy studies on lead free Ba1-xMgx(Ti0.9Zr0.1)O3 ceramics

    NASA Astrophysics Data System (ADS)

    Ben Moumen, S.; Neqali, A.; Asbani, B.; Mezzane, D.; Amjoud, M.; Choukri, E.; Gagou, Y.; El Marssi, M.; Luk'yanchuk, Igor A.

    2018-06-01

    Ba1-xMgx(Ti0.9Zr0.1)O3 (x = 0.01 and 0.02) ceramics were prepared using the conventional solid state reaction. Rietveld refinement performed on X-ray diffraction patterns indicates that the samples are tetragonal crystal structure with P4mm space group. By increasing Mg content from 1 to 2% the unit cell volume decreased. Likewise, the grains size is greatly reduced from 10 μm to 4 μm. The temperature dependence of dielectric constants at different frequencies exhibited typical relaxor ferroelectric characteristic, with sensitive dependence in frequency and temperature for ac conductivity. The obtained activation energy values were correlated to the proposed conduction mechanisms.

  8. Annealing temperature dependence of magnetoimpedance effect in electrodeposited [Ni80fe20/Cu]3 multilayers

    NASA Astrophysics Data System (ADS)

    Maulana, Frendi; Eko Prastyo, W.; Nuryani; Purnama, B.

    2017-11-01

    We have conducted an experiment of magnetoimpedance with a variation of annealing temperature of [Ni80Fe20/Cu)]3 multilayers. The multilayer is electrodeposited on Cu-PCB substrate. Magnetoimpedance effect is impedance measure on account of external magnetic field. The found MI (magnetoimpedance) ratio is 7,63 % (without annealing) and 4,75 % (using annealing) of 100 ºC. We find that MI ratio depends on to annealing temperature and current frequence. MI ratio decreases due to rising temperature and identified increase due to the frequency. The highest MI ratio is on a sample without annealing temperature and measurement at 100 kHz frequence.

  9. Dielectric dispersion in pure and doped lithium rubidium sulphate

    NASA Astrophysics Data System (ADS)

    Kassem, M. E.; El-Muraikhi, M.; Al-Houty, L.; Mohamed, A. A.

    The frequency (102 - 105 Hz) dependence of the dielectric properties of lithium rubidium sulphate (LRS) are reported in the vicinity of the transition temperature Tc = 477 K. The a.c. conductivity σ(ω) shows a strong temperature dependence and weak frequency response. The dielectric constant in this region shows a strong frequency dispersion. A Cole-Cole diagram was used to determine the distribution parameter and the molecular relaxation time. The effect of doping with Dy+3, Sm+3 and V+3, was also studied. It was found that doping gives rise to localized states which produce a disorder in the structure of LiRbSO4.

  10. Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

    2018-03-01

    Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

  11. Alternating current characterization of nano-Pt(II) octaethylporphyrin (PtOEP) thin film as a new organic semiconductor

    NASA Astrophysics Data System (ADS)

    M, Dongol; M, M. El-Nahass; A, El-Denglawey; A, A. Abuelwafa; T, Soga

    2016-06-01

    Alternating current (AC) conductivity and dielectric properties of thermally evaporated Au/PtOEP/Au thin films are investigated each as a function of temperature (303 K-473 K) and frequency (50 Hz-5 MHz). The frequency dependence of AC conductivity follows the Jonscher universal dynamic law. The AC-activation energies are determined at different frequencies. It is found that the correlated barrier hopping (CBH) model is the dominant conduction mechanism. The variation of the frequency exponent s with temperature is analyzed in terms of the CBH model. Coulombic barrier height W m , hopping distance R ω , and the density of localized states N(E F) are valued at different frequencies. Dielectric constant ɛ 1(ω,T) and dielectric loss ɛ 2(ω,T) are discussed in terms of the dielectric polarization process. The dielectric modulus shows the non-Debye relaxation in the material. The extracted relaxation time by using the imaginary part of modulus (M″) is found to follow the Arrhenius law.

  12. Experimental evidence for frequency dependent self-fertilization in the gynodioecious plant, Silene vulgaris.

    PubMed

    Miyake, Keiko; Olson, Matthew S

    2009-06-01

    After over a half century of empirical and theoretical research regarding the evolution and maintenance of gynodioecy in plants, unexplored factors influencing the relative fitnesses of females and hermaphrodites remain. Theoretical studies suggest that hermaphrodite self-fertilization (selfing) rate influences the maintenance of gynodioecy and we hypothesized that population sex ratio may influence hermaphrodite selfing rate. An experimental test for frequency-dependent self-fertilization was conducted using replicated populations constructed with different sex ratios of the gynodioecious plant Silene vulgaris. We found that hermaphrodite selfing increased with decreased hermaphrodite frequency, whereas evidence for increased inbreeding depression was equivocal. We argue that incorporation of context dependent inbreeding into future models of the evolution of gynodioecy is likely to yield novel insights into sex ratio evolution.

  13. Quantifying Fish Backscattering using SONAR Instrument and Kirchhoff Ray Mode (KRM) Model

    NASA Astrophysics Data System (ADS)

    Manik, Henry M.

    2016-08-01

    Sonar instrument was used to study backscattering from tuna fish. Extraction of target strength, incidence angle, and frequency dependence of the backscattered signal for individual scatterer was important for biological information. For this purpose, acoustic measurement of fish backscatter was conducted in the laboratory. Characteristics and general trends of the target strength of fish with special reference to tuna fish were investigated by using a Kirchhoff Ray Mode (KRM) model. Backscattering strength were calculated for the KRM having typical morphological and physical parameters of actual fish. Those backscattering amplitudes were shown as frequency, body length, backscattering patterns, the density and sound speed dependences, and orientation dependence. These results were compared with experimentally measured target strength data and good agreement was found. Measurement and model showed the target strength from the fish are depend on the presence of swimbladder. Target Strength increase with increasing the frequency and fish length.

  14. DC and AC conductivity properties of bovine dentine hydroxyapatite (BDHA)

    NASA Astrophysics Data System (ADS)

    Dumludag, F.; Gunduz, O.; Kılıc, O.; Ekren, N.; Kalkandelen, C.; Ozbek, B.; Oktar, F. N.

    2017-12-01

    Bovine dentine bio-waste may be used as a potential natural source of hydroxyapatite (BDHA), thus extraction of bovine dentin hydroxyapatite (BDHA) from bio-waste is significantly important to fabricate in a simple, economically and environmentally preferable. DC and AC conductivity properties of BDHA were investigated depending on sintering temperature (1000ºC - 1300°C) in air and vacuum (<10-2 mbar) ambient at room temperature. DC conductivity measurements performed between -1 and 1 V. AC conductivity measurements performed in the frequency range of 40 Hz - 100 kHz. DC conductivity results showed that dc conductivity values of the BDHA decrease with increasing sintering temperature in air ambient. It is not observed remarkable/systematic behavior for ac conductivity depending on sintering temperature.

  15. The influence of low frequency sound on the changes of EEG signal morphology

    NASA Astrophysics Data System (ADS)

    Damijan, Z.; Wiciak, J.

    2006-11-01

    The effects of low frequency sound on the changes of morphology of the spectral power density function of EEG signals were studied as a part of the research program f = 40 Hz, Lp = 110 dB HP. The research program involved 33 experiments. A quantitative analysis was conducted of the driving response effect for the fundamental frequency and its harmonics to find the frequency of the driving response effect occurrence depending on the sex of participants.

  16. Effect of Al2O3 nanoparticles in plasticized PMMA-LiClO4 based solid polymer electrolyte

    NASA Astrophysics Data System (ADS)

    Pal, P.; Ghosh, A.

    2017-05-01

    We have studied the broadband complex conductivity spectra covering a 0.01 Hz-3 GHz frequency range for plasticized PMMA-LiClO4 based solid polymer electrolyte embedded with Al2O3 nanoparticle. We have analyzed the conductivity spectra using the random free-energy barrier model (RBM) coupled with electrode polarization contribution in the low frequency region and at high temperatures. The temperature dependence of the ionic conductivity obtained from the analysis has been analyzed using Vogel-Tammann-Fulcher equation. The maximum ionic conductivity ˜ 1.93×10-4 S/cm has been obtained for 1 wt% Al2O3 nanoparticle.

  17. Third-order optical conductivity of an electron fluid

    NASA Astrophysics Data System (ADS)

    Sun, Zhiyuan; Basov, D. N.; Fogler, M. M.

    2018-02-01

    We derive the nonlinear optical conductivity of an isotropic electron fluid at frequencies below the interparticle collision rate. In this regime, governed by hydrodynamics, the conductivity acquires a universal form at any temperature, chemical potential, and spatial dimension. We show that the nonlinear response of the fluid to a uniform field is dominated by the third-order conductivity tensor σ(3 ) whose magnitude and temperature dependence differ qualitatively from those in the conventional kinetic regime of higher frequencies. We obtain explicit formulas for σ(3 ) for Dirac materials such as graphene and Weyl semimetals. We make predictions for the third-harmonic generation, renormalization of the collective-mode spectrum, and the third-order circular magnetic birefringence experiments.

  18. Study of electrical properties of Sc doped BaFe12O19 ceramic using dielectric, impedance, modulus spectroscopy and AC conductivity

    NASA Astrophysics Data System (ADS)

    Gupta, Surbhi; Deshpande, S. K.; Sathe, V. G.; Siruguri, V.

    2018-04-01

    We present dielectric, complex impedance, modulus spectroscopy and AC conductivity studies of the compound BaFe10Sc2O19 as a function of temperature and frequency to understand the conduction mechanism. The variation in complex dielectric constant with frequency and temperature were analyzed on the basis of Maxwell-Wagner-Koop's theory and charge hopping between ferrous and ferric ions. The complex impedance spectroscopy study shows only grain contribution whereas complex modulus plot shows two semicircular arcs which indicate both grain and grain boundary contributions in conduction mechanism. AC conductivity has also been evaluated which follows the Jonscher's law. The activation energy calculated from temperature dependence of DC conductivity comes out to be Ea˜ 0.31eV.

  19. Ac-conductivity and dielectric response of new zinc-phosphate glass/metal composites

    NASA Astrophysics Data System (ADS)

    Maaroufi, A.; Oabi, O.; Lucas, B.

    2016-07-01

    The ac-conductivity and dielectric response of new composites based on zinc-phosphate glass with composition 45 mol%ZnO-55 mol%P2O5, filled with metallic powder of nickel (ZP/Ni) were investigated by impedance spectroscopy in the frequency range from 100 Hz to 1 MHz at room temperature. A high percolating jump of seven times has been observed in the conductivity behavior from low volume fraction of filler to the higher fractions, indicating an insulator - semiconductor phase transition. The measured conductivity at higher filler volume fraction is about 10-1 S/cm and is frequency independent, while, the obtained conductivity for low filler volume fraction is around 10-8 S/cm and is frequency dependent. Moreover, the elaborated composites are characterized by high dielectric constants in the range of 105 for conductive composites at low frequencies (100 Hz). In addition, the distribution of the relaxation processes was also evaluated. The Debye, Cole-Cole, Davidson-Cole and Havriliak-Negami models in electric modulus formalism were used to model the observed relaxation phenomena in ZP/Ni composites. The observed relaxation phenomena are fairly simulated by Davidson-Cole model, and an account of the interpretation of results is given.

  20. Inversion of multi-frequency electromagnetic induction data for 3D characterization of hydraulic conductivity

    USGS Publications Warehouse

    Brosten, Troy R.; Day-Lewis, Frederick D.; Schultz, Gregory M.; Curtis, Gary P.; Lane, John W.

    2011-01-01

    Electromagnetic induction (EMI) instruments provide rapid, noninvasive, and spatially dense data for characterization of soil and groundwater properties. Data from multi-frequency EMI tools can be inverted to provide quantitative electrical conductivity estimates as a function of depth. In this study, multi-frequency EMI data collected across an abandoned uranium mill site near Naturita, Colorado, USA, are inverted to produce vertical distribution of electrical conductivity (EC) across the site. The relation between measured apparent electrical conductivity (ECa) and hydraulic conductivity (K) is weak (correlation coefficient of 0.20), whereas the correlation between the depth dependent EC obtained from the inversions, and K is sufficiently strong to be used for hydrologic estimation (correlation coefficient of − 0.62). Depth-specific EC values were correlated with co-located K measurements to develop a site-specific ln(EC)–ln(K) relation. This petrophysical relation was applied to produce a spatially detailed map of K across the study area. A synthetic example based on ECa values at the site was used to assess model resolution and correlation loss given variations in depth and/or measurement error. Results from synthetic modeling indicate that optimum correlation with K occurs at ~ 0.5 m followed by a gradual correlation loss of 90% at 2.3 m. These results are consistent with an analysis of depth of investigation (DOI) given the range of frequencies, transmitter–receiver separation, and measurement errors for the field data. DOIs were estimated at 2.0 ± 0.5 m depending on the soil conductivities. A 4-layer model, with varying thicknesses, was used to invert the ECa to maximize available information within the aquifer region for improved correlations with K. Results show improved correlation between K and the corresponding inverted EC at similar depths, underscoring the importance of inversion in using multi-frequency EMI data for hydrologic estimation.

  1. Inversion of multi-frequency electromagnetic induction data for 3D characterization of hydraulic conductivity

    USGS Publications Warehouse

    Brosten, T.R.; Day-Lewis, F. D.; Schultz, G.M.; Curtis, G.P.; Lane, J.W.

    2011-01-01

    Electromagnetic induction (EMI) instruments provide rapid, noninvasive, and spatially dense data for characterization of soil and groundwater properties. Data from multi-frequency EMI tools can be inverted to provide quantitative electrical conductivity estimates as a function of depth. In this study, multi-frequency EMI data collected across an abandoned uranium mill site near Naturita, Colorado, USA, are inverted to produce vertical distribution of electrical conductivity (EC) across the site. The relation between measured apparent electrical conductivity (ECa) and hydraulic conductivity (K) is weak (correlation coefficient of 0.20), whereas the correlation between the depth dependent EC obtained from the inversions, and K is sufficiently strong to be used for hydrologic estimation (correlation coefficient of -0.62). Depth-specific EC values were correlated with co-located K measurements to develop a site-specific ln(EC)-ln(K) relation. This petrophysical relation was applied to produce a spatially detailed map of K across the study area. A synthetic example based on ECa values at the site was used to assess model resolution and correlation loss given variations in depth and/or measurement error. Results from synthetic modeling indicate that optimum correlation with K occurs at ~0.5m followed by a gradual correlation loss of 90% at 2.3m. These results are consistent with an analysis of depth of investigation (DOI) given the range of frequencies, transmitter-receiver separation, and measurement errors for the field data. DOIs were estimated at 2.0??0.5m depending on the soil conductivities. A 4-layer model, with varying thicknesses, was used to invert the ECa to maximize available information within the aquifer region for improved correlations with K. Results show improved correlation between K and the corresponding inverted EC at similar depths, underscoring the importance of inversion in using multi-frequency EMI data for hydrologic estimation. ?? 2011.

  2. Dielectric relaxation of gamma irradiated muscovite mica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaur, Navjeet; Singh, Mohan, E-mail: mohansinghphysics@gmail.com; Singh, Lakhwant

    2015-03-15

    Highlights: • The present article reports the effect of gamma irradiation on the dielectric relaxation characteristics of muscovite mica. • Dielectric and electrical relaxations have been analyzed in the framework of dielectric permittivity, electric modulus and Cole–Cole formalisms. • The frequency dependent electrical conductivity has been rationalized using Johnsher’s universal power law. • The experimentally measured electric modulus and conductivity data have been fitted using Havriliak–Negami dielectric relaxation function. - Abstract: In the present research, the dielectric relaxation of gamma irradiated muscovite mica was studied in the frequency range of 0.1 Hz–10 MHz and temperature range of 653–853 K, usingmore » the dielectric permittivity, electric modulus and conductivity formalisms. The dielectric constants (ϵ′ and ϵ′′) are found to be high for gamma irradiated muscovite mica as compared to the pristine sample. The frequency dependence of the imaginary part of complex electric modulus (M′′) and dc conductivity data conforms Arrhenius law with single value of activation energy for pristine sample and two values of activation energy for gamma irradiated mica sample. The experimentally assessed electric modulus and conductivity information have been interpreted by the Havriliak–Negami dielectric relaxation explanation. Using the Cole–Cole framework, an analysis of real and imaginary characters of the electric modulus for pristine and gamma irradiated sample was executed which reflects the non-Debye relaxation mechanism.« less

  3. Effects of Skin Thickness on Cochlear Input Signal using Transcutaneous Bone Conduction Implants

    PubMed Central

    Mattingly, Jameson K.; Greene, Nathaniel T.; Jenkins, Herman A.; Tollin, Daniel J.; Easter, James R.; Cass, Stephen P.

    2015-01-01

    Hypothesis Intracochlear sound pressures (PIC) and velocity measurements of the stapes, round window, and promontory (VStap/RW/Prom) will show frequency dependent attenuation using magnet-based, transcutaneous bone-conduction implants (TCBCI) in comparison to direct-connect, skin-penetrating implants (DCBCI). Background TCBCIs have recently been introduced as alternatives to DCBCIs. Clinical studies have demonstrated elevated high-frequency thresholds for TCBCIs as compared to DCBCIs; however, little data exists examining the direct effect of skin thickness on the cochlear input signal using TCBCIs. Methods Using seven cadveric heads, PIC was measured in the scala vestibuli and tympani with fiber-optic pressure sensors concurrently with VStap/RW/Prom via laser Doppler vibrometry. Ipsilateral titanium implant fixtures were placed and connected to either a DCBCI or TCBCI. Soft tissue flaps with varying thicknesses (no flap, 3, 6, and 9 mm) were placed successively between the magnetic plate and sound processor magnet. A bone-conduction transducer coupled to custom software provided pure tone stimuli between 120 to 10240 Hz. Results Stimulation via the DCBCI produced the largest response magnitudes. The TCBCI showed similar PSV/ST and VStap/RW/Prom with no intervening flap, and a frequency-dependent, non-linear reduction of magnitude with increasing flap thickness. Phase shows a comparable dependence on transmission delay as the acoustic baseline, and the slope steepens at higher frequencies as flap thickness increases suggesting a longer group delay. Conclusions Proper soft tissue management is critical to optimize the cochlear input signal. The skin thickness related effects on cochlear response magnitudes should be taken into account when selecting patients for a TCBCI. PMID:26164446

  4. Dielectric properties of metallic alloy FeCoZr-dielectric ceramic PZT nanostructures prepared by ion sputtering in vacuum conditions

    NASA Astrophysics Data System (ADS)

    Boiko, O.

    2018-05-01

    The main objective of the research was investigation of dielectric properties of (FeCoZr)x(PZT)(100-x) granular nanocomposites and determination the influence of isochronous annealing in temperatures of 398 K-573 K on them. The impedance spectroscopy methodology was used. The measurements of electrical parameters, such as: phase shift angle φ, dielectric loss factor tgδ, capacity C and conductivity σ of (FeCoZr)x(PZT)(100-x) nanocomposites have been performed. Frequency dependencies of these parameters were obtained for the ambient temperature range 98 K-373 K for the frequencies ranging from 50 Hz to 105 Hz. It was established, that the conductivity σ of the tested materials before the percolation threshold demonstrates non-linear dependence on frequency. Furthermore, it increases when the ambient temperature is increasing, which indicates a dielectric type of the material. The two types of electrical conduction: capacitive (phase shift angle φ takes negative values) and inductive (φ takes positive values) have been observed. It was concluded that the hopping conductivity dominated in the nanocomposites. Voltage and current resonances phenomena are observed in the materials. The isochronous annealing intensifies the dielectric properties of (FeCoZr)x(PZT)(100-x) nanocomposites.

  5. Effective masking levels for 500 and 2000 Hz bone conduction auditory steady state responses in infants and adults with normal hearing.

    PubMed

    Small, Susan A; Smyth, Aisling; Leon, Griselle

    2014-01-01

    Few studies have investigated effective masking levels (EMLs) needed to isolate the test ear for bone conduction assessments in infants. The objective of this study was to determine EMLs for 500 and 2000 Hz bone conduction auditory steady state responses (ASSRs) to amplitude (AM)/frequency-modulated (FM) stimuli for infants and adults with normal hearing. Maturational factors that contribute to infant-adult differences in EMLs will also be investigated. The present study and previously published 1000 and 4000 Hz EML data will be compared to investigate EML across four frequencies. These findings will provide a starting point for implementing clinical masking for infant bone conduction testing using physiological measures. Participants were 15 infants (7 to 35 weeks) and 15 adults (21 to 56 years) with normal hearing. Bone-conducted single ASSR stimuli (research MASTER) were 100% AM and 25% FM at 85 and 101 Hz for 500 and 2000 Hz carrier frequencies, respectively. They were presented at 25 and 35 dB HL for 500 Hz and at 35 and 45 dB HL for 2000 Hz for both infants and adults (approximately 10 and 20 dB SL at each frequency for infants). Air-conducted narrowband maskers were presented to both ears simultaneously. Real-ear to coupler differences were measured to account for differences in the sound pressure developed in infant and adult ear canals as a result of ear-canal size. Data analyses were conducted for mean EMLs across frequency (500 to 4000 Hz) and between age groups. Masked and unmasked ASSR amplitudes were compared for 500 and 2000 Hz. Both infants and adults required much more masking (25 to 33 dB) to eliminate responses at 500 compared with 2000 Hz. On average, infants required 16 dB more masking at 500 Hz and similar amounts of masking at 2000 Hz compared with adults. When adjusted for ear-canal size and bone conduction sensitivity, the pattern of results did not change. Across all four frequencies, infants showed a systematic decrease in mean EMLs with an increase in frequency; all pair-wise comparisons were significant except 2000 versus 4000 Hz. Adults showed smaller frequency-dependent changes in EML (only significantly greater for 500 versus 2000 Hz and 4000 Hz). When ear-canal size and bone conduction sensitivity were taken into account, only 500 Hz required more masking than other frequencies in infants; there were no significant frequency-dependent trends for adults, although the greater EMLs at 1000 versus 2000 Hz and 4000 Hz approached significance. Unmasked and masked amplitudes tended to be larger for 2000 Hz but not for 500 Hz when comparing infants with adults. EMLs appropriate for infants for bone conduction ASSRs elicited to AM/FM stimuli are considerably higher at 500 compared with 2000 Hz. Infants also need more masking at 500 Hz compared with adults but the same amount of masking at 2000 Hz. Comparisons across four frequencies reveal a systematic decrease in EML with an increase in frequency in infants, which is not apparent in adults. Recommended EMLs for AM/FM bone-conducted ASSR stimuli presented at 35 dB HL for 500, 1000, 2000, and 4000 Hz, respectively, are: (1) infants: 81, 68, 59, and 45 dB SPL, and (2) adults: 66, 63, 59, and 55 dB SPL.

  6. UHF Radar observations at HAARP with HF pump frequencies near electron gyro-harmonics and associated ionospheric effects

    NASA Astrophysics Data System (ADS)

    Watkins, Brenton; Fallen, Christopher; Secan, James

    Results for HF modification experiments at the HAARP facility in Alaska are presented for experiments with the HF pump frequency near third and fourth electron gyro-harmonics. A UHF diagnostic radar with range resolution of 600 m was used to determine time-dependent altitudes of scattering from plasma turbulence during heating experiments. Experiments were conducted with multiple HF frequencies stepped by 20 kHz above and below the gyro-harmonic values. During times of HF heating the HAARP facility has sufficient power to enhance large-scale ionospheric densities in the lower ionosphere (about 150-200 km altitude) and also in the topside ionosphere (above about 350 km). In the lower ionosphere, time-dependent decreases of the altitude of radar scatter result from electron density enhancements. The effects are substantially different even for relatively small frequency steps of 20 kHz. In all cases the time-varying altitude decrease of radar scatter stops about 5-10 km below the gyro-harmonic altitude that is frequency dependent; we infer that electron density enhancements stop at this altitude where the radar signals stop decreasing with altitude. Experiments with corresponding total electron content (TEC) data show that for HF interaction altitudes above about 170 km there is substantial topside electron density increases due to upward electron thermal conduction. For lower altitudes of HF interaction the majority of the thermal energy is transferred to the neutral gas and no significant topside density increases are observed. By selecting an appropriate HF frequency a little greater than the gyro-harmonic value we have demonstrated that the ionospheric response to HF heating is a self-oscillating mode where the HF interaction altitude moves up and down with a period of several minutes. If the interaction region is above about 170 km this also produces a continuously enhanced topside electron density and upward plasma flux. Experiments using an FM scan with the HF frequency increasing near the gyro-harmonic value were conducted. The FM scan rate was sufficiently slow that the electron density was approximately in an equilibrium state. For these experiments the altitude of the HF interaction follows a near straight line downward parallel to the altitude-dependent gyro-harmonic level.

  7. AC conductivity scaling behavior in grain and grain boundary response regime of fast lithium ionic conductors

    NASA Astrophysics Data System (ADS)

    Mariappan, C. R.

    2014-05-01

    AC conductivity spectra of Li-analogues NASICON-type Li1.5Al0.5Ge1.5P3O12 (LAGP), Li-Al-Ti-P-O (LATP) glass-ceramics and garnet-type Li7La2Ta2O13 (LLTO) ceramic are analyzed by universal power law and Summerfield scaling approaches. The activation energies and pre-exponential factors of total and grain conductivities are following the Meyer-Neldel (M-N) rule for NASICON-type materials. However, the garnet-type LLTO material deviates from the M-N rule line of NASICON-type materials. The frequency- and temperature-dependent conductivity spectra of LAGP and LLTO are superimposed by Summerfield scaling. The scaled conductivity curves of LATP are not superimposed at the grain boundary response region. The superimposed conductivity curves are observed at cross-over frequencies of grain boundary response region for LATP by incorporating the exp ( {{{ - (EAt - EAg )} {{{ - (EAt - EAg )} {kT}}} ) factor along with Summerfield scaling factors on the frequency axis, where EAt and EAg are the activation energies of total and grain conductivities, respectively.

  8. Probing Anisotropic Thermal Conductivity of Transition Metal Dichalcogenides MX2 (M = Mo, W and X = S, Se) using Time-Domain Thermoreflectance.

    PubMed

    Jiang, Puqing; Qian, Xin; Gu, Xiaokun; Yang, Ronggui

    2017-09-01

    Transition metal dichalcogenides (TMDs) are a group of layered 2D semiconductors that have shown many intriguing electrical and optical properties. However, the thermal transport properties in TMDs are not well understood due to the challenges in characterizing anisotropic thermal conductivity. Here, a variable-spot-size time-domain thermoreflectance approach is developed to simultaneously measure both the in-plane and the through-plane thermal conductivity of four kinds of layered TMDs (MoS 2 , WS 2 , MoSe 2 , and WSe 2 ) over a wide temperature range, 80-300 K. Interestingly, it is found that both the through-plane thermal conductivity and the Al/TMD interface conductance depend on the modulation frequency of the pump beam for all these four compounds. The frequency-dependent thermal properties are attributed to the nonequilibrium thermal resistance between the different groups of phonons in the substrate. A two-channel thermal model is used to analyze the nonequilibrium phonon transport and to derive the intrinsic thermal conductivity at the thermal equilibrium limit. The measurements of the thermal conductivities of bulk TMDs serve as an important benchmark for understanding the thermal conductivity of single- and few-layer TMDs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Anisotropic electrodynamics of type-II Weyl semimetal candidate WTe 2

    DOE PAGES

    Frenzel, A. J.; Homes, C. C.; Gibson, Q. D.; ...

    2017-06-30

    We investigated the ab-plane optical properties of single crystals of WTe 2 for light polarized parallel and perpendicular to the W-chain axis over a broad range of frequency and temperature. At far-infrared frequencies, we observed a striking dependence of the reflectance edge on light polarization, corresponding to anisotropy of the carrier effective masses. We quantitatively studied the temperature dependence of the plasma frequency, revealing a modest increase of the effective mass anisotropy in the ab plane upon cooling. We also found strongly anisotropic interband transitions persisting to high photon energies. These results were analyzed by comparison with ab initio calculations.more » The calculated and measured plasma frequencies agree to within 10% for both polarizations, while the calculated interband conductivity shows excellent agreement with experiment.« less

  10. Spike Phase Locking in CA1 Pyramidal Neurons depends on Background Conductance and Firing Rate

    PubMed Central

    Broiche, Tilman; Malerba, Paola; Dorval, Alan D.; Borisyuk, Alla; Fernandez, Fernando R.; White, John A.

    2012-01-01

    Oscillatory activity in neuronal networks correlates with different behavioral states throughout the nervous system, and the frequency-response characteristics of individual neurons are believed to be critical for network oscillations. Recent in vivo studies suggest that neurons experience periods of high membrane conductance, and that action potentials are often driven by membrane-potential fluctuations in the living animal. To investigate the frequency-response characteristics of CA1 pyramidal neurons in the presence of high conductance and voltage fluctuations, we performed dynamic-clamp experiments in rat hippocampal brain slices. We drove neurons with noisy stimuli that included a sinusoidal component ranging, in different trials, from 0.1 to 500 Hz. In subsequent data analysis, we determined action potential phase-locking profiles with respect to background conductance, average firing rate, and frequency of the sinusoidal component. We found that background conductance and firing rate qualitatively change the phase-locking profiles of CA1 pyramidal neurons vs. frequency. In particular, higher average spiking rates promoted band-pass profiles, and the high-conductance state promoted phase-locking at frequencies well above what would be predicted from changes in the membrane time constant. Mechanistically, spike-rate adaptation and frequency resonance in the spike-generating mechanism are implicated in shaping the different phase-locking profiles. Our results demonstrate that CA1 pyramidal cells can actively change their synchronization properties in response to global changes in activity associated with different behavioral states. PMID:23055508

  11. Terahertz spectroscopic evidence of non-Fermi-liquid-like behavior in structurally modulated PrNi O3 thin films

    NASA Astrophysics Data System (ADS)

    Phanindra, V. Eswara; Agarwal, Piyush; Rana, D. S.

    2018-01-01

    The intertwined and competing energy scales of various interactions in rare-earth nickelates R Ni O3 (R =La to Lu) hold potential for a wide range of exotic ground states realized upon structural modulation. Using terahertz (THz) spectroscopy, the low-energy dynamics of a novel non-Fermi liquid (NFL) metallic phase induced in compressive PrNi O3 thin film was studied by evaluating the quasiparticle scattering rate in the light of two distinct models over a wide temperature range. First, evaluating THz conductivity in the framework of extended Drude model, the frequency-dependent scattering rate is found to deviate from the Landau Fermi liquid (LFL) behavior, thus, suggesting NFL-like phase at THz frequencies. Second, fitting THz conductivity to the multiband Drude-Lorentz model reveals the band-dependent scattering rates and provides microscopic interpretation of the carriers contributing to the Drude modes. This is first evidence of NFL-like behavior in nickelates at THz frequencies consistent with dc conductivity, which also suggests that THz technology is indispensable in understanding emerging electronic phases and associated phenomena. We further demonstrate that the metal-insulator transition in nickelates has the potential to design efficient THz modulators.

  12. Dependence of the optical conductivity on the uniaxial and biaxial strains in black phosphorene

    NASA Astrophysics Data System (ADS)

    Yang, C. H.; Zhang, J. Y.; Wang, G. X.; Zhang, C.

    2018-06-01

    By using the Kubo formula, the optical conductivity of strained black phosphorene was studied. The anisotropic band dispersion gives rise to an orientation dependent optical conductivity. The energy gap can be tuned by the uniaxial and biaxial strains which can be observed from the interband optical conductivity polarized along the armchair (x ) direction. The preferential conducting direction is along the x direction. The dependence of the intraband optical conductivity along the zigzag (y ) direction on the Fermi energy and strain exhibits increasing or decreasing monotonously. However, along the x direction this dependence is complicated which originates from the carriers' inverse-direction movements obtained by two types of the nearest phosphorus atom interactions. The modification of the biaxial strain on the energy structure and optical-absorption property is more effective. The imaginary part of the total optical conductivity (Im σ ) can be negative around the threshold of the interband optical transition by modifying the chemical potential. Away from this frequency region, Im σ exhibits positive value. It can be used in the application of the surface plasmon propagations in multilayer dielectric structures.

  13. Rayleigh and Wood anomalies in the diffraction of light from a perfectly conducting reflection grating

    NASA Astrophysics Data System (ADS)

    Maradudin, A. A.; Simonsen, I.; Polanco, J.; Fitzgerald, R. M.

    2016-02-01

    By means of a modal method we have calculated the angular dependence of the reflectivity and the efficiencies of several other diffracted orders of a perfectly conducting lamellar reflection grating illuminated by p-polarized light. These dependencies display the signatures of Rayleigh and Wood anomalies, usually associated with diffraction from a metallic grating. The Wood anomalies here are caused by the excitation of the surface electromagnetic waves supported by a periodically corrugated perfectly conducting surface, whose dispersion curves in both the nonradiative and radiative regions of the frequency-wavenumber plane are calculated.

  14. On interaction of P-waves with one-dimensional photonic crystal consisting of weak conducting matter and transparent dielectric layers

    NASA Astrophysics Data System (ADS)

    Yushkanov, A. A.; Zverev, N. V.

    2018-03-01

    An influence of quantum and spatial dispersion properties of the non-degenerate electron plasma on the interaction of electromagnetic P-waves with one-dimensional photonic crystal consisting of conductor with low carrier electron density and transparent dielectric matter, is studied numerically. It is shown that at the frequencies of order of the plasma frequency and at small widths of the conducting and dielectric layers of the photonic crystal, optical coefficients in the quantum non-degenerate plasma approach differ from the coefficients in the classical electron gas approach. And also, at these frequencies one observes a temperature dependence of the optical coefficients.

  15. AC impedance investigations of proton conduction in Nafion(sup TM)

    NASA Astrophysics Data System (ADS)

    Cahan, B. D.; Wainright, J. S.

    1993-12-01

    AC impedance spectroscopy has been employed to study the conduction of protons in Nafion 117 polymer electrolyte membrane. Both two- and four-electrode geometries have been used to uniquely distinguish between the membrane impedance and the interfacial impedances. The results show that the impedance of Nafion for frequencies up to 100 kHz is characterized by a pure resistance, similar to conventional liquid electrolytes. The frequency dependent features observed using a two-electrode geometry are shown to be consistent will well-characterized interfacial impedances and do not arise from ionic conduction in the membrane. These results show that previous two-electrode studies reported in the literature have misinterpreted the impedance of the electrode interfaces as belonging to the conduction process in the electrolyte.

  16. AC conductivity, magnetic and shielding effectiveness studies on polyaniline embedded Co0.5Mn0.5Fe2O4 nanoparticles for electromagnetic interference suppression

    NASA Astrophysics Data System (ADS)

    Gurusiddesh, M.; Madhu, B. J.; Shankaramurthy, G. J.

    2018-05-01

    Electrically conducting Polyaniline (PANI)/Co0.5Mn0.5Fe2O4 nanocomposites are synthesized by in situ polymerization of aniline monomer in the presence of Co0.5Mn0.5Fe2O4 nanoparticles. Structural studies on the synthesized samples have been carried out using X-ray diffraction technique, Field emission scanning electron microscopy and Energy dispersive X-ray spectroscopy. Frequency dependent ac conductivity studies on the prepared samples revealed that conductivity of the composite is high compared to Co0.5Mn0.5Fe2O4 nanoparticles. Further, both the samples exhibited hysteresis behavior under the applied magnetic field. Electromagnetic interference (EMI) shielding effectiveness of both the samples decreases with increase in the applied frequency in the studied frequency range. Maximum shielding effectiveness (SE) of 31.49 dB and 62.84 dB were obtained for Co0.5Mn0.5Fe2O4 nanoparticles and PANI/Co0.5Mn0.5Fe2O4 nanocomposites respectively in the studied frequency range. Observed higher EMI shielding in the composites was attributed to its high electrical conductivity.

  17. Transport of oxygen ions in Er doped La2Mo2O9 oxide ion conductors: Correlation with microscopic length scales

    NASA Astrophysics Data System (ADS)

    Paul, T.; Ghosh, A.

    2018-01-01

    We report oxygen ion transport in La2-xErxMo2O9 (0.05 ≤ x ≤ 0.25) oxide ion conductors. We have measured conductivity and dielectric spectra at different temperatures in a wide frequency range. The mean square displacement and spatial extent of non-random sub-diffusive regions are estimated from the conductivity spectra and dielectric spectra, respectively, using linear response theory. The composition dependence of the conductivity is observed to be similar to that of the spatial extent of non-random sub-diffusive regions. The behavior of the composition dependence of the mean square displacement of oxygen ions is opposite to that of the conductivity. The attempt frequency estimated from the analysis of the electric modulus agrees well with that obtained from the Raman spectra analysis. The full Rietveld refinement of X-ray diffraction data of the samples is performed to estimate the distance between different oxygen lattice sites. The results obtained from such analysis confirm the ion hopping within the spatial extent of non-random sub-diffusive regions.

  18. Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.

    2013-12-01

    Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.

  19. Dielectric relaxation behavior of colloidal suspensions of palladium nanoparticle chains dispersed in PVP/EG solution.

    PubMed

    Chen, Zhen; Zhao, Kong-Shuang; Guo, Lin; Feng, Cai-Hong

    2007-04-28

    Dielectric measurements were carried out on colloidal suspensions of palladium nanoparticle chains dispersed in poly(vinyl pyrrolidone)/ethylene glycol (PVP/EG) solution with different particle volume fractions, and dielectric relaxation with relaxation time distribution and small relaxation amplitude was observed in the frequency range from 10(5) to 10(7) Hz. By means of the method based on logarithmic derivative of the dielectric constant and a numerical Kramers-Kronig transform method, two dielectric relaxations were confirmed and dielectric parameters were determined from the dielectric spectra. The dielectric parameters showed a strong dependence on the volume fraction of palladium nanoparticle chain. Through analyzing limiting conductivity at low frequency, the authors found the conductance percolation phenomenon of the suspensions, and the threshold volume fraction is about 0.18. It was concluded from analyzing the dielectric parameters that the high frequency dielectric relaxation results from interfacial polarization and the low frequency dielectric relaxation is a consequence of counterion polarization. They also found that the dispersion state of the palladium nanoparticle chain in PVP/EG solution is dependent on the particle volume fraction, and this may shed some light on a better application of this kind of materials.

  20. Microscopic theoretical study of frequency dependent dielectric constant of heavy fermion systems

    NASA Astrophysics Data System (ADS)

    Shadangi, Keshab Chandra; Rout, G. C.

    2017-05-01

    The dielectric polarization and the dielectric constant plays a vital role in the deciding the properties of the Heavy Fermion Systems. In the present communication we consider the periodic Anderson's Model which consists of conduction electron kinetic energy, localized f-electron kinetic energy and the hybridization between the conduction and localized electrons, besides the Coulomb correlation energy. We calculate dielectric polarization which involves two particle Green's functions which are calculated by using Zubarev's Green's function technique. Using the equations of motion of the fermion electron operators. Finally, the temperature and frequency dependent dielectric constant is calculated from the dielectric polarization function. The charge susceptibility and dielectric constant are computed numerically for different physical parameters like the position (Ef) of the f-electron level with respect to fermi level, the strength of the hybridization (V) between the conduction and localized f-electrons, Coulomb correlation potential temperature and optical phonon wave vector (q). The results will be discussed in a reference to the experimental observations of the dielectric constants.

  1. Anisotropic thermal transport in van der Waals layered alloys WSe2(1-x)Te2x

    NASA Astrophysics Data System (ADS)

    Qian, Xin; Jiang, Puqing; Yu, Peng; Gu, Xiaokun; Liu, Zheng; Yang, Ronggui

    2018-06-01

    Transition metal dichalcogenide (TMD) alloys have attracted great interest in recent years due to their tunable electronic properties and the semiconductor-metal phase transition along with their potential applications in solid-state memories and thermoelectrics among others. However, the thermal conductivity of layered TMD alloys remains largely unexplored despite that it plays a critical role in the reliability and functionality of TMD-enabled devices. In this work, we study the composition- and temperature-dependent anisotropic thermal conductivity of the van der Waals layered TMD alloys WSe2(1-x)Te2x in both the in-plane direction (parallel to the basal planes) and the cross-plane direction (along the c-axis) using time-domain thermoreflectance measurements. In the WSe2(1-x)Te2x alloys, the cross-plane thermal conductivity is observed to be dependent on the heating frequency (modulation frequency of the pump laser) due to the non-equilibrium transport between different phonon modes. Using a two-channel heat conduction model, we extracted the anisotropic thermal conductivity at the equilibrium limit. A clear discontinuity in both the cross-plane and the in-plane thermal conductivity is observed as x increases from 0.4 to 0.6 due to the phase transition from the 2H to the Td phase in the layered alloys. The temperature dependence of thermal conductivity for the TMD alloys was found to become weaker compared with the pristine 2H WSe2 and Td WTe2 due to the atomic disorder. This work serves as an important starting point for exploring phonon transport in layered alloys.

  2. Pacemaker Dependency after Cardiac Surgery: A Systematic Review of Current Evidence.

    PubMed

    Steyers, Curtis M; Khera, Rohan; Bhave, Prashant

    2015-01-01

    Severe postoperative conduction disturbances requiring permanent pacemaker implantation frequently occur following cardiac surgery. Little is known about the long-term pacing requirements and risk factors for pacemaker dependency in this population. We performed a systematic review of the literature addressing rates and predictors of pacemaker dependency in patients requiring permanent pacemaker implantation after cardiac surgery. Using a comprehensive search of the Medline, Web of Science and EMBASE databases, studies were selected for review based on predetermined inclusion and exclusion criteria. A total of 8 studies addressing the endpoint of pacemaker-dependency were identified, while 3 studies were found that addressed the recovery of atrioventricular (AV) conduction endpoint. There were 10 unique studies with a total of 780 patients. Mean follow-up ranged from 6-72 months. Pacemaker dependency rates ranged from 32%-91% and recovery of AV conduction ranged from 16%-42%. There was significant heterogeneity with respect to the definition of pacemaker dependency. Several patient and procedure-specific variables were found to be independently associated with pacemaker dependency, but these were not consistent between studies. Pacemaker dependency following cardiac surgery occurs with variable frequency. While individual studies have identified various perioperative risk factors for pacemaker dependency and non-resolution of AV conduction disease, results have been inconsistent. Well-conducted studies using a uniform definition of pacemaker dependency might identify patients who will benefit most from early permanent pacemaker implantation after cardiac surgery.

  3. Dynamical spin accumulation in large-spin magnetic molecules

    NASA Astrophysics Data System (ADS)

    Płomińska, Anna; Weymann, Ireneusz; Misiorny, Maciej

    2018-01-01

    The frequency-dependent transport through a nanodevice containing a large-spin magnetic molecule is studied theoretically in the Kondo regime. Specifically, the effect of magnetic anisotropy on dynamical spin accumulation is of primary interest. Such accumulation arises due to finite components of frequency-dependent conductance that are off diagonal in spin. Here, employing the Kubo formalism and the numerical renormalization group method, we demonstrate that the dynamical transport properties strongly depend on the relative orientation of spin moments in electrodes of the device, as well as on intrinsic parameters of the molecule. In particular, the effect of dynamical spin accumulation is found to be greatly affected by the type of magnetic anisotropy exhibited by the molecule, and it develops for frequencies corresponding to the Kondo temperature. For the parallel magnetic configuration of the device, the presence of dynamical spin accumulation is conditioned by the interplay of ferromagnetic-lead-induced exchange field and the Kondo correlations.

  4. Dielectrophoresis of Cells

    PubMed Central

    Pohl, Herbert A.; Crane, Joe S.

    1971-01-01

    Dielectrophoresis, the motion produced by the action of nonuniform electric field upon a neutral object, is shown to be a simple and useful technique for the study of cellular organisms. In the present study of yeast (Saccharomyces cerevisiae) using a simple pin-pin electrode system of platinum and high-frequency alternating fields, one observes that the collectability of cells at the electrode tip, i.e. at the region of highest field strength, depends upon physical parameters such as field strength, field uniformity, frequency, cell concentration, suspension conductivity, and time of collection. The yield of cells collected is also observed to depend upon biological factors such as colony age, thermal treatment of the cells, and chemical poisons, but not upon irradiation with ultraviolet light. Several interesting side effect phenomena coincident with nonuniform electric field conditions were observed, including stirring (related to “jet” effects at localized electrode sites), discontinuous repulsions, and cellular rotation which was found to be frequency dependent. ImagesFIGURE 2 PMID:5132497

  5. Thermal conductivity measurement of fluids using the 3ω method

    NASA Astrophysics Data System (ADS)

    Lee, Seung-Min

    2009-02-01

    We have developed a procedure to measure the thermal conductivity of dielectric liquids and gases using a steady state ac hot wire method in which a thin metal wire is used as a heater and thermometer. The temperature response of the heater wire was measured in a four-probe geometry using an electronic circuit developed for the conventional 3ω method. The measurements have been performed in the frequency range from 1 mHz to 1 kHz. We devised a method to transform the raw data into well-known linear logarithmic frequency dependence plot. After the transformation, an optimal frequency region of the thermal conductivity data was clearly determined as has been done with the data from thin metal film heater. The method was tested with air, water, ethanol, mono-, and tetraethylene glycol. Volumetric heat capacity of the fluids was also calculated with uncertainty and the capability as a probe for metal-liquid thermal boundary conductance was discussed.

  6. Terahertz and infrared transmission of an organic/inorganic hybrid thermoelectric material

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heyman, J. N., E-mail: heyman@macalester.edu; Alebachew, B. A.; Kaminski, Z. S.

    2014-04-07

    We report terahertz and infrared transmission measurements of a high-performance thermoelectric material containing tellurium nanowires in a conducting polymer poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) matrix. The DC electrical conductivity of the hybrid material (41 S/cm) is approximately one hundred times that of pure PEDOT:PSS and more than 400 times that of a film of pure tellurium nanowires, while the terahertz-frequency (THz) conductivity of PEDOT:PSS and the hybrid material are comparable at f ∼ 2THz. A frequency-dependent conductivity model indicates that the increased DC conductivity of the hybrid material results from an increase in the DC charge mobility rather than in the free charge density. We suggestmore » that the increased DC conductivity of the hybrid material results from an increase in linkage between PEDOT domains by the tellurium nanowires.« less

  7. Thermal, dielectric characteristics and conduction mechanism of azodyes derived from quinoline and their copper complexes.

    PubMed

    El-Ghamaz, N A; Diab, M A; El-Bindary, A A; El-Sonbati, A Z; Nozha, S G

    2015-05-15

    A novel series of (5-(4'-derivatives phenyl azo)-8-hydroxy-7-quinolinecarboxaldehyde) (AQLn) (n=1, p-OCH3; n=2, R=H; and n=3; p-NO2) and their complexes [Cu(AQLn)2]·5H2O are synthesized and investigated. The optimized bond lengths, bond angles and the calculated quantum chemical parameters for AQLn are investigated. HOMO-LUMO energy gap, absolute electronegativities, chemical potentials, and absolute hardness are also calculated. The thermal properties, dielectric properties, alternating current conductivity (σac) and conduction mechanism are investigated in the frequency range 0.1-100kHz and temperature range 293-568K for AQL1-3 and 318-693K for [Cu(AQL1-3)2]·5H2O complexes. The thermal properties are of ligands (AQLn) and their Cu(II) complexes investigated by thermogravimetric analysis (TGA). The temperature and frequency dependence of the real and the imaginary part of the dielectric constant are studied. The values of the thermal activation energy of conduction mechanism for AQLn and their complexes [Cu(AQLn)2]·5H2O under investigation are calculated at different test frequencies. The values of thermal activation energies ΔE1 and ΔE2 for AQLn and [Cu(AQLn)2]·5H2O decrease with increasing the values of frequency. The ac conductivity is found to be depending on the chemical structure of the compounds. Different conduction mechanisms have been proposed to explain the obtained experimental data. The small polaron tunneling (SPT) is the dominant conduction mechanism for AQL1 and its complex [Cu(AQL1)2]·5H2O. The quantum mechanical tunneling (QMT) is the dominant conduction mechanism for AQL2 and its complex [Cu(AQL2)2]·5H2O. The correlated barrier hopping (CBH) is the dominant conduction mechanism for AQL3 and its complex [Cu(AQL3)2]·5H2O, and the values of the maximum barrier height (Wm) are calculated. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. ac conductivity in Gd doped Pb(Zr0.53Ti0.47)O3 ceramics

    NASA Astrophysics Data System (ADS)

    Portelles, J.; Almodovar, N. S.; Fuentes, J.; Raymond, O.; Heiras, J.; Siqueiros, J. M.

    2008-10-01

    This study is focused in the conduction processes taking place in 0.6 wt % Gd doped lead zirconate titanate samples PbZr0.53Ti0.47O3:Gd (PZT53/47:Gd) in the vicinity of the morphotropic phase boundary. Doped samples show very large dielectric permittivity with respect to that of undoped ones near the transition temperature. The frequency dependent ac conductivity of PZT53/47:Gd ceramics was studied in the 30-450 °C temperature range. X-ray diffraction analyses indicate the incorporation of Gd atoms to the structure. The changes in the dielectric properties as functions of temperature of the doped samples are taken as additional evidence of the incorporation of Gd into the crystal structure. Gd acts as donor center promoting extrinsic n-type conduction. The ac conductivity behavior obeys Jonscher universal relation in the 100 Hz-1 MHz frequency range for temperatures between 30 and 300 °C. The measured conductivity values for Gd doped PZT53/47 are higher than those of pure PZT53/47. According to the correlated barrier hopping model, the preponderant conduction mechanism in the frequency-temperature response was recognized as small polarons hopping mechanism.

  9. In Situ Polymerization and Characterization of Highly Conducting Polypyrrole Fish Scales for High-Frequency Applications

    NASA Astrophysics Data System (ADS)

    Velhal, Ninad B.; Patil, Narayan D.; Puri, Vijaya R.

    2015-12-01

    Polypyrrole (Ppy) thin films on alumina were synthesized by an in situ chemical oxidative polymerization method at 300 K with equal monomer-to-oxidant ratio. Fourier transform infrared spectroscopy (FTIR) and FT-Raman spectroscopy confirmed the formation of Ppy. A thickness-dependent change from cauliflower to fish-scale morphology was observed. Microwave properties such as transmission, reflection, shielding effectiveness, permittivity, and microwave conductivity are reported in the frequency range from 8 GHz to 12 GHz. The direct-current (DC) conductivity varied from 9.45 × 10-3 S/cm to 17.29 × 10-3 S/cm, whereas the microwave conductivity varied from 63.07 S/cm to 349.08 S/cm. The shielding effectiveness varied between 6.18 dB and 10.39 dB.

  10. Frequency Management for Electromagnetic Continuous Wave Conductivity Meters

    PubMed Central

    Mazurek, Przemyslaw; Putynkowski, Grzegorz

    2016-01-01

    Ground conductivity meters use electromagnetic fields for the mapping of geological variations, like the determination of water amount, depending on ground layers, which is important for the state analysis of embankments. The VLF band is contaminated by numerous natural and artificial electromagnetic interference signals. Prior to the determination of ground conductivity, the meter’s working frequency is not possible, due to the variable frequency of the interferences. Frequency management based on the analysis of the selected band using track-before-detect (TBD) algorithms, which allows dynamical frequency changes of the conductivity of the meter transmitting part, is proposed in the paper. Naive maximum value search, spatio-temporal TBD (ST-TBD), Viterbi TBD and a new algorithm that uses combined ST-TBD and Viterbi TBD are compared. Monte Carlo tests are provided for the numerical analysis of the properties for a single interference signal in the considered band, and a new approach based on combined ST-TBD and Viterbi algorithms shows the best performance. The considered algorithms process spectrogram data for the selected band, so DFT (Discrete Fourier Transform) could be applied for the computation of the spectrogram. Real–time properties, related to the latency, are discussed also, and it is shown that TBD algorithms are feasible for real applications. PMID:27070608

  11. Frequency Management for Electromagnetic Continuous Wave Conductivity Meters.

    PubMed

    Mazurek, Przemyslaw; Putynkowski, Grzegorz

    2016-04-07

    Ground conductivity meters use electromagnetic fields for the mapping of geological variations, like the determination of water amount, depending on ground layers, which is important for the state analysis of embankments. The VLF band is contaminated by numerous natural and artificial electromagnetic interference signals. Prior to the determination of ground conductivity, the meter's working frequency is not possible, due to the variable frequency of the interferences. Frequency management based on the analysis of the selected band using track-before-detect (TBD) algorithms, which allows dynamical frequency changes of the conductivity of the meter transmitting part, is proposed in the paper. Naive maximum value search, spatio-temporal TBD (ST-TBD), Viterbi TBD and a new algorithm that uses combined ST-TBD and Viterbi TBD are compared. Monte Carlo tests are provided for the numerical analysis of the properties for a single interference signal in the considered band, and a new approach based on combined ST-TBD and Viterbi algorithms shows the best performance. The considered algorithms process spectrogram data for the selected band, so DFT (Discrete Fourier Transform) could be applied for the computation of the spectrogram. Real-time properties, related to the latency, are discussed also, and it is shown that TBD algorithms are feasible for real applications.

  12. Single crystal growth by gel technique and characterization of lithium hydrogen tartrate

    NASA Astrophysics Data System (ADS)

    Ahmad, Nazir; Ahmad, M. M.; Kotru, P. N.

    2015-02-01

    Single crystal growth of lithium hydrogen tartrate by gel encapsulation technique is reported. Dependence of crystal count on gel density, gel pH, reactant concentration and temperature are studied and the optimum conditions for these crystals are worked out. The stoichiometric composition of the grown crystals is determined using EDAX/AES and CH analysis. The grown crystals are characterized by X-ray diffraction, FTIR and Uv-Visible spectroscopy. It is established that crystal falls under orthorhombic system and space group P222 with the cell parameters as: a=10.971 Å, b=13.125 Å and c=5.101 Å; α=90.5o, β=γ=90°. The morphology of the crystals as revealed by SEM is illustrated. Crystallite size, micro strain, dislocation density and distortion parameters are calculated from the powder XRD results of the crystal. UV-vis spectroscopy shows indirect allowed transition with an optical band gap of 4.83 eV. The crystals are also shown to have high transmittance in the entire visible region. Dependence of dielectric constant, dielectric loss and conductivity on frequency of the applied ac field is analyzed. The frequency-dependent real part of the complex ac conductivity is found to follow the universal dielectric response: σac (ω) ωs. The trend in the variation of frequency exponent with frequency corroborates the fact that correlated barrier hopping is the dominant charge-transport mechanism in the present system.

  13. Energy drink consumption and increased risk for alcohol dependence.

    PubMed

    Arria, Amelia M; Caldeira, Kimberly M; Kasperski, Sarah J; Vincent, Kathryn B; Griffiths, Roland R; O'Grady, Kevin E

    2011-02-01

    Energy drinks are highly caffeinated beverages that are increasingly consumed by young adults. Prior research has established associations between energy drink use and heavier drinking and alcohol-related problems among college students. This study investigated the extent to which energy drink use might pose additional risk for alcohol dependence over and above that from known risk factors. Data were collected via personal interview from 1,097 fourth-year college students sampled from 1 large public university as part of an ongoing longitudinal study. Alcohol dependence was assessed according to DSM-IV criteria. After adjustment for the sampling design, 51.3%(wt) of students were classified as "low-frequency" energy drink users (1 to 51 days in the past year) and 10.1%(wt) as "high-frequency" users (≥52 days). Typical caffeine consumption varied widely depending on the brand consumed. Compared to the low-frequency group, high-frequency users drank alcohol more frequently (141.6 vs. 103.1 days) and in higher quantities (6.15 vs. 4.64 drinks/typical drinking day). High-frequency users were at significantly greater risk for alcohol dependence relative to both nonusers (AOR = 2.40, 95% CI = 1.27 to 4.56, p = 0.007) and low-frequency users (AOR = 1.86, 95% CI = 1.10, 3.14, p = 0.020), even after holding constant demographics, typical alcohol consumption, fraternity/sorority involvement, depressive symptoms, parental history of alcohol/drug problems, and childhood conduct problems. Low-frequency energy drink users did not differ from nonusers on their risk for alcohol dependence. Weekly or daily energy drink consumption is strongly associated with alcohol dependence. Further research is warranted to understand the possible mechanisms underlying this association. College students who frequently consume energy drinks represent an important target population for alcohol prevention. Copyright © 2010 by the Research Society on Alcoholism.

  14. Dielectric relaxation and electrical conductivity in Bi 5NbO 10 oxygen ion conductors prepared by a modified sol-gel process

    NASA Astrophysics Data System (ADS)

    Hou, Jungang; Vaish, Rahul; Qu, Yuanfang; Krsmanovic, Dalibor; Varma, K. B. R.; Kumar, R. V.

    Crystalline Bi 5NbO 10 nanoparticles have been achieved through a modified sol-gel process using a mixture of ethylenediamine and ethanolamine as a solvent. The Bi 5NbO 10 nanoparticles were characterized by X-ray diffraction (XRD), differential scanning calorimetry/thermogravimetry (DSC/TG), Fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM) and Raman spectroscopy. The results showed that well-dispersed 5-60 nm Bi 5NbO 10 nanoparticles were prepared through heat-treating the precursor at 650 °C and the high density pellets were obtained at temperatures lower than those commonly employed. The frequency and temperature dependence of the dielectric constant and the electrical conductivity of the Bi 5NbO 10 solid solutions were investigated in the 0.1 Hz to 1 MHz frequency range. Two distinct relaxation mechanisms were observed in the plots of dielectric loss and the imaginary part of impedance (Z″) versus frequency in the temperature range of 200-350 °C. The dielectric constant and the loss in the low frequency regime were electrode dependent. The ionic conductivity of Bi 5NbO 10 solid solutions at 700 °C is 2.86 Ω -1 m -1 which is in same order of magnitude for Y 2O 3-stabilized ZrO 2 ceramics at same temperature. These results suggest that Bi 5NbO 10 is a promising material for an oxygen ion conductor.

  15. Realizing one-dimensional quantum and high-frequency transport features in aligned single-walled carbon nanotube ropes

    NASA Astrophysics Data System (ADS)

    Ncube, Siphephile; Chimowa, George; Chiguvare, Zivayi; Bhattacharyya, Somnath

    2014-07-01

    The superiority of the electronic transport properties of single-walled carbon nanotube (SWNT) ropes over SWNT mats is verified from low temperature and frequency-dependent transport. The overall change of resistance versus in nanotube mats shows that 3D variable range hopping is the dominant conduction mechanism within the 2-300 K range. The magneto-resistance (MR) is found to be predominantly negative with a parabolic nature, which can also be described by the hopping model. Although the positive upturn of the MR at low temperatures establishes the contribution from quantum interference, the inherent quantum transport in individual tubes is suppressed at elevated temperatures. Therefore, to minimize multi-channel effects from inter-tube interactions and other defects, two-terminal devices were fabricated from aligned SWNT (extracted from a mat) for low temperature transport as well as high-frequency measurements. In contrast to the mat, the aligned ropes exhibit step-like features in the differential conductance within the 80-300 K temperature range. The effects of plasmon propagation, unique to one dimension, were identified in electronic transport as a non-universal power-law dependence of the differential conductance on temperature and source-drain voltage. The complex impedance showed high power transmission capabilities up to 65 GHz as well as oscillations in the frequency range up to 30 GHz. The measurements suggest that aligned SWNT ropes have a realistic potential for high-speed device applications.

  16. Direct Comparison of Brookhaven Reflectivity Measurements with Free-Electron Theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bane, Karl L.F.

    2010-12-13

    The reflectivity at normal incidence of copper and aluminum samples was recently measured over a large frequency range at Brookhaven by one of us (JT). Then using the Kramers-Kroning integrals, and assuming the free-electron model of conductivity, the dependence of conductivity on frequency was obtained. The results seemed to suggest, for example, that the dc conductivities of the copper and evaporated aluminum samples are a factor of 3 lower than expected. We propose in this report, instead, directly fitting the free-electron model to the low frequency end of the reflectivity data. This fitting does not depend on the higher frequencymore » results and on Kramers-Kronig integrations, but it does assume that the data at the low frequency end is sufficiently accurate. Note that for our LCLS wakefield studies, it is only over these (relatively) low frequencies that we need to know the electrical properties of the metals. The equations that relate reflectivity R with the free electron parameters dc conductivity {sigma} and relaxation time {tau} are: (1) {tilde {sigma}} = {sigma}/1-ikc{tau}; (2) {tilde n} = {radical} {tilde {epsilon}} = {radical}(1+4{pi}i{tilde k}c/{omega}); and (3) R = |{tilde n}-1/{tilde n} + 1|{sup 2}. The parameters are ac conductivity {tilde {sigma}}, index of refraction {tilde n}, dielectric constant {tilde {epsilon}}, and wave number k = {omega}/c, with {omega} frequency and c the speed of light. In Fig. 1 we show the ideal behavior of R for a reasonably good conducting metal, where {sigma} = 0.12 x 10{sup 17}/s and {tau} = 0.55 x 10{sup -14} s (solid line); these parameters are, respectively, 2% ({sigma}) and 20% ({tau}) of the nominal values for copper. The parameters were chosen so that the important features of R(k) could be seen easily in one plot. We see 3 distinct regions: (1) for low frequencies, k {approx}< 1/c{tau}, R continually decreases, with positive curvature, and with a low frequency asymptote of (1 - {radical}2kc/{pi}{sigma}); (2) for intermediate frequencies the reflectivity is nearly constant, R {approx} (1 - {radical}1/{pi}{sigma}{tau}); (3) for k {approx}> k{sub p} = {radical}4{pi}{sigma}/c{sup 2}{tau}, the plasma frequency of the metal, R quickly drops to zero. The dashed lines in Fig. 1 give the analytic guideposts for the 3 regions. Note that it is only in the first and part of the second region that we can expect the free electron model to have validity in real metals; at higher frequencies the effects of absorption bands and other physics will distort the R(k) curve. In principle, knowing R accurately in the entire 1st region suffices for obtaining the free-electron parameters {sigma} and {tau}; in practice, however, knowing it also in the 2nd region gives us more confidence in the model and especially in the value of {tau}.« less

  17. Effect of stress on ultrasonic pulses in fiber reinforced composites

    NASA Technical Reports Server (NTRS)

    Hemann, J. H.; Baaklini, G. Y.

    1986-01-01

    An acoustical-ultrasonic technique was used to demonstrate relationships existing between changes in attenuation of stress waves and tensile stress on an eight ply 0 degree graphite-epoxy fiber reinforced composite. All tests were conducted in the linear range of the material for which no mechanical or macroscopic damage was evident. Changes in attenuation were measured as a function of tensile stress in the frequency domain and in the time domain. Stress wave propagation in these specimens was dispersive, i.e., the wave speed depends on frequency. Wave speeds varied from 267,400 cm/sec to 680,000 cm/sec as the frequency of the signal was varied from 150 kHz to 1.9 MHz which strongly suggests that flexural/lamb wave modes of propagation exist. The magnitude of the attenuation changes depended strongly on tensile stress. It was further observed that the wave speeds increased slightly for all tested frequencies as the stress was increased.

  18. Low-frequency noise in charge ordered system Pr0.63Ca0.37MnO3 near the charge-ordering transition and in the current induced destabilized state

    NASA Astrophysics Data System (ADS)

    Bid, Aveek; Raychaudhuri, Arup K.

    2003-05-01

    We have investigated the dynamics of co-existing phases in the Charge Ordered (CO) manganite Pr0.63Ca0.37MnO3 using the technique of conductance noise spectroscopy. We note that close to the CO transition temperature Tco the spectral power of Sv(f)/V2 deviates significantly from the 1/f frequency dependence for f<=0.12Hz. Our analysis shows that this deviation can be described by a single frequency Lorentzian with corner frequency fc in addition to the usual broadband 1/f noise. Such a Lorentzian contribution to Sv(f)/V2 can come from a two level system (TLS). In the time serioues this shows up as RTN. For T<=Tco the system shows the onset of a non-linear conduction close to a threshold value Jdc = Jth the noise spectra is mainly 1/f in nature. For J > Jth a large low frequency component of noise (characterized again by a frequency fc) appears. We associate fc with the relaxation time tc of the TLS fluctuator so the tc = 1/fc. For thermal activation of the TLS the temperature dependence of fc will follow fc=foexp(-Ea/kBT) where Ea is an energy barrier. The value of fc shows an increase with Jdc showing that the value of the activation energy Ea is being lowered by the applied bias.

  19. Electrophysiological effects of an anti-influenza drug oseltamivir on the guinea-pig atrium: comparison with those of pilsicainide.

    PubMed

    Takahara, Akira; Suzuki, Sanae; Hagiwara, Mihoko; Nozaki, Shuhei; Sugiyama, Atsushi

    2013-01-01

    We assessed the effects of oseltamivir on the conduction velocity and effective refractory period in the guinea-pig atrium in comparison with those of a class Ic antiarrhythmic drug pilsicainide. The recording and stimulating electrodes were attached on the epicardium close to the sinus nodal region and on the left atrial appendage. Oseltamivir (10-100 µM) as well as pilsicainide (1-10 µM) decreased the atrial conduction velocity in a frequency-dependent manner. Both drugs also increased the effective refractory period in both atria; but the frequency-dependent property of oseltamivir was lacking in the left atrium, and it was less obvious in the right atrium compared with that of pilsicainide. These results suggest that oseltamivir can directly modify the electrophysiological functions in the guinea-pig atrium possibly via combination of Na(+) and K(+) channel-blocking actions.

  20. Rietveld refinement, dielectric and magnetic properties of Nb modified Bi0.80Ba0.20FeO3 ceramic

    NASA Astrophysics Data System (ADS)

    Jangra, Sandhaya; Sanghi, Sujata; Agarwal, Ashish; Rangi, Manisha

    2018-05-01

    Bi0.80Ba0.20Fe0.95Nb0.05O3 ceramic has been prepared via conventional solid state reaction method. Structure analysis was carried out by X-ray diffraction (XRD) technique at room temperature. XRD pattern confirmed the crystalline nature of prepared sample. Rietveld analysis used for further structural investigations and confirmed the existence of rhombohedral symmetry (R3c space group). The dielectric response shows dispersion at lower frequency range and becomes frequency independent at high frequency. The approximation of conduction mechanism is determined by the temperature dependent behavior of frequency exponent `s'. Fitting results suggests the applicability of small polaron conduction mechanism at lower temperatures and CBH model at higher temperature. Room temperature magnetic measurements give the evidence of significant enhancement in magnetic properties with remanent magnetization (Mr = 0.1218 emu/g) and coercive field (Hc = 3.5342 kOe).

  1. Calculation and research of electrical characteristics of induction crucible furnaces with unmagnetized conductive crucible

    NASA Astrophysics Data System (ADS)

    Fedin, M. A.; Kuvaldin, A. B.; Kuleshov, A. O.; Zhmurko, I. Y.; Akhmetyanov, S. V.

    2018-01-01

    Calculation methods for induction crucible furnaces with a conductive crucible have been reviewed and compared. The calculation method of electrical and energy characteristics of furnaces with a conductive crucible has been developed and the example of the calculation is shown below. The calculation results are compared with experimental data. Dependences of electrical and power characteristics of the furnace on frequency, inductor current, geometric dimensions and temperature have been obtained.

  2. An electrohydrodynamic flow in ac electrowetting.

    PubMed

    Lee, Horim; Yun, Sungchan; Ko, Sung Hee; Kang, Kwan Hyoung

    2009-12-17

    In ac electrowetting, hydrodynamic flows occur within a droplet. Two distinct flow patterns were observed, depending on the frequency of the applied electrical signal. The flow at low-frequency range was explained in terms of shape oscillation and a steady streaming process in conjunction with contact line oscillation. The origin of the flow at high-frequency range has not yet been explained. We suggest that the high-frequency flow originated mainly from the electrothermal effect, in which electrical charge is generated due to the gradient of electrical conductivity and permittivity, which is induced by the Joule heating of fluid medium. To support our argument, we analyzed the flow field numerically while considering the electrical body force generated by the electrothermal effect. We visualized the flow pattern and measured the flow velocity inside the droplet. The numerical results show qualitative agreement with experimental results with respect to electric field and frequency dependence of flow velocity. The effects of induced-charge electro-osmosis, natural convection, and the Marangoni flow are discussed.

  3. Spike propagation through the dorsal root ganglia in an unmyelinated sensory neuron: a modeling study

    PubMed Central

    Sundt, Danielle; Gamper, Nikita

    2015-01-01

    Unmyelinated C-fibers are a major type of sensory neurons conveying pain information. Action potential conduction is regulated by the bifurcation (T-junction) of sensory neuron axons within the dorsal root ganglia (DRG). Understanding how C-fiber signaling is influenced by the morphology of the T-junction and the local expression of ion channels is important for understanding pain signaling. In this study we used biophysical computer modeling to investigate the influence of axon morphology within the DRG and various membrane conductances on the reliability of spike propagation. As expected, calculated input impedance and the amplitude of propagating action potentials were both lowest at the T-junction. Propagation reliability for single spikes was highly sensitive to the diameter of the stem axon and the density of voltage-gated Na+ channels. A model containing only fast voltage-gated Na+ and delayed-rectifier K+ channels conducted trains of spikes up to frequencies of 110 Hz. The addition of slowly activating KCNQ channels (i.e., KV7 or M-channels) to the model reduced the following frequency to 30 Hz. Hyperpolarization produced by addition of a much slower conductance, such as a Ca2+-dependent K+ current, was needed to reduce the following frequency to 6 Hz. Attenuation of driving force due to ion accumulation or hyperpolarization produced by a Na+-K+ pump had no effect on following frequency but could influence the reliability of spike propagation mutually with the voltage shift generated by a Ca2+-dependent K+ current. These simulations suggest how specific ion channels within the DRG may contribute toward therapeutic treatments for chronic pain. PMID:26334005

  4. Influence of temperature and frequency on ionic conductivity of Li{sub 3}PO{sub 4}–Pb{sub 3}(PO{sub 4}){sub 2}–BiPO{sub 4} phosphate glasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El Moudane, M., E-mail: m.elmoudane@gmail.com; El Maniani, M.; Sabbar, A.

    2015-12-15

    Highlights: • Results of ionic conductivities of Li{sub 3}PO{sub 4}–Pb{sub 3}(PO{sub 4}){sub 2}–BiPO{sub 4} phosphate glasses. • Determination of glass transition temperature using DSC method. • Study of temperature and frequency on ionic conductivity of Li{sub 3}PO{sub 4}–Pb{sub 3}(PO{sub 4}){sub 2}–BiPO{sub 4} phosphate glasses. - Abstract: Lithium–Lead–Bismuth phosphates glasses having, a composition 30Li{sub 3}PO{sub 4}–(70 − x)Pb{sub 3}(PO{sub 4}){sub 2}–xBiPO{sub 4} (45 ≤ x ≤ 60 mol%) were prepared by using the melt quenching method 1000 °C. The thermal stability of theses glasses increases with the substitution of Bi{sub 2}O{sub 3} with PbO. The ionic conductivity of all compositions havemore » been measured over a wide temperature (200–500 °C) and frequency range (1–106 Hz). The ionic conductivity data below and above T{sub g} follows Arrhenius and Vogel–Tamman–Fulcher (VTF) relationship, respectively. The activation energies are estimated and discussed. The dependence in frequency of AC conductivity is found to obey Jonscher’s relation.« less

  5. High frequency measurements of shot noise suppression in atomic-scale metal contacts

    NASA Astrophysics Data System (ADS)

    Wheeler, Patrick J.; Evans, Kenneth; Russom, Jeffrey; King, Nicholas; Natelson, Douglas

    2009-03-01

    Shot noise provides a means of assessing the number and transmission coefficients of transmitting channels in atomic- and molecular-scale junctions. Previous experiments at low temperatures in metal and semiconductor point contacts have demonstrated the expected suppression of shot noise when junction conductance is near an integer multiple of the conductance quantum, G0≡2e^2/h. Using high frequency techniques, we demonstrate the high speed acquisition of such data at room temperature in mechanical break junctions. In clean Au contacts conductance histograms with clear peaks at G0, 2G0, and 3G0 are acquired within hours, and histograms of simultaneous measurements of the shot noise show clear suppression at those conductance values. We describe the dependence of the noise on bias voltage and analyze the noise vs. conductance histograms in terms of a model that averages over transmission coefficients.

  6. Radio-frequency lesioning in brain tissue with coagulation-dependent thermal conductivity: modelling, simulation and analysis of parameter influence and interaction.

    PubMed

    Johansson, Johannes D; Eriksson, Ola; Wren, Joakim; Loyd, Dan; Wårdell, Karin

    2006-09-01

    Radio-frequency brain lesioning is a method for reducing e.g. symptoms of movement disorders. A small electrode is used to thermally coagulate malfunctioning tissue. Influence on lesion size from thermal and electric conductivity of the tissue, microvascular perfusion and preset electrode temperature was investigated using a finite-element model. Perfusion was modelled as an increased thermal conductivity in non-coagulated tissue. The parameters were analysed using a 2(4)-factorial design (n=16) and quadratic regression analysis (n=47). Increased thermal conductivity of the tissue increased lesion volume, while increased perfusion decreased it since coagulation creates a thermally insulating layer due to the cessation of blood perfusion. These effects were strengthened with increased preset temperature. The electric conductivity had negligible effect. Simulations were found realistic compared to in vivo experimental lesions.

  7. Pacemaker Dependency after Cardiac Surgery: A Systematic Review of Current Evidence

    PubMed Central

    2015-01-01

    Background Severe postoperative conduction disturbances requiring permanent pacemaker implantation frequently occur following cardiac surgery. Little is known about the long-term pacing requirements and risk factors for pacemaker dependency in this population. Methods We performed a systematic review of the literature addressing rates and predictors of pacemaker dependency in patients requiring permanent pacemaker implantation after cardiac surgery. Using a comprehensive search of the Medline, Web of Science and EMBASE databases, studies were selected for review based on predetermined inclusion and exclusion criteria. Results A total of 8 studies addressing the endpoint of pacemaker-dependency were identified, while 3 studies were found that addressed the recovery of atrioventricular (AV) conduction endpoint. There were 10 unique studies with a total of 780 patients. Mean follow-up ranged from 6–72 months. Pacemaker dependency rates ranged from 32%-91% and recovery of AV conduction ranged from 16%-42%. There was significant heterogeneity with respect to the definition of pacemaker dependency. Several patient and procedure-specific variables were found to be independently associated with pacemaker dependency, but these were not consistent between studies. Conclusions Pacemaker dependency following cardiac surgery occurs with variable frequency. While individual studies have identified various perioperative risk factors for pacemaker dependency and non-resolution of AV conduction disease, results have been inconsistent. Well-conducted studies using a uniform definition of pacemaker dependency might identify patients who will benefit most from early permanent pacemaker implantation after cardiac surgery. PMID:26470027

  8. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    NASA Astrophysics Data System (ADS)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  9. Frequency-Modulated Wave Dielectrophoresis of Vesicles And Cells: Periodic U-Turns at the Crossover Frequency

    NASA Astrophysics Data System (ADS)

    Frusawa, Hiroshi

    2018-06-01

    We have formulated the dielectrophoretic force exerted on micro/nanoparticles upon the application of frequency-modulated (FM) electric fields. By adjusting the frequency range of an FM wave to cover the crossover frequency f X in the real part of the Clausius-Mossotti factor, our theory predicts the reversal of the dielectrophoretic force each time the instantaneous frequency periodically traverses f X . In fact, we observed periodic U-turns of vesicles, leukemia cells, and red blood cells that undergo FM wave dielectrophoresis (FM-DEP). It is also suggested by our theory that the video tracking of the U-turns due to FM-DEP is available for the agile and accurate measurement of f X . The FM-DEP method requires a short duration, less than 30 s, while applying the FM wave to observe several U-turns, and the agility in measuring f X is of much use for not only salty cell suspensions but also nanoparticles because the electric-field-induced solvent flow is suppressed as much as possible. The accuracy of f X has been verified using two types of experiment. First, we measured the attractive force exerted on a single vesicle experiencing alternating-current dielectrophoresis (AC-DEP) at various frequencies of sinusoidal electric fields. The frequency dependence of the dielectrophoretic force yields f X as a characteristic frequency at which the force vanishes. Comparing the AC-DEP result of f X with that obtained from the FM-DEP method, both results of f X were found to coincide with each other. Second, we investigated the conductivity dependencies of f X for three kinds of cell by changing the surrounding electrolytes. From the experimental results, we evaluated simultaneously both of the cytoplasmic conductivities and the membrane capacitances using an elaborate theory on the single-shell model of biological cells. While the cytoplasmic conductivities, similar for these cells, were slightly lower than the range of previous reports, the membrane capacitances obtained were in good agreement with those previously reported in the literature.

  10. On the relation between the peak frequency and the corresponding rise time of solar microwave impulsive bursts and the height dependence of magnetic fields

    NASA Astrophysics Data System (ADS)

    Zhao, Ren-Yang; Magun, Andreas; Schanda, Erwin

    1990-12-01

    Results are reported from a correlation analysis for 57 microwave impulsive bursts observed at six frequencies. A regression line between the peak frequency and the corresponding rise time of microwave impulsive bursts is obtained, with a correlation coefficient of -0.43. This can be explained in the frame of a thermal model. The magnetic field decrease with height has to be much slower than in a dipole field in order to explain the weak dependence of f(p) on t(r). This decrease of magnetic field with height in burst sources is based on the relationship between f(p) and t(r) found by assuming a thermal flare model with a collisionless conduction front.

  11. Optical conductivity of three and two dimensional topological nodal-line semimetals

    NASA Astrophysics Data System (ADS)

    Barati, Shahin; Abedinpour, Saeed H.

    2017-10-01

    The peculiar shape of the Fermi surface of topological nodal-line semimetals at low carrier concentrations results in their unusual optical and transport properties. We analytically investigate the linear optical responses of three- and two-dimensional nodal-line semimetals using the Kubo formula. The optical conductivity of a three-dimensional nodal-line semimetal is anisotropic. Along the axial direction (i.e., the direction perpendicular to the nodal-ring plane), the Drude weight has a linear dependence on the chemical potential at both low and high carrier dopings. For the radial direction (i.e., the direction parallel to the nodal-ring plane), this dependence changes from linear into quadratic in the transition from low into high carrier concentration. The interband contribution into optical conductivity is also anisotropic. In particular, at large frequencies, it saturates to a constant value for the axial direction and linearly increases with frequency along the radial direction. In two-dimensional nodal-line semimetals, no interband optical transition could be induced and the only contribution to the optical conductivity arises from the intraband excitations. The corresponding Drude weight is independent of the carrier density at low carrier concentrations and linearly increases with chemical potential at high carrier doping.

  12. Accurate measurements of cross-plane thermal conductivity of thin films by dual-frequency time-domain thermoreflectance (TDTR)

    NASA Astrophysics Data System (ADS)

    Jiang, Puqing; Huang, Bin; Koh, Yee Kan

    2016-07-01

    Accurate measurements of the cross-plane thermal conductivity Λcross of a high-thermal-conductivity thin film on a low-thermal-conductivity (Λs) substrate (e.g., Λcross/Λs > 20) are challenging, due to the low thermal resistance of the thin film compared with that of the substrate. In principle, Λcross could be measured by time-domain thermoreflectance (TDTR), using a high modulation frequency fh and a large laser spot size. However, with one TDTR measurement at fh, the uncertainty of the TDTR measurement is usually high due to low sensitivity of TDTR signals to Λcross and high sensitivity to the thickness hAl of Al transducer deposited on the sample for TDTR measurements. We observe that in most TDTR measurements, the sensitivity to hAl only depends weakly on the modulation frequency f. Thus, we performed an additional TDTR measurement at a low modulation frequency f0, such that the sensitivity to hAl is comparable but the sensitivity to Λcross is near zero. We then analyze the ratio of the TDTR signals at fh to that at f0, and thus significantly improve the accuracy of our Λcross measurements. As a demonstration of the dual-frequency approach, we measured the cross-plane thermal conductivity of a 400-nm-thick nickel-iron alloy film and a 3-μm-thick Cu film, both with an accuracy of ˜10%. The dual-frequency TDTR approach is useful for future studies of thin films.

  13. Subthreshold voltage noise of rat neocortical pyramidal neurones

    PubMed Central

    Jacobson, Gilad A; Diba, Kamran; Yaron-Jakoubovitch, Anat; Oz, Yasmin; Koch, Christof; Segev, Idan; Yarom, Yosef

    2005-01-01

    Neurones are noisy elements. Noise arises from both intrinsic and extrinsic sources, and manifests itself as fluctuations in the membrane potential. These fluctuations limit the accuracy of a neurone's output but have also been suggested to play a computational role. We present a detailed study of the amplitude and spectrum of voltage noise recorded at the soma of layer IV–V pyramidal neurones in slices taken from rat neocortex. The dependence of the noise on holding potential, synaptic activity and Na+ conductance is systematically analysed. We demonstrate that voltage noise increases non-linearly as the cell depolarizes (from a standard deviation (s.d.) of 0.19 mV at −75 mV to an s.d. of 0.54 mV at −55 mV). The increase in voltage noise is accompanied by an increase in the cell impedance, due to voltage dependence of Na+ conductance. The impedance increase accounts for the majority (70%) of the voltage noise increase. The increase in voltage noise and impedance is restricted to the low-frequency range (0.2–2 Hz). At the high frequency range (5–100 Hz) the voltage noise is dominated by synaptic activity. In our slice preparation, synaptic noise has little effect on the cell impedance. A minimal model reproduces qualitatively these data. Our results imply that ion channel noise contributes significantly to membrane voltage fluctuations at the subthreshold voltage range, and that Na+ conductance plays a key role in determining the amplitude of this noise by acting as a voltage-dependent amplifier of low-frequency transients. PMID:15695244

  14. Molecular dynamics of alamethicin transmembrane channels from open-channel current noise analysis.

    PubMed

    Mak, D O; Webb, W W

    1995-12-01

    Conductance noise measurement of the open states of alamethicin transmembrane channels reveals excess noise attributable to cooperative low-frequency molecular dynamics that can generate fluctuations approximately 1 A rms in the effective channel pore radius. Single-channel currents through both persistent and nonpersistent channels with multiple conductance states formed by purified polypeptide alamethicin in artificial phospholipid bilayers isolated onto micropipettes with gigaohm seals were recorded using a voltage-clamp technique with low background noise (rms noise < 3 pA up to 20 kHz). Current noise power spectra between 100 Hz and 20 kHz of each open channel state showed little frequency dependence. Noise from undetected conductance state transitions was insignificant. Johnson and shot noises were evaluated. Current noise caused by electrolyte concentration fluctuation via diffusion was isolated by its dependence on buffer concentration. After removing these contributions, significant current noise remains in all persistent channel states and increases in higher conductance states. In nonpersistent channels, remaining noise occurs primarily in the lowest two states. These fluctuations of channel conductance are attributed to thermal oscillations of the channel molecular conformation and are modeled as a Langevin translational oscillation of alamethicin molecules moving radially from the channel pore, damped mostly by lipid bilayer viscosity.

  15. [Experimental research and analysis on dielectric properties of blood in anemia mice].

    PubMed

    Shen, Ben; Liang, Quiyan; Gao, Weiqi; You, Chu; Hong, Mengqi; Ma, Qing

    2013-12-01

    The conductivity and permittivity of blood in mice were measured by the AC electrical impedance method at frequency range of 0.1-100MHz, and then the changes of the Cole-Cole parameters of dielectric spectra of blood from phenylhydrazine-induced anemia mice were observed by numerical calculation and curve fitting residual analysis of the Cole-Cole equation. The results showed that hematocrit (Hct) of the mice with phenylhydrazine injection was significantly reduced; the permittivity(epsilon) spectroscopy of blood moved to the low insulating region and its permittivity decreased; conductivity (kappa) spectrum curve of blood moved to the high conductivity zone and conductivity increased; the 2nd characteristic frequency was lower than that in the normal group. There was phenylhydrazine dose dependent in the changes of the Cole-Cole parameters of dielectric spectra of blood.

  16. Energy drink consumption and increased risk for alcohol dependence

    PubMed Central

    Arria, Amelia M.; Caldeira, Kimberly M.; Kasperski, Sarah J.; Vincent, Kathryn B.; Griffiths, Roland R.; O'Grady, Kevin E.

    2010-01-01

    Background Energy drinks are highly caffeinated beverages that are increasingly consumed by young adults. Prior research has established associations between energy drink use and heavier drinking and alcohol-related problems among college students. This study investigated the extent to which energy drink use might pose additional risk for alcohol dependence over and above that from known risk factors. Methods Data were collected via personal interview from 1,097 fourth-year college students sampled from one large public university as part of an ongoing longitudinal study. Alcohol dependence was measured with DSM-IV criteria. Results After adjustment for the sampling design, 51.3%wt of students were classified as “low-frequency” energy drink users (1 to 51 days in the past year) and 10.1%wt as “high-frequency” users (≥52 days). Typical caffeine consumption varied widely depending on the brand consumed. Compared to the low-frequency group, high-frequency users drank alcohol more frequently (141.6 vs. 103.1 days) and in higher quantities (6.15 vs. 4.64 drinks/typical drinking day). High-frequency users were at significantly greater risk for alcohol dependence relative to both non-users (AOR=2.40, 95% CI=1.27-4.56, p=.007) and low-frequency users (AOR=1.86, 95% CI=1.10, 3.14, p=.020), even after holding constant demographics, typical alcohol consumption, fraternity/sorority involvement, depressive symptoms, parental history of alcohol/drug problems, and childhood conduct problems. Low-frequency energy drink users did not differ from non-users on their risk for alcohol dependence. Conclusions Weekly or daily energy drink consumption is strongly associated with alcohol dependence. Further research is warranted to understand the possible mechanisms underlying this association. College students who frequently consume energy drinks represent an important target population for alcohol prevention. PMID:21073486

  17. Temperature and composition dependent density of states extracted using overlapping large polaron tunnelling model in MnxCo1-xFe2O4 (x=0.25, 0.5, 0.75) nanoparticles

    NASA Astrophysics Data System (ADS)

    Jamil, Arifa; Afsar, M. F.; Sher, F.; Rafiq, M. A.

    2017-03-01

    We report detailed ac electrical and structural characterization of manganese cobalt ferrite nanoparticles, prepared by coprecipitation technique. X-ray diffraction (XRD) confirmed single-phase cubic spinel structure of the nanoparticles. Tetrahedral (A) and octahedral (B) group complexes were present in the spinel lattice as determined by Fourier Transform Infrared Spectroscopy (FTIR). Scanning Electron Microscope (SEM) images revealed presence of spherical shape nanoparticles having an average diameter 50-80 nm. Composition, temperature and frequency dependent ac electrical study of prepared nanoparticles interpreted the role of cationic distribution between A and B sites. Overlapping large polaron tunnelling (OLPT) conduction mechanism was observed from 290 to 200 K. Frequency exponent s was fitted theoretically using OLPT model. High values of Density of States (DOS) of the order of 1022-1024 eV-1 cm-3 were extracted from ac conductivity for different compositions. We found that DOS was dependent on distribution of cations in the tunnel-type cavities along the a and b axis.

  18. Characterization of the relationship of the cure cycle chemistry to cure cycle processing properties

    NASA Technical Reports Server (NTRS)

    Kranbuehl, D. E.

    1985-01-01

    Dynamic dielectric analysis (DDA) is used to study curing polymer systems and thermoplastics. Measurements are made over a frequency range of six decades. This wide range of frequencies increases the amount of information which can be obtained. The data is analyzed in terms of the frequency dependence of the complex permittivity epsilon sup *, specific conductivity sigma (ohm/cm) and the relaxation time tau, parameters which are characteristic of the cure state of the material and independent of the size of the sample.

  19. Impedance Spectroscopy and AC Conductivity Studies of Bulk 3-Amino-7-(dimethylamino)-2-methyl-hydrochloride

    NASA Astrophysics Data System (ADS)

    El-Shabaan, M. M.

    2018-02-01

    Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.

  20. Antiferromagnetic resonance excited by oscillating electric currents

    NASA Astrophysics Data System (ADS)

    Sluka, Volker

    2017-12-01

    In antiferromagnetic materials the order parameter exhibits resonant modes at frequencies that can be in the terahertz range, making them interesting components for spintronic devices. Here, it is shown that antiferromagnetic resonance can be excited using the inverse spin-Hall effect in a system consisting of an antiferromagnetic insulator coupled to a normal-metal waveguide. The time-dependent interplay between spin torque, ac spin accumulation, and magnetic degrees of freedom is studied. It is found that the dynamics of the antiferromagnet affects the frequency-dependent conductivity of the normal metal. Further, a comparison is made between spin-current-induced and Oersted-field-induced excitation under the condition of constant power injection.

  1. Computational models of O-LM cells are recruited by low or high theta frequency inputs depending on h-channel distributions

    PubMed Central

    Sekulić, Vladislav; Skinner, Frances K

    2017-01-01

    Although biophysical details of inhibitory neurons are becoming known, it is challenging to map these details onto function. Oriens-lacunosum/moleculare (O-LM) cells are inhibitory cells in the hippocampus that gate information flow, firing while phase-locked to theta rhythms. We build on our existing computational model database of O-LM cells to link model with function. We place our models in high-conductance states and modulate inhibitory inputs at a wide range of frequencies. We find preferred spiking recruitment of models at high (4–9 Hz) or low (2–5 Hz) theta depending on, respectively, the presence or absence of h-channels on their dendrites. This also depends on slow delayed-rectifier potassium channels, and preferred theta ranges shift when h-channels are potentiated by cyclic AMP. Our results suggest that O-LM cells can be differentially recruited by frequency-modulated inputs depending on specific channel types and distributions. This work exposes a strategy for understanding how biophysical characteristics contribute to function. DOI: http://dx.doi.org/10.7554/eLife.22962.001 PMID:28318488

  2. Zinc chloride modified electronic transport and relaxation studies in barium-tellurite glasses

    NASA Astrophysics Data System (ADS)

    Dhankhar, Sunil; Kundu, R. S.; Rani, Sunita; Sharma, Preeti; Murugavel, S.; Punia, Rajesh; Kishore, N.

    2017-09-01

    The ac conductivity of halide based tellurium glasses having composition 70 TeO2-(30-x) BaO-x ZnCl2; x = 5, 10, 15, 20 and 25 has been investigated in the frequency range 10-1 Hz to 105Hz and in the temperature range 453 K to 553 K. The frequency and temperature dependent ac conductivity show mixed behaviour with increase in halide content and found to obey Jonscher's universal power law. The values of dc conductivity, crossover frequency and frequency exponent have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. For determining the conduction mechanism in studied glass system, frequency exponent has been analyzed by various theoretical models. In presently studied glasses, the ac conduction takes place via overlapping large polaron tunneling (OLPT). The values of activation energy for dc conduction (W) and the one associated with relaxation process ( E R) are found to increase with increase in x up to glass sample with x = 15 and thereafter it decrease with increase in zinc chloride content. DC conduction takes place via variable range hopping (VRH) as proposed by Mott with some modification suggested by Punia et al. The value of real part of modulus ( M') is observed to decrease with increase in temperature. The value of stretched exponent (β) obtained from fitting of M'' reveals the presence of non-Debye type of relaxation in presently studied glass samples. Scaling spectra of ac conductivity and values of electric modulus ( M' and M'') collapse into a single master curve for all the compositions and temperatures. The values of relaxation energy ( E R) for all the studied glass compositions are almost equal to W, suggesting that polarons have to overcome same barrier while relaxing and conducting. The conduction and relaxation processes in the studied glass samples are composition and temperature independent. [Figure not available: see fulltext.

  3. ELECTRIC IMPEDANCE OF ASTERIAS EGGS

    PubMed Central

    Cole, Kenneth S.; Cole, Robert H.

    1936-01-01

    The alternating current resistance and capacity of suspensions of unfertilized eggs of Asterias forbesi have been measured at frequencies from one thousand to sixteen million cycles per second. The plasma membrane of the egg has a static capacity of 1.10µf/cm.2 which is practically independent of frequency. The suspensions show a capacity dependent on frequency at low frequencies which may be attributable to surface conductance. The specific resistance of the cytoplasm is between 136 and 225 ohm cm. (4 to 7 times sea water), indicating a relatively high concentration of non-electrolytes. At frequencies above one million cycles there is definite evidence of another element of which the nucleus is presumably a part. PMID:19872951

  4. Tunable reflecting terahertz filter based on chirped metamaterial structure

    PubMed Central

    Yang, Jing; Gong, Cheng; Sun, Lu; Chen, Ping; Lin, Lie; Liu, Weiwei

    2016-01-01

    Tunable reflecting terahertz bandstop filter based on chirped metamaterial structure is demonstrated by numerical simulation. In the metamaterial, the metal bars are concatenated to silicon bars with different lengths. By varying the conductivity of the silicon bars, the reflectivity, central frequency and bandwidth of the metamaterial could be tuned. Light illumination could be introduced to change the conductivity of the silicon bars. Numerical simulations also show that the chirped metamaterial structure is insensitive to the incident angle and polarization-dependent. The proposed chirped metamaterial structure can be operated as a tunable bandstop filter whose modulation depth, bandwidth, shape factor and center frequency can be controlled by light pumping. PMID:27941833

  5. Measurements of the microwave conductivity of the organic superconductor ET2 (IAuI)

    NASA Astrophysics Data System (ADS)

    Tanner, D. B.; Jacobsen, C. S.; Williams, J. M.; Wang, H. H.

    The microwave conductivity of ET2(IAuI), which is superconducting below 4 K, has been measured between 20 and 300 K. The measurements were done by cavity perturbation at 35 GHz for electric field along the highly conducting direction. The samples were in the skin-depth limit. The room temperature conductivity is quite low, approximately 6 mu/cm. With a decrease in temperature the conductivity increases as T sup -2 reaching nearly 900 mu/cm at 20 K. These values are rather close to extrapolations of the frequency-dependent conductivity determined from far-infrared experiments.

  6. Plasmon Excitations of Multi-layer Graphene on a Conducting Substrate

    PubMed Central

    Gumbs, Godfrey; Iurov, Andrii; Wu, Jhao-Ying; Lin, M. F.; Fekete, Paula

    2016-01-01

    We predict the existence of low-frequency nonlocal plasmons at the vacuum-surface interface of a superlattice of N graphene layers interacting with conducting substrate. We derive a dispersion function that incorporates the polarization function of both the graphene monolayers and the semi-infinite electron liquid at whose surface the electrons scatter specularly. We find a surface plasmon-polariton that is not damped by particle-hole excitations or the bulk modes and which separates below the continuum mini-band of bulk plasmon modes. The surface plasmon frequency of the hybrid structure always lies below , the surface plasmon frequency of the conducting substrate. The intensity of this mode depends on the distance of the graphene layers from the conductor’s surface, the energy band gap between valence and conduction bands of graphene monolayer and, most importantly, on the number of two-dimensional layers. For a sufficiently large number of layers the hybrid structure has no surface plasmon. The existence of plasmons with different dispersion relations indicates that quasiparticles with different group velocity may coexist for various ranges of wavelengths determined by the number of layers in the superlattice. PMID:26883086

  7. Electrode effects in dielectric spectroscopy measurements on (Nb+In) co-doped TiO2

    NASA Astrophysics Data System (ADS)

    Crandles, D. A.; Yee, S. M. M.; Savinov, M.; Nuzhnyy, D.; Petzelt, J.; Kamba, S.; Prokeš, J.

    2016-04-01

    Recently, several papers reported the discovery of giant permittivity and low dielectric loss in (Nb+In) co-doped TiO2. A series of tests was performed which included the measurement of the frequency dependence of the dielectric permittivity and alternating current (ac) conductivity of co-doped (Nb+In)TiO2 as a function of electrode type, sample thickness, and temperature. The data suggest that the measurements are strongly affected by the electrodes. The consistency between four-contact van der Pauw direct current conductivity measurements and bulk conductivity values extracted from two-contact ac conductivity measurements suggest that the values of colossal permittivity are, at least in part, a result of Schottky barrier depletion widths that depend on electrode type and temperature.

  8. Electrode effects in dielectric spectroscopy measurements on (Nb +In) co-doped TiO2

    NASA Astrophysics Data System (ADS)

    Crandles, David; Yee, Susan; Savinov, Maxim; Nuzhnyy, Dimitri; Petzelt, Jan; Kamba, Stanislav; Prokes, Jan

    Recently, several papers reported the discovery of giant permittivity and low dielectric loss in (Nb+In) co-doped TiO2. A series of tests was performed which included the measurement of the frequency dependence of the dielectric permittivity and ac conductivity of co-doped (Nb+In)TiO2 as a function of electrode type, sample thickness and temperature. The data suggest that the measurements are strongly affected by the electrodes. The consistency between four contact van der Pauw dc conductivity measurements and bulk conductivity values extracted from two contact ac conductivity measurements suggest that the values of colossal permittivity are, at least in part, a result of Schottky barrier depletion widths that depend on electrode type and temperature. Nserc, Czech Science Foundation (Project 15-08389S).

  9. The effect of milling frequency on a mechanochemical organic reaction monitored by in situ Raman spectroscopy

    PubMed Central

    Julien, Patrick A; Malvestiti, Ivani

    2017-01-01

    We provide the first in situ and real-time study of the effect of milling frequency on the course of a mechanochemical organic reaction conducted using a vibratory shaker (mixer) ball mill. The use of in situ Raman spectroscopy for real-time monitoring of the mechanochemical synthesis of a 2,3-diphenylquinoxaline derivative revealed a pronounced dependence of chemical reactivity on small variations in milling frequency. In particular, in situ measurements revealed the establishment of two different regimes of reaction kinetics at different frequencies, providing tentative insight into processes of mechanical activation in organic mechanochemical synthesis. PMID:29114323

  10. Ionic conductivity and dielectric relaxation in Y doped La2Mo2O9 oxide-ion conductors

    NASA Astrophysics Data System (ADS)

    Paul, T.; Ghosh, A.

    2014-10-01

    In this work, we have studied electrical conductivity and dielectric properties of polycrystalline La2-xYxMo2O9 (0.05 ≤ x ≤ 0.3) compounds in the temperature range from 358 K to 1088 K and the frequency range from 10 Hz to 3 GHz. The bulk and grain boundary contributions to the overall conductivity of these compounds show Arrhenius type behavior at low temperatures. The random free-energy barrier model has been used to analyze the frequency dependence of the conductivity. The charge carrier relaxation time and its activation energy have been determined from the analysis of the conductivity spectra using this model. The results obtained from the random free-energy barrier model satisfy Barton-Nakajima-Namikawa relation. The conduction mechanism has been also predicted using random free-energy barrier model and the scaling formalism. We have observed that the dielectric relaxation peaks arise from the diffusion of oxygen ions via vacancies.

  11. Prevalence and Nature of Hearing Loss in 22q11.2 Deletion Syndrome

    ERIC Educational Resources Information Center

    Van Eynde, Charlotte; Swillen, Ann; Lambeens, Elien; Verhaert, Nicolas; Desloovere, Christian; Luts, Heleen; Vander Poorten, Vincent; Devriendt, Koenraad; Hens, Greet

    2016-01-01

    Purpose: The purpose of this study was to clarify the prevalence, type, severity, and age-dependency of hearing loss in 22q11.2 deletion syndrome. Method: Extensive audiological measurements were conducted in 40 persons with proven 22q11.2 deletion (aged 6-36 years). Besides air and bone conduction thresholds in the frequency range between 0.125…

  12. Sound Speed and Attenuation in Multiphase Media

    DTIC Science & Technology

    2007-09-30

    Number: N00014-04-1-0164 LONG-TERM GOALS One research goal developed from conducted shallow water (SW) acoustic transmission experiments in...code 1 only 14. ABSTRACT One research goal developed from conducted shallow water (SW) acoustic transmission experiments in sandy-silty areas [1...propagation code, such as Kraken [11], or with a poroelastic -parabolic-equation code, Ram, [ 12,13 ] with a depth dependent profiles and frequency

  13. Direction Dependent Effects In Widefield Wideband Full Stokes Radio Imaging

    NASA Astrophysics Data System (ADS)

    Jagannathan, Preshanth; Bhatnagar, Sanjay; Rau, Urvashi; Taylor, Russ

    2015-01-01

    Synthesis imaging in radio astronomy is affected by instrumental and atmospheric effects which introduce direction dependent gains.The antenna power pattern varies both as a function of time and frequency. The broad band time varying nature of the antenna power pattern when not corrected leads to gross errors in full stokes imaging and flux estimation. In this poster we explore the errors that arise in image deconvolution while not accounting for the time and frequency dependence of the antenna power pattern. Simulations were conducted with the wideband full stokes power pattern of the Very Large Array(VLA) antennas to demonstrate the level of errors arising from direction-dependent gains. Our estimate is that these errors will be significant in wide-band full-pol mosaic imaging as well and algorithms to correct these errors will be crucial for many up-coming large area surveys (e.g. VLASS)

  14. Mode-coupling theoretical analysis of transport and relaxation properties of liquid dimethylimidazolium chloride

    NASA Astrophysics Data System (ADS)

    Yamaguchi, T.; Koda, S.

    2010-03-01

    The mode-coupling theory for molecular liquids based on the interaction-site model is applied to a representative molecular ionic liquid, dimethylimidazolium chloride, and dynamic properties such as shear viscosity, self-diffusion coefficients, reorientational relaxation time, electric conductivity, and dielectric relaxation spectrum are analyzed. Molecular dynamics (MD) simulation is also performed on the same system for comparison. The theory captures the characteristics of the dynamics of the ionic liquid qualitatively, although theoretical relaxation times are several times larger than those from the MD simulation. Large relaxations are found in the 100 MHz region in the dispersion of the shear viscosity and the dielectric relaxation, in harmony with various experiments. The relaxations of the self-diffusion coefficients are also found in the same frequency region. The dielectric relaxation spectrum is divided into the contributions of the translational and reorientational modes, and it is demonstrated that the relaxation in the 100 MHz region mainly stems from the translational modes. The zero-frequency electric conductivity is close to the value predicted by the Nernst-Einstein equation in both MD simulation and theoretical calculation. However, the frequency dependence of the electric conductivity is different from those of self-diffusion coefficients in that the former is smaller than the latter in the gigahertz-terahertz region, which is compensated by the smaller dispersion of the former in the 100 MHz region. The analysis of the theoretical calculation shows that the difference in their frequency dependence is due to the different contribution of the short- and long-range liquid structures.

  15. Nonlocal electrodynamics in Weyl semimetals

    NASA Astrophysics Data System (ADS)

    Rosenstein, B.; Kao, H. C.; Lewkowicz, M.

    2017-02-01

    Recently synthesized three-dimensional materials with Dirac spectrum exhibit peculiar electric transport qualitatively different from its two-dimensional analog, graphene. By neglecting impurity scattering, the real part of the conductivity is strongly frequency dependent, while the imaginary part is nonzero unlike in undoped, clean graphene. The Coulomb interaction between electrons is unscreened as in a dielectric and hence is long range. We demonstrate that the interaction correction renders the electrodynamics nonlocal on a mesoscopic scale. The longitudinal conductivity σL and the transverse conductivity σT are different in the long-wavelength limit and consequently the standard local Ohm's law description does not apply. This leads to several remarkable effects in optical response. The p -polarized light generates in these materials bulk plasmons as well as the transversal waves. At a specific frequency the two modes coincide, a phenomenon impossible in a local medium. For any frequency there is a Brewster angle where total absorption occurs, turning the Weyl semimetals opaque. The effect of the surface, including the Fermi arcs, is discussed.

  16. Grain boundary-dominated electrical conduction and anomalous optical-phonon behaviour near the Neel temperature in YFeO3 ceramics

    NASA Astrophysics Data System (ADS)

    Raut, Subhajit; Babu, P. D.; Sharma, R. K.; Pattanayak, Ranjit; Panigrahi, Simanchalo

    2018-05-01

    We investigated the anomalous behaviour in the dielectric properties, occurring nearly at room temperature and at elevated temperatures (near the Neel temperature TN) of the polycrystalline samples of YFeO3 (YFO) ceramics. On the prepared YFO ceramics, the magnetic measurements showed the Neel temperature of YFO to be 650 K, below which the compound exhibited the weak ferromagnetic behaviour. X-ray photoelectron spectroscopy (XPS) shows the presence of Fe ions (Fe2+ and Fe3+ states) and also revealed the formation of the oxygen vacancies. The frequency dependence of the complex dielectric constant within the frequency domain of 100 Hz-1 MHz shows the presence of grain dominated dielectric relaxation over the thermal window of 300-373 K. The activation energy Eact.ɛ=0.611 eV extracted from the imaginary permittivity spectrum indicates the involvement of oxygen vacancies in the relaxation process. Above 493 K, the ac conductivity, complex impedance, and modulus studies revealed appreciable conduction and relaxation processes occurring in YFO ceramics with respective activation energies Eac t . σ=1.362 eV and Eac t . Z=1.345 eV , which suggests that the oxygen vacancies are also involved for the anomalous behaviour of the dielectric constant at elevated temperatures. The temperature dependent Raman spectroscopic measurements within the thermal window of 298-698 K showed anomalous variations of the line widths and frequencies of several Raman active modes above 473 K up to the vicinity of TN pointing towards the presence of admixtures of the electron-phonon and spin-phonon coupling in the system. A further study on the thermal variation of the B2g(4) mode frequency with [M(T)/MS]2 shows the occurrence of strong spin-phonon (s-p) coupling, while the line shape shows the presence of the Fano asymmetry, suggesting spin dependent electron-phonon (e-p) coupling in the system below TN.

  17. On the relation between the peak frequency and the corresponding rise time of solar microwave impulsive bursts and the height dependence of magnetic fields

    NASA Astrophysics Data System (ADS)

    Ren-Yang, Zhao; Magun, Andreas; Schanda, Erwin

    1990-12-01

    In the present paper we report the results of a correlation analysis for 57 microwave impulsive bursts observed at six frequencies in which we have obtained a regression line between the peak frequency and the corresponding rise time of microwave impulsive bursts: {ie361-01} (with a correlation coefficient of - 0.43). This can be explained in the frame of a thermal model. The magnetic field decrease with height has to be much slower than in a dipole field in order to explain the weak dependence of f p on t r . This decrease of magnetic field with height in burst sources is based on the relationship between f p and t r found by assuming a thermal flare model with a collisionless conduction front.

  18. Polaron conductivity mechanism in oxalic acid dihydrate: ac conductivity experiment

    NASA Astrophysics Data System (ADS)

    Levstik, Adrijan; Filipič, Cene; Bobnar, Vid; Levstik, Iva; Hadži, Dušan

    2006-10-01

    The ac electrical conductivity of the oxalic acid dihydrate ( α -POX) was investigated as a function of the frequency and temperature. The real part of the complex ac electrical conductivity was found to follow the universal dielectric response σ'∝νs , indicating that hopping or tunneling of localized charge carriers governs the electrical transport. A detailed analysis of the temperature dependence of the exponent s revealed that in a broad temperature range 50-200K the tunneling of polarons is the dominating charge transport mechanism.

  19. Viscoelastic Properties, Ionic Conductivity, and Materials Design Considerations for Poly(styrene-b-ethylene oxide-b-styrene)-Based Ion Gel Electrolytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Sipei; Lee, Keun Hyung; Sun, Jingru

    2013-03-07

    The viscoelastic properties and ionic conductivity of ion gels based on the self-assembly of a poly(styrene-b-ethylene oxide-b-styrene) (SOS) triblock copolymer (M{sub n,S} = 3 kDa, M{sub n,O} = 35 kDa) in the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)amide ([EMI][TFSA]) were investigated over the composition range of 10-50 wt % SOS and the temperature range of 25-160 C. The poly(styrene) (PS) end-blocks associate into micelles, whereas the poly(ethylene oxide) (PEO) midblocks are well-solvated by this ionic liquid. The ion gel with 10 wt % SOS melts at 54 C, with the longest relaxation time exhibiting a similar temperature dependence to that of themore » viscosity of bulk PS. However, the actual values of the gel relaxation time are more than 4 orders of magnitude larger than the relaxation time of bulk PS. This is attributed to the thermodynamic penalty of pulling PS end-blocks through the PEO/[EMI][TFSA] matrix. Ion gels with 20-50 wt % SOS do not melt and show two plateaus in the storage modulus over the temperature and frequency ranges measured. The one at higher frequencies is that of an entangled network of PEO strands with PS cross-links; the modulus displays a quadratic dependence on polymer weight fraction and agrees with the prediction of linear viscoelastic theory assuming half of the PEO chains are elastically effective. The frequency that separates the two plateaus, {omega}{sub c}, reflects the time scale of PS end-block pull-out. The other plateau at lower frequencies is that of a congested micelle solution with PS cores and PEO coronas, which has a power law dependence on domain spacing similar to diblock melts. The ionic conductivity of the ion gels is compared to PEO homopolymer solutions at similar polymer concentrations; the conductivity is reduced by a factor of 2.1 or less, decreases with increasing PS volume fraction, and follows predictions based on a simple obstruction model. Our collective results allow the formulation of basic design considerations for optimizing the mechanical properties, thermal stability, and ionic conductivity of these gels.« less

  20. Charge carrier dynamics in PMMA-LiClO4 based polymer electrolytes plasticized with different plasticizers

    NASA Astrophysics Data System (ADS)

    Pal, P.; Ghosh, A.

    2017-07-01

    We have studied the charge carrier dynamics in poly(methylmethacrylate)-LiClO4 polymer electrolytes plasticized with different plasticizers such as ethylene carbonate (EC), propylene carbonate (PC), polyethylene glycol (PEG), and dimethyl carbonate (DMC). We have measured the broadband complex conductivity spectra of these electrolytes in the frequency range of 0.01 Hz-3 GHz and in the temperature range of 203 K-363 K and analyzed the conductivity spectra in the framework of the random barrier model by taking into account the contribution of the electrode polarization observed at low frequencies and/or at high temperatures. It is observed that the temperature dependences of the ionic conductivity and relaxation time follow the Vogel-Tammann-Fulcher relation for all plasticized electrolytes. We have also performed the scaling of the conductivity spectra, which indicates that the charge carrier dynamics is almost independent of temperature and plasticizers in a limited frequency range. The existence of nearly constant loss in these electrolytes has been observed at low temperatures and/or high frequencies. We have studied the dielectric relaxation in these electrolytes using electric modulus formalism and obtained the stretched exponent and the decay function. We have observed less cooperative ion dynamics in electrolytes plasticized with DMC compared to electrolytes plasticized with EC, PC, and PEG.

  1. Analysis of electronic parameters and frequency-dependent properties of Au/NiO/ n-GaN heterojunctions

    NASA Astrophysics Data System (ADS)

    Reddy, Varra Niteesh; Padma, R.; Gunasekhar, K. R.

    2018-01-01

    The electrical and frequency-dependent properties of ten Au/NiO/ n-GaN heterojunctions fabricated with similar conditions are assessed by I-V, C-V, and G-V measurement methods. In addition, C-f and G-f measurements are conducted in the frequency range of 1 kHz-1 MHz. The electronic parameters are changed from junction to junction even if they are fabricated in the similar way. The calculated barrier height and ideality factor values are fitted by the Gaussian distribution function. Statistical analysis of the data provides the mean barrier height and ideality factor values of 0.84 eV and 2.70 for the heterojunction. Besides, the mean barrier height ( V b), donor concentration ( N d), space charge layer width ( W D), and Fermi level ( E F) are determined from the C-V data and the corresponding values are 1.30 eV, 2.00 × 1017 cm-3, 8.222 × 10-6 cm, and 0.018 eV, respectively. The interface state density ( N SS) and relaxation time (τ) are assessed from C-f and G-f measurements. Moreover, the dielectric constant ( ɛ'), dielectric loss ( ɛ″), tangent loss (tan δ), and electrical conductivity ( σ ac) are determined from C-f and G-f data in the frequency range of 1 kHz-1 MHz with various biases (0.1-0.6 V). ɛ' and ɛ″ are decreased with increasing frequency.

  2. Electrical transport in lead-free (Na0.5Bi0.5)1-xSrxTiO3 ceramics (x = 0, 0.01 and 0.02)

    NASA Astrophysics Data System (ADS)

    Dutkiewicz, E. M.; Suchanicz, J.; Konieczny, K.; Czaja, P.; Kluczewska, K.; Czternastek, H.; Antonova, M.; Sternberg, A.

    2017-09-01

    Lead-free (Na0.5Bi0.5)1xSrxTiO3 (x = 0, 0.01 and 0.02) ceramics were manufactured through a solid-state mixed oxide method and their ac (σac) and dc (σdc) electric conductivity were studied. It is shown that the low-frequency (100 Hz-1 MHz) ac conductivity obeys a power law σac ∼ ωs characteristic for disordered materials. Both the dc and ac conductivities have thermally activated character and possess linear parts with different activation energies. The calculated activation energies are attributed to different mechanism of conductivity. Frequency dependence of σdc and exponent s is reasonably interpreted by a correlated barrier hopping model. The NBT-ST system is expected to be a new promising candidate for lead-free electronic materials.

  3. Electrical conductivity studies in (Ag3AsS3)x(As2S3)1-x superionic glasses and composites

    NASA Astrophysics Data System (ADS)

    Studenyak, I. P.; Neimet, Yu. Yu.; Kranjčec, M.; Solomon, A. M.; Orliukas, A. F.; Kežionis, A.; Kazakevičius, E.; Šalkus, T.

    2014-01-01

    Compositional, frequency, and temperature studies of impedance and electrical conductivity in (Ag3AsS3)x(As2S3)1-x superionic glasses and composites were performed. Frequency range from 10 Hz to 3 × 109 Hz and temperature interval 300-400 K were used for the measurements. Compositional dependences of electrical conductivity and activation energy are analyzed; the most substantial changes are observed with the transition from (Ag3AsS3)0.4(As2S3)0.6 glass to (Ag3AsS3)0.5(As2S3)0.5 composite. With increase of Ag3AsS3 content, the investigated materials are found to have crystalline inclusions and show the two-phase composite nature. Addition of Ag3AsS3 leads to the increase of electrical conductivity whereas the activation energy decreases.

  4. Comparative studies of the structure, morphology and electrical conductivity of polyaniline weakly doped with chlorocarboxylic acids

    NASA Astrophysics Data System (ADS)

    Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif

    2007-08-01

    We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.

  5. 3-D decoupled inversion of complex conductivity data in the real number domain

    NASA Astrophysics Data System (ADS)

    Johnson, Timothy C.; Thomle, Jonathan

    2018-01-01

    Complex conductivity imaging (also called induced polarization imaging or spectral induced polarization imaging when conducted at multiple frequencies) involves estimating the frequency-dependent complex electrical conductivity distribution of the subsurface. The superior diagnostic capabilities provided by complex conductivity spectra have driven advancements in mechanistic understanding of complex conductivity as well as modelling and inversion approaches over the past several decades. In this work, we demonstrate the theory and application for an approach to 3-D modelling and inversion of complex conductivity data in the real number domain. Beginning from first principles, we demonstrate how the equations for the real and imaginary components of the complex potential may be decoupled. This leads to a description of the real and imaginary source current terms, and a corresponding assessment of error arising from an assumption necessary to complete the decoupled modelling. We show that for most earth materials, which exhibit relatively small phases (e.g. less than 0.2 radians) in complex conductivity, these errors become insignificant. For higher phase materials, the errors may be quantified and corrected through an iterative procedure. We demonstrate the accuracy of numerical forward solutions by direct comparison to corresponding analytic solutions. We demonstrate the inversion using both synthetic and field examples with data collected over a waste infiltration trench, at frequencies ranging from 0.5 to 7.5 Hz.

  6. Investigation of Laser Parameters in Silicon Pulsed Laser Conduction Welding

    NASA Astrophysics Data System (ADS)

    Shayganmanesh, Mahdi; Khoshnoud, Afsaneh

    2016-03-01

    In this paper, laser welding of silicon in conduction mode is investigated numerically. In this study, the effects of laser beam characteristics on the welding have been studied. In order to model the welding process, heat conduction equation is solved numerically and laser beam energy is considered as a boundary condition. Time depended heat conduction equation is used in our calculations to model pulsed laser welding. Thermo-physical and optical properties of the material are considered to be temperature dependent in our calculations. Effects of spatial and temporal laser beam parameters such as laser beam spot size, laser beam quality, laser beam polarization, laser incident angle, laser pulse energy, laser pulse width, pulse repetition frequency and welding speed on the welding characteristics are assessed. The results show that how the temperature dependent thermo-physical and optical parameters of the material are important in laser welding modeling. Also the results show how the parameters of the laser beam influence the welding characteristics.

  7. On the room temperature multiferroic BiFeO3: magnetic, dielectric and thermal properties

    NASA Astrophysics Data System (ADS)

    Lu, J.; Günther, A.; Schrettle, F.; Mayr, F.; Krohns, S.; Lunkenheimer, P.; Pimenov, A.; Travkin, V. D.; Mukhin, A. A.; Loidl, A.

    2010-06-01

    Magnetic dc susceptibility between 1.5 and 800 K, ac susceptibility and magnetization, thermodynamic properties, temperature dependence of radio and audio-wave dielectric constants and conductivity, contact-free dielectric constants at mm-wavelengths, as well as ferroelectric polarization are reported for single crystalline BiFeO3. A well developed anomaly in the magnetic susceptibility signals the onset of antiferromagnetic order close to 635 K. Beside this anomaly no further indications of phase or glass transitions are indicated in the magnetic dc and ac susceptibilities down to the lowest temperatures. The heat capacity has been measured from 2 K up to room temperature and significant contributions from magnon excitations have been detected. From the low-temperature heat capacity an anisotropy gap of the magnon modes of the order of 6 meV has been determined. The dielectric constants measured in standard two-point configuration are dominated by Maxwell-Wagner like effects for temperatures T > 300 K and frequencies below 1 MHz. At lower temperatures the temperature dependence of the dielectric constant and loss reveals no anomalies outside the experimental errors, indicating neither phase transitions nor strong spin phonon coupling. The temperature dependence of the dielectric constant was measured contact free at microwave frequencies. At room temperature the dielectric constant has an intrinsic value of 53. The loss is substantial and strongly frequency dependent indicating the predominance of hopping conductivity. Finally, in small thin samples we were able to measure the ferroelectric polarization between 10 and 200 K. The saturation polarization is of the order of 40 μC/cm2, comparable to reports in literature.

  8. Frequency Dependent Electrical and Dielectric Properties of Au/P3HT:PCBM:F4-TCNQ/n-Si Schottky Barrier Diode

    NASA Astrophysics Data System (ADS)

    Taşçıoğlu, İ.; Tüzün Özmen, Ö.; Şağban, H. M.; Yağlıoğlu, E.; Altındal, Ş.

    2017-04-01

    In this study, poly(3-hexylthiophene):[6,6]-phenyl-C61-butyric acid methyl ester: 2,3,5,6-tetrafluoro-7,7,8,8-tetracyanoquinodimethane (P3HT:PCBM:F4-TCNQ) organic film was deposited on n-type silicon (n-Si) substrate by spin coating method. The electrical and dielectric analysis of Au/P3HT:PCBM:F4-TCNQ/n-Si Schottky barrier diode was conducted by means of capacitance-voltage ( C- V) and conductance-voltage ( G/ ω- V) measurements in the frequency range of 10 kHz-2 MHz. The C- V- f plots exhibit fairly large frequency dispersion due to excess capacitance caused by the presence of interface states ( N ss). The values of N ss located in semiconductor bandgap at the organic film/semiconductor interface were calculated by Hill-Coleman method. Experimental results show that dielectric constant ( ɛ') and dielectric loss ( ɛ″) decrease with increasing frequency, whereas loss tangent (tan δ) remains nearly the same. The decrease in ɛ' and ɛ″ was interpreted by the theory of dielectric relaxation due to interfacial polarization. It is also observed that ac electrical conductivity ( σ ac) and electric modulus ( M' and M″) increase with increasing frequency.

  9. Correlation of the impedance and effective electrode area of doped PEDOT modified electrodes for brain-machine interfaces.

    PubMed

    Harris, Alexander R; Molino, Paul J; Kapsa, Robert M I; Clark, Graeme M; Paolini, Antonio G; Wallace, Gordon G

    2015-05-07

    Electrode impedance is used to assess the thermal noise and signal-to-noise ratio for brain-machine interfaces. An intermediate frequency of 1 kHz is typically measured, although other frequencies may be better predictors of device performance. PEDOT-PSS, PEDOT-DBSA and PEDOT-pTs conducting polymer modified electrodes have reduced impedance at 1 kHz compared to bare metal electrodes, but have no correlation with the effective electrode area. Analytical solutions to impedance indicate that all low-intermediate frequencies can be used to compare the electrode area at a series RC circuit, typical of an ideal metal electrode in a conductive solution. More complex equivalent circuits can be used for the modified electrodes, with a simplified Randles circuit applied to PEDOT-PSS and PEDOT-pTs and a Randles circuit including a Warburg impedance element for PEDOT-DBSA at 0 V. The impedance and phase angle at low frequencies using both equivalent circuit models is dependent on the electrode area. Low frequencies may therefore provide better predictions of the thermal noise and signal-to-noise ratio at modified electrodes. The coefficient of variation of the PEDOT-pTs impedance at low frequencies was lower than the other conducting polymers, consistent with linear and steady-state electroactive area measurements. There are poor correlations between the impedance and the charge density as they are not ideal metal electrodes.

  10. High Thermal Conductivity of Copper Matrix Composite Coatings with Highly-Aligned Graphite Nanoplatelets

    PubMed Central

    Tagliaferri, Vincenzo; Ucciardello, Nadia

    2017-01-01

    Nanocomposite coatings with highly-aligned graphite nanoplatelets in a copper matrix were successfully fabricated by electrodeposition. For the first time, the disposition and thermal conductivity of the nanofiller has been evaluated. The degree of alignment and inclination of the filling materials has been quantitatively evaluated by polarized micro-Raman spectroscopy. The room temperature values of the thermal conductivity were extracted for the graphite nanoplatelets by the dependence of the Raman G-peak frequency on the laser power excitation. Temperature dependency of the G-peak shift has been also measured. Most remarkable is the global thermal conductivity of 640 ± 20 W·m−1·K−1 (+57% of copper) obtained for the composite coating by the flash method. Our experimental results are accounted for by an effective medium approximation (EMA) model that considers the influence of filler geometry, orientation, and thermal conductivity inside a copper matrix. PMID:29068424

  11. In-situ analysis of microwave conductivity and impedance spectroscopy for evaluation of charge carrier dynamics at interfaces

    NASA Astrophysics Data System (ADS)

    Choi, Wookjin; Inoue, Junichi; Tsutsui, Yusuke; Sakurai, Tsuneaki; Seki, Shu

    2017-11-01

    A unique concerted analysis comprising non-contact microwave conductivity measurements and impedance spectroscopy was developed to simultaneously assess the charge carrier mobility and injection barriers. The frequency dependence of the microwave conductivity as well as the electrical current was analyzed by applying sinusoidal voltage to determine the equivalent circuit parameters. Based on the temperature dependence of the circuit parameters, the energy of the injection barrier was estimated to be 0.4 eV with the Richardson-Schottky model, and the band-like transport was confirmed with the negative temperature coefficient with the β value of 1.4 in the intra-layer conduction of C8-BTBT. In contrast, the increase in the resistance of the C8-BTBT layer with decreasing temperature implied the occurrence of hopping-like transport in the inter-layer conduction of C8-BTBT.

  12. Migration of dispersive GPR data

    USGS Publications Warehouse

    Powers, M.H.; Oden, C.P.; ,

    2004-01-01

    Electrical conductivity and dielectric and magnetic relaxation phenomena cause electromagnetic propagation to be dispersive in earth materials. Both velocity and attenuation may vary with frequency, depending on the frequency content of the propagating energy and the nature of the relaxation phenomena. A minor amount of velocity dispersion is associated with high attenuation. For this reason, measuring effects of velocity dispersion in ground penetrating radar (GPR) data is difficult. With a dispersive forward model, GPR responses to propagation through materials with known frequency-dependent properties have been created. These responses are used as test data for migration algorithms that have been modified to handle specific aspects of dispersive media. When either Stolt or Gazdag migration methods are modified to correct for just velocity dispersion, the results are little changed from standard migration. For nondispersive propagating wavefield data, like deep seismic, ensuring correct phase summation in a migration algorithm is more important than correctly handling amplitude. However, the results of migrating model responses to dispersive media with modified algorithms indicate that, in this case, correcting for frequency-dependent amplitude loss has a much greater effect on the result than correcting for proper phase summation. A modified migration is only effective when it includes attenuation recovery, performing deconvolution and migration simultaneously.

  13. Level of Automation and Failure Frequency Effects on Simulated Lunar Lander Performance

    NASA Technical Reports Server (NTRS)

    Marquez, Jessica J.; Ramirez, Margarita

    2014-01-01

    A human-in-the-loop experiment was conducted at the NASA Ames Research Center Vertical Motion Simulator, where instrument-rated pilots completed a simulated terminal descent phase of a lunar landing. Ten pilots participated in a 2 x 2 mixed design experiment, with level of automation as the within-subjects factor and failure frequency as the between subjects factor. The two evaluated levels of automation were high (fully automated landing) and low (manual controlled landing). During test trials, participants were exposed to either a high number of failures (75% failure frequency) or low number of failures (25% failure frequency). In order to investigate the pilots' sensitivity to changes in levels of automation and failure frequency, the dependent measure selected for this experiment was accuracy of failure diagnosis, from which D Prime and Decision Criterion were derived. For each of the dependent measures, no significant difference was found for level of automation and no significant interaction was detected between level of automation and failure frequency. A significant effect was identified for failure frequency suggesting failure frequency has a significant effect on pilots' sensitivity to failure detection and diagnosis. Participants were more likely to correctly identify and diagnose failures if they experienced the higher levels of failures, regardless of level of automation

  14. Ultrasonic attenuation and velocity in AS/3501-6 graphite/epoxy fiber composite

    NASA Technical Reports Server (NTRS)

    Williams, J. H., Jr.; Nayebhashemi, H.; Lee, S. S.

    1979-01-01

    The ultrasonic group velocity and attenuation were measured as a function of frequency for longitudinal and shear waves in the epoxy matrix (3501-6) and in the principal directions of the unidirectional graphite/epoxy composite (AS/3501-6). Tests were conducted in the frequency ranges 0.25 Mz to 14 MHz and 0.5 Mz to 3 MHz for longitudinal and shear wave modes, respectively. The attenuation increased with frequency for all wave modes, but the group velocity was independent of frequency for all wave modes. The effects of pressure and couplant at the transducer-specimen interface were studied and it was found that for each transducer type there exists a frequency dependent 'saturation pressure' corresponding to the maximum output signal amplitude.

  15. The effect of stress on ultrasonic pulses in fiber reinforced composites

    NASA Technical Reports Server (NTRS)

    Hemann, J. H.; Baaklini, G. Y.

    1983-01-01

    An acoustical-ultrasonic technique was used to demonstrate relationships existing between changes in attenuation of stress waves and tensile stress for an eight ply 0 degree graphite-epoxy fiber reinforced composite. All tests were conducted in the linear range of the material for which no mechanical or macroscopic damage was evident. Changes in attenuation were measured as a function of tensile stress in the frequency domain and in the time domain. Stress wave propagation in these specimens was dispersive, i.e., the wave speed depends on frequency. Wave speeds varied from 267 400 cm/sec to 680 000 cm/sec as the frequency of the signal was varied from 150 kHz to 1.9 MHz which strongly suggests that flexural/lamb wave modes of propagation exist. The magnitude of the attenuation changes depended strongly on tensile stress. It was further observed that the wave speeds increased slightly for all tested frequencies as the stress was increased.

  16. Inward rectifier potassium current IKir promotes intrinsic pacemaker activity of thalamocortical neurons.

    PubMed

    Amarillo, Yimy; Tissone, Angela I; Mato, Germán; Nadal, Marcela S

    2018-06-01

    Slow repetitive burst firing by hyperpolarized thalamocortical (TC) neurons correlates with global slow rhythms (<4 Hz), which are the physiological oscillations during non-rapid eye movement sleep or pathological oscillations during idiopathic epilepsy. The pacemaker activity of TC neurons depends on the expression of several subthreshold conductances, which are modulated in a behaviorally dependent manner. Here we show that upregulation of the small and neglected inward rectifier potassium current I Kir induces repetitive burst firing at slow and delta frequency bands. We demonstrate this in mouse TC neurons in brain slices by manipulating the Kir maximum conductance with dynamic clamp. We also performed a thorough theoretical analysis that explains how the unique properties of I Kir enable this current to induce slow periodic bursting in TC neurons. We describe a new ionic mechanism based on the voltage- and time-dependent interaction of I Kir and hyperpolarization-activated cationic current I h that endows TC neurons with the ability to oscillate spontaneously at very low frequencies, even below 0.5 Hz. Bifurcation analysis of conductance-based models of increasing complexity demonstrates that I Kir induces bistability of the membrane potential at the same time that it induces sustained oscillations in combination with I h and increases the robustness of low threshold-activated calcium current I T -mediated oscillations. NEW & NOTEWORTHY The strong inwardly rectifying potassium current I Kir of thalamocortical neurons displays a region of negative slope conductance in the current-voltage relationship that generates potassium currents activated by hyperpolarization. Bifurcation analysis shows that I Kir induces bistability of the membrane potential; generates sustained subthreshold oscillations by interacting with the hyperpolarization-activated cationic current I h ; and increases the robustness of oscillations mediated by the low threshold-activated calcium current I T . Upregulation of I Kir in thalamocortical neurons induces repetitive burst firing at slow and delta frequency bands (<4 Hz).

  17. Low-frequency dynamic response of the bismuth strontium ferrite (Bi,Sr)FeO3- x

    NASA Astrophysics Data System (ADS)

    Pronin, A. A.; Torgashev, V. I.; Bush, A. A.; Gorshunov, B. P.; Volkov, A. A.; Prokhorov, A. S.

    2009-03-01

    Broad-range measurements of the dynamic response of polycrystalline samples of the (Bi,Sr)FeO3- x perovskite-like solid solution are performed over a frequency range from 10 Hz to 1 GHz at temperatures of 100-300 K for the first time. The colossal dielectric constant effect and the influence of electric contacts on the results of measurements are considered. It is shown that the frequency dependences of the permittivity and dynamic conductivity of (Bi,Sr)FeO3- x samples can be described within the universal dielectric response model.

  18. Dielectric and impedance study of praseodymium substituted Mg-based spinel ferrites

    NASA Astrophysics Data System (ADS)

    Farid, Hafiz Muhammad Tahir; Ahmad, Ishtiaq; Ali, Irshad; Ramay, Shahid M.; Mahmood, Asif; Murtaza, G.

    2017-07-01

    Spinel ferrites with nominal composition MgPryFe2-yO4 (y = 0.00, 0.025, 0.05, 0.075, 0.10) were prepared by sol-gel method. Temperature dependent DC electrical conductivity and drift mobility were found in good agreement with each other, reflecting semiconducting behavior. The dielectric properties of all the samples as a function of frequency (1 MHz-3 GHz) were measured at room temperature. The dielectric constant and complex dielectric constant of these samples decreased with the increase of praseodymium concentration. In the present spinel ferrite, Cole-Cole plots were used to separate the grain and grain boundary's effects. The substitution of praseodymium ions in Mg-based spinel ferrites leads to a remarkable rise of grain boundary's resistance as compared to the grain's resistance. As both AC conductivity and Cole-Cole plots are the functions of concentration, they reveal the dominant contribution of grain boundaries in the conduction mechanism. AC activation energy was lower than dc activation energy. Temperature dependence normalized AC susceptibility of spinel ferrites reveals that MgFe2O4 exhibits multi domain (MD) structure with high Curie temperature while on substitution of praseodymium, MD to SD transitions occurs. The low values of conductivity and low dielectric loss make these materials best candidate for high frequency application.

  19. Ultrafast modulation of the plasma frequency of vertically aligned indium tin oxide rods.

    PubMed

    Tice, Daniel B; Li, Shi-Qiang; Tagliazucchi, Mario; Buchholz, D Bruce; Weiss, Emily A; Chang, Robert P H

    2014-03-12

    Light-matter interaction at the nanoscale is of particular interest for future photonic integrated circuits and devices with applications ranging from communication to sensing and imaging. In this Letter a combination of transient absorption (TA) and the use of third harmonic generation as a probe (THG-probe) has been adopted to investigate the response of the localized surface plasmon resonances (LSPRs) of vertically aligned indium tin oxide rods (ITORs) upon ultraviolet light (UV) excitation. TA experiments, which are sensitive to the extinction of the LSPR, show a fluence-dependent increase in the frequency and intensity of the LSPR. The THG-probe experiments show a fluence-dependent decrease of the LSPR-enhanced local electric field intensity within the rod, consistent with a shift of the LSPR to higher frequency. The kinetics from both TA and THG-probe experiments are found to be independent of the fluence of the pump. These results indicate that UV excitation modulates the plasma frequency of ITO on the ultrafast time scale by the injection of electrons into, and their subsequent decay from, the conduction band of the rods. Increases to the electron concentration in the conduction band of ∼13% were achieved in these experiments. Computer simulation and modeling have been used throughout the investigation to guide the design of the experiments and to map the electric field distribution around the rods for interpreting far-field measurement results.

  20. Food deprivation and prior anoxic coma have opposite effects on the activity of a visual interneuron in the locust.

    PubMed

    Cross, Kevin P; Britton, Samantha; Mangulins, Rebecca; Money, Tomas G A; Robertson, R Meldrum

    2017-04-01

    We compared how different metabolic stressors, anoxic coma and food deprivation, affected signaling in neural tissue. We used the locust's Descending Contralateral Movement Detector (DCMD) interneuron because its large axon, high firing frequencies, and rapid conduction velocity make it energetically expensive. We exposed locusts to a 30min anoxic coma or 1day of food deprivation and found contrasting effects on signaling within the axon. After a prior anoxic coma, the DCMD fired fewer high-frequency (>200Hz) action potentials (APs) (Control: 12.4±1.6; Coma: 6.3±0.9) with a reduction in axonal conduction velocity (CV) at all frequencies (∼4-8%) when presented with a standard looming visual stimulus. Prior anoxic coma was also associated with a loss of supernormal conduction by reducing both the number of supernormal APs and the firing frequency with the highest CV. Initially, food deprivation caused a significant increase in the number of low- and high-frequency APs with no differences observed in CV. After controlling for isolation, food deprivation resulted in an increase in high-frequency APs (>200Hz: Control: 17.1±1.7; Food-deprived: 19.9±1.3) and an increase in relative conduction velocity for frequencies >150Hz (∼2%). Action potentials of food-deprived animals had a smaller half-width (Control: 0.45±0.02ms; Food-deprived: 0.40±0.01ms) and decay time (Control: 0.62±0.03ms; Food-deprived: 0.54±0.02ms). Our data indicate that the effects of metabolic stress on neural signaling can be stressor-dependent. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Ground EMI: designing the future trends in shallow depth surveying

    NASA Astrophysics Data System (ADS)

    Thiesson, J.; Schamper, C.; Simon, F. X.; Tabbagh, A.

    2017-12-01

    In theory, electromagnetic induction phenomena are driven by three fundamental properties (conductivity, susceptibility, permittivity). Since the 1930's, the developments of EMI prospecting were based on assumptions (Low frequency VS High frequency, low/high induction number). The design of the devices was focused on specific aims (diffusive/propagative, mapping/sounding) and, in the last thirty years the progressive transition from analog to numeric electronics completely enhanced the potency of measurements (multi-channeling, automatic positioning) a) as it did in model computation. In the field of metric sized devices for lower depths of investigation, the measurements have been first restricted to electrical conductivity. However, the measurement of the magnetic susceptibility proved to be possible thanks to in phase and quadrature separation, and the last developed commercially available multi-frequency and/or multi-receivers devices permit, thanks to accurate calibration, the measurements of the three properties with various geometries or frequencies simultaneously. The aims of this study is to present theoretical results in order to give hints for designing a device which can be optimal to evaluate the three properties and their frequency dependence.

  2. On the correct choice of equivalent circuit for fitting bulk impedance data of ionic/electronic conductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hernández, Miguel A.; Masó, Nahum; West, Anthony R.

    Bulk conductivity data of ionically and electronically conducting solid electrolytes and electronic ceramics invariably show a frequency dependence that cannot be modelled by a single-valued resistor. To model this, common practice is to add a constant phase element (CPE) in parallel with the bulk resistance. To fit experimental data on a wide variety of materials, however, it is also essential to include the limiting, high frequency permittivity of the material in the equivalent circuit. Failure to do so can lead to incorrect values for the sample resistance and CPE parameters and to an inappropriate circuit for materials that are electricallymore » heterogeneous.« less

  3. A finite element model of the human head for auditory bone conduction simulation.

    PubMed

    Taschke, Henning; Hudde, Herbert

    2006-01-01

    In order to investigate the mechanisms of bone conduction, a finite element model of the human head was developed. The most important steps of the modelling process are described. The model was excited by means of percutaneously applied forces in order to get a deeper insight into the way the parts of the peripheral hearing organ and the surrounding tissue vibrate. The analysis is done based on the division of the bone conduction mechanisms into components. The frequency-dependent patterns of vibration of the components are analyzed. Furthermore, the model allows for the calculation of the contribution of each component to the overall bone-conducted sound. The components interact in a complicated way, which strongly depends on the nature of the excitation and the spatial region to which it is applied.

  4. Ac conductivity and dielectric properties of bulk tin phthalocyanine dichloride (SnPcCl 2)

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Farid, A. M.; Abd El-Rahman, K. F.; Ali, H. A. M.

    2008-07-01

    The ac conductivity, σac( ω), has been measured for bulk tin phthalocyanine dichloride (SnPcCl 2) in the form of compressed pellet with evaporated ohmic Au electrodes in a temperature range 303-403 K. Ac conductivity, σac( ω), is found to vary as ωs in the frequency range 42 Hz-5×10 6 Hz. At low range of frequency, s<1 and it decreases with the increase in temperature indicating a dominant hopping process. At high range of frequency, s is found to be equal to ≈1.09 and is temperature independent. The dielectric constant, ε1, and dialectic loss, ε2, have been determined for bulk SnPcCl 2. Both ε1 and ε2 decrease with the increase in frequency and increase with the increase in temperature. The Cole-Cole types have been used to determine some parameters such as; the macroscopic relaxation time ( τo), the molecular relaxation time ( τ), the activation energy for relaxation ( Eo) and the distribution parameter ( α). The temperature dependence of τ is expressed by a thermally activated process with the activation energy of 0.299 eV.

  5. Age, cognitive style, and traffic signs.

    PubMed

    Lambert, L D; Fleury, M

    1994-04-01

    This study assessed the efficiency with which young and older adults of varying field dependence extract information from traffic signs. It also identified some visual attributes of signs which affect recognition time. Two experiments were conducted. In Exp. 1, digitized signs, embedded in rural and urban backgrounds, were presented on a computer monitor. Subjects indicated on which side a target sign had appeared. Analysis showed that recognition times were dependent on age and field-dependence scores. Also, visual backgrounds and spatial frequency of pictographs affected RTs. In Exp. 2, recognition RT to 2 signs with redesigned pictographs was measured as well as time taken to detect signs. The signs showing reduced spatial frequency were the fastest to recognize, although no effect was noticed during detection. The subjects who showed the worst performance when facing the original signs benefitted the most from the modifications.

  6. Complex conductivity of organic-rich shales

    NASA Astrophysics Data System (ADS)

    Woodruff, W. F.; Revil, A.; Torres-Verdin, C.

    2013-12-01

    We can accurately determine the intrinsic anisotropy and material properties in the laboratory, providing empirical evidence of transverse isotropy and the polarization of the organic and metallic fractions in saturated and unsaturated shales. We develop two distinct approaches to obtain the complex conductivity tensor from spectral induced polarization (SIP) measurements. Experimental results indicate clear anisotropy, and characterize the effects of thermal maturation, TOC, and pyrite, aiding in the calibration and interpretation of geophysical data. SIP is a non-intrusive measurement, sensitive to the surface conductance of mineral grains, frequency-dependent polarization of the electrical double layer, and bulk conductivity of the pore water. The in-phase and quadrature components depend upon parameters of principal importance in unconventional shale formation evaluation (e.g., the distribution of pore throat sizes, formation factor, permeability, salinity and cation exchange capacity (CEC), fluid saturation and wettability). In addition to the contribution of the electrical double layer of non-conducting minerals to surface conductivity, we have observed a clear relaxation associated with kerogen pyrolysis, pyrite distribution, and evidence that the CEC of the kerogen fraction may also contribute, depending on thermal maturation history. We utilize a recent model for anisotropic complex conductivity, and rigorous experimental protocols to quantify the role of kerogen and pyrolysis on surface and quadrature conductivity in mudrocks. The complex conductivity tensor σ* describes the directional dependence of electrical conduction in a porous medium, and accounts for both conduction and polarization. The complex-valued tensor components are given as σ*ij , where σ'ij represents in-phase and σ"ij denotes quadrature conductivities. The directional dependence of the complex conductivity tensor is relegated to the textural properties of the material. The components of the formation factor and connectivity (tortuosity) tensors Fij and Tij (affecting the bulk and surface conductivity, respectively) are correlated as Fij=TijΦ. Both conductivity and connectivity tensors share the same eigenvectors; the anisotropy ratio is equivalent in TI media. At high pore water salinity, surface and quadrature conductivity share the same bulk tortuosity; when surface conductivity dominates (low salinity), conductivity is controlled by the surface conductance, and the tortuosity of electrical current along mineral surfaces usually higher than that of the pore water. We developed two distinct SIP measurement protocols to obtain the tensor: (1) azimuthal sampling and inversion of phasor potentials through the full-field solution of the Laplace equation; (2) direct measurement of complex conductivity eigenvalues by polarized, single-component stimulus current. Experiments also include unsaturated and saturated measurements with three brines of known salinity and pH, at log-distributed frequencies ranging 1 mHz to 45 kHz. Both azimuthal spectra and eigenvalue spectra validate the theoretical model and illustrate the effectiveness of the protocols themselves. We obtain the textural tensors and invert key parameters including Archie exponents and CEC, and characterize the relaxation phenomena associated with kerogen content and maturity for multiphase fluid systems.

  7. High-frequency response and the possibilities of frequency-tunable narrow-band terahertz amplification in resonant tunneling nanostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kapaev, V. V., E-mail: kapaev@sci.lebedev.ru; Kopaev, Yu. V.; Savinov, S. A.

    2013-03-15

    The characteristics of the high-frequency response of single- and double-well resonant tunneling structures in a dc electric field are investigated on the basis of the numerical solution of a time-dependent Schroedinger equation with open boundary conditions. The frequency dependence of the real part of high frequency conductivity (high-frequency response) in In{sub 0.53}Ga{sub 0.47}As/AlAs/InP structures is analyzed in detail for various values of the dc voltage V{sub dc} in the negative differential resistance (NDR) region. It is shown that double-well three-barrier structures are promising for the design of terahertz-band oscillators. The presence of two resonant states with close energies in suchmore » structures leads to a resonant (in frequency) response whose frequency is determined by the energy difference between these levels and can be controlled by varying the parameters of the structure. It is shown that, in principle, such structures admit narrow-band amplification, tuning of the amplification frequency, and a fine control of the amplification (oscillation) frequency in a wide range of terahertz frequencies by varying a dc electric voltage applied to the structure. Starting from a certain width of the central intermediate barrier in double-well structures, one can observe a collapse of resonances, where the structure behaves like a single-well system. This phenomenon imposes a lower limit on the oscillation frequency in three-barrier resonant tunneling structures.« less

  8. Purely hopping conduction in c-axis oriented LiNbO3 thin films

    NASA Astrophysics Data System (ADS)

    Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay

    2009-05-01

    Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.

  9. Frequency dependent electrical characteristics of ferroelectric Pb{4.0}K{1.0}Li{1.0}Nb{10}O{30} ceramics

    NASA Astrophysics Data System (ADS)

    Rao, K. S.; Krishna, P. M.; Prasad, D. M.; Latha, T. S.; Hussain, M.

    2007-09-01

    Dielectric, impedance, modulus and conductivity studies were performed over temperature 35 °C 600 °C and frequency 45 Hz 5 MHz range on the Lead Potassium Lithium Niobate (Pb{4.0}K{1.0}Li{1.0}Nb{10}O{30}, PKLN) ceramics. These studies established the conduction ion motion and polarization mechanism in the material. The dispersive dielectric loss at high temperature reveals the ionic conductivity. From frequency variation of \\varepsilonl response the pre-factor A(T) and critical exponent n(T) are evaluated, and are used in Jonscher's dielectric dispersion relation for \\varepsilon ' to fit with the experimental data. Complex impedance plots showed a non Debye type relaxation, are used to evaluate the grain and grain boundary conduction and relaxation activation energies. DC and ac conduction activation energies are estimated from Arrhenius plots. Occupancy of Li+ for C-sites gave a completely filled structure and enhanced the phase transition temperature to 520 °C compared to PKN. This is supported by the conduction activation energy in ferro region is more than the para region. Also, the dc conductivity characterized from bulk resistance and M^ll peak frequency. Polaron hoping mechanism at room temperature has been confirmed via the linear variation of the plot log (σ ac-σ dc) as a function of log ω 2. Stretched exponential parameter, β (0 < β ≤slant 1) has been evaluated from impedance plots, interpreted as a result of correlated motions between the Li+ ions and distribution of dielectric relaxation. Compared the results from different techniques, and discussed the conduction mechanism in the material.

  10. Thin and Broadband Two-Layer Microwave Absorber in 4-12 GHz with Developed Flaky Cobalt Material

    NASA Astrophysics Data System (ADS)

    Gill, Neeraj; Singh, Jaydeep; Puthucheri, Smitha; Singh, Dharmendra

    2018-03-01

    Microwave absorbing materials (MAMs) in the frequency range of 2.0-18.0 GHz are essential for the stealth and communication applications. Researchers came up with effective MAMs for the higher frequency regions, i.e., 8.0-18.0 GHz, while absorbers with comparable properties in the lower frequency band are still not in the limelight. Designing a MAM for the lower frequency range is a critical task. It is known that the factors governing the absorption in this frequency predominantly depend on the permeability and conductivity of the material, whereas the shape anisotropy of the particles can initiate different absorption mechanisms like multiple internal reflections, phase cancellations, surface charge polarization and enhanced conductivity that can promote the microwave absorption towards lower frequencies. But the material alone may not serve the purpose of getting broad absorption bandwidth. With the effective use of advanced electromagnetic technique like multi-layering this problem may be solved. Therefore, in this paper, a material with shape anisotropy (cobalt flakes with high shape anisotropy) has been prepared and a two-layer structure is developed which gives the absorption bandwidth in 4.17-12.05 GHz at a coating thickness of 2.66 mm.

  11. Thin and Broadband Two-Layer Microwave Absorber in 4-12 GHz with Developed Flaky Cobalt Material

    NASA Astrophysics Data System (ADS)

    Gill, Neeraj; Singh, Jaydeep; Puthucheri, Smitha; Singh, Dharmendra

    2018-05-01

    Microwave absorbing materials (MAMs) in the frequency range of 2.0-18.0 GHz are essential for the stealth and communication applications. Researchers came up with effective MAMs for the higher frequency regions, i.e., 8.0-18.0 GHz, while absorbers with comparable properties in the lower frequency band are still not in the limelight. Designing a MAM for the lower frequency range is a critical task. It is known that the factors governing the absorption in this frequency predominantly depend on the permeability and conductivity of the material, whereas the shape anisotropy of the particles can initiate different absorption mechanisms like multiple internal reflections, phase cancellations, surface charge polarization and enhanced conductivity that can promote the microwave absorption towards lower frequencies. But the material alone may not serve the purpose of getting broad absorption bandwidth. With the effective use of advanced electromagnetic technique like multi-layering this problem may be solved. Therefore, in this paper, a material with shape anisotropy (cobalt flakes with high shape anisotropy) has been prepared and a two-layer structure is developed which gives the absorption bandwidth in 4.17-12.05 GHz at a coating thickness of 2.66 mm.

  12. Effective electromagnetic properties of microheterogeneous materials with surface phenomena

    NASA Astrophysics Data System (ADS)

    Levin, Valery; Markov, Mikhail; Mousatov, Aleksandr; Kazatchenko, Elena; Pervago, Evgeny

    2017-10-01

    In this paper, we present an approach to calculate the complex dielectric permittivity of a micro-heterogeneous medium composed of non-conductive solid inclusions embedded into the conductive liquid continuous host. To take into account the surface effects, we approximate the inclusion by a layered ellipsoid consisting of a dielectric core and an infinitesimally thin outer shell corresponding to an electrical double layer (EDL). To predict the effective complex dielectric permittivity of materials with a high concentration of inclusions, we have modified the Effective Field Method (EFM) for the layered ellipsoidal particles with complex electrical properties. We present the results of complex permittivity calculations for the composites with randomly and parallel oriented ellipsoidal inclusions. To analyze the influence of surface polarization, we have accomplished modeling in a wide frequency range for different existing physic-chemical models of double electrical layer. The results obtained show that the tensor of effective complex permittivity of a micro-heterogeneous medium with surface effects has complicate dependences on the component electrical properties, spatial material texture, and the inclusion shape (ellipsoid aspect ratio) and size. The dispersion of dielectric permittivity corresponds to the frequency dependence for individual inclusion of given size, and does not depend on the inclusion concentration.

  13. Hyperbolic spoof plasmonic metasurfaces

    DOE PAGES

    Yang, Yihao; Jing, Liqiao; Shen, Lian; ...

    2017-08-25

    Hyperbolic metasurfaces have recently emerged as a new research frontier because of the unprecedented capabilities to manipulate surface plasmon polaritons (SPPs) and many potential applications. But, thus far, the existence of hyperbolic metasurfaces has neither been observed nor predicted at low frequencies because noble metals cannot support SPPs at longer wavelengths. Here, we propose and experimentally demonstrate spoof plasmonic metasurfaces with a hyperbolic dispersion, where the spoof SPPs propagate on complementary H-shaped, perfectly conducting surfaces at low frequencies. Therefore, non-divergent diffractions, negative refraction and dispersion-dependent spin-momentum locking are observed as the spoof SPPs travel over the hyperbolic spoof plasmonic metasurfacesmore » (HSPMs). The HSPMs provide fundamental new platforms to explore the propagation and spin of spoof SPPs. They show great capabilities for designing advanced surface wave devices such as spatial multiplexers, focusing and imaging devices, planar hyperlenses, and dispersion-dependent directional couplers, at both microwave and terahertz frequencies.« less

  14. Probing Growth-Induced Anisotropic Thermal Transport in High-Quality CVD Diamond Membranes by Multifrequency and Multiple-Spot-Size Time-Domain Thermoreflectance.

    PubMed

    Cheng, Zhe; Bougher, Thomas; Bai, Tingyu; Wang, Steven Y; Li, Chao; Yates, Luke; Foley, Brian M; Goorsky, Mark; Cola, Baratunde A; Faili, Firooz; Graham, Samuel

    2018-02-07

    The maximum output power of GaN-based high-electron mobility transistors is limited by high channel temperature induced by localized self-heating, which degrades device performance and reliability. Chemical vapor deposition (CVD) diamond is an attractive candidate to aid in the extraction of this heat and in minimizing the peak operating temperatures of high-power electronics. Owing to its inhomogeneous structure, the thermal conductivity of CVD diamond varies along the growth direction and can differ between the in-plane and out-of-plane directions, resulting in a complex three-dimensional (3D) distribution. Depending on the thickness of the diamond and size of the electronic device, this 3D distribution may impact the effectiveness of CVD diamond in device thermal management. In this work, time-domain thermoreflectance is used to measure the anisotropic thermal conductivity of an 11.8 μm-thick high-quality CVD diamond membrane from its nucleation side. Starting with a spot-size diameter larger than the thickness of the membrane, measurements are made at various modulation frequencies from 1.2 to 11.6 MHz to tune the heat penetration depth and sample the variation in thermal conductivity. We then analyze the data by creating a model with the membrane divided into ten sublayers and assume isotropic thermal conductivity in each sublayer. From this, we observe a two-dimensional gradient of the depth-dependent thermal conductivity for this membrane. The local thermal conductivity goes beyond 1000 W/(m K) when the distance from the nucleation interface only reaches 3 μm. Additionally, by measuring the same region with a smaller spot size at multiple frequencies, the in-plane and cross-plane thermal conductivities are extracted. Through this use of multiple spot sizes and modulation frequencies, the 3D anisotropic thermal conductivity of CVD diamond membrane is experimentally obtained by fitting the experimental data to a thermal model. This work provides an improved understanding of thermal conductivity inhomogeneity in high-quality CVD polycrystalline diamond that is important for applications in the thermal management of high-power electronics.

  15. Resonance frequency control of RF normal conducting cavity using gradient estimator of reflected power

    NASA Astrophysics Data System (ADS)

    Leewe, R.; Shahriari, Z.; Moallem, M.

    2017-10-01

    Control of the natural resonance frequency of an RF cavity is essential for accelerator structures due to their high cavity sensitivity to internal and external vibrations and the dependency of resonant frequency on temperature changes. Due to the relatively high radio frequencies involved (MHz to GHz), direct measurement of the resonant frequency for real-time control is not possible by using conventional microcontroller hardware. So far, all operational cavities are tuned using phase comparison techniques. The temperature dependent phase measurements render this technique labor and time intensive. To eliminate the phase measurement, reduce man hours and speed up cavity start up time, this paper presents a control theme that relies solely on the reflected power measurement. The control algorithm for the nonlinear system is developed through Lyapunov's method. The controller stabilizes the resonance frequency of the cavity using a nonlinear control algorithm in combination with a gradient estimation method. Experimental results of the proposed system on a test cavity show that the resonance frequency can be tuned to its optimum operating point while the start up time of a single cavity and the accompanied man hours are significantly decreased. A test result of the fully commissioned control system on one of TRIUMF's DTL tanks verifies its performance under real environmental conditions.

  16. Dielectric relaxation dynamics and AC conductivity scaling of metal-organic framework (MOF-5) based polymer electrolyte nanocomposites incorporated with ionic liquid

    NASA Astrophysics Data System (ADS)

    Dutta, Rituraj; Kumar, A.

    2017-10-01

    Dielectric relaxation dynamics and AC conductivity scaling of a metal-organic framework (MOF-5) based poly (vinylidene fluoride-co-hexafluoropropylene) (PVdf-HFP) incorporated with 1-Butyl-3-methylimidazolium hexafluorophosphate have been studied over a frequency range of 40 Hz-5 MHz and in the temperature range of 300 K-380 K. High values of dielectric permittivity (~{{\\varepsilon }\\prime} ) having strong dispersion are obtained at low frequency because of interfacial polarization. The real part of the dielectric modulus spectra (M‧) shows no prominent peak, whereas the imaginary part (M″) shows certain peaks, with a reduction in relaxation time (τ) that can be attributed to a non-Debye relaxation mechanism. The spectra also depict both concentration- and temperature-independent scaling behavior. The power law dependent variation of AC conductivity follows the jump relaxation model and reveals activated ion hopping over diffusion barriers. The value of the frequency exponent is observed to decrease with increasing concentration of ionic liquid, indicating the forward hopping of ions in the relaxation process. The AC conductivity scaling curves at different temperatures also depict the temperature-independent relaxation dynamics.

  17. Structural, electrical properties and dielectric relaxations in Na+-ion-conducting solid polymer electrolyte.

    PubMed

    Arya, Anil; Sharma, A L

    2018-04-25

    In this paper, we have studied the structural, microstructural, electrical, dielectric properties and ion dynamics of a sodium-ion-conducting solid polymer electrolyte film comprising PEO 8 -NaPF 6 +  x wt. % succinonitrile. The structural and surface morphology properties have been investigated, respectively using x-ray diffraction and field emission scanning electron microscopy. The complex formation was examined using Fourier transform infrared spectroscopy, and the fraction of free anions/ion pairs obtained via deconvolution. The complex dielectric permittivity and loss tangent has been analyzed across the whole frequency window, and enables us to estimate the DC conductivity, dielectric strength, double layer capacitance and relaxation time. The presence of relaxing dipoles was determined by the addition of succinonitrile (wt./wt.) and the peak shift towards high frequency indicates the decrease of relaxation time. Further, relations among various relaxation times ([Formula: see text]) have been elucidated. The complex conductivity has been examined across the whole frequency window; it obeys the Universal Power Law, and displays strong dependency on succinonitrile content. The sigma representation ([Formula: see text]) was introduced in order to explore the ion dynamics by highlighting the dispersion region in the Cole-Cole plot ([Formula: see text]) in the lower frequency window; increase in the semicircle radius indicates a decrease of relaxation time. This observation is accompanied by enhancement in ionic conductivity and faster ion transport. A convincing, logical scheme to justify the experimental data has been proposed.

  18. Calcium-dependent control of temporal processing in an auditory interneuron: a computational analysis

    PubMed Central

    Ponnath, Abhilash

    2010-01-01

    Sensitivity to acoustic amplitude modulation in crickets differs between species and depends on carrier frequency (e.g., calling song vs. bat-ultrasound bands). Using computational tools, we explore how Ca2+-dependent mechanisms underlying selective attention can contribute to such differences in amplitude modulation sensitivity. For omega neuron 1 (ON1), selective attention is mediated by Ca2+-dependent feedback: [Ca2+]internal increases with excitation, activating a Ca2+-dependent after-hyperpolarizing current. We propose that Ca2+ removal rate and the size of the after-hyperpolarizing current can determine ON1’s temporal modulation transfer function (TMTF). This is tested using a conductance-based simulation calibrated to responses in vivo. The model shows that parameter values that simulate responses to single pulses are sufficient in simulating responses to modulated stimuli: no special modulation-sensitive mechanisms are necessary, as high and low-pass portions of the TMTF are due to Ca2+-dependent spike frequency adaptation and post-synaptic potential depression, respectively. Furthermore, variance in the two biophysical parameters is sufficient to produce TMTFs of varying bandwidth, shifting amplitude modulation sensitivity like that in different species and in response to different carrier frequencies. Thus, the hypothesis that the size of after-hyperpolarizing current and the rate of Ca2+ removal can affect amplitude modulation sensitivity is computationally validated. PMID:20559640

  19. Gapped fermionic spectrum from a domain wall in seven dimension

    NASA Astrophysics Data System (ADS)

    Mukhopadhyay, Subir; Rai, Nishal

    2018-05-01

    We obtain a domain wall solution in maximally gauged seven dimensional supergravity, which interpolates between two AdS spaces and spontaneously breaks a U (1) symmetry. We analyse frequency dependence of conductivity and find power law behaviour at low frequency. We consider certain fermions of supergravity in the background of this domain wall and compute holographic spectral function of the operators in the dual six dimensional theory. We find fermionic operators involving bosons with non-zero expectation value lead to gapped spectrum.

  20. Penetration of Nonstationary Ionospheric Electric Fields into Lower Atmospheric Layers in the Global Electric Circuit Model

    NASA Astrophysics Data System (ADS)

    Morozov, V. N.

    2018-01-01

    The problem of the penetration of nonstationary ionospheric electric fields into the lower atmospheric layers is considered based on the model of the global electric circuit in the Earth's atmosphere. For the equation of the electric field potential, a solution that takes into account exponential variation in the electrical conductivity with height has been obtained. Analysis of the solution made it possible to reveal three cases of the dependence of the solution on height. The first case (the case of high frequencies) corresponds to the Coulomb approximation, when the electrical conductivity of the atmosphere can be neglected. In the case of low frequencies (when the frequency of changes in the ionosphere potential is less than the quantity reciprocal to the time of electric relaxation of the atmosphere), a quasi-stationary regime, in which the variation in the electric potential of the atmosphere is determined by the electric conduction currents, occurs. In the third case, due to the increase in the electrical conductivity of the atmosphere, two spherical regions appear: with the Coulomb approximation in the lower region and conduction currents in the upper one. For these three cases, formulas for estimating the electric field strength near the Earth's surface have been obtained.

  1. Temperature dependent dielectric and conductivity studies of polyvinyl alcohol-ZnO nanocomposite films by impedance spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hemalatha, K. S.; Damle, R.; Rukmani, K., E-mail: rukmani9909@yahoo.co.in

    2015-10-21

    Dielectric and conductivity behaviors of nano ZnO doped polyvinyl alcohol (PVA) composites for various concentrations of dopant were investigated using impedance spectroscopy for a wide range of temperatures (303 K–423 K) and frequencies (5 Hz–30 MHZ). The dielectric properties of host polymer matrix have been improved by the addition of nano ZnO and are found to be highly temperature dependent. Anomalous dielectric behavior was observed in the frequency range of 2.5 MHz–5 MHz. Increase in dielectric permittivity and dielectric loss was observed with respect to temperature. The Cole-Cole plot could be modeled by low resistance regions in a high resistance matrix and the lowest resistance wasmore » observed for the 10 mol. % films. The imaginary part of the electric modulus showed asymmetric peaks with the relaxation following Debye nature below and non-Debye nature above the peaks. The ac conductivity is found to obey Jonscher's power law, whereas the variation of dc conductivity with temperature was found to follow Arrhenius behavior. Two different activation energy values were obtained from Arrhenius plot indicating that two conduction mechanisms are involved in the composite films. Fitting the ac conductivity data to Jonscher's law indicates that large polaron assisted tunneling is the most likely conduction mechanism in the composites. Maximum conductivity is observed at 423 K for all the samples and it is optimum for 10 mol. % ZnO doped PVA composite film. Significant increase in dc and ac conductivities in these composite films makes them a potential candidate for application in electronic devices.« less

  2. Moderate temperature-dependent surface and volume resistivity and low-frequency dielectric constant measurements of pure and multi-walled carbon nanotube (MWCNT) doped polyvinyl alcohol thin films

    NASA Astrophysics Data System (ADS)

    Edwards, Matthew; Guggilla, Padmaja; Reedy, Angela; Ijaz, Quratulann; Janen, Afef; Uba, Samuel; Curley, Michael

    2017-08-01

    Previously, we have reported measurements of temperature-dependent surface resistivity of pure and multi-walled carbon nanotube (MWNCT) doped amorphous Polyvinyl Alcohol (PVA) thin films. In the temperature range from 22 °C to 40 °C with humidity-controlled environment, we found the surface resistivity to decrease initially, but to rise steadily as the temperature continued to increase. Moreover, electric surface current density (Js) was measured on the surface of pure and MWCNT doped PVA thin films. In this regard, the surface current density and electric field relationship follow Ohm's law at low electric fields. Unlike Ohmic conduction in metals where free electrons exist, selected captive electrons are freed or provided from impurities and dopants to become conduction electrons from increased thermal vibration of constituent atoms in amorphous thin films. Additionally, a mechanism exists that seemingly decreases the surface resistivity at higher temperatures, suggesting a blocking effect for conducting electrons. Volume resistivity measurements also follow Ohm's law at low voltages (low electric fields), and they continue to decrease as temperatures increase in this temperature range, differing from surface resistivity behavior. Moreover, we report measurements of dielectric constant and dielectric loss as a function of temperature and frequency. Both the dielectric constant and dielectric loss were observed to be highest for MWCNT doped PVA compared to pure PVA and commercial paper, and with frequency and temperature for all samples.

  3. Microstructural, electrical and frequency-dependent properties of Au/p-Cu2ZnSnS4/n-GaN heterojunction.

    PubMed

    Rajagopal Reddy, V; Janardhanam, V; Won, Jonghan; Choi, Chel-Jong

    2017-08-01

    An Au/Cu 2 ZnSnS 4 (CZTS)/n-GaN heterojunction (HJ) is fabricated with a CZTS interlayer and probed its chemical states, structural, electrical and frequency-dependent characteristics by XPS, TEM, I-V and C-V measurements. XPS and TEM results confirmed that the CZTS films are formed on the n-GaN surface. The band gap of deposited CZTS film is found to be 1.55eV. The electrical properties of HJ correlated with the Au/n-GaN Schottky junction (SJ). The Au/CZTS/n-GaN HJ reveals a good rectification nature with high barrier height (0.82eV) compared to the Au/n-GaN SJ (0.69eV), which suggests the barrier height is influenced by the CZTS interlayer. The barrier height values assessed by I-V, Cheung's and Norde functions are closely matched with one other, thus the methods used here are reliable and valid. The extracted interface state density (N SS ) of Au/CZTS/n-GaN HJ is lower compared to the Au/n-GaN SJ that suggests the CZTS interlayer plays an important role in the reduction of N SS . Moreover, the capacitance-frequency (C-f) and conductance-frequency (G-f) characteristics of SJ and HJ are measured in the range of 1kHz-1MHz, and found that the capacitance and conductance strappingly dependent on frequency. It is found that the N SS estimated from C-f and G-f characteristics is lower compared to those estimated from I-V characteristics. Analysis confirmed that Poole-Frenkel emission dominates the reverse leakage current in both SJ and HJ, probably related to the structural defects and trap levels in the CZTS interlayer. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Frequency dependence of electrical properties of polyvinylidene fluoride/graphite electrode waste/natural carbon black composite

    NASA Astrophysics Data System (ADS)

    Insiyanda, D. R.; Indayaningsih, N.; Prihandoko, B.; Subhan, A.; Khaerudini, D. S.; Widodo, H.; Destyorini, F.; Chaer, A.

    2018-03-01

    Polyvinylidene fluoride (PVdF) is a semi-crystalline thermoplastic material with remarkably high piezoelectric coefficient and an attractive polymer matrix for micro-composite with superior mechanical and electrical properties. The conductive filler is obtained from Graphite Electrode Waste (GEW) and Natural Carbon Black (NCB). The variation of composite content (%) of PVdF/NCB/GEW were 100/0/0, 95/5/0, 95/0/5, 95/2.5/2.5. This experiment employed dry dispersion method for material mixing. The materials were then moulded using hot press machine with compression parameters of P = 5.5 MPa, T = 150 °C, t = 60 minutes, A = 5×5×(0.2 - 0.4) cm3. The electrical conductivity properties of pure PVdF, as well as PVdF/GEW, PVdF/NCB, and PVdF/NCB/GEW composites were investigated in a frequency range of 100 to 100000 Hz. The PVdF/GEW sample obtained the highest electrical conductivity. It is concluded that GEW and NCB can be incorporated into PVdF as a conductive filler to increase the conductivity of conductive material composite without solvent.

  5. Effects of fullerene coalescence on the thermal conductivity of carbon nanopeapods

    NASA Astrophysics Data System (ADS)

    Li, Jiaqian; Shen, Haijun

    2018-05-01

    The heat conduction and its dependence on fullerene coalescence in carbon nanopeapods (CNPs) have been investigated by equilibrium molecular dynamics simulations. The effects of fullerene coalescence on the thermal conductivity of CNPs were discussed under different temperatures. It is shown that the thermal conductivity of the CNPs decreases with the coalescence of encapsulated fullerene molecules. The thermal transmission mechanism of the effect of fullerene coalescence was analysed by the mass transfer contribution, the relative contributions of phonon oscillation frequencies to total heat current and the phonon vibrational density of states (VDOS). The mass transfer in CNPs is mainly attributed to the motion of encapsulated fullerene molecule and it gets more restricted with the coalescence of the fullerene. It shows that the low-frequency phonon modes below 20 THz contribute mostly to thermal conductivity in CNPs. The analysis of VDOS demonstrates that the dominating contribution to heat transfer is from the inner fullerene chain. With the coalescence of fullerene, the interfacial heat transfer between the CNT and fullerene chain is strengthened; however, the heat conduction of the fullerene chain decreases more rapidly at the same time.

  6. Powder X-ray diffraction, infrared and conductivity studies of AgSbMP{sub 3}O{sub 12} (M = Al, Ga, Fe and Cr)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rambabu, G.; Anantharamulu, N.; Koteswara Rao, K.

    2008-06-03

    New Nasicon type of compounds of composition AgSbMP{sub 3}O{sub 12} (M = Al, Ga, Fe and Cr) are synthesized by solid-state method. All the compounds crystallize in the hexagonal lattice with space group R3-barc. The infrared spectra of these compounds show characteristic bands due to PO{sub 4} group. The frequency independent conductivity of these compounds shows Arrhenius type behavior and the activation energy for conduction is in the range 0.40-0.55 eV. Frequency independent conductivity ({sigma}{sub dc}) studies and frequency dependent ({sigma}{sub ac}) impedance measurements correlate well. The Cole-Cole plots do not show any spikes on the lower frequency side indicatingmore » negligible electrode effects. The activation energies obtained from the plots of log {sigma}{sub dc}T versus 1/T, log {sigma}{sub ac}(0) versus 1/T and log {tau} versus 1/T are approximately the same. The peak width at half height for electric modulus (M'') plot is {approx}1.24 decades for all samples, which is close to 1.14 decades observed for Debye solid. The height of electric modulus (M'') obtained from the experimental plots are close to that of M'' (max) = C{sub 0}/2C indicating the Debye nature of the samples.« less

  7. Finite-element time-domain modeling of electromagnetic data in general dispersive medium using adaptive Padé series

    NASA Astrophysics Data System (ADS)

    Cai, Hongzhu; Hu, Xiangyun; Xiong, Bin; Zhdanov, Michael S.

    2017-12-01

    The induced polarization (IP) method has been widely used in geophysical exploration to identify the chargeable targets such as mineral deposits. The inversion of the IP data requires modeling the IP response of 3D dispersive conductive structures. We have developed an edge-based finite-element time-domain (FETD) modeling method to simulate the electromagnetic (EM) fields in 3D dispersive medium. We solve the vector Helmholtz equation for total electric field using the edge-based finite-element method with an unstructured tetrahedral mesh. We adopt the backward propagation Euler method, which is unconditionally stable, with semi-adaptive time stepping for the time domain discretization. We use the direct solver based on a sparse LU decomposition to solve the system of equations. We consider the Cole-Cole model in order to take into account the frequency-dependent conductivity dispersion. The Cole-Cole conductivity model in frequency domain is expanded using a truncated Padé series with adaptive selection of the center frequency of the series for early and late time. This approach can significantly increase the accuracy of FETD modeling.

  8. Fast temporal fluctuations in single-molecule junctions.

    PubMed

    Ochs, Roif; Secker, Daniel; Elbing, Mark; Mayor, Marcel; Weber, Heiko B

    2006-01-01

    The noise within the electrical current through single-molecule junctions is studied cryogenic temperature. The organic sample molecules were contacted with the mechanically controlled break-junction technique. The noise spectra refer to a where only few Lorentzian fluctuators occur in the conductance. The frequency dependence shows qualitative variations from sample to sample.

  9. Optimal Selection of Time Series Coefficients for Wrist Myoelectric Control Based on Intramuscular Recordings

    DTIC Science & Technology

    2001-10-25

    considered static or invariant because the spectral behavior of EMG data is dependent on the specific muscle , contraction level, and limb function. However...produced at the onset of the muscle contraction . Because the units with lower conduction velocity (lower frequency components) are recruited first, the

  10. Archaeological Evaluation of The Multi-frequency Electromagnetic Slingram Device Gem 300

    NASA Astrophysics Data System (ADS)

    Schmidt, A.; Bonsall, J.

    Frequency-domain electromagnetic devices offer a great potential in geophysical prospection as they allow the simultaneous measurement of two parameters. Con- ventionally, in-phase and quadrature components of the return-signal are recorded. However the identification of these measurements with ground properties such as con- ductance or magnetic susceptibility are complicated and depend on instrument design, frequency and other parameters, such as magnetic viscosity. While in environmental applications a simple identification of strongly conductive features (e.g. oil drums) can be obtained, archaeological surveys pose much greater challenges due to the smaller contrast in conductivity and magnetic susceptibility. A very detailed analysis of mea- sured data and sophisticated computations are therefore required. The new GEM 300 Slingram device allows to measure in-phase and quadrature data at up to 16 frequencies simultaneously which could be used to calculate three inde- pendent soil parameters: conductivity, magnetic susceptibility and magnetic viscosity. Alternatively, the manufacturer claims that the different frequencies can be used for depth soundings. The instrument was tested on a number of sites for which prior geophysical and ar- chaeological investigations had revealed distinct features (e.g. a brick-built cest pit). The results were disappointing as large drift and undefined offsets made a quantitative analysis of data nearly impossible. It was therefore concluded that further develop- ments of the instrument are required before it can be used successfully for archaeo- logical prospection.

  11. Fracture Decoupling of Small Chemical Explosions in Granite and Limestone

    NASA Astrophysics Data System (ADS)

    Stroujkova, A. F.; Bonner, J. L.; Reinke, R.; Lenox, E. A.

    2012-12-01

    Reduction of the seismic amplitudes produced by underground explosions due to dissipation in a low-coupling medium poses a significant challenge for nuclear test monitoring. We examined the data from two experiments, which involved conducting explosions in the damage zone created by previous explosions ("repeat shots"). The first experiment was conducted in central New Hampshire in a fluid saturated granodiorite. The experiment involved detonating two 46 kg explosions: one in virgin rock and the other in the fractured rock zone produced by a larger (232 kg) explosion. The second experiment took place near Albuquerque, NM, in dry limestone. In this scenario the second explosion was conducted in the cavity created by the first explosion. Both limestone explosions had yields of 90.5 kg. The reduction of the seismic amplitudes was observed for both repeat shots: in granodiorite the amplitudes were reduced by a factor of 2-3, in limestone by a factor of 3-4 compared to the shots in the undamaged rocks. For the granodiorite repeat shot the decoupling ratios were frequency dependent with stronger amplitude reduction at higher frequencies. In addition, the virgin rock shot produced higher corner frequency and overshoot parameter than the repeat shot. For the limestone shot the decoupling ratios were nearly flat at all frequencies with similar corner frequencies. This observation suggests different mechanisms of energy dissipation for the two experiments.

  12. High precision optical measurement of displacement and simultaneous determinations of piezoelectric coefficients

    NASA Astrophysics Data System (ADS)

    Gamboa, Bryan M.; Malladi, Madhuri; Vadlamani, Ramya; Guo, Ruyan; Bhalla, Amar

    2016-09-01

    PZT are also well known for their applications in Micro Electrical Mechanical Systems (MEMS). It is necessary to study the piezoelectric coefficients of the materials accurately in order to design a sensor as an example, which defines their strain dependent applications. Systematic study of the electro mechanic displacement measurement was conducted and compared using a white light fiber optic sensor, a heterodyne laser Doppler vibrometer, and a homodyne laser interferometry setup. Frequency dependent measurement is conducted to evaluate displacement values well below and near the piezoelectric resonances. UHF-120 ultra-high frequency Vibrometer is used to measure the longitudinal piezoelectric displacement or x33 and the MTI 2000 FotonicTM Sensor is used to measure the transverse piezoelectric displacement or x11 over 100Hz to 2MHz. A Multiphysics Finite Element Analysis method, COMSOL, is also adopted in the study to generate a three dimensional electromechanical coupled model based on experimentally determined strains x33 and x11 as a function of frequency of the electric field applied. The full family of piezoelectric coefficients of the poled electronic ceramic PZT, d33, d31, and d15, can be then derived, upon satisfactory simulation of the COMSOL. This is achieved without the usual need of preparation of piezoelectric resonators of fundamental longitudinal, transversal, and shear modes respectively.

  13. Long term attenuation statistics at 11.6 GHz in the three Italian Main Stations

    NASA Astrophysics Data System (ADS)

    Carassa, Francesco; Mauri, Mario; Paraboni, Aldo

    1987-04-01

    Results are presented from the 5-year attenuation-measurement campaign conducted with the SIRIO satellite at 11.6 and 17.8, which used near-continuous measurements at the lower frequency from the Italian ground stations at Fucino, Lario, and Spino d'Adda, and fewer measurements at the higher frequency from Fucino and Lario. The long-term statistics thus obtained have been applied in the design of the Italian domestic satellite system Italsat, which is to begin operating in 1989. Attention is presently given to annual worst month, time-of-day dependence, rain rate attenuation correlation, and frequency scaling statistics.

  14. Investigation of electrophysical properties of allotropic modifications of carbon in the range of temperatures 140-400 K

    NASA Astrophysics Data System (ADS)

    Goshev, A. A.; Eseev, M. K.; Volkov, A. S.; Lyah, N. L.

    2017-09-01

    The paper presents the results of the investigation of allotropic modifications of carbon (coal, graphite, fullerenes, CNTs. Dependences of conductivity on the field frequency in the temperature range 140-400 K are presented. The characteristic features associated with the structure and types of hybridization are revealed. Calculation of the activation energy of carriers was performed. As well article presents experimental study of electrical properties of polymeric composites, reinforced different types of allotropic modifications of carbon (CNTs, graphite, fullerenes, coal) in alternating electrical field in frequency band from 0.01 Hz to 10 MHz. The threshold of percolation of polymer composites with various types of additives and their influence for conduction properties was estimated.

  15. Conduction in In 2O 3/YSZ heterostructures: Complex interplay between electrons and ions, mediated by interfaces

    DOE PAGES

    Veal, B. W.; Eastman, J. A.

    2017-03-01

    Thin film In 2O 3/YSZ heterostructures exhibit significant increases in electrical conductance with time when small in-plane electric fields are applied. Contact resistances between the current electrodes and film, and between current electrodes and substrate are responsible for the behavior. With an in-plane electric field, different field profiles are established in the two materials, with the result that oxygen ions can be driven across the heterointerface, altering the doping of the n-type In 2O 3. Furthermore, a low frequency inductive feature observed in AC impedance spectroscopy measurements under DC bias conditions was found to be due to frequency-dependent changes inmore » the contact resistance.« less

  16. Method and apparatus for identifying conductive objects by monitoring the true resistive component of impedance change in a coil system caused by the object

    DOEpatents

    Gregory, William D.; Capots, Larry H.; George, James P.; Janik, Richard

    1981-01-01

    The type of conductor, its property, and if a metal, its type and cross-sectional area can be obtained from measurements made at different frequencies for the amount of unbalance created in a previously balanced stable coil detection system. The true resistive component is accurately measured and thus reflects only the voltage loss attributable to eddy currents caused by introduction of the test sample to the coil system. This voltage divided by corresponding applied frequency gives a curve which peaks at a frequency dependent upon type of conductor. For a metal this peak frequency is proportional to the samples resistivity divided by its cross-sectional area.

  17. Angular-dependent EDMR linewidth for spin-dependent space charge limited conduction in a polycrystalline pentacene

    NASA Astrophysics Data System (ADS)

    Fukuda, Kunito; Asakawa, Naoki

    2017-08-01

    Spin-dependent space charge limited carrier conduction in a Schottky barrier diode using polycrystalline p-type π-conjugated molecular pentacene is explored using multiple-frequency electrically detected magnetic resonance (EDMR) spectroscopy with a variable-angle configuration. The measured EDMR spectra are decomposed into two components derived respectively from mobile and trapped positive polarons. The linewidth of the EDMR signal for the trapped polarons increases with increasing resonance magnetic field for an in-plane configuration where the normal vector of the device substrate is perpendicular to the resonance magnetic field, while it is independent of the field for an out-of-plane configuration. This difference is consistent with the pentacene arrangement on the device substrate, where pentacene molecules exhibit a uniaxial orientation on the out-of-substrate plane. By contrast, the mobile polarons do not show anisotropic behavior with respect to the resonance magnetic field, indicating that the anisotropic effect is averaged out owing to carrier motion. These results suggest that the orientational arrangements of polycrystalline pentacene molecules in a nano thin film play a crucial role in spin-dependent electrical conduction.

  18. On the Dependence of the Ionospheric E-Region Electric Field of the Solar Activity

    NASA Astrophysics Data System (ADS)

    Denardini, Clezio Marcos; Schuch, Nelson Jorge; Moro, Juliano; Araujo Resende, Laysa Cristina; Chen, Sony Su; Costa, D. Joaquim

    2016-07-01

    We have being studying the zonal and vertical E region electric field components inferred from the Doppler shifts of type 2 echoes (gradient drift irregularities) detected with the 50 MHz backscatter coherent (RESCO) radar set at Sao Luis, Brazil (SLZ, 2.3° S, 44.2° W) during the solar cycle 24. In this report we present the dependence of the vertical and zonal components of this electric field with the solar activity, based on the solar flux F10.7. For this study we consider the geomagnetically quiet days only (Kp <= 3+). A magnetic field-aligned-integrated conductivity model was developed for proving the conductivities, using the IRI-2007, the MISIS-2000 and the IGRF-11 models as input parameters for ionosphere, neutral atmosphere and Earth magnetic field, respectively. The ion-neutron collision frequencies of all the species are combined through the momentum transfer collision frequency equation. The mean zonal component of the electric field, which normally ranged from 0.19 to 0.35 mV/m between the 8 and 18 h (LT) in the Brazilian sector, show a small dependency with the solar activity. Whereas, the mean vertical component of the electric field, which normally ranges from 4.65 to 10.12 mV/m, highlight the more pronounced dependency of the solar flux.

  19. Dynamic effective properties of heterogeneous geological formations with spherical inclusions under periodic time variations

    NASA Astrophysics Data System (ADS)

    Rabinovich, A.; Dagan, G.; Miloh, T.

    2013-04-01

    In unsteady groundwater flow (or similar processes of heat/electrical conduction), the heterogeneous medium structure is characterized by two random properties, the conductivity K and the specific storativity S. The average head field ⟨H ⟩and the associated effective properties Kef, Sef are determined for a layer with a periodic head drop between boundaries, such that H is periodic in time, and a medium made up of a matrix with a dilute concentration of spherical inclusions. In the common quasi-steady approximation, Kef is equal to the classical steady solution while Sef = SA, the arithmetic mean. We derive expressions for the frequency dependent Kef, Sef, which are generally complex, i.e., dynamic. The main result is the delineation of the ranges of the parameters: dimensionless frequency (ω) and contrasts of conductivity (κ) and storativity (s) between the matrix and the inclusions, for which dynamic effects are significant.

  20. Advances in high gradient normal conducting accelerator structures

    DOE PAGES

    Simakov, Evgenya Ivanovna; Dolgashev, Valery A.; Tantawi, Sami G.

    2018-03-09

    Here, this paper reviews the current state-of-the-art in understanding the phenomena of ultra-high vacuum radio-frequency (rf) breakdown in accelerating structures and the efforts to improve stable operation of the structures at accelerating gradients above 100 MV/m. Numerous studies have been conducted recently with the goal of understanding the dependence of the achievable accelerating gradients and breakdown rates on the frequency of operations, the geometry of the structure, material and method of fabrication, and operational temperature. Tests have been conducted with single standing wave accelerator cells as well as with the multi-cell traveling wave structures. Notable theoretical effort was directed atmore » understanding the physical mechanisms of the rf breakdown and its statistical behavior. Finally, the achievements presented in this paper are the result of the large continuous self-sustaining collaboration of multiple research institutions in the United States and worldwide.« less

  1. Advances in high gradient normal conducting accelerator structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simakov, Evgenya Ivanovna; Dolgashev, Valery A.; Tantawi, Sami G.

    Here, this paper reviews the current state-of-the-art in understanding the phenomena of ultra-high vacuum radio-frequency (rf) breakdown in accelerating structures and the efforts to improve stable operation of the structures at accelerating gradients above 100 MV/m. Numerous studies have been conducted recently with the goal of understanding the dependence of the achievable accelerating gradients and breakdown rates on the frequency of operations, the geometry of the structure, material and method of fabrication, and operational temperature. Tests have been conducted with single standing wave accelerator cells as well as with the multi-cell traveling wave structures. Notable theoretical effort was directed atmore » understanding the physical mechanisms of the rf breakdown and its statistical behavior. Finally, the achievements presented in this paper are the result of the large continuous self-sustaining collaboration of multiple research institutions in the United States and worldwide.« less

  2. Sensorless battery temperature measurements based on electrochemical impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Raijmakers, L. H. J.; Danilov, D. L.; van Lammeren, J. P. M.; Lammers, M. J. G.; Notten, P. H. L.

    2014-02-01

    A new method is proposed to measure the internal temperature of (Li-ion) batteries. Based on electrochemical impedance spectroscopy measurements, an intercept frequency (f0) can be determined which is exclusively related to the internal battery temperature. The intercept frequency is defined as the frequency at which the imaginary part of the impedance is zero (Zim = 0), i.e. where the phase shift between the battery current and voltage is absent. The advantage of the proposed method is twofold: (i) no hardware temperature sensors are required anymore to monitor the battery temperature and (ii) the method does not suffer from heat transfer delays. Mathematical analysis of the equivalent electrical-circuit, representing the battery performance, confirms that the intercept frequency decreases with rising temperatures. Impedance measurements on rechargeable Li-ion cells of various chemistries were conducted to verify the proposed method. These experiments reveal that the intercept frequency is clearly dependent on the temperature and does not depend on State-of-Charge (SoC) and aging. These impedance-based sensorless temperature measurements are therefore simple and convenient for application in a wide range of stationary, mobile and high-power devices, such as hybrid- and full electric vehicles.

  3. Dendritic small conductance calcium-activated potassium channels activated by action potentials suppress EPSPs and gate spike-timing dependent synaptic plasticity.

    PubMed

    Jones, Scott L; To, Minh-Son; Stuart, Greg J

    2017-10-23

    Small conductance calcium-activated potassium channels (SK channels) are present in spines and can be activated by backpropagating action potentials (APs). This suggests they may play a critical role in spike-timing dependent synaptic plasticity (STDP). Consistent with this idea, EPSPs in both cortical and hippocampal pyramidal neurons were suppressed by preceding APs in an SK-dependent manner. In cortical pyramidal neurons EPSP suppression by preceding APs depended on their precise timing as well as the distance of activated synapses from the soma, was dendritic in origin, and involved SK-dependent suppression of NMDA receptor activation. As a result SK channel activation by backpropagating APs gated STDP induction during low-frequency AP-EPSP pairing, with both LTP and LTD absent under control conditions but present after SK channel block. These findings indicate that activation of SK channels in spines by backpropagating APs plays a key role in regulating both EPSP amplitude and STDP induction.

  4. Optical and thermal-transport properties of an inhomogeneous d-wave superconductor.

    PubMed

    Atkinson, W A; Hirschfeld, P J

    2002-05-06

    We calculate transport properties of disordered 2D d-wave superconductors from solutions of the Bogoliubov-de Gennes equations, and show that weak localization effects give rise to a finite-frequency peak in the optical conductivity similar to that observed in experiments on disordered cuprates. At low energies, order parameter inhomogeneities induce linear and quadratic temperature dependencies in microwave and thermal conductivities respectively, and appear to drive the system towards a quasiparticle insulating phase.

  5. How do the medial olivocochlear efferents influence the biomechanics of the outer hair cells and thereby the cochlear amplifier? Simulation results

    NASA Astrophysics Data System (ADS)

    Saremi, Amin; Stenfelt, Stefan; Verhulst, Sarah

    2015-12-01

    The bottom-up signal pathway, which starts from the outer ear and leads to the brain cortices, gives the classic image of the human sound perception. However, there have been growing evidences in the last six decades for existence of a functional descending network whereby the central auditory system can modulate the early auditory processing, in a top-down manner. The medial olivocochlear efferent fibers project from the superior olivary complex at the brainstem into the inner ear. They are linked to the basal poles of the hair cells by forming synaptic cisterns. This descending network can activate nicotinic cholinergic receptors (nAChR) that increase the membrane conductance of the outer hair cells and thereby modify the magnitude of the active force generated inside the cochlea. The aim of the presented work is to quantitatively investigate how the changes in the biomechanics of the outer hair cells, caused by the efferent activation, manipulate the cochlear responses. This is done by means of a frequency-domain biophysical model of the cochlea [12] where the parameters of the model convey physiological interpretations of the human cochlear structures. The simulations manifest that a doubling of the outer hair cell conductance, due to efferent activation, leads to a frequency-dependent gain reduction along the cochlear duct with its highest effect at frequencies between 1 kHz and 3.5 kHz and a maximum of approximately 10 dB gain reduction at 2 kHz. This amount of the gain inhibition and its frequency dependence reasonably agrees with the experimental data recorded from guinea pig, cat and human cochleae where the medial olivococlear efferents had been elicited by broad-band stimuli. The simulations also indicate that the efferent-induced increase of the outer hair cell conductance increases the best frequency of the cochlear responses, in the basal region. The presented simulations quantitatively confirm that activation of the medial olivocochlear efferents can biomechanically manipulate the cochlear responses, in a top-down manner, by inhibiting the gain of the cochlear amplifier as well as altering the frequency-position map (tuning pattern) of the cochlea.

  6. Dielectric relaxation and electrical conduction mechanism in A2HoSbO6 (A=Ba, Sr, Ca) Double Perovskite Ceramics: An impedance spectroscopic analysis

    NASA Astrophysics Data System (ADS)

    Halder, Saswata; Dutta, Alo; Sinha, T. P.

    2017-03-01

    The AC electrical properties of polycrystalline double perovskite oxides A2HoSbO6 (A=Ba, Sr, Ca; AHS) synthesized by solid state reaction technique has been explored by using impedance spectroscopic studies. The Rietveld refinement of the room temperature X-ray diffraction data show that Ba2HoSbO6 (BHS) has cubic phase and Sr2HoSbO6 (SHS) and Ca2HoSbO6 (CHS) crystallize in monoclinic phase. The samples show significant frequency dispersion in their dielectric properties. The polydispersive nature of the relaxation mechanism is explained by the modified Cole-Cole model. The scaling behavior of dielectric loss indicate the temperature independence of the relaxation mechanism. The magnitude of the activation energy indicates that the hopping mechanism is responsible for carrier transport in AHS. The frequency dependent conductivity spectra follow the double power law. Impedance spectroscopic data presented in the Nyquist plot (Z" versus Z‧) are used to identify an equivalent circuit along with to know the grain, grain boundary and interface contributions. The constant phase element (CPE) is used to analyze the experimental response of BHS, SHS and CHS comprehending the contribution of different microstructural features to the conduction process. The temperature dependent electrical conductivity shows a semiconducting behavior.

  7. Investigations on structural and multiferroic properties of artificially engineered lead zirconate titanate-cobalt iron oxide layered nanostructures

    NASA Astrophysics Data System (ADS)

    Ortega Achury, Nora Patricia

    Mutiferroics are a novel class of next generation multifunctional materials, which display simultaneous magnetic, electric, and ferroelastic ordering, have drawn increasing interest due to their multi-functionality for a variety of device applications. Since, very rare single phase materials exist in nature this kind of properties, an intensive research activity is being pursued towards the development of new engineered materials with strong magneto-electric (ME) coupling. In the present investigation, we have fabricated polycrystalline and highly oriented PbZr0.53,Ti0.47O3--CoFe 2O4 (PZT/CFO) artificially multilayers (MLs) engineered nanostructures thin films which were grown on Pt/TiO2/SiO2/Si and La 0.5Sr0.5CoO3 (LSCO) coated (001) MgO substrates respectively, using the pulsed laser deposition technique. The effect of various PZT/CFO sandwich configurations having 3, 5, and 9 layers, while maintaining similar total PZT and CFO thickness, has been systematically investigated. The first part of this thesis is devoted to the analysis of structural and microstructure properties of the PZT/CFO MLs. X-ray diffraction (XRD) and micro Raman analysis revealed that PZT and CFO were in the perovskite and spinel phases respectively in the all layered nanostructure, without any intermediate phase. The TEM and STEM line scan of the ML thin films showed that the layered structure was maintained with little inter-diffusion near the interfaces at nano-metric scale without any impurity phase, however better interface was observed in highly oriented films. Second part of this dissertation was dedicated to study of the dielectric, impedance, modulus, and conductivity spectroscopies. These measurements were carried out over a wide range of temperatures (100 K to 600 K) and frequencies (100 Hz to 1 MHz) to investigate the grain and grain boundary effects on electrical properties of MLs. The temperature dependent dielectric and loss tangent illustrated step-like behavior and relaxation peaks near the step-up characteristic respectively. The Cole-Cole plots indicate that the most of the dielectric response came from the bulk (grains) MLs below 300 K, whereas grain boundaries and electrode-MLs effects prominent at elevated temperature. The dielectric loss relaxation peaks shifted to higher frequency side with increase in temperature, finally above 300 K, it went out experimental frequency window. Our Cole-Cole fitting of dielectric loss spectra indicated marked deviation from the ideal Debye type of relaxation which is more prominent at elevated temperature. Master modulus spectra support the observation from impedance spectra, it also indicate that the difference between C g and Cgb are higher compared to polycrystalline MLs indicating less effects of grain boundary in highly oriented MLs. We have explained these electrical properties of MLs by Maxwell-Wagner type contributions arising from the interfacial charge at the interface of the MLs structure. Three different types of frequency dependent conduction process were observed at elevated temperature (>300 K), which well fitted with the double power law, sigma(o) = sigma(0) + A 1on1 + A 2on2, it indicates conduction at: Low frequency (<1 kHz) may be due to long range ordering (frequency independent), mid frequency (<10 kHz) may be due to short range hopping, and high frequency (<1 MHz) due to the localized relaxation hopping mechanism. The last part of the thesis is devoted to the study of the multiferroic and magnetoelectric properties of the ML thin films. Both polycrystalline and highly oriented films showed well saturated ferroelectric and ferromagnetic hysteresis loops at room temperature. Temperature dependence of ferroelectric properties showed that polarization slowly decreases from 300 K to 200 K, with complete collapse of polarization at ˜ 100 K, but there was complete recovery of the polarization during heating, which was repeatable over many different experiments. At the same time, in the same temperature interval the remanent magnetization of the MLs showed slow enhancement in the magnitude till 200 K with three fold increase at 100 K compared to room temperature. This enhancement in remanent magnetization and decrease in remanent ferroelectric polarization on lowering the temperature indicate temperature dependent dynamic switching of ferroelectric polarization. Frequencies and temperatures dependence of the ferroelectric hysteresis loop showed weak frequency dependence for highly oriented MLs, while significant dependence was observed for polycrystalline MLs. The fatigue test showed almost 0-20% deterioration in polarization. The fatigue and strong temperature and frequency dependent magneto-electric coupling suggest the utility of MLs for Dynamic Magneto-Electric Random Access Memory (DMERAM) and magnetic field sensor devices.

  8. Frequency-dependent electrodeformation of giant phospholipid vesicles in AC electric field

    PubMed Central

    2010-01-01

    A model of vesicle electrodeformation is described which obtains a parametrized vesicle shape by minimizing the sum of the membrane bending energy and the energy due to the electric field. Both the vesicle membrane and the aqueous media inside and outside the vesicle are treated as leaky dielectrics, and the vesicle itself is modeled as a nearly spherical shape enclosed within a thin membrane. It is demonstrated (a) that the model achieves a good quantitative agreement with the experimentally determined prolate-to-oblate transition frequencies in the kilohertz range and (b) that the model can explain a phase diagram of shapes of giant phospholipid vesicles with respect to two parameters: the frequency of the applied alternating current electric field and the ratio of the electrical conductivities of the aqueous media inside and outside the vesicle, explored in a recent paper (S. Aranda et al., Biophys J 95:L19–L21, 2008). A possible use of the frequency-dependent shape transitions of phospholipid vesicles in conductometry of microliter samples is discussed. PMID:21886342

  9. Vibration characteristics of bone conducted sound in vitro.

    PubMed

    Stenfelt, S; Håkansson, B; Tjellström, A

    2000-01-01

    A dry skull added with damping material was used to investigate the vibratory pattern of bone conducted sound. Three orthogonal vibration responses of the cochleae were measured, by means of miniature accelerometers, in the frequency range 0.1-10 kHz. The exciter was attached to the temporal, parietal, and frontal bones, one at the time. In the transmission response to the ipsilateral cochlea, a profound low frequency antiresonance (attenuation) was found, verified psycho-acoustically, and shown to yield a distinct lateralization effect. It was also shown that, for the ipsilateral side, the direction of excitation coincides with that of maximum response. At the contralateral cochlea, no such dominating response direction was found for frequencies above the first skull resonance. An overall higher response level was achieved, for the total energy transmission in general and specifically for the direction of excitation, at the ipsilateral cochlea when the transducer was attached to the excitation point closest to the cochlea. The transranial attenuation was found to be frequency dependent, with values from -5 to 10 dB for the energy transmission and -30 to 40 dB for measurements in a single direction, with a tendency toward higher attenuation at the higher frequencies.

  10. Possible implications of global climate change on global lightning distributions and frequencies

    NASA Technical Reports Server (NTRS)

    Price, Colin; Rind, David

    1994-01-01

    The Goddard Institute for Space Studies (GISS) general circulation model (GCM) is used to study the possible implications of past and future climate change on global lightning frequencies. Two climate change experiments were conducted: one for a 2 x CO2 climate (representing a 4.2 degs C global warming) and one for a 2% decrease in the solar constant (representing a 5.9 degs C global cooling). The results suggest at 30% increase in global lightning activity for the warmer climate and a 24% decrease in global lightning activity for the colder climate. This implies an approximate 5-6% change in global lightning frequencies for every 1 degs C global warming/cooling. Both intracloud and cloud-to-ground frequencies are modeled, with cloud-to-ground lightning frequencies showing larger sensitivity to climate change than intracloud frequencies. The magnitude of the modeled lightning changes depends on season, location, and even time of day.

  11. Influence of Pore Structure on SIP Properties Deduced from Micro-Scale Modelling

    NASA Astrophysics Data System (ADS)

    Volkmann, Jan; Klitzsch, Norbert; Wiens, Eugen; Mohnke, Oliver

    2010-05-01

    In geophysics frequency dependent complex resistivity measurements are called Spectral Induced Polarization (SIP). In other fields this method is known as Impedance Spectroscopy. In the last two decades many empirical relations were proposed which relate the frequency dependent electrical properties of water saturated rocks to structural properties such as pore radius and inner surface area, or to hydraulic conductivity. Unfortunately, these relations are not universal; they apply only for specific rock types and water compositions. In order to quantify the influence of inner rock structure (as well as of electrochemical water and rock properties) on the frequency dependent electrical properties we model the charge transport processes at the pore space using Comsol Multiphysics. In the frequency domain the effect of Induced Polarization (IP) is characterised by a phase shift between a measured electric current and an alternating voltage applied to the ground. A possible origin of this behaviour particularly for nonconducting rock minerals can be seen in the membrane polarization model as proposed by Marshall and Madden. This model describes a system of electrolyte filled pores. Different mobilities of cations and anions in the small pores cause a membrane effect and thus an electrical polarization. We aim to find a more realistic way of modelling the membrane polarization effect than using the simple Marshall and Madden model. The electric double layer, the origin of the Induced Polarization effect, is caused by surface charges located at the electrolyte rock interface. Thus, the EDL as a boundary effect is accounted for by reduced ion mobilities at the inner surface area. The governing equations and boundary conditions for a system of larger and smaller pores with applied voltage are expressed in frequency domain using a time harmonic approach, the electric current is determined to obtain information about amplitude and phase of the complex resistivity. The results are compared to corresponding theoretic and experimental results. The model is applied to study the influence of pore sizes and pore structure as well as of electrolyte properties like ion mobilities and concentrations. We find two characteristic phase minima in the frequency range 1mHz - 100MHz. The dependence of the 'high frequency' minimum (f > 10kHz) on the electrolyte concentration and the dependence of the corresponding relaxation times on variations of the pore geometry are in good agreement with the classical Maxwell-Wagner theory. In contrast to this effective medium approach the simulations confirm the necessity of pore throats to obtain non-vanishing phase values. For large size differences of the smaller and larger pores a second 'low frequency' minimum (f < 10kHz) exists. Its relaxation time mainly depends on the length of the large pores of the system. Furthermore we find a decreasing phase amplitude with increasing electrolyte concentration not predicted by Marshall and Madden and similar models but confirmed by experimental results. This study was conducted within the Transregional Collaborative Research Centre 32 (SFB TR 32; subproject A2), funded by the German Research Foundation (DFG). Present and future studies are supported by the Deutsche Gesellschaft für Erdöl, Erdgas und Kohle e.V. (DGMK).

  12. Frequency dependent ac transport of films of close-packed carbon nanotube arrays

    NASA Astrophysics Data System (ADS)

    Endo, A.; Katsumoto, S.; Matsuda, K.; Norimatsu, W.; Kusunoki, M.

    2018-03-01

    We have measured low-temperature ac impedance of films of closely-packed, highly-aligned carbon nanotubes prepared by thermal decomposition of silicon carbide wafers. The measurement was performed on films with the thickness (the length of the nanotubes) ranging from 6.5 to 65 nm. We found that the impedance rapidly decreases with the frequency. This can be interpreted as resulting from the electric transport via capacitive coupling between adjacent nanotubes. We also found numbers of sharp spikes superposed on frequency vs. impedance curves, which presumably represent resonant frequencies seen in the calculated conductivity of random capacitance networks. Capacitive coupling between the nanotubes was reduced by the magnetic field perpendicular to the films at 8.2 mK, resulting in the transition from negative to positive magnetoresistance with an increase of the frequency.

  13. Comparative Proteomic Analysis of Liver Steatosis and Fibrosis after Oral Hepatotoxicant Administration in Sprague-Dawley Rats.

    PubMed

    McDyre, B Claire; AbdulHameed, Mohamed Diwan M; Permenter, Matthew G; Dennis, William E; Baer, Christine E; Koontz, Jason M; Boyle, Molly H; Wallqvist, Anders; Lewis, John A; Ippolito, Danielle L

    2018-02-01

    The past decade has seen an increase in the development and clinical use of biomarkers associated with histological features of liver disease. Here, we conduct a comparative histological and global proteomics analysis to identify coregulated modules of proteins in the progression of hepatic steatosis or fibrosis. We orally administered the reference chemicals bromobenzene (BB) or 4,4'-methylenedianiline (4,4'-MDA) to male Sprague-Dawley rats for either 1 single administration or 5 consecutive daily doses. Livers were preserved for histopathology and global proteomics assessment. Analysis of liver sections confirmed a dose- and time-dependent increase in frequency and severity of histopathological features indicative of lipid accumulation after BB or fibrosis after 4,4'-MDA. BB administration resulted in a dose-dependent increase in the frequency and severity of inflammation and vacuolation. 4,4'-MDA administration resulted in a dose-dependent increase in the frequency and severity of periportal collagen accumulation and inflammation. Pathway analysis identified a time-dependent enrichment of biological processes associated with steatogenic or fibrogenic initiating events, cellular functions, and toxicological states. Differentially expressed protein modules were consistent with the observed histology, placing physiologically linked protein networks into context of the disease process. This study demonstrates the potential for protein modules to provide mechanistic links between initiating events and histopathological outcomes.

  14. Structural, electrical properties and dielectric relaxations in Na+-ion-conducting solid polymer electrolyte

    NASA Astrophysics Data System (ADS)

    Arya, Anil; Sharma, A. L.

    2018-04-01

    In this paper, we have studied the structural, microstructural, electrical, dielectric properties and ion dynamics of a sodium-ion-conducting solid polymer electrolyte film comprising PEO8-NaPF6+  x wt. % succinonitrile. The structural and surface morphology properties have been investigated, respectively using x-ray diffraction and field emission scanning electron microscopy. The complex formation was examined using Fourier transform infrared spectroscopy, and the fraction of free anions/ion pairs obtained via deconvolution. The complex dielectric permittivity and loss tangent has been analyzed across the whole frequency window, and enables us to estimate the DC conductivity, dielectric strength, double layer capacitance and relaxation time. The presence of relaxing dipoles was determined by the addition of succinonitrile (wt./wt.) and the peak shift towards high frequency indicates the decrease of relaxation time. Further, relations among various relaxation times ({{τ }{{\\varepsilon \\prime}}}>~{{τ }tanδ }>{{τ }z}>{{τ }m} ) have been elucidated. The complex conductivity has been examined across the whole frequency window; it obeys the Universal Power Law, and displays strong dependency on succinonitrile content. The sigma representation ({{σ }\\prime\\prime}~versus~{{σ }\\prime} ) was introduced in order to explore the ion dynamics by highlighting the dispersion region in the Cole–Cole plot ({{\\varepsilon }\\prime\\prime}~versus~{{\\varepsilon }\\prime} ) in the lower frequency window; increase in the semicircle radius indicates a decrease of relaxation time. This observation is accompanied by enhancement in ionic conductivity and faster ion transport. A convincing, logical scheme to justify the experimental data has been proposed.

  15. Locating arbitrarily time-dependent sound sources in three dimensional space in real time.

    PubMed

    Wu, Sean F; Zhu, Na

    2010-08-01

    This paper presents a method for locating arbitrarily time-dependent acoustic sources in a free field in real time by using only four microphones. This method is capable of handling a wide variety of acoustic signals, including broadband, narrowband, impulsive, and continuous sound over the entire audible frequency range, produced by multiple sources in three dimensional (3D) space. Locations of acoustic sources are indicated by the Cartesian coordinates. The underlying principle of this method is a hybrid approach that consists of modeling of acoustic radiation from a point source in a free field, triangulation, and de-noising to enhance the signal to noise ratio (SNR). Numerical simulations are conducted to study the impacts of SNR, microphone spacing, source distance and frequency on spatial resolution and accuracy of source localizations. Based on these results, a simple device that consists of four microphones mounted on three mutually orthogonal axes at an optimal distance, a four-channel signal conditioner, and a camera is fabricated. Experiments are conducted in different environments to assess its effectiveness in locating sources that produce arbitrarily time-dependent acoustic signals, regardless whether a sound source is stationary or moves in space, even toward behind measurement microphones. Practical limitations on this method are discussed.

  16. Multiferroic properties of Indian natural ilmenite

    NASA Astrophysics Data System (ADS)

    Acharya, Truptimayee; Choudhary, R. N. P.

    2017-03-01

    In this communication, the main results and analysis of extensive studies of electric and magnetic characteristics (relative dielectric constant, tangent loss, electric polarization, electric transport, impedance, magnetic polarization and magneto-electric coupling coefficient) of Indian natural ilmenite (NI) have been presented. Preliminary structural analysis was studied by Rietveld refinement of room temperature XRD data, which suggests the rhombohedral crystal system of NI. Maxwell-Wagner mechanism was used to explain the nature of the frequency dependence of the relative dielectric constant. The impedance analysis reveals that below 270 °C, only the bulk contributes, whereas at higher temperature, both grain boundary and the bulk contribute to the resistive characteristics of the material. The magnitude of the depression angles of the semicircles in the Nyquist plot has been estimated. The correlated barrier hopping model has been used to explain the frequency dependence of ac conductivity of the material. The activation energy of the compound has been estimated using the temperature dependence of dc conductivity plot. The obtained polarization hysteresis loops manifest improper ferroelectric behavior of NI. The existence M-H hysteresis loop supports anti-ferromagnetism in the studied material. The magneto-electric voltage coupling coefficient is found to be 0.7 mV/cm Oe. Hence, other than dielectric constant, electric polarization, magnetization and magneto-electric studies support the existence of multiferroic properties in NI.

  17. Anomalous frequency and temperature-dependent scattering and Hund's coupling in the almost quantum critical heavy-fermion system CeFe2Ge2

    NASA Astrophysics Data System (ADS)

    Bossé, G.; Pan, LiDong; Li, Yize S.; Greene, L. H.; Eckstein, J.; Armitage, N. P.

    2016-02-01

    We present THz range optical conductivity data of a thin film of the near quantum critical heavy-fermion compound CeFe2Ge2 . Our complex conductivity measurements find a deviation from conventional Drude-like transport in a temperature range previously reported to exhibit unconventional behavior. We calculate the frequency-dependent effective mass and scattering rate using an extended Drude model analysis. We find the inelastic scattering rate can be described by a temperature-dependent power law ωn (T ), where n (T ) approaches ˜1.0 ±0.2 at 1.5 K. This is compared to the ρ ˜T1.5 behavior claimed in dc resistivity data and the ρ ˜T2 expected from Fermi-liquid theory. In addition to a low-temperature mass renormalization, we find an anomalous mass renormalization that persists to high temperature. We attribute this to a Hund's coupling in the Fe states in a manner similar to that recently proposed in the ferropnictides. CeFe2Ge2 appears to be a very interesting system where one may study the interplay between the usual 4 f lattice Kondo effect and this Hund's enhanced Kondo effect in the 3 d states.

  18. An enhanced rheometer inertia correction procedure (ERIC) for the study of gelling systems using combined motor-transducer rheometers

    NASA Astrophysics Data System (ADS)

    Hudson, R. E.; Holder, A. J.; Hawkins, K. M.; Williams, P. R.; Curtis, D. J.

    2017-12-01

    The rheological characterisation of viscoelastic materials undergoing a sol-gel transition at the Gel Point (GP) has important applications in a wide range of industrial, biological, and clinical environments and can provide information regarding both kinetic and microstructural aspects of gelation. The most rigorous basis for identifying the GP involves exploiting the frequency dependence of the real and imaginary parts of the complex shear modulus of the critical gel (the system at the GP) measured under small amplitude oscillatory shear conditions. This approach to GP identification requires that rheological data be obtained over a range of oscillatory shear frequencies. Such measurements are limited by sample mutation considerations (at low frequencies) and, when experiments are conducted using combined motor-transducer (CMT) rheometers, by instrument inertia considerations (at high frequencies). Together, sample mutation and inertia induced artefacts can lead to significant errors in the determination of the GP. Overcoming such artefacts is important, however, as the extension of the range of frequencies available to the experimentalist promises both more accurate GP determination and the ability to study rapidly gelling samples. Herein, we exploit the frequency independent viscoelastic properties of the critical gel to develop and evaluate an enhanced rheometer inertia correction procedure. The procedure allows acquisition of valid GP data at previously inaccessible frequencies (using CMT rheometers) and is applied in a study of the concentration dependence of bovine gelatin gelation GP parameters. A previously unreported concentration dependence of the stress relaxation exponent (α) for critical gelatin gels has been identified, which approaches a limiting value (α = 0.7) at low gelatin concentrations, this being in agreement with previous studies and theoretical predictions for percolating systems at the GP.

  19. Electric properties of nanostructure (FeCoZr)x(CaF2)(100-x) produced in argon Ar atmosphere

    NASA Astrophysics Data System (ADS)

    Bondariev, Vitalii; Czarnacka, Karolina; Boiko, Oleksandr

    2015-09-01

    The paper presents frequency f and temperature Tp dependences of conductivity σ, capacitance Cp and phase shift angle θ for the nanocomposite metal-dielectric (FeCoZr)x(CaF2)(100-x). Samples of nanocomposite were produced by ion-beam sputtering in pure argon Ar atmosphere. Partial pressure of gas Ar in the ion source pAr=1.1×10-1Pa. Contains of metallic phase in tested sample is x = 54.6 at.%. Studies carried out by stand to measuring of AC electrical properties of nanocomposites and semiconductors. The measurements have been performed using alternating current within the frequency range of 50 Hz - 1 MHz for measuring temperatures ranging from 77 K to 373 K. On the frequency-temperature dependence of phase shift angle θ at low frequencies phase shift have capacitive character and at high frequencies - inductive. Position of fmin on the frequency dependence on capacitance Cp corresponds exactly to the resonance frequency fR for which the angle θ crosses zero. Analysis of the results showed that phenomena similar to phenomena in conventional circuit RLC occur in the nanocomposite (CoFeZr)54.6(CaF2)45.4. Jumping recharging between the defects leads to the formation of dipoles and consequently to the increase of permittivity. After a time τ electron returns to the first defect and dipole disappears. The formation of inductance in nanocomposite is associated with return jumps of electrons from defect with negative charge to the defect with positive charge, set by the time, which are characterized by low values of activation energy.

  20. A large coaxial reflection cell for broadband dielectric characterization of coarse-grained materials

    NASA Astrophysics Data System (ADS)

    Bore, Thierry; Bhuyan, Habibullah; Bittner, Tilman; Murgan, Vignesh; Wagner, Norman; Scheuermann, Alexander

    2018-01-01

    Knowledge of the frequency-dependent electromagnetic properties of coarse-grained materials is imperative for the successful application of high frequency electromagnetic measurement techniques for near and subsurface monitoring. This paper reports the design, calibration and application of a novel one-port large coaxial cell for broadband complex permittivity measurements of civil engineering materials. It was designed to allow the characterization of heterogeneous material with large aggregate dimensions (up to 28 mm) over a frequency range from 1 MHz-860 MHz. In the first step, the system parameters were calibrated using the measured scattering function in a perfectly known dielectric material in an optimization scheme. In the second step, the method was validated with measurements made on standard liquids. Then the performance of the cell was evaluated on a compacted coarse-grained soil. The dielectric spectra were obtained by means of fitting the measured scattering function using a transverse electromagnetic mode propagation model considering the frequency-dependent complex permittivity. Two scenarios were systematically analyzed and compared. The first scenario consisted of a broadband generalized dielectric relaxation model with two Cole-Cole type relaxation processes related to the interaction of the aqueous phase and the solid phase, a constant high frequency contribution as well as an apparent direct current conductivity term. The second scenario relied on a three-phase theoretical mixture equation which was used in a forward approach in order to calibrate the model. Both scenarios provide almost identical results for the broadband effective complex relative permittivity. The combination of both scenarios suggests the simultaneous estimation of water content, density, bulk and pore water conductivity for road base materials for in situ applications.

  1. Phase Separation During the Curing of a Cyanate Ester Oligomer

    NASA Astrophysics Data System (ADS)

    Gurov, D. A.; Novikov, G. F.

    2018-07-01

    It is found during the curing of a cyanate ester oligomer that there are such features as a step and a maximum in the frequency dependences (in a range of 10-2-105 Hz) of the real parts of the complex electric conductivity and loss tangent, respectively. In the frequency range where these features are observed, the diagrams of complex electric modulus are semicircles with centers near the abscissas. Subsequent analysis shows these features are due to the formation of the microphase of the intermediate product, carbamate.

  2. Dielectric and conductivity studies of Co-Cu mixed ferrite

    NASA Astrophysics Data System (ADS)

    Parveez, Asiya; Shekhawat, M. S.; Nayeem, Firdous; Mohd. Shariff, S.; Sinha, R. R.; Khader, S. Abdul

    2018-05-01

    Nanoparticles of Co-Cu mixed ferrite having the basic composition Co1-xCuxFe2O4(x=0, 0.2, 0.4, 0.6, 0.8 and 1.0) were synthesized using nitrate-citrate combustion method. Structural, dielectric and a.c conductivity of nanopowders, which are sintered at 900°C were studied. Powder X-ray diffraction studies confirmed phase and their nanocrystalline nature. The peaks observed in the XRD spectrum indicated single phase spinel cubic structure for the synthesized samples. Surface morphology of the samples has been investigated using High ResolutionScanning Electron Microscope. The dielectric constant (ɛ') and dielectric loss factor (ɛ″) of nanocrystalline Co-Cu mixed ferrites were investigated as a function of frequency and Cu+2 concentration at room temperature over the frequency range 100 Hz to 1 MHz using Hioki make LCR Hi-Tester 3250. Synthesized mixed ferrites exhibited usual dielectric dispersion, dependence of ɛ' and ɛ″ with the frequency of the alternating applied electric field is in accordance with the Maxwell-Wagner type interfacial polarization. The electrical conductivity (σac) deduced from the measured dielectric data has been thoroughly analyzed and found that the conduction mechanism in Co1-xCuxFe2O4 mixed nanoferrites are in conformity with the electron hopping model.

  3. NMR relaxation studies in doped poly-3-methylthiophene

    NASA Astrophysics Data System (ADS)

    Singh, K. Jugeshwar; Clark, W. G.; Gaidos, G.; Reyes, A. P.; Kuhns, P.; Thompson, J. D.; Menon, R.; Ramesh, K. P.

    2015-05-01

    NMR relaxation rates (1 /T1 ), magnetic susceptibility, and electrical conductivity studies in doped poly-3-methylthiophene are reported in this paper. The magnetic susceptibility data show the contributions from both Pauli and Curie spins, with the size of the Pauli term depending strongly on the doping level. Proton and fluorine NMR relaxation rates have been studied as a function of temperature (3-300 K) and field (for protons at 0.9, 9.0, 16.4, and 23.4 T, and for fluorine at 9.0 T). The temperature dependence of T1 is classified into three regimes: (a) For T <(g μBB /2 kB ) , the relaxation mechanism follows a modified Korringa relation due to electron-electron interactions and disorder. 1H - T1 is due to the electron-nuclear dipolar interaction in addition to the contact term. (b) For the intermediate temperature range (g μBB /2 kB )

  4. Towards Thermal Reading of Magnetic States in Hall Crosses

    NASA Astrophysics Data System (ADS)

    Xu, Y.; Petit-Watelot, S.; Polewczyk, V.; Parent, G.; Montaigne, F.; Wegrowe, J.-E.; Mangin, S.; Lacroix, D.; Hehn, M.; Lacour, D.

    2018-03-01

    The 3 ω method is a standard way to measure the thermal conductivity of thin films. In this study, we apply the method to read the magnetic state of a perpendicularly magnetized CoTb ferrimagnetic Hall cross using a thermal excitation. In order to generate the thermal excitation, an oscillating current at an ω frequency is applied to the Hall cross using different geometries. The magnetic signals oscillating at ω , 2 ω , and 3 ω are probed using a lock-in technique. From the analysis of the power dependence, we can attribute the 3 ω response to the temperature oscillation and the 2 ω to the temperature-gradient oscillation. Finally, the frequency dependence of the magnetic signals can be understood by considering the heat diffusion in a two-dimensional model.

  5. Determination of medium electrical properties through full-wave modelling of frequency domain reflectrometry data

    NASA Astrophysics Data System (ADS)

    André, Frédéric; Lambot, Sébastien

    2015-04-01

    Accurate knowledge of the shallow soil properties is of prime importance in agricultural, hydrological and environmental engineering. During the last decade, numerous geophysical techniques, either invasive or resorting to proximal or remote sensing, have been developed and applied for quantitative characterization of soil properties. Amongst them, time domain reflectrometry (TDR) and frequency domain reflectometry (FDR) are recognized as standard techniques for the determination of soil dielectric permittivity and electrical conductivity, based on the reflected electromagnetic waves from a probe inserted into the soil. TDR data were first commonly analyzed in the time domain using methods considering only a part of the waveform information. Later, advancements have led to the possibility of analyzing the TDR signal through full-wave inverse modeling either in the time or the frequency domains. A major advantage of FDR compared to TDR is the possibility to increase the bandwidth, thereby increasing the information content of the data and providing more detailed characterization of the medium. Amongst the recent works in this field, Minet et al. (2010) developed a modeling procedure for processing FDR data based on an exact solution of Maxwell's equations for wave propagation in one-dimensional multilayered media. In this approach, the probe head is decoupled from the medium and is fully described by characteristic transfer functions. The authors successfully validated the method for homogeneous sand subject to a range of water contents. In the present study, we further validated the modelling approach using reference liquids with well-characterized frequency-dependent electrical properties. In addition, the FDR model was coupled with a dielectric mixing model to investigate the ability of retrieving water content, pore water electrical conductivity and sand porosity from inversion of FDR data acquired in sand subject to different water content levels. Finally, the possibility of reconstructing the vertical profile of the properties by inversion of FDR data collected during progressive insertion of the probe into a vertically heterogeneous medium was also investigated. Index Terms: Frequency domain reflectrometry (FDR), frequency dependence, dielectric permittivity, electrical conductivity Reference: Minet J., Lambot S., Delaide G., Huisman J.A., Vereecken H., Vanclooster M., 2010. A generalized frequency domain reflectometry modeling technique for soil electrical properties determination. Vadose Zone Journal, 9: 1063-1072.

  6. Synthesis and electrochemical studies of charge-transfer complexes of thiazolidine-2,4-dione with σ and π acceptors

    NASA Astrophysics Data System (ADS)

    Singh, Prashant; Kumar, Pradeep; Katyal, Anju; Kalra, Rashmi; Dass, Sujata K.; Prakash, Satya; Chandra, Ramesh

    2010-03-01

    In the present work, we report the synthesis and characterization of novel charge-transfer complexes of thiazolidine-2,4-dione (TZD) with sigma acceptor (iodine) and pi acceptors (chloranil, dichlorodicyanoquinone, picric acid and duraquinone). We also evaluated their thermal and electrochemical properties and we conclude that these complexes are frequency dependent. Charge-transfer complex between thiazolidine-2,4-dione and iodine give best conductivity. In conclusion, complex with sigma acceptors are more conducting than with pi acceptors.

  7. Magnetotransport properties of 8-Pmmn borophene: effects of Hall field and strain.

    PubMed

    Islam, S K Firoz

    2018-07-11

    The polymorph of 8-Pmmn borophene is an anisotropic Dirac material with tilted Dirac cones at two valleys. The tilting of the Dirac cones at two valleys are in opposite directions, which manifests itself via the valley dependent Landau levels in presence of an in-plane electric field (Hall field). The valley dependent Landau levels cause valley polarized magnetotransport properties in presence of the Hall field, which is in contrast to the monolayer graphene with isotropic non-tilted Dirac cones. The longitudinal conductivity and Hall conductivity are evaluated by using linear response theory in low temperature regime. An analytical approximate form of the longitudinal conductivity is also obtained. It is observed that the tilting of the Dirac cones amplifies the frequency of the longitudinal conductivity oscillation (Shubnikov-de Haas). On the other hand, the Hall conductivity exhibits graphene-like plateaus except the appearance of valley dependent steps which are purely attributed to the Hall field induced lifting of the valley degeneracy in the Landau levels. Finally we look into the different cases when the Hall field is applied to the strained borophene and find that valley dependency is fully dominated by strain rather than Hall field. Another noticeable point is that if the real magnetic field is replaced by the strain induced pseudo magnetic field then the electric field looses its ability to cause valley polarized transport.

  8. Feasibility of controlling speed-dependent low-frequency brake vibration amplification by modulating actuation pressure

    NASA Astrophysics Data System (ADS)

    Sen, Osman Taha; Dreyer, Jason T.; Singh, Rajendra

    2014-12-01

    In this article, a feasibility study of controlling the low frequency torque response of a disc brake system with modulated actuation pressure (in the open loop mode) is conducted. First, a quasi-linear model of the torsional system is introduced, and analytical solutions are proposed to incorporate the modulation effect. Tractable expressions for three different modulation schemes are obtained, and conditions that would lead to a reduction in the oscillatory amplitudes are identified. Second, these conditions are evaluated with a numerical model of the torsional system with clearance nonlinearity, and analytical solutions are verified in terms of the trends observed. Finally, a laboratory experiment with a solenoid valve is built to modulate actuation pressure with a constant duty cycle, and time-frequency domain data are acquired. Measurements are utilized to assess analytical observations, and all methods show that the speed-dependent brake torque amplitudes can be altered with an appropriate modulation of actuation pressure.

  9. Comparative study of mobility extraction methods in p-type polycrystalline silicon thin film transistors

    NASA Astrophysics Data System (ADS)

    Liu, Kai; Liu, Yuan; Liu, Yu-Rong; En, Yun-Fei; Li, Bin

    2017-07-01

    Channel mobility in the p-type polycrystalline silicon thin film transistors (poly-Si TFTs) is extracted using Hoffman method, linear region transconductance method and multi-frequency C-V method. Due to the non-negligible errors when neglecting the dependence of gate-source voltage on the effective mobility, the extracted mobility results are overestimated using linear region transconductance method and Hoffman method, especially in the lower gate-source voltage region. By considering of the distribution of localized states in the band-gap, the frequency independent capacitance due to localized charges in the sub-gap states and due to channel free electron charges in the conduction band were extracted using multi-frequency C-V method. Therefore, channel mobility was extracted accurately based on the charge transport theory. In addition, the effect of electrical field dependent mobility degradation was also considered in the higher gate-source voltage region. In the end, the extracted mobility results in the poly-Si TFTs using these three methods are compared and analyzed.

  10. Microstrip Patch Sensor for Salinity Determination.

    PubMed

    Lee, Kibae; Hassan, Arshad; Lee, Chong Hyun; Bae, Jinho

    2017-12-18

    In this paper, a compact microstrip feed inset patch sensor is proposed for measuring the salinities in seawater. The working principle of the proposed sensor depends on the fact that different salinities in liquid have different relative permittivities and cause different resonance frequencies. The proposed sensor can obtain better sensitivity to salinity changes than common sensors using conductivity change, since the relative permittivity change to salinity is 2.5 times more sensitive than the conductivity change. The patch and ground plane of the proposed sensor are fabricated by conductive copper spray coating on the masks made by 3D printer. The fabricated patch and the ground plane are bonded to a commercial silicon substrate and then attached to 5 mm-high chamber made by 3D printer so that it contains only 1 mL seawater. For easy fabrication and testing, the maximum resonance frequency was selected under 3 GHz and to cover salinities in real seawater, it was assumed that the salinity changes from 20 to 35 ppt. The sensor was designed by the finite element method-based ANSYS high-frequency structure simulator (HFSS), and it can detect the salinity with 0.01 ppt resolution. The designed sensor has a resonance frequency separation of 37.9 kHz and reflection coefficients under -20 dB at the resonant frequencies. The fabricated sensor showed better performance with average frequency separation of 48 kHz and maximum reflection coefficient of -35 dB. By comparing with the existing sensors, the proposed compact and low-cost sensor showed a better detection capability. Therefore, the proposed patch sensor can be utilized in radio frequency (RF) tunable sensors for salinity determination.

  11. Potential formulation of the dispersion relation for a uniform, magnetized plasma with stationary ions in terms of a vector phasor

    NASA Astrophysics Data System (ADS)

    Johnson, Robert W.

    2012-06-01

    The derivation of the helicon dispersion relation for a uniform plasma with stationary ions subject to a constant background magnetic field is reexamined in terms of the potential formulation of electrodynamics. Under the same conditions considered by the standard derivation, the nonlinear self-coupling between the perturbed electron flow and the potential it generates is addressed. The plane wave solution for general propagation vector is determined for all frequencies and expressed in terms of a vector phasor. The behavior of the solution as described in vacuum units depends upon the ratio of conductivity to the magnitude of the background field. Only at low conductivity and below, the cyclotron frequency can significant propagation occur as determined by the ratio of skin depth to wavelength.

  12. Optical spectroscopy study of the three-dimensional Dirac semimetal ZrTe 5

    DOE PAGES

    Chen, R. Y.; Gu, G. D.; Zhang, S. J.; ...

    2015-08-05

    Three-dimensional (3D) topological Dirac materials have been under intensive study recently. The layered compound ZrTe 5 has been suggested to be one such material as a result of transport and angle-resolved photoemission spectroscopy experiments. Here, we perform infrared reflectivity measurements to investigate the underlying physics of this material. The derived optical conductivity increases linearly with frequency below normal interband transitions, which provides optical spectroscopic proof of a 3D Dirac semimetal. In addition, the plasma edge shifts dramatically to lower energy upon temperature cooling, which might be due to the shrinking of the lattice parameters. Additionally, an extremely sharp peak showsmore » up in the frequency-dependent optical conductivity, indicating the presence of a Van Hove singularity in the joint density of state.« less

  13. A multi-frequency radiometric measurement of soil moisture content over bare and vegetated fields

    NASA Technical Reports Server (NTRS)

    Wang, J. R.; Schmugge, T. J.; Gould, W. I.; Glazar, W. S.; Fuchs, J. E.; Mcmurtrey, J. E., III

    1982-01-01

    An experiment on soil moisture remote sensing was conducted during July to September 1981 on bare, grass, and alfalfa fields at frequencies of 0.6, 1.4, 5.0, and 10.6 GHz with radiometers mounted on mobile towers. The results confirm the frequency dependence of sensitivity reduction due to the presence of vegetation cover. For the type of vegetated fields reported here, the vegetation effect is appreciable even at 0.6 GHz. Measurements over bare soil show that when the soil is wet, the measured brightness temperature is lowest at 5.0 GHz and highest at 0.6 GHz, a result contrary to the expectation based on the estimated dielectric permittivity of soil-water mixtures and the current radiative transfer model in that frequency range.

  14. DC bias effect on alternating current electrical conductivity of poly(ethylene terephthalate)/alumina nanocomposites

    NASA Astrophysics Data System (ADS)

    Nikam, Pravin N.; Deshpande, Vineeta D.

    2016-05-01

    Polymer nanocomposites based on metal oxide (ceramic) nanoparticles are a new class of materials with unique properties and designed for various applications such as electronic device packaging, insulation, fabrication and automotive industries. Poly(ethylene terephthalate) (PET)/alumina (Al2O3) nanocomposites with filler content between 1 wt% and 5 wt% were prepared by melt compounding method using co-rotating twin screw extruder and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and precision LCR meter techniques. The results revealed that proper uniform dispersion at lower content up to 2 wt% of nano-alumina observed by using TEM. Aggregation of nanoparticles was observed at higher content of alumina examined by using SEM and TEM. The frequency dependences of the alternating current (AC) conductivity (σAC) of PET/alumina nanocomposites on the filler content and DC bias were investigated in the frequency range of 20Hz - 1MHz. The results showed that the AC and direct current (DC) conductivity increases with increasing DC bias and nano-alumina content upto 3 wt%. It follows the Jonscher's universal power law of solids. It revealed that σAC of PET/alumina nanocomposites can be well characterized by the DC conductivity (σDC), critical frequency (ωc), critical exponent of the power law (s). Roll of DC bias potential led to an increase of DC conductivity (σDC) due to the creation of additional conducting paths with the polymer nanocomposites and percolation behavior achieved through co-continuous morphology.

  15. cAmp activation of apical membrane Cl(-) channels: theoretical considerations for impedance analysis.

    PubMed Central

    Păunescu, T G; Helman, S I

    2001-01-01

    Transepithelial electrical impedance analysis provides a sensitive method to evaluate the conductances and capacitances of apical and basolateral plasma membranes of epithelial cells. Impedance analysis is complicated, due not only to the anatomical arrangement of the cells and their paracellular shunt pathways, but also in particular to the existence of audio frequency-dependent capacitances or dispersions. In this paper we explore implications and consequences of anatomically related Maxwell-Wagner and Cole-Cole dielectric dispersions that impose limitations, approximations, and pitfalls of impedance analysis when tissues are studied under widely ranging spontaneous rates of transport, and in particular when apical membrane sodium and chloride channels are activated by adenosine 3',5'-cyclic monophosphate (cAMP) in A6 epithelia. We develop the thesis that capacitive relaxation processes of any origin lead not only to dependence on frequency of the impedance locus, but also to the appearance of depressed semicircles in Nyquist transepithelial impedance plots, regardless of the tightness or leakiness of the paracellular shunt pathways. Frequency dependence of capacitance precludes analysis of data in traditional ways, where capacitance is assumed constant, and is especially important when apical and/or basolateral membranes exhibit one or more dielectric dispersions. PMID:11463629

  16. Investigation of electrical studies of spinel FeCo2O4 synthesized by sol-gel method

    NASA Astrophysics Data System (ADS)

    Lobo, Laurel Simon; Kalainathan, S.; Kumar, A. Ruban

    2015-12-01

    In this work, spinel FeCo2O4 is synthesized by sol-gel method using succinic acid as a chelating agent at 900 °C. The structural, spectroscopic and morphological characterization was carried out by using X-ray diffraction (XRD), Fourier Transform Infrared Spectroscopy (FT-IR) and Scanning Electron Microscopy equipped with Energy Dispersive X-ray spectrometer (SEM-EDX). The M-H loop at room temperature confirms the ferromagnetic property of the sample. The frequency and temperature dependence of dielectric constant (εʹ) and dielectric loss (tan δ) shows the presence of Maxwell-Wagner relaxation in the sample due to the presence of oxygen vacancy. Nyquist plot for frequency and temperature domain signifies the presence of grain effect, grain boundary effect and electrode interface in the conduction process. Electric modulus under suppression of electrode polarization shows the grain and grain boundary effects. The electrode polarization is observed in the lower frequency range of the conductivity graph.

  17. Temperature and frequency response of conductivity in Ag2S doped chalcogenide glassy semiconductor

    NASA Astrophysics Data System (ADS)

    Ojha, Swarupa; Das, Anindya Sundar; Roy, Madhab; Bhattacharya, Sanjib

    2018-06-01

    The electric conductivity of chalcogenide glassy semiconductor xAg2S-(1-x)(0.5S-0.5Te) has been presented here as a function of temperature and frequency. Formation of different nanocrystallites has been confirmed from X-ray diffraction study. It is also noteworthy that average size of nanocrystallites decreases with the increase of dislocation density. Dc conductivity data have been interpreted using Mott's model and Greaves's model in low and high temperature regions respectively. Ac conductivity above the room temperature has been analyzed using Meyer-Neldel (MN) conduction rule. It is interestingly noted that Correlated Barrier Hopping (CBH) model is the most appropriate conduction mechanism for x = 0.35, where pairs of charge carrier are considered to hop over the potential barrier between the sites via thermal activation. To interpret experimental data for x = 0.45, modified non-overlapping small polaron tunnelling (NSPT) model is supposed to be appropriate model due to tunnelling through grain boundary. The conductivity spectra at various temperatures have been analyzed using Almond-West Formalism (power law model). Scaling of conductivity spectra reveals that electrical relaxation process of charge carriers (polaron) is temperature independent but depends upon the composition of the present chalcogenide glassy system.

  18. Anisotropy of human muscle via non invasive impedance measurements. Frequency dependence of the impedance changes during isometric contractions

    NASA Astrophysics Data System (ADS)

    Kashuri, Hektor

    In this thesis we present non invasive muscle impedance measurements using rotatable probes extending the work done by Aaron et al. (1997) by measuring not only the real part of the impedance but the imaginary part as well. The results reveal orientations of underlying muscle fibers via minima in resistance and reactance versus angle curves, suggesting this method as potentially useful for studying muscle properties in clinical and physiological research. Calculations of the current distribution for a slab of material with anisotropic conductivity show that the current distribution depends strongly on the separation of two current electrodes and as well as on its conducting anisotropy. Forearm muscle impedance measurements at 50 kHz done by Shiffman et al. (2003) had shown that both resistance (R) and reactance (X) increase during isometric contraction. We have extended these measurements in the 3 to 100 kHz range and we found that resistance (R) and reactance (X) both increase and their changes increased or decreased at frequency dependent rates. Analysis based on circuit models of changes in R and X during the short contraction pulses showed that the extra cellular fluid resistance increased by 3.9 +/- 1.4 %, while the capacitance increased by 5.6 +/- 2 %. For long contraction pulses at very low frequencies: (1) there was practically no change in R during contraction, which implies that these changes are due to cellular membrane or intracellular effects with the extra cellular water component not participating, and (2) in post contraction stage there were no morphological changes which means that drifts in R can only be due to physiological changes. Following Shiffman et al. (2003) we measured impedance changes of R and X during a triangular shaped pulse of force generated via isometric forearm muscle contraction at 50 kHz. We measured these changes in 3-100 kHz frequency range for a stair case pulse of forces and the results showed that they are frequency dependent. Analysis based on circuit models suggest that the increase of isometric forearm muscle contraction is accompanied with both extra and intra cellular effects. The decrease following it is accompanied with changes in the extra cellular components and with intracellular elements remaining at the values they have at the maximum contraction force.

  19. Dielectric and microstructure properties of polymer carbon black composites

    NASA Astrophysics Data System (ADS)

    Brosseau, C.; Boulic, F.; Queffelec, P.; Bourbigot, C.; Le Mest, Y.; Loaec, J.; Beroual, A.

    1997-01-01

    Dielectric and physicochemical properties of a composite material prepared by incorporating carbon black particles into a polymer matrix were investigated. Two types of carbon blacks, having very different structures of aggregates, were used. The volume fraction of the carbon blacks ranged from 0.2% to 7%, i.e. below and above the percolation threshold concentration observed from the measurements of dc conductivity. The composite samples were characterized in terms of: swelling by a compatible solvent, electron paramagnetic resonance (EPR) response, and frequency variation of permittivity. First, the article attempts to evaluate the diffusion coefficient of an appropriate solvent in these materials. Sorption kinetics experiments with toluene indicate that the initial uptake of solvent exhibits a square root dependence in time as a consequence of Fick's law and permit to evaluate the effective diffusion coefficient in the range 10-11-10-12 m2 s-1 depending on the volume fraction of the carbon black in the sample. Second, the analysis of the carbon black concentration dependence of the intensity and linewidth of the EPR signals indicates that EPR is an important experimental probe of the structure of the elasticity network. The most notable feature of the present work is that we find a correlation of the percolation threshold concentration which is detected from the dc electrical conductivity with moments of the EPR lines. The conclusions on the elasticity networks deduced from swelling measurements are confirmed by EPR data carried out on swollen samples. On qualitative grounds the role of the specific surface of carbon black is further analyzed. It is suggested that the elasticity network is mainly controlled by secondary (respectively primary) aggregates for samples containing low (respectively high) specific surface carbon blacks. Last, the article reports precise experimental data on the permittivity of these composite materials as a function of frequency. Thanks to a sensitive measurement technique using an impedance analyzer, we are able to measure the complex permittivity and permeability values of the samples in the frequency range from 108 to 1010 Hz. It is found that the real part of the permittivity is a function of frequency f, via a power law expression ɛ'=af-b, where a and b are two parameters depending upon carbon black concentration, in the range of frequency investigated. The data analysis reaffirms the result that percolation threshold is a key parameter for characterizing the topological arrangement in these structures.

  20. Determination of rock properties by low-frequency AC electrokinetics

    NASA Astrophysics Data System (ADS)

    Pengra, David B.; Xi Li, Sidney; Wong, Po-Zen

    1999-12-01

    In brine-saturated rock the existence of a mobile space charge at the fluid/solid interface leads to the electrokinetic phenomena of electroosmotic pressure and streaming potential. The coupling coefficients of these electrokinetic effects, when combined with the conductivity of the brine-saturated rock, determine the brine permeability of rock exactly. A sensitive low-frequency AC technique has been used to measure electrokinetic response of a collection of eight rock and four glass bead samples saturated with NaCl brine as a function of salt concentration (fluid conductivity of 0.5 to 6.38 S/m); the response of four of the original 12 samples has also been measured as a function of temperature from 0° to 50°C. All data verify the predicted permeability relationship. Additionally, the frequency response of the electroosmotic pressure signal alone can also be used to determine the permeability, given knowledge of experimental parameters. The concentration and temperature dependence of electroosmosis and streaming potential is found to mostly conform to the predictions of a simple model based on the Helmholtz-Smoluchowski equation, the Stern model of the electrochemical double layer, and an elementary theory of ionic conduction.

  1. Dielectric properties of (CuO, CaO2, and BaO)y/CuTl-1223 composites

    NASA Astrophysics Data System (ADS)

    Mumtaz, M.; Kamran, M.; Nadeem, K.; Jabbar, Abdul; Khan, Nawazish A.; Saleem, Abida; Tajammul Hussain, S.; Kamran, M.

    2013-07-01

    We synthesized (CuO, CaO2, and BaO)y/Cu0.5Tl0.5Ba2Ca2Cu3O10-δ (y = 0, 5%, 10%, 15%) composites by solid-state reaction and characterized them by x-ray diffraction, scanning electron microscopy, dc-resistivity, and Fourier transform infrared spectroscopy. Frequency and temperature dependent dielectric properties, such as real and imaginary parts of the dielectric constant, dielectric loss, and ac-conductivity of these composites were studied by capacitance and conductance measurements as a function of frequency (10 kHz to 10 MHz) and temperature (78 to 300 K). X-ray diffraction analysis reveals that the characteristic behavior of the superconductor phase and the structure of Cu0.5Tl0.5Ba2Ca2Cu3O10-δ are nearly undisturbed by doping with nanoparticles. Scanning electron microscopy images show the improvement in the intergranular linking between the superconducting grains occurring with increasing nanoparticle concentration. Microcracks are healed up with these nanoparticles, and superconducting volume fraction is also increased. Dielectric properties of these composites strongly depend on the frequency and temperature. Zero resistivity critical temperature and dielectric properties show opposite trends with the addition of nanoparticles to the Cu0.5Tl0.5Ba2Ca2Cu3O10-δ superconductor matrix.

  2. Age dependence of dielectric properties of bovine brain and ocular tissues in the frequency range of 400 MHz to 18 GHz

    NASA Astrophysics Data System (ADS)

    Schmid, Gernot; Überbacher, Richard

    2005-10-01

    In order to identify possible age-dependent dielectric properties of brain and eye tissues in the frequency range of 400 MHz to 18 GHz, measurements on bovine grey and white matter as well as on cornea, lens (cortical) and the vitreous body were performed using a commercially available open-ended coaxial probe and a computer-controlled vector network analyser. Freshly excised tissues of 52 animals of two age groups (42 adult animals, i.e. 16-24 month old and 10 young animals, i.e. 4-6 month old calves) were examined within 8 min (brain tissue) and 15 min (eye tissue), respectively, of the animals' death. Tissue temperatures for the measurements were 32 ± 1 °C and 25 ± 1 °C for brain and eye tissues, respectively. Statistical analysis of the measured data revealed significant differences in the dielectric properties of white matter and cortical lens tissue between the adult and the young group. In the case of white matter the mean values of conductivity and permittivity of young tissue were 15%-22% and 12%-15%, respectively, higher compared to the adult tissue in the considered frequency range. Similarly, young cortical lens tissue was 25%-76% higher in conductivity and 27%-39% higher in permittivity than adult cortical lens tissue.

  3. Initial results of stimulated radiation measurements during the HAARP campaign of September 2017

    NASA Astrophysics Data System (ADS)

    Yellu, A. D.; Scales, W. A.; Mahmoudian, A.; Siefring, C.; Bernhardt, P.

    2018-02-01

    Initial results of stimulated electromagnetic radiation observed during an ionosphere heating experiment conducted at the High-Frequency Active Auroral Program (HAARP) facility are reported. The frequency of the pump wave used in the heating is in the neighborhood of the third harmonic of the electron cyclotron frequency, and of interest are simulated electromagnetic emissions (SEEs) within ? kHz of the heating frequency known as narrowband SEE (NSEE) and the commonly known wideband SEE (WSEE) which occur within ? kHz of the pump wave frequency. With the transmit power maintained at maximum, and all other conditions of the experiment invariable, the characteristics of NSEE and WSEE as time progresses from the time the transmitter is switched on are detailed in the results. The dependence of the characteristics of the NSEE and WSEE with temporal evolution into the heating cycle are observed to be fundamentally different.

  4. CW and pulsed electrically detected magnetic resonance spectroscopy at 263 GHz/12 T on operating amorphous silicon solar cells

    NASA Astrophysics Data System (ADS)

    Akhtar, W.; Schnegg, A.; Veber, S.; Meier, C.; Fehr, M.; Lips, K.

    2015-08-01

    Here we describe a new high frequency/high field continuous wave and pulsed electrically detected magnetic resonance (CW EDMR and pEDMR) setup, operating at 263 GHz and resonance fields between 0 and 12 T. Spin dependent transport in illuminated hydrogenated amorphous silicon p-i-n solar cells at 5 K and 90 K was studied by in operando 263 GHz CW and pEDMR alongside complementary X-band CW EDMR. Benefiting from the superior resolution at 263 GHz, we were able to better resolve EDMR signals originating from spin dependent hopping and recombination processes. 5 K EDMR spectra were found to be dominated by conduction and valence band tail states involved in spin dependent hopping, with additional contributions from triplet exciton states. 90 K EDMR spectra could be assigned to spin pair recombination involving conduction band tail states and dangling bonds as the dominating spin dependent transport process, with additional contributions from valence band tail and triplet exciton states.

  5. Charge carrier dynamics and relaxation in (polyethylene oxide-lithium-salt)-based polymer electrolyte containing 1-butyl-1-methylpyrrolidinium bis(trifluoromethylsulfonyl)imide as ionic liquid

    NASA Astrophysics Data System (ADS)

    Karmakar, A.; Ghosh, A.

    2011-11-01

    In this paper we report the dynamics of charge carriers and relaxation in polymer electrolytes based on polyethylene oxide (PEO), lithium bis(trifluoromethylsulfonyl)imide (LiTFSI) and 1-butyl-1-methylpyrrolidinium bis(trifluoromethylsulfonyl)imide (BMPTFSI) ionic liquid prepared by solution cast technique. It has been observed that the incorporation of BMPTFSI into PEO-LiTFSI electrolyte is an effective way for increasing the amorphous phase to a large extent. It has also been observed that both the glass transition and melting temperatures decrease with the increase of BMPTFSI concentration. The ionic conductivity of these polymer electrolytes increases with the increase of BMPTFSI concentration. The highest ionic conductivity obtained at 25 °C is ˜3×10-4 S cm-1 for the electrolyte containing 60 wt % BMPTFSI and ethylene oxide (EO)/Li ratio of 20. The temperature dependence of the dc conductivity and the hopping frequency show Vogel-Tamman-Fulcher type behavior indicating a strong coupling between the ionic and the polymer chain segmental motions. The frequency dependence of the ac conductivity exhibits a power law with an exponent n which decreases with the increase of temperature. The scaling of the ac conductivity indicates that relaxation dynamics of charge carriers follows a common mechanism for all temperatures and BMPTFSI concentrations. We have also presented the electric modulus data which have been analyzed in the framework of a Havriliak-Negami equation and the shape parameters obtained by the analysis show slight temperature dependence, but change sharply with BMPTFSI concentration. The stretched exponent β obtained from Kohlrausch-Williams-Watts fit to the modulus data is much lower than unity signifying that the relaxation is highly nonexponential. The decay function obtained from analysis of experimental modulus data is highly asymmetric with time.

  6. Nonperturbative renormalization-group approach preserving the momentum dependence of correlation functions

    NASA Astrophysics Data System (ADS)

    Rose, F.; Dupuis, N.

    2018-05-01

    We present an approximation scheme of the nonperturbative renormalization group that preserves the momentum dependence of correlation functions. This approximation scheme can be seen as a simple improvement of the local potential approximation (LPA) where the derivative terms in the effective action are promoted to arbitrary momentum-dependent functions. As in the LPA, the only field dependence comes from the effective potential, which allows us to solve the renormalization-group equations at a relatively modest numerical cost (as compared, e.g., to the Blaizot-Mendéz-Galain-Wschebor approximation scheme). As an application we consider the two-dimensional quantum O(N ) model at zero temperature. We discuss not only the two-point correlation function but also higher-order correlation functions such as the scalar susceptibility (which allows for an investigation of the "Higgs" amplitude mode) and the conductivity. In particular, we show how, using Padé approximants to perform the analytic continuation i ωn→ω +i 0+ of imaginary frequency correlation functions χ (i ωn) computed numerically from the renormalization-group equations, one can obtain spectral functions in the real-frequency domain.

  7. Control of electronic transport in graphene by electromagnetic dressing

    PubMed Central

    Kristinsson, K.; Kibis, O. V.; Morina, S.; Shelykh, I. A.

    2016-01-01

    We demonstrated theoretically that the renormalization of the electron energy spectrum near the Dirac point of graphene by a strong high-frequency electromagnetic field (dressing field) drastically depends on polarization of the field. Namely, linear polarization results in an anisotropic gapless energy spectrum, whereas circular polarization leads to an isotropic gapped one. As a consequence, the stationary (dc) electronic transport in graphene strongly depends on parameters of the dressing field: A circularly polarized field monotonically decreases the isotropic conductivity of graphene, whereas a linearly polarized one results in both giant anisotropy of conductivity (which can reach thousands of percents) and the oscillating behavior of the conductivity as a function of the field intensity. Since the predicted phenomena can be observed in a graphene layer irradiated by a monochromatic electromagnetic wave, the elaborated theory opens a substantially new way to control electronic properties of graphene with light. PMID:26838371

  8. Control of electronic transport in graphene by electromagnetic dressing.

    PubMed

    Kristinsson, K; Kibis, O V; Morina, S; Shelykh, I A

    2016-02-03

    We demonstrated theoretically that the renormalization of the electron energy spectrum near the Dirac point of graphene by a strong high-frequency electromagnetic field (dressing field) drastically depends on polarization of the field. Namely, linear polarization results in an anisotropic gapless energy spectrum, whereas circular polarization leads to an isotropic gapped one. As a consequence, the stationary (dc) electronic transport in graphene strongly depends on parameters of the dressing field: A circularly polarized field monotonically decreases the isotropic conductivity of graphene, whereas a linearly polarized one results in both giant anisotropy of conductivity (which can reach thousands of percents) and the oscillating behavior of the conductivity as a function of the field intensity. Since the predicted phenomena can be observed in a graphene layer irradiated by a monochromatic electromagnetic wave, the elaborated theory opens a substantially new way to control electronic properties of graphene with light.

  9. Thermal conductivity in nanocrystalline-SiC/C superlattices

    DOE PAGES

    Habermehl, S.; Serrano, J. R.

    2015-11-17

    We reported the formation of thin film superlattices consisting of alternating layers of nitrogen-doped SiC (SiC:N) and C. Periodically terminating the SiC:N surface with a graphitic C boundary layer and controlling the SiC:N/C thickness ratio yield nanocrystalline SiC grains ranging in size from 365 to 23 nm. Frequency domain thermo-reflectance is employed to determine the thermal conductivity, which is found to vary from 35.5 W m -1 K -1 for monolithic undoped α-SiC films to 1.6 W m -1 K -1 for a SiC:N/C superlattice with a 47 nm period and a SiC:N/C thickness ratio of 11. A series conductancemore » model is employed to explain the dependence of the thermal conductivity on the superlatticestructure. Our results indicate that the thermal conductivity is more dependent on the SiC:N/C thickness ratio than the SiC:N grain size, indicative of strong boundary layerphonon scattering.« less

  10. Ionospheric very low frequency transmitter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuo, Spencer P.

    2015-02-15

    The theme of this paper is to establish a reliable ionospheric very low frequency (VLF) transmitter, which is also broad band. Two approaches are studied that generate VLF waves in the ionosphere. The first, classic approach employs a ground-based HF heater to directly modulate the high latitude ionospheric, or auroral electrojet. In the classic approach, the intensity-modulated HF heater induces an alternating current in the electrojet, which serves as a virtual antenna to transmit VLF waves. The spatial and temporal variations of the electrojet impact the reliability of the classic approach. The second, beat-wave approach also employs a ground-based HFmore » heater; however, in this approach, the heater operates in a continuous wave mode at two HF frequencies separated by the desired VLF frequency. Theories for both approaches are formulated, calculations performed with numerical model simulations, and the calculations are compared to experimental results. Theory for the classic approach shows that an HF heater wave, intensity-modulated at VLF, modulates the electron temperature dependent electrical conductivity of the ionospheric electrojet, which, in turn, induces an ac electrojet current. Thus, the electrojet becomes a virtual VLF antenna. The numerical results show that the radiation intensity of the modulated electrojet decreases with an increase in VLF radiation frequency. Theory for the beat wave approach shows that the VLF radiation intensity depends upon the HF heater intensity rather than the electrojet strength, and yet this approach can also modulate the electrojet when present. HF heater experiments were conducted for both the intensity modulated and beat wave approaches. VLF radiations were generated and the experimental results confirm the numerical simulations. Theory and experimental results both show that in the absence of the electrojet, VLF radiation from the F-region is generated via the beat wave approach. Additionally, the beat wave approach generates VLF radiations over a larger frequency band than by the modulated electrojet.« less

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Majetich, Sara

    In the proposed research program we will investigate the time- and frequency-dependent behavior of ordered nanoparticle assemblies, or nanoparticle crystals. Magnetostatic interactions are long-range and anisotropic, and this leads to complex behavior in nanoparticle assemblies, particularly in the time- and frequency-dependent properties. We hypothesize that the high frequency performance of composite materials has been limited because of the range of relaxation times; if a composite is a dipolar ferromagnet at a particular frequency, it should have the advantages of a single phase material, but without significant eddy current power losses. Arrays of surfactant-coated monodomain magnetic nanoparticles can exhibit long-range magneticmore » order that is stable over time. The magnetic domain size and location of domain walls is governed not by structural grain boundaries but by the shape of the array, due to the local interaction field. Pores or gaps within an assembly pin domain walls and limit the domain size. Measurements of the magnetic order parameter as a function of temperature showed that domains can exist at high temoerature, and that there is a collective phase transition, just as in an exchange-coupled ferromagnet. Dipolar ferromagnets are not merely of fundamental interest; they provide an interesting alternative to exchange-based ferromagnets. Dipolar ferromagnets made with high moment metallic particles in an insulating matrix could have high permeability without large eddy current losses. Such nanocomposites could someday replace the ferrites now used in phase shifters, isolators, circulators, and filters in microwave communications and radar applications. We will investigate the time- and frequency-dependent behavior of nanoparticle crystals with different magnetic core sizes and different interparticle barrier resistances, and will measure the magnetic and electrical properties in the DC, low frequency (0.1 Hz - 1 kHz), moderate frequency (10 Hz - 500 MHz), and high frequency (up to 20 GHz) regimes. Our results will demonstrate whether a DC dipolar ferromagnet shows collective frequency-dependent reponse similar to that of an exchange-based ferromagnet, and will provide data for comparison of optimal nanocomposite properties with those of ferrites used in high frequency applications. Both the magnetic and electronic response of the composites will be examined in order to determine the frequency range where hopping conductivity leads to significant eddy current power losses. In the high frequency regime we will look for evidence of spin wave quantization and the resulting decrease in non-linear spin wave processes that could affect the performance of high frequency magnetic devices.« less

  12. Characterisation of Nd2O3 thick gate dielectric for silicon

    NASA Astrophysics Data System (ADS)

    Dakhel, A. A.

    2004-03-01

    Thin neodymium films were prepared by the reactive synthesis method on Si (P) substrates to form MOS devices. The oxide films were characterised by UV absorption spectroscopy, X-ray fluorescence (EDXRF) and X-ray diffraction (XRD). The ac conductance and capacitance of the devices were studied as a function of frequency in the range 100 Hz-100 kHz, of temperature in the range 293-473 K and of gate voltage. It was proved that a suitable formalism to explain the frequency dependence of the ac conductivity and capacitance of the insulator is controlled by a universal power law based on the relaxation processes of the hopping or tunnelling of the current carriers between equilibrium sites. The temperature dependence of the ac conductance at the accumulation state shows a small activation energy of about 0.07 eV for a MOS device with amorphous neodymium oxide. The temperature dependence of the accumulation capacitance for a MOS structure with crystalline neodymium oxide shows a maximum at about 390 K; such a maximum was not observed for the structure with amorphous neodymium oxide. The method of capacitance-gate voltage (C-Vg) measurements was used to investigate the effect of annealing in air and in vacuum on the surface density of states (Nss) at the insulator/semiconductor (I/S) interface. It was concluded that the density of surface states in the mid-gap increases by about five times while the density of the trapped charges in the oxide layer decreases by about eight times when the oxide crystallises into a polycrystalline structure.

  13. Metamaterial Behavior of Polymer Nanocomposites Based on Polypropylene/Multi-Walled Carbon Nanotubes Fabricated by Means of Ultrasound-Assisted Extrusion

    PubMed Central

    Pérez-Medina, Juan C.; Waldo-Mendoza, Miguel A.; Cruz-Delgado, Víctor J.; Quiñones-Jurado, Zoe V.; González-Morones, Pablo; Ziolo, Ronald F.; Martínez-Colunga, Juan G.; Soriano-Corral, Florentino; Avila-Orta, Carlos A.

    2016-01-01

    Metamaterial behavior of polymer nanocomposites (NCs) based on isotactic polypropylene (iPP) and multi-walled carbon nanotubes (MWCNTs) was investigated based on the observation of a negative dielectric constant (ε′). It is demonstrated that as the dielectric constant switches from negative to positive, the plasma frequency (ωp) depends strongly on the ultrasound-assisted fabrication method, as well as on the melt flow index of the iPP. NCs were fabricated using ultrasound-assisted extrusion methods with 10 wt % loadings of MWCNTs in iPPs with different melt flow indices (MFI). AC electrical conductivity (σ(AC)) as a function of frequency was determined to complement the electrical classification of the NCs, which were previously designated as insulating (I), static-dissipative (SD), and conductive (C) materials. It was found that the SD and C materials can also be classified as metamaterials (M). This type of behavior emerges from the negative dielectric constant observed at low frequencies although, at certain frequencies, the dielectric constant becomes positive. Our method of fabrication allows for the preparation of metamaterials with tunable ωp. iPP pure samples show only positive dielectric constants. Electrical conductivity increases in all cases with the addition of MWCNTs with the largest increases observed for samples with the highest MFI. A relationship between MFI and the fabrication method, with respect to electrical properties, is reported. PMID:28774042

  14. Intrinsic optical conductivity of a {{\\rm{C}}}_{2v} symmetric topological insulator

    NASA Astrophysics Data System (ADS)

    Sengupta, Parijat; Matsubara, Masahiko; Bellotti, Enrico; Shi, Junxia

    2017-07-01

    In this work we analytically investigate the longitudinal optical conductivity of the {{{C}}}2v symmetric topological insulator. The conductivity expressions at T = 0 are derived using the Kubo formula and expressed as a function of the ratio of the Dresselhaus and Rashba parameters that characterize the low-energy Hamiltonian. We find that the longitudinal inter-band conductivity vanishes when Dresselhaus and Rashba parameters are equal in strength, also called the persistent spin helix state. The calculations are extended to obtain the frequency-dependent real and imaginary components of the optical conductivity for the topological Kondo insulator SmB6 which exhibits {{{C}}}2v symmetric and anisotropic Dirac cones hosting topological states at \\overline{X} point on the surface Brillouin zone.

  15. ELECTRIC IMPEDANCE OF ARBACIA EGGS

    PubMed Central

    Cole, Kenneth S.; Cole, Robert H.

    1936-01-01

    The alternating current resistance and capacity of suspensions of unfertilized and fertilized eggs of Arbacia punctulata have been measured at frequencies from 103 to 1.64 x 107 cycles per second. The unfertilized egg has a static plasma membrane capacity of 0.73 µf./cm.2 which is practically independent of frequency. The fertilized egg has a static membrane capacity of 3.1 µf./cm.2 at low frequencies which decreases to a value of 0.55 µf./cm.2 at high frequencies. The decrease follows closely the relaxation dispersion of the dielectric constant if the dissipation of such a system is ignored. It is considered more probable that the effect is due to a fertilization membrane of 3.1 µf./cm.2 capacity lifted 1.5 µ. from the plasma membrane, the interspace having the conductivity of sea water. The suspensions show a frequency-dependent capacity at low frequencies which may be attributable to surface conductance. The equivalent low frequency internal specific resistance of both the unfertilized and fertilized egg is about 186 ohm cm. or about 6 times that of sea water, while the high frequency data extrapolate to a value of about 4 times sea water. There is evidence at the highest frequencies that the current is penetrating the nucleus and other materials in the cytoplasm. If this effect were entirely due to the nucleus it would lead to a very approximate value of 0.1 µf./cm.2 for the capacity of the nuclear membrane. The measurements do not indicate any change in this effect on fertilization. PMID:19872952

  16. Structural and electrical transport properties of La2Mo2O9 thin films prepared by pulsed laser deposition

    NASA Astrophysics Data System (ADS)

    Paul, T.; Ghosh, A.

    2017-04-01

    We have studied the structure and electrical properties of La2Mo2O9 thin films of different thicknesses prepared by the laser deposition technique at different substrate temperatures. The structural properties of the thin films have been investigated using XRD, XPS, AFM, TEM, SEM, and Raman spectroscopy. The electrical transport properties of the thin films have been investigated in wide temperature and frequency ranges. The cubic nature of the thin films has been confirmed from structural analysis. An enhancement of the oxygen ion conductivity of the films up to five orders of magnitude is obtained compared to that of the bulk La2Mo2O9, suggesting usefulness of the thin films as electrolytes in micro-solid oxide fuel cells. The enhanced dc ionic conductivity of the thin films has been interpreted using the rule of the mixture model, while a power law model has been used to investigate the frequency and temperature dependences of the conductivity. The analysis of the results predicts the three-dimensional oxygen ion conduction in the thin films.

  17. Observatory geoelectric fields induced in a two-layer lithosphere during magnetic storms

    USGS Publications Warehouse

    Love, Jeffrey J.; Swidinsky, Andrei

    2015-01-01

    We report on the development and validation of an algorithm for estimating geoelectric fields induced in the lithosphere beneath an observatory during a magnetic storm. To accommodate induction in three-dimensional lithospheric electrical conductivity, we analyze a simple nine-parameter model: two horizontal layers, each with uniform electrical conductivity properties given by independent distortion tensors. With Laplace transformation of the induction equations into the complex frequency domain, we obtain a transfer function describing induction of observatory geoelectric fields having frequency-dependent polarization. Upon inverse transformation back to the time domain, the convolution of the corresponding impulse-response function with a geomagnetic time series yields an estimated geoelectric time series. We obtain an optimized set of conductivity parameters using 1-s resolution geomagnetic and geoelectric field data collected at the Kakioka, Japan, observatory for five different intense magnetic storms, including the October 2003 Halloween storm; our estimated geoelectric field accounts for 93% of that measured during the Halloween storm. This work demonstrates the need for detailed modeling of the Earth’s lithospheric conductivity structure and the utility of co-located geomagnetic and geoelectric monitoring.

  18. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  19. Subsurface Ice Detection via Low Frequency Surface Electromagnetic Method

    NASA Astrophysics Data System (ADS)

    Stillman, D. E.; Grimm, R. E.; Mcginnis, R. N.

    2014-12-01

    The geophysical detection of ice in the Cryosphere is typically conducted by measuring the absence of water. These interpretations can become non-unique in dry soils or in clay- and silt-rich soils that contain significant quantities of unfrozen water. Extensive laboratory measurements of electrical properties were made on permafrost samples as a function of frequency, temperature, and water content. These laboratory measurements show that the amount of ice can be uniquely obtained by measuring a frequency dependence of the electrical properties over a large frequency range (20 kHz - 10 Hz). In addition, the electrical properties of permafrost are temperature dependent, which can allow for an estimate of subsurface temperature. In order to test this approach in the field, we performed field surveys at four locations in Alaska. We used three low frequency electromagnetic methods: Spectral Induced Polarization (SIP: 20 kHz - 10 Hz), Capacively Coupled Resistivity (CCR: OhmMapper - 16.5 kHz), and DC Resistivity (Syscal ~ 8 Hz). At the Cold Regions Research and Engineering Laboratory permafrost tunnel near Fox, AK, we used SIP to measure the average ice concentration of 80 v% and determined the temperature to be -3±1°C by matching survey results to lab data. SIP data acquisition is very slow; therefore, at three sites near Tok, AK, we used CCR to perform reconnaissance of the area. Then SIP and DC resistivity were performed at anomalous areas. The three survey types give very similar absolute resistivity values. We found that while SIP gives the most quantitative results, the frequency dependence from the CCR and DC resistivity surveys is all that are needed to determine ice content in permafrost.

  20. Cantilever Beam Natural Frequencies in Centrifugal Inertia Field

    NASA Astrophysics Data System (ADS)

    Jivkov, V. S.; Zahariev, E. V.

    2018-03-01

    In the advanced mechanical science the well known fact is that the gravity influences on the natural frequencies and modes even for the vertical structures and pillars. But, the condition that should be fulfilled in order for the gravity to be taken into account is connected with the ration between the gravity value and the geometrical cross section inertia. The gravity is related to the earth acceleration but for moving structures there exist many other acceleration exaggerated forces and such are forces caused by the centrifugal accelerations. Large rotating structures, as wind power generators, chopper wings, large antennas and radars, unfolding space structures and many others are such examples. It is expected, that acceleration based forces influence on the structure modal and frequency properties, which is a subject of the present investigations. In the paper, rotating beams are subject to investigations and modal and frequency analysis is carried out. Analytical dependences for the natural resonances are derived and their dependences on the angular velocity and centrifugal accelerations are derived. Several examples of large rotating beams with different orientations of the rotating shaft are presented. Numerical experiments are conducted. Time histories of the beam tip deflections, that depict the beam oscillations are presented.

  1. Pb2+ Modulates Ca2+ Membrane Permeability In Paramecium

    NASA Astrophysics Data System (ADS)

    Bernal-Martínez, Juan; Ortega Soto, Arturo

    2004-09-01

    Intracellular recording experiments in current clamp configuration were done to evaluate whether Pb2+ modulates ionic membrane permeability in the fresh water Paramecium tetraurelia. It was found that Pb2+ triggers in a dose-dependent manner, a burst of spontaneous action potentials followed by a robust and sustained after hyper-polarization. In addition, Pb2+ increased the frequency of firing the spontaneous Ca2+-Action Potential and also, the duration of Ca2+-Action Potential, in a dose and reversibly-dependent manner. These results suggest that Pb2+ increases calcium membrane permeability of Paramecium and probably activates a calcium-dependent-potassium conductance in the ciliate.

  2. γ-rays irradiation effects on dielectric properties of Ti/Au/GaAsN Schottky diodes with 1.2%N

    NASA Astrophysics Data System (ADS)

    Teffahi, A.; Hamri, D.; Djeghlouf, A.; Abboun Abid, M.; Saidane, A.; Al Saqri, N.; Felix, J. F.; Henini, M.

    2018-06-01

    Dielectric properties of As grown and irradiated Ti /Au/GaAsN Schottky diodes with 1.2%N are investigated using capacitance/conductance-voltage measurements in 90-290 K temperature range and 50-2000 kHz frequency range. Extracted parameters are interface state density, series resistance, dielectric constant, dielectric loss, tangent loss and ac conductivity. It is shown that exposure to γ-rays irradiation leads to reduction in effective trap density believed to result from radiation-induced traps annulations. An increase in series resistance is attributed to a net doping reduction. Dielectric constant (ε') shows usual step-like transitions with corresponding relaxation peaks in dielectric loss. These peaks shift towards lower temperature as frequency decrease. Temperature dependant ac conductivity followed an Arrhenius relation with activation energy of 153 meV in the 200-290 K temperature range witch correspond to As vacancy. The results indicate that γ-rays irradiation improves the dielectric and electrical properties of the diode due to the defect annealing effect.

  3. Assessing the high frequency behavior of non-polarizable electrodes for spectral induced polarization measurements

    NASA Astrophysics Data System (ADS)

    Abdulsamad, Feras; Florsch, Nicolas; Schmutz, Myriam; Camerlynck, Christian

    2016-12-01

    During the last decades, the usage of spectral induced polarization (SIP) measurements in hydrogeology and detecting environmental problems has been extensively increased. However, the physical mechanisms which are responsible for the induced polarization response over the usual frequency range (typically 1 mHz to 10-20 kHz) require better understanding. The phase shift observed at high frequencies is sometimes attributed to the so-called Maxwell-Wagner polarization which takes place when charges cross an interface. However, SIP measurements of tap water show a phase shift at frequencies higher than 1 kHz, where no Maxwell-Wagner polarization may occur. In this paper, we enlighten the possible origin of this phase shift and deduce its likely relationship with the types of the measuring electrodes. SIP Laboratory measurements of tap water using different types of measuring electrodes (polarizable and non-polarizable electrodes) are carried out to detect the origin of the phase shift at high frequencies and the influence of the measuring electrodes types on the observed complex resistivity. Sodium chloride is used to change the conductivity of the medium in order to quantify the solution conductivity role. The results of these measurements are clearly showing the impact of the measuring electrodes type on the measured phase spectrum while the influence on the amplitude spectrum is negligible. The phenomenon appearing on the phase spectrum at high frequency (> 1 kHz) whatever the electrode type is, the phase shows an increase compared to the theoretical response, and the discrepancy (at least in absolute value) increases with frequency, but it is less severe when medium conductivity is larger. Additionally, the frequency corner is shifted upward in frequency. The dependence of this phenomenon on the conductivity and the measuring electrodes type (electrode-electrolyte interface) seems to be due to some dielectric effects (as an electrical double layer of small relaxation time formed at the electrodes interface). Therefore, this dielectric response should be taken into account at high frequency to better analytically separate the medium own response from that linked to the measuring electrodes used. We modeled this effect by adding a capacitance connected in parallel with the traditional equivalent electric circuit used to describe the dielectric response of medium.

  4. Robust random telegraph conductivity noise in single crystals of the ferromagnetic insulating manganite La0.86Ca0.14MnO3

    NASA Astrophysics Data System (ADS)

    Przybytek, J.; Fink-Finowicki, J.; Puźniak, R.; Shames, A.; Markovich, V.; Mogilyansky, D.; Jung, G.

    2017-03-01

    Robust random telegraph conductivity fluctuations have been observed in La0.86Ca0.14MnO3 manganite single crystals. At room temperatures, the spectra of conductivity fluctuations are featureless and follow a 1 /f shape in the entire experimental frequency and bias range. Upon lowering the temperature, clear Lorentzian bias-dependent excess noise appears on the 1 /f background and eventually dominates the spectral behavior. In the time domain, fully developed Lorentzian noise appears as pronounced two-level random telegraph noise with a thermally activated switching rate, which does not depend on bias current and applied magnetic field. The telegraph noise is very robust and persists in the exceptionally wide temperature range of more than 50 K. The amplitude of the telegraph noise decreases exponentially with increasing bias current in exactly the same manner as the sample resistance increases with the current, pointing out the dynamic current redistribution between percolation paths dominated by phase-separated clusters with different conductivity as a possible origin of two-level conductivity fluctuations.

  5. Temperature-Dependent Dielectric Properties of Al/Epoxy Nanocomposites

    NASA Astrophysics Data System (ADS)

    Wang, Zijun; Zhou, Wenying; Sui, Xuezhen; Dong, Lina; Cai, Huiwu; Zuo, Jing; Chen, Qingguo

    2016-06-01

    Broadband dielectric spectroscopy was carried out to study the transition in electrical properties of Al/epoxy nanocomposites over the frequency range of 1-107 Hz and the temperature range of -20°C to 200°C. The dielectric permittivity, dissipation factor, and electrical conductivity of the nanocomposites increased with temperature and showed an abrupt increase around the glass transition temperature ( T g). The results clearly reveal an interesting transition of the electrical properties with increasing temperature: insulator below 70°C, conductor at about 70°C. The behavior of the transition in electrical properties of the nanocomposites was explored at different temperatures. The presence of relaxation peaks in the loss tangent and electric modulus spectra of the nanocomposites confirms that the chain segmental dynamics of the polymer is accompanied by the absorption of energy given to the system. It is suggested that the temperature-dependent transition of the electric properties in the nanocomposite is closely associated with the α-relaxation. The large increase in the dissipation factor and electric conductivity depends on the direct current conduction of thermally activated charge carriers resulting from the epoxy matrix above T g.

  6. Pressure effect on phonon frequencies in some transition metals: A molecular dynamics study

    NASA Astrophysics Data System (ADS)

    Kazanc, S.; Ozgen, S.

    2005-08-01

    It is important to determine the atomic lattice vibrations of metallic materials, under high-pressure conditions, due to its effects on material properties such as thermal, electrical and optical conductions. In this work, we have investigated the changes of acoustic phonon frequencies with hydrostatic pressure for Cu, Ni, Al, Ag and Au transition metals, using molecular dynamics (MD) simulations based on embedded atom method (EAM). For this aim, we have adopted the embedded atom potential proposed by Sutton and Chen. The phonon frequencies have been calculated from the dynamical matrix for [1 0 0], [1 1 0] and [1 1 1] high symmetry directions of the Brillouin zone. The obtained results show that the hydrostatic pressure causes an increment in phonon frequencies, and this rising do not depend linearly on the increasing pressure.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Erkaev, N. V.; Siberian Federal University, Krasnoyarsk; Semenov, V. S.

    Magnetic filament approach is applied for modeling of nonlinear 'kink'-like flapping oscillations of thin magnetic flux tubes in the Earth's magnetotail current sheet. A discrete approximation for the magnetic flux tube was derived on a basis of the Hamiltonian formulation of the problem. The obtained system of ordinary differential equations was integrated by method of Rosenbrock, which is suitable for stiff equations. The two-dimensional exact Kan's solution of the Vlasov equations was used to set the background equilibrium conditions for magnetic field and plasma. Boundary conditions for the magnetic filament were found to be dependent on the ratio of themore » ionospheric conductivity and the Alfven conductivity of the magnetic tube. It was shown that an enhancement of this ratio leads to the corresponding increase of the frequency of the flapping oscillations. For some special case of boundary conditions, when the magnetic perturbations vanish at the boundaries, the calculated frequency of the 'kink'-like flapping oscillations is rather close to that predicted by the 'double gradient' analytical model. For others cases, the obtained frequency of the flapping oscillations is somewhat larger than that from the 'double gradient' theory. The frequency of the nonlinear flapping oscillations was found to be a decreasing function of the amplitude.« less

  8. Examining the Effects of Stiffness and Mass Difference on the Thermal Interface Conductance Between Lennard-Jones Solids

    NASA Astrophysics Data System (ADS)

    Gordiz, Kiarash; Henry, Asegun

    2015-12-01

    To date, the established methods that describe thermal interface conductance (TIC) and include mode-level dependence have not included anharmonicity. The current intuition is therefore based on the behavior in the harmonic limit, whereby the extent of overlap in the bulk phonon density of states (DoS) (e.g., frequency overlap) dictates the TIC and more frequency overlap leads to higher TIC. Here, we study over 2,000 interfaces described by the Lennard-Jones potential using equilibrium molecular dynamics simulations, whereby we systematically change the mass and stiffness of each side. We show that the trends in TIC do not generally follow that of the bulk phonon DoS overlap, but instead more closely follow the vibrational power spectrum overlap for the interfacial atoms. We then identify the frequency overlap in the interfacial power spectra as an improved descriptor for understanding the qualitative trends in TIC. Although improved, the results show that the basic intuition of frequency overlap is still insufficient to explain all of the features, as the remaining variations are shown to arise from anharmonicity, which is a critical effect to include in interface calculations above cryogenic temperatures.

  9. Dielectric investigation of the sliding charge-density wave in Tl0.3MoO3

    NASA Astrophysics Data System (ADS)

    Ramanujachary, K. V.; Collins, B. T.; Greenblatt, M.; Gerhardt, R.; Rietman, E. A.

    1988-10-01

    We have investigated the low-frequency complex conductivity of the charge-density-wave condensate in Tl0.3MoO3, in the temperature range 40-90 K, by the measurement of admittance sampled in the frequency interval 5 Hz-13 MHz. The observed response can be characterized in terms of a simple Debye relaxation model with a distribution of relaxation times by analogy with the reported behavior of its isostructural analog K0.3MoO3. Despite qualitative similarities with the general trends observed in K0.3MoO3, the relaxational response in Tl0.3MoO3 differed significantly in detail. Both the mean relaxation times (τ0) and static dielectric constants (ɛ0) are shown to have Arrhenius temperature dependence with activation energies of 743 and 152 K, respectively. For applied dc biases above the threshold field (ET) for nonlinear conduction, the response shows structure at frequencies that resemble ``washboard'' characteristics of a moving charge condensate. From the values of the high-frequency real and imaginary parts of the dielectric constants, the existence of yet another relaxation process is proposed.

  10. Structure dependent electrical properties of Ni-Mg-Cu nano ferrites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choudhari, Nagabhushan J., E-mail: nagabhushanchoudhari@gmail.com; Kakati, Sushanth S.; Hiremath, Chidanandayya S.

    2016-05-06

    Nano ferrites with the general chemical formula Ni{sub 0.5}Mg{sub x}Cu{sub 1-x} Fe{sub 2}O{sub 4} were synthesized by chemical route. They were characterized by x-ray diffraction by powder method. The diffraction patterns confirm the formation of single phase ferrites. The particle size is calculated by Scherrer formula which varies between 20nm to 60nm. DC resistivity was measured as a function of composition from room temperature to 700{sup o} C by two probe method. These ferrites show higher resistivity than those synthesized by ceramic method, due to control over composition and morphology. This leads to the elimination of domain wall resonance somore » that the materials can work at higher frequencies. AC resistivity was measured as a function of frequency at room temperature. Dielectric dispersion obeys Maxwell - Wagner model, in accordance with Koop’s phenomenological theory. The variation of loss angle follows the variation of ac resistivity with frequency and composition. The change in ac conductivity with frequency obeys the power law σ{sub a} = B.ω{sup n}. Such a behavior suggests that conductivity is due to polarons in all the samples.« less

  11. Potential formulation of the dispersion relation for a uniform, magnetized plasma with stationary ions in terms of a vector phasor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Robert W.

    2012-06-15

    The derivation of the helicon dispersion relation for a uniform plasma with stationary ions subject to a constant background magnetic field is reexamined in terms of the potential formulation of electrodynamics. Under the same conditions considered by the standard derivation, the nonlinear self-coupling between the perturbed electron flow and the potential it generates is addressed. The plane wave solution for general propagation vector is determined for all frequencies and expressed in terms of a vector phasor. The behavior of the solution as described in vacuum units depends upon the ratio of conductivity to the magnitude of the background field. Onlymore » at low conductivity and below, the cyclotron frequency can significant propagation occur as determined by the ratio of skin depth to wavelength.« less

  12. Structure, temperature and frequency dependent electrical conductivity of oxidized and reduced electrochemically exfoliated graphite

    NASA Astrophysics Data System (ADS)

    Radoń, Adrian; Włodarczyk, Patryk; Łukowiec, Dariusz

    2018-05-01

    The article presents the influence of reduction by hydrogen in statu nascendi and modification by hydrogen peroxide on the structure and electrical conductivity of electrochemically exfoliated graphite. It was confirmed that the electrochemical exfoliation can be used to produce oxidized nanographite with an average number of 25 graphene layers. The modified electrochemical exfoliated graphite and reduced electrochemical exfoliated graphite were characterized by high thermal stability, what was associated with removing of labile oxygen-containing groups. The presence of oxygen-containing groups was confirmed using Fourier-transform infrared spectroscopy. Influence of chemical modification by hydrogen and hydrogen peroxide on the electrical conductivity was determined in wide frequency (0.1 Hz-10 kHz) and temperature range (-50 °C-100 °C). Material modified by hydrogen peroxide (0.29 mS/cm at 0 °C) had the lowest electrical conductivity. This can be associated with oxidation of unstable functional groups and was also confirmed by analysis of Raman spectra. The removal of oxygen-containing functional groups by hydrogen in statu nascendi resulted in a 1000-fold increase in the electrical conductivity compared to the electrochemical exfoliated graphite.

  13. AC-electric field dependent electroformation of giant lipid vesicles.

    PubMed

    Politano, Timothy J; Froude, Victoria E; Jing, Benxin; Zhu, Yingxi

    2010-08-01

    Giant vesicles of larger than 5 microm, which have been of intense interest for their potential as drug delivery vehicles and as a model system for cell membranes, can be rapidly formed from a spin-coated lipid thin film under an electric field. In this work, we explore the AC-field dependent electroformation of giant lipid vesicles in aqueous media over a wide range of AC-frequency from 1 Hz to 1 MHz and peak-to-peak field strength from 0.212 V/mm to 40 V/mm between two parallel conducting electrode surfaces. By using fluorescence microscopy, we perform in-situ microscopic observations of the structural evolution of giant vesicles formed from spin-coated lipid films under varied uniform AC-electric fields. The real-time observation of bilayer bulging from the lipid film, vesicle growth and fusing further examine the critical role of AC-induced electroosmotic flow of surrounding fluids for giant vesicle formation. A rich AC-frequency and field strength phase diagram is obtained experimentally to predict the AC-electroformation of giant unilamellar vesicles (GUVs) of l-alpha-phosphatidylcholine, where a weak dependence of vesicle size on AC-frequency is observed at low AC-field voltages, showing decreased vesicle size with a narrowed size distribution with increased AC-frequency. Formation of vesicles was shown to be constrained by an upper field strength of 10 V/mm and an upper AC-frequency of 10 kHz. Within these parameters, giant lipid vesicles were formed predominantly unilamellar and prevalent across the entire electrode surfaces. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Far-Infrared Optical Conductivity Gap in Superconducting MgB2 Films

    NASA Astrophysics Data System (ADS)

    Kaindl, Robert A.; Carnahan, Marc A.; Orenstein, Joseph; Chemla, Daniel S.; Christen, Hans M.; Zhai, Hong-Ying; Paranthaman, Mariappan; Lowndes, Doug H.

    2002-01-01

    We report the first study of the optical conductivity of MgB 2 covering the range of its lowest-energy superconducting gap. Terahertz time-domain spectroscopy is utilized to determine the complex, frequency-dependent conductivity σ(ω) of thin films. The imaginary part reveals an inductive response due to the emergence of the superconducting condensate. The real part exhibits a strong depletion of oscillator strength near 5 meV resulting from the opening of a superconducting energy gap. The gap ratio of 2Δ0/kBTC~1.9 is well below the weak-coupling value, pointing to complex behavior in this novel superconductor.

  15. TRPM8-Dependent Dynamic Response in a Mathematical Model of Cold Thermoreceptor

    PubMed Central

    Olivares, Erick; Salgado, Simón; Maidana, Jean Paul; Herrera, Gaspar; Campos, Matías; Madrid, Rodolfo; Orio, Patricio

    2015-01-01

    Cold-sensitive nerve terminals (CSNTs) encode steady temperatures with regular, rhythmic temperature-dependent firing patterns that range from irregular tonic firing to regular bursting (static response). During abrupt temperature changes, CSNTs show a dynamic response, transiently increasing their firing frequency as temperature decreases and silencing when the temperature increases (dynamic response). To date, mathematical models that simulate the static response are based on two depolarizing/repolarizing pairs of membrane ionic conductance (slow and fast kinetics). However, these models fail to reproduce the dynamic response of CSNTs to rapid changes in temperature and notoriously they lack a specific cold-activated conductance such as the TRPM8 channel. We developed a model that includes TRPM8 as a temperature-dependent conductance with a calcium-dependent desensitization. We show by computer simulations that it appropriately reproduces the dynamic response of CSNTs from mouse cornea, while preserving their static response behavior. In this model, the TRPM8 conductance is essential to display a dynamic response. In agreement with experimental results, TRPM8 is also needed for the ongoing activity in the absence of stimulus (i.e. neutral skin temperature). Free parameters of the model were adjusted by an evolutionary optimization algorithm, allowing us to find different solutions. We present a family of possible parameters that reproduce the behavior of CSNTs under different temperature protocols. The detection of temperature gradients is associated to a homeostatic mechanism supported by the calcium-dependent desensitization. PMID:26426259

  16. Size- and temperature-dependent Hamaker constants for heterogeneous systems of interacting nanoparticles

    NASA Astrophysics Data System (ADS)

    Pinchuk, P.; Pinchuk, A. O.

    2016-09-01

    Hamaker-Lifshitz constants are used to calculate van der Waals interaction forces between small particles in solution. Typically, these constants are size-independent and material specific. According to the Lifshitz theory, the Hamaker-Lifshitz constants can be calculated by taking integrals that include the dielectric permittivity, as a function of frequency, of the interacting particles and the medium around particles. The dielectric permittivity of interacting metal nanoparticles can be calculated using the free-electron Drude model for metals. For bulk metals, the Drude model does is size independent. However, the conducting electrons in small metal nanoparticles exhibit surface scattering, which changes the complex dielectric permittivity function. Additionally, the Drude model can be modified to include temperature dependence. That is, an increase in temperature leads to thermal volume expansion and increased phonon population, which affect the scattering rate of the electrons and the plasma frequency. Both of these terms contribute significantly to the Drude model for the dielectric permittivity of the particles. In this work, we show theoretically that scattering of the free conducting electrons inside noble metal nanoparticles with the size of 1 - 50 nm leads to size-dependent dielectric permittivity and Hamaker-Lifshitz constants. In addition, we calculate numerically the Hamaker-Lifshitz constants for a variety of temperatures. The results of the study might be of interest for understanding colloidal stability of metal nanoparticles.

  17. Electrical conductivity of diopside: evidence for oxygen vacancies

    USGS Publications Warehouse

    Huebner, J.S.; Voigt, D.E.

    1988-01-01

    Impedance spectra for two natural single crystals of diopside were obtained at 800 to 1300??C and 1-bar pressure over the frequency range 0.001 Hz to 100 kHz in a system closed to all components but oxygen. At both higher and lower fO2 values, no fO2 dependence of conductivity was observed, indicating the presence of different conduction mechanisms. At temperatures less than 1000??C, the activation energy is 1.3 eV, also suggesting a different conduction mechanism. Thus, at least four regimes are necessary to describe the conductivity of this diopside in T-fO2 space. The approximately -1/(7 ?? 1) value of d(log ??)/d(log fO2) in a high-temperature geologic region suggests a reaction by which oxygen vacancies control the conductivity. This relatively pure diopside is much less conducting than olivine or orthopyroxene. A second diopside with greater Fe content but otherwise similar in composition to the near-end-member diopside, is more conducting, has a smaller activation energy (1.0 eV) over the range 1050 to 1225??C, and shows only a weak negative fO2 dependence; suggesting that oxygen vacancies are present but are not the dominant defect in controlling the conductivity. -from Authors

  18. Use of Kramers-Kronig relations to extract the conductivity of high-[ital T][sub [ital c

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, D.; Richards, P.L.

    1993-05-01

    In principle the conductivity of the cuprate superconductors can be obtained from reflectivity measurements using the Kramers-Kronig-transform technique. However, at low temperatures and for frequencies below [similar to]300 cm[sup [minus]1] the reflectivities of materials such as YBa[sub 2]Cu[sub 3]O[sub 7] are close to unity. Uncertainty in the precise signal level corresponding to unity reflectivity and a lack of knowledge of the reflectivity below the lowest measured frequency cause this method to become unreliable. To address this problem we have used a bolometric technique and a resonant technique to obtain accurate submillimeter and microwave data for the residual losses in epitaxialmore » thin films of YBa[sub 2]Cu[sub 3]O[sub 7] at low temperatures. The Kramers-Kronig analysis of our data is in good agreement with results from fitting our data to simple weakly coupled grain and two-fluid models for the [ital a]-[ital b] plane conductivity. However, below 450 cm[sup [minus]1] it is in disagreement with some published results of other workers obtained from Kramers-Kronig analysis of reflectivity data. To understand this discrepancy we analyze how the conductivity determined by the Kramers-Kronig-transform technique depends on some commonly used low-frequency extrapolations of reflectivity data.« less

  19. DC bias effect on alternating current electrical conductivity of poly(ethylene terephthalate)/alumina nanocomposites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nikam, Pravin N., E-mail: pravinya26@gmail.com; Deshpande, Vineeta D., E-mail: drdeshpandevd@gmail.com

    Polymer nanocomposites based on metal oxide (ceramic) nanoparticles are a new class of materials with unique properties and designed for various applications such as electronic device packaging, insulation, fabrication and automotive industries. Poly(ethylene terephthalate) (PET)/alumina (Al{sub 2}O{sub 3}) nanocomposites with filler content between 1 wt% and 5 wt% were prepared by melt compounding method using co-rotating twin screw extruder and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and precision LCR meter techniques. The results revealed that proper uniform dispersion at lower content up to 2 wt% of nano-alumina observed by using TEM. Aggregation of nanoparticles was observedmore » at higher content of alumina examined by using SEM and TEM. The frequency dependences of the alternating current (AC) conductivity (σ{sub AC}) of PET/alumina nanocomposites on the filler content and DC bias were investigated in the frequency range of 20Hz - 1MHz. The results showed that the AC and direct current (DC) conductivity increases with increasing DC bias and nano-alumina content upto 3 wt%. It follows the Jonscher’s universal power law of solids. It revealed that σ{sub AC} of PET/alumina nanocomposites can be well characterized by the DC conductivity (σ{sub DC}), critical frequency (ω{sub c}), critical exponent of the power law (s). Roll of DC bias potential led to an increase of DC conductivity (σ{sub DC}) due to the creation of additional conducting paths with the polymer nanocomposites and percolation behavior achieved through co-continuous morphology.« less

  20. Electronic transport coefficients from ab initio simulations and application to dense liquid hydrogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Holst, Bastian; French, Martin; Redmer, Ronald

    2011-06-15

    Using Kubo's linear response theory, we derive expressions for the frequency-dependent electrical conductivity (Kubo-Greenwood formula), thermopower, and thermal conductivity in a strongly correlated electron system. These are evaluated within ab initio molecular dynamics simulations in order to study the thermoelectric transport coefficients in dense liquid hydrogen, especially near the nonmetal-to-metal transition region. We also observe significant deviations from the widely used Wiedemann-Franz law, which is strictly valid only for degenerate systems, and give an estimate for its valid scope of application toward lower densities.

  1. Transient conduction-radiation analysis of an absolute active cavity radiometer using finite elements

    NASA Technical Reports Server (NTRS)

    Mahan, J. R.; Kowsary, F.; Tira, N.; Gardiner, B. D.

    1987-01-01

    A NASA-developed finite element-based model of a generic active cavity radiometer (ACR) has been developed in order to study the dependence on operating temperature of the closed-loop and open-loop transient response of the instrument. Transient conduction within the sensing element is explored, and the transient temperature distribution resulting from the application of a time-varying radiative boundary condition is calculated. The results verify the prediction that operation of an ACR at cryogenic temperatures results in large gains in frequency response.

  2. Temperature dependent dielectric relaxation and ac-conductivity of alkali niobate ceramics studied by impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Yadav, Abhinav; Mantry, Snigdha Paramita; Fahad, Mohd.; Sarun, P. M.

    2018-05-01

    Sodium niobate (NaNbO3) ceramics is prepared by conventional solid state reaction method at sintering temperature 1150 °C for 4 h. The structural information of the material has been investigated by X-ray diffraction (XRD) and Field emission scanning electron microscopy (FE-SEM). The XRD analysis of NaNbO3 ceramics shows an orthorhombic structure. The FE-SEM micrograph of NaNbO3 ceramics exhibit grains with grain sizes ranging between 1 μm to 5 μm. The surface coverage and average grain size of NaNbO3 ceramics are found to be 97.6 % and 2.5 μm, respectively. Frequency dependent electrical properties of NaNbO3 is investigated from room temperature to 500 °C in wide frequency range (100 Hz-5 MHz). Dielectric constant, ac-conductivity, impedance, modulus and Nyquist analysis are performed. The observed dielectric constant (1 kHz) at transition temperature (400 °C) are 975. From conductivity analysis, the estimated activation energy of NaNbO3 ceramics is 0.58 eV at 10 kHz. The result of Nyquist plot shows that the electrical behavior of NaNbO3 ceramics is contributed by grain and grain boundary responses. The impedance and modulus spectrum asserts that the negative temperature coefficient of resistance (NTCR) behavior and non-Debye type relaxation in NaNbO3.

  3. Modeling time-dependent corrosion fatigue crack propagation in 7000 series aluminum alloys

    NASA Technical Reports Server (NTRS)

    Mason, Mark E.; Gangloff, Richard P.

    1994-01-01

    Stress corrosion cracking and corrosion fatigue experiments were conducted with the susceptible S-L orientation of AA7075-T651, immersed in acidified and inhibited NaCl solution, to provide a basis for incorporating environmental effects into fatigue crack propagation life prediction codes such as NASA FLAGRO. This environment enhances da/dN by five to ten-fold compared to fatigue in moist air. Time-based crack growth rates from quasi-static load experiments are an order of magnitude too small for accurate linear superposition prediction of da/dN for loading frequencies above 0.001 Hz. Alternate methods of establishing da/dt, based on rising-load or ripple-load-enhanced crack tip strain rate, do not increase da/dt and do not improve linear superposition. Corrosion fatigue is characterized by two regimes of frequency dependence; da/dN is proportional to f(exp -1) below 0.001 Hz and to F(exp 0) to F(exp -0.1) for higher frequencies. Da/dN increases mildly both with increasing hold-time at K(sub max) and with increasing rise-time for a range of loading waveforms. The mild time-dependence is due to cycle-time-dependent corrosion fatigue growth. This behavior is identical for S-L nd L-T crack orientations. The frequency response of environmental fatigue in several 7000 series alloys is variable and depends on undefined compositional or microstructural variables. Speculative explanations are based on the effect of Mg on occluded crack chemistry and embritting hydrogen uptake, or on variable hydrogen diffusion in the crack tip process zone. Cracking in the 7075/NaCl system is adequately described for life prediction by linear superposition for prolonged load-cycle periods, and by a time-dependent upper bound relationship between da/dN and delta K for moderate loading times.

  4. Is the Role of External Feedback in Auditory Skill Learning Age Dependent?

    ERIC Educational Resources Information Center

    Zaltz, Yael; Roth, Daphne Ari-Even; Kishon-Rabin, Liat

    2017-01-01

    Purpose: The purpose of this study is to investigate the role of external feedback in auditory perceptual learning of school-age children as compared with that of adults. Method: Forty-eight children (7-9 years of age) and 64 adults (20-35 years of age) conducted a training session using an auditory frequency discrimination (difference limen for…

  5. Brillouin precursors in Debye media

    NASA Astrophysics Data System (ADS)

    Macke, Bruno; Ségard, Bernard

    2015-05-01

    We theoretically study the formation of Brillouin precursors in Debye media. We point out that the precursors are visible only at propagation distances such that the impulse response of the medium is essentially determined by the frequency dependence of its absorption and is practically Gaussian. By simple convolution, we then obtain explicit analytical expressions of the transmitted waves generated by reference incident waves, distinguishing precursor and main signal by a simple examination of the long-time behavior of the overall signal. These expressions are in good agreement with the signals obtained in numerical or real experiments performed on water in the radio-frequency domain and explain in particular some observed shapes of the precursor. Results are obtained for other remarkable incident waves. In addition, we show quite generally that the shape of the Brillouin precursor appearing alone at sufficiently large propagation distance and the law giving its amplitude as a function of this distance do not depend on the precise form of the incident wave but only on its integral properties. The incidence of a static conductivity of the medium is also examined and explicit analytical results are again given in the limit of weak and strong conductivities.

  6. Structural and dielectric properties of Ba{sub 2}LaSbO{sub 6} ceramics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumari, Premlata, E-mail: k.premlata1@gmail.com; Dutta, Alo; Sinha, T. P.

    2014-04-24

    The ceramic Ba{sub 2}LaSbO{sub 6} (BLS) is synthesized by the solid state reaction technique. The Rietveld refinement of X-ray diffraction pattern at room temperature shows Monoclinic P2{sub 1}/n space group symmetry with lattice parameter a = 6.0720 (0) Å, b = 6.1058 (3) Å, c = 8.6016 (6) Å and β =89.7091 ° (8). Dielectric study of sample has been performed in the temperature range from 30 °C to 300 °C in the frequency range 50 Hz to 1.1 MHz. Dielectric relaxation peaks are observed in the imaginary part of complex permittivity of the spectra. The frequency dependence of realmore » and imaginary parts of dielectric permittivity is analyzed using Cole-Cole model. The temperature dependent relaxation time is found to obey the Arrhenius law having activation energy 0.48 eV which indicates that the conduction mechanism in the materials may be due to polaron hopping based on electron carriers. The complex plane plots of BLS shows the presence of both grain and grain boundary effects. Conductivity spectra follow the power law.« less

  7. Temperature dependent x-ray diffraction and dielectric studies of multiferroic GaFeO{sub 3}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Rajeev; Mall, Ashish Kumar, E-mail: ashishm@iitk.ac.in; Gupta, Rajeev

    2016-05-06

    Polycrystalline GaFeO{sub 3} (GFO) samples were synthesized by sol-gel method. The structural and dielectric properties of GaFeO{sub 3} ceramic have been investigated by a combination of XRD and permittivity measurement. The X-ray diffraction spectra shows single phase orthorhombically distorted perovskite structure with Pc2{sub 1}n symmetry over a wide range of temperature 300 K to 600 K, with no evidence of any phase transition. Refined lattice parameters (a, b, c and V) increases with increasing temperature. Temperature dependent dielectric properties were investigated in the frequency range from 100Hz–5MHz. Impedance spectroscopy study on the sample showed that the dielectric constant and acmore » conductivity with frequency increases on increasing the temperature. Cole-Cole plots suggest that the response from grain is dominant at low temperature whereas grain boundary response overcomes as temperature increases. The relaxation activation energy (calculated from Cole-Cole plots) value is found to be 0.32 eV for the grain boundary. We believe that the oxygen ion vacancies play an important role in conduction processes at higher temperatures.« less

  8. Experimental demonstration of scaling behavior for ionic transport and its fluctuations in individual carbon nanotube

    NASA Astrophysics Data System (ADS)

    Bocquet, Lyderic; Secchi, Eleonora; Nigues, Antoine; Siria, Alessandro

    2015-11-01

    We perform an experimental study of ionic transport and current fluctuations inside individual Carbon Nanotubes (CNT) with a size ranging from 40 down to 7 nanometers in radius. The conductance exhibits a power law behavior dependence on the salinity, with an exponent close to 1/3. This is in contrast to Boron-Nitride nanotubes which exhibits a constant surface conductance. This scaling behavior is rationalized in terms of a model accounting for hydroxide adsorption at the (hydrophobic) carbon surface. This predicts a density dependent surface charge with a exponent 1/3 in full agreement with the experimental observations. Then we measure the low frequency noise of the ionic current in single CNTs. The noise exhibits a robust 1/f characteristic, with an amplitude which scales proportionaly to the surface charge measured independently. Data for the various CNT at a given pH do collapse on a master curve. This behavior is rationalized in terms of the fluctuations of the surface charge based on the adsorption behavior. This suggests that the low frequency noise takes its origin in the process occuring at the surface of the carbon nanotube.

  9. Effect of input compression and input frequency response on music perception in cochlear implant users.

    PubMed

    Halliwell, Emily R; Jones, Linor L; Fraser, Matthew; Lockley, Morag; Hill-Feltham, Penelope; McKay, Colette M

    2015-06-01

    A study was conducted to determine whether modifications to input compression and input frequency response characteristics can improve music-listening satisfaction in cochlear implant users. Experiment 1 compared three pre-processed versions of music and speech stimuli in a laboratory setting: original, compressed, and flattened frequency response. Music excerpts comprised three music genres (classical, country, and jazz), and a running speech excerpt was compared. Experiment 2 implemented a flattened input frequency response in the speech processor program. In a take-home trial, participants compared unaltered and flattened frequency responses. Ten and twelve adult Nucleus Freedom cochlear implant users participated in Experiments 1 and 2, respectively. Experiment 1 revealed a significant preference for music stimuli with a flattened frequency response compared to both original and compressed stimuli, whereas there was a significant preference for the original (rising) frequency response for speech stimuli. Experiment 2 revealed no significant mean preference for the flattened frequency response, with 9 of 11 subjects preferring the rising frequency response. Input compression did not alter music enjoyment. Comparison of the two experiments indicated that individual frequency response preferences may depend on the genre or familiarity, and particularly whether the music contained lyrics.

  10. On regularization and error estimates for the backward heat conduction problem with time-dependent thermal diffusivity factor

    NASA Astrophysics Data System (ADS)

    Karimi, Milad; Moradlou, Fridoun; Hajipour, Mojtaba

    2018-10-01

    This paper is concerned with a backward heat conduction problem with time-dependent thermal diffusivity factor in an infinite "strip". This problem is drastically ill-posed which is caused by the amplified infinitely growth in the frequency components. A new regularization method based on the Meyer wavelet technique is developed to solve the considered problem. Using the Meyer wavelet technique, some new stable estimates are proposed in the Hölder and Logarithmic types which are optimal in the sense of given by Tautenhahn. The stability and convergence rate of the proposed regularization technique are proved. The good performance and the high-accuracy of this technique is demonstrated through various one and two dimensional examples. Numerical simulations and some comparative results are presented.

  11. Carrier interactions and porosity initiated reversal of temperature dependence of thermal conduction in nanoscale tin films

    NASA Astrophysics Data System (ADS)

    Kaul, Pankaj B.; Prakash, Vikas

    2014-01-01

    Recently, tin has been identified as an attractive electrode material for energy storage/conversion technologies. Tin thin films have also been utilized as an important constituent of thermal interface materials in thermal management applications. In this regards, in the present paper, we investigate thermal conductivity of two nanoscale tin films, (i) with thickness 500 ± 50 nm and 0.45% porosity and (ii) with thickness 100 ± 20 nm and 12.21% porosity. Thermal transport in these films is characterized over the temperature range from 40 K-310 K, using a three-omega method for multilayer configurations. The experimental results are compared with analytical predictions obtained by considering both phonon and electron contributions to heat conduction as described by existing frequency-dependent phenomenological models and BvK dispersion for phonons. The thermal conductivity of the thicker tin film (500 nm) is measured to be 46.2 W/m-K at 300 K and is observed to increase with reduced temperatures; the mechanisms for thermal transport are understood to be governed by strong phonon-electron interactions in addition to the normal phonon-phonon interactions within the temperature range 160 K-300 K. In the case of the tin thin film with 100 nm thickness, porosity and electron-boundary scattering supersede carrier interactions, and a reversal in the thermal conductivity trend with reduced temperatures is observed; the thermal conductivity falls to 1.83 W/m-K at 40 K from its room temperature value of 36.1 W/m-K. In order to interpret the experimental results, we utilize the existing analytical models that account for contributions of electron-boundary scattering using the Mayadas-Shatzkes and Fuchs-Sondheimer models for the thin and thick films, respectively. Moreover, the effects of porosity on carrier transport are included using a previous treatment based on phonon radiative transport involving frequency-dependent mean free paths and the morphology of the nanoporous channels. The systematic modeling approach presented in here can, in general, also be utilized to understand thermal transport in semi-metals and semiconductor nano-porous thin films and/or phononic nanocrystals.

  12. Viscothermal Coupling Effects on Sound Attenuation in Concentrated Colloidal Dispersions.

    NASA Astrophysics Data System (ADS)

    Han, Wei

    1995-11-01

    This thesis describes a Unified Coupled Phase Continuum (UCPC) model to analyze sound propagation through aerosols, emulsions and suspensions in terms of frequency dependent attenuation coefficient and sound speed. Expressions for the viscous and thermal coupling coefficients explicitly account for the effects of particle size, shape factor, orientation as well as concentration and the sound frequency. The UCPC model also takes into account the intrinsic acoustic absorption within the fluid medium due to its viscosity and heat conductivity. The effective complex wave number as a function of frequency is derived. A frequency- and concentration-dependent complex Nusselt number for the interfacial thermal coupling coefficient is derived using an approximate similarity between the 'viscous skin drag' and 'heat conduction flux' associated with the discontinuous suspended phase, on the basis of a cell model. The theoretical predictions of attenuation spectra provide satisfactory agreement with reported experimental data on two concentrated suspensions (polystyrene latex and kaolin pigment), two concentrated emulsions (toluene -in-water, n-hexadecane-in-water), and two aerosols (oleic acid droplets-in-nitrogen, alumina-in-air), covering a wide range of relative magnitudes (from 10^ {-3} to 10^{3}) of thermal versus viscous contributions, for dispersed phase volume fractions as high as 50%. The relative differences between the additive result of separate viscous and thermal loss estimates and combined viscothermal absorption results are also presented. Effects of particle shape on viscous attenuation of sound in concentrated suspensions of non-spherical clay particles are studied. Attenuation spectra for 18 frequencies from 3 to 100 MHz are measured and analyzed for eleven kaolin clay slurries with solid concentrations ranging from 0.6% to 35% (w/w). A modified viscous drag coefficient that considers frequency, concentration, particle size, shape and orientation of spheroids, is developed and applied to estimate the viscous attenuation coefficients. With incorporation of particle size and shape distributions (PSSD), predictions agree quantitatively with observed attenuation coefficients. The effects of particle aspect ratio and orientation become more evident as particle concentrations and frequencies are increased. The UCPC model combined with the ultrasonic spectroscopy techniques can provide for theoretical and experimental frameworks in characterization of concentrated colloidal dispersions.

  13. Sticking properties of ice grains

    NASA Astrophysics Data System (ADS)

    Jongmanns, M.; Kumm, M.; Wurm, G.; Wolf, D. E.; Teiser, J.

    2017-06-01

    We study the size dependence of pull-off forces of water ice in laboratory experiments and numerical simulations. To determine the pull-off force in our laboratory experiments, we use a liquid nitrogen cooled centrifuge. Depending on its rotation frequency, spherical ice grains detach due to the centrifugal force which is related to the adhesive properties. Numerical simulations are conducted by means of molecular dynamics simulations of hexagonal ice using a standard coarse-grained water potential. The pull-off force of a single contact between two spherical ice grains is measured due to strain controlled simulations. Both, the experimental study and the simulations reveal a dependence between the pull-off force and the (reduced) particle radii, which differ significantly from the linear dependence of common contact theories.

  14. Temperature and size-dependent Hamaker constants for metal nanoparticles

    NASA Astrophysics Data System (ADS)

    Jiang, K.; Pinchuk, P.

    2016-08-01

    Theoretical values of the Hamaker constant have been calculated for metal nanoparticles using Lifshitz theory. The theory describes the Hamaker constant in terms of the permittivity of the interacting bodies. Metal nanoparticles exhibit an internal size effect that alters the dielectric permittivity of the particle when its size falls below the mean free path of the conducting electrons. This size dependence of the permittivity leads to size-dependence of the Hamaker constant for metal nanoparticles. Additionally, the electron damping and the plasma frequency used to model the permittivity of the particle exhibit temperature-dependence, which lead to temperature dependence of the Hamaker constant. In this work, both the size and temperature dependence for gold, silver, copper, and aluminum nanoparticles is demonstrated. The results of this study might be of interest for studying the colloidal stability of nanoparticles in solution.

  15. Temperature and size-dependent Hamaker constants for metal nanoparticles.

    PubMed

    Jiang, K; Pinchuk, P

    2016-08-26

    Theoretical values of the Hamaker constant have been calculated for metal nanoparticles using Lifshitz theory. The theory describes the Hamaker constant in terms of the permittivity of the interacting bodies. Metal nanoparticles exhibit an internal size effect that alters the dielectric permittivity of the particle when its size falls below the mean free path of the conducting electrons. This size dependence of the permittivity leads to size-dependence of the Hamaker constant for metal nanoparticles. Additionally, the electron damping and the plasma frequency used to model the permittivity of the particle exhibit temperature-dependence, which lead to temperature dependence of the Hamaker constant. In this work, both the size and temperature dependence for gold, silver, copper, and aluminum nanoparticles is demonstrated. The results of this study might be of interest for studying the colloidal stability of nanoparticles in solution.

  16. Electrical, dielectric properties and study of AC electrical conduction mechanism of Li0.9□0.1NiV0.5P0.5O4

    NASA Astrophysics Data System (ADS)

    Rahal, A.; Borchani, S. Megdiche; Guidara, K.; Megdiche, M.

    2018-02-01

    In this paper, we report the measurements of impedance spectroscopy for a new olivine-type lithium deficiency Li0.9□0.1NiV0.5P0.5O4 compound. It was synthesized by the conventional solid-state technique. All the X-ray diffraction peaks of the compound are indexed, and it is found that the sample is well crystallized in orthorhombic olivine structure belonging to the space group Pnma. Conductivity and dielectric analyses of the sample are carried out at different temperatures and frequencies using the complex impedance spectroscopy technique. The electrical conductivity of Li0.9□0.1NiV0.5P0.5O4 is higher than that of parent compound LiNiV0.5P0.5O4. Temperature dependence of the DC conductivity and modulus was found to obey the Arrhenius law. The obtained values of activation energy are different which confirms that transport in the title compound is not due to a simple hopping mechanism. To determine the conduction mechanism, the AC conductivity and its frequency exponent have been analysed in this work by a theoretical model based on quantum mechanical tunnelling: the non-overlapping small polaron tunnelling model.

  17. Spatially-Resolved Hydraulic Conductivity Estimation Via Poroelastic Magnetic Resonance Elastography

    PubMed Central

    McGarry, Matthew; Weaver, John B.; Paulsen, Keith D.

    2015-01-01

    Poroelastic magnetic resonance elastography is an imaging technique that could recover mechanical and hydrodynamical material properties of in vivo tissue. To date, mechanical properties have been estimated while hydrodynamical parameters have been assumed homogeneous with literature-based values. Estimating spatially-varying hydraulic conductivity would likely improve model accuracy and provide new image information related to a tissue’s interstitial fluid compartment. A poroelastic model was reformulated to recover hydraulic conductivity with more appropriate fluid-flow boundary conditions. Simulated and physical experiments were conducted to evaluate the accuracy and stability of the inversion algorithm. Simulations were accurate (property errors were < 2%) even in the presence of Gaussian measurement noise up to 3%. The reformulated model significantly decreased variation in the shear modulus estimate (p≪0.001) and eliminated the homogeneity assumption and the need to assign hydraulic conductivity values from literature. Material property contrast was recovered experimentally in three different tofu phantoms and the accuracy was improved through soft-prior regularization. A frequency-dependence in hydraulic conductivity contrast was observed suggesting that fluid-solid interactions may be more prominent at low frequency. In vivo recovery of both structural and hydrodynamical characteristics of tissue could improve detection and diagnosis of neurological disorders such as hydrocephalus and brain tumors. PMID:24771571

  18. Thermal conductivity model for nanoporous thin films

    NASA Astrophysics Data System (ADS)

    Huang, Congliang; Zhao, Xinpeng; Regner, Keith; Yang, Ronggui

    2018-03-01

    Nanoporous thin films have attracted great interest because of their extremely low thermal conductivity and potential applications in thin thermal insulators and thermoelectrics. Although there are some numerical and experimental studies about the thermal conductivity of nanoporous thin films, a simplified model is still needed to provide a straightforward prediction. In this paper, by including the phonon scattering lifetimes due to film thickness boundary scattering, nanopore scattering and the frequency-dependent intrinsic phonon-phonon scattering, a fitting-parameter-free model based on the kinetic theory of phonon transport is developed to predict both the in-plane and the cross-plane thermal conductivities of nanoporous thin films. With input parameters such as the lattice constants, thermal conductivity, and the group velocity of acoustic phonons of bulk silicon, our model shows a good agreement with available experimental and numerical results of nanoporous silicon thin films. It illustrates that the size effect of film thickness boundary scattering not only depends on the film thickness but also on the size of nanopores, and a larger nanopore leads to a stronger size effect of the film thickness. Our model also reveals that there are different optimal structures for getting the lowest in-plane and cross-plane thermal conductivities.

  19. Conduction velocity is regulated by sodium channel inactivation in unmyelinated axons innervating the rat cranial meninges.

    PubMed

    De Col, Roberto; Messlinger, Karl; Carr, Richard W

    2008-02-15

    Axonal conduction velocity varies according to the level of preceding impulse activity. In unmyelinated axons this typically results in a slowing of conduction velocity and a parallel increase in threshold. It is currently held that Na(+)-K(+)-ATPase-dependent axonal hyperpolarization is responsible for this slowing but this has long been equivocal. We therefore examined conduction velocity changes during repetitive activation of single unmyelinated axons innervating the rat cranial meninges. In direct contradiction to the currently accepted postulate, Na(+)-K(+)-ATPase blockade actually enhanced activity-induced conduction velocity slowing, while the degree of velocity slowing was curtailed in the presence of lidocaine (10-300 microm) and carbamazepine (30-500 microm) but not tetrodotoxin (TTX, 10-80 nm). This suggests that a change in the number of available sodium channels is the most prominent factor responsible for activity-induced changes in conduction velocity in unmyelinated axons. At moderate stimulus frequencies, axonal conduction velocity is determined by an interaction between residual sodium channel inactivation following each impulse and the retrieval of channels from inactivation by a concomitant Na(+)-K(+)-ATPase-mediated hyperpolarization. Since the process is primarily dependent upon sodium channel availability, tracking conduction velocity provides a means of accessing relative changes in the excitability of nociceptive neurons.

  20. Magnetic field, frequency and temperature dependence of complex conductance of ultrathin La 1.65Sr 0.45CuO 4/La 2CuO 4 films and the organic superconductors κ-(BEDT-TTF) 2Cu[N(CN) 2]Br

    DOE PAGES

    V. A. Gasparov; Bozovic, I.; He, Xi; ...

    2015-09-01

    In this study, we used atomic-layer molecular beam epitaxy (ALL-MBE) to synthesize bilayer films of a cuprate metal (La 1.65Sr 0.45CuO 4) and a cuprate insulator (La 2CuO 4), in which interface superconductivity occurs in a layer that is just one-half unit cell thick. We have studied the magnetic field and temperature dependence of the complex sheet conductance, σ(ω), of these films, and compared them to κκ-(BEDT-TTF) 2Cu[N(CN) 2]Br single crystals. The magnetic field H was applied both parallel and perpendicular to the 2D conducting layers. Experiments have been carried out at frequencies between 23 kHz and 50 MHz usingmore » either two-coil mutual inductance technique, or the LC resonators with spiral or rectangular coils. The real and the imaginary parts of the mutual-inductance M(T,ω) between the coil and the sample were measured and converted to complex conductivity. For H perpendicular to the conducting layers, we observed almost identical behavior in both films and κ-Br single crystals: (i) the transition onset in the inductive response, L k –1(T) occurs at a temperature lower by 2 K than in Re σ(T), (ii) this shift is almost constant with magnetic field up to 8 T; (iii) the vortex diffusion constant D(T) is exponential due to pinning of vortex cores. These results can be described by the extended dynamic theory of the Berezinski–Kosterlitz–Thouless (BKT) transition and dynamics of bound vortex–antivortex pairs with short separation lengths.« less

  1. Survey of Ionospheric Pc3-5 ULF Wave Signatures in SuperDARN High Time Resolution Data

    NASA Astrophysics Data System (ADS)

    Shi, X.; Ruohoniemi, J. M.; Baker, J. B. H.; Lin, D.; Bland, E. C.; Hartinger, M. D.; Scales, W. A.

    2018-05-01

    Ionospheric signatures of ultralow frequency (ULF) wave in the Pc3-5 band (1.7-40.0 mHz) were surveyed using ˜6-s resolution data from Super Dual Auroral Radar Network (SuperDARN) radars in the Northern Hemisphere from 2010 to 2016. Numerical experiments were conducted to derive wave period-dependent thresholds for automated detection of ULF waves using the Lomb-Scargle periodogram technique. The spatial occurrence distribution, frequency characteristics, seasonal effects, solar wind condition, and geomagnetic activity level dependence have been studied. Pc5 wave events were found to dominate at high and polar latitudes with a most probable frequency of 2.08 ± 0.07 mHz, while Pc3-4 waves were relatively more common at midlatitudes on the nightside with a most probable frequency of 11.39 ± 0.14 mHz. At high latitudes, the occurrence rate of Pc4-5 waves maximizes in the dusk sector and during winter. These events tend to occur during low geomagnetic activity and northward interplanetary magnetic field. For the category of radially bounded but longitudinally extended Pc4 events in the duskside ionosphere, an internal driving source is suggested. At midlatitudes, the poloidal Pc3-4 occurrence rate maximizes premidnight and during equinox. This tendency becomes more prominent with increasing auroral electrojet (AE) index and during southward interplanetary magnetic field, which suggests that many of these events are Pi2 and Pc3-4 pulsations associated with magnetotail dynamics during active geomagnetic intervals. The overall occurrence rate of Pc3-5 wave events is lowest in summer, which suggests that the ionospheric conductivity plays a role in controlling ULF wave occurrence.

  2. Bimodal dielectric relaxation of electrolyte solutions in weakly polar solvents.

    PubMed

    Yamaguchi, Tsuyoshi; Koda, Shinobu

    2014-12-28

    The dielectric relaxation spectra of dilute electrolyte solutions in solvents of small dielectric constants are investigated both theoretically and experimentally. The theoretical calculation in our previous work [T. Yamaguchi, T. Matsuoka, and S. Koda, J. Chem. Phys. 135, 164511 (2011)] is reanalyzed, and it is shown that the dielectric relaxation spectra are composed of three components, namely, the relaxation of ionic atmosphere, the reorientational relaxation of ion pairs, and the collision between ions. The relaxation frequency of the slowest one increases with increasing the concentration, and the slower two relaxations, those of ionic atmosphere and ion pairs, merge into one at the concentration where the Debye length is comparable to the size of ions. Experimentally, the dielectric relaxation spectra of some electrolytes in two solvents, tetrahydrofuran and tetraglyme, are determined at frequencies from 300 kHz to 200 MHz, and the presence of the slower two relaxations was confirmed. The concentration dependence of the relaxation frequency is also in harmony with the theoretical calculation. The relationship between the dielectric relaxation spectra and the concentration dependence of the ionic conductivity is discussed.

  3. Bimodal dielectric relaxation of electrolyte solutions in weakly polar solvents

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Tsuyoshi; Koda, Shinobu

    2014-12-01

    The dielectric relaxation spectra of dilute electrolyte solutions in solvents of small dielectric constants are investigated both theoretically and experimentally. The theoretical calculation in our previous work [T. Yamaguchi, T. Matsuoka, and S. Koda, J. Chem. Phys. 135, 164511 (2011)] is reanalyzed, and it is shown that the dielectric relaxation spectra are composed of three components, namely, the relaxation of ionic atmosphere, the reorientational relaxation of ion pairs, and the collision between ions. The relaxation frequency of the slowest one increases with increasing the concentration, and the slower two relaxations, those of ionic atmosphere and ion pairs, merge into one at the concentration where the Debye length is comparable to the size of ions. Experimentally, the dielectric relaxation spectra of some electrolytes in two solvents, tetrahydrofuran and tetraglyme, are determined at frequencies from 300 kHz to 200 MHz, and the presence of the slower two relaxations was confirmed. The concentration dependence of the relaxation frequency is also in harmony with the theoretical calculation. The relationship between the dielectric relaxation spectra and the concentration dependence of the ionic conductivity is discussed.

  4. The effect of small-wave modulation on the electromagnetic bias

    NASA Technical Reports Server (NTRS)

    Rodriguez, Ernesto; Kim, Yunjin; Martin, Jan M.

    1992-01-01

    The effect of the modulation of small ocean waves by large waves on the physical mechanism of the EM bias is examined by conducting a numerical scattering experiment which does not assume the applicability of geometric optics. The modulation effect of the large waves on the small waves is modeled using the principle of conservation of wave action and includes the modulation of gravity-capillary waves. The frequency dependence and magnitude of the EM bias is examined for a simplified ocean spectral model as a function of wind speed. These calculations make it possible to assess the validity of previous assumptions made in the theory of the EM bias, with respect to both scattering and hydrodynamic effects. It is found that the geometric optics approximation is inadequate for predictions of the EM bias at typical radar altimeter frequencies, while the improved scattering calculations provide a frequency dependence of the EM bias which is in qualitative agreement with observation. For typical wind speeds, the EM bias contribution due to small-wave modulation is of the same order as that due to modulation by the nonlinearities of the large-scale waves.

  5. Noise effect on performance of IR PVDF pyroelectric detector

    NASA Astrophysics Data System (ADS)

    Abdullah, K. Al; Batal, M. Anwar; Hamdan, Rawad; Khalil, Toni; Salame, Chafic

    2018-05-01

    The spin-casting and casting technology were used to make IR pyroelectric PVDF detectors, where the operational amplifier, TC75S63TU, is used to amplify pyroelectrical signal. The pyroelectric coefficient is measured by charge integration method, which is 23 µC/m2K. The voltage responsivity and noise equivalent power depending on the dielectric constant, specific conductivity and loss tangent, which are measured at various frequencies, is estimated where changing of detector capacitance and resistor with frequency is taken into account. Maximum voltage responsivity was for detector thickness d=116.05 µm at chopping frequency (f=0.8Hz). Influence of thermal, Johnson and amplifier noises on output voltage are studied. At frequencies (<1kHz), Johnson noise dominates whereas at frequencies (>1kHz), amplifier voltage noise dominates. The thinner detector, the lower noise affects on output voltage. The optimal signal to noise ratio (SNR) of pyroelectrical detector is for thickness d=30.1 µm at frequency f=20Hz. The reducing electrode area decreases slightly total noise at low frequency and enhances slightly SNR of pyroelectrical detector.

  6. Measuring historical trauma in an American Indian Community Sample: Contributions of substance dependence, affective disorder, conduct disorder and PTSD

    PubMed Central

    Ehlers, Cindy L.; Gizer, Ian R.; Gilder, David A.; Ellingson, Jarrod M.; Yehuda, Rachel

    2013-01-01

    Background The American Indian experience of historical trauma is thought of as both a source of intergenerational trauma responses as well as a potential causative factor for long-term distress and substance abuse among communities. The aims of the present study were to evaluate the extent to which the frequency of thoughts of historical loss and associated symptoms are influenced by: current traumatic events, post traumatic stress disorder (PTSD), cultural identification, percent Native American Heritage, substance dependence, affective/anxiety disorders, and conduct disorder/antisocial personality disorder (ASPD). Methods Participants were American Indians recruited from reservations that were assessed with the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), The Historical Loss Scale and The Historical Loss Associated Symptoms Scale (to quantify frequency of thoughts and symptoms of historical loss) the Stressful-Life-Events Scale (to assess experiences of trauma) and the Orthogonal Cultural Identification Scale (OCIS). Results Three hundred and six (306) American Indian adults participated in the study. Over half of them indicated that they thought about historical losses at least occasionally, and that it caused them distress. Logistic regression revealed that significant increases in how often a person thought about historical losses were associated with: not being married, high degrees of Native Heritage, and high cultural identification. Additionally, anxiety/affective disorders and substance dependence were correlated with historical loss associated symptoms. Conclusions In this American Indian community, thoughts about historical losses and their associated symptomatology are common and the presences of these thoughts are associated with Native American Heritage, cultural identification, and substance dependence. PMID:23791028

  7. Influence of Al3+ substitution on the electrical resistivity and dielectric behavior of Ni0.25Cu0.20Zn0.55AlxFe2-xO4 ferrites synthesized by solid state reaction technique

    NASA Astrophysics Data System (ADS)

    Rahman, K. R.; Chowdhury, F.-U.-Z.; Khan, M. N. I.

    2017-12-01

    In this paper, the effect of Al3+ substitution on the electrical and dielectric properties of Ni0.25Cu0.20Zn0.55AlxFe2-xO4 ferrites with x = 0.0, 0.05. 0.10, 0.15 and 0.20, synthesized by solid state reaction has been reported. Using two probe method, the DC resistivity has been investigated in the temperature range from 30 °C to 300 °C. Activation energy was calculated from the Arrhenius plot. The electrical conduction is explained on the basis of the hopping mechanism. The frequency dependent dielectric properties of these spinel ferrites have been studied at room temperature by measuring AC resistivity, conductivity (σac), dielectric constant and dielectric loss tangent (tan δ) in the frequency range between 1 kHz and 120 MHz. The study of dielectric properties showed that the dielectric constant and dielectric loss increased with increasing non-magnetic Al ions. The dependence of dielectric constant with frequency has been explained by Maxwell-Wagner interfacial polarization. Cole-Cole plots show semicircular arc(s) for the samples, and equivalent RC circuits have been proposed to clarify the phenomena involved therein. The analysis of complex impedance spectroscopy has been used to distinguish between the grain and grain boundary contribution to the total resistance.

  8. Structural, Dielectric, and Electrical Properties of Bi1- x Pb x Fe1- x (Zr0.5Ti0.5) x O3

    NASA Astrophysics Data System (ADS)

    Panda, Niranjan; Pattanayak, Samita; Choudhary, R. N. P.

    2015-12-01

    Polycrystalline samples of Bi1- x Pb x Fe1- x (Zr0.5Ti0.5) x O3 (BPFZTO) with x = 0.0, 0.2, 0.3, and 0.4 were prepared by high-temperature solid-state reaction. Preliminary structural analysis of calcined powders of the materials by use of x-ray powder diffraction confirmed formation of single-phase systems with the tetragonal structure. Room-temperature scanning electron micrographs of the samples revealed uniform distribution of grains of low porosity and different dimensions on the surface of the samples. The frequency-temperature dependence of dielectric and electric properties was studied by use of dielectric and complex impedance spectroscopy over a wide range of frequency (1 kHz to 1 MHz) at different temperatures (25-500°C). The dielectric constant of BiFeO3 (BFO) was enhanced by substitution with Pb(Zr0.5Ti0.5)O3 (PZT) whereas the dielectric loss of the BPFZTO compounds decreased with increasing PZT content. A significant contribution of both grains and grain boundaries to the electrical response of the materials was observed. The frequency-dependence of the ac conductivity of BPFZTO followed Jonscher's power law. Negative temperature coefficient of resistance behavior was observed for all the BPFZTO samples. Conductivity by thermally excited charge carriers and oxygen vacancies in the materials was believed to be of the Arrhenius-type.

  9. AC electric field induced dielectrophoretic assembly behavior of gold nanoparticles in a wide frequency range

    NASA Astrophysics Data System (ADS)

    Liu, Weiyu; Wang, Chunhui; Ding, Haitao; Shao, Jinyou; Ding, Yucheng

    2016-05-01

    In this work, we focus on frequency-dependence of pearl chain formations (PCF) of gold nanoparticles driven by AC dielectrophoresis (DEP), especially in a low field-frequency range, where induced double-layer charging effect at ideally polarizable surfaces on particle DEP behavior and surrounding liquid motion need not be negligible. As field frequency varies, grown features of DEP assembly structures ranging from low-frequency non-bridged gap to high-frequency single gold nanoparticle-made nanowires bridging the electrodes are demonstrated experimentally. Specifically, at 10 kHz, a kind of novel channel-like structure with parallel opposing banks is formed at the center of interelectrode gap. In stark contrast, at 1 MHz, thin PCF with diameter of 100 nm is created along the shortest distance of the isolation spacing. Moreover, a particular conductive path of nanoparticle chains is produced at 1 MHz in a DEP device embedded with multiple floating electrodes. A theoretical framework taking into account field-induced double-layer polarization at both the particle/electrolyte and electrode/electrolyte interface is developed to correlate these experimental observations with induced-charge electrokinetic (ICEK) phenomenon. And a RC circuit model is helpful in accounting for the formation of this particular non-bridged channel-like structure induced by a low-frequency AC voltage. As compared to thin PCF formed at high field frequency that effectively short circuits the electrode pair, though it is difficult for complete PCF bridging to occur at low frequency, the non-bridged conducting microstructure has potential to further miniaturize the size of electrode gap fabricated by standard micromachining process and may find useful application in biochemical sensing.

  10. Monitoring of cell and tissue responses to photodynamic therapy by electrical impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Molckovsky, A.; Wilson, B. C.

    2001-04-01

    Electrical impedance spectroscopic (EIS) monitoring of photodynamic therapy (PDT) was investigated in vivo in rat liver and in vitro in multicellular spheroids. Liver impedance was continuously measured with two needle electrodes before, during and up to 3 hours following Photofrin-PDT. EIS spectra were altered immediately after PDT, with significant changes in conductivity at ~10 kHz, and in permittivity at ~30 kHz and 1 MHz. The change in permittivity at high frequencies was related to oedema, while low-frequency effects were attributed to cell necrosis and vascular changes. Photofrin-PDT-treated spheroids showed dose-dependent decreases in permittivity and conductivity at frequencies above 10 and 100 kHz, respectively. Histology showed concomitant development of a damaged rim containing sparsely distributed cells with compromised membranes and lightly staining cytoplasm. Different EIS responses to apoptotic versus necrotic modes of cell death further verified the sensitivity of impedance to purely cellular changes in the spheroid model. In conclusion, EIS sensitivity to PDT-induced damage, at both the cell and tissue level, varies with dose and time, and can be correlated qualitatively to biological changes.

  11. Time-frequency analysis of SEMG--with special consideration to the interelectrode spacing.

    PubMed

    Alemu, M; Kumar, Dinesh Kant; Bradley, Alan

    2003-12-01

    The surface electromyogram (SEMG) is a complex, nonstationary signal. The spectrum of the SEMG is dependent on the force of contraction being generated and other factors like muscle fatigue and interelectrode distance (IED). The spectrum of the signal is time variant. This paper reports the experimental research conducted to study the influence of force of muscle contraction and IED on the SEMG signal using time-frequency (T-F) analysis. Two T-F techniques have been used: Wigner-Ville distribution (WVD) and Choi-Williams distribution (CWD). The experiment was conducted with the help of ten healthy volunteers (five males and five females) who performed isometric elbow flexions of the active right arm at 20%, 50%, and 80% of their maximal voluntary contraction. The SEMG signal was recorded using surface electrodes placed at a distance of 18 and 36 mm over biceps brachii muscle. The results indicate that the two distributions were spread out across the frequency range at smaller IED. Further, regardless of the spacing, both distributions displayed increased spectral compression with time at higher contraction level.

  12. Corrosion monitoring using high-frequency guided ultrasonic waves

    NASA Astrophysics Data System (ADS)

    Fromme, Paul

    2014-02-01

    Corrosion develops due to adverse environmental conditions during the life cycle of a range of industrial structures, e.g., offshore oil platforms, ships, and desalination plants. Both pitting corrosion and generalized corrosion leading to wall thickness loss can cause the degradation of the structural integrity. The nondestructive detection and monitoring of corrosion damage in difficult to access areas can be achieved using high frequency guided waves propagating along the structure from accessible areas. Using standard ultrasonic transducers with single sided access to the structure, guided wave modes were generated that penetrate through the complete thickness of the structure. The wave propagation and interference of the different guided wave modes depends on the thickness of the structure. Laboratory experiments were conducted and the wall thickness reduced by consecutive milling of the steel structure. Further measurements were conducted using accelerated corrosion in a salt water bath and the damage severity monitored. From the measured signal change due to the wave mode interference the wall thickness reduction was monitored. The high frequency guided waves have the potential for corrosion damage monitoring at critical and difficult to access locations from a stand-off distance.

  13. Longitudinal optical phonon-plasmon coupled modes of degenerate Al-doped ZnO films

    NASA Astrophysics Data System (ADS)

    Ding, K.; Hu, Q. C.; Lin, W. W.; Huang, J. K.; Huang, F.

    2012-07-01

    We have investigated the interaction between carriers and polar phonons by using Raman scattering spectroscopy in highly conductive Al-doped ZnO films grown by metalorganic chemical vapor deposition. Different from the longitudinal optical phonon-plasmon coupled modes (LOPPCM) observed in nondegenerate ZnO, an A1(LO)-like mode appears at the low frequency side of the uncoupled A1(LO) mode, and it monotonically shifts to higher frequencies and approaches to the uncoupled A1(LO) mode as Al composition increases. Based on line shape calculations, the A1(LO)-like mode is assigned to the large wave-vector LOPPCM arising from nonconserving scattering dominated by the Al impurity-induced Fröhlich mechanism. Benefiting from the nonmonotonic Al composition dependence of the electron density, it is revealed that the LOPPCM depends mainly on the doping level but not the carrier concentration.

  14. Dielectric behavior and transport properties of ZnO nanorods

    NASA Astrophysics Data System (ADS)

    Soosen Samuel, M.; Koshy, Jiji; Chandran, Anoop; George, K. C.

    2011-08-01

    Highly optical, good crystalline and randomly aligned ZnO nanorods were synthesized by the hydrothermal method. The dielectric properties of ZnO nanorods were attributed to the interfacial polarization at low frequencies (below 10 kHz) and orientational polarization at higher frequencies. The observed ω( n-1) dependence of dielectric loss was discussed on the basis of the Universal model of dielectric response. Dielectric loss peak was composed of the Debye like loss peak at higher frequencies and interfacial loss peak at lower frequencies. Charge transport through the grain and grain boundary region was investigated by impedance spectroscopy. At higher temperatures the conductivity of the nanorod was mainly through the grain interior and the overall impedance was contributed by the grain boundary region. The activation energy of nanorod was calculated as 0.078 eV, which is slightly higher than the reported bulk value.

  15. Characterization and Impact of Low Frequency Wind Turbine Noise Emissions

    NASA Astrophysics Data System (ADS)

    Finch, James

    Wind turbine noise is a complex issue that requires due diligence to minimize any potential impact on quality of life. This study enhances existing knowledge of wind turbine noise through focused analyses of downwind sound propagation, directionality, and the low frequency component of the noise. Measurements were conducted at four wind speeds according to a design of experiments at incremental distances and angles. Wind turbine noise is shown to be highly directional, while downwind sound propagation is spherical with limited ground absorption. The noise is found to have a significant low frequency component that is largely independent of wind speed over the 20-250 Hz range. The generated low frequency noise is shown to be audible above 40 Hz at the MOE setback distance of 550 m. Infrasound levels exhibit higher dependency on wind speed, but remain below audible levels up to 15 m/s.

  16. Low-loss negative index metamaterials for X, Ku, and K microwave bands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, David A.; Vedral, L. James; Smith, David A.

    2015-04-15

    Low-loss, negative-index of refraction metamaterials were designed and tested for X, Ku, and K microwave frequency bands. An S-shaped, split-ring resonator was used as a unit cell to design homogeneous slabs of negative-index metamaterials. Then, the slabs of metamaterials were cut unto prisms to measure experimentally the negative index of refraction of a plane electromagnetic wave. Theoretical simulations using High-Frequency Structural Simulator, a finite element equation solver, were in good agreement with experimental measurements. The negative index of refraction was retrieved from the angle- and frequency-dependence of the transmitted intensity of the microwave beam through the metamaterial prism and comparedmore » well to simulations; in addition, near-field electromagnetic intensity mapping was conducted with an infrared camera, and there was also a good match with the simulations for expected frequency ranges for the negative index of refraction.« less

  17. Numerical calculations for effects of structure of skeletal muscle on frequency-dependence of its electrical admittance and impedance

    NASA Astrophysics Data System (ADS)

    Sekine, Katsuhisa; Yamada, Ayumi; Kageyama, Hitomi; Igarashi, Takahiro; Yamamoto, Nana; Asami, Koji

    2015-06-01

    Numerical calculations were carried out by the finite difference method using three-dimensional models to examine effects of the structure of skeletal muscle on the frequency-dependence of its electrical admittance Y and impedance Z in transversal and longitudinal directions. In the models, the muscle cell was represented by a rectangular solid surrounded by a smooth surface membrane, and the cells were assumed to be distributed periodically. The width of the cross section of the cell, thickness of the intercellular medium, and the relative permittivities and the conductivities of the cell interior, the intercellular medium and the surface membrane were changed. Based on the results of the calculations, reported changes in Y and Z of the muscles from 1 kHz to 1 MHz were analyzed. The analyses revealed that a decreased cell radius was reasonable to explain the Y and Z of the muscles of immature rats, rats subjected to sciatic nerve crush at chronic stage and the amyotrophic lateral sclerosis (ALS) mice. Changes in Y and Z due to the sciatic nerve crush at acute stage were attributable to the decreased cell radius, the increased space between the cells, the increased permittivity of the surface membrane and the increased conductivity of the cell interior. The changes in Z due to contraction were explained by the changes in the cell radius, and the conductivities of the cell interior and the intercellular medium. The changes in Z of meat due to aging were compared with the effects of the increase in the conductivity of the surface membrane.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isić, Goran, E-mail: isicg@ipb.ac.rs; Gajić, Radoš

    It is well known that due to the high conductivity of noble metals at terahertz frequencies and scalability of macroscopic Maxwell equations, a geometrical downscaling of a terahertz resonator results in the linear upscaling of its resonance frequency. However, the scaling laws of modal decay rates, important for the resonator excitation efficiency, are much less known. Here, we investigate the extent to which the scale-invariance of decay rates is violated due to the finite conductivity of the metal. We find that the resonance quality factor or the excitation efficiency may be substantially affected by scaling and show that this happensmore » as a result of the scale-dependence of the metal absorption rate, while the radiative decay and the dielectric cavity absorption rates are approximately scale-invariant. In particular, we find that by downscaling overcoupled resonators, their excitation efficiency increases, while the opposite happens with undercoupled resonators.« less

  19. Diffuse phase ferroelectric vs. Polomska transition in (1-x) BiFeO3-(x) Ba Zr0.025Ti0.975O3 (0.1 ≤ x ≤ 0.3) solid solutions

    NASA Astrophysics Data System (ADS)

    Jha, Pardeep K.; Jha, Priyanka A.; Singh, Vikash; Kumar, Pawan; Asokan, K.; Dwivedi, R. K.

    2015-01-01

    Investigations on the solid solutions (1-x) BiFeO3 - (x) Ba Zr0.025Ti0.975O3 (0.1 ≤ x ≤ 0.3) in the temperature range 300-750 K show colossal permittivity behavior and the occurrence of diffuse phase ferroelectric transition along with frequency dependent anomaly which disappears at temperature ˜450 K. For x = 0.3, these anomalies have been verified through differential scanning calorimetry and dielectric/impedance/conductivity measurements. The occurrence of peak in pyrocurrent (dPs/dT) vs. T plots also supports phase transition. With the increasing x, transition temperature decreases and diffusivity increases. This anomaly is absent at high frequencies (>100 kHz) in conductivity plots, indicating Polomska like surface phase transition, which is supported by modulus study.

  20. Electrical and thermoluminescence properties of γ-irradiated La2CuO4 crystals

    NASA Astrophysics Data System (ADS)

    El-Kolaly, M. A.; Abd El-Kader, H. I.; Kassem, M. E.

    1994-12-01

    Measurements of the electrical properties of unirradiated as well as ?-irradiated La2CuO4 crystals were carried out at different temperatures in the frequency range of 0.1-100 kHz. Thermoluminescence (TL) studies were also performed on such crystals in the temperature range of 300-600K. The conductivity of the unirradiated La2CuO4 crystals were found to obey the power law frequency dependence at each measured temperature below the transition temperature (Tc = 450K). The activation energies for conduction and dielectric relaxation time have been calculated. The TL response and the dc resistance were found to increase with ?-irradiation dose up to 9-10 kGy. The results showed that the ferroelastic domain walls of La2CuO4 crystal as well as its TL traps are sensitive to ?-raditaion. This material can be used in radiation measurements in the range 225 Gy-10 kGy.

  1. Quantum beats in conductance oscillations in graphene-based asymmetric double velocity wells and electrostatic wells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Lei; Department of Medical Physics, Basic Medical College, Hebei Medical University, Shijiazhuang, Hebei 050017; Li, Yu-Xian

    2014-01-14

    The transport properties in graphene-based asymmetric double velocity well (Fermi velocity inside the well less than that outside the well) and electrostatic well structures are investigated using the transfer matrix method. The results show that quantum beats occur in the oscillations of the conductance for asymmetric double velocity wells. The beating effect can also be found in asymmetric double electrostatic wells, but only if the widths of the two wells are different. The beat frequency for the asymmetric double well is exactly equal to the frequency difference between the oscillation rates in two isolated single wells with the same structuresmore » as the individual wells in the double well structure. A qualitative interpretation is proposed based on the fact that the resonant levels depend upon the sizes of the quantum wells. The beating behavior can provide a new way to identify the symmetry of double well structures.« less

  2. Phase transformation in multiferroic Bi5Ti3FeO15 ceramics by temperature-dependent ellipsometric and Raman spectra: An interband electronic transition evidence

    NASA Astrophysics Data System (ADS)

    Jiang, P. P.; Duan, Z. H.; Xu, L. P.; Zhang, X. L.; Li, Y. W.; Hu, Z. G.; Chu, J. H.

    2014-02-01

    Thermal evolution and an intermediate phase between ferroelectric orthorhombic and paraelectric tetragonal phase of multiferroic Bi5Ti3FeO15 ceramic have been investigated by temperature-dependent spectroscopic ellipsometry and Raman scattering. Dielectric functions and interband transitions extracted from the standard critical-point model show two dramatic anomalies in the temperature range of 200-873 K. It was found that the anomalous temperature dependence of electronic transition energies and Raman mode frequencies around 800 K can be ascribed to intermediate phase transformation. Moreover, the disappearance of electronic transition around 3 eV at 590 K is associated with the conductive property.

  3. Optical devices having flakes suspended in a host fluid to provide a flake/fluid system providing flakes with angularly dependent optical properties in response to an alternating current electric field due to the dielectric properties of the system

    DOEpatents

    Kosc, Tanya Z [Rochester, NY; Marshall, Kenneth L [Rochester, NY; Jacobs, Stephen D [Pittsford, NY

    2006-05-09

    Optical devices utilizing flakes (also called platelets) suspended in a host fluid have optical characteristics, such as reflective properties, which are angular dependent in response to an AC field. The reflectivity may be Bragg-like, and the characteristics are obtained through the use of flakes of liquid crystal material, such as polymer liquid crystal (PLC) materials including polymer cholesteric liquid crystal (PCLC) and polymer nematic liquid crystal (PNLC) material or birefringent polymers (BP). The host fluid may be propylene carbonate, poly(ethylene glycol) or other fluids or fluid mixtures having fluid conductivity to support conductivity in the flake/host system. AC field dependent rotation of 90.degree. can be obtained at rates and field intensities dependent upon the frequency and magnitude of the AC field. The devices are useful in providing displays, polarizers, filters, spatial light modulators and wherever switchable polarizing, reflecting, and transmission properties are desired.

  4. Thermal Conductance and High-Frequency Properties of Cryogenic Normal or Superconducting Semi-rigid Coaxial Cables in the Temperature Range of 1-8 K

    NASA Astrophysics Data System (ADS)

    Kushino, A.; Kasai, S.; Ukibe, M.; Ohkubo, M.

    2018-04-01

    In this study, the characteristics of thin semi-rigid cables composed of different conductors and with outer diameters ranging from 0.86 to 1.19 mm were investigated at low temperatures. The thermal conductance was measured between approximately 1 and 8 K, and the frequency dependence of the attenuation in the cables was obtained at 3 K. The electrical conductors used in the cables were alloys: beryllium copper, brass, stainless steel (SUS304), phosphor bronze, cupronickel (CuNi), and niobium-titanium (NbTi). The thermal conductance of a commercial miniature coaxial cable with braided wires forming the outer electrical conductor was also examined for reference. The measured thermal conductance was compared to published data and that generated from material libraries and databases. Among the measured cables using normal metals, the semi-rigid cable composed of SUS304 conductors and a polytetrafluoroethylene insulator showed the lowest thermal conductance. The transmission performance of the semi-rigid cables using SUS304 or CuNi was improved by plating the central conductors with a silver coating of approximately 3 μm thickness, and their thermal conductance with the plating increased by approximately one order of magnitude. The superconducting NbTi semi-rigid cable exhibited the lowest thermal conductance of all the cables considered in the present study along with very small attenuation up to above 5 GHz.

  5. Effects of a chirped bias voltage on ion energy distributions in inductively coupled plasma reactors

    NASA Astrophysics Data System (ADS)

    Lanham, Steven J.; Kushner, Mark J.

    2017-08-01

    The metrics for controlling reactive fluxes to wafers for microelectronics processing are becoming more stringent as feature sizes continue to shrink. Recent strategies for controlling ion energy distributions to the wafer involve using several different frequencies and/or pulsed powers. Although effective, these strategies are often costly or present challenges in impedance matching. With the advent of matching schemes for wide band amplifiers, other strategies to customize ion energy distributions become available. In this paper, we discuss results from a computational investigation of biasing substrates using chirped frequencies in high density, electronegative inductively coupled plasmas. Depending on the frequency range and chirp duration, the resulting ion energy distributions exhibit components sampled from the entire frequency range. However, the chirping process also produces transient shifts in the self-generated dc bias due to the reapportionment of displacement and conduction with frequency to balance the current in the system. The dynamics of the dc bias can also be leveraged towards customizing ion energy distributions.

  6. Frequency dependent dielectric properties of Sr doped NiO nanostructures

    NASA Astrophysics Data System (ADS)

    Siddique, M. Naseem; Ahmed, Ateeq; Ali, T.; Tripathi, P.

    2018-05-01

    Ni1-xSrxO (x=0.0, 0.02) nanoparticles have been synthesized using sol-gel method calcined at temperature 600 °C. The XRD analysis result revealed that the calcined sample has a cubic structure with single phase structure. We have calculated crystallite size of samples using both Debye-Sherrer and William Hall (W-H) method which are found to be 19.69 nm, 22.39 nm and 28.50 nm, 33.27 nm, respectively. TEM image reveals the formation of spherical shaped particles. In addition, dielectric properties have been studied using LCR measurement and found that ɛ', ɛ″ and tan δ are decreases with increase in frequency whereas ac conductivity increases with increase in frequency. This behavior may be explained using Maxwell-Wagner and Koop theory.

  7. Propogation loss with frequency of ultrasound guided waves in a composite metal-honeycomb structure

    NASA Astrophysics Data System (ADS)

    Saxena, Indu F.; Baid, Harsh K.; Guzman, Narciso; Kempen, Lothar U.; Mal, Ajit

    2009-05-01

    Non-destructive testing of critical structural components is time consuming, while necessary for maintaining safe operation. Large aerospace structures, such as the vertical stabilizers of aircraft undergo inspection at regular intervals for damage diagnostics. However, conventional techniques for damage detection and identification before repair can be scheduled are conducted off-line and therefore can take weeks. The use of guided ultrasound waves is being investigated to expedite damage detection in composites. We measure the frequency dependent loss of ultrasonic guided waves for a structure comprising a boron-nitride composite skin sandwiching an aluminum honeycomb. A wide range of ultrasound frequencies propagate as measured using PZTs, with the lowest attenuation observed about 200-250 kHz. These measurements are confirmed using optical fiber Bragg grating arrays used as ultrasound transducers.

  8. Radio frequency and capacitive sensors for dielectric characterization of low-conductivity media

    NASA Astrophysics Data System (ADS)

    Sheldon, Robert T.

    Low-conductivity media are found in a vast number of applications, for example as electrical insulation or as the matrix polymer in high strength-to-weight ratio structural composites. In some applications, these materials are subjected to extreme environmental, thermal, and mechanical conditions that can affect the material's desired performance. In a more general sense, a medium may be comprised of one or more layers with unknown material properties that may affect the desired performance of the entire structure. It is often, therefore, of great import to be able to characterize the material properties of these media for the purpose of estimating their future performance in a certain application. Low-conductivity media, or dielectrics, are poor electrical conductors and permit electromagnetic waves and static electric fields to pass through with minimal attenuation. The amount of electrical energy that may be stored (and lost) in these fields depends directly upon the material property, permittivity, which is generally complex, frequency-dependent and has a measurable effect on sensors designed to characterize dielectric media. In this work, two different types of dielectric sensors: radio frequency resonant antennas and lower-frequency (<1 MHz) capacitive sensors, are designed for permittivity characterization in their respective frequency regimes. In the first part of this work, the capability of characterizing multilayer dielectric structures is studied using a patch antenna, a type of antenna that is primarily designed for data communications in the microwave bands but has application in the field of nondestructive evaluation as well. Each configuration of a patch antenna has a single lowest resonant (dominant mode) frequency that is dependent upon the antenna's substrate material and geometry as well as the permittivity and geometry of exterior materials. Here, an extant forward model is validated using well-characterized microwave samples and a new method of resonant frequency and quality factor determination from measured data is presented. Excellent agreement between calculated and measured values of sensor resonant frequency was obtained for the samples studied. Agreement between calculated and measured quality factor was good in some cases but incurred the particular challenge of accurately quantifying multiple contributions to loss from the sensor structure itself, which at times dominates the contribution due to the sample material. Two later chapters describe the development of capacitive sensors to quantify the low-frequency changes in material permittivity due to environmental aging mechanisms. One embodiment involves the application of coplanar concentric interdigital electrode sensors for the purpose of investigating polymer-matrix degradation in glass-fiber composites due to isothermal aging. Samples of bismaleimide-matrix glass-fiber composites were aged at several high temperatures to induce thermal degradation and capacitive sensors were used to measure the sensor capacitance and dissipation factor, parameters that are directly proportional to the real and imaginary components of complex permittivity, respectively. It was shown that real permittivity and dissipation factor decreased with increasing aging temperature, a trend that was common to both interdigital sensor measurements and standard parallel plate electrode measurements. The second piece of work involves the development of cylindrical interdigital electrode sensors to characterize complex permittivity changes in wire insulation due to aging-related degradation. The sensor was proven effective in detecting changes in irradiated nuclear power plant wiring insulation and in aircraft wiring insulation due to liquid chemical immersion. In all three cases, the results indicate a clear correlation of measured capacitance and dissipation factor with increased degradation.

  9. Textile composite processing science

    NASA Technical Reports Server (NTRS)

    Loos, Alfred C.; Hammond, Vincent H.; Kranbuehl, David E.; Hasko, Gregory H.

    1993-01-01

    A multi-dimensional model of the Resin Transfer Molding (RTM) process was developed for the prediction of the infiltration behavior of a resin into an anisotropic fiber preform. Frequency dependent electromagnetic sensing (FDEMS) was developed for in-situ monitoring of the RTM process. Flow visualization and mold filling experiments were conducted to verify sensor measurements and model predictions. Test results indicated good agreement between model predictions, sensor readings, and experimental data.

  10. The Dependence on Smokeless Tobacco in the South Asian Communities in East London.

    PubMed

    Khaja, Amjad Hussain; Ali Zwiad, Abdulsalam; Tarakji, Bassel; Gazal, Giath; Albaba, Feras; KalajI, Nader; Petro, Waleed

    2015-05-17

    The purpose of the study was to understand the dependency on smokeless tobacco. The major aspect of the interview was to study the type of chewing tobacco used, frequency of purchase of chewing tobacco, change in attitude and behavior after the use of chewing tobacco. This study was done in 2005 in London. Of the 110 respondents interviewed 88 were used for the data analysis. An exploratory study was conducted in East London, United Kingdom. The selected sample was interviewed through a questionnaire, based on the Severson Smokeless Tobacco Dependence Scale. Cross tabulations report that in a sample of 88 South Asian UK resident men 46.6% used leaf (paan), 43.2% used processed form of chewing tobacco and 10.2% used gutka. Older age (67%) respondents were more likely than the younger age (30%) respondents to chew tobacco. The frequency of purchase of chewing tobacco is reported high (67.2%) in the older age group than the younger age group (50%). This current study used an amended form of the Severson Smokeless Tobacco Scale questionnaire to study the dependency on smokeless tobacco. The study could be developed in the selection of the sample, which would include both males and females to study the dependency on smokeless tobacco.

  11. Impedance and AC conductivity studies of Sm3+ substituted 0.8Ba0.2(Bi0.5K0.5)TiO3 lead free ceramics

    NASA Astrophysics Data System (ADS)

    Sastry, C. V. S. S.; Ramesh, M. N. V.; Ramesh, K. V.

    2017-07-01

    Samarium substituted 0.8Ba0.2(Bi0.5K0.5)TiO3 (here after abbreviated as BTBKT-20) lead free ceramics with composition 0.8Ba0.2(Bi0.5(1-x)Sm0.5xK0.5)TiO3 (where x=0.01,0.03,0.05) lead free ceramics have been prepared by solid state reaction and followed by high energy ball milling process. The present paper focuses the impedance and ac conductivity studies of Sm substituted BTBKT-20 lead free ceramics. Impedance spectroscopic studies revealthat temperature dependent relaxation process. Single depressed semi circle was observed in Cole-Cole plots, indicates non-Debye kind of relaxation process. Maximum grain resistance was observed for x=0.03 Sm substituted BTBKT-20 sample. Frequency and temperature dependent AC conductivity was calculated and it found to obey the universal Jonscher's power law and the values of activation energies suggest that conduction is ionic in nature.

  12. A novel method for synthesizing nanoscale superionic MF-Sn2F5 (M = K, Cs) solid electrolytes

    NASA Astrophysics Data System (ADS)

    Podgorbunsky, Anatoly B.; Usolseva, T. I.; Sokolov, Alexander A.; Gnedenkov, S. V.; Sinebryukhov, S. L.

    2017-09-01

    Cesium and potassium pentafluorodistannites have been synthesized through "wet" high-energy ball milling and characterized through XRD, SEM techniques. The electrical conductivity of the systems have been investigated in the temperature range from 373 K to 513 K by means of impedance spectroscopy. It has been shown that the frequency dependent conductivity of the present system shows the power law feature. Thermally induced phase transitions has been confirmed as well as activation energy calculated from temperature variation of dc conductivity. It has been shown that synthesis in a wet medium enables one to obtain nanoparticles much smaller than in the case of "dry" milling.

  13. Subminiature eddy-current transducers designed to study welded joints of titanium alloys

    NASA Astrophysics Data System (ADS)

    Malikov, V. N.; Dmitriev, S. F.; Katasonov, A. O.; Sagalakov, A. M.; Ishkov, A. V.

    2017-12-01

    Eddy current transducers (ECT) are used to construct a sensor for investigating titanium sheets connected by a welded joint. The paper provides key technical information about the eddy current transducer used and describes the procedure of measurements that makes it possible to control defects in welded joints of titanium alloys. It is capable of automatically changing the filtering cutoff frequency and operating frequency of the device. Experiments were conducted on welded VT1-0 titanium plates. The paper contains the results of these measurements. The dependence data facilitates the assessment of the quality of the welded joints and helps make an educated conclusion about welding quality.

  14. [Peculiarities of pilot's perception of flight information presented on on-board liquid crystal displays].

    PubMed

    Lemeshchenko, N A; Ivanov, A I; Lapa, V V; Davydov, V V; Zhelonkin, V I; Riabinin, V A; Golosov, S Iu

    2014-01-01

    The article deals with results of experimental studies conducted on flight testing desk and covering peculiarities of pilot's perception of flight information presented on on-board liquid crystal display in dependence on changes speed and update rate of the screen. The authors determine frequency characteristics of information update rate, that achieve acceptable quality of the flight parameters perception in accordance with the changes speed. Vigorous maneuvering with high angular velocities of changed parameters of roll and pitch causes visual distortions that are connected with poor frequency of information update rate, deteriorate piloting quality and can cause flight unsafety.

  15. State and location dependence of action potential metabolic cost in cortical pyramidal neurons.

    PubMed

    Hallermann, Stefan; de Kock, Christiaan P J; Stuart, Greg J; Kole, Maarten H P

    2012-06-03

    Action potential generation and conduction requires large quantities of energy to restore Na(+) and K(+) ion gradients. We investigated the subcellular location and voltage dependence of this metabolic cost in rat neocortical pyramidal neurons. Using Na(+)/K(+) charge overlap as a measure of action potential energy efficiency, we found that action potential initiation in the axon initial segment (AIS) and forward propagation into the axon were energetically inefficient, depending on the resting membrane potential. In contrast, action potential backpropagation into dendrites was efficient. Computer simulations predicted that, although the AIS and nodes of Ranvier had the highest metabolic cost per membrane area, action potential backpropagation into the dendrites and forward propagation into axon collaterals dominated energy consumption in cortical pyramidal neurons. Finally, we found that the high metabolic cost of action potential initiation and propagation down the axon is a trade-off between energy minimization and maximization of the conduction reliability of high-frequency action potentials.

  16. Anisotropic thermal conductivity in carbon honeycomb

    NASA Astrophysics Data System (ADS)

    Chen, Xue-Kun; Liu, Jun; Du, Dan; Xie, Zhong-Xiang; Chen, Ke-Qiu

    2018-04-01

    Carbon honeycomb, a new kind of 3D carbon allotrope experimentally synthesized recently, has received much attention for its fascinating applications in electronic device and energy storage. In the present work, we perform equilibrium molecular dynamics (EMD) to study the thermal transport properties of carbon honeycombs with different chirality. It is found that the thermal conductivity along the honeycomb axis ({κx} ) is three times larger than that normal to the axis ({κz} ), which shows strong anisotropy reflecting their geometric anisotropy. Lattice dynamics calculations reveal that this anisotropy stems from the orientation-dependent phonon group velocities. Moreover, when ambient temperature (T ) increases from 200 K to 800 K, the {{T}-1} dependence of κ is observed due to the enhanced Umklapp scattering. The detailed phonon spectra analyses indicate phonon group velocities are insensitive to the variation of ambient temperature, and the temperature dependence of the relaxation times of low-frequency phonons (<20 THz) follows ∼ {{T}-1} behavior. Our results have a certain guiding significance to develop carbon honeycomb for effective thermal channeling devices.

  17. Spectral fingerprint of electrostatic forces between biological cells

    NASA Astrophysics Data System (ADS)

    Murovec, T.; Brosseau, C.

    2015-10-01

    The prediction of electrostatic forces (EFs) between biological cells still poses challenges of great scientific importance, e.g., cell recognition, electroporation (EP), and mechanosensing. Frequency-domain finite element simulations explore a variety of cell configurations in the range of parameters typical for eukaryotic cells. Here, by applying an electric field to a pair of layered concentric shells, a prototypical model of a biological cell, we provide numerical evidence that the instantaneous EF changes from repulsion to attraction as the drive frequency of the electric field is varied. We identify crossover frequencies and discuss their dependence as a function of field frequency, conductivity of the extracellular medium, and symmetry of the configuration of cells. We present findings which suggest that the spectrum of EFs depends sensitively on the configuration of cells. We discuss the signatures of the collective behavior of systems with many cells in the spectrum of the EF and highlight a few of the observational consequences that this behavior implies. By looking at different cell configurations, we are able to show that the repulsion-to-attraction transition phenomenon is largely associated with an asymmetric electrostatic screening at very small separation between cells. These findings pave the way for the experimental observation of the electromagnetic properties of efficient and simple models of biological tissues.

  18. Spectral fingerprint of electrostatic forces between biological cells.

    PubMed

    Murovec, T; Brosseau, C

    2015-10-01

    The prediction of electrostatic forces (EFs) between biological cells still poses challenges of great scientific importance, e.g., cell recognition, electroporation (EP), and mechanosensing. Frequency-domain finite element simulations explore a variety of cell configurations in the range of parameters typical for eukaryotic cells. Here, by applying an electric field to a pair of layered concentric shells, a prototypical model of a biological cell, we provide numerical evidence that the instantaneous EF changes from repulsion to attraction as the drive frequency of the electric field is varied. We identify crossover frequencies and discuss their dependence as a function of field frequency, conductivity of the extracellular medium, and symmetry of the configuration of cells. We present findings which suggest that the spectrum of EFs depends sensitively on the configuration of cells. We discuss the signatures of the collective behavior of systems with many cells in the spectrum of the EF and highlight a few of the observational consequences that this behavior implies. By looking at different cell configurations, we are able to show that the repulsion-to-attraction transition phenomenon is largely associated with an asymmetric electrostatic screening at very small separation between cells. These findings pave the way for the experimental observation of the electromagnetic properties of efficient and simple models of biological tissues.

  19. Probing the magnetic field dependence of the light hole transition in GaAs/AlGaAs quantum wells using optically pumped NMR

    NASA Astrophysics Data System (ADS)

    Willmering, Matthew M.; Sesti, Erika L.; Hayes, Sophia E.; Wood, Ryan M.; Bowers, Clifford R.; Thapa, Sunil K.; Stanton, Christopher J.; Reyes, Arneil P.; Kuhns, Philip; McGill, Stephen

    2018-02-01

    Optically pumped NMR (OPNMR) of the NMR-active Ga/7169 species has been shown to be a unique method to probe electronic energy bands in GaAs, with sensitivity to the light hole-to-conduction band transition. This transition is often obscured in other optical measurements such as magnetoabsorption. Using OPNMR, we exploit the hyperfine interaction between conduction band electrons (and their spin states) and nuclear spins, which are detected through phase-sensitive radio-frequency (NMR) spectroscopy. Measurements were made over a range of external magnetic fields (B0) in two different labs with separate experimental setups to obtain the magnetic field dependence of the light hole-to-conduction band transition energy. In addition, k .p theory was used to interpret the experimental results, mapping out this specific transition's magnetic field dependence in an AlGaAs/GaAs quantum well. The combination of theory and experiment point to a mixing of valence bands at a field of approximately B0=4.7 T, swapping the dominant character of the absorption transition and, thus, explaining the magnetic field dependence. Lastly, the experimental dependence of the light hole-to-conduction band transition energy on B0 is found to be less steep compared to the calculated trend, indicating that inclusion of additional effects may be necessary to accurately model the spin-split band structure. The additional insight gained by Ga/7169 OPNMR about the light hole states will facilitate future testing of more complex band structure models.

  20. High figure-of-merit p-type transparent conductor, Cu alloyed ZnS via radio frequency magnetron sputtering

    NASA Astrophysics Data System (ADS)

    Maurya, Sandeep Kumar; Liu, Ya; Xu, Xiaojie; Woods-Robinson, Rachel; Das, Chandan; Ager, Joel W., III; Balasubramaniam, K. R.

    2017-12-01

    p-type transparent conducting Cu alloyed ZnS thin films from Cu{x} Zn{1-x} S targets (x = 0.1 , 0.2, 0.3, 0.4, and 0.5) were deposited on glass substrates via radio frequency sputtering. x-ray diffraction and TEM-SAED analysis show that all the films have sphalerite ZnS as the majority crystalline phase. In addition, films with 30% and 40% Cu show the presence of increasing amounts of crystalline Cu2S phase. Conductivity values  ⩾400 S cm-1 were obtained for the films having 30% and 40% Cu, with the maximum conductivity of 752 S cm-1 obtained for the film with 40% Cu. Temperature dependent electrical transport measurements indicate metallic as well as degenerate hole conductivity in the deposited films. The reflection-corrected transmittance of this Cu alloyed ZnS (40% Cu) film was determined to be  ⩾75% at 550 nm. The transparent conductor figure of merit (ΦTC ) of the Cu alloyed ZnS (40% Cu), calculated with the average value of transmittance between 1.5 to 2.5 eV, was  ≈276 μS .

  1. Far-infrared Optical Conductivity Gap in Superconducting MgB2 Films

    NASA Astrophysics Data System (ADS)

    Carnahan, M. A.; Kaindl, R. A.; Chemla, D. S.; Christen, H. M.; Zhai, H. Y.; Paranthaman, M.; Lowndes, D. H.

    2002-03-01

    The prospect of unconventional coupling in the superconductor MgB2 motivates experiments which probe the density of states around the superconducting gap. The frequency and temperature dependent optical conductivity contains important spectroscopic information about the fundamental gap excitations as well as providing a contactless measure of the superconducting condensate. Here we present the first measurements of the far-infrared conductivity of MgB2 over a broad frequency range which spans excitations across its lowest-energy superconducting gap [1]. Thin films of MgB2 are grown on Al_2O3 substrates through e-beam evaporation and subsequent ex-situ annealing [2]. Both the real and imaginary parts of the conductivity are obtained - without recourse to Kramers-Kronig transformations - from terahertz time-domain spectroscopy. Below Tc we observe a depletion of oscillator strength due to the opening of a superconducting gap. We find a gap size of 2Δ ≈ 5 meV. This result, a value which is only half that expected in weak-coupling BCS theory, disfavors a conventional isotropic single-gap scenario. [1] R. Kaindl et al., Phys. Rev. Lett. (to appear). [2] M. Paranthaman et al., Appl. Phys. Lett. 78, 3669 (2001).

  2. Studies on structural, thermal and AC conductivity scaling of PEO-LiPF6 polymer electrolyte with added ionic liquid [BMIMPF6

    NASA Astrophysics Data System (ADS)

    Chaurasia, S. K.; Saroj, A. L.; Shalu, Singh, V. K.; Tripathi, A. K.; Gupta, A. K.; Verma, Y. L.; Singh, R. K.

    2015-07-01

    Preparation and characterization of polymer electrolyte films of PEO+10wt.% LiPF6 + xwt.% BMIMPF6 (1-butyl-3-methylimidazolium hexafluorophosphate) containing dopant salt lithium hexafluorophosphate (LiPF6) and ionic liquid (BMIMPF6) having common anion PF6 - are reported. The ionic conductivity of the polymer electrolyte films has been found to increase with increasing concentration of BMIMPF6 in PEO+10 wt.% LiPF6 due to the plasticization effect of ionic liquid. DSC and XRD results show that the crystallinity of polymer electrolyte decreases with BMIMPF6 concentration which, in turn, is responsible for the increase in ionic conductivity. FTIR spectroscopic study shows the complexation of salt and/or ionic liquid cations with the polymer backbone. Ion dynamics behavior of PEO+LiPF6 as well as PEO+LiPF6 + BMIMPF6 polymer electrolytes was studied by frequency dependent conductivity, σ(f) measurements. The values σ(f) at various temperatures have been analyzed in terms of Jonscher power law (JPL) and scaled with respect to frequency which shows universal power law characteristics at all temperatures.

  3. Ion transport properties of magnesium bromide/dimethyl sulfoxide non-aqueous liquid electrolyte

    PubMed Central

    Sheha, E.

    2015-01-01

    Nonaqueous liquid electrolyte system based dimethyl sulfoxide DMSO and magnesium bromide (MgBr2) is synthesized via ‘Solvent-in-Salt’ method for the application in magnesium battery. Optimized composition of MgBr2/DMSO electrolyte exhibits high ionic conductivity of 10−2 S/cm at ambient temperature. This study discusses different concentrations from 0 to 5.4 M of magnesium salt, representing low, intermediate and high concentrations of magnesium salt which are examined in frequency dependence conductivity studies. The temperature dependent conductivity measurements have also been carried out to compute activation energy (Ea) by least square linear fitting of Arrhenius plot: ‘log σ − 1/T. The transport number of Mg2+ ion determined by means of a combination of d.c. and a.c. techniques is ∼0.7. A prototype cell was constructed using nonaqueous liquid electrolyte with Mg anode and graphite cathode. The Mg/graphite cell shows promising cycling. PMID:26843967

  4. Dispersive electron transport in tris(8-hydroxyquinoline) aluminum (Alq3) probed by impedance spectroscopy.

    PubMed

    Berleb, Stefan; Brütting, Wolfgang

    2002-12-31

    Electron transport in tris(8-hydroxyquinoline) aluminum (Alq3) is investigated by impedance spectroscopy under conditions of space-charge limited conduction (SCLC). Existing SCLC models are extended to include the field dependence of the charge carrier mobility and energetically distributed trap states. The dispersive nature of electron transport is revealed by a frequency-dependent mobility with a dispersion parameter alpha in the range 0.4-0.5, independent of temperature. This indicates that positional rather than energetic disorder is the dominant mechanism for the dispersive transport of electrons in Alq3.

  5. Strong negative terahertz photoconductivity in photoexcited graphene

    NASA Astrophysics Data System (ADS)

    Fu, Maixia; Wang, Xinke; Ye, Jiasheng; Feng, Shengfei; Sun, Wenfeng; Han, Peng; Zhang, Yan

    2018-01-01

    Terahertz (THz) response of a chemical vapor deposited graphene on a quartz substrate has been investigated by using an ultrafast optical-pump THz-probe spectroscopy. Without photoexcitation, the frequency-dependence optical conductivity shows a strong carrier response owing to the intrinsically doped graphene. Upon photoexcitation, an enhancement in THz transmission is observed and the transmission increases nonlinearly with the increase of pump power, which is rooted in a reduction of intrinsic conductivity arising from the strong enhancement of carrier scattering rather than THz emission occurrence. The modulation depth of 18.8% was experimentally achieved, which is more than four times greater than that of the previous reported. The photoinduced response here highlights the variety of response possible in graphene depending on the sample quality, carrier mobility and doping level. The graphene provides promising applications in high-performance THz modulators and THz photoelectric devices.

  6. Diagnosing the Role of Alfvén Waves in Magnetosphere-Ionosphere Coupling: Swarm Observations of Large Amplitude Nonstationary Magnetic Perturbations During an Interval of Northward IMF

    NASA Astrophysics Data System (ADS)

    Pakhotin, I. P.; Mann, I. R.; Lysak, R. L.; Knudsen, D. J.; Gjerloev, J. W.; Rae, I. J.; Forsyth, C.; Murphy, K. R.; Miles, D. M.; Ozeke, L. G.; Balasis, G.

    2018-01-01

    High-resolution multispacecraft Swarm data are used to examine magnetosphere-ionosphere coupling during a period of northward interplanetary magnetic field (IMF) on 31 May 2014. The observations reveal a prevalence of unexpectedly large amplitude (>100 nT) and time-varying magnetic perturbations during the polar passes, with especially large amplitude magnetic perturbations being associated with large-scale downward field-aligned currents. Differences between the magnetic field measurements sampled at 50 Hz from Swarm A and C, approximately 10 s apart along track, and the correspondence between the observed electric and magnetic fields at 16 samples per second, provide significant evidence for an important role for Alfvén waves in magnetosphere-ionosphere coupling even during northward IMF conditions. Spectral comparison between the wave E- and B-fields reveals a frequency-dependent phase difference and amplitude ratio consistent with interference between incident and reflected Alfvén waves. At low frequencies, the E/B ratio is in phase with an amplitude determined by the Pedersen conductance. At higher frequencies, the amplitude and phase change as a function of frequency in good agreement with an ionospheric Alfvén resonator model including Pedersen conductance effects. Indeed, within this Alfvén wave incidence, reflection, and interference paradigm, even quasi-static field-aligned currents might be reasonably interpreted as very low frequency (ω → 0) Alfvén waves. Overall, our results not only indicate the importance of Alfvén waves for magnetosphere-ionosphere coupling but also demonstrate a method for using Swarm data for the innovative experimental diagnosis of Pedersen conductance from low-Earth orbit satellite measurements.

  7. A geometrical shift results in erroneous appearance of low frequency tissue eddy current induced phase maps.

    PubMed

    Mandija, Stefano; van Lier, Astrid L H M W; Katscher, Ulrich; Petrov, Petar I; Neggers, Sebastian F W; Luijten, Peter R; van den Berg, Cornelis A T

    2016-09-01

    Knowledge on low frequency (LF) tissue conductivity is relevant for various biomedical purposes. To obtain this information, LF phase maps arising from time-varying imaging gradients have been demonstrated to create a LF conductivity contrast. Essential in this methodology is the subtraction of phase images acquired with opposite gradient polarities to separate LF and RF phase effects. Here we demonstrate how sensitive these subtractions are with respect to geometrical distortions. The effect of geometrical distortions on LF phase maps is mathematically defined. After quantifying typical geometrical distortions, their effects on LF phase maps are evaluated using conductive phantoms. For validation, electromagnetic simulations of LF phase maps were performed. Even sub-voxel distortions of 10% of the voxel size, measured for a typical LF MR sequence, cause leakage of RF phase into LF phase of several milli-radians, leading to a misleading pattern of LF phase maps. This leakage is mathematically confirmed, while simulations indicate that the expected LF phase should be in order of micro-radians. The conductivity scaling of LF phase maps is attributable to the RF phase leakage, thus dependent on the RF conductivity. In fact, simulations show that the LF phase is not measurable. Magn Reson Med 76:905-912, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  8. Frequency-dependent glycinergic inhibition modulates plasticity in hippocampus.

    PubMed

    Keck, Tara; Lillis, Kyle P; Zhou, Yu-Dong; White, John A

    2008-07-16

    Previous studies have demonstrated the presence of functional glycine receptors (GlyRs) in hippocampus. In this work, we examine the baseline activity and activity-dependent modulation of GlyRs in region CA1. We find that strychnine-sensitive GlyRs are open in the resting CA1 pyramidal cell, creating a state of tonic inhibition that "shunts" the magnitude of EPSPs evoked by electrical stimulation of the Schaffer collateral inputs. This GlyR-mediated shunting conductance is independent of the presynaptic stimulation rate; however, pairs of presynaptic and postsynaptic action potentials, repeated at frequencies above 5 Hz, reduce the GlyR-mediated conductance and increase peak EPSP magnitudes to levels at least 20% larger than those seen with presynaptic stimulation alone. We refer to this phenomenon as rate-dependent efficacy (RDE). Exogenous GlyR agonists (glycine, taurine) block RDE by preventing the closure of postsynaptic GlyRs. The GlyR antagonist strychnine blocks postsynaptic GlyRs under all conditions, occluding RDE. During RDE, GlyRs are less responsive to local glycine application, suggesting that a reduction in the number or sensitivity of membrane-inserted GlyRs underlies RDE. By extending the RDE induction protocol to include 500 paired presynaptic and postsynaptic spikes, we can induce long-term synaptic depression (LTD). Manipulations that lead to reduced functionality of GlyRs, either pharmacologically or through RDE, also lead to increased LTD. This result suggests that RDE contributes to long-term synaptic plasticity in the hippocampus.

  9. High-harmonic generation from Bloch electrons in solids

    NASA Astrophysics Data System (ADS)

    Wu, Mengxi; Ghimire, Shambhu; Reis, David A.; Schafer, Kenneth J.; Gaarde, Mette B.

    2015-04-01

    We study the generation of high-harmonic radiation by Bloch electrons in a model transparent solid driven by a strong midinfrared laser field. We solve the single-electron time-dependent Schrödinger equation (TDSE) using a velocity-gauge method [M. Korbman et al., New J. Phys. 15, 013006 (2013), 10.1088/1367-2630/15/1/013006] that is numerically stable as the laser intensity and number of energy bands are increased. The resulting harmonic spectrum exhibits a primary plateau due to the coupling of the valence band to the first conduction band, with a cutoff energy that scales linearly with field strength and laser wavelength. We also find a weaker second plateau due to coupling to higher-lying conduction bands, with a cutoff that is also approximately linear in the field strength. To facilitate the analysis of the time-frequency characteristics of the emitted harmonics, we also solve the TDSE in a time-dependent basis set, the Houston states [J. B. Krieger and G. J. Iafrate, Phys. Rev. B 33, 5494 (1986), 10.1103/PhysRevB.33.5494], which allows us to separate interband and intraband contributions to the time-dependent current. We find that the interband and intraband contributions display very different time-frequency characteristics. We show that solutions in these two bases are equivalent under a unitary transformation but that, unlike the velocity-gauge method, the Houston state treatment is numerically unstable when more than a few low-lying energy bands are used.

  10. A Harmonic Solution for the Hyperbolic Heat Conduction Equation and Its Relationship to the Guyer-Krumhansl Equation

    NASA Astrophysics Data System (ADS)

    Zhukovsky, K. V.

    2018-01-01

    A particular solution of the hyperbolic heat-conduction equation was constructed using the method of operators. The evolution of a harmonic solution is studied, which simulates the propagation of electric signals in long wire transmission lines. The structures of the solutions of the telegraph equation and of the Guyer-Krumhansl equation are compared. The influence of the phonon heat-transfer mechanism in the environment is considered from the point of view of heat conductivity. The fulfillment of the maximum principle for the obtained solutions is considered. The frequency dependences of heat conductivity in the telegraph equation and in an equation of the Guyer-Krumhansl type are studied and compared with each other. The influence of the Knudsen number on heat conductivity in the model of thin films is studied.

  11. Low-frequency random telegraphic noise and 1/f noise in the rare-earth manganite Pr0.63Ca0.37MnO3 near the charge-ordering transition

    NASA Astrophysics Data System (ADS)

    Bid, Aveek; Guha, Ayan; Raychaudhuri, A. K.

    2003-05-01

    We have studied low-frequency resistance fluctuations (noise) in a single crystal of the rare-earth perovskite manganite Pr0.63Ca0.37MnO3, which shows a charge-ordering transition at a temperature TCO≈245 K. The measurements were made across the charge-ordering transition covering the temperature range 200 K

  12. Impedance Spectroscopic Investigation of Proton Conductivity in Nafion Using Transient Electrochemical Atomic Force Microscopy (AFM)

    PubMed Central

    Hink, Steffen; Wagner, Norbert; Bessler, Wolfgang G.; Roduner, Emil

    2012-01-01

    Spatially resolved impedance spectroscopy of a Nafion polyelectrolyte membrane is performed employing a conductive and Pt-coated tip of an atomic force microscope as a point-like contact and electrode. The experiment is conducted by perturbing the system by a rectangular voltage step and measuring the incurred current, followed by Fourier transformation and plotting the impedance against the frequency in a conventional Bode diagram. To test the potential and limitations of this novel method, we present a feasibility study using an identical hydrogen atmosphere at a well-defined relative humidity on both sides of the membrane. It is demonstrated that good quality impedance spectra are obtained in a frequency range of 0.2–1000 Hz. The extracted polarization curves exhibit a maximum current which cannot be explained by typical diffusion effects. Simulation based on equivalent circuits requires a Nernst element for restricted diffusion in the membrane which suggests that this effect is based on the potential dependence of the electrolyte resistance in the high overpotential region. PMID:24958175

  13. Heat conductivity in graphene and related materials: A time-domain modal analysis

    NASA Astrophysics Data System (ADS)

    Gill-Comeau, Maxime; Lewis, Laurent J.

    2015-11-01

    We use molecular dynamics (MD) simulations to study heat conductivity in single-layer graphene and graphite. We analyze the MD trajectories through a time-domain modal analysis and show that this is essential for obtaining a reliable representation of the heat flow in graphene and graphite as it permits the proper treatment of collective vibrational excitations, in contrast to a frequency-domain formulation. Our temperature-dependent results are in very good agreement with experiment and, for temperatures in the range 300-1200 K, we find that the ZA branch allows more heat flow than all other branches combined while the contributions of the TA, LA, and ZO branches are comparable at all temperatures. Conductivity mappings reveal strong collective excitations associated with low-frequency ZA modes. We demonstrate that these collective effects are a consequence of the quadratic nature of the ZA branch as they also show up in graphite but are reduced in strained graphene, where the dispersion becomes linear, and are absent in diamond, where acoustic branches are linear. In general, neglecting collective excitations yields errors similar to those from the single-mode relaxation-time approximation.

  14. Elucidating the DEP phenomena using a volumetric polarization approach with consideration of the electric double layer

    PubMed Central

    Brcka, Jozef; Faguet, Jacques; Zhang, Guigen

    2017-01-01

    Dielectrophoretic (DEP) phenomena have been explored to great success for various applications like particle sorting and separation. To elucidate the underlying mechanism and quantify the DEP force experienced by particles, the point-dipole and Maxwell Stress Tensor (MST) methods are commonly used. However, both methods exhibit their own limitations. For example, the point-dipole method is unable to fully capture the essence of particle-particle interactions and the MST method is not suitable for particles of non-homogeneous property. Moreover, both methods fare poorly when it comes to explaining DEP phenomena such as the dependence of crossover frequency on medium conductivity. To address these limitations, the authors have developed a new method, termed volumetric-integration method, with the aid of computational implementation, to reexamine the DEP phenomena, elucidate the governing mechanism, and quantify the DEP force. The effect of an electric double layer (EDL) on particles' crossover behavior is dealt with through consideration of the EDL structure along with surface ionic/molecular adsorption, unlike in other methods, where the EDL is accounted for through simply assigning a surface conductance value to the particles. For validation, by comparing with literature experimental data, the authors show that the new method can quantify the DEP force on not only homogeneous particles but also non-homogeneous ones, and predict particle-particle interactions fairly accurately. Moreover, the authors also show that the predicted dependence of crossover frequency on medium conductivity and particle size agrees very well with experimental measurements. PMID:28396710

  15. Size effects on the thermal conductivity of amorphous silicon thin films

    DOE PAGES

    Thomas Edwin Beechem; Braun, Jeffrey L.; Baker, Christopher H.; ...

    2016-04-01

    In this study, we investigate thickness-limited size effects on the thermal conductivity of amorphous silicon thin films ranging from 3 to 1636 nm grown via sputter deposition. While exhibiting a constant value up to ~100 nm, the thermal conductivity increases with film thickness thereafter. The thickness dependence we demonstrate is ascribed to boundary scattering of long wavelength vibrations and an interplay between the energy transfer associated with propagating modes (propagons) and nonpropagating modes (diffusons). A crossover from propagon to diffuson modes is deduced to occur at a frequency of ~1.8 THz via simple analytical arguments. These results provide empirical evidencemore » of size effects on the thermal conductivity of amorphous silicon and systematic experimental insight into the nature of vibrational thermal transport in amorphous solids.« less

  16. Manipulation of peripheral neural feedback loops alters human corticomuscular coherence

    PubMed Central

    Riddle, C Nicholas; Baker, Stuart N

    2005-01-01

    Sensorimotor EEG shows ∼20 Hz coherence with contralateral EMG. This could involve efferent and/or afferent components of the sensorimotor loop. We investigated the pathways responsible for coherence genesis by manipulating nervous conduction delays using cooling. Coherence between left sensorimotor EEG and right EMG from three hand and two forearm muscles was assessed in healthy subjects during the hold phase of a precision grip task. The right arm was then cooled to 10°C for ∼90 min, increasing peripheral motor conduction time (PMCT) by ∼35% (assessed by F-wave latency). EEG and EMG recordings were repeated, and coherence recalculated. Control recordings revealed a heterogeneous subject population. In 6/15 subjects (Group A), the corticomuscular coherence phase increased linearly with frequency, as expected if oscillations were propagated along efferent pathways from cortex to muscle. The mean corticomuscular conduction delay for intrinsic hand muscles calculated from the phase–frequency regression slope was 10.4 ms; this is smaller than the delay expected for conduction over fast corticospinal pathways. In 8/15 subjects (Group B), the phase showed no dependence with frequency. One subject showed both Group A and Group B patterns over different frequency ranges. Following cooling, averaged corticomuscular coherence was decreased in Group A subjects, but unchanged for Group B, even though both groups showed comparable slowing of nervous conduction. The delay calculated from the slope of the phase–frequency regression was increased following cooling. However, the size of this increase was around twice the rise in PMCT measured using the F-wave (regression slope 2.33, 95% confidence limits 1.30–3.36). Both afferent and efferent peripheral nerves will be slowed by similar amounts following cooling. The change in delay calculated from the coherence phase therefore better matches the rise in total sensorimotor feedback loop time caused by cooling, rather than just the change in the efferent limb. A model of corticomuscular coherence which assumes that only efferent pathways contribute cannot be reconciled to these results. The data rather suggest that afferent feedback pathways may also play a role in the genesis of corticomuscular coherence. PMID:15919711

  17. Dielectric relaxation and electronic structure of double perovskite Sr{sub 2}FeSbO{sub 6}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dutta, Alo; Sinha, T. P.; Shannigrahi, Santiranjan

    2008-09-15

    The dielectric property and the electronic structure of a double perovskite, Sr{sub 2}FeSbO{sub 6} (SFS) synthesized by solid state reaction technique are investigated. The x-ray diffraction of the sample taken at room temperature shows cubic phase. The scanning electron micrograph of the sample also confirms the formation of the single phase of the material. We have measured the capacitance and conductance of SFS in a frequency range from 50 Hz to 1 MHz and in a temperature range from 163 to 463 K. A relaxation is observed in the entire temperature range as a gradual decrease in {epsilon}{sup '}({omega}) andmore » as a broad peak in {epsilon}{sup ''}({omega}). The frequency dependent electrical data are analyzed in the framework of conductivity and electric modulus formalisms. The frequencies corresponding to the maxima of the imaginary electric modulus at various temperatures are found to obey an Arrhenius law with an activation energy of 0.74 eV. The Cole-Cole model is used to study the dielectric relaxation of SFS. The scaling behavior of imaginary part of electric modulus suggests that the relaxation describes the same mechanism at various temperatures. The frequency dependent conductivity spectra follow the universal power law. The electronic structure of the SFS is studied by x-ray photoemission spectroscopy (XPS). Its valence band consists mainly of the oxygen 2p-states hybridized with the Fe 3d-states. The XPS spectra are investigated by the first principles full potential linearized augmented plane wave method. The angular momentum projected total and partial density of states obtained from first principles calculation are used to analyze the XPS results of the sample. The calculated electronic structures of SFS are qualitatively similar to those of the XPS spectra in terms of spectral features, energy positions, and relative intensities. The electronic structure calculation reveals that the electrical properties of SFS are dominated by the interaction between transition-metal and oxygen ions.« less

  18. Alternating-current conductivity and dielectric relaxation of bulk iodoargentate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duan, Hai-Bao, E-mail: duanhaibao4660@163.com; Yu, Shan-Shan; Zhou, Hong

    Graphical abstract: The electric modulus shows single dielectric relaxation process in the measured frequency range. - Highlights: • The conduction mechanism is described by quantum mechanical tunneling model. • The applications of dielectric modulus give a simple method for evaluating the activation energy of the dielectric relaxation. • The [Ag{sub 2}I{sub 4}]{sup 2−}1-D chain and [Cu(en){sub 2}]{sup 2+} cation column form the layered stacks by hydrogen bond interactions. - Abstract: An inorganic-organic hybrid compound Cu(en){sub 2}Ag{sub 2}I{sub 4} (en = ethylenediamine) (1) was synthesized and single crystal structurally characterized. Along the [001] direction, the inorganic parts form an infinite 1-Dmore » chain and [Cu(en){sub 2}]{sup 2+} cations are separated by inorganic chain. The electrical conductivity and dielectric properties of 1 have been investigated over wide ranges of frequency. The alternating-current conductivities have been fitted to the Almond–West type power law expression with use of a single value of S. It is found that S values for 1 are nearly temperature-independent, which indicates that the conduction mechanism could be quantum mechanical tunneling (QMT) model. The dielectric loss and electric modulus show single dielectric relaxation process. The activation energy obtained from temperature-dependent electric modulus compare with the calculated from the dc conductivity plots.« less

  19. Conduction velocity is regulated by sodium channel inactivation in unmyelinated axons innervating the rat cranial meninges

    PubMed Central

    De Col, Roberto; Messlinger, Karl; Carr, Richard W

    2008-01-01

    Axonal conduction velocity varies according to the level of preceding impulse activity. In unmyelinated axons this typically results in a slowing of conduction velocity and a parallel increase in threshold. It is currently held that Na+–K+-ATPase-dependent axonal hyperpolarization is responsible for this slowing but this has long been equivocal. We therefore examined conduction velocity changes during repetitive activation of single unmyelinated axons innervating the rat cranial meninges. In direct contradiction to the currently accepted postulate, Na+–K+-ATPase blockade actually enhanced activity-induced conduction velocity slowing, while the degree of velocity slowing was curtailed in the presence of lidocaine (10–300 μm) and carbamazepine (30–500 μm) but not tetrodotoxin (TTX, 10–80 nm). This suggests that a change in the number of available sodium channels is the most prominent factor responsible for activity-induced changes in conduction velocity in unmyelinated axons. At moderate stimulus frequencies, axonal conduction velocity is determined by an interaction between residual sodium channel inactivation following each impulse and the retrieval of channels from inactivation by a concomitant Na+–K+-ATPase-mediated hyperpolarization. Since the process is primarily dependent upon sodium channel availability, tracking conduction velocity provides a means of accessing relative changes in the excitability of nociceptive neurons. PMID:18096592

  20. Trap assisted space charge conduction in p-NiO/n-ZnO heterojunction diode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tyagi, Manisha; Tomar, Monika; Gupta, Vinay, E-mail: drguptavinay@gmail.com

    2015-06-15

    Highlights: • p-NiO/n-ZnO heterojunction diode with enhanced junction parameters has been prepared. • Temperature dependent I–V throw insight into the involved conduction mechanism. • SCLC with exponential trap distribution was found to be the dominant mechanism. • C–V measurement at different frequencies support the presence of traps. - Abstract: The development of short-wavelength p–n junction is essentially important for the realization of transparent electronics for next-generation optoelectronic devices. In the present work, a p–n heterojunction diode based on p-NiO/n-ZnO has been prepared under the optimised growth conditions exhibiting improved electrical and junction parameters. The fabricated heterojunction gives typical current–voltage (I–V)more » characteristics with good rectifying behaviour (rectification ratio ≈ 10{sup 4} at 2 V). The temperature dependent current–voltage characteristics of heterojunction diode have been studied and origin of conduction mechanism is identified. The space-charge limited conduction with exponential trap distribution having deep level trap is found to be the dominant conduction mechanism in the fabricated p–n heterojunction diode. The conduction and valence band discontinuities for NiO/ZnO heterostructure have been determined from the capacitance–voltage (C–V) measurements.« less

  1. Engineering frequency-dependent superfluidity in Bose-Fermi mixtures

    NASA Astrophysics Data System (ADS)

    Arzamasovs, Maksims; Liu, Bo

    2018-04-01

    Unconventional superconductivity and superfluidity are among the most exciting and fascinating quantum phenomena in condensed-matter physics. Usually such states are characterized by nontrivial spin or spatial symmetry of the pairing order parameter, such as "spin triplet" or "p wave." However, besides spin and spatial dependence the order parameter may have unconventional frequency dependence which is also permitted by Fermi-Dirac statistics. Odd-frequency fermionic pairing is an exciting paradigm when discussing exotic superfluidity or superconductivity and is yet to be realized in experiments. In this paper we propose a symmetry-based method of controlling frequency dependence of the pairing order parameter via manipulating the inversion symmetry of the system. First, a toy model is introduced to illustrate that frequency dependence of the order parameter can be achieved through our proposed approach. Second, by taking advantage of recent rapid developments in producing spin-orbit-coupled dispersions in ultracold gases, we propose a Bose-Fermi mixture to realize such frequency-dependent superfluid. The key idea is introducing the frequency-dependent attraction between fermions mediated by Bogoliubov phonons with asymmetric dispersion. Our proposal should pave an alternative way for exploring frequency-dependent superfluids with cold atoms.

  2. Colossal dielectric constants in single-crystalline and ceramic CaCu3Ti4O12 investigated by broadband dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Krohns, S.; Lunkenheimer, P.; Ebbinghaus, S. G.; Loidl, A.

    2008-04-01

    In the present work, the authors report results of broadband dielectric spectroscopy on various samples of CaCu3Ti4O12 (CCTO), also including single-crystalline material, which so far was only rarely investigated. The measurements extend up to 1.3 GHz, covering more than nine frequency decades. We address the question of the origin of the colossal dielectric constants and of the relaxational behavior in this material, including the second relaxation reported in several recent works. For this purpose, the dependence of the temperature- and frequency-dependent dielectric properties on different tempering and surface treatments of the samples and on ac-field amplitude is investigated. Broadband spectra of a single crystal are analyzed by an equivalent circuit description by assuming two highly resistive layers in series to the bulk. Good fits could be achieved, including the second relaxation, which also shows up in single crystals. The temperature- and frequency-dependent intrinsic conductivity of CCTO is consistent with the variable range hopping model. The second relaxation is sensitive to surface treatment and, in contrast to the main relaxation, is also strongly affected by the applied ac voltage. Concerning the origin of the two insulating layers, we discuss a completely surface-related mechanism by assuming the formation of a metal-insulator diode and a combination of surface and internal barriers.

  3. Dielectric studies of Co3-xMnxO4 (x=0.1-1.0) cubic spinel multiferroic

    NASA Astrophysics Data System (ADS)

    Meena, P. L.; Kumar, Ravi; Prajapat, C. L.; Sreenivas, K.; Gupta, Vinay

    2009-07-01

    A series of Co3-xMnxO4 (x =0.1-1.0) multiferroic cubic spinel ceramics were prepared to study the effect of Mn substitution at Co site on the crystal structures and dielectric properties. No significant change in the structural symmetry was observed with increasing x up to 1.0. A linear increase in lattice parameter with x is attributed to the substitution of Co3+ by Mn3+ (large ionic radii) at the octahedral sites. An antiferromagnetic-type ordering of Co3O4 changes to ferrimagnetic-type order after incorporation of Mn. The effect of Mn substitution on the dielectric constant and loss tangent was studied over a wide range of frequency (75 kHz-5 MHz) and temperature of 150-450 K. The measured value of room temperature ac conductivity at 1.0 MHz was found to increase from 2.0×10-6 to 4.4×10-4 Ω-1 cm-1 and follows power law (σac=Aωs) behavior. The dielectric constant ɛ'(ω) shows a weak frequency dispersion and small temperature dependence below 250 K for all ceramic samples. However, a strong temperature and frequency dependence on ɛ'(ω) was observed at higher temperature (>250 K). The temperature dependent ɛ'(ω) data show the existence of room temperature ferroelectricity in all prepared samples.

  4. Measuring historical trauma in an American Indian community sample: contributions of substance dependence, affective disorder, conduct disorder and PTSD.

    PubMed

    Ehlers, Cindy L; Gizer, Ian R; Gilder, David A; Ellingson, Jarrod M; Yehuda, Rachel

    2013-11-01

    The American Indian experience of historical trauma is thought of as both a source of intergenerational trauma responses as well as a potential causative factor for long-term distress and substance abuse among communities. The aims of the present study were to evaluate the extent to which the frequency of thoughts of historical loss and associated symptoms are influenced by: current traumatic events, post traumatic stress disorder (PTSD), cultural identification, percent Native American Heritage, substance dependence, affective/anxiety disorders, and conduct disorder/antisocial personality disorder (ASPD). Participants were American Indians recruited from reservations that were assessed with the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), The Historical Loss Scale and The Historical Loss Associated Symptoms Scale (to quantify frequency of thoughts and symptoms of historical loss) the Stressful-Life-Events Scale (to assess experiences of trauma) and the Orthogonal Cultural Identification Scale (OCIS). Three hundred and six (306) American Indian adults participated in the study. Over half of them indicated that they thought about historical losses at least occasionally, and that it caused them distress. Logistic regression revealed that significant increases in how often a person thought about historical losses were associated with: not being married, high degrees of Native Heritage, and high cultural identification. Additionally, anxiety/affective disorders and substance dependence were correlated with historical loss associated symptoms. In this American Indian community, thoughts about historical losses and their associated symptomatology are common and the presence of these thoughts are associated with Native American Heritage, cultural identification, and substance dependence. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. Computational method for exact frequency-dependent rays on the basis of the solution of the Helmholtz equation

    NASA Astrophysics Data System (ADS)

    Protasov, M.; Gadylshin, K.

    2017-07-01

    A numerical method is proposed for the calculation of exact frequency-dependent rays when the solution of the Helmholtz equation is known. The properties of frequency-dependent rays are analysed and compared with classical ray theory and with the method of finite-difference modelling for the first time. In this paper, we study the dependence of these rays on the frequency of signals and show the convergence of the exact rays to the classical rays with increasing frequency. A number of numerical experiments demonstrate the distinctive features of exact frequency-dependent rays, in particular, their ability to penetrate into shadow zones that are impenetrable for classical rays.

  6. Investigation of Trap States in AlInN/AlN/GaN Heterostructures by Frequency-Dependent Admittance Analysis

    NASA Astrophysics Data System (ADS)

    Arslan, Engin; Bütün, Serkan; Şafak, Yasemin; Ozbay, Ekmel

    2010-12-01

    We present a systematic study on the admittance characterization of surface trap states in unpassivated and SiN x -passivated Al0.83In0.17N/AlN/GaN heterostructures. C- V and G/ ω- V measurements were carried out in the frequency range of 1 kHz to 1 MHz, and an equivalent circuit model was used to analyze the experimental data. A detailed analysis of the frequency-dependent capacitance and conductance data was performed, assuming models in which traps are located at the metal-AlInN surface. The density ( D t) and time constant ( τ t) of the surface trap states have been determined as a function of energy separation from the conduction-band edge ( E c - E t). The D st and τ st values of the surface trap states for the unpassivated samples were found to be D_{{st}} \\cong (4 - 13) × 10^{12} {eV}^{ - 1} {cm}^{ - 2} and τ st ≈ 3 μs to 7 μs, respectively. For the passivated sample, D st decreased to 1.5 × 10^{12} {eV}^{ - 1} {cm}^{ - 2} and τ st to 1.8 μs to 2 μs. The density of surface trap states in Al0.83In0.17N/AlN/GaN heterostructures decreased by approximately one order of magnitude with SiN x passivation, indicating that the SiN x insulator layer between the metal contact and the surface of the Al0.83In0.17N layer can passivate surface states.

  7. Temperature dependent quasi-static capacitance-voltage characterization of SiO2/β-Ga2O3 interface on different crystal orientations

    NASA Astrophysics Data System (ADS)

    Zeng, Ke; Singisetti, Uttam

    2017-09-01

    The interface trap density (Dit) of the SiO2/β-Ga2O3 interface in ( 2 ¯ 01), (010), and (001) orientations is obtained by the Hi-Lo method with the low frequency capacitance measured using the Quasi-Static Capacitance-Voltage (QSCV) technique. QSCV measurements are carried out at higher temperatures to increase the measured energy range of Dit in the bandgap. At room temperature, higher Dit is observed near the band edge for all three orientations. The measurement at higher temperatures led to an annealing effect that reduced the Dit value for all samples. Comparison with the conductance method and frequency dispersion of the capacitance suggests that the traps at the band edge are slow traps which respond to low frequency signals.

  8. Dielectric and relaxation properties of poly(o-anisidine)/graphene nanocomposite

    NASA Astrophysics Data System (ADS)

    Sangamithirai, D.; Narayanan, V.; Stephen, A.

    2016-05-01

    Poly(o-anisidine)/graphene (POA/GR) nanocomposite was synthesized via chemical oxidative polymerization of o-anisidine in the presence of graphene sheets in acidic medium. The electrical properties of the nanocomposite are studied using AC impedance spectroscopic technique. It has been found that the room temperature electrical conductivity value enhanced from 1.28 × 10-6 S cm-1 to 4.47 × 10-4 S cm-1 on addition of 10 wt % of graphene into the polymer. An analysis of real and imaginary parts of dielectric permittivity reveals that both ɛ` and ɛ״ increases with the decrease of frequency at all temperature levels. Frequency dependence of dielectric loss (tan δ) spectrum indicates that hopping frequency increases with temperature and the relaxation time decreases from 2.67 × 10-5 to 7.28 × 10-6 sec.

  9. Spectral induced polarization of the three-phase system CO2 - brine - sand under reservoir conditions

    NASA Astrophysics Data System (ADS)

    Börner, Jana H.; Herdegen, Volker; Repke, Jens-Uwe; Spitzer, Klaus

    2017-01-01

    The spectral complex conductivity of a water-bearing sand during interaction with carbon dioxide (CO2) is influenced by multiple, simultaneous processes. These processes include partial saturation due to the replacement of conductive pore water with CO2 and chemical interaction of the reactive CO2 with the bulk fluid and the grain-water interface. We present a laboratory study on the spectral induced polarization of water-bearing sands during exposure to and flow-through by CO2. Conductivity spectra were measured successfully at pressures up to 30 MPa and 80 °C during active flow and at steady-state conditions concentrating on the frequency range between 0.0014 and 100 Hz. The frequency range between 0.1 and 100 Hz turned out to be most indicative for potential monitoring applications. The presented data show that the impact of CO2 on the electrolytic conductivity may be covered by a model for pore-water conductivity, which depends on salinity, pressure and temperature and has been derived from earlier investigations of the pore-water phase. The new data covering the three-phase system CO2-brine-sand further show that chemical interaction causes a reduction of surface conductivity by almost 20 per cent, which could be related to the low pH-value in the acidic environment due to CO2 dissolution and the dissociation of carbonic acid. The quantification of the total CO2 effect may be used as a correction during monitoring of a sequestration in terms of saturation. We show that this leads to a correct reconstruction of fluid saturation from electrical measurements. In addition, an indicator for changes of the inner surface area, which is related to mineral dissolution or precipitation processes, can be computed from the imaginary part of conductivity. The low frequency range between 0.0014 and 0.1 Hz shows additional characteristics, which deviate from the behaviour at higher frequencies. A Debye decomposition approach is applied to isolate the feature dominating the data at low frequencies. We conclude from our study that electrical conductivity is not only a highly sensitive indicator for CO2 saturation in pore space. When it is measured in its full spectral and complex form it contains additional information on the chemical state of the system, which holds the potential of getting access to both saturation and interface properties with one monitoring method.

  10. An analysis of the relationships between subthreshold electrical properties and excitability in skeletal muscle

    PubMed Central

    L.-H. Huang, Christopher; Fraser, James A.

    2011-01-01

    Skeletal muscle activation requires action potential (AP) initiation followed by its sarcolemmal propagation and tubular excitation to trigger Ca2+ release and contraction. Recent studies demonstrate that ion channels underlying the resting membrane conductance (GM) of fast-twitch mammalian muscle fibers are highly regulated during muscle activity. Thus, onset of activity reduces GM, whereas prolonged activity can markedly elevate GM. Although these observations implicate GM regulation in control of muscle excitability, classical theoretical studies in un-myelinated axons predict little influence of GM on membrane excitability. However, surface membrane morphologies differ markedly between un-myelinated axons and muscle fibers, predominantly because of the tubular (t)-system of muscle fibers. This study develops a linear circuit model of mammalian muscle fiber and uses this to assess the role of subthreshold electrical properties, including GM changes during muscle activity, for AP initiation, AP propagation, and t-system excitation. Experimental observations of frequency-dependent length constant and membrane-phase properties in fast-twitch rat fibers could only be replicated by models that included t-system luminal resistances. Having quantified these resistances, the resulting models showed enhanced conduction velocity of passive current flow also implicating elevated AP propagation velocity. Furthermore, the resistances filter passive currents such that higher frequency current components would determine sarcolemma AP conduction velocity, whereas lower frequency components excite t-system APs. Because GM modulation affects only the low-frequency membrane impedance, the GM changes in active muscle would predominantly affect neuromuscular transmission and low-frequency t-system excitation while exerting little influence on the high-frequency process of sarcolemmal AP propagation. This physiological role of GM regulation was increased by high Cl− permeability, as in muscle endplate regions, and by increased extracellular [K+], as observed in working muscle. Thus, reduced GM at the onset of exercise would enhance t-system excitation and neuromuscular transmission, whereas elevated GM after sustained activity would inhibit these processes and thereby accentuate muscle fatigue. PMID:21670208

  11. Turbulent Boundary Layers in Oscillating Flows. Part 1: an Experimental and Computational Study

    NASA Technical Reports Server (NTRS)

    Cook, W. J.

    1986-01-01

    An experimental-computational study of the behavior of turbulent boundary layers for oscillating air flows over a plane surface with a small favorable mean pressure gradient is described. Experimental studies were conducted for boundary layers generated on the test section wall of a facility that produces a flow with a mean free stream velocity and a superposed nearly-pure sinusoidal component over a wide range of frequency. Flow at a nominal mean free stream velocity of 50 m/s were studied at atmospheric pressure and temperature at selected axial positions over a 2 m test length for frequencies ranging from 4 to 29 Hz. Quantitative experimental results are presented for unsteady velocity profiles and longitudinal turbulence levels obtained from hot wire anemometer measurements at three axial positions. Mean velocity profiles for oscillating flows were found to exhibit only small deviations from corresponding steady flow profiles, while amplitudes and phase relationships exhibited a strong dependence on axial position and frequency. Since sinusoidal flows could be generated over a wide range of frequency, studies at fixed values of reduced frequency at different axial positions were studied. Results show that there is some utility in the use of reduced frequency to correlate unsteady velocity results. The turbulence level u' sub rms was observed to vary essentially sinusoidally around values close to those measured in steady flow. However, the amplitude of oscillation and phase relations for turbulence level were found to be strongly frequency dependent. Numerical predictions were obtained using an unsteady boundary layer computational code and the Cebeci-Smith and Glushko turbulence models. Predicted quantities related to unsteady velocity profiles exhibit fair agreement with experiment when the Cebeci-Smith turbulence model is used.

  12. Modeling seasonal behavior changes and disease transmission with application to chronic wasting disease.

    PubMed

    Oraby, Tamer; Vasilyeva, Olga; Krewski, Daniel; Lutscher, Frithjof

    2014-01-07

    Behavior and habitat of wildlife animals change seasonally according to environmental conditions. Mathematical models need to represent this seasonality to be able to make realistic predictions about the future of a population and the effectiveness of human interventions. Managing and modeling disease in wild animal populations requires particular care in that disease transmission dynamics is a critical consideration in the etiology of both human and animal diseases, with different transmission paradigms requiring different disease risk management strategies. Since transmission of infectious diseases among wildlife depends strongly on social behavior, mechanisms of disease transmission could also change seasonally. A specific consideration in this regard confronted by modellers is whether the contact rate between individuals is density-dependent or frequency-dependent. We argue that seasonal behavior changes could lead to a seasonal shift between density and frequency dependence. This hypothesis is explored in the case of chronic wasting disease (CWD), a fatal disease that affects deer, elk and moose in many areas of North America. Specifically, we introduce a strategic CWD risk model based on direct disease transmission that accounts for the seasonal change in the transmission dynamics and habitats occupied, guided by information derived from cervid ecology. The model is composed of summer and winter susceptible-infected (SI) equations, with frequency-dependent and density-dependent transmission dynamics, respectively. The model includes impulsive birth events with density-dependent birth rate. We determine the basic reproduction number as a weighted average of two seasonal reproduction numbers. We parameterize the model from data derived from the scientific literature on CWD and deer ecology, and conduct global and local sensitivity analyses of the basic reproduction number. We explore the effectiveness of different culling strategies for the management of CWD: although summer culling seems to be an effective disease eradication strategy, the total culling rate is limited by the requirement to preserve the herd. © 2013 Elsevier Ltd. All rights reserved.

  13. In vitro Neurons in Mammalian Cortical Layer 4 Exhibit Intrinsic Oscillatory Activity in the 10- to 50-Hz Frequency Range

    NASA Astrophysics Data System (ADS)

    Llinas, Rodolfo R.; Grace, Anthony A.; Yarom, Yosef

    1991-02-01

    We report here the presence of fast subthreshold oscillatory potentials recorded in vitro from neurons within layer 4 of the guinea pig frontal cortex. Two types of oscillatory neurons were recorded: (i) One type exhibited subthreshold oscillations whose frequency increased with membrane depolarization and encompassed a range of 10-45 Hz. Action potentials in this type of neuron demonstrated clear after-hyperpolarizations. (ii) The second type of neuron was characterized by narrow-frequency oscillations near 35-50 Hz. These oscillations often outlasted the initiating depolarizing stimulus. No calcium component could be identified in their action potential. In both types of cell the subthreshold oscillations were tetrodotoxin-sensitive, indicating that the depolarizing phase of the oscillation was generated by a voltage-dependent sodium conductance. The initial depolarizing phase was followed by a potassium conductance responsible for the falling phase of the oscillatory wave. In both types of cell, the subthreshold oscillation could trigger spikes at the oscillatory frequency, if the membrane was sufficiently depolarized. Combining intracellular recordings with Lucifer yellow staining showed that the narrow-frequency oscillatory activity was produced by a sparsely spinous interneuron located in layer 4 of the cortex. This neuron has extensive local axonal collaterals that ramify in layers 3 and 4 such that they may contribute to the columnar synchronization of activity in the 40- to 50-Hz range. Cortical activity in this frequency range has been proposed as the basis for the "conjunctive properties" of central nervous system networks.

  14. Development of a frequency-separated knob with variable change rates by rotation speed.

    PubMed

    Kim, Huhn; Ham, Dong-Han

    2014-11-01

    The principle of frequency separation is a design method to display different information or feedback in accordance with the frequency of interaction between users and systems. This principle can be usefully applied to the design of knobs. Particularly, their rotation speed can be a meaningful criterion for applying the principle. Hence a knob can be developed, which shows change rates varying depending on its rotation speed. Such a knob would be more efficient than conventional knobs with constant change rate. We developed a prototype of frequency-separated knobs that has different combinations of the number of rotation speed steps and the size of the variation of change rate. With this prototype, we conducted an experiment to examine whether a speed frequency-separated knob enhances users' task performance. The results showed that the newly designed knob was effective in enhancing task performance, and that task efficiency was the best when its change rate increases exponentially and its rotation speed has three steps. We conducted another experiment to investigate how a more rapid exponential increase of change rate and a more number of steps of rotation speed influence users' task performance. The results showed that merely increasing both the size of the variation of change rates and the number of speed steps did not result in better task performance. Although two experimental results cannot easily be generalized to other contexts, they still offer practical information useful for designing a speed frequency-separated knob in various consumer electronics and control panels of industrial systems. Copyright © 2014 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  15. Investigations on Cu2+-substituted Ni-Zn ferrite nanoparticles

    NASA Astrophysics Data System (ADS)

    Amarjeet; Kumar, Vinod

    2016-11-01

    CuxNi(1-x)/2Zn(1-x)/2Fe2O4 (x = 0.1, 0.3 and 0.5) nanoparticles were prepared by chemical co-precipitation method. The developed nanoparticles were characterized for structural properties by powder X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FTIR) techniques. Peak position in the X-ray diffraction pattern confirmed the single spinel phase of the developed particles. Infrared (IR) spectroscopy in mid-IR range showed the presence of characteristic absorption bands corresponding to octahedral and tetrahedral bonds in the spinel structure of prepared samples. Thermo-gravimetric analysis (TGA) measurements showed a considerable weight loss in the developed samples above 700∘C. Frequency dependence of the electrical properties of the developed material pellets was studied in the frequency range of 1 kHz-5 MHz. Temperature dependence of the dielectric constant of Cu0.1Ni0.45Zn0.45Fe2O4 was studied at different temperatures, i.e. at 425, 450 and 475 K, in the frequency range of 1 kHz-5 MHz. It was found that the electrical conductivity decreases with increasing Cu2+ ion content while it increases with the increase in temperature.

  16. On the relation between pitch and level.

    PubMed

    Zheng, Yi; Brette, Romain

    2017-05-01

    Pitch is the perceptual dimension along which musical notes are ordered from low to high. It is often described as the perceptual correlate of the periodicity of the sound's waveform. Previous reports have shown that pitch can depend slightly on sound level. We wanted to verify that these observations reflect genuine changes in perceived pitch, and were not due to procedural factors or confusion between dimensions of pitch and level. We first conducted a systematic pitch matching task and confirmed that the pitch of low frequency pure tones, but not complex tones, decreases by an amount equivalent to a change in frequency of more than half a semitone when level increases. We then showed that the structure of pitch shifts is anti-symmetric and transitive, as expected for changes in pitch. We also observed shifts in the same direction (although smaller) in an interval matching task. Finally, we observed that musicians are more precise in pitch matching tasks than non-musicians but show the same average shifts with level. These combined experiments confirm that the pitch of low frequency pure tones depends weakly but systematically on level. These observations pose a challenge to current theories of pitch. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Optimal Damping Behavior of a Composite Sandwich Beam Reinforced with Coated Fibers

    NASA Astrophysics Data System (ADS)

    Lurie, S.; Solyaev, Y.; Ustenko, A.

    2018-04-01

    In the present paper, the effective damping properties of a symmetric foam-core sandwich beam with composite face plates reinforced with coated fibers is studied. A glass fiber-epoxy composite with additional rubber-toughened epoxy coatings on the fibers is considered as the material of the face plates. A micromechanical analysis of the effective properties of the unidirectional lamina is conducted based on the generalized self-consistent method and the viscoelastic correspondence principle. The effective complex moduli of composite face plates with a symmetric angle-ply structure are evaluated based on classical lamination theory. A modified Mead-Markus model is utilized to evaluate the fundamental modal loss factor of a simply supported sandwich beam with a polyurethane core. The viscoelastic frequency-dependent behaviors of the core and face plate materials are both considered. The properties of the face plates are evaluated based on a micromechanical analysis and found to implicitly depend on frequency; thus, an iterative procedure is applied to find the natural frequencies of the lateral vibrations of the beam. The optimal values of the coating thickness, lamination angle and core thickness for the best multi-scale damping behavior of the beam are found.

  18. Experimental Study of Electron and Phonon Dynamics in Nanoscale Materials by Ultrafast Laser Time-Domain Spectroscopy

    NASA Astrophysics Data System (ADS)

    Shen, Xiaohan

    With the rapid advances in the development of nanotechnology, nowadays, the sizes of elementary unit, i.e. transistor, of micro- and nanoelectronic devices are well deep into nanoscale. For the pursuit of cheaper and faster nanoscale electronic devices, the size of transistors keeps scaling down. As the miniaturization of the nanoelectronic devices, the electrical resistivity increases dramatically, resulting rapid growth in the heat generation. The heat generation and limited thermal dissipation in nanoscale materials have become a critical problem in the development of the next generation nanoelectronic devices. Copper (Cu) is widely used conducting material in nanoelectronic devices, and the electron-phonon scattering is the dominant contributor to the resistivity in Cu nanowires at room temperature. Meanwhile, phonons are the main carriers of heat in insulators, intrinsic and lightly doped semiconductors. The thermal transport is an ensemble of phonon transport, which strongly depends on the phonon frequency. In addition, the phonon transport in nanoscale materials can behave fundamentally different than in bulk materials, because of the spatial confinement. However, the size effect on electron-phonon scattering and frequency dependent phonon transport in nanoscale materials remain largely unexplored, due to the lack of suitable experimental techniques. This thesis is mainly focusing on the study of carrier dynamics and acoustic phonon transport in nanoscale materials. The weak photothermal interaction in Cu makes thermoreflectance measurement difficult, we rather measured the reflectivity change of Cu induced by absorption variation. We have developed a method to separately measure the processes of electron-electron scattering and electron-phonon scattering in epitaxial Cu films by monitoring the transient reflectivity signal using the resonant probe with particular wavelengths. The enhancement on electron-phonon scattering in epitaxial Cu films with thickness less than 100 nm was observed. The longitudinal acoustic phonon transport in silicon (Si) nanorod with confined diameter and length was investigated. The guided phonon modes in Si nanorod with different frequencies and wave vectors were observed. The mean-free-path of the guided phonons in Si nanorod was found to be larger than the effective phonon mean-free-path in Si film, because of the limited phonon scattering channels in Si nanorod. The phonon density of states and dispersion relation strongly depend on the size and boundary conditions of nanorod. Our work demonstrates the possibility of modifying the phonon transport properties in nanoscale materials by designing the size and boundary conditions, hence the control of thermal conductivity. In addition, the periodicity effect of nanostructures on acoustic phonon transport was investigated in silicon dioxide (SiO2) nanorod arrays. The lattice modes and mechanical eigenmodes were observed, and the pitch effect on lattice modes was discussed. A narrowband acoustic phonon spectroscopic technique with tunable frequency and spectral width throughout GHz frequency range has been developed to investigate the frequency-dependent acoustic phonon transport in nanoscale materials. The quadratic frequency dependence of acoustic attenuation of SiO2 and indium tin oxide (ITO) thin films was observed, and the acoustic attenuation of ITO was found to be larger than SiO2. Moreover, the acoustic control on mechanical resonance of nanoscale materials using the narrowband acoustic phonon source was demonstrated in tungsten thin film.

  19. Experimental evaluation of electrical conductivity imaging of anisotropic brain tissues using a combination of diffusion tensor imaging and magnetic resonance electrical impedance tomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sajib, Saurav Z. K.; Jeong, Woo Chul; Oh, Tong In

    Anisotropy of biological tissues is a low-frequency phenomenon that is associated with the function and structure of cell membranes. Imaging of anisotropic conductivity has potential for the analysis of interactions between electromagnetic fields and biological systems, such as the prediction of current pathways in electrical stimulation therapy. To improve application to the clinical environment, precise approaches are required to understand the exact responses inside the human body subjected to the stimulated currents. In this study, we experimentally evaluate the anisotropic conductivity tensor distribution of canine brain tissues, using a recently developed diffusion tensor-magnetic resonance electrical impedance tomography method. At lowmore » frequency, electrical conductivity of the biological tissues can be expressed as a product of the mobility and concentration of ions in the extracellular space. From diffusion tensor images of the brain, we can obtain directional information on diffusive movements of water molecules, which correspond to the mobility of ions. The position dependent scale factor, which provides information on ion concentration, was successfully calculated from the magnetic flux density, to obtain the equivalent conductivity tensor. By combining the information from both techniques, we can finally reconstruct the anisotropic conductivity tensor images of brain tissues. The reconstructed conductivity images better demonstrate the enhanced signal intensity in strongly anisotropic brain regions, compared with those resulting from previous methods using a global scale factor.« less

  20. Infrared reflectivity investigation of the phase transition sequence in Pr0.5Ca0.5MnO3

    NASA Astrophysics Data System (ADS)

    Ribeiro, J. L.; Vieira, L. G.; Gomes, I. T.; Araújo, J. P.; Tavares, P.; Almeida, B. G.

    2016-06-01

    This work reports an infrared reflectivity study of the phase transition sequence observed in Pr0.5Ca0.5MnO3. The need to measure over an extended spectral range in order to properly take into account the effects of the high frequency polaronic absorption is circumvented by adopting a simple approximate method, based on the asymmetry present in the Kramers Kronig inversion of the phonon spectrum. The temperature dependence of the phonon optical conductivity is then investigated by monitoring the behavior of three relevant spectral moments of the optical conductivity. This combined methodology allows us to disclose subtle effects of the orbital, charge and magnetic orders on the lattice dynamics of the compound. The characteristic transition temperatures inferred from the spectroscopic measurements are compared and correlated with those obtained from the temperature dependence of the induced magnetization and electrical resistivity.

  1. Polaron physics and crossover transition in magnetite probed by pressure-dependent infrared spectroscopy.

    PubMed

    Ebad-Allah, J; Baldassarre, L; Sing, M; Claessen, R; Brabers, V A M; Kuntscher, C A

    2013-01-23

    The optical properties of magnetite at room temperature were studied by infrared reflectivity measurements as a function of pressure up to 8 GPa. The optical conductivity spectrum consists of a Drude term, two sharp phonon modes, a far-infrared band at around 600 cm(-1) and a pronounced mid-infrared absorption band. With increasing pressure both absorption bands shift to lower frequencies and the phonon modes harden in a linear fashion. Based on the shape of the MIR band, the temperature dependence of the dc transport data, and the occurrence of the far-infrared band in the optical conductivity spectrum, the polaronic coupling strength in magnetite at room temperature should be classified as intermediate. For the lower energy phonon mode an abrupt increase of the linear pressure coefficient occurs at around 6 GPa, which could be attributed to minor alterations of the charge distribution among the different Fe sites.

  2. Bioelectrical Impedance Methods for Noninvasive Health Monitoring: A Review

    PubMed Central

    Bera, Tushar Kanti

    2014-01-01

    Under the alternating electrical excitation, biological tissues produce a complex electrical impedance which depends on tissue composition, structures, health status, and applied signal frequency, and hence the bioelectrical impedance methods can be utilized for noninvasive tissue characterization. As the impedance responses of these tissue parameters vary with frequencies of the applied signal, the impedance analysis conducted over a wide frequency band provides more information about the tissue interiors which help us to better understand the biological tissues anatomy, physiology, and pathology. Over past few decades, a number of impedance based noninvasive tissue characterization techniques such as bioelectrical impedance analysis (BIA), electrical impedance spectroscopy (EIS), electrical impedance plethysmography (IPG), impedance cardiography (ICG), and electrical impedance tomography (EIT) have been proposed and a lot of research works have been conducted on these methods for noninvasive tissue characterization and disease diagnosis. In this paper BIA, EIS, IPG, ICG, and EIT techniques and their applications in different fields have been reviewed and technical perspective of these impedance methods has been presented. The working principles, applications, merits, and demerits of these methods has been discussed in detail along with their other technical issues followed by present status and future trends. PMID:27006932

  3. Eddy current sensor concepts for the Bridgman growth of semiconductors

    NASA Astrophysics Data System (ADS)

    Dharmasena, Kumar P.; Wadley, Haydn N. G.

    1997-03-01

    Electromagnetic finite element methods have been used to identify eddy current sensor designs for monitoring CdTe vertical Bridgman crystal growth. A model system consisting of pairs of silicon cylinders with electrical conductivities similar to those of solid and liquid CdTe has been used to evaluate the multifrequency response of several sensors designed for locating and characterizing the curvature of liquid-solid interfaces during vertical Bridgman growth. At intermediate frequencies (100-800 kHz), the sensor's imaginary impedance monotonically increases as interfacial curvature changes from concave to convex or the interface location moves upwards through the sensor. The experimental data are in excellent agreement with theoretical predictions. At higher test frequencies (˜ 5 MHz), the test circuit's parasitics contribute to the sensor's response. Even so, the predicted trends with interface location/curvature were found to be still preserved, and the experiments confirm that the sensor's high frequency response depends more on interface location and has only a small sensitivity to curvature. Multifrequency data obtained from these types of sensors have the potential to separately discriminate the location and the shape of liquid-solid interfaces during the vertical Bridgman growth of CdTe and other semiconductor materials of higher electrical conductivity.

  4. Structural and impedance spectroscopy properties of La0.8Ba0.1Ca0.1Mn1-xRuxO3 perovskites

    NASA Astrophysics Data System (ADS)

    Chebaane, M.; Talbi, N.; Dhahri, A.; Oumezzine, M.; Khirouni, K.

    2017-03-01

    Polycrystalline samples La0.8Ba0.1Ca0.1Mn1-xRuxO3 (x=0 and 0.075) were prepared by sol-gel-based Pechini method. The X ray diffraction study has shown that all the samples exhibit a single phase with rhombohedral structure (space group R 3 ̅c, no. 167). The complex impedance has been investigated in the temperature range 160-320 K and in the frequency range 40 Hz-1 MHz. The imaginary part of the complex impedance (Z‧‧) frequency dependence revealed one relaxation peak. The Cole-Cole plots of the impedance values exhibited a semi -circular arc that can be described by an R1+(R2//ZCPE) electrical equivalent circuit. The conductance spectra have been investigated by the Jonscher universal power law: G(ω)=GDC+Aωn, where ω is the frequency of the ac field, and n is the exponent. The activation energy obtained both from the conductance and from time relaxation analyses are very similar, and hence the relaxation process may be attributed to the same type of charge carriers.

  5. Intermediate conductance calcium-activated potassium channels modulate summation of parallel fiber input in cerebellar Purkinje cells.

    PubMed

    Engbers, Jordan D T; Anderson, Dustin; Asmara, Hadhimulya; Rehak, Renata; Mehaffey, W Hamish; Hameed, Shahid; McKay, Bruce E; Kruskic, Mirna; Zamponi, Gerald W; Turner, Ray W

    2012-02-14

    Encoding sensory input requires the expression of postsynaptic ion channels to transform key features of afferent input to an appropriate pattern of spike output. Although Ca(2+)-activated K(+) channels are known to control spike frequency in central neurons, Ca(2+)-activated K(+) channels of intermediate conductance (KCa3.1) are believed to be restricted to peripheral neurons. We now report that cerebellar Purkinje cells express KCa3.1 channels, as evidenced through single-cell RT-PCR, immunocytochemistry, pharmacology, and single-channel recordings. Furthermore, KCa3.1 channels coimmunoprecipitate and interact with low voltage-activated Cav3.2 Ca(2+) channels at the nanodomain level to support a previously undescribed transient voltage- and Ca(2+)-dependent current. As a result, subthreshold parallel fiber excitatory postsynaptic potentials (EPSPs) activate Cav3 Ca(2+) influx to trigger a KCa3.1-mediated regulation of the EPSP and subsequent after-hyperpolarization. The Cav3-KCa3.1 complex provides powerful control over temporal summation of EPSPs, effectively suppressing low frequencies of parallel fiber input. KCa3.1 channels thus contribute to a high-pass filter that allows Purkinje cells to respond preferentially to high-frequency parallel fiber bursts characteristic of sensory input.

  6. Microwave dielectric properties of inorganic fullerene-like tungsten disulfide nanoparticles

    NASA Astrophysics Data System (ADS)

    Chang, Hong; Dimitrakis, Georgios; Xu, Fang; Yi, Chenbo; Kingman, Samuel; Zhu, Yanqiu

    2013-01-01

    The dielectric response of inorganic fullerene-like (IF) tungsten disulfide (WS2) nanoparticles prepared by a sulfidization reaction of WO3 nanoparticles has been investigated, against commercial platelet 2H-WS2 particles, using a cavity perturbation technique at microwave frequencies at temperatures ranging from 20 to 750 °C. The IF-WS2 nanoparticles showed both temperature and frequency dependent dielectric properties. The different dielectric behaviour between the IF-WS2 and 2H-WS2 can be attributed to the different conductivity and structure peculiar to the materials. The microstructure and thermal stability of the IF-WS2 and 2H-WS2 were thoroughly examined, to correlate with the resulting dielectric responses.

  7. Electrical properties of Ba(Dy{sub 1/2}Nb{sub 1/2})O{sub 3} ceramic

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nath, K. Amar, E-mail: karn190@gmail.com; Chandra, K. P., E-mail: kpchandra23@gmail.com; Dubey, K., E-mail: kirandubey45@yahoo.com

    2016-05-06

    Polycrystalline Ba(Dy{sub 1/2}Nb{sub 1/2})O{sub 3} was prepared using a high-temperature solid-state reaction method. X-ray diffraction analysis indicated the formation of a single-phase cubic structure having space group Pm3m. AC impedance plots as a function of frequency at different temperatures were used to analyse the electrical behaviour of the sample, which indicated the negative temperature coefficient of resistance character. Complex impedance analysis targeted non-Debye type dielectric relaxation. Frequency dependent ac conductivity data obeyed Jonscher’s power law. The apparent activation energy was estimated to be 0.97 eV at 1 kHz.

  8. Parameter dependence of high-frequency nonlinear oscillations and intrinsic chaos in short GaAs/(Al, Ga)As superlattices

    NASA Astrophysics Data System (ADS)

    Essen, Jonathan; Ruiz-Garcia, Miguel; Jenkins, Ian; Carretero, Manuel; Bonilla, Luis L.; Birnir, Björn

    2018-04-01

    We explore the design parameter space of short (5-25 period), n-doped, Ga/(Al,Ga)As semiconductor superlattices (SSLs) in the sequential resonant tunneling regime. We consider SSLs at cool (77 K) and warm (295 K) temperatures, simulating the electronic response to variations in (a) the number of SSL periods, (b) the contact conductivity, and (c) the strength of disorder (aperiodicities). Our analysis shows that the chaotic dynamical phases exist on a number of sub-manifolds of codimension zero within the design parameter space. This result provides an encouraging guide towards the experimental observation of high-frequency intrinsic dynamical chaos in shorter SSLs.

  9. Dielectric Measurements on Sol-Gel Derived Titania Films

    NASA Astrophysics Data System (ADS)

    Capan, Rifat; Ray, Asim K.

    2017-11-01

    Alternating current (AC) impedance measurements were performed on 37 nm thick nanostructured sol-gel derived anatase titania films on ultrasonically cleaned (100) p-silicon substrates at temperatures T ranging from 100 K to 300 K over a frequency range between 20 Hz and 1 MHz. The frequency-dependent behavior of the AC conductivity σ ac( f, T) obeys the universal power law, and the values of the effective hopping barrier and hopping distance were found to be 0.79 eV and 6.7 × 10-11 m from an analysis due to the correlated barrier-hopping model. The dielectric relaxation was identified as a thermally activated non-Debye process involving an activation energy of 41.5 meV.

  10. Dielectric spectroscopy of solutions of amino silicone emulsion in distilled water

    NASA Astrophysics Data System (ADS)

    Shah, K. N.; Rana, V. A.; Trivedi, C. M.; Vankar, H. P.

    2016-05-01

    Complex permittivity spectra ɛ*(ω) = ɛ' - jɛ″ of solutions of amino silicone emulsion in distilled water in the frequency range 100 Hz to 2 MHz were obtained using precision LCR meter. Complex permittivity data is used to find out complex impedance z*(ω) and complex electric conductivity σ*(ω). All these spectra are used to gain information about various polarization processes taking place in the solutions of amino silicone emulsion in distilled water under the effect of ac electric field. The frequency and concentration dependent behavior of the solutions of amino silicone emulsion in distilled waterhave beenalso investigated. Density and refractive index of the samples are also measured and are reported.

  11. Dielectric study of chalcogenide (Se80Te20)94Ge6 glass

    NASA Astrophysics Data System (ADS)

    Sharma, Neha; Patial, Balbir Singh; Thakur, Nagesh

    2018-04-01

    In the present study, dielectric characteristics specifically dielectric constant (ɛ'), dielectric loss (ɛ″) and AC conductivity (σAC) have been investigated for chalcogenide (Se80Te20)94Ge6 glass in the frequency range from 1Hz to 1MHz and within the temperature range from 300 K to 380 K. ɛ'(ω) and ɛ″(ω) are found to be frequency and temperature dependent. This behaviour is interpreted on the basis of Guintini's theory of dielectric dispersion. The investigated glass obeys the power law ωs (s<1) and decreases as temperature rises. The obtained results are discussed in terms of the correlation barrier hopping (CBH) model proposed by Elliot.

  12. Quasi-Static Alfv{é}n Dynamics and Scale-Dependent Energy Deposition in Magnetosphere-Ionosphere Coupling

    NASA Astrophysics Data System (ADS)

    Lotko, W.; Lysak, R. L.; Streltsov, A. V.

    2002-12-01

    Alfv{é}n wave dynamics become quasi-static in the ionosphere and low-altitude magnetosphere in the ULF regime below 10 mHz and at altitudes less than a few RE when the following two conditions are met: ω L RE << vA (l) and ω l << 1 / μ 0 Σ P. L is the dipole shell parameter, ω is the wave frequency in radians, l represents field-aligned distance above the ionosphere, vA (l) is the local Alfv{é}n speed, and Σ P is the ionospheric Pedersen conductance. In this limit, reactive power stored in Alfv{é}nic fluctuations at high altitude flows quasi-statically into ionospheric Joule heating and low-altitude collisionless dissipation. The combined dissipative effects are described by the electrostatic model of Chiu-Cornwall-Lyons [1980] which captures the transverse wavelength dependence of low-altitude Alfv{é}nic energy deposition. The analysis and results described here 1) correspond to the low-altitude, low-frequency limit of theories for the interaction of an Alfv{é}n wave with the ionosphere [Knudsen et al., 1992], including effects of a low-altitude collisionless dissipation layer [Vogt and Haerendel, 1998], and field line eigenmodes with allowance for finite ionospheric conductivity and realistic parallel inhomogeneity [Allan and Knox, 1979]; 2) reconcile the interpretation of inverted-V precipitation regions as electrostatic potential structures with electromagnetic energy deposition via Alfv{é}n waves at frequencies below 10 mHz; 3) provide criteria for the validity of the Knight current-voltage relation in the ULF regime and its use in global MHD simulations; 4) relate low-altitude satellite measurements of both ``static'' and ULF electric and magnetic fields directly to the ionospheric Pedersen conductivity; and 5) offer a resolution to debates about high-altitude closure of auroral potential structures as O-, U-, or S-potential forms.

  13. Role of geometric parameters in electrical measurements of insulating thin films deposited on a conductive substrate

    NASA Astrophysics Data System (ADS)

    Kumar, S.; Gerhardt, R. A.

    2012-03-01

    The effects of film thickness, electrode size and substrate thickness on the impedance parameters of alternating frequency dielectric measurements of insulating thin films deposited on conductive substrates were studied through parametric finite-element simulations. The quasi-static forms of Maxwell's electromagnetic equations in a time harmonic mode were solved using COMSOL Multiphysics® for several types of 2D models (linear and axisymmetric). The full 2D model deals with a configuration in which the impedance is measured between two surface electrodes on top of a film deposited on a conductive substrate. For the simplified 2D models, the conductive substrate is ignored and the two electrodes are placed on the top and bottom of the film. By comparing the full model and the simplified models, approximations and generalizations are deduced. For highly insulating films, such as the case of insulating SiO2 films on a conducting Si substrate, even the simplified models predict accurate capacitance values at all frequencies. However, the edge effects on the capacitance are found to be significant when the film thickness increases and/or the top electrode contact size decreases. The thickness of the substrate affects predominantly the resistive components of the dielectric response while having no significant effect on the capacitive components. Changing the electrode contact size or the film thickness determines the specific values of the measured resistance or capacitance while the material time constant remains the same, and thus this affects the frequency dependence that is able to be detected. This work highlights the importance of keeping in mind the film thickness and electrode contact size for the correct interpretation of the measured dielectric properties of micro/nanoscale structures that are often investigated using nanoscale capacitance measurements.

  14. Nonequilibrium Simulations of Ion Dynamics in Ionomer Melts

    NASA Astrophysics Data System (ADS)

    Frischknecht, Amalie

    Ionomers, polymers containing a small fraction of covalently bound ionic groups, are of interest as possible electrolytes in batteries. However, to date ionomers do not have sufficiently high conductivities for practical application, most likely because the ions tend to form aggregates, leading to slow ion transport. To build a better understanding of the relationships among ionomer chemistry, morphology, and ion transport, we have performed a series of molecular dynamics simulations and connected aspects of these simulations with experiment. In previous work using both atomistic and coarse-grained models, we showed that precise ionomers (with a fixed spacing between ionic groups along the polymer backbone) exhibit a range of ionic aggregate morphologies, from discrete clusters to percolated aggregates. In this talk I will describe recent simulations of our coarse-grained ionomer melts in an applied electric field. From a constant applied field, we are able to extract the ion mobilities and hence conductivities. We find that ionomers with percolated ionic aggregate morphologies have higher ion mobilities and hence higher conductivities. Application of an oscillating electric field enables us to calculate the frequency-dependent conductivity of the model ionomer melts. The real part of the conductivity has a high frequency peak associated with plasma oscillations, and a very broad low frequency peak associated with ion motions in ionic aggregates. I will end with comments on the connections to atomistic simulations and to experimental probes of ion dynamics. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  15. Estimation of dc transport dynamics in strongly correlated (La,Pr,Ca)MnO{sub 3} film using an insulator-metal composite model for terahertz conductivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, T. V. A.; Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531; Hattori, A. N.

    2014-07-14

    Temperature-dependent conductivities at dc and terahertz (THz) frequency region (σ{sub THz}(ω,T)) were obtained for a strongly correlated (La{sub 0.275}Pr{sub 0.35}Ca{sub 0.375})MnO{sub 3} (LPCMO) film using THz time domain spectroscopy. A composite model that describes σ{sub THz}(ω,T) for LPCMO through the insulator-metal transition (IMT) was established by incorporating Austin-Mott model characterizing the hopping of localized electrons and Drude model explaining the behavior of free electrons. This model enables us to reliably investigate the dc transport dynamics from THz conductivity measurement, i.e., simultaneously evaluate the dc conductivity and the competing composition of metal and insulator phases through the IMT, reflecting the changesmore » in microscopic conductivity of these phases.« less

  16. A model for studying the energetics of sustained high frequency firing

    PubMed Central

    Morris, Catherine E.

    2018-01-01

    Regulating membrane potential and synaptic function contributes significantly to the energetic costs of brain signaling, but the relative costs of action potentials (APs) and synaptic transmission during high-frequency firing are unknown. The continuous high-frequency (200-600Hz) electric organ discharge (EOD) of Eigenmannia, a weakly electric fish, underlies its electrosensing and communication. EODs reflect APs fired by the muscle-derived electrocytes of the electric organ (EO). Cholinergic synapses at the excitable posterior membranes of the elongated electrocytes control AP frequency. Based on whole-fish O2 consumption, ATP demand per EOD-linked AP increases exponentially with AP frequency. Continual EOD-AP generation implies first, that ion homeostatic processes reliably counteract any dissipation of posterior membrane ENa and EK and second that high frequency synaptic activation is reliably supported. Both of these processes require energy. To facilitate an exploration of the expected energy demands of each, we modify a previous excitability model and include synaptic currents able to drive APs at frequencies as high as 600 Hz. Synaptic stimuli are modeled as pulsatile cation conductance changes, with or without a small (sustained) background conductance. Over the full species range of EOD frequencies (200–600 Hz) we calculate frequency-dependent “Na+-entry budgets” for an electrocyte AP as a surrogate for required 3Na+/2K+-ATPase activity. We find that the cost per AP of maintaining constant-amplitude APs increases nonlinearly with frequency, whereas the cost per AP for synaptic input current is essentially constant. This predicts that Na+ channel density should correlate positively with EOD frequency, whereas AChR density should be the same across fish. Importantly, calculated costs (inferred from Na+-entry through Nav and ACh channels) for electrocyte APs as frequencies rise are much less than expected from published whole-fish EOD-linked O2 consumption. For APs at increasingly high frequencies, we suggest that EOD-related costs external to electrocytes (including packaging of synaptic transmitter) substantially exceed the direct cost of electrocyte ion homeostasis. PMID:29708986

  17. Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor.

    PubMed

    van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Noël, Timothy; Arends, Isabel W C E; Hollmann, Frank

    2018-01-01

    The biocatalytic preparation of trans -hex-2-enal from trans -hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii ( Pe AAOx) is reported. As O 2 -dependent enzyme Pe AAOx-dependent reactions are generally plagued by the poor solubility of O 2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s -1 ) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme.

  18. Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor

    PubMed Central

    van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Arends, Isabel W C E

    2018-01-01

    The biocatalytic preparation of trans-hex-2-enal from trans-hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii (PeAAOx) is reported. As O2-dependent enzyme PeAAOx-dependent reactions are generally plagued by the poor solubility of O2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s−1) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme. PMID:29719567

  19. Homogenized boundary conditions and resonance effects in Faraday cages

    PubMed Central

    Hewitt, I. J.

    2016-01-01

    We present a mathematical study of two-dimensional electrostatic and electromagnetic shielding by a cage of conducting wires (the so-called ‘Faraday cage effect’). Taking the limit as the number of wires in the cage tends to infinity, we use the asymptotic method of multiple scales to derive continuum models for the shielding, involving homogenized boundary conditions on an effective cage boundary. We show how the resulting models depend on key cage parameters such as the size and shape of the wires, and, in the electromagnetic case, on the frequency and polarization of the incident field. In the electromagnetic case, there are resonance effects, whereby at frequencies close to the natural frequencies of the equivalent solid shell, the presence of the cage actually amplifies the incident field, rather than shielding it. By appropriately modifying the continuum model, we calculate the modified resonant frequencies, and their associated peak amplitudes. We discuss applications to radiation containment in microwave ovens and acoustic scattering by perforated shells. PMID:27279775

  20. A multi-frequency radiometric measurement of soil moisture content over bare and vegetated fields

    NASA Technical Reports Server (NTRS)

    Wang, J. R.; Schmugge, T. J.; Mcmurtrey, J. E., III; Gould, W. I.; Glazar, W. S.; Fuchs, J. E. (Principal Investigator)

    1981-01-01

    A USDA Beltsville Agricultural Research Center site was used for an experiment in which soil moisture remote sensing over bare, grass, and alfalfa fields was conducted over a three-month period using 0.6 GHz, 1.4 GHz, and 10.6 GHz Dicke-type microwave radiometers mounted on mobile towers. Ground truth soil moisture content and ambient air and sil temperatures were obtained concurrently with the radiometric measurements. Biomass of the vegetation cover was sampled about once a week. Soil density for each of the three fields was measured several times during the course of the experiment. Results of the radiometric masurements confirm the frequency dependence of moisture sensing sensitivity reduction reported earlier. Observations over the bare, wet field show that the measured brightness temperature is lowest at 5.0 GHz and highest of 0.6 GHz frequency, a result contrary to expectation based on the estimated dielectric permittivity of soil water mixtures and current radiative transfer model in that frequency range.

  1. Contribution of crosstalk to the uncertainty of electrostatic actuator calibrations.

    PubMed

    Shams, Qamar A; Soto, Hector L; Zuckerwar, Allan J

    2009-09-01

    Crosstalk in electrostatic actuator calibrations is defined as the ratio of the microphone response to the actuator excitation voltage at a given frequency with the actuator polarization voltage turned off to the response, at the excitation frequency, with the polarization voltage turned on. It consequently contributes to the uncertainty of electrostatic actuator calibrations. Two sources of crosstalk are analyzed: the first attributed to the stray capacitance between the actuator electrode and the microphone backplate, and the second to the ground resistance appearing as a common element in the actuator excitation and microphone input loops. Measurements conducted on 1/4, 1/2, and 1 in. air condenser microphones reveal that the crosstalk has no frequency dependence up to the membrane resonance frequency and that the level of crosstalk lies at about -60 dB for all three microphones-conclusions that are consistent with theory. The measurements support the stray capacitance model. The contribution of crosstalk to the measurement standard uncertainty of an electrostatic actuator calibration is therewith 0.01 dB.

  2. Homogenized boundary conditions and resonance effects in Faraday cages

    NASA Astrophysics Data System (ADS)

    Hewett, D. P.; Hewitt, I. J.

    2016-05-01

    We present a mathematical study of two-dimensional electrostatic and electromagnetic shielding by a cage of conducting wires (the so-called `Faraday cage effect'). Taking the limit as the number of wires in the cage tends to infinity, we use the asymptotic method of multiple scales to derive continuum models for the shielding, involving homogenized boundary conditions on an effective cage boundary. We show how the resulting models depend on key cage parameters such as the size and shape of the wires, and, in the electromagnetic case, on the frequency and polarization of the incident field. In the electromagnetic case, there are resonance effects, whereby at frequencies close to the natural frequencies of the equivalent solid shell, the presence of the cage actually amplifies the incident field, rather than shielding it. By appropriately modifying the continuum model, we calculate the modified resonant frequencies, and their associated peak amplitudes. We discuss applications to radiation containment in microwave ovens and acoustic scattering by perforated shells.

  3. Homogenized boundary conditions and resonance effects in Faraday cages.

    PubMed

    Hewett, D P; Hewitt, I J

    2016-05-01

    We present a mathematical study of two-dimensional electrostatic and electromagnetic shielding by a cage of conducting wires (the so-called 'Faraday cage effect'). Taking the limit as the number of wires in the cage tends to infinity, we use the asymptotic method of multiple scales to derive continuum models for the shielding, involving homogenized boundary conditions on an effective cage boundary. We show how the resulting models depend on key cage parameters such as the size and shape of the wires, and, in the electromagnetic case, on the frequency and polarization of the incident field. In the electromagnetic case, there are resonance effects, whereby at frequencies close to the natural frequencies of the equivalent solid shell, the presence of the cage actually amplifies the incident field, rather than shielding it. By appropriately modifying the continuum model, we calculate the modified resonant frequencies, and their associated peak amplitudes. We discuss applications to radiation containment in microwave ovens and acoustic scattering by perforated shells.

  4. Dynamics of unforced and vertically forced rocking elliptical and semi-elliptical disks

    NASA Astrophysics Data System (ADS)

    Wang, Xue-She; Mazzoleni, Michael J.; Mann, Brian P.

    2018-03-01

    This paper presents the results of an investigation on the dynamics of unforced and vertically forced rocking elliptical and semi-elliptical disks. The full equation of motion for both rocking disks is derived from first principles. For unforced behavior, Lamb's method is used to derive the linear natural frequency of both disks, and harmonic balance is used to determine their amplitude-dependent rocking frequencies. A stability analysis then reveals that the equilibria and stability of the two disks are considerably different, as the semi-elliptical disk has a super-critical pitchfork bifurcation that enables it to exhibit bistable rocking behavior. Experimental studies were conducted to verify the trends. For vertically forced behavior, numerical investigations show the disk's responses to forward and reverse frequency sweeps. Three modes of periodicity were observed for the steady state behavior. Experiments were performed to verify the frequency responses and the presence of the three rocking modes. Comparisons between the experiments and numerical investigations show good agreement.

  5. Dynamical Properties of Disordered Systems.

    DTIC Science & Technology

    1984-05-21

    34Frequency dependence of the conductivity in presence of an electric field in one dimension: Weak disorder limit", by B. Derrida and R. Orbach, Phys...strips) of B. Derrida and J. Vannimenus (submitted for publication, 1982) finds t = 1.28, in close accord with the above consequence (t = 1.264) of...obtained ver’ glasses should exhibit such a length, roughly independent recently for percolating networks by B. Derrida . R. Or- of the character of their

  6. Linear Friction Welding Process Model for Carpenter Custom 465 Precipitation-Hardened Martensitic Stainless Steel

    DTIC Science & Technology

    2014-04-11

    Fig. 9(a) and (b). In addition, the temperature dependencies of the true and room-temperature-based mean values of the linear thermal expansion ...Variation of (a) thermal conductivity, (b) specific heat, (c) true linear thermal expansion coefficient, and (d) room-temperature-based mean thermal ...defined as follows: (a) alloy-grade and thermal -mechanical treatment of the workpiece materials to be joined, (b) frequency of reciprocating motion

  7. Radar attenuation tomography using the centroid frequency downshift method

    USGS Publications Warehouse

    Liu, L.; Lane, J.W.; Quan, Y.

    1998-01-01

    A method for tomographically estimating electromagnetic (EM) wave attenuation based on analysis of centroid frequency downshift (CFDS) of impulse radar signals is described and applied to cross-hole radar data. The method is based on a constant-Q model, which assumes a linear frequency dependence of attenuation for EM wave propagation above the transition frequency. The method uses the CFDS to construct the projection function. In comparison with other methods for estimating attenuation, the CFDS method is relatively insensitive to the effects of geometric spreading, instrument response, and antenna coupling and radiation pattern, but requires the data to be broadband so that the frequency shift and variance can be easily measured. The method is well-suited for difference tomography experiments using electrically conductive tracers. The CFDS method was tested using cross-hole radar data collected at the U.S. Geological Survey Fractured Rock Research Site at Mirror Lake, New Hampshire (NH) during a saline-tracer injection experiment. The attenuation-difference tomogram created with the CFDS method outlines the spatial distribution of saline tracer within the tomography plane. ?? 1998 Elsevier Science B.V. All rights reserved.

  8. Intra- and inter-brain synchronization during musical improvisation on the guitar.

    PubMed

    Müller, Viktor; Sänger, Johanna; Lindenberger, Ulman

    2013-01-01

    Humans interact with the environment through sensory and motor acts. Some of these interactions require synchronization among two or more individuals. Multiple-trial designs, which we have used in past work to study interbrain synchronization in the course of joint action, constrain the range of observable interactions. To overcome the limitations of multiple-trial designs, we conducted single-trial analyses of electroencephalography (EEG) signals recorded from eight pairs of guitarists engaged in musical improvisation. We identified hyper-brain networks based on a complex interplay of different frequencies. The intra-brain connections primarily involved higher frequencies (e.g., beta), whereas inter-brain connections primarily operated at lower frequencies (e.g., delta and theta). The topology of hyper-brain networks was frequency-dependent, with a tendency to become more regular at higher frequencies. We also found hyper-brain modules that included nodes (i.e., EEG electrodes) from both brains. Some of the observed network properties were related to musical roles during improvisation. Our findings replicate and extend earlier work and point to mechanisms that enable individuals to engage in temporally coordinated joint action.

  9. Intra- and Inter-Brain Synchronization during Musical Improvisation on the Guitar

    PubMed Central

    Müller, Viktor; Sänger, Johanna; Lindenberger, Ulman

    2013-01-01

    Humans interact with the environment through sensory and motor acts. Some of these interactions require synchronization among two or more individuals. Multiple-trial designs, which we have used in past work to study interbrain synchronization in the course of joint action, constrain the range of observable interactions. To overcome the limitations of multiple-trial designs, we conducted single-trial analyses of electroencephalography (EEG) signals recorded from eight pairs of guitarists engaged in musical improvisation. We identified hyper-brain networks based on a complex interplay of different frequencies. The intra-brain connections primarily involved higher frequencies (e.g., beta), whereas inter-brain connections primarily operated at lower frequencies (e.g., delta and theta). The topology of hyper-brain networks was frequency-dependent, with a tendency to become more regular at higher frequencies. We also found hyper-brain modules that included nodes (i.e., EEG electrodes) from both brains. Some of the observed network properties were related to musical roles during improvisation. Our findings replicate and extend earlier work and point to mechanisms that enable individuals to engage in temporally coordinated joint action. PMID:24040094

  10. High Frequency Resolution TOA Analysis for ELF/VLFWave Generation Experiments at HAARP

    NASA Astrophysics Data System (ADS)

    Ruddle, J. D.; Moore, R. C.

    2014-12-01

    Modulated HF heating of the ionosphere in the presence of natural ionospheric current sources has been used as a method to generate electromagnetic ELF/VLF waves since the 1970's. In the ~1-5 kHz band, the amplitude and phase of the received ELF/VLF signal depends on the amplitude and phase of the conductivity modulation generated throughout the HF-heated ionospheric body, as well as on the signal propagation parameters (i.e., the attenuation and phase constants) between each of the current sources and the receiver. Recent signal processing advances have produced an accurate ELF/VLF time-of-arrival (TOA) analysis technique that differentiates line-of-sight and ionospherically-reflected signal components, determining the amplitude and phase of each component observed at the receiver. This TOA method requires a wide bandwidth (> 2.5 kHz) and therefore is relatively insensitive to the frequency-dependent nature of ELF/VLF wave propagation. In this paper, we present an improved ELF/VLF TOA method that is capable of providing high frequency resolution. The new analysis technique is applied to experimental observations of ELF/VLF signals generated by modulated heating at HAARP. We present measurements of the amplitude and phase of the received ELF/VLF signal as a function of frequency and compare the results with the predictions of an HF heating model.

  11. Quasiparticle properties at microwave frequencies in the underdoped YBa2Cu3O7-δ thin films

    NASA Astrophysics Data System (ADS)

    Hsing, Lai

    2004-03-01

    Microstrip ring resonators with quality factor (Q) over 10^4 at temperature 5 K were fabricated using the double-side YBa_2Cu_3O_7-δ (YBCO) films deposited on LaAlO3 (LAO) substrates. By placing a narrow gap in the ring resonator, the original fundamental resonating mode (3.61 GHz) splits into two modes (1.80 GHz and 5.33 GHz) with distinct resonating frequencies. The samples allow us to determine the temperature and the frequency dependences of penetration depth and microwave conductivity for various underdoped-cuprates by using Drude formula and the modified two-fluid model. The natures of the order parameter of high-Tc superconductivity in the underdoped cases are shown to be of d-wave type in an exact manner. In particular, the Fermi-liquid correction factor α ^2 and the vertex correction factor β from the model, proposed by Wen and Lee, can be estimated that α ^2 is doping independent in the underdoped regime and β decreases as oxygen content is decreasing in our experiment data. All these results are independent of frequencies as well. The results reveal that the interaction between quasiparticles is insensitive dependence of the impurity concentrations due to oxygen deficiency on the CuO chain and the impurity potential for forward scattering approaches the same as back scattering with more oxygen deficiency.

  12. Dependence of cavitation, chemical effect, and mechanical effect thresholds on ultrasonic frequency.

    PubMed

    Thanh Nguyen, Tam; Asakura, Yoshiyuki; Koda, Shinobu; Yasuda, Keiji

    2017-11-01

    Cavitation, chemical effect, and mechanical effect thresholds were investigated in wide frequency ranges from 22 to 4880kHz. Each threshold was measured in terms of sound pressure at fundamental frequency. Broadband noise emitted from acoustic cavitation bubbles was detected by a hydrophone to determine the cavitation threshold. Potassium iodide oxidation caused by acoustic cavitation was used to quantify the chemical effect threshold. The ultrasonic erosion of aluminum foil was conducted to estimate the mechanical effect threshold. The cavitation, chemical effect, and mechanical effect thresholds increased with increasing frequency. The chemical effect threshold was close to the cavitation threshold for all frequencies. At low frequency below 98kHz, the mechanical effect threshold was nearly equal to the cavitation threshold. However, the mechanical effect threshold was greatly higher than the cavitation threshold at high frequency. In addition, the thresholds of the second harmonic and the first ultraharmonic signals were measured to detect bubble occurrence. The threshold of the second harmonic approximated to the cavitation threshold below 1000kHz. On the other hand, the threshold of the first ultraharmonic was higher than the cavitation threshold below 98kHz and near to the cavitation threshold at high frequency. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Sputtered deposited nanocrystalline ZnO films: A correlation between electrical, optical and microstructural properties

    NASA Astrophysics Data System (ADS)

    Lee, J.; Gao, W.; Li, Z.; Hodgson, M.; Metson, J.; Gong, H.; Pal, U.

    2005-05-01

    Zinc oxide thin films were prepared by dc (direct current) and rf (radio frequency) magnetron sputtering on glass substrates. ZnO films produced by dc sputtering have a high resistance, while the films produced using rf sputtering are significantly more conductive. While the conductive films have a compact nodular surface morphology, the resistive films have a relatively porous surface with columnar structures in cross section. Compared to the dc sputtered films, rf sputtered films have a microstructure with smaller d spacing, lower internal stress, higher band gap energy and higher density. Dependence of conductivity on the deposition technique and the resulting d spacing , stress, density, band gap, film thickness and Al doping are discussed. Correlations between the electrical conductivity, microstructural parameters and optical properties of the films have been made.

  14. Equilibrium electrodeformation of a spheroidal vesicle in an ac electric field

    NASA Astrophysics Data System (ADS)

    Nganguia, H.; Young, Y.-N.

    2013-11-01

    In this work, we develop a theoretical model to explain the equilibrium spheroidal deformation of a giant unilamellar vesicle (GUV) under an alternating (ac) electric field. Suspended in a leaky dielectric fluid, the vesicle membrane is modeled as a thin capacitive spheroidal shell. The equilibrium vesicle shape results from the balance between mechanical forces from the viscous fluid, the restoring elastic membrane forces, and the externally imposed electric forces. Our spheroidal model predicts a deformation-dependent transmembrane potential, and is able to capture large deformation of a vesicle under an electric field. A detailed comparison against both experiments and small-deformation (quasispherical) theory showed that the spheroidal model gives better agreement with experiments in terms of the dependence on fluid conductivity ratio, permittivity ratio, vesicle size, electric field strength, and frequency. The spheroidal model also allows for an asymptotic analysis on the crossover frequency where the equilibrium vesicle shape crosses over between prolate and oblate shapes. Comparisons show that the spheroidal model gives better agreement with experimental observations.

  15. 12-crown-4 ether-assisted enhancement of ionic conductivity and interfacial kinetics in polyethylene oxide electrolytes

    NASA Technical Reports Server (NTRS)

    Nagasubramanian, G.; Di Stefano, S.

    1990-01-01

    The electrical and electrochemical properties of thin films of polyethylene oxide electrolytes with and without 12-crown-4 ether (12Cr4) are studied as a function of temperature and in the frequency regime from 100 kHz to 0.1 Hz. These measurements were made on electrolytes containing LiCF3SO3, LiBF4, or LiClO4 salts. At a given temperature, the bulk conductivity for a particular salt depends on the 12Cr4 concentration, reaching a maximum for a ratio of 12Cr4 to Li of 0.003.

  16. Large reflector antenna study

    NASA Technical Reports Server (NTRS)

    Christodoulou, C. G.

    1986-01-01

    In some applications, the wires used to construct the grids are plated over with highly conducting materials such as gold or silver. In those cases, depending on the frequency of operation, the coating may not be thick enough to prevent currents from flowing in the substrate. The conjugate gradient method, in conjunction with the fast Fourier transform is employed to solve the problem of scattering from such rectangular grids. An internal impedance is utilized to account for the effects of the substrate conductivity on the induced current densities. Calculated values of the reflection coefficient and induced currents from different coating thicknesses, angles of incidence and polarizations are presented and discussed.

  17. Fiber-coupled thermal microscope for solid materials based on thermoreflectance method

    NASA Astrophysics Data System (ADS)

    Miyake, Shugo; Hatori, Kimihito; Ohtsuki, Tetsuya; Awano, Takaaki; Sekine, Makoto

    2018-06-01

    Measurement of the thermal properties of solid-state materials, including high- and low-thermal-conductivity materials in electronic devices, is very important to improve thermal design. The thermoreflectance method is well known as a powerful technique for measuring a wide range of thermal conductivity. However, in order to precisely determine the thermoreflectance signal, the alignment between two laser beams should be perfectly coaxial, similar to that in the numerical calculation model. In this paper, a developed fiber-coupled thermal microscope based on the thermoreflectance method is demonstrated, which we use to determine the frequency dependence of the temperature responses of silicon, sapphire, zirconium, and Pyrex glass samples.

  18. Characterization of HIRF Susceptibility Threshold for a Prototype Implementation of an Onboard Data Network

    NASA Technical Reports Server (NTRS)

    Torres-Pomales, Wilfredo

    2012-01-01

    An experiment was conducted to characterize the effects of HIRF-induced upsets on a prototype onboard data network. The experiment was conducted at the NASA Langley Research Center s High Intensity Radiation Field Laboratory and used a generic distributed system prototyping platform to realize the data network. This report presents the results of the hardware susceptibility threshold characterization which examined the dependence of measured susceptibility on factors like the frequency and modulation of the radiation, layout of the physical nodes and position of the nodes in the test chamber. The report also includes lessons learned during the development and execution of the experiment.

  19. Influence of small DC bias field on the electrical behaviour of Sr- and Mg-doped lanthanum gallate

    NASA Astrophysics Data System (ADS)

    Raghvendra; Singh, Rajesh Kumar; Singh, Prabhakar

    2014-09-01

    One of the promising electrolyte materials for solid oxide fuel cells application, Sr- and Mg-doped lanthanum gallate La0.9Sr0.1Ga0.8Mg0.2O3-δ (LSGM), is synthesized by conventional solid state ceramic route. X-ray Rietveld analysis confirms the formation of main orthorhombic phase at room temperature along with a few minor secondary phases. SEM micrograph reveals the grain and grainboundary morphology of the system. Electrical conductivity of the LSGM sample is measured in the temperature range 573-873 K and in the frequency range 20 Hz-1 MHz at a few small DC bias fields (at 0.0, 0.5, 1.0, 1.5 and 2.0 V). The conductivity spectra show power-law behaviour. Electrical conductivity of the sample is found to be weakly dependent on DC bias field. This is attributed to field-dependent bulk and grainboundary conduction processes. In the present system, under investigated bias field range, the possibility of formation of Schottky barrier is ruled out. The concept of grainboundary channel (pathway) modulation on the application of bias field is proposed.

  20. Drude-type conductivity of charged sphere colloidal crystals: Density and temperature dependence

    NASA Astrophysics Data System (ADS)

    Medebach, Martin; Jordán, Raquel Chuliá; Reiber, Holger; Schöpe, Hans-Joachim; Biehl, Ralf; Evers, Martin; Hessinger, Dirk; Olah, Julianna; Palberg, Thomas; Schönberger, Ernest; Wette, Patrick

    2005-09-01

    We report on extensive measurements in the low-frequency limit of the ac conductivity of colloidal fluids and crystals formed from charged colloidal spheres suspended in de-ionized water. Temperature was varied in a range of 5°C<Θ<35°C and the particle number density n between 0.2 and 25μm-3 for the larger, respectively, 2.75 and 210μm-3 for the smaller of two investigated species. At fixed Θ the conductivity increased linearly with increasing n without any significant change at the fluid-solid phase boundary. At fixed n it increased with increasing Θ and the increase was more pronounced for larger n. Lacking a rigorous electrohydrodynamic treatment for counterion-dominated systems we describe our data with a simple model relating to Drude's theory of metal conductivity. The key parameter is an effectively transported particle charge or valence Z*. All temperature dependencies other than that of Z* were taken from literature. Within experimental resolution Z* was found to be independent of n irrespective of the suspension structure. Interestingly, Z* decreases with temperature in near quantitative agreement with numerical calculations.

Top