Sample records for frequency dependent transfer

  1. Voltage and frequency dependence of prestin-associated charge transfer

    PubMed Central

    Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.

    2009-01-01

    Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917

  2. A multislice gradient echo pulse sequence for CEST imaging.

    PubMed

    Dixon, W Thomas; Hancu, Ileana; Ratnakar, S James; Sherry, A Dean; Lenkinski, Robert E; Alsop, David C

    2010-01-01

    Chemical exchange-dependent saturation transfer and paramagnetic chemical exchange-dependent saturation transfer are agent-mediated contrast mechanisms that depend on saturating spins at the resonant frequency of the exchangeable protons on the agent, thereby indirectly saturating the bulk water. In general, longer saturating pulses produce stronger chemical and paramagnetic exchange-dependent saturation transfer effects, with returns diminishing for pulses longer than T1. This could make imaging slow, so one approach to chemical exchange-dependent saturation transfer imaging has been to follow a long, frequency-selective saturation period by a fast imaging method. A new approach is to insert a short frequency-selective saturation pulse before each spatially selective observation pulse in a standard, two-dimensional, gradient-echo pulse sequence. Being much less than T1 apart, the saturation pulses have a cumulative effect. Interleaved, multislice imaging is straightforward. Observation pulses directed at one slice did not produce observable, unintended chemical exchange-dependent saturation transfer effects in another slice. Pulse repetition time and signal-to noise ratio increase in the normal way as more slices are imaged simultaneously. Copyright (c) 2009 Wiley-Liss, Inc.

  3. An asymptotic preserving unified gas kinetic scheme for frequency-dependent radiative transfer equations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Wenjun, E-mail: sun_wenjun@iapcm.ac.cn; Jiang, Song, E-mail: jiang@iapcm.ac.cn; Xu, Kun, E-mail: makxu@ust.hk

    This paper presents an extension of previous work (Sun et al., 2015 [22]) of the unified gas kinetic scheme (UGKS) for the gray radiative transfer equations to the frequency-dependent (multi-group) radiative transfer system. Different from the gray radiative transfer equations, where the optical opacity is only a function of local material temperature, the simulation of frequency-dependent radiative transfer is associated with additional difficulties from the frequency-dependent opacity. For the multiple frequency radiation, the opacity depends on both the spatial location and the frequency. For example, the opacity is typically a decreasing function of frequency. At the same spatial region themore » transport physics can be optically thick for the low frequency photons, and optically thin for high frequency ones. Therefore, the optical thickness is not a simple function of space location. In this paper, the UGKS for frequency-dependent radiative system is developed. The UGKS is a finite volume method and the transport physics is modeled according to the ratio of the cell size to the photon's frequency-dependent mean free path. When the cell size is much larger than the photon's mean free path, a diffusion solution for such a frequency radiation will be obtained. On the other hand, when the cell size is much smaller than the photon's mean free path, a free transport mechanism will be recovered. In the regime between the above two limits, with the variation of the ratio between the local cell size and photon's mean free path, the UGKS provides a smooth transition in the physical and frequency space to capture the corresponding transport physics accurately. The seemingly straightforward extension of the UGKS from the gray to multiple frequency radiation system is due to its intrinsic consistent multiple scale transport modeling, but it still involves lots of work to properly discretize the multiple groups in order to design an asymptotic preserving (AP) scheme in all regimes. The current scheme is tested in a few frequency-dependent radiation problems, and the results are compared with the solutions from the well-defined implicit Monte Carlo (IMC) method. The UGKS is much more efficient than IMC, and the computational times of both schemes for all test cases are listed. The UGKS seems to be the first discrete ordinate method (DOM) for the accurate capturing of multiple frequency radiative transport physics from ballistic particle motion to the diffusive wave propagation.« less

  4. Dynamic blocked transfer stiffness method of characterizing the magnetic field and frequency dependent dynamic viscoelastic properties of MRE

    NASA Astrophysics Data System (ADS)

    Poojary, Umanath R.; Hegde, Sriharsha; Gangadharan, K. V.

    2016-11-01

    Magneto rheological elastomer (MRE) is a potential resilient element for the semi active vibration isolator. MRE based isolators adapt to different frequency of vibrations arising from the source to isolate the structure over wider frequency range. The performance of MRE isolator depends on the magnetic field and frequency dependent characteristics of MRE. Present study is focused on experimentally evaluating the dynamic stiffness and loss factor of MRE through dynamic blocked transfer stiffness method. The dynamic stiffness variations of MRE exhibit strong magnetic field and mild frequency dependency. Enhancements in dynamic stiffness saturate with the increase in magnetic field and the frequency. The inconsistent variations of loss factor with the magnetic field substantiate the inability of MRE to have independent control over its damping characteristics.

  5. Adaptive Same Frequency Repeater (SFR) Study

    DTIC Science & Technology

    1976-03-01

    Formulation 13 (2) Evaluation of the Steady State Weights!.’.’.’!.*!!."!! 21 (3) Evaluation of the Composite Transfer Function.... 2^ (4) Simplified...well as possible the amplitude and phase of the composite coupling path. Because the coupling paths have frequency-dependent transfer functions...34), (35) and the notch filter and channel transfer .’unctions (3fi) and (39). The composite transfer function Hc(f ’ ^’.f) is then found and

  6. Off-resonance frequency operation for power transfer in a loosely coupled air core transformer

    DOEpatents

    Scudiere, Matthew B

    2012-11-13

    A power transmission system includes a loosely coupled air core transformer having a resonance frequency determined by a product of inductance and capacitance of a primary circuit including a primary coil. A secondary circuit is configured to have a substantially same product of inductance and capacitance. A back EMF generating device (e.g., a battery), which generates a back EMF with power transfer, is attached to the secondary circuit. Once the load power of the back EMF generating device exceeds a certain threshold level, which depends on the system parameters, the power transfer can be achieved at higher transfer efficiency if performed at an operating frequency less than the resonance frequency, which can be from 50% to 95% of the resonance frequency.

  7. Impaired pulsation absorber mechanism in idiopathic normal pressure hydrocephalus: laboratory investigation.

    PubMed

    Park, Eun-Hyoung; Eide, Per Kristian; Zurakowski, David; Madsen, Joseph R

    2012-12-01

    The pathophysiology of normal pressure hydrocephalus (NPH), and the related problem of patient selection for treatment of this condition, have been of great interest since the description of this seemingly paradoxical condition nearly 50 years ago. Recently, Eide has reported that measurements of the amplitude of the intracranial pressure (ICP) can both positively and negatively predict response to CSF shunting. Specifically, the fraction of time spent in a "high amplitude" (> 4 mm Hg) state predicted response to shunting, which may represent a marker for hydrocephalic pathophysiology. Increased ICP amplitude might suggest decreased brain compliance, meaning a static measure of a pressure-volume ratio. Recent studies of canine data have shown that the brain compliance can be described as a frequency-dependent function. The normal canine brain seems to show enhanced ability to absorb the pulsations around the heart rate, quantified as a cardiac pulsation absorbance (CPA), with properties like a notch filter in engineering. This frequency dependence of the function is diminished with development of hydrocephalus in dogs. In this pilot study, the authors sought to determine whether frequency dependence could be observed in humans, and whether the frequency dependence would be any different in epochs with high ICP amplitude compared with epochs of low ICP amplitude. Systems analysis was applied to arterial blood pressure (ABP) and ICP waveforms recorded from 10 patients undergoing evaluations of idiopathic NPH to calculate a time-varying transfer function that reveals frequency dependence and CPA, the measure of frequency-dependent compliance previously used in animal experiments. The ICP amplitude was also calculated in the same samples, so that epochs with high (> 4 mm Hg) versus low (≤ 4 mm Hg) amplitude could be compared in CPA and transfer functions. Transfer function analysis for the more "normal" epochs with low amplitude exhibits a dip or notch in the physiological frequency range of the heart rate, confirming in humans the pulsation absorber phenomenon previously observed in canine studies. Under high amplitude, however, the dip in the transfer function is absent. An inverse relationship between CPA index and ICP amplitude is evident and statistically significant. Thus, elevated ICP amplitude indicates decreased performance of the human pulsation absorber. The results suggest that the human intracranial system shows frequency dependence as seen in animal experiments. There is an inverse relationship between CPA index and ICP amplitude, indicating that higher amplitudes may occur with a reduced performance of the pulsation absorber. Our findings show that frequency dependence can be observed in humans and imply that reduced frequency-dependent compliance may be responsible for elevated ICP amplitude observed in patients who respond to CSF shunting.

  8. Temperature and frequency dependence of anelasticity in a nickel oscillator

    NASA Astrophysics Data System (ADS)

    Berg, Robert F.

    1995-09-01

    The frequency dependence of the real and imaginary parts of a nickel oscillator's transfer function is described over 3 decades in frequency by the use of simple expressions. These expressions incorporate only the resonance frequency ω0, the quality factor Q, and a characteristic exponent β determined by a single measurement of creep. They are based on the ansatz φ(ω)=Q-1(ω/ω0)-β, where φ is the imaginary part of the spring constant. Over a 100 K range of temperature T, the exponent β≂0.18 was constant even though Q(T) changed by a factor of 8. These expressions are potentially useful for accurately describing a mechanical oscillator whose transfer function must be modeled at frequencies far below ω0. Examples include accelerometers based on a flexure element and suspensions for interferometric gravitational wave detectors.

  9. Image transfer by cascaded stack of photonic crystal and air layers.

    PubMed

    Shen, C; Michielsen, K; De Raedt, H

    2006-01-23

    We demonstrate image transfer by a cascaded stack consisting of two and three triangular-lattice photonic crystal slabs separated by air. The quality of the image transfered by the stack is sensitive to the air/photonic crystal interface termination and the frequency. Depending on the frequency and the surface termination, the image can be transfered by the stack with very little deterioration of the resolution, that is the resolution of the final image is approximately the same as the resolution of the image formed behind one single photonic crystal slab.

  10. Transfer function concept for ultrasonic characterization of material microstructures

    NASA Technical Reports Server (NTRS)

    Vary, A.; Kautz, H. E.

    1986-01-01

    The approach given depends on treating material microstructures as elastomechanical filters that have analytically definable transfer functions. These transfer functions can be defined in terms of the frequency dependence of the ultrasonic attenuation coefficient. The transfer function concept provides a basis for synthesizing expressions that characterize polycrystalline materials relative to microstructural factors such as mean grain size, grain-size distribution functions, and grain boundary energy transmission. Although the approach is nonrigorous, it leads to a rational basis for combining the previously mentioned diverse and fragmented equations for ultrasonic attenuation coefficients.

  11. Ionospheric limitations to time transfer by satellite

    NASA Technical Reports Server (NTRS)

    Knowles, S. H.

    1983-01-01

    The ionosphere can contribute appreciable group delay and phase change to radio signals traversing it; this can constitute a fundamental limitation to the accuracy of time and frequency measurements using satellites. Because of the dispersive nature of the ionosphere, the amount of delay is strongly frequency-dependent. Ionospheric compensation is necessary for the most precise time transfer and frequency measurements, with a group delay accuracy better than 10 nanoseconds. A priori modeling is not accurate to better than 25%. The dual-frequency compensation method holds promise, but has not been rigorously experimentally tested. Irregularities in the ionosphere must be included in the compensation process.

  12. Practice and transfer of the frequency structures of continuous isometric force.

    PubMed

    King, Adam C; Newell, Karl M

    2014-04-01

    The present study examined the learning, retention and transfer of task outcome and the frequency-dependent properties of isometric force output dynamics. During practice participants produced isometric force to a moderately irregular target pattern either under a constant or variable presentation. Immediate and delayed retention tests examined the persistence of practice-induced changes of force output dynamics and transfer tests investigated performance to novel (low and high) irregular target patterns. The results showed that both constant and variable practice conditions exhibited similar reductions in task error but that the frequency-dependent properties were differentially modified across the entire bandwidth (0-12Hz) of force output dynamics as a function of practice. Task outcome exhibited persistent properties on the delayed retention test whereas the retention of faster time scales processes (i.e., 4-12Hz) of force output was mediated as a function of frequency structure. The structure of the force frequency components during early practice and following a rest interval was characterized by an enhanced emphasis on the slow time scales related to perceptual-motor feedback. The findings support the proposition that there are different time scales of learning at the levels of task outcome and the adaptive frequency bandwidths of force output dynamics. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Frequency-response identification of XV-15 tilt-rotor aircraft dynamics

    NASA Technical Reports Server (NTRS)

    Tischler, Mark B.

    1987-01-01

    The timely design and development of the next generation of tilt-rotor aircraft (JVX) depend heavily on the in-depth understanding of existing XV-15 dynamics and the availability of fully validated simulation models. Previous studies have considered aircraft and simulation trim characteristics, but analyses of basic flight vehicle dynamics were limited to qualitative pilot evaluation. The present study has the following objectives: documentation and evaluation of XV-15 bare-airframe dynamics; comparison of aircraft and simulation responses; and development of a validated transfer-function description of the XV-15 needed for future studies. A nonparametric frequency-response approach is used which does not depend on assumed model order or structure. Transfer-function representations are subsequently derived which fit the frequency responses in the bandwidth of greatest concern for piloted handling-qualities and control-system applications.

  14. Acoustic radiation from weakly wrinkled premixed flames

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lieuwen, Tim; Mohan, Sripathi; Rajaram, Rajesh

    2006-01-01

    This paper describes a theoretical analysis of acoustic radiation from weakly wrinkled (i.e., u'/S{sub L}<1) premixed flames. Specifically, it determines the transfer function relating the spectrum of the acoustic pressure oscillations, P'({omega}), to that of the turbulent velocity fluctuations in the approach flow, U'({omega}). In the weakly wrinkled limit, this transfer function is local in frequency space; i.e., velocity fluctuations at a frequency {omega} distort the flame and generate sound at the same frequency. This transfer function primarily depends upon the flame Strouhal number St (based on mean flow velocity and flame length) and the correlation length, {lambda}, of themore » flow fluctuations. For cases where the ratio of the correlation length and duct radius {lambda}/a>>1, the acoustic pressure and turbulent velocity power spectra are related by P'({omega})-{omega}{sup 2}U'({omega}) and P'({omega})-U'({omega}) for St<<1 and St>>1, respectively. For cases where {lambda}/a<<1, the transfer functions take the form P'({omega})-{omega}{sup 2}({lambda}/a){sup 2}U'({omega}) and P'({omega})-{omega}{sup 2}({lambda}/a){sup 2}({psi}-{delta}ln({lambda}/a))U'({omega}) for St<<1 and St>>1, respectively, where (PS) and {delta} are constants. The latter result demonstrates that this transfer function does not exhibit a simple power law relationship in the high frequency region of the spectra. The simultaneous dependence of this pressure-velocity transfer function upon the Strouhal number and correlation length suggests a mechanism for the experimentally observed maximum in acoustic spectra and provides some insight into the controversy in the literature over how this peak should scale with the flame Strouhal number.« less

  15. Frequency Response of Graphene Electrolyte-Gated Field-Effect Transistors

    PubMed Central

    McVay, Elaine; Palacios, Tomás

    2018-01-01

    This work develops the first frequency-dependent small-signal model for graphene electrolyte-gated field-effect transistors (EGFETs). Graphene EGFETs are microfabricated to measure intrinsic voltage gain, frequency response, and to develop a frequency-dependent small-signal model. The transfer function of the graphene EGFET small-signal model is found to contain a unique pole due to a resistive element, which stems from electrolyte gating. Intrinsic voltage gain, cutoff frequency, and transition frequency for the microfabricated graphene EGFETs are approximately 3.1 V/V, 1.9 kHz, and 6.9 kHz, respectively. This work marks a critical step in the development of high-speed chemical and biological sensors using graphene EGFETs. PMID:29414868

  16. Spin polarization transfer by the radical pair mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zarea, Mehdi, E-mail: m-zarea@northwestern.edu; Ratner, Mark A.; Wasielewski, Michael R.

    2015-08-07

    In a three-site representation, we study a spin polarization transfer from radical pair spins to a nearby electron or nuclear spin. The quantum dynamics of the radical pair spins is governed by a constant exchange interaction between the radical pair spins which have different Zeeman frequencies. Radical pair spins can recombine to the singlet ground state or to lower energy triplet states. It is then shown that the coherent dynamics of the radical pair induces spin polarization on the nearby third spin in the presence of a magnetic field. The spin polarization transfer depends on the difference between Zeeman frequencies,more » the singlet and triplet recombination rates, and on the exchange and dipole-dipole interactions between the different spins. In particular, the sign of the polarization depends on the exchange coupling between radical pair spins and also on the difference between singlet and triplet recombination rate constants.« less

  17. Results of the Calibration of the Delays of Earth Stations for TWSTFT Using the VSL Satellite Simulator Method

    NASA Technical Reports Server (NTRS)

    deJong, Gerrit; Kirchner, Dieter; Ressler, Hubert; Hetzel, Peter; Davis, John; Pears, Peter; Powell, Bill; McKinley, Angela Davis; Klepczynski, Bill; DeYoung, James; hide

    1996-01-01

    Two-way satellite time and frequency transfer (TWSTFT) is the most accurate and precise method of comparing two remote clocks or time scales. The accuracy obtained is dependent on the accuracy of the determination of the non-reciprocal delays of the transmit and the receive paths. When the same transponders in the satellite at the same frequencies are used, then the non-reciprocity in the Earth stations is the limiting factor for absolute time transfer.

  18. Cardinal and anti-cardinal points, equalities and chromatic dependence.

    PubMed

    Evans, Tanya; Harris, William F

    2017-05-01

    Cardinal points are used for ray tracing through Gaussian systems. Anti-principal and anti-nodal points (which we shall refer to as the anti-cardinal points), along with the six familiar cardinal points, belong to a much larger set of special points. The purpose of this paper is to obtain a set of relationships and resulting equalities among the cardinal and anti-cardinal points and to illustrate them using Pascal's ring. The methodology used relies on Gaussian optics and the transference T. We make use of two equations, obtained via the transference, which give the locations of the six cardinal and four anti-cardinal points with respect to the system. We obtain equalities among the cardinal and anti-cardinal points. We utilise Pascal's ring to illustrate which points depend on frequency and their displacement with change in frequency. Pascal described a memory schema in the shape of a hexagon for remembering equalities among the points and illustrating shifts in these points when an aspect of the system changes. We modify and extend Pascal's ring to include the anti-cardinal points. We make use of Pascal's ring extended to illustrate which points are dependent on the frequency of light and the direction of shift of the equalities with change in frequency. For the reduced eye the principal and nodal points are independent of frequency, but the focal points and the anti-cardinal points depend on frequency. For Le Grand's four-surface model eye all six cardinal and four anti-cardinal points depend on frequency. This has implications for definitions, particularly of chromatic aberrations of the eye, that make use of cardinal points and that themselves depend on frequency. Pascal's ring and Pascal's ring extended are novel memory schema for remembering the equalities among the cardinal and anti-cardinal points. The rings are useful for illustrating changes among the equalities and direction of shift of points when an aspect of a system changes. Care should be taken when defining concepts that rely on cardinal points that depend on frequency. © 2017 The Authors Ophthalmic & Physiological Optics © 2017 The College of Optometrists.

  19. Relative frequency of knowledge of performance and motor skill learning.

    PubMed

    Weeks, D L; Kordus, R N

    1998-09-01

    This study examined the effects of variations in relative frequency of knowledge of performance (KP) on acquisition, retention, and transfer of form for a multilimb closed sport skill. Two groups received either 100% relative frequency of KP or 33% relative frequency of KP while learning the soccer throw-in skill. Participants were boys between the ages of 11 and 14 years who were unfamiliar with the skill. Participants performed a 30-trial acquisition phase in which KP was provided about one of eight aspects of form. Following acquisition, five trial retention and transfer (to a target at a different distance than experienced in acquisition) tests were administered at 5 min, 24 hr, and 72 hr. Although no group differences were found for accuracy scores, the 33% group had higher form scores in acquisition and all retention and transfer tests. It was concluded that reducing the relative frequency of KP eliminated a dependency on KP to guide performance in acquisition, which was beneficial for maintaining form in conditions in which KP was absent.

  20. Faithful state transfer between two-level systems via an actively cooled finite-temperature cavity

    NASA Astrophysics Data System (ADS)

    Sárkány, Lőrinc; Fortágh, József; Petrosyan, David

    2018-03-01

    We consider state transfer between two qubits—effective two-level systems represented by Rydberg atoms—via a common mode of a microwave cavity at finite temperature. We find that when both qubits have the same coupling strength to the cavity field, at large enough detuning from the cavity mode frequency, quantum interference between the transition paths makes the swap of the excitation between the qubits largely insensitive to the number of thermal photons in the cavity. When, however, the coupling strengths are different, the photon-number-dependent differential Stark shift of the transition frequencies precludes efficient transfer. Nevertheless, using an auxiliary cooling system to continuously extract the cavity photons, we can still achieve a high-fidelity state transfer between the qubits.

  1. Frequency-dependent ultrasound-induced transformation in E. coli.

    PubMed

    Deeks, Jeremy; Windmill, James; Agbeze-Onuma, Maduka; Kalin, Robert M; Argondizza, Peter; Knapp, Charles W

    2014-12-01

    Ultrasound-enhanced gene transfer (UEGT) is continuing to gain interest across many disciplines; however, very few studies investigate UEGT efficiency across a range of frequencies. Using a variable frequency generator, UEGT was tested in E. coli at six ultrasonic frequencies. Results indicate frequency can significantly influence UEGT efficiency positively and negatively. A frequency of 61 kHz improved UEGT efficiency by ~70 % higher, but 99 kHz impeded UEGT to an extent worse than no ultrasound exposure. The other four frequencies (26, 133, 174, and 190 kHz) enhanced transformation compared to no ultrasound, but efficiencies did not vary. The influence of frequency on UEGT efficiency was observed across a range of operating frequencies. It is plausible that frequency-dependent dynamics of mechanical and chemical energies released during cavitational-bubble collapse (CBC) are responsible for observed UEGT efficiencies.

  2. Frequency-dependent local field factors in dielectric liquids by a polarizable force field and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Davari, Nazanin; Haghdani, Shokouh; Åstrand, Per-Olof

    2015-12-01

    A force field model for calculating local field factors, i.e. the linear response of the local electric field for example at a nucleus in a molecule with respect to an applied electric field, is discussed. It is based on a combined charge-transfer and point-dipole interaction model for the polarizability, and thereby it includes two physically distinct terms for describing electronic polarization: changes in atomic charges arising from transfer of charge between the atoms and atomic induced dipole moments. A time dependence is included both for the atomic charges and the atomic dipole moments and if they are assumed to oscillate with the same frequency as the applied electric field, a model for frequency-dependent properties are obtained. Furthermore, if a life-time of excited states are included, a model for the complex frequency-dependent polariability is obtained including also information about excited states and the absorption spectrum. We thus present a model for the frequency-dependent local field factors through the first molecular excitation energy. It is combined with molecular dynamics simulations of liquids where a large set of configurations are sampled and for which local field factors are calculated. We are normally not interested in the average of the local field factor but rather in configurations where it is as high as possible. In electrical insulation, we would like to avoid high local field factors to reduce the risk for electrical breakdown, whereas for example in surface-enhanced Raman spectroscopy, high local field factors are desired to give dramatically increased intensities.

  3. Dynamics of networks of excitatory and inhibitory neurons in response to time-dependent inputs.

    PubMed

    Ledoux, Erwan; Brunel, Nicolas

    2011-01-01

    We investigate the dynamics of recurrent networks of excitatory (E) and inhibitory (I) neurons in the presence of time-dependent inputs. The dynamics is characterized by the network dynamical transfer function, i.e., how the population firing rate is modulated by sinusoidal inputs at arbitrary frequencies. Two types of networks are studied and compared: (i) a Wilson-Cowan type firing rate model; and (ii) a fully connected network of leaky integrate-and-fire (LIF) neurons, in a strong noise regime. We first characterize the region of stability of the "asynchronous state" (a state in which population activity is constant in time when external inputs are constant) in the space of parameters characterizing the connectivity of the network. We then systematically characterize the qualitative behaviors of the dynamical transfer function, as a function of the connectivity. We find that the transfer function can be either low-pass, or with a single or double resonance, depending on the connection strengths and synaptic time constants. Resonances appear when the system is close to Hopf bifurcations, that can be induced by two separate mechanisms: the I-I connectivity and the E-I connectivity. Double resonances can appear when excitatory delays are larger than inhibitory delays, due to the fact that two distinct instabilities exist with a finite gap between the corresponding frequencies. In networks of LIF neurons, changes in external inputs and external noise are shown to be able to change qualitatively the network transfer function. Firing rate models are shown to exhibit the same diversity of transfer functions as the LIF network, provided delays are present. They can also exhibit input-dependent changes of the transfer function, provided a suitable static non-linearity is incorporated.

  4. Parameters assessment of the inductively-coupled circuit for wireless power transfer

    NASA Astrophysics Data System (ADS)

    Isaev, Yu N.; Vasileva, O. V.; Budko, A. A.; Lefebvre, S.

    2017-02-01

    In this paper, a wireless power transfer model through the example of inductively-coupled coils of irregular shape in software package COMSOL Multiphysics is studied. Circuit parameters, such as inductance, coil resistance and self-capacitance were defined through electromagnetic energy by the finite-element method. The study was carried out according to Helmholtz equation. Spatial distribution of current per unit depending on frequency and the coupling coefficient for analysis of resonant frequency and spatial distribution of the vector magnetic potential at different distances between coils were presented. The resulting algorithm allows simulating the wireless power transfer between the inductively coupled coils of irregular shape with the assessment of the optimal parameters.

  5. Acoustic Wave Propagation in Pressure Sense Lines

    NASA Technical Reports Server (NTRS)

    Vitarius, Patrick; Gregory, Don A.; Wiley, John; Korman, Valentin

    2003-01-01

    Sense lines are used in pressure measurements to passively transmit information from hostile environments to areas where transducers can be used. The transfer function of a sense line can be used to obtain information about the measured environment from the protected sensor. Several properties of this transfer function are examined, including frequency dependence, Helmholtz resonance, and time of flight delay.

  6. Energy transfer in mesoscopic vibrational systems enabled by eigenfrequency fluctuations

    NASA Astrophysics Data System (ADS)

    Atalaya, Juan

    Energy transfer between low-frequency vibrational modes can be achieved by means of nonlinear coupling if their eigenfrequencies fulfill certain nonlinear resonance conditions. Because of the discreteness of the vibrational spectrum at low frequencies, such conditions may be difficult to satisfy for most low-frequency modes in typical mesoscopic vibrational systems. Fluctuations of the vibrational eigenfrequencies can also be relatively strong in such systems. We show that energy transfer between modes can occur in the absence of nonlinear resonance if frequency fluctuations are allowed. The case of three modes with cubic nonlinear coupling and no damping is particularly interesting. It is found that the system has a non-thermal equilibrium state which depends only on the initial conditions. The rate at which the system approaches to such state is determined by the parameters such as the noise strength and correlation time, the nonlinearity strength and the detuning from exact nonlinear resonance. We also discuss the case of many weakly coupled modes. Our results shed light on the problem of energy relaxation of low-frequency vibrational modes into the continuum of high-frequency vibrational modes. The results have been obtained with Mark Dykman. Alternative email: jatalaya2012@gmail.com.

  7. Low-frequency ultrasound increases non-viral gene transfer to the mouse lung.

    PubMed

    Xenariou, Stefania; Liang, Hai-Dong; Griesenbach, Uta; Zhu, Jie; Farley, Raymond; Somerton, Lucinda; Singh, Charanjit; Jeffery, Peter K; Scheule, Ronald K; Cheng, Seng H; Geddes, Duncan M; Blomley, Martin; Alton, Eric W F W

    2010-01-01

    The aim of the study was to assess if low-frequency ultrasound (US), in the range of 30-35 kHz, increases non-viral gene transfer to the mouse lung. US is greatly attenuated in the lung due to large energy losses at the air/tissue interfaces. The advantages of low-frequency US, compared with high-frequency US are: (i) increased cavitation (responsible for the formation of transient pores in the cell membrane) and (ii) reduced energy losses during lung penetration. Cationic lipid GL67/plasmid DNA (pDNA), polyethylenimine (PEI)/pDNA and naked pDNA were delivered via intranasal instillation and the animals were then exposed to US (sonoporation) at 0.07 or 0.1 MPa for 10 min. Under these conditions, US did not enhance GL67 or PEI-mediated transfection. It did, however, increase naked pDNA gene transfer by approximately 4 folds. Importantly, this was achieved in the absence of microbubbles, which are crucial for the commonly used high-frequency (1 MHz) sonoporation but may not be able to withstand nebulization in a clinically relevant setup. Lung hemorrhage was also assessed and shown to increase with US pressure in a dose-dependent manner. We have thus, established that low-frequency US can enhance lung gene transfer with naked pDNA and this enhancement is more effective than the previously reported 1 MHz US.

  8. Synthesis and electrochemical studies of charge-transfer complexes of thiazolidine-2,4-dione with σ and π acceptors

    NASA Astrophysics Data System (ADS)

    Singh, Prashant; Kumar, Pradeep; Katyal, Anju; Kalra, Rashmi; Dass, Sujata K.; Prakash, Satya; Chandra, Ramesh

    2010-03-01

    In the present work, we report the synthesis and characterization of novel charge-transfer complexes of thiazolidine-2,4-dione (TZD) with sigma acceptor (iodine) and pi acceptors (chloranil, dichlorodicyanoquinone, picric acid and duraquinone). We also evaluated their thermal and electrochemical properties and we conclude that these complexes are frequency dependent. Charge-transfer complex between thiazolidine-2,4-dione and iodine give best conductivity. In conclusion, complex with sigma acceptors are more conducting than with pi acceptors.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vecchio, Alberto; Wickham, Elizabeth D.L.

    The Laser Interferometer Space Antenna (LISA) is expected to provide the largest observational sample of binary systems of faint subsolar mass compact objects, in particular, white-dwarfs, whose radiation is monochromatic over most of the LISA observational window. Current astrophysical estimates suggest that the instrument will be able to resolve {approx}10{sup 4} such systems, with a large fraction of them at frequencies > or approx. 3 mHz, where the wavelength of gravitational waves becomes comparable to or shorter than the LISA armlength. This affects the structure of the so-called LISA transfer function which cannot be treated as constant in this frequencymore » range: it introduces characteristic phase and amplitude modulations that depend on the source location in the sky and the emission frequency. Here we investigate the effect of the LISA transfer function on detection and parameter estimation for monochromatic sources. For signal detection we show that filters constructed by approximating the transfer function as a constant (long-wavelength approximation) introduce a negligible loss of signal-to-noise ratio--the fitting factor always exceeds 0.97--for f{<=}10 mHz, therefore in a frequency range where one would actually expect the approximation to fail. For parameter estimation, we conclude that in the range 3 mHz < or approx. f < or approx. 30 mHz the errors associated with parameter measurements differ from {approx_equal}5% up to a factor {approx}10 (depending on the actual source parameters and emission frequency) with respect to those computed using the long-wavelength approximation.« less

  10. Time-dependent view of an isotope effect in electron-nuclear nonequilibrium dynamics with applications to N2.

    PubMed

    Ajay, Jayanth S; Komarova, Ksenia G; Remacle, Francoise; Levine, R D

    2018-06-05

    Isotopic fractionation in the photodissociation of N 2 could explain the considerable variation in the 14 N/ 15 N ratio in different regions of our galaxy. We previously proposed that such an isotope effect is due to coupling of photoexcited bound valence and Rydberg electronic states in the frequency range where there is strong state mixing. We here identify features of the role of the mass in the dynamics through a time-dependent quantum-mechanical simulation. The photoexcitation of N 2 is by an ultrashort pulse so that the process has a sharply defined origin in time and so that we can monitor the isolated molecule dynamics in time. An ultrafast pulse is necessarily broad in frequency and spans several excited electronic states. Each excited molecule is therefore not in a given electronic state but in a superposition state. A short time after excitation, there is a fairly sharp onset of a mass-dependent large population transfer when wave packets on two different electronic states in the same molecule overlap. This coherent overlap of the wave packets on different electronic states in the region of strong coupling allows an effective transfer of population that is very mass dependent. The extent of the transfer depends on the product of the populations on the two different electronic states and on their relative phase. It is as if two molecules collide but the process occurs within one molecule, a molecule that is simultaneously in both states. An analytical toy model recovers the (strong) mass and energy dependence.

  11. Wireless power transfer based on dielectric resonators with colossal permittivity

    NASA Astrophysics Data System (ADS)

    Song, Mingzhao; Belov, Pavel; Kapitanova, Polina

    2016-11-01

    Magnetic resonant wireless power transfer system based on dielectric disk resonators made of colossal permittivity (ɛ = 1000) and low loss (tan δ = 2.5 × 10-4) microwave ceramic is experimentally investigated. The system operates at the magnetic dipole mode excited in the resonators providing maximal power transfer efficiency of 90% at the frequency 232 MHz. By applying an impedance matching technique, the efficiency of 50% is achieved within the separation between the resonators d = 16 cm (3.8 radii of the resonator). The separation, misalignment and rotation dependencies of wireless power transfer efficiency are experimentally studied.

  12. Radiative transfer to space through a precipitating cloud at multiple microwave frequencies. I - Model description. II - Results and analysis

    NASA Technical Reports Server (NTRS)

    Mugnai, Alberto; Smith, Eric A.

    1988-01-01

    The impact of time-dependent cloud microphysical structure on the transfer to space of passive microwave radiation is studied at several frequencies across the EHF and lower SHF portions of the microwave spectrum. The feasibility of using multichannel passive-microwave retrieval techniques to estimate precipitation from space-based platforms is examined. The model is described, and the results are assessed in conjunction with a Nimbus-7 SMMR case study of precipitation in an intense tropical Pacific storm. It is concluded that the effects of cloud liquid water content must be considered to obtain a realistic estimation and distribution of rainrates.

  13. Conjugal Transfer of the Pathogenicity Island ROD21 in Salmonella enterica serovar Enteritidis Depends on Environmental Conditions

    PubMed Central

    Salazar-Echegarai, Francisco J.; Tobar, Hugo E.; Nieto, Pamela A.; Riedel, Claudia A.; Bueno, Susan M.

    2014-01-01

    Unstable pathogenicity islands are chromosomal elements that can be transferred from one bacterium to another. Salmonella enterica serovar Enteritidis (S. Enteritidis) is a pathogenic bacterium containing such unstable pathogenicity islands. One of them, denominated ROD21, is 26.5 kb in size and capable of excising from the chromosome in certain culture conditions, as well as during bacterial infection of phagocytic cells. In this study we have evaluated whether ROD21 can be effectively transferred from one bacterium to another. We generated a donor and several recipient strains of S. Enteritidis to carry out transfer assays in liquid LB medium. These assays showed that ROD21 is effectively transferred from donor to recipient strains of S. Enteritidis and S. Typhimurium. When Escherichia coli was used as the recipient strain, ROD21 transfer failed to be observed. Subsequently, we showed that a conjugative process was required for the transfer of the island and that changes in temperature and pH increased the transfer frequency between Salmonella strains. Our data indicate that ROD21 is an unstable pathogenicity island that can be transferred by conjugation in a species-specific manner between Salmonellae. Further, ROD21 transfer frequency increases in response to environmental changes, such as pH and temperature. PMID:24705125

  14. An improved random walk algorithm for the implicit Monte Carlo method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keady, Kendra P., E-mail: keadyk@lanl.gov; Cleveland, Mathew A.

    In this work, we introduce a modified Implicit Monte Carlo (IMC) Random Walk (RW) algorithm, which increases simulation efficiency for multigroup radiative transfer problems with strongly frequency-dependent opacities. To date, the RW method has only been implemented in “fully-gray” form; that is, the multigroup IMC opacities are group-collapsed over the full frequency domain of the problem to obtain a gray diffusion problem for RW. This formulation works well for problems with large spatial cells and/or opacities that are weakly dependent on frequency; however, the efficiency of the RW method degrades when the spatial cells are thin or the opacities aremore » a strong function of frequency. To address this inefficiency, we introduce a RW frequency group cutoff in each spatial cell, which divides the frequency domain into optically thick and optically thin components. In the modified algorithm, opacities for the RW diffusion problem are obtained by group-collapsing IMC opacities below the frequency group cutoff. Particles with frequencies above the cutoff are transported via standard IMC, while particles below the cutoff are eligible for RW. This greatly increases the total number of RW steps taken per IMC time-step, which in turn improves the efficiency of the simulation. We refer to this new method as Partially-Gray Random Walk (PGRW). We present numerical results for several multigroup radiative transfer problems, which show that the PGRW method is significantly more efficient than standard RW for several problems of interest. In general, PGRW decreases runtimes by a factor of ∼2–4 compared to standard RW, and a factor of ∼3–6 compared to standard IMC. While PGRW is slower than frequency-dependent Discrete Diffusion Monte Carlo (DDMC), it is also easier to adapt to unstructured meshes and can be used in spatial cells where DDMC is not applicable. This suggests that it may be optimal to employ both DDMC and PGRW in a single simulation.« less

  15. Frequency analysis via the method of moment functionals

    NASA Technical Reports Server (NTRS)

    Pearson, A. E.; Pan, J. Q.

    1990-01-01

    Several variants are presented of a linear-in-parameters least squares formulation for determining the transfer function of a stable linear system at specified frequencies given a finite set of Fourier series coefficients calculated from transient nonstationary input-output data. The basis of the technique is Shinbrot's classical method of moment functionals using complex Fourier based modulating functions to convert a differential equation model on a finite time interval into an algebraic equation which depends linearly on frequency-related parameters.

  16. Using transfer functions to quantify El Niño Southern Oscillation dynamics in data and models.

    PubMed

    MacMartin, Douglas G; Tziperman, Eli

    2014-09-08

    Transfer function tools commonly used in engineering control analysis can be used to better understand the dynamics of El Niño Southern Oscillation (ENSO), compare data with models and identify systematic model errors. The transfer function describes the frequency-dependent input-output relationship between any pair of causally related variables, and can be estimated from time series. This can be used first to assess whether the underlying relationship is or is not frequency dependent, and if so, to diagnose the underlying differential equations that relate the variables, and hence describe the dynamics of individual subsystem processes relevant to ENSO. Estimating process parameters allows the identification of compensating model errors that may lead to a seemingly realistic simulation in spite of incorrect model physics. This tool is applied here to the TAO array ocean data, the GFDL-CM2.1 and CCSM4 general circulation models, and to the Cane-Zebiak ENSO model. The delayed oscillator description is used to motivate a few relevant processes involved in the dynamics, although any other ENSO mechanism could be used instead. We identify several differences in the processes between the models and data that may be useful for model improvement. The transfer function methodology is also useful in understanding the dynamics and evaluating models of other climate processes.

  17. Filter frequency response of time dependent signal using Laplace transform

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shestakov, Aleksei I.

    We analyze the effect a filter has on a time dependent signal x(t). If X(s) is the Laplace transform of x and H (s) is the filter Transfer function, the response in frequency space is X (s) H (s). Consequently, in real space, the response is the convolution (x*h) (t), where hi is the Laplace inverse of H. Effects are analyzed and analytically for functions such as (t/t c) 2 e -t/tmore » $$_c$$, where t c = const. We consider lowpass, highpass and bandpass filters.« less

  18. Time dependent heat transfer rates in high Reynolds number hypersonic flowfields

    NASA Technical Reports Server (NTRS)

    Flanagan, Michael J.

    1992-01-01

    Time dependent heat transfer rates have been calculated from time dependent temperature measurements in the vicinity of shock-wave boundary-layer interactions due to conical compression ramps on an axisymmetric body. The basic model is a cylindrical body with a 10 degree conical nose. Four conical ramps, 20, 25, 30, and 35 degrees serve as shock wave generators. Flowfield surveys have been made in the vicinity of the conical ramp vertex, the separation point, and the reattachment point. A significant effort was made to characterize the natural frequencies and relative powers of the resulting fluctuations in heat transfer rates. This research effort, sponsored jointly by NASA and the Air Force, was conducted in the Air Force Flight Dynamics Directorate High Reynolds Facility. The nominal freestream Mach number was 6, and the freestream Reynolds numbers ranged from 2.2 million/ft to 30.0 million/ft. Experimental results quantify temperature response and the resulting heat transfer rates as a function of ramp angle and Reynolds number. The temperature response within the flowfield appears to be steady-state for all compression ramp angles and all Reynolds numbers, and hence, the heat transfer rates appear to be steady-state.

  19. Time dependent heat transfer rates in high Reynolds number hypersonic flowfields

    NASA Astrophysics Data System (ADS)

    Flanagan, Michael J.

    1992-09-01

    Time dependent heat transfer rates have been calculated from time dependent temperature measurements in the vicinity of shock-wave boundary-layer interactions due to conical compression ramps on an axisymmetric body. The basic model is a cylindrical body with a 10 degree conical nose. Four conical ramps, 20, 25, 30, and 35 degrees serve as shock wave generators. Flowfield surveys have been made in the vicinity of the conical ramp vertex, the separation point, and the reattachment point. A significant effort was made to characterize the natural frequencies and relative powers of the resulting fluctuations in heat transfer rates. This research effort, sponsored jointly by NASA and the Air Force, was conducted in the Air Force Flight Dynamics Directorate High Reynolds Facility. The nominal freestream Mach number was 6, and the freestream Reynolds numbers ranged from 2.2 million/ft to 30.0 million/ft. Experimental results quantify temperature response and the resulting heat transfer rates as a function of ramp angle and Reynolds number. The temperature response within the flowfield appears to be steady-state for all compression ramp angles and all Reynolds numbers, and hence, the heat transfer rates appear to be steady-state.

  20. The alpha-motoneuron pool as transmitter of rhythmicities in cortical motor drive.

    PubMed

    Stegeman, Dick F; van de Ven, Wendy J M; van Elswijk, Gijs A; Oostenveld, Robert; Kleine, Bert U

    2010-10-01

    Investigate the effectiveness and frequency dependence of central drive transmission via the alpha-motoneuron pool to the muscle. We describe a model for the simulation of alpha-motoneuron firing and the EMG signal as response to central drive input. The transfer in the frequency domain is investigated. Coherence between stochastical central input and EMG is also evaluated. The transmission of central rhythmicities to the EMG signal relates to the spectral content of the latter. Coherence between central input to the alpha-motoneuron pool and the EMG signal is significant whereby the coupling strength hardly depends on the frequency in a range from 1 to 100 Hz. Common central input to pairs of alpha-motoneurons strongly increases the coherence levels. The often-used rectification of the EMG signal introduces a clear frequency dependence. Oscillatory phenomena are strongly transmitted via the alpha-motoneuron pool. The motoneuron firing frequencies do play a role in the transmission gain, but do not influence the coherence levels. Rectification of the EMG signal enhances the transmission gain, but lowers coherence and introduces a strong frequency dependency. We think that it should be avoided. Our findings show that rhythmicities are translated into alpha-motoneuron activity without strong non-linearities. Copyright 2010 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  1. Transfer function analysis of dynamic cerebral autoregulation in humans

    NASA Technical Reports Server (NTRS)

    Zhang, R.; Zuckerman, J. H.; Giller, C. A.; Levine, B. D.; Blomqvist, C. G. (Principal Investigator)

    1998-01-01

    To test the hypothesis that spontaneous changes in cerebral blood flow are primarily induced by changes in arterial pressure and that cerebral autoregulation is a frequency-dependent phenomenon, we measured mean arterial pressure in the finger and mean blood flow velocity in the middle cerebral artery (VMCA) during supine rest and acute hypotension induced by thigh cuff deflation in 10 healthy subjects. Transfer function gain, phase, and coherence function between changes in arterial pressure and VMCA were estimated using the Welch method. The impulse response function, calculated as the inverse Fourier transform of this transfer function, enabled the calculation of transient changes in VMCA during acute hypotension, which was compared with the directly measured change in VMCA during thigh cuff deflation. Beat-to-beat changes in VMCA occurred simultaneously with changes in arterial pressure, and the autospectrum of VMCA showed characteristics similar to arterial pressure. Transfer gain increased substantially with increasing frequency from 0.07 to 0.20 Hz in association with a gradual decrease in phase. The coherence function was > 0.5 in the frequency range of 0.07-0.30 Hz and < 0.5 at < 0.07 Hz. Furthermore, the predicted change in VMCA was similar to the measured VMCA during thigh cuff deflation. These data suggest that spontaneous changes in VMCA that occur at the frequency range of 0.07-0.30 Hz are related strongly to changes in arterial pressure and, furthermore, that short-term regulation of cerebral blood flow in response to changes in arterial pressure can be modeled by a transfer function with the quality of a high-pass filter in the frequency range of 0.07-0.30 Hz.

  2. Heat transfer in an evaporation-condensation system in simulated weightlessness conditions

    NASA Astrophysics Data System (ADS)

    Bologa, M. K.; Grosu, F. P.; Kozhevnikov, I. V.; Motorin, O. V.; Polikarpov, A. A.

    2017-10-01

    The process of heat transfer in an evaporation-condensation system (ECS) at circulation of dielectric liquid in a closed thermoelectrohydrodynamic (TEHD) loop consisting of an evaporator, a condenser and electrohydrodynamic (EHD) pump for pumping of heat carrier, is considered. Previously, the authors studied the dependence of heat transfer on the angle of rotation of TEHD loop in a vertical plane. The report contains the results of studies of heat transfer at electrohydrodynamic pumping of the heat carrier (8% solution of acetone in Freon 113) in the condenser area by means of EHD pump of “cone-cone” type. All elements of the ECS are arranged in a horizontal plane and the heat transfer from the heater to the condenser without EHD pumping is impossible. A pulsating heat carrier flow mode, depending on the heat input and the voltage applied to the pump, takes place at EHD pumping. As the input power is decreasing the frequency of the coolant pulsations as well as the departure diameter and number of vapour bubbles are also decreasing. At some critical heat input the pulsations disappear and the transition from turbulent mode to the laminar one takes place causing the decrease of the heat transfer coefficient. The increase of the pumping flow rate by raising the voltage applied to the EHD pump, results in a partial suppression of boiling. The maximum intensification of heat transfer is reached at pulsation frequency of 1.25 Hz. The maximum heat flow from the heater was 4.2·104 W/m2. Graphical representation and the physical interpretation of the results, which reflect the essence of the process, are given.

  3. Solid-state dynamic nuclear polarization at 263 GHz: spectrometer design and experimental results†

    PubMed Central

    Rosay, Melanie; Tometich, Leo; Pawsey, Shane; Bader, Reto; Schauwecker, Robert; Blank, Monica; Borchard, Philipp M.; Cauffman, Stephen R.; Felch, Kevin L.; Weber, Ralph T.; Temkin, Richard J.; Griffin, Robert G.; Maas, Werner E.

    2015-01-01

    Dynamic Nuclear Polarization (DNP) experiments transfer polarization from electron spins to nuclear spins with microwave irradiation of the electron spins for enhanced sensitivity in nuclear magnetic resonance (NMR) spectroscopy. Design and testing of a spectrometer for magic angle spinning (MAS) DNP experiments at 263 GHz microwave frequency, 400 MHz 1H frequency is described. Microwaves are generated by a novel continuous-wave gyrotron, transmitted to the NMR probe via a transmission line, and irradiated on a 3.2 mm rotor for MAS DNP experiments. DNP signal enhancements of up to 80 have been measured at 95 K on urea and proline in water–glycerol with the biradical polarizing agent TOTAPOL. We characterize the experimental parameters affecting the DNP efficiency: the magnetic field dependence, temperature dependence and polarization build-up times, microwave power dependence, sample heating effects, and spinning frequency dependence of the DNP signal enhancement. Stable system operation, including DNP performance, is also demonstrated over a 36 h period. PMID:20449524

  4. Rotordynamic analysis using the Complex Transfer Matrix: An application to elastomer supports using the viscoelastic correspondence principle

    NASA Astrophysics Data System (ADS)

    Varney, Philip; Green, Itzhak

    2014-11-01

    Numerous methods are available to calculate rotordynamic whirl frequencies, including analytic methods, finite element analysis, and the transfer matrix method. The typical real-valued transfer matrix (RTM) suffers from several deficiencies, including lengthy computation times and the inability to distinguish forward and backward whirl. Though application of complex coordinates in rotordynamic analysis is not novel per se, specific advantages gained from using such coordinates in a transfer matrix analysis have yet to be elucidated. The present work employs a complex coordinate redefinition of the transfer matrix to obtain reduced forms of the elemental transfer matrices in inertial and rotating reference frames, including external stiffness and damping. Application of the complex-valued state variable redefinition results in a reduction of the 8×8 RTM to the 4×4 Complex Transfer Matrix (CTM). The CTM is advantageous in that it intrinsically separates forward and backward whirl, eases symbolic manipulation by halving the transfer matrices’ dimension, and provides significant improvement in computation time. A symbolic analysis is performed on a simple overhung rotor to demonstrate the mathematical motivation for whirl frequency separation. The CTM's utility is further shown by analyzing a rotordynamic system supported by viscoelastic elastomer rings. Viscoelastic elastomer ring supports can provide significant damping while reducing the cost and complexity associated with conventional components such as squeeze film dampers. The stiffness and damping of a viscoelastic damper ring are determined herein as a function of whirl frequency using the viscoelastic correspondence principle and a constitutive fractional calculus viscoelasticity model. The CTM is then employed to obtain the characteristic equation, where the whirl frequency dependent stiffness and damping of the elastomer supports are included. The Campbell diagram is shown, demonstrating the CTM's ability to intrinsically separate synchronous whirl direction for a non-trivial rotordynamic system. Good agreement is found between the CTM results and previously obtained analytic and experimental results for the elastomer ring supported rotordynamic system.

  5. The acoustical cues to sound location in the Guinea pig (cavia porcellus)

    PubMed Central

    Greene, Nathanial T; Anbuhl, Kelsey L; Williams, Whitney; Tollin, Daniel J.

    2014-01-01

    There are three main acoustical cues to sound location, each attributable to space-and frequency-dependent filtering of the propagating sound waves by the outer ears, head, and torso: Interaural differences in time (ITD) and level (ILD) as well as monaural spectral shape cues. While the guinea pig has been a common model for studying the anatomy, physiology, and behavior of binaural and spatial hearing, extensive measurements of their available acoustical cues are lacking. Here, these cues were determined from directional transfer functions (DTFs), the directional components of the head-related transfer functions, for eleven adult guinea pigs. In the frontal hemisphere, monaural spectral notches were present for frequencies from ~10 to 20 kHz; in general, the notch frequency increased with increasing sound source elevation and in azimuth toward the contralateral ear. The maximum ITDs calculated from low-pass filtered (2 kHz cutoff frequency) DTFs were ~250 µs, whereas the maximum ITD measured with low frequency tone pips was over 320 µs. A spherical head model underestimates ITD magnitude under normal conditions, but closely approximates values when the pinnae were removed. Interaural level differences (ILDs) strongly depended on location and frequency; maximum ILDs were < 10 dB for frequencies < 4 kHz and were as large as 40 dB for frequencies > 10 kHz. Removal of the pinna reduced the depth and sharpness of spectral notches, altered the acoustical axis, and reduced the acoustical gain, ITDs, and ILDs; however, spectral shape features and acoustical gain were not completely eliminated, suggesting a substantial contribution of the head and torso in altering the sounds present at the tympanic membrane. PMID:25051197

  6. Design of a Satellite Data Manipulation Tool in a Time and Frequency Transfer System Using Satellites

    DTIC Science & Technology

    1999-12-01

    as an R & D part of the time/frequency transfer system using Koreasat of Korea Telecom. INTRODUCTION The time/frequency transfer system distributes...Satellite Data Manipulation Tool in a Time and Frequency Transfer System Using Satellites 5a . CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...precision and stability. In Korea, research for the time/frequency transfer system using Koreasat is in progress. The time/frequency transfer system using

  7. Lower bound for LCD image quality

    NASA Astrophysics Data System (ADS)

    Olson, William P.; Balram, Nikhil

    1996-03-01

    The paper presents an objective lower bound for the discrimination of patterns and fine detail in images on a monochrome LCD. In applications such as medical imaging and military avionics the information of interest is often at the highest frequencies in the image. Since LCDs are sampled data systems, their output modulation is dependent on the phase between the input signal and the sampling points. This phase dependence becomes particularly significant at high spatial frequencies. In order to use an LCD for applications such as those mentioned above it is essential to have a lower (worst case) bound on the performance of the display. We address this problem by providing a mathematical model for the worst case output modulation of an LCD in response to a sine wave input. This function can be interpreted as a worst case modulation transfer function (MTF). The intersection of the worst case MTF with the contrast threshold function (CTF) of the human visual system defines the highest spatial frequency that will always be detectable. In addition to providing the worst case limiting resolution, this MTF is combined with the CTF to produce objective worst case image quality values using the modulation transfer function area (MTFA) metric.

  8. Modulation transfer function of a triangular pixel array detector.

    PubMed

    Karimzadeh, Ayatollah

    2014-07-01

    The modulation transfer function (MTF) is the main parameter that is used to evaluate image quality in electro-optical systems. Detector sampling MTF in most electro-optical systems determines the cutoff frequency of the system. The MTF of the detector depends on its pixel shape. In this work, we calculated the MTF of a detector with an equilateral triangular pixel shape. Some new results were found in deriving the MTF for the equilateral triangular pixel shape.

  9. Magnetization transfer proportion: a simplified measure of dose response for polymer gel dosimetry.

    PubMed

    Whitney, Heather M; Gochberg, Daniel F; Gore, John C

    2008-12-21

    The response to radiation of polymer gel dosimeters has most often been described by measuring the nuclear magnetic resonance transverse relaxation rate as a function of dose. This approach is highly dependent upon the choice of experimental parameters, such as the echo spacing time for Carr-Purcell-Meiboom-Gill-type pulse sequences, and is difficult to optimize in imaging applications where a range of doses are applied to a single gel, as is typical for practical uses of polymer gel dosimetry. Moreover, errors in computing dose can arise when there are substantial variations in the radiofrequency (B1) field or resonant frequency, as may occur for large samples. Here we consider the advantages of using magnetization transfer imaging as an alternative approach and propose the use of a simplified quantity, the magnetization transfer proportion (MTP), to assess doses. This measure can be estimated through two simple acquisitions and is more robust in the presence of some sources of system imperfections. It also has a dependence upon experimental parameters that is independent of dose, allowing simultaneous optimization at all dose levels. The MTP is shown to be less susceptible to B1 errors than are CPMG measurements of R2. The dose response can be optimized through appropriate choices of the power and offset frequency of the pulses used in magnetization transfer imaging.

  10. Computational studies of molecular charge transfer complexes of heterocyclic 4-methylepyridine-2-azomethine-p-benzene derivatives with picric acid and m-dinitrobenzene.

    PubMed

    Al-Harbi, L M; El-Mossalamy, E H; Obaid, A Y; Al-Jedaani, A H

    2014-01-01

    Charge transfer complexes of substituted aryl Schiff bases as donors with picric acid and m-dinitrobenzene as acceptors were investigated by using computational analysis calculated by Configuration Interaction Singles Hartree-Fock (CIS-HF) at standard 6-31G∗ basis set and Time-Dependent Density-Functional Theory (TD-DFT) levels of theory at standard 6-31G∗∗ basis set, infrared spectra, visible and nuclear magnetic resonance spectra are investigated. The optimized geometries and vibrational frequencies were evaluated. The energy and oscillator strength were calculated by Configuration Interaction Singles Hartree-Fock method (CIS-HF) and the Time-Dependent Density-Functional Theory (TD-DFT) results. Electronic properties, such as HOMO and LUMO energies and band gaps of CTCs set, were studied by the Time-Dependent density functional theory with Becke-Lee-Young-Parr (B3LYP) composite exchange correlation functional and by Configuration Interaction Singles Hartree-Fock method (CIS-HF). The ionization potential Ip and electron affinity EA were calculated by PM3, HF and DFT methods. The columbic force was calculated theoretically by using (CIS-HF and TD-DFT) methods. This study confirms that the theoretical calculation of vibrational frequencies for (aryl Schiff bases--(m-dinitrobenzene and picric acid)) complexes are quite useful for the vibrational assignment and for predicting new vibrational frequencies. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Vibration-translation energy transfer in vibrationally excited diatomic molecules. Ph.D. Thesis - York Univ., Toronto

    NASA Technical Reports Server (NTRS)

    Mckenzie, R. L.

    1976-01-01

    A semiclassical collision model is applied to the study of energy transfer rates between a vibrationally excited diatomic molecule and a structureless atom. The molecule is modeled as an anharmonic oscillator with a multitude of dynamically coupled vibrational states. Three main aspects in the prediction of vibrational energy transfer rates are considered. The applicability of the semiclassical model to an anharmonic oscillator is first evaluated for collinear encounters. Second, the collinear semiclassical model is applied to obtain numerical predictions of the vibrational energy transfer rate dependence on the initial vibrational state quantum number. Thermally averaged vibration-translation rate coefficients are predicted and compared with CO-He experimental values for both ground and excited initial states. The numerical model is also used as a basis for evaluating several less complete but analytic models. Third, the role of rational motion in the dynamics of vibrational energy transfer is examined. A three-dimensional semiclassical collision model is constructed with coupled rotational motion included. Energy transfer within the molecule is shown to be dominated by vibration-rotation transitions with small changes in angular momentum. The rates of vibrational energy transfer in molecules with rational frequencies that are very small in comparison to their vibrational frequency are shown to be adequately treated by the preceding collinear models.

  12. Numerical modeling of heat and mass transfer in the human eye under millimeter wave exposure.

    PubMed

    Karampatzakis, Andreas; Samaras, Theodoros

    2013-05-01

    Human exposure to millimeter wave (MMW) radiation is expected to increase in the next several years. In this work, we present a thermal model of the human eye under MMW illumination. The model takes into account the fluid dynamics of the aqueous humor and predicts a frequency-dependent reversal of its flow that also depends on the incident power density. The calculated maximum fluid velocity in the anterior chamber and the temperature rise at the corneal apex are reported for frequencies from 40 to 100 GHz and different values of incident power density. Copyright © 2013 Wiley Periodicals, Inc.

  13. An analytic formula for H-infinity norm sensitivity with applications to control system design

    NASA Technical Reports Server (NTRS)

    Giesy, Daniel P.; Lim, Kyong B.

    1992-01-01

    An analytic formula for the sensitivity of singular value peak variation with respect to parameter variation is derived. As a corollary, the derivative of the H-infinity norm of a stable transfer function with respect to a parameter is presented. It depends on some of the first two derivatives of the transfer function with respect to frequency and the parameter. For cases when the transfer function has a linear system realization whose matrices depend on the parameter, analytic formulas for these first two derivatives are derived, and an efficient algorithm for calculating them is discussed. Examples are given which provide numerical verification of the H-infinity norm sensitivity formula and which demonstrate its utility in designing control systems satisfying H-infinity norm constraints. In the appendix, derivative formulas for singular values are paraphrased.

  14. Very high frequency spectroscopy and tuning of a single-cooper-pair transistor with an on-chip generator.

    PubMed

    Billangeon, P-M; Pierre, F; Bouchiat, H; Deblock, R

    2007-03-23

    A single-Cooper-pair transistor (SCPT) is coupled capacitively to a voltage biased Josephson junction, used as a high-frequency generator. Thanks to the high energy of photons generated by the Josephson junction, transitions between energy levels, not limited to the first two levels, were induced and the effect of this irradiation on the dc Josephson current of the SCPT was measured. The phase and gate bias dependence of energy levels of the SCPT at high energy is probed. Because the energies of photons can be higher than the superconducting gap we can induce not only transfer of Cooper pairs but also transfer of quasiparticles through the island of the SCPT, thus controlling the poisoning of the SCPT. This can both decrease and increase the average Josephson energy of the SCPT: its supercurrent is then controlled by high-frequency irradiation.

  15. Controlled exciton transfer between quantum dots with acoustic phonons taken into account

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Golovinski, P. A., E-mail: golovinski@bk.ru

    2015-09-15

    A system of excitons in two quantum dots coupled by the dipole–dipole interaction is investigated. The excitation transfer process controlled by the optical Stark effect at nonresonant frequencies is considered and the effect of the interaction between excitons and acoustic phonons in a medium on this process is taken into account. The system evolution is described using quantum Heisenberg equations. A truncated set of equations is obtained and the transfer dynamics is numerically simulated. High-efficiency picosecond switching of the excitation transfer by a laser pulse with a rectangular envelope is demonstrated. The dependence of picosecond switching on the quantum-dot parametersmore » and optical-pulse length is presented.« less

  16. Carrier-envelope phase effects for a dipolar molecule interacting with two-color pump-probe laser pulses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng Taiwang; Brown, Alex

    2004-12-01

    The interaction of a two-level dipolar molecule with two laser pulses, where one laser's frequency is tuned to the energy level separation (pump laser) while the second laser's frequency is extremely small (probe laser), is investigated. A dipolar molecule is one with a nonzero difference between the permanent dipole moments of the molecular states. As shown previously [A. Brown, Phys. Rev. A 66, 053404 (2002)], the final population transfer between the two levels exhibits a dependence on the carrier-envelope phase of the probe laser. Based on the rotating-wave approximation (RWA), an effective Hamiltonian is derived to account for the basicmore » characteristics of the carrier-envelope phase dependence effect. By analysis of the effective Hamiltonian, scaling properties of the system are found with regard to field strengths, pulse durations, and frequencies. According to these scaling properties, the final-state population transfer can be controlled by varying the carrier-envelope phase of the probe laser field using lasers with weak field strengths (low intensities) and relatively long pulse durations. In order to examine the possible roles of background states, the investigation is extended to a three-level model. It is demonstrated that the carrier-envelope phase effect still persists in a well-defined manner even when neighboring energy levels are present. These results illustrate the potential of utilizing excitation in dipolar molecules as a means of measuring the carrier-envelope phase of a laser pulse or if one can manipulate the carrier envelope phase, as a method of controlling population transfer in dipolar molecules. The results also suggest that the carrier-envelope phases must be taken into account properly when performing calculations involving pump-probe excitation schemes with laser frequencies which differ widely in magnitude.« less

  17. Linearized blade row compression component model. Stability and frequency response analysis of a J85-3 compressor

    NASA Technical Reports Server (NTRS)

    Tesch, W. A.; Moszee, R. H.; Steenken, W. G.

    1976-01-01

    NASA developed stability and frequency response analysis techniques were applied to a dynamic blade row compression component stability model to provide a more economic approach to surge line and frequency response determination than that provided by time-dependent methods. This blade row model was linearized and the Jacobian matrix was formed. The clean-inlet-flow stability characteristics of the compressors of two J85-13 engines were predicted by applying the alternate Routh-Hurwitz stability criterion to the Jacobian matrix. The predicted surge line agreed with the clean-inlet-flow surge line predicted by the time-dependent method to a high degree except for one engine at 94% corrected speed. No satisfactory explanation of this discrepancy was found. The frequency response of the linearized system was determined by evaluating its Laplace transfer function. The results of the linearized-frequency-response analysis agree with the time-dependent results when the time-dependent inlet total-pressure and exit-flow function amplitude boundary conditions are less than 1 percent and 3 percent, respectively. The stability analysis technique was extended to a two-sector parallel compressor model with and without interstage crossflow and predictions were carried out for total-pressure distortion extents of 180 deg, 90 deg, 60 deg, and 30 deg.

  18. Interocular transfer of spatial adaptation is weak at low spatial frequencies.

    PubMed

    Baker, Daniel H; Meese, Tim S

    2012-06-15

    Adapting one eye to a high contrast grating reduces sensitivity to similar target gratings shown to the same eye, and also to those shown to the opposite eye. According to the textbook account, interocular transfer (IOT) of adaptation is around 60% of the within-eye effect. However, most previous studies on this were limited to using high spatial frequencies, sustained presentation, and criterion-dependent methods for assessing threshold. Here, we measure IOT across a wide range of spatiotemporal frequencies, using a criterion-free 2AFC method. We find little or no IOT at low spatial frequencies, consistent with other recent observations. At higher spatial frequencies, IOT was present, but weaker than previously reported (around 35%, on average, at 8c/deg). Across all conditions, monocular adaptation raised thresholds by around a factor of 2, and observers showed normal binocular summation, demonstrating that they were not binocularly compromised. These findings prompt a reassessment of our understanding of the binocular architecture implied by interocular adaptation. In particular, the output of monocular channels may be available to perceptual decision making at low spatial frequencies. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Superresolution imaging reveals activity-dependent plasticity of axon morphology linked to changes in action potential conduction velocity.

    PubMed

    Chéreau, Ronan; Saraceno, G Ezequiel; Angibaud, Julie; Cattaert, Daniel; Nägerl, U Valentin

    2017-02-07

    Axons convey information to nearby and distant cells, and the time it takes for action potentials (APs) to reach their targets governs the timing of information transfer in neural circuits. In the unmyelinated axons of hippocampus, the conduction speed of APs depends crucially on axon diameters, which vary widely. However, it is not known whether axon diameters are dynamic and regulated by activity-dependent mechanisms. Using time-lapse superresolution microscopy in brain slices, we report that axons grow wider after high-frequency AP firing: synaptic boutons undergo a rapid enlargement, which is mostly transient, whereas axon shafts show a more delayed and progressive increase in diameter. Simulations of AP propagation incorporating these morphological dynamics predicted bidirectional effects on AP conduction speed. The predictions were confirmed by electrophysiological experiments, revealing a phase of slowed down AP conduction, which is linked to the transient enlargement of the synaptic boutons, followed by a sustained increase in conduction speed that accompanies the axon shaft widening induced by high-frequency AP firing. Taken together, our study outlines a morphological plasticity mechanism for dynamically fine-tuning AP conduction velocity, which potentially has wide implications for the temporal transfer of information in the brain.

  20. Quantum state transfer in double-quantum-well devices

    NASA Technical Reports Server (NTRS)

    Jakumeit, Jurgen; Tutt, Marcel; Pavlidis, Dimitris

    1994-01-01

    A Monte Carlo simulation of double-quantum-well (DQW) devices is presented in view of analyzing the quantum state transfer (QST) effect. Different structures, based on the AlGaAs/GaAs system, were simulated at 77 and 300 K and optimized in terms of electron transfer and device speed. The analysis revealed the dominant role of the impurity scattering for the QST. Different approaches were used for the optimization of QST devices and basic physical limitations were found in the electron transfer between the QWs. The maximum transfer of electrons from a high to a low mobility well was at best 20%. Negative differential resistance is hampered by the almost linear rather than threshold dependent relation of electron transfer on electric field. By optimizing the doping profile the operation frequency limit could be extended to 260 GHz.

  1. Study of Anti-Vortex Baffle Effect in Suppressing Swirling Flow in LOX Tank

    NASA Technical Reports Server (NTRS)

    Yang, H. Q.; Peugeot, John

    2011-01-01

    Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

  2. Electrical properties of dispersions of graphene in mineral oil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Monteiro, O. R., E-mail: othon.monteiro@bakerhughes.com

    2014-02-03

    Dispersions of graphene in mineral oil have been prepared and electrical conductivity and permittivity have been measured. The direct current (DC) conductivity of the dispersions depends on the surface characteristics of the graphene platelets and followed a percolation model with a percolation threshold ranging from 0.05 to 0.1 wt. %. The difference in DC conductivities can be attributed to different states of aggregation of the graphene platelets and to the inter-particle electron transfer, which is affected by the surface radicals. The frequency-dependent conductivity (σ(ω)) and permittivity (ε(ω)) were also measured. The conductivity of dispersions with particle contents much greater than themore » percolation threshold remains constant and equal to the DC conductivity at low frequencies ω with and followed a power-law σ(ω)∝ ω{sup s} dependence at very high frequencies with s≈0.9. For dispersions with graphene concentration near the percolation threshold, a third regime was displayed at intermediate frequencies indicative of interfacial polarization consistent with Maxwell-Wagner effect typically observed in mixtures of two (or more) phases with very distinct electrical and dielectric properties.« less

  3. Radiative acceleration in Schwarzschild space-times

    NASA Astrophysics Data System (ADS)

    Keane, A. J.; Barrett, R. K.; Simmons, J. F. L.

    2001-03-01

    We examine the radial motion of a material particle in the intense radiation field of a static spherically symmetric compact object with spherical emitting surface outside the Schwarzschild radius. This paper generalizes previous work which dealt with radial motion in the Thomson limit, where the radiation force is simply proportional to the radiative flux. In the general case the average time component of the 4-momentum transferred to the particle is not negligible compared with its rest mass. Consequently, we find that the frequency dependence of the radiation force owing to Compton scattering for highly energetic photons gives rise to an increase in the effective mass of the test particle. In this work we outline the effects of this frequency dependence and compare these with the results in the Thomson limit. We present the frequency dependent saturation velocity curves for a range of stellar luminosities and radiation frequencies and present the resulting phase-space diagrams corresponding to the radial test particle trajectories. In particular, the stable equilibrium points which exist in the Thomson limit are found to be absent in the general case.

  4. Novel recA-Independent Horizontal Gene Transfer in Escherichia coli K-12.

    PubMed

    Kingston, Anthony W; Roussel-Rossin, Chloé; Dupont, Claire; Raleigh, Elisabeth A

    2015-01-01

    In bacteria, mechanisms that incorporate DNA into a genome without strand-transfer proteins such as RecA play a major role in generating novelty by horizontal gene transfer. We describe a new illegitimate recombination event in Escherichia coli K-12: RecA-independent homologous replacements, with very large (megabase-length) donor patches replacing recipient DNA. A previously uncharacterized gene (yjiP) increases the frequency of RecA-independent replacement recombination. To show this, we used conjugal DNA transfer, combining a classical conjugation donor, HfrH, with modern genome engineering methods and whole genome sequencing analysis to enable interrogation of genetic dependence of integration mechanisms and characterization of recombination products. As in classical experiments, genomic DNA transfer begins at a unique position in the donor, entering the recipient via conjugation; antibiotic resistance markers are then used to select recombinant progeny. Different configurations of this system were used to compare known mechanisms for stable DNA incorporation, including homologous recombination, F'-plasmid formation, and genome duplication. A genome island of interest known as the immigration control region was specifically replaced in a minority of recombinants, at a frequency of 3 X 10(-12) CFU/recipient per hour.

  5. Experimental Waterflow Determination of the Dynamic Hydraulic Transfer Function for the J-2X Oxidizer Turbopump. Part Two; Results and Interpretation

    NASA Technical Reports Server (NTRS)

    Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave

    2011-01-01

    Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

  6. Effects of fullerene coalescence on the thermal conductivity of carbon nanopeapods

    NASA Astrophysics Data System (ADS)

    Li, Jiaqian; Shen, Haijun

    2018-05-01

    The heat conduction and its dependence on fullerene coalescence in carbon nanopeapods (CNPs) have been investigated by equilibrium molecular dynamics simulations. The effects of fullerene coalescence on the thermal conductivity of CNPs were discussed under different temperatures. It is shown that the thermal conductivity of the CNPs decreases with the coalescence of encapsulated fullerene molecules. The thermal transmission mechanism of the effect of fullerene coalescence was analysed by the mass transfer contribution, the relative contributions of phonon oscillation frequencies to total heat current and the phonon vibrational density of states (VDOS). The mass transfer in CNPs is mainly attributed to the motion of encapsulated fullerene molecule and it gets more restricted with the coalescence of the fullerene. It shows that the low-frequency phonon modes below 20 THz contribute mostly to thermal conductivity in CNPs. The analysis of VDOS demonstrates that the dominating contribution to heat transfer is from the inner fullerene chain. With the coalescence of fullerene, the interfacial heat transfer between the CNT and fullerene chain is strengthened; however, the heat conduction of the fullerene chain decreases more rapidly at the same time.

  7. Characterization and Comparison of Vibration Transfer Paths in a Helicopter Gearbox and a Fixture Mounted Gearbox

    NASA Technical Reports Server (NTRS)

    Islam, Akm Anwarul; Dempsey, Paula J.; Feldman, Jason; Larsen, Chris

    2014-01-01

    Health monitoring of rotorcraft components, currently being performed by Health and Usage Monitoring Systems through analyses of vibration signatures of dynamic mechanical components, is very important for their safe and economic operation. HUMS analyze vibration signatures associated with faults and quantify them as condition indicators to predict component behavior. Vibration transfer paths are characterized by frequency response functions derived from the input/output relationship between applied force and dynamic response through a structure as a function of frequency. With an objective to investigate the differences in transfer paths, transfer path measurements were recorded under similar conditions in the left and right nose gearboxes of an AH-64 helicopter and in an isolated left nose gearbox in a test fixture at NASA Glenn Research Center. The test fixture enabled the application of measured torques-common during an actual operation. An impact hammer as well as commercial and lab piezo shakers, were used in conjunction with two types of commercially available accelerometers to collect the vibration response under various test conditions. The frequency response functions measured under comparable conditions of both systems were found to be consistent. Measurements made on the fixture indicated certain real-world installation and maintenance issues, such as sensor alignments, accelerometer locations and installation torques, had minimal effect. However, gear vibration transfer path dynamics appeared to be somewhat dependent on the presence of oil, and the transfer path dynamics were notably different if the force input was on the internal ring gear rather than on the external gearbox case.

  8. Modulation transfer function cascade model for a sampled IR imaging system.

    PubMed

    de Luca, L; Cardone, G

    1991-05-01

    The performance of the infrared scanning radiometer (IRSR) is strongly stressed in convective heat transfer applications where high spatial frequencies in the signal that describes the thermal image are present. The need to characterize more deeply the system spatial resolution has led to the formulation of a cascade model for the evaluation of the actual modulation transfer function of a sampled IR imaging system. The model can yield both the aliasing band and the averaged modulation response for a general sampling subsystem. For a line scan imaging system, which is the case of a typical IRSR, a rule of thumb that states whether the combined sampling-imaging system is either imaging-dependent or sampling-dependent is proposed. The model is tested by comparing it with other noncascade models as well as by ad hoc measurements performed on a commercial digitized IRSR.

  9. Radiative energy transfer from MoS2 excitons to surface plasmons

    NASA Astrophysics Data System (ADS)

    Kang, Yimin; Li, Bowen; Fang, Zheyu

    2017-12-01

    In this work, we demonstrated the energy transfer process from few-layer MoS2 to gold dimer arrays via ultrafast pump-probe spectroscopy. With the overlap between the MoS2 exciton and the designed plasmon dipolar modes in the frequency domain, the exciton energy can be radiatively transferred to plasmonic structures, excited the localized surface plasmon resonance, and then enhanced the oscillation of coherent acoustic phonons. Power-dependent differential reflection signals and an analytical model based on the rate equation of exciton density were carried out to quantitatively study the energy transfer process. Our finding explores the energy flow between MoS2 excitons and surface plasmons, and can be contributed to the design of exciton-plasmon structures utilizing ultrathin materials.

  10. Nonadiabatic effect on the quantum heat flux control.

    PubMed

    Uchiyama, Chikako

    2014-05-01

    We provide a general formula of quantum transfer that includes the nonadiabatic effect under periodic environmental modulation by using full counting statistics in Hilbert-Schmidt space. Applying the formula to an anharmonic junction model that interacts with two bosonic environments within the Markovian approximation, we find that the quantum transfer is divided into the adiabatic (dynamical and geometrical phases) and nonadiabatic contributions. This extension shows the dependence of quantum transfer on the initial condition of the anharmonic junction just before the modulation, as well as the characteristic environmental parameters such as interaction strength and cut-off frequency of spectral density. We show that the nonadiabatic contribution represents the reminiscent effect of past modulation including the transition from the initial condition of the anharmonic junction to a steady state determined by the very beginning of the modulation. This enables us to tune the frequency range of modulation, whereby we can obtain the quantum flux corresponding to the geometrical phase by setting the initial condition of the anharmonic junction.

  11. Brain state-dependent recruitment of high-frequency oscillations in the human hippocampus.

    PubMed

    Billeke, Pablo; Ossandon, Tomas; Stockle, Marcelo; Perrone-Bertolotti, Marcela; Kahane, Philippe; Lachaux, Jean-Philippe; Fuentealba, Pablo

    2017-09-01

    Ripples are high-frequency bouts of coordinated hippocampal activity believed to be crucial for information transfer and memory formation. We used intracortical macroelectrodes to record neural activity in the human hippocampus of awake subjects undergoing surgical treatment for refractory epilepsy and distinguished two populations of ripple episodes based on their frequency spectrum. The phase-coupling of one population, slow ripples (90-110 Hz), to cortical delta oscillations was differentially modulated by cognitive task; whereas the second population, fast ripples (130-170 Hz), was not seemingly correlated to local neural activity. Furthermore, as cognitive tasks changed, the ongoing coordination of neural activity associated to slow ripples progressively augmented along the parahippocampal axis. Thus, during resting states, slow ripples were coordinated in restricted hippocampal territories; whereas during active states, such as attentionally-demanding tasks, high frequency activity emerged across the hippocampus and parahippocampal cortex, that was synchronized with slow ripples, consistent with ripples supporting information transfer and coupling anatomically distant regions. Hence, our results provide further evidence of neural diversity in hippocampal high-frequency oscillations and their association to cognitive processing in humans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Transfer and dissipation of energy during wave group propagation on a gentle beach slope

    NASA Astrophysics Data System (ADS)

    Padilla, Enrique M.; Alsina, José M.

    2017-08-01

    The propagation of bichromatic wave groups over a constant 1:100 beach slope and the influence of the group modulation is presented. The modulation is controlled by varying the group frequency, fg, which is shown to remarkably affect the energy transfer to high and low frequency components. The growth of the high frequency (hf) wave skewness increases when fg decreases. This is explained by nonlinear coupling between the primary frequencies, which results in a larger growth of hf components as fg decreases, causing the hf waves to break earlier. Due to high spatial resolution, wave tracking has provided an accurate measurement of the varying breakpoint. These breaking locations are very well described (R2>0.91) by the wave-height to effective-depth ratio (γ). However, for any given Iribarren number, this γ is shown to increase with fg. Therefore, a modified Iribarren number is proposed to include the grouping structure, leading to a considerable improvement in reproducing the measured γ-values. Within the surf zone, the behavior of the Incident Long Wave also depends on the group modulation. For low fg conditions, the lf wave decays only slightly by transferring energy back to the hf wave components. However, for high fg wave conditions, strong dissipation of low frequency (lf) components occurs close to the shoreline associated with lf wave breaking. This mechanism is explained by the growth of the lf wave height, induced partly by the self-self interaction of fg, and partly by the nonlinear coupling between the primary frequencies and fg.

  13. Linearized unsteady jet analysis

    NASA Technical Reports Server (NTRS)

    Viets, H.; Piatt, M.

    1979-01-01

    The introduction of a time dependency into a jet flow to change the rate at which it mixes with a coflowing stream or ambient condition is investigated. The advantages and disadvantages of the unsteady flow are discussed in terms of steady state mass and momentum transfer. A linear system which is not limited by frequency constraints and evolves through a simplification of the equations of motion is presented for the analysis of the unsteady flow field generated by the time dependent jet.

  14. The effect of disorder on the wave propagation in one-dimensional periodic optical systems

    NASA Astrophysics Data System (ADS)

    Godin, Yuri A.; Molchanov, Stanislav; Vainberg, Boris

    2011-02-01

    The influence of disorder on the transmission through periodic waveguides is studied. Using a canonical form of the transfer matrix, we investigate the dependence of the Lyapunov exponent γ on the frequency ν and magnitude of the disorder σ. It is shown that in the bulk of the bands γ ∼ σ2, while near the band edges it has order γ ∼ σ2/3. This dependence is illustrated by numerical simulations.

  15. A single residue controls electron transfer gating in photosynthetic reaction centers

    NASA Astrophysics Data System (ADS)

    Shlyk, Oksana; Samish, Ilan; Matěnová, Martina; Dulebo, Alexander; Poláková, Helena; Kaftan, David; Scherz, Avigdor

    2017-03-01

    Interquinone QA- → QB electron-transfer (ET) in isolated photosystem II reaction centers (PSII-RC) is protein-gated. The temperature-dependent gating frequency “k” is described by the Eyring equation till levelling off at T ≥ 240 °K. Although central to photosynthesis, the gating mechanism has not been resolved and due to experimental limitations, could not be explored in vivo. Here we mimic the temperature dependency of “k” by enlarging VD1-208, the volume of a single residue at the crossing point of the D1 and D2 PSII-RC subunits in Synechocystis 6803 whole cells. By controlling the interactions of the D1/D2 subunits, VD1-208 (or 1/T) determines the frequency of attaining an ET-active conformation. Decelerated ET, impaired photosynthesis, D1 repair rate and overall cell physiology upon increasing VD1-208 to above 130 Å3, rationalize the >99% conservation of small residues at D1-208 and its homologous motif in non-oxygenic bacteria. The experimental means and resolved mechanism are relevant for numerous transmembrane protein-gated reactions.

  16. Modeling multi-layer effects in passive microwave remote sensing of dry snow using Dense Media Radiative Transfer Theory (DMRT) based on quasicrystalline approximation

    USGS Publications Warehouse

    Liang, D.; Xu, X.; Tsang, L.; Andreadis, K.M.; Josberger, E.G.

    2008-01-01

    The Dense Media Radiative Transfer theory (DMRT) of Quasicrystalline Approximation of Mie scattering by sticky particles is used to study the multiple scattering effects in layered snow in microwave remote sensing. Results are illustrated for various snow profile characteristics. Polarization differences and frequency dependences of multilayer snow model are significantly different from that of the single-layer snow model. Comparisons are also made with CLPX data using snow parameters as given by the VIC model. ?? 2007 IEEE.

  17. Transfer matrix modeling and experimental validation of cellular porous material with resonant inclusions.

    PubMed

    Doutres, Olivier; Atalla, Noureddine; Osman, Haisam

    2015-06-01

    Porous materials are widely used for improving sound absorption and sound transmission loss of vibrating structures. However, their efficiency is limited to medium and high frequencies of sound. A solution for improving their low frequency behavior while keeping an acceptable thickness is to embed resonant structures such as Helmholtz resonators (HRs). This work investigates the absorption and transmission acoustic performances of a cellular porous material with a two-dimensional periodic arrangement of HR inclusions. A low frequency model of a resonant periodic unit cell based on the parallel transfer matrix method is presented. The model is validated by comparison with impedance tube measurements and simulations based on both the finite element method and a homogenization based model. At the HR resonance frequency (i) the transmission loss is greatly improved and (ii) the sound absorption of the foam can be either decreased or improved depending on the HR tuning frequency and on the thickness and properties of the host foam. Finally, the diffuse field sound absorption and diffuse field sound transmission loss performance of a 2.6 m(2) resonant cellular material are measured. It is shown that the improvements observed at the Helmholtz resonant frequency on a single cell are confirmed at a larger scale.

  18. A Role of Phase-Resetting in Coordinating Large Scale Neural Networks During Attention and Goal-Directed Behavior

    PubMed Central

    Voloh, Benjamin; Womelsdorf, Thilo

    2016-01-01

    Short periods of oscillatory activation are ubiquitous signatures of neural circuits. A broad range of studies documents not only their circuit origins, but also a fundamental role for oscillatory activity in coordinating information transfer during goal directed behavior. Recent studies suggest that resetting the phase of ongoing oscillatory activity to endogenous or exogenous cues facilitates coordinated information transfer within circuits and between distributed brain areas. Here, we review evidence that pinpoints phase resetting as a critical marker of dynamic state changes of functional networks. Phase resets: (1) set a “neural context” in terms of narrow band frequencies that uniquely characterizes the activated circuits; (2) impose coherent low frequency phases to which high frequency activations can synchronize, identifiable as cross-frequency correlations across large anatomical distances; (3) are critical for neural coding models that depend on phase, increasing the informational content of neural representations; and (4) likely originate from the dynamics of canonical E-I circuits that are anatomically ubiquitous. These multiple signatures of phase resets are directly linked to enhanced information transfer and behavioral success. We survey how phase resets re-organize oscillations in diverse task contexts, including sensory perception, attentional stimulus selection, cross-modal integration, Pavlovian conditioning, and spatial navigation. The evidence we consider suggests that phase-resets can drive changes in neural excitability, ensemble organization, functional networks, and ultimately, overt behavior. PMID:27013986

  19. Reducing Interprocessor Dependence in Recoverable Distributed Shared Memory

    NASA Technical Reports Server (NTRS)

    Janssens, Bob; Fuchs, W. Kent

    1994-01-01

    Checkpointing techniques in parallel systems use dependency tracking and/or message logging to ensure that a system rolls back to a consistent state. Traditional dependency tracking in distributed shared memory (DSM) systems is expensive because of high communication frequency. In this paper we show that, if designed correctly, a DSM system only needs to consider dependencies due to the transfer of blocks of data, resulting in reduced dependency tracking overhead and reduced potential for rollback propagation. We develop an ownership timestamp scheme to tolerate the loss of block state information and develop a passive server model of execution where interactions between processors are considered atomic. With our scheme, dependencies are significantly reduced compared to the traditional message-passing model.

  20. The role of quantum effects in proton transfer reactions in enzymes: quantum tunneling in a noisy environment?

    NASA Astrophysics Data System (ADS)

    Bothma, Jacques P.; Gilmore, Joel B.; McKenzie, Ross H.

    2010-05-01

    We consider the role of quantum effects in the transfer of hydrogen-like species in enzyme-catalyzed reactions. This review is stimulated by claims that the observed magnitude and temperature dependence of kinetic isotope effects (KIEs) implies that quantum tunneling below the energy barrier associated with the transition state significantly enhances the reaction rate in many enzymes. We review the path integral approach and the Caldeira-Leggett model, which provides a general framework to describe and understand tunneling in a quantum system that interacts with a noisy environment at nonzero temperature. Here the quantum system is the active site of the enzyme, and the environment is the surrounding protein and water. Tunneling well below the barrier only occurs for temperatures less than a temperature T0, which is determined by the curvature of the potential energy surface near the top of the barrier. We argue that for most enzymes this temperature is less than room temperature. We review typical values for the parameters in the Caldeira-Leggett Hamiltonian, including the frequency-dependent friction and noise due to the environment. For physically reasonable parameters, we show that quantum transition state theory gives a quantitative description of the temperature dependence and magnitude of KIEs for two classes of enzymes that have been claimed to exhibit signatures of quantum tunneling. The only quantum effects are those associated with the transition state, both reflection at the barrier top and tunneling just below the barrier. We establish that the friction and noise due to the environment are weak and only slightly modify the reaction rate. Furthermore, at room temperature and for typical energy barriers environmental fluctuations with frequencies much less than 1000 cm-1 do not have a significant effect on quantum corrections to the reaction rate. This is essentially because the time scales associated with the dynamics of proton transfer are faster than much of the low-frequency noise associated with the protein and solvent.

  1. Temperature-dependence of stress and elasticity in wet-transferred graphene membranes

    NASA Astrophysics Data System (ADS)

    De Alba, Roberto; Abhilash, T. S.; Hui, Aaron; Storch, Isaac R.; Craighead, Harold G.; Parpia, Jeevak M.

    2018-03-01

    We report measurements of the mechanical properties of two suspended graphene membranes in the temperature range of 80 K to 550 K. For this entire range, the resonant frequency and quality factor of each device were monitored continuously during cooling and heating. Below 300 K, we have additionally measured the resonant frequency's tunability via electrostatic force, and modeled this data to determine graphene's tension and elastic modulus; both of these parameters are found to be strongly temperature-dependent in this range. Above 300 K, we observe a resonant frequency (and therefore tension) minimum near room temperature. This suggests that the thermal expansion coefficient is positive for temperatures below roughly 315 K, and negative for higher temperatures. Lastly, we observe a large, reproducible hysteresis in the resonant frequency as our graphene devices are cycled between 300 K and 550 K. After returning to 300 K, the measured frequency evolves exponentially in time with a time constant of ˜24 h. Our results clash with expectations for pristine graphene membranes, but are consistent with expectations for composite membranes composed of graphene coated by a thin layer of polymer residue.

  2. Linear quadratic stochastic control of atomic hydrogen masers.

    PubMed

    Koppang, P; Leland, R

    1999-01-01

    Data are given showing the results of using the linear quadratic Gaussian (LQG) technique to steer remote hydrogen masers to Coordinated Universal Time (UTC) as given by the United States Naval Observatory (USNO) via two-way satellite time transfer and the Global Positioning System (GPS). Data also are shown from the results of steering a hydrogen maser to the real-time USNO mean. A general overview of the theory behind the LQG technique also is given. The LQG control is a technique that uses Kalman filtering to estimate time and frequency errors used as input into a control calculation. A discrete frequency steer is calculated by minimizing a quadratic cost function that is dependent on both the time and frequency errors and the control effort. Different penalties, chosen by the designer, are assessed by the controller as the time and frequency errors and control effort vary from zero. With this feature, controllers can be designed to force the time and frequency differences between two standards to zero, either more or less aggressively depending on the application.

  3. Spin dynamics and frequency dependence of magnetic damping study in soft ferromagnetic FeTaC film with a stripe domain structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samantaray, B., E-mail: iitg.biswanath@gmail.com; Ranganathan, R.; Mandal, P.

    Perpendicular magnetic anisotropy (PMA) and low magnetic damping are the key factors for the free layer magnetization switching by spin transfer torque technique in magnetic tunnel junction devices. The magnetization precessional dynamics in soft ferromagnetic FeTaC thin film with a stripe domain structure was explored in broad band frequency range by employing micro-strip ferromagnetic resonance technique. The polar angle variation of resonance field and linewidth at different frequencies have been analyzed numerically using Landau-Lifshitz-Gilbert equation by taking into account the total free energy density of the film. The numerically estimated parameters Landé g-factor, PMA constant, and effective magnetization are foundmore » to be 2.1, 2 × 10{sup 5} erg/cm{sup 3} and 7145 Oe, respectively. The frequency dependence of Gilbert damping parameter (α) is evaluated by considering both intrinsic and extrinsic effects into the total linewidth analysis. The value of α is found to be 0.006 at 10 GHz and it increases monotonically with decreasing precessional frequency.« less

  4. Wettability Investigations and Wet Transfer Enhancement of Large-Area CVD-Graphene on Aluminum Nitride

    PubMed Central

    Knapp, Marius; Hoffmann, René; Cimalla, Volker; Ambacher, Oliver

    2017-01-01

    The two-dimensional and virtually massless character of graphene attracts great interest for radio frequency devices, such as surface and bulk acoustic wave resonators. Due to its good electric conductivity, graphene might be an alternative as a virtually massless electrode by improving resonator performance regarding mass-loading effects. We report on an optimization of the commonly used wet transfer technique for large-area graphene, grown via chemical vapor deposition, onto aluminum nitride (AlN), which is mainly used as an active, piezoelectric material for acoustic devices. Today, graphene wet transfer is well-engineered for silicon dioxide (SiO2). Investigations on AlN substrates reveal highly different surface properties compared to SiO2 regarding wettability, which strongly influences the quality of transferred graphene monolayers. Both physical and chemical effects of a plasma treatment of AlN surfaces change wettability and avoid large-scale cracks in the transferred graphene sheet during desiccation. Spatially-resolved Raman spectroscopy reveals a strong strain and doping dependence on AlN plasma pretreatments correlating with the electrical conductivity of graphene. In our work, we achieved transferred crack-free large-area (40 × 40 mm2) graphene monolayers with sheet resistances down to 350 Ω/sq. These achievements make graphene more powerful as an eco-friendly and cheaper replacement for conventional electrode materials used in radio frequency resonator devices. PMID:28820462

  5. TIME-DEPENDENT MULTI-GROUP MULTI-DIMENSIONAL RELATIVISTIC RADIATIVE TRANSFER CODE BASED ON SPHERICAL HARMONIC DISCRETE ORDINATE METHOD

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tominaga, Nozomu; Shibata, Sanshiro; Blinnikov, Sergei I., E-mail: tominaga@konan-u.ac.jp, E-mail: sshibata@post.kek.jp, E-mail: Sergei.Blinnikov@itep.ru

    We develop a time-dependent, multi-group, multi-dimensional relativistic radiative transfer code, which is required to numerically investigate radiation from relativistic fluids that are involved in, e.g., gamma-ray bursts and active galactic nuclei. The code is based on the spherical harmonic discrete ordinate method (SHDOM) which evaluates a source function including anisotropic scattering in spherical harmonics and implicitly solves the static radiative transfer equation with ray tracing in discrete ordinates. We implement treatments of time dependence, multi-frequency bins, Lorentz transformation, and elastic Thomson and inelastic Compton scattering to the publicly available SHDOM code. Our code adopts a mixed-frame approach; the source functionmore » is evaluated in the comoving frame, whereas the radiative transfer equation is solved in the laboratory frame. This implementation is validated using various test problems and comparisons with the results from a relativistic Monte Carlo code. These validations confirm that the code correctly calculates the intensity and its evolution in the computational domain. The code enables us to obtain an Eddington tensor that relates the first and third moments of intensity (energy density and radiation pressure) and is frequently used as a closure relation in radiation hydrodynamics calculations.« less

  6. Chirped frequency transfer: a tool for synchronization and time transfer.

    PubMed

    Raupach, Sebastian M F; Grosche, Gesine

    2014-06-01

    We propose and demonstrate the phase-stabilized transfer of a chirped frequency as a tool for synchronization and time transfer. Technically, this is done by evaluating remote measurements of the transferred, chirped frequency. The gates of the frequency counters, here driven by a 10-MHz oscillation derived from a hydrogen maser, play a role analogous to the 1-pulse per second (PPS) signals usually employed for time transfer. In general, for time transfer, the gates consequently must be related to the external clock. Synchronizing observations based on frequency measurements, on the other hand, only requires a stable oscillator driving the frequency counters. In a proof of principle, we demonstrate the suppression of symmetrical delays, such as the geometrical path delay. We transfer an optical frequency chirped by around 240 kHz/s over a fiber link of around 149 km. We observe an accuracy and simultaneity, as well as a precision (Allan deviation, 18,000 s averaging interval) of the transferred frequency of around 2 × 10(-19). We apply chirped frequency transfer to remote measurements of the synchronization between two counters' gate intervals. Here, we find a precision of around 200 ps at an estimated overall uncertainty of around 500 ps. The measurement results agree with those obtained from reference measurements, being well within the uncertainty. In the present setup, timing offsets up to 4 min can be measured unambiguously. We indicate how this range can be extended further.

  7. High-resolution spectroscopy of jet-cooled CH5+: Progress

    NASA Astrophysics Data System (ADS)

    Savage, C.; Dong, F.; Nesbitt, D. J.

    2015-01-01

    Protonated methane (CH5+) is thought to be a highly abundant molecular ion in interstellar medium, as well as a potentially bright μwave- mm wave emitter that could serve as a tracer for methane. This paper describes progress and first successful efforts to obtain a high resolution, supersonically cooled spectrum of CH5+ in the 2900-3100 cm-1 region, formed in a slit supersonic discharge at low jet temperatures and with sub-Doppler resolution. Short term precision in frequency measurement (< 5 MHz on an hour time scale) is obtained from a thermally controlled optical transfer cavity servoloop locked onto a frequency stabilized HeNe laser. Long term precision (< 20 MHz day-to-day) due to pressure, temperature and humidity dependent index of refraction effects in the optical transfer cavity is also present and discussed.

  8. Electron Tunneling in Lithium Ammonia Solutions Probed by Frequency-Dependent Electron-Spin Relaxation Studies

    PubMed Central

    Maeda, Kiminori; Lodge, Matthew T.J.; Harmer, Jeffrey; Freed, Jack H.; Edwards, Peter P.

    2012-01-01

    Electron transfer or quantum tunneling dynamics for excess or solvated electrons in dilute lithium-ammonia solutions have been studied by pulse electron paramagnetic resonance (EPR) spectroscopy at both X- (9.7 GHz) and W-band (94 GHz) frequencies. The electron spin-lattice (T1) and spin-spin (T2) relaxation data indicate an extremely fast transfer or quantum tunneling rate of the solvated electron in these solutions which serves to modulate the hyperfine (Fermi-contact) interaction with nitrogen nuclei in the solvation shells of ammonia molecules surrounding the localized, solvated electron. The donor and acceptor states of the solvated electron in these solutions are the initial and final electron solvation sites found before, and after, the transfer or tunneling process. To interpret and model our electron spin relaxation data from the two observation EPR frequencies requires a consideration of a multi-exponential correlation function. The electron transfer or tunneling process that we monitor through the correlation time of the nitrogen Fermi-contact interaction has a time scale of (1–10)×10−12 s over a temperature range 230–290K in our most dilute solution of lithium in ammonia. Two types of electron-solvent interaction mechanisms are proposed to account for our experimental findings. The dominant electron spin relaxation mechanism results from an electron tunneling process characterized by a variable donor-acceptor distance or range (consistent with such a rapidly fluctuating liquid structure) in which the solvent shell that ultimately accepts the transferring electron is formed from random, thermal fluctuations of the liquid structure in, and around, a natural hole or Bjerrum-like defect vacancy in the liquid. Following transfer and capture of the tunneling electron, further solvent-cage relaxation with a timescale of ca. 10−13 s results in a minor contribution to the electron spin relaxation times. This investigation illustrates the great potential of multi-frequency EPR measurements to interrogate the microscopic nature and dynamics of ultra fast electron transfer or quantum-tunneling processes in liquids. Our results also impact on the universal issue of the role of a host solvent (or host matrix, e.g. a semiconductor) in mediating long-range electron transfer processes and we discuss the implications of our results with a range of other materials and systems exhibiting the phenomenon of electron transfer. PMID:22568866

  9. Transfer characteristics and low-frequency noise in single- and multi-layer MoS{sub 2} field-effect transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Deepak; Theiss Research, Inc., La Jolla, California 92037; Department of Electrical and Computer Engineering, George Mason University, Fairfax, Virginia 22030

    Leveraging nanoscale field-effect transistors (FETs) in integrated circuits depends heavily on its transfer characteristics and low-frequency noise (LFN) properties. Here, we report the transfer characteristics and LFN in FETs fabricated with molybdenum disulfide (MoS{sub 2}) with different layer (L) counts. 4L to 6L devices showed highest I{sub ON}-I{sub OFF} ratio (≈10{sup 8}) whereas LFN was maximum for 1L device with normalized power spectral density (PSD) ≈1.5 × 10{sup −5 }Hz{sup −1}. For devices with L ≈ 6, PSD was minimum (≈2 × 10{sup −8 }Hz{sup −1}). Further, LFN for single and few layer devices satisfied carrier number fluctuation (CNF) model in both weak andmore » strong accumulation regimes while thicker devices followed Hooge's mobility fluctuation model in the weak accumulation regime and CNF model in strong accumulation regime, respectively. Transfer-characteristics and LFN experimental data are explained with the help of model incorporating Thomas-Fermi charge screening and inter-layer resistance coupling.« less

  10. Experimental development of a Nusselt correlation for forced reciprocating oscillated vertical annular glycerol flow through a porous domain

    NASA Astrophysics Data System (ADS)

    Sayar, Ersin

    2017-07-01

    The objective of this paper is to investigate the heat transfer to oscillating annular flow of a viscous fluid. The flow media includes stationary stainless steel wool porous domain and glycerol as the working fluid. The effects of actuation frequency and wall heat flux on the temperature field and resultant heat convection coefficient are studied. The temperature values at radial direction are close each other as porous media mixes the glycerol successfully. A correlation with a functional dependence to kinetic Reynolds number is recommended that can be used to acquire the averaged heat transfer for oscillating flows. Present experimental results with glycerol in a porous media are compared to the published experimental works with water. For the limited case of the two working fluids, Nusselt number is normalized well using the Prandtl number (Pr0.67). Results are also compared to non-porous media study and heat transfer is found to increase up to a factor of five in porous media. The recommended correlation is claimed to have a significant role for anticipating heat transfer of oscillating viscous fluid not only at low frequencies but also at low heat fluxes in a porous and permeable solid media.

  11. Factors Affecting Auditory Localization and Situational Awareness in the Urban Battlefield

    DTIC Science & Technology

    2005-04-01

    Scharine and Tomasz R. Letowski (both of ARL) 5f. WORK UNIT NUMBER 7 . PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) U.S. Army Research... 7 Figure 3. Effect of frequency band on... 7 canal (and reflected from the body and pinnae) is direction dependent. This directional function is called the head-related transfer function and

  12. Position-dependent hearing in three species of bushcrickets (Tettigoniidae, Orthoptera)

    PubMed Central

    Lakes-Harlan, Reinhard; Scherberich, Jan

    2015-01-01

    A primary task of auditory systems is the localization of sound sources in space. Sound source localization in azimuth is usually based on temporal or intensity differences of sounds between the bilaterally arranged ears. In mammals, localization in elevation is possible by transfer functions at the ear, especially the pinnae. Although insects are able to locate sound sources, little attention is given to the mechanisms of acoustic orientation to elevated positions. Here we comparatively analyse the peripheral hearing thresholds of three species of bushcrickets in respect to sound source positions in space. The hearing thresholds across frequencies depend on the location of a sound source in the three-dimensional hearing space in front of the animal. Thresholds differ for different azimuthal positions and for different positions in elevation. This position-dependent frequency tuning is species specific. Largest differences in thresholds between positions are found in Ancylecha fenestrata. Correspondingly, A. fenestrata has a rather complex ear morphology including cuticular folds covering the anterior tympanal membrane. The position-dependent tuning might contribute to sound source localization in the habitats. Acoustic orientation might be a selective factor for the evolution of morphological structures at the bushcricket ear and, speculatively, even for frequency fractioning in the ear. PMID:26543574

  13. Position-dependent hearing in three species of bushcrickets (Tettigoniidae, Orthoptera).

    PubMed

    Lakes-Harlan, Reinhard; Scherberich, Jan

    2015-06-01

    A primary task of auditory systems is the localization of sound sources in space. Sound source localization in azimuth is usually based on temporal or intensity differences of sounds between the bilaterally arranged ears. In mammals, localization in elevation is possible by transfer functions at the ear, especially the pinnae. Although insects are able to locate sound sources, little attention is given to the mechanisms of acoustic orientation to elevated positions. Here we comparatively analyse the peripheral hearing thresholds of three species of bushcrickets in respect to sound source positions in space. The hearing thresholds across frequencies depend on the location of a sound source in the three-dimensional hearing space in front of the animal. Thresholds differ for different azimuthal positions and for different positions in elevation. This position-dependent frequency tuning is species specific. Largest differences in thresholds between positions are found in Ancylecha fenestrata. Correspondingly, A. fenestrata has a rather complex ear morphology including cuticular folds covering the anterior tympanal membrane. The position-dependent tuning might contribute to sound source localization in the habitats. Acoustic orientation might be a selective factor for the evolution of morphological structures at the bushcricket ear and, speculatively, even for frequency fractioning in the ear.

  14. AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

    PubMed

    Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

    2015-06-01

    In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

  15. Kindling alters entorhinal cortex-hippocampal interaction by increased efficacy of presynaptic GABA(B) autoreceptors in layer III of the entorhinal cortex.

    PubMed

    Gloveli, Tengis; Behr, Joachim; Dugladze, Tamar; Kokaia, Zaal; Kokaia, Merab; Heinemann, Uwe

    2003-08-01

    We studied the effect of kindling, a model of temporal lobe epilepsy, on the frequency-dependent information transfer from the entorhinal cortex to the hippocampus in vitro. In control rats repetitive synaptic activation of layer III projection cells resulted in a frequency dependent depression of the synaptic transfer of action potentials to the hippocampus. One-to-two-days after kindling this effect was strongly reduced. Although no substantial change in synaptic inhibition upon single electrical stimulation was detected in kindled rats, there was a significant depression in the prolonged inhibition following high frequency stimulation. In kindled animals, paired-pulse depression (PPD) of stimulus-evoked IPSCs in layer III neurons was significantly stronger than in control rats. The increase of PPD is most likely caused by an increased presynaptic GABA(B) receptor-mediated autoinhibition. In kindled animals activation of presynaptic GABA(B) receptors by baclofen (10 microM) suppressed monosynaptic IPSCs significantly more than in control rats. In contrast, activation of postsynaptic GABA(B) receptors by baclofen was accompanied by comparable changes of the membrane conductance in both animal groups. Thus, in kindled animals activation of the layer III-CA1 pathway is facilitated by an increased GABA(B) receptor-mediated autoinhibition leading to an enhanced activation of the monosynaptic EC-CA1 pathway.

  16. Characterizing 3D sensors using the 3D modulation transfer function

    NASA Astrophysics Data System (ADS)

    Kellner, Timo; Breitbarth, Andreas; Zhang, Chen; Notni, Gunther

    2018-03-01

    The fields of optical 3D measurement system applications are continuously expanding and becoming more and more diverse. To evaluate appropriate systems for various measurement tasks, comparable parameters are necessary, whereas the 3D modulation transfer function (3D-MTF) has been established as a further criterion. Its aim is the determination of the system response between the measurement of a straight, sharp-edged cube and its opposite ideal calculated one. Within the scope of this work simulations and practical investigations regarding the 3D-MTF’s influences and its main issues are specifically investigated. Therefore, different determined edge radii representing the high-frequency spectra lead to various decreasing 3D-MTF characteristics. Furthermore, rising sampling frequencies improve its maximum transfer value to a saturation point in dependence of the radius. To approve these results of previous simulations, three fringe projection scanners were selected to determine the diversity. As the best 3D-MTF characteristic, a saturated transfer value of H_3D( f_N, 3D) = 0.79 has been identified at a sufficient sampling frequency, which is reached at four times the Nyquist limit. This high 3D resolution can mainly be achieved due to an improved camera projector interaction. Additionally, too small sampling ratios lead to uncertainties in the edge function determination, while higher ratios do not show major improvements. In conclusion, the 3D-MTF algorithm has thus been practically verified and its repeatability as well as its robustness have been confirmed.

  17. Wall Area of Influence and Growing Wall Heat Transfer due to Sliding Bubbles in Subcooled Boiling Flow

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoo, Junsoo; Estrada-Perez, Carlos E.; Hassan, Yassin A.

    A variety of dynamical features of sliding bubbles and their impact on wall heat transfer were observed at subcooled flow boiling conditions in a vertical square test channel. Among the wide range of parameters observed, we particularly focus in this paper on (i) the sliding bubbles’ effect on wall heat transfer (supplemantry discussion to the authors’ previous work in Yoo et al. (2016a,b)) and (ii) the wall area influenced by sliding bubbles in subcooled boiling flow. At first, this study reveals that the degree of wall heat transfer improvement due to sliding bubbles depended less on the wall superheat conditionmore » as the mass flux increased. Also, the sliding bubble trajectory was found to be one of the critical factors in order to properly describe the wall heat transfer associated with sliding bubbles. In particular, the wall area influenced by sliding bubbles depended strongly on both sliding bubble trajectory and sliding bubble size; the sliding bubble trajectory was also observed to be closely related to the sliding bubble size. Importantly, these results indicate the limitation of current approach in CFD analyses especially for the wall area of bubble influence. In addition, the analyses on the temporal fraction of bubbles’ residence (FR) along the heated wall show that the sliding bubbles typically travel through narrow path with high frequency while the opposite was observed downstream. That is, both FR and sliding bubble trajectory depended substantially on the distance from nucleation site, which is expected to be similar for the quenching heat transfer mode induced by sliding bubbles.« less

  18. Bounded diffusion impedance characterization of battery electrodes using fractional modeling

    NASA Astrophysics Data System (ADS)

    Gabano, Jean-Denis; Poinot, Thierry; Huard, Benoît

    2017-06-01

    This article deals with the ability of fractional modeling to describe the bounded diffusion behavior encountered in modern thin film and nanoparticles lithium battery electrodes. Indeed, the diffusion impedance of such batteries behaves as a half order integrator characterized by the Warburg impedance at high frequencies and becomes a classical integrator described by a capacitor at low frequencies. The transition between these two behaviors depends on the particles geometry. Three of them will be considered in this paper: planar, cylindrical and spherical ones. The fractional representation proposed is a gray box model able to perfectly fit the low and high frequency diffusive impedance behaviors while optimizing the frequency response transition. Identification results are provided using frequential simulation data considering the three electrochemical diffusion models based on the particles geometry. Furthermore, knowing this geometry allows to estimate the diffusion ionic resistance and time constant using the relationships linking these physical parameters to the structural fractional model parameters. Finally, other simulations using Randles impedance models including the charge transfer impedance and the external resistance demonstrate the interest of fractional modeling in order to identify properly not only the charge transfer impedance but also the diffusion physical parameters whatever the particles geometry.

  19. Evaluation of power transfer efficiency for a high power inductively coupled radio-frequency hydrogen ion source

    NASA Astrophysics Data System (ADS)

    Jain, P.; Recchia, M.; Cavenago, M.; Fantz, U.; Gaio, E.; Kraus, W.; Maistrello, A.; Veltri, P.

    2018-04-01

    Neutral beam injection (NBI) for plasma heating and current drive is necessary for International Thermonuclear Experimental reactor (ITER) tokamak. Due to its various advantages, a radio frequency (RF) driven plasma source type was selected as a reference ion source for the ITER heating NBI. The ITER relevant RF negative ion sources are inductively coupled (IC) devices whose operational working frequency has been chosen to be 1 MHz and are characterized by high RF power density (˜9.4 W cm-3) and low operational pressure (around 0.3 Pa). The RF field is produced by a coil in a cylindrical chamber leading to a plasma generation followed by its expansion inside the chamber. This paper recalls different concepts based on which a methodology is developed to evaluate the efficiency of the RF power transfer to hydrogen plasma. This efficiency is then analyzed as a function of the working frequency and in dependence of other operating source and plasma parameters. The study is applied to a high power IC RF hydrogen ion source which is similar to one simplified driver of the ELISE source (half the size of the ITER NBI source).

  20. Evaluation of a GPS Receiver for Code and Carrier-Phase Time and Frequency Transfer

    DTIC Science & Technology

    2010-11-01

    2], and carrier-phase [3]. NIST also employs GPS time transfer as the backup link to Two Way Satellite Time and Frequency Transfer ( TWSTFT ) [4...4] D. Kirchner, 1999, “Two-Way Satellite Time and Frequency Transfer ( TWSTFT ): Principle, Implementation, and Current Performance,” Review of

  1. Advances in Time and Frequency Transfer From Dual-Frequency GPS Pseudorange and Carrier-Phase Observations

    DTIC Science & Technology

    2008-12-01

    collocated independent time transfer techniques such as Two-Way Satellite Time and Frequency Transfer ( TWSTFT ) [10,11]. The issue of pseudorange errors...transfer methods, e.g. TWSTFT . There is a side benefit that far exceeds just meeting the objective we have set. The new model explicitly reveals, on

  2. Femtosecond-level timing fluctuation suppression in atmospheric frequency transfer with passive phase conjunction correction.

    PubMed

    Sun, Fuyu; Hou, Dong; Zhang, Danian; Tian, Jie; Hu, Jianguo; Huang, Xianhe; Chen, Shijun

    2017-09-04

    We demonstrate femtosecond-level timing fluctuation suppression in indoor atmospheric comb-based frequency transfer with a passive phase conjunction correction technique. Timing fluctuations and Allan deviations are both measured to characterize the excess frequency instability incurred during the frequency transfer process. By transferring a 2 GHz microwave over a 52-m long free-space link in 5000 s, the total root-mean-square (RMS) timing fluctuation was measured to be about 280 fs with a fractional frequency instability on the order of 3 × 10 -13 at 1 s and 6 × 10 -17 at 1000 s. This atmospheric comb-based frequency transfer with passive phase conjunction correction can be used to build an atomic clock-based free-space frequency transmission link because its instability is less than that of a commercial Cs or H-master clock.

  3. Site Transfer Functions of Three-Component Ground Motion in Western Turkey

    NASA Astrophysics Data System (ADS)

    Ozgur Kurtulmus, Tevfik; Akyol, Nihal; Camyildiz, Murat; Gungor, Talip

    2015-04-01

    Because of high seismicity accommodating crustal deformation and deep graben structures, on which have, urbanized and industrialized large cities in western Turkey, the importance of site-specific seismic hazard assessments becomes more crucial. Characterizing source, site and path effects is important for both assessing the seismic hazard in a specific region and generation of the building codes/or renewing previous ones. In this study, we evaluated three-component recordings for micro- and moderate-size earthquakes with local magnitudes ranging between 2.0 and 5.6. This dataset is used for site transfer function estimations, utilizing two different spectral ratio approaches 'Standard Spectral Ratio-(SSR)' and 'Horizontal to Vertical Spectral Ratio-(HVSR)' and a 'Generalized Inversion Technique-(GIT)' to highlight site-specific seismic hazard potential of deep basin structures of the region. Obtained transfer functions revealed that the sites located near the basin edges are characterized by broader HVSR curves. Broad HVSR peaks could be attributed to the complexity of wave propagation related to significant 2D/3D velocity variations at the sediment-bedrock interface near the basin edges. Comparison of HVSR and SSR estimates for the sites located on the grabens showed that SSR estimates give larger values at lower frequencies which could be attributed to lateral variations in regional velocity and attenuation values caused by basin geometry and edge effects. However, large amplitude values of vertical component GIT site transfer functions were observed at varying frequency ranges for some of the stations. These results imply that vertical component of ground motion is not amplification free. Contamination of HVSR site transfer function estimates at different frequency bands could be related to complexities in the wave field caused by deep or shallow heterogeneities in the region such as differences in the basin geometries, fracturing and fluid saturation along different propagation paths. The results also show that, even if the site is located on a horst, the presence of weathered zones near the surface could cause moderate frequency dependent site effects.

  4. Retinohypothalamic Tract Synapses in the Rat Suprachiasmatic Nucleus Demonstrate Short-Term Synaptic Plasticity

    PubMed Central

    Moldavan, Mykhaylo G.

    2010-01-01

    The master circadian pacemaker located in the suprachiasmatic nucleus (SCN) is entrained by light intensity–dependent signals transmitted via the retinohypothalamic tract (RHT). Short-term plasticity at glutamatergic RHT–SCN synapses was studied using stimulus frequencies that simulated the firing of light sensitive retinal ganglion cells. The evoked excitatory postsynaptic current (eEPSC) was recorded from SCN neurons located in hypothalamic brain slices. The eEPSC amplitude was stable during 0.08 Hz stimulation and exhibited frequency-dependent short-term synaptic depression (SD) during 0.5 to 100 Hz stimulus trains in 95 of 99 (96%) recorded neurons. During SD the steady-state eEPSC amplitude decreased, whereas the cumulative charge transfer increased in a frequency-dependent manner and saturated at 20 Hz. SD was similar during subjective day and night and decreased with increasing temperature. Paired-pulse stimulation (PPS) and voltage-dependent Ca2+ channel (VDCC) blockers were used to characterize a presynaptic release mechanism. Facilitation was present in 30% and depression in 70% of studied neurons during PPS. Synaptic transmission was reduced by blocking both N- and P/Q-type presynaptic VDCCs, but only the N-type channel blocker significantly relieved SD. Aniracetam inhibited AMPA receptor desensitization but did not alter SD. Thus we concluded that SD is the principal form of short-term plasticity at RHT synapses, which presynaptically and frequency-dependently attenuates light-induced glutamatergic RHT synaptic transmission protecting SCN neurons against excessive excitation. PMID:20220078

  5. Simultaneous measurement of thermal conductivity and heat capacity of bulk and thin film materials using frequency-dependent transient thermoreflectance method.

    PubMed

    Liu, Jun; Zhu, Jie; Tian, Miao; Gu, Xiaokun; Schmidt, Aaron; Yang, Ronggui

    2013-03-01

    The increasing interest in the extraordinary thermal properties of nanostructures has led to the development of various measurement techniques. Transient thermoreflectance method has emerged as a reliable measurement technique for thermal conductivity of thin films. In this method, the determination of thermal conductivity usually relies much on the accuracy of heat capacity input. For new nanoscale materials with unknown or less-understood thermal properties, it is either questionable to assume bulk heat capacity for nanostructures or difficult to obtain the bulk form of those materials for a conventional heat capacity measurement. In this paper, we describe a technique for simultaneous measurement of thermal conductivity κ and volumetric heat capacity C of both bulk and thin film materials using frequency-dependent time-domain thermoreflectance (TDTR) signals. The heat transfer model is analyzed first to find how different combinations of κ and C determine the frequency-dependent TDTR signals. Simultaneous measurement of thermal conductivity and volumetric heat capacity is then demonstrated with bulk Si and thin film SiO2 samples using frequency-dependent TDTR measurement. This method is further testified by measuring both thermal conductivity and volumetric heat capacity of novel hybrid organic-inorganic thin films fabricated using the atomic∕molecular layer deposition. Simultaneous measurement of thermal conductivity and heat capacity can significantly shorten the development∕discovery cycle of novel materials.

  6. Experimental observation of carrier-envelope-phase effects by multicycle pulses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Pankaj K.; Scully, Marlan O.; Mechanical and Aerospace Engineering and the Princeton Institute for the Science and Technology of Materials, Princeton University, Princeton, New Jersey 08544

    2011-03-15

    We present an experimental and theoretical study of carrier-envelope-phase (CEP) effects on the population transfer between two bound atomic states interacting with pulses consisting of many cycles. Using intense radio-frequency pulse with Rabi frequency of the order of the atomic transition frequency, we investigate the influence of the CEP on the control of phase-dependent multiphoton transitions between the Zeeman sublevels of the ground state of {sup 87}Rb. Our scheme has no limitation on the duration of the pulses. Extending the CEP control to longer pulses creates interesting possibilities to generate pulses with accuracy that is better than the period ofmore » optical oscillations.« less

  7. Analysis of resonant population transfer in time-dependent elliptical quantum billiards

    NASA Astrophysics Data System (ADS)

    Liss, Jakob; Liebchen, Benno; Schmelcher, Peter

    2013-01-01

    A Fermi golden rule for population transfer between instantaneous eigenstates of elliptical quantum billiards with oscillating boundaries is derived. Thereby the occurrence of both the recently observed resonant population transfer between instantaneous eigenstates and the empirical criterion stating that these transitions occur when the driving frequency matches the mean difference of the latter [Lenz , New J. Phys.NJOPFM1367-263010.1088/1367-2630/13/10/103019 13, 103019 (2011)] is explained. As a second main result a criterion judging which resonances are resolvable in a corresponding experiment of certain duration is provided. Our analysis is complemented by numerical simulations for three different driving laws. The corresponding resonance spectra are in agreement with the predictions of both criteria.

  8. Micromagnetic modal analysis of spin-transfer-driven ferromagnetic resonance of individual nanomagnets

    NASA Astrophysics Data System (ADS)

    Torres, L.; Finocchio, G.; Lopez-Diaz, L.; Martinez, E.; Carpentieri, M.; Consolo, G.; Azzerboni, B.

    2007-05-01

    In a recent investigation Sankey et al. [Phys. Rev. Lett. 96, 227601 (2006)] demonstrated a technique for measuring spin-transfer-driven ferromagnetic resonance in individual ellipsoidal PyCu nanomagnets as small as 30×90×5.5nm3. In the present work, these experiments are analyzed by means of full micromagnetic modeling finding quantitative agreement and enlightening the spatial distribution of the normal modes found in the experiment. The magnetic parameter set used in the computations is obtained by fitting static magnetoresistance measurements. The temperature effect is also included together with all the nonuniform contributions to the effective field as the magnetostatic coupling and the Ampere field. The polarization function of Slonczewski [J. Magn. Magn. Mater. 159, L1 (1996)] is used including its spatial and angular dependences. Experimental spin-transfer-driven ferromagnetic resonance spectra are reproduced using the same currents as in the experiment. The use of full micromagnetic modeling allows us to further investigate the spatial dependence of the modes. The dependence of the normal mode frequency on the dc and the external field together with a comparison to the normal modes induced by a microwave current is also addressed.

  9. Calcium-dependent control of temporal processing in an auditory interneuron: a computational analysis

    PubMed Central

    Ponnath, Abhilash

    2010-01-01

    Sensitivity to acoustic amplitude modulation in crickets differs between species and depends on carrier frequency (e.g., calling song vs. bat-ultrasound bands). Using computational tools, we explore how Ca2+-dependent mechanisms underlying selective attention can contribute to such differences in amplitude modulation sensitivity. For omega neuron 1 (ON1), selective attention is mediated by Ca2+-dependent feedback: [Ca2+]internal increases with excitation, activating a Ca2+-dependent after-hyperpolarizing current. We propose that Ca2+ removal rate and the size of the after-hyperpolarizing current can determine ON1’s temporal modulation transfer function (TMTF). This is tested using a conductance-based simulation calibrated to responses in vivo. The model shows that parameter values that simulate responses to single pulses are sufficient in simulating responses to modulated stimuli: no special modulation-sensitive mechanisms are necessary, as high and low-pass portions of the TMTF are due to Ca2+-dependent spike frequency adaptation and post-synaptic potential depression, respectively. Furthermore, variance in the two biophysical parameters is sufficient to produce TMTFs of varying bandwidth, shifting amplitude modulation sensitivity like that in different species and in response to different carrier frequencies. Thus, the hypothesis that the size of after-hyperpolarizing current and the rate of Ca2+ removal can affect amplitude modulation sensitivity is computationally validated. PMID:20559640

  10. Physical processes in the strong magnetic fields of accreting neutron stars

    NASA Technical Reports Server (NTRS)

    Meszaros, P.

    1984-01-01

    Analytical formulae are fitted to observational data on physical processes occurring in strong magnetic fields surrounding accreting neutron stars. The propagation of normal modes in the presence of a quantizing magnetic field is discussed in terms of a wave equation in Fourier space, quantum electrodynamic effects, polarization and mode ellipticity. The results are applied to calculating the Thomson scattering, bremsstrahlung and Compton scattering cross-sections, which are a function of the frequency, angle and polarization of the magnetic field. Numerical procedures are explored for solving the radiative transfer equations. When applied to modeling X ray pulsars, a problem arises in the necessity to couple the magnetic angle and frequency dependence of the cross-sections with the hydrodynamic equations. The use of time-dependent averaging and approximation techniques is indicated.

  11. A multi-frequency radiometric measurement of soil moisture content over bare and vegetated fields

    NASA Technical Reports Server (NTRS)

    Wang, J. R.; Schmugge, T. J.; Gould, W. I.; Glazar, W. S.; Fuchs, J. E.; Mcmurtrey, J. E., III

    1982-01-01

    An experiment on soil moisture remote sensing was conducted during July to September 1981 on bare, grass, and alfalfa fields at frequencies of 0.6, 1.4, 5.0, and 10.6 GHz with radiometers mounted on mobile towers. The results confirm the frequency dependence of sensitivity reduction due to the presence of vegetation cover. For the type of vegetated fields reported here, the vegetation effect is appreciable even at 0.6 GHz. Measurements over bare soil show that when the soil is wet, the measured brightness temperature is lowest at 5.0 GHz and highest at 0.6 GHz, a result contrary to the expectation based on the estimated dielectric permittivity of soil-water mixtures and the current radiative transfer model in that frequency range.

  12. Low-frequency electrical properties.

    USGS Publications Warehouse

    Olhoeft, G.R.

    1985-01-01

    In the interpretation of induced polarization data, it is commonly assumed that metallic mineral polarization dominantly or solely causes the observed response. However, at low frequencies, there is a variety of active chemical processes which involve the movement or transfer of electrical charge. Measurements of electrical properties at low frequencies (such as induced polarization) observe such movement of charge and thus monitor many geochemical processes at a distance. Examples in which this has been done include oxidation-reduction of metallic minerals such as sulfides, cation exchange on clays, and a variety of clay-organic reactions relevant to problems in toxic waste disposal and petroleum exploration. By using both the frequency dependence and nonlinear character of the complex resistivity spectrum, these reactions may be distinguished from each other and from barren or reactionless materials.-Author

  13. Evaluation of the Time and Frequency Transfer Capabilities of a Network of GNSS Receivers Located in Timing Laboratories

    DTIC Science & Technology

    2009-11-01

    metrology, different techniques are used for time and frequency transfer, basically TWSTFT (Two-Way Satellite Time and Frequency Transfer), GPS CV (Common...traditional GPS/GLONASS CV/AV receivers and TWSTFT equipment. Time and frequency transfer using GPS code and carrier-phase is an important...or mixing GPS geodetic results with other independent techniques, such as the TWSTFT . 41 st Annual Precise Time and Time Interval (PTTI

  14. Amide proton transfer imaging with improved robustness to magnetic field inhomogeneity and magnetization transfer asymmetry using Saturation with Frequency Alternating RF Irradiation (SAFARI)

    PubMed Central

    Scheidegger, Rachel; Vinogradov, Elena; Alsop, David C

    2011-01-01

    Amide proton transfer (APT) imaging has shown promise as an indicator of tissue pH and as a marker for brain tumors. Sources of error in APT measurements include direct water saturation, and magnetization transfer (MT) from membranes and macromolecules. These are typically suppressed by post-processing asymmetry analysis. However, this approach is strongly dependent on B0 homogeneity and can introduce additional errors due to intrinsic MT asymmetry, aliphatic proton features opposite the amide peak, and radiation damping-induced asymmetry. Although several methods exist to correct for B0 inhomogeneity, they tremendously increase scan times and do not address errors induced by asymmetry of the z-spectrum. In this paper, a novel saturation scheme - saturation with frequency alternating RF irradiation (SAFARI) - is proposed in combination with a new magnetization transfer ratio (MTR) parameter designed to generate APT images insensitive to direct water saturation and MT, even in the presence of B0 inhomogeneity. The feasibility of the SAFARI technique is demonstrated in phantoms and in the human brain. Experimental results show that SAFARI successfully removes direct water saturation and MT contamination from APT images. It is insensitive to B0 offsets up to 180Hz without using additional B0 correction, thereby dramatically reducing scanning time. PMID:21608029

  15. Sensorless battery temperature measurements based on electrochemical impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Raijmakers, L. H. J.; Danilov, D. L.; van Lammeren, J. P. M.; Lammers, M. J. G.; Notten, P. H. L.

    2014-02-01

    A new method is proposed to measure the internal temperature of (Li-ion) batteries. Based on electrochemical impedance spectroscopy measurements, an intercept frequency (f0) can be determined which is exclusively related to the internal battery temperature. The intercept frequency is defined as the frequency at which the imaginary part of the impedance is zero (Zim = 0), i.e. where the phase shift between the battery current and voltage is absent. The advantage of the proposed method is twofold: (i) no hardware temperature sensors are required anymore to monitor the battery temperature and (ii) the method does not suffer from heat transfer delays. Mathematical analysis of the equivalent electrical-circuit, representing the battery performance, confirms that the intercept frequency decreases with rising temperatures. Impedance measurements on rechargeable Li-ion cells of various chemistries were conducted to verify the proposed method. These experiments reveal that the intercept frequency is clearly dependent on the temperature and does not depend on State-of-Charge (SoC) and aging. These impedance-based sensorless temperature measurements are therefore simple and convenient for application in a wide range of stationary, mobile and high-power devices, such as hybrid- and full electric vehicles.

  16. Coherent fifth-order visible-infrared spectroscopies: ultrafast nonequilibrium vibrational dynamics in solution.

    PubMed

    Lynch, Michael S; Slenkamp, Karla M; Cheng, Mark; Khalil, Munira

    2012-07-05

    Obtaining a detailed description of photochemical reactions in solution requires measuring time-evolving structural dynamics of transient chemical species on ultrafast time scales. Time-resolved vibrational spectroscopies are sensitive probes of molecular structure and dynamics in solution. In this work, we develop doubly resonant fifth-order nonlinear visible-infrared spectroscopies to probe nonequilibrium vibrational dynamics among coupled high-frequency vibrations during an ultrafast charge transfer process using a heterodyne detection scheme. The method enables the simultaneous collection of third- and fifth-order signals, which respectively measure vibrational dynamics occurring on electronic ground and excited states on a femtosecond time scale. Our data collection and analysis strategy allows transient dispersed vibrational echo (t-DVE) and dispersed pump-probe (t-DPP) spectra to be extracted as a function of electronic and vibrational population periods with high signal-to-noise ratio (S/N > 25). We discuss how fifth-order experiments can measure (i) time-dependent anharmonic vibrational couplings, (ii) nonequilibrium frequency-frequency correlation functions, (iii) incoherent and coherent vibrational relaxation and transfer dynamics, and (iv) coherent vibrational and electronic (vibronic) coupling as a function of a photochemical reaction.

  17. Hydroxyl Impurities Enhance Radiative Transfer in the Upper Mantle

    NASA Astrophysics Data System (ADS)

    Hofmeister, A. M.

    2002-12-01

    Modelling radiative heat transfer is essential to geodynamics because the increase of the diffusive radiative thermal conductivity (krdf) with temperature promotes stability through feedback (Dubuffet et al., 2002, Nonlinear Proc. Geophys., 9: 1-13). Measuring krdf is virtually impossible, and therefore krdf is calculated from spectroscopic measurements. Previous efforts show that Fe2+ impurities in olivine engender radiative transfer when luminous emissions of "hot" grains are absorbed by slightly cooler nearest-neighbor grains. Hydroxyl impurities provide a similar mechanism of emission/absorption. Hydroxyl is important to radiative transfer because (1) OH absorptions are located in the transparent gap between the lattice modes and the Fe2+ transitions (2) small amounts of OH produce intense absorptions, (3) the specific frequencies enable transfer at lower temperatures than is possible with Fe transitions, i.e. even in the cold interiors of slabs, and (4) OH is preferentially located in mineral phases such as garnet and wadsleyite, whereas Fe contents are distributed more or less uniformly. The effect of changing OH concentration on krdf is explored using forsteritic olivine to represent mantle material. Polarized (absorption and reflection) spectroscopic measurements from 77 to 623 K show that the changes in frequency, width, and intensity of the OH bands are small, and that peak area is constant. This allows the effect of OH to be treated independently of temperature. However, OH content and grain size (d) cannot be separated, because the strength of the emissions within a self-emitting medium depends on d. For d = 3 mm, concentrations below 200 H/10{6) Si atoms contribute negligibly to radiative transfer. With low OH contents krdf increases, whereas above ca 1000 H /106 Si, krdf is inverse with concentration. The maxima for krdf depends on d and OH content. Kimberlite samples suggest that the upper mantle has evolved to towards conditions which maximize krdf. For the lower mantle with its small grain size, OH contents are irrelevant to radiative heat transfer. Chemical stratification is inferred with Earth's H inventory being stored above 670 km.

  18. RF-SABRE: A Way to Continuous Spin Hyperpolarization at High Magnetic Fields.

    PubMed

    Pravdivtsev, Andrey N; Yurkovskaya, Alexandra V; Vieth, Hans-Martin; Ivanov, Konstantin L

    2015-10-29

    A new technique is developed that allows one to carry out the signal amplification by reversible exchange (SABRE) experiments at high magnetic field. SABRE is a hyperpolarization method, which utilizes transfer of spin order from para-hydrogen to the spins of a substrate in transient iridium complexes. Previously, it has been thought that such a transfer of spin order is only efficient at low magnetic fields, notably, at level anti-crossing (LAC) regions. Here it is demonstrated that LAC conditions can also be fulfilled at high fields under the action of a RF field. The high-field RF-SABRE experiment can be implemented using commercially available nuclear magnetic resonance (NMR) and magnetic resonance imaging (MRI) machines and does not require technically demanding field-cycling. The achievable NMR enhancements are around 100 for several substrates as compared to their NMR signals at thermal equilibrium conditions at 4.7 T. The frequency dependence of RF-SABRE is comprised of well pronounced peaks and dips, whose position and amplitude are conditioned solely by the magnetic resonance parameters such as chemical shifts and scalar coupling of the spin system involved in the polarization transfer and by the amplitude of the RF field. Thus, the proposed method can serve as a new sensitive tool for probing transient complexes. Simulations of the dependence of magnetization transfer (i.e., NMR signal amplifications) on the frequency and amplitude of the RF field are in good agreement with the developed theoretical approach. Furthermore, the method enables continuous re-hyperpolarization of the SABRE substrate over a long period of time, giving a straightforward way to repetitive NMR experiments.

  19. Sources of Instabilities in Two-Way Satellite Time Transfer

    DTIC Science & Technology

    2005-08-01

    Frequency Division 325 Broadway Boulder, CO USA Abstract -- Two-Way Satellite Time and Frequency Transfer ( TWSTFT ) has become an important...stability of TWSTFT a more complete understanding of the sources of instabilities is required. This paper analyzes several sources of instabilities...Frequency Transfer ( TWSTFT ) regularly delivers subnanosecond time transfer stability at 1 day as measured by the time deviation (TDEV) statistic

  20. High Efficiency Transformation of Cultured Tobacco Cells 1

    PubMed Central

    An, Gynheung

    1985-01-01

    Tobacco calli were transformed at levels up to 50% by cocultivation of tobacco cultured cells with Agrobacterium tumefaciens harboring the binary transfer-DNA vector, pGA472, containing a kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so, on the expression of the vir genes of the tumor-inducing plasmid. Maximum transformation frequency was obtained with exponentially growing plant cells, suggesting that rapid growth of plant cells is an essental factor for efficient transformation of higher plants. Images Fig. 1 PMID:16664453

  1. Carrier-envelope phase dynamics and noise analysis in octave-spanning Ti:sapphire lasers.

    PubMed

    Matos, Lia; Mücke, Oliver D; Chen, Jian; Kärtner, Franz X

    2006-03-20

    We investigate the carrier-envelope phase dynamics of octave-spanning Ti:sapphire lasers and perform a complete noise analysis of the carrier-envelope phase stabilization. We model the effect of the laser dynamics on the residual carrier-envelope phase noise by deriving a transfer function representation of the octave-spanning frequency comb. The modelled phase noise and the experimental results show excellent agreement. This greatly enhances our capability of predicting the dependence of the residual carrier-envelope phase noise on the feedback loop filter, the carrier-envelope frequency control mechanism and the pump laser used.

  2. The effects of layers in dry snow on its passive microwave emissions using dense media radiative transfer theory based on the quasicrystalline approximation (QCA/DMRT)

    USGS Publications Warehouse

    Liang, D.; Xu, X.; Tsang, L.; Andreadis, K.M.; Josberger, E.G.

    2008-01-01

    A model for the microwave emissions of multilayer dry snowpacks, based on dense media radiative transfer (DMRT) theory with the quasicrystalline approximation (QCA), provides more accurate results when compared to emissions determined by a homogeneous snowpack and other scattering models. The DMRT model accounts for adhesive aggregate effects, which leads to dense media Mie scattering by using a sticky particle model. With the multilayer model, we examined both the frequency and polarization dependence of brightness temperatures (Tb's) from representative snowpacks and compared them to results from a single-layer model and found that the multilayer model predicts higher polarization differences, twice as much, and weaker frequency dependence. We also studied the temporal evolution of Tb from multilayer snowpacks. The difference between Tb's at 18.7 and 36.5 GHz can be S K lower than the single-layer model prediction in this paper. By using the snowpack observations from the Cold Land Processes Field Experiment as input for both multi- and single-layer models, it shows that the multilayer Tb's are in better agreement with the data than the single-layer model. With one set of physical parameters, the multilayer QCA/DMRT model matched all four channels of Tb observations simultaneously, whereas the single-layer model could only reproduce vertically polarized Tb's. Also, the polarization difference and frequency dependence were accurately matched by the multilayer model using the same set of physical parameters. Hence, algorithms for the retrieval of snowpack depth or water equivalent should be based on multilayer scattering models to achieve greater accuracy. ?? 2008 IEEE.

  3. Sound-power collection by the auditory periphery of the Mongolian gerbil Meriones unguiculatus. I: Middle-ear input impedance.

    PubMed

    Ravicz, M E; Rosowski, J J; Voigt, H F

    1992-07-01

    This is the first paper of a series dealing with sound-power collection by the auditory periphery of the gerbil. The purpose of the series is to quantify the physiological action of the gerbil's relatively large tympanic membrane and middle-ear air cavities. To this end the middle-ear input impedance ZT was measured at frequencies between 10 Hz and 18 kHz before and after manipulations of the middle-ear cavity. The frequency dependence of ZT is consistent with that of the middle-ear transfer function computed from extant data. Comparison of the impedance and transfer function suggests a middle-ear transformer ratio of 50 at frequencies below 1 kHz, substantially smaller than the anatomical value of 90 [Lay, J. Morph. 138, 41-120 (1972)]. Below 1 kHz the data suggest a low-frequency acoustic stiffness KT for the middle ear of 970 Pa/mm3 and a stiffness of the middle-ear cavity of 720 Pa/mm3 (middle-ear volume V MEC of 195 mm3); thus the middle-ear air spaces contribute about 70% of the acoustic stiffness of the auditory periphery. Manipulations of a middle-ear model suggest that decreases in V MEC lead to proportionate increases in KT but that further increases in middle-ear cavity volume produce only limited decreases in middle-ear stiffness. The data and the model point out that the real part of the middle-ear impedance at frequencies below 100 Hz is determined primarily by losses within the middle-ear cavity. The measured impedance is comparable in magnitude and frequency dependence to the impedance in several larger mammalian species commonly used in auditory research. A comparison of low-frequency stiffness and anatomical dimensions among several species suggests that the large middle-ear cavities in gerbil act to reduce the middle-ear stiffness at low frequencies. A description of sound-power collection by the gerbil ear requires a description of the function of the external ear.

  4. Probing membrane protein structure using water polarization transfer solid-state NMR.

    PubMed

    Williams, Jonathan K; Hong, Mei

    2014-10-01

    Water plays an essential role in the structure and function of proteins, lipid membranes and other biological macromolecules. Solid-state NMR heteronuclear-detected (1)H polarization transfer from water to biomolecules is a versatile approach for studying water-protein, water-membrane, and water-carbohydrate interactions in biology. We review radiofrequency pulse sequences for measuring water polarization transfer to biomolecules, the mechanisms of polarization transfer, and the application of this method to various biological systems. Three polarization transfer mechanisms, chemical exchange, spin diffusion and NOE, manifest themselves at different temperatures, magic-angle-spinning frequencies, and pulse irradiations. Chemical exchange is ubiquitous in all systems examined so far, and spin diffusion plays the key role in polarization transfer within the macromolecule. Tightly bound water molecules with long residence times are rare in proteins at ambient temperature. The water polarization-transfer technique has been used to study the hydration of microcrystalline proteins, lipid membranes, and plant cell wall polysaccharides, and to derive atomic-resolution details of the kinetics and mechanism of ion conduction in channels and pumps. Using this approach, we have measured the water polarization transfer to the transmembrane domain of the influenza M2 protein to obtain information on the structure of this tetrameric proton channel. At short mixing times, the polarization transfer rates are site-specific and depend on the pH, labile protons, sidechain conformation, as well as the radial position of the residues in this four-helix bundle. Despite the multiple dependences, the initial transfer rates reflect the periodic nature of the residue positions from the water-filled pore, thus this technique provides a way of gleaning secondary structure information, helix tilt angle, and the oligomeric structure of membrane proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Modelling the dependence of contrast sensitivity on grating area and spatial frequency.

    PubMed

    Rovamo, J; Luntinen, O; Näsänen, R

    1993-12-01

    We modelled the human foveal visual system in a detection task as a simple image processor comprising (i) low-pass filtering due to the optical transfer function of the eye, (ii) high-pass filtering of neural origin, (iii) addition of internal neural noise, and (iv) detection by a local matched filter. Its detection efficiency for gratings was constant up to a critical area but then decreased with increasing area. To test the model we measured Michelson contrast sensitivity as a function of grating area at spatial frequencies of 0.125-32 c/deg for simple vertical and circular cosine gratings. In circular gratings luminance was sinusoidally modulated as a function of the radius of the grating field. In agreement with the model, contrast sensitivity at all spatial frequencies increased in proportion to the square-root of grating area at small areas. When grating area exceeded critical area, the increase saturated and contrast sensitivity became independent of area at large grating areas. Spatial integration thus obeyed Piper's law at small grating areas. The critical area of spatial integration, marking the cessation of Piper's law, was constant in solid degrees at low spatial frequencies but inversely proportional to spatial frequency squared at medium and high spatial frequencies. At low spatial frequencies the maximum contrast sensitivity obtainable by spatial integration increased in proportion to spatial frequency but at high spatial frequencies it decreased in proportion to the cube of the increasing spatial frequency. The increase was due to high-pass filtering of neural origin (lateral inhibition) and the decrease was mainly due to the optical transfer function of the eye. Our model explained 95% of the total variance of the contrast sensitivity data.

  6. Energy transfer and motion synchronization between mechanical oscillators through microhydrodynamic coupling

    NASA Astrophysics Data System (ADS)

    Wan, Yu; Jin, Kai; Ahmad, Talha J.; Black, Michael J.; Xu, Zhiping

    2017-03-01

    Fluidic environment is encountered for mechanical components in many circumstances, which not only damps the oscillation but also modulates their dynamical behaviors through hydrodynamic interactions. In this study, we examine energy transfer and motion synchronization between two mechanical micro-oscillators by performing thermal lattice-Boltzmann simulations. The coefficient of inter-oscillator energy transfer is measured to quantify the strength of microhydrodynamic coupling, which depends on their distance and fluid properties such as density and viscosity. Synchronized motion of the oscillators is observed in the simulations for typical parameter sets in relevant applications, with the formation and loss of stable anti-phase synchronization controlled by the oscillating frequency, amplitude, and hydrodynamic coupling strength. The critical ranges of key parameters to assure efficient energy transfer or highly synchronized motion are predicted. These findings could be used to advise mechanical design of passive and active devices that operate in fluid.

  7. Oscillation characteristics of zero-field spin transfer oscillators with field-like torque

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Yuan-Yuan; Xue, Hai-Bin, E-mail: xuehaibin@tyut.edu.cn; Department of Physics and Optoelectronics, Taiyuan University of Technology, Taiyuan 030024

    2015-05-15

    We theoretically investigate the influence of the field-like spin torque term on the oscillation characteristics of spin transfer oscillators, which are based on MgO magnetic tunnel junctions (MTJs) consisting of a perpendicular magnetized free layer and an in-plane magnetized pinned layer. It is demonstrated that the field-like torque has a strong impact on the steady-state precession current region and the oscillation frequency. In particular, the steady-state precession can occur at zero applied magnetic field when the ratio between the field-like torque and the spin transfer torque takes up a negative value. In addition, the dependence of the oscillation properties onmore » the junction sizes has also been analyzed. The results indicate that this compact structure of spin transfer oscillator without the applied magnetic field is practicable under certain conditions, and it may be a promising configuration for the new generation of on-chip oscillators.« less

  8. Sub-picosecond timing fluctuation suppression in laser-based atmospheric transfer of microwave signal using electronic phase compensation

    NASA Astrophysics Data System (ADS)

    Chen, Shijun; Sun, Fuyu; Bai, Qingsong; Chen, Dawei; Chen, Qiang; Hou, Dong

    2017-10-01

    We demonstrated a timing fluctuation suppression in outdoor laser-based atmospheric radio-frequency transfer over a 110 m one-way free-space link using an electronic phase compensation technique. Timing fluctuations and Allan Deviation are both measured to characterize the instability of transferred frequency incurred during the transfer process. With transferring a 1 GHz microwave signal over a timing fluctuation suppressed transmission link, the total root-mean-square (rms) timing fluctuation was measured to be 920 femtoseconds in 5000 s, with fractional frequency instability on the order of 1 × 10-12 at 1 s, and order of 2 × 10-16 at 1000 s. This atmospheric frequency transfer scheme with the timing fluctuation suppression technique can be used to fast build an atomic clock-based frequency free-space transmission link since its stability is superior to a commercial Cs and Rb clock.

  9. PTTI 2030 - Time Transfer and Applications in 2030

    DTIC Science & Technology

    2010-01-01

    today’s society is paramount. Every day billions of people worldwide depend on some level of time synchronization , and timing laboratories require...applications as an inexpensive way to disseminate GPS-acquired time and frequency among groups, or as a backup method of time synchronization in the...strictly for timing use would be very expensive, perhaps prohibitive. ADVANTAGES OF AN IEEE-1588-ENABLED POWER GRID Time synchronization in

  10. Textile composite processing science

    NASA Technical Reports Server (NTRS)

    Loos, Alfred C.; Hammond, Vincent H.; Kranbuehl, David E.; Hasko, Gregory H.

    1993-01-01

    A multi-dimensional model of the Resin Transfer Molding (RTM) process was developed for the prediction of the infiltration behavior of a resin into an anisotropic fiber preform. Frequency dependent electromagnetic sensing (FDEMS) was developed for in-situ monitoring of the RTM process. Flow visualization and mold filling experiments were conducted to verify sensor measurements and model predictions. Test results indicated good agreement between model predictions, sensor readings, and experimental data.

  11. UCEPR: Ultrafast localized CEST-spectroscopy with PRESS in phantoms and in vivo.

    PubMed

    Liu, Zheng; Dimitrov, Ivan E; Lenkinski, Robert E; Hajibeigi, Asghar; Vinogradov, Elena

    2016-05-01

    Chemical exchange saturation transfer (CEST) is a contrast mechanism enhancing low-concentration molecules through saturation transfer from their exchangeable protons to bulk water. Often many scans are acquired to form a Z-spectrum, making the CEST method time-consuming. Here, an ultrafast localized CEST-spectroscopy with PRESS (UCEPR) is proposed to obtain the entire Z-spectrum of a voxel using only two scans, significantly accelerating CEST. The approach combines ultrafast nonlocalized CEST spectroscopy with localization using PRESS. A field gradient is applied concurrently with the saturation pulse producing simultaneous saturation of all Z-spectrum frequencies that are also spatially encoded. A readout gradient during data acquisition resolves the spatial dependence of the CEST responses into frequency. UCEPR was tested on a 3T scanner both in phantoms and in vivo. In phantoms, a fast Z-spectroscopy acquisition of multiple pH-variant iopamidol samples was achieved with four- to seven-fold acceleration as compared to the conventional CEST methods. In vivo, amide proton transfer (APT) in white matter of healthy human brain was measured rapidly in 48 s and with high frequency resolution (≤ 0.2 ppm). Compared with conventional CEST methods, UCEPR has the advantage of rapidly acquiring high-resolution Z-spectra. Potential in vivo applications include ultrafast localized Z-spectroscopy, quantitative, or dynamic CEST studies. © 2015 Wiley Periodicals, Inc.

  12. Improved transfer efficiencies in radio-frequency-driven recoupling solid-state NMR by adiabatic sweep through the dipolar recoupling condition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Straasø, Lasse A.; Shankar, Ravi; Nielsen, Niels Chr.

    The homonuclear radio-frequency driven recoupling (RFDR) experiment is commonly used in solid-state NMR spectroscopy to gain insight into the structure of biological samples due to its ease of implementation, stability towards fluctuations/missetting of radio-frequency (rf) field strength, and in general low rf requirements. A theoretical operator-based Floquet description is presented to appreciate the effect of having a temporal displacement of the π-pulses in the RFDR experiment. From this description, we demonstrate improved transfer efficiency for the RFDR experiment by generating an adiabatic passage through the zero-quantum recoupling condition. We have compared the performances of RFDR and the improved sequence tomore » mediate efficient {sup 13}CO to {sup 13}C{sub α} polarization transfer for uniformly {sup 13}C,{sup 15}N-labeled glycine and for the fibril forming peptide SNNFGAILSS (one-letter amino acid codes) uniformly {sup 13}C,{sup 15}N-labeled at the FGAIL residues. Using numerically optimized sweeps, we get experimental gains of approximately 20% for glycine where numerical simulations predict an improvement of 25% relative to the standard implementation. For the fibril forming peptide, using the same sweep parameters as found for glycine, we have gains in the order of 10%–20% depending on the spectral regions of interest.« less

  13. Microwave Radiative Transfer: Theory and Applications

    NASA Astrophysics Data System (ADS)

    Wilheit, T. T.

    2006-12-01

    The same physical laws govern visible, infrared and microwave radiative transfer. However, frequency dependence of the Planck function and of the properties of geophysically important materials create apparent differences. The applicability of the Rayleigh-Jeans to most of the microwave spectrum is a convenience, and makes it easier to illustrate some physical principles, but is of very little fundamental importance. Line widths of gaseous constituents are determined by collision frequencies and are of the order of 1 GHz throughout the troposphere in the visible, infrared and microwave portions of the spectrum. However, it is easy to make a radiometer that has a bandwidth small compared to this width in the microwave portion of the spectrum and significantly more difficult in the infrared and visible. As a result, computations in the microwave are monochromatic (or very close to it). In the microwave portion of the spectrum there is no need for elaborate band models. Clouds are a fundamental difference because the opacity of most clouds is very high in the visible and infrared and fairly small in the microwave. This quantitative difference necessitates qualitative differences in approach. Probably, the most counter-intuitive differences between the microwave regions and shorter wavelengths result from the preponderance of highly reflective surfaces in the microwave. The oceans reflect on the order of 50% but the details depend strongly on frequency, polarization and view angle. The large glaciers of Greenland and Antarctica are also highly reflective but less dependant on view angle and polarization. This high reflectivity means that introducing an absorber into the atmosphere at a temperature colder than the surface temperature will, nevertheless increase the observed radiance. This has fundamental importance for the retrieval of constituents from the atmosphere. Even over land surfaces, the observed radiance in microwave window channels depends more on the reflectivity than on the temperature. Thus, microwave observations can yield information on the surface composition (soil moisture, vegetation cover).

  14. Visual Bias Predicts Gait Adaptability in Novel Sensory Discordant Conditions

    NASA Technical Reports Server (NTRS)

    Brady, Rachel A.; Batson, Crystal D.; Peters, Brian T.; Mulavara, Ajitkumar P.; Bloomberg, Jacob J.

    2010-01-01

    We designed a gait training study that presented combinations of visual flow and support-surface manipulations to investigate the response of healthy adults to novel discordant sensorimotor conditions. We aimed to determine whether a relationship existed between subjects visual dependence and their postural stability and cognitive performance in a new discordant environment presented at the conclusion of training (Transfer Test). Our training system comprised a treadmill placed on a motion base facing a virtual visual scene that provided a variety of sensory challenges. Ten healthy adults completed 3 training sessions during which they walked on a treadmill at 1.1 m/s while receiving discordant support-surface and visual manipulations. At the first visit, in an analysis of normalized torso translation measured in a scene-movement-only condition, 3 of 10 subjects were classified as visually dependent. During the Transfer Test, all participants received a 2-minute novel exposure. In a combined measure of stride frequency and reaction time, the non-visually dependent subjects showed improved adaptation on the Transfer Test compared to their visually dependent counterparts. This finding suggests that individual differences in the ability to adapt to new sensorimotor conditions may be explained by individuals innate sensory biases. An accurate preflight assessment of crewmembers biases for visual dependence could be used to predict their propensities to adapt to novel sensory conditions. It may also facilitate the development of customized training regimens that could expedite adaptation to alternate gravitational environments.

  15. Dynamics of a Landau-Zener transitions in a two-level system driven by a dissipative environment

    NASA Astrophysics Data System (ADS)

    Ateuafack, M. E.; Diffo, J. T.; Fai, L. C.

    2016-02-01

    The paper investigates the effects of a two-level quantum system coupled to transversal and longitudinal dissipative environment. The time-dependent phase accumulation, LZ transition probability and entropy in the presence of fast-ohmic, sub-ohmic and super-ohmic quantum noise are derived. Analytical results are obtained in terms of temperature, dissipation strength, LZ parameter and bath cutoff frequency. The bath is observed to modify the standard occupation difference by a decaying random phase factor and also produces dephasing during the transfer of population. The dephasing characteristics or the initial non-zero decoherence rate are observed to increase in time with the bath temperature and depend on the system-bath coupling strength and cutoff frequency. These parameters are found to strongly affect the memory and thus tailor the coherence process of the system.

  16. Optical injection locking-based amplification in phase-coherent transfer of optical frequencies.

    PubMed

    Kim, Joonyoung; Schnatz, Harald; Wu, David S; Marra, Giuseppe; Richardson, David J; Slavík, Radan

    2015-09-15

    We demonstrate the use of an optical injection phase locked loop (OIPLL) as a regenerative amplifier for optical frequency transfer applications. The optical injection locking provides high gain within a narrow bandwidth (<100  MHz) and is capable of preserving the fractional frequency stability of the incoming carrier to better than 10(-18) at 1000 s. The OIPLL was tested in the field as a mid-span amplifier for the transfer of an ultrastable optical carrier, stabilized to an optical frequency standard, over a 292 km long installed dark fiber link. The transferred frequency at the remote end reached a fractional frequency instability of less than 1×10(-19) at averaging time of 3200 s.

  17. Analytical modeling and sensor monitoring for optimal processing of advanced textile structural composites by resin transfer molding

    NASA Technical Reports Server (NTRS)

    Loos, Alfred C.; Macrae, John D.; Hammond, Vincent H.; Kranbuehl, David E.; Hart, Sean M.; Hasko, Gregory H.; Markus, Alan M.

    1993-01-01

    A two-dimensional model of the resin transfer molding (RTM) process was developed which can be used to simulate the infiltration of resin into an anisotropic fibrous preform. Frequency dependent electromagnetic sensing (FDEMS) has been developed for in situ monitoring of the RTM process. Flow visualization tests were performed to obtain data which can be used to verify the sensor measurements and the model predictions. Results of the tests showed that FDEMS can accurately detect the position of the resin flow-front during mold filling, and that the model predicted flow-front patterns agreed well with the measured flow-front patterns.

  18. Mass transfer from a sphere in an oscillating flow with zero mean velocity

    NASA Technical Reports Server (NTRS)

    Drummond, Colin K.; Lyman, Frederic A.

    1990-01-01

    A pseudospectral numerical method is used for the solution of the Navier-Stokes and mass transport equations for a sphere in a sinusoidally oscillating flow with zero mean velocity. The flow is assumed laminar and axisymmetric about the sphere's polar axis. Oscillating flow results were obtained for Reynolds numbers (based on the free-stream oscillatory flow amplitude) between 1 and 150, and Strouhal numbers between 1 and 1000. Sherwood numbers were computed and their dependency on the flow frequency and amplitude discussed. An assessment of the validity of the quasi-steady assumption for mass transfer is based on these results.

  19. Measurement of visual contrast sensitivity

    NASA Astrophysics Data System (ADS)

    Vongierke, H. E.; Marko, A. R.

    1985-04-01

    This invention involves measurement of the visual contrast sensitivity (modulation transfer) function of a human subject by means of linear or circular spatial frequency pattern on a cathode ray tube whose contrast is automatically decreasing or increasing depending on the subject pressing or releasing a hand-switch button. The threshold of detection of the pattern modulation is found by the subject by adjusting the contrast to values which vary about the subject's threshold thereby determining the threshold and also providing by the magnitude of the contrast fluctuations between reversals some estimate of the variability of the subject's absolute threshold. The invention also involves the slow automatic sweeping of the spatial frequency of the pattern over the spatial frequencies after preset time intervals or after threshold has been defined at each frequency by a selected number of subject-determined threshold crossings; i.e., contrast reversals.

  20. Definitions of Frequency and Timing Terms, Satellite Navigation and Timing Systems, and the Behavior and Analyses of Precision Crystal and Atomic Frequency Standards and their Characteristics

    DTIC Science & Technology

    2009-05-01

    time transfer techniques has largely been due to the improvement in frequency standards. In this document, an effort was made to provide substantial...of RCC Document 214-94, contains definitions of frequency and timing terms, time transfer techniques and analysis, and behavior of crystal and atomic...Characteristics, May 2009 viii TTG Telecommunications and Timing Group TWSTFT Two-Way Satellite Time and Frequency Transfer U.S. United States USNO

  1. A Long-Term Comparison of GPS Carrierphase Frequency Transfer and Two-Way Satellite Time/Frequency Transfer

    DTIC Science & Technology

    2007-01-01

    and frequency transfer ( TWSTFT ) were performed along three transatlantic links over the 6-month period 29 January – 31 July 2006. The GPSCPFT and... TWSTFT results were subtracted in order to estimate the combined uncertainty of the methods. The frequency values obtained from GPSCPFT and TWSTFT ...values were equal to or less than the frequency-stability values σy(GPSCPFT) – y( TWSTFT ) (τ) (or TheoBR (τ)) computed for the corresponding averaging

  2. Analysis of FORTE data to extract ionospheric parameters

    NASA Astrophysics Data System (ADS)

    Roussel-Dupré, Robert A.; Jacobson, Abram R.; Triplett, Laurie A.

    2001-01-01

    The ionospheric transfer function is derived for a spherically symmetric ionosphere with an arbitrary radial electron density profile in the limit where the radio frequencies of interest ω are much larger than the plasma frequency ωpe. An expansion of the transfer function to second order in the parameter X (= ω2pe/ω2) is carried out. In this limit the dispersive properties of the ionosphere are manifested as a frequency-dependent time of arrival that includes quadratic, cubic, and quartic terms in 1/ω. The coefficients of these terms are related to the total electron content (TEC) along the slant path from transmitter to receiver, the product of TEC and the longitudinal magnetic field strength along the slant path, and refractive bending and higher-order electron density profile effects, respectively. By fitting the time of arrival versus frequency of a transionospheric signal to a polynomial in 1/ω it is possible to extract the TEC, the longitudinal magnetic field strength, the peak electron density, and an effective thickness for the ionosphere. This exercise was carried out for a number of transionospheric pulses measured in the VHF by the FORTE satellite receiver and generated by the Los Alamos Portable Pulser. The results are compared with predictions derived from the International Reference Ionosphere and the United States Geological Survey geomagnetic field model.

  3. Analysis and measurement of the modulation transfer function of harmonic shear wave induced phase encoding imaging.

    PubMed

    McAleavey, Stephen A

    2014-05-01

    Shear wave induced phase encoding (SWIPE) imaging generates ultrasound backscatter images of tissue-like elastic materials by using traveling shear waves to encode the lateral position of the scatters in the phase of the received echo. In contrast to conventional ultrasound B-scan imaging, SWIPE offers the potential advantages of image formation without beam focusing or steering from a single transducer element, lateral resolution independent of aperture size, and the potential to achieve relatively high lateral resolution with low frequency ultrasound. Here a Fourier series description of the phase modulated echo signal is developed, demonstrating that echo harmonics at multiples of the shear wave frequency reveal target k-space data at identical multiples of the shear wavenumber. Modulation transfer functions of SWIPE imaging systems are calculated for maximum shear wave acceleration and maximum shear constraints, and compared with a conventionally focused aperture. The relative signal-to-noise ratio of the SWIPE method versus a conventionally focused aperture is found through these calculations. Reconstructions of wire targets in a gelatin phantom using 1 and 3.5 MHz ultrasound and a cylindrical shear wave source are presented, generated from the fundamental and second harmonic of the shear wave modulation frequency, demonstrating weak dependence of lateral resolution with ultrasound frequency.

  4. Gap Detection and Temporal Modulation Transfer Function as Behavioral Estimates of Auditory Temporal Acuity Using Band-Limited Stimuli in Young and Older Adults

    PubMed Central

    Shen, Yi

    2015-01-01

    Purpose Gap detection and the temporal modulation transfer function (TMTF) are 2 common methods to obtain behavioral estimates of auditory temporal acuity. However, the agreement between the 2 measures is not clear. This study compares results from these 2 methods and their dependencies on listener age and hearing status. Method Gap detection thresholds and the parameters that describe the TMTF (sensitivity and cutoff frequency) were estimated for young and older listeners who were naive to the experimental tasks. Stimuli were 800-Hz-wide noises with upper frequency limits of 2400 Hz, presented at 85 dB SPL. A 2-track procedure (Shen & Richards, 2013) was used for the efficient estimation of the TMTF. Results No significant correlation was found between gap detection threshold and the sensitivity or the cutoff frequency of the TMTF. No significant effect of age and hearing loss on either the gap detection threshold or the TMTF cutoff frequency was found, while the TMTF sensitivity improved with increasing hearing threshold and worsened with increasing age. Conclusion Estimates of temporal acuity using gap detection and TMTF paradigms do not seem to provide a consistent description of the effects of listener age and hearing status on temporal envelope processing. PMID:25087722

  5. Coverage dependent non-adiabaticity of CO on a copper surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Omiya, Takuma; Surface and Interface Science Laboratory, RIKEN, Wako 351-0198; Arnolds, Heike

    2014-12-07

    We have studied the coverage-dependent energy transfer dynamics between hot electrons and CO on Cu(110) with femtosecond visible pump, sum frequency probe spectroscopy. We find that transients of the C–O stretch frequency display a red shift, which increases from 3 cm{sup −1} at 0.1 ML to 9 cm{sup −1} at 0.77 ML. Analysis of the transients reveals that the non-adiabatic coupling between the adsorbate vibrational motion and the electrons becomes stronger with increasing coverage. This trend requires the frustrated rotational mode to be the cause of the non-adiabatic behavior, even for relatively weak laser excitation of the adsorbate. We attributemore » the coverage dependence to both an increase in the adsorbate electronic density of states and an increasingly anharmonic potential energy surface caused by repulsive interactions between neighboring CO adsorbates. This work thus reveals adsorbate-adsorbate interactions as a new way to control adsorbate non-adiabaticity.« less

  6. Accuracy and Precision of USNO GPS Carrier-Phase Time Transfer

    DTIC Science & Technology

    2010-01-01

    values. Comparison measures used include estimates obtained from two-way satellite time/frequency transfer ( TWSTFT ), and GPS-based estimates obtained...the IGS are used as a benchmark in the computation. Frequency values have a few times 10 -15 fractional frequency uncertainty. TWSTFT values confirm...obtained from two-way satellite time/frequency transfer ( TWSTFT ), BIPM Circular T, and the International GNSS Service (IGS). At present, it is known that

  7. Evaluating psychological markers for human nicotine dependence: tobacco choice, extinction, and Pavlovian-to-instrumental transfer.

    PubMed

    Hogarth, Lee; Chase, Henry W

    2012-06-01

    Individual differences in drug dependence may be mediated by several abnormalities in associative learning, including perseveration of drug-seeking following contingency change, greater control over drug-seeking by Pavlovian stimuli, or greater sensitivity to drug reinforcement establishing higher rates of drug-seeking. To evaluate these three candidate markers for nicotine dependence, Experiment 1 contrasted daily (N = 22) and nondaily smoker groups (N = 22) on a novel instrumental learning task, where one S+ was first trained as a predictor of tobacco reward before being extinguished. Experiment 2 compared daily (N = 18) and nondaily smoker groups (N = 18) on a concurrent-choice task for tobacco and chocolate reward before an extinction test in which the tobacco response was extinguished, followed by a Pavlovian-to-instrumental transfer test, wherein the impact of tobacco and chocolate cues on concurrent choice was measured (gender was balanced within each smoker group). The results showed no group difference in sensitivity to extinction of either the stimulus-drug or response-drug contingency in Experiments 1 and 2, respectively, nor did groups show a difference in Pavlovian-to-instrumental transfer of control over tobacco choice. By contrast, nicotine-dependence status was marked by a higher frequency of tobacco choice in the concurrent-choice procedure, and this choice preference was associated with subjective craving (gender did not affect any behavioral measure). These results favor the view that nicotine dependence in this sample is not determined by individual predilection for perseveration or stimulus-control over drug-seeking, but by greater sensitivity to reinforcement of instrumental drug choice. Value-based decision theories of dependence are discussed.

  8. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2012-01-01

    Satellite Time Transfer (TWSTT), also referred to as Two-Way Satellite Time and Frequency Transfer ( TWSTFT ) The most accurate means of operational long...satellite broadcasts, and the BIPM uses that reported by the Observatory of Paris (OP), transferred to the BIPM via TWSTFT . This is compared to...Frequency Transfer ( TWSTFT ),” Review of Radio Science (Oxford Science Publications), pp. 27-44. [25] L. A. Breakiron, A. L. Smith, B. C. Fonville

  9. Spin-locking vs. chemical exchange saturation transfer MRI for investigating chemical exchange process between water and labile metabolite protons

    PubMed Central

    Jin, Tao; Autio, Joonas; Obata, Takayuki; Kim, Seong-Gi

    2010-01-01

    Chemical exchange saturation transfer (CEST) and spin-locking (SL) experiments were both able to probe the exchange process between protons of non-equivalent chemical environments. To compare the characteristics of the CEST and SL approaches in the study of chemical exchange effects, we performed CEST and SL experiments at varied pH and concentrated metabolites with exchangeable amide, amine, and hydroxyl protons at 9.4 T. Our results show that: i) On-resonance SL is most sensitive to chemical exchanges in the intermediate exchange regime and is able to detect hydroxyl and amine protons on a millimolar concentration scale. Off-resonance SL and CEST approaches are sensitive to slow-exchanging protons when an optimal SL or saturation pulse power matches the exchanging rate, respectively. ii) Offset frequency-dependent SL and CEST spectra are very similar, and can be explained well with an SL model recently developed by Trott and Palmer. iii) The exchange rate and population of metabolite protons can be determined from offset-dependent SL or CEST spectra or from on-resonance SL relaxation dispersion measurements. iv) The asymmetry of the magnetization transfer ratio (MTRasym) is highly dependent on the choice of saturation pulse power. In the intermediate exchange regime, MTRasym becomes complicated and should be interpreted with care. PMID:21500270

  10. IHF-independent assembly of the Tn10 strand transfer transpososome: implications for inhibition of disintegration.

    PubMed

    Stewart, Barry J; Wardle, Simon J; Haniford, David B

    2002-08-15

    The frequency of DNA transposition in transposition systems that employ a strand transfer step may be significantly affected by the occurrence of a disintegration reaction, a reaction that reverses the strand transfer event. We have asked whether disintegration occurs in the Tn10 transposition system. We show that disintegration substrates (substrates constituting one half of the strand transfer product) are assembled into a transpososome that mimics the strand transfer intermediate. This strand transfer transpososome (STT) does appear to support an intermolecular disintegration reaction, but only at a very low level. Strikingly, assembly of the STT is not dependent on IHF, a host protein that is required for de novo assembly of all previously characterized Tn10 transpososomes. We suggest that disintegration substrates are able to form both transposon end and target type contacts with transposase because of their enhanced conformational flexibility. This probably allows the conformation of DNA within the complex that prevents the destructive disintegration reaction, and is responsible for relaxing the DNA sequence requirements for STT formation relative to other Tn10 transpososomes.

  11. IHF-independent assembly of the Tn10 strand transfer transpososome: implications for inhibition of disintegration

    PubMed Central

    Stewart, Barry J.; Wardle, Simon J.; Haniford, David B.

    2002-01-01

    The frequency of DNA transposition in transposition systems that employ a strand transfer step may be significantly affected by the occurrence of a disintegration reaction, a reaction that reverses the strand transfer event. We have asked whether disintegration occurs in the Tn10 transposition system. We show that disintegration substrates (substrates constituting one half of the strand transfer product) are assembled into a transpososome that mimics the strand transfer intermediate. This strand transfer transpososome (STT) does appear to support an intermolecular disintegration reaction, but only at a very low level. Strikingly, assembly of the STT is not dependent on IHF, a host protein that is required for de novo assembly of all previously characterized Tn10 transpososomes. We suggest that disintegration substrates are able to form both transposon end and target type contacts with transposase because of their enhanced conformational flexibility. This probably allows the conformation of DNA within the complex that prevents the destructive disintegration reaction, and is responsible for relaxing the DNA sequence requirements for STT formation relative to other Tn10 transpososomes. PMID:12169640

  12. Heat transfer between a heated plate and an impinging transient diesel spray

    NASA Astrophysics Data System (ADS)

    Arcoumanis, C.; Chang, J.-C.

    1993-12-01

    An experimental investigation was performed to determine the heat-transfer distribution in the vicinity of a transient diesel spray impinging on a heated flat plate. The spray prior to impingement was characterised in terms of simultaneous droplet sizes and velocities by phase-Doppler anemometry while during its impingement on the plate, which was heated at temperatures between 150 205°C, the instantaneous surface temperature and associated rates of wall heat transfer were monitored by fast response thermocouples. The parameters examined in this work included the distance between the nozzle and the wall surface, the radial distance from the impingement point, the injection frequency, the injected volume and the pre-impingement wall temperature. The results showed that the wall heat transfer rates are dependent on the spray characteristics prior to impingement; the higher the “velocity of arrival” of the droplet is, the higher the heat transfer. A correlation was thus developed for the instantaneous and spatially-resolved spray/wall heat transfer based on experimentally-determined Nusselt, Reynolds, Prandtl and Weber numbers over a wide range of test conditions.

  13. Stable radio frequency dissemination by simple hybrid frequency modulation scheme.

    PubMed

    Yu, Longqiang; Wang, Rong; Lu, Lin; Zhu, Yong; Wu, Chuanxin; Zhang, Baofu; Wang, Peizhang

    2014-09-15

    In this Letter, we propose a fiber-based stable radio frequency transfer system by a hybrid frequency modulation scheme. Creatively, two radio frequency signals are combined and simultaneously transferred by only one laser diode. One frequency component is used to detect the phase fluctuation, and the other one is the derivative compensated signal providing a stable frequency for the remote end. A proper ratio of the frequencies of the components is well maintained by parameter m to avoid interference between them. Experimentally, a stable 200 MHz signal is transferred over 100 km optical fiber with the help of a 1 GHz detecting signal, and fractional instability of 2×10(-17) at 10(5) s is achieved.

  14. The Sound Broadcasting System of the Bullfrog

    NASA Astrophysics Data System (ADS)

    Purgue, Alejandro P.

    1995-01-01

    This work presents a comparison across selected species of several aspects of the mechanism of sound broadcasting in anuran amphibians. These studies indicate that all anuran species studied to date broadcast their calls through structures that resonate at the dominant frequency in their calls. Measurements of the magnitude of the transfer function of the radiating structures show that the structures responsible for radiating the bulk of the energy present in the call vary depending on the species considered. Bullfrogs (Rana catesbeiana) radiate most of the energy (89% sound level) present in their calls through their eardrums. In this species the transfer function of the eardrum displays several peaks coincident in frequency and amplitude with the energy distribution observed in the mating and release call of the species. The vocal sac and gular area contribute energy only in the lower band (150 to 400 Hz) of the call. The ears are responsible for radiating additional frequency bands to the ones being radiated through the gular area and vocal sacs. This condition appears to be derived. In Rana pipiens the ears also broadcast a significant portion of the energy present in the call (63% sound level) but the frequencies of the aural emissions are a subset of those frequencies radiated through the vocal sac and gular area. Character optimization suggests that this is the primitive condition for ranid frogs. Finally, the barking treefrog (Hyla gratiosa) appears to use two different structures to radiate different portions of the call. The low frequency band appears to be preferentially radiated through the lungs while the high frequency components of the call are radiated through the vocal sac.

  15. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2010-01-01

    TWSTT, ALSO REFERRED TO AS TWO-WAY SATELLITE TIME AND FREQUENCY TRANSFER ( TWSTFT ) The most accurate means of operational long-distance time...Frequency Transfer ( TWSTFT ),” Review of Radio Science (Oxford Science Publications), pp. 27-44. [25] L. A. Breakiron, A. L. Smith, B. C. Fonville, E...Breakiron, A. Bauch, D. Piester, D., and Z. Jiang, 2009, “Two-Way Satellite Time and Frequency ( TWSTFT ) Transfer Calibration Constancy from Closure

  16. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2009-11-01

    Massachusetts, USA (Institute of Navigation, Alexandria, Virginia). [22] D. Kirchner, 1999, “Two Way Satellite Time and Frequency Transfer ( TWSTFT ...Piester, D., and Z. Jiang, 2009, “Two-Way Satellite Time and Frequency ( TWSTFT ) Transfer Calibration Constancy from Closure Sums,” in Proceedings of...Shäfer, and A. Pawlitzki, 2005, “Development of Carrier- Phase-Based Two-Way Satellite Time and Frequency Transfer ( TWSTFT ),” in Proceedings of the 36 th

  17. Modeling and Assessment of Precise Time Transfer by Using BeiDou Navigation Satellite System Triple-Frequency Signals.

    PubMed

    Tu, Rui; Zhang, Pengfei; Zhang, Rui; Liu, Jinhai; Lu, Xiaochun

    2018-03-29

    This study proposes two models for precise time transfer using the BeiDou Navigation Satellite System triple-frequency signals: ionosphere-free (IF) combined precise point positioning (PPP) model with two dual-frequency combinations (IF-PPP1) and ionosphere-free combined PPP model with a single triple-frequency combination (IF-PPP2). A dataset with a short baseline (with a common external time frequency) and a long baseline are used for performance assessments. The results show that IF-PPP1 and IF-PPP2 models can both be used for precise time transfer using BeiDou Navigation Satellite System (BDS) triple-frequency signals, and the accuracy and stability of time transfer is the same in both cases, except for a constant system bias caused by the hardware delay of different frequencies, which can be removed by the parameter estimation and prediction with long time datasets or by a priori calibration.

  18. Theoretical analysis of the unusual temperature dependence of the kinetic isotope effect in quinol oxidation.

    PubMed

    Ludlow, Michelle K; Soudackov, Alexander V; Hammes-Schiffer, Sharon

    2009-05-27

    In this paper we present theoretical calculations on model biomimetic systems for quinol oxidation. In these model systems, an excited-state [Ru(bpy)(2)(pbim)](+) complex (bpy = 2,2'-dipyridyl, pbim = 2-(2-pyridyl)benzimidazolate) oxidizes a ubiquinol or plastoquinol analogue in acetonitrile. The charge transfer reaction occurs via a proton-coupled electron transfer (PCET) mechanism, in which an electron is transferred from the quinol to the Ru and a proton is transferred from the quinol to the pbim(-) ligand. The experimentally measured average kinetic isotope effects (KIEs) at 296 K are 1.87 and 3.45 for the ubiquinol and plastoquinol analogues, respectively, and the KIE decreases with temperature for plastoquinol but increases with temperature for ubiquinol. The present calculations provide a possible explanation for the differences in magnitudes and temperature dependences of the KIEs for the two systems and, in particular, an explanation for the unusual inverse temperature dependence of the KIE for the ubiquinol analogue. These calculations are based on a general theoretical formulation for PCET reactions that includes quantum mechanical effects of the electrons and transferring proton, as well as the solvent reorganization and proton donor-acceptor motion. The physical properties of the system that enable the inverse temperature dependence of the KIE are a stiff hydrogen bond, which corresponds to a high-frequency proton donor-acceptor motion, and small inner-sphere and solvent reorganization energies. The inverse temperature dependence of the KIE may be observed if the 0/0 pair of reactant/product vibronic states is in the inverted Marcus region, while the 0/1 pair of reactant/product vibronic states is in the normal Marcus region and is the dominant contributor to the overall rate. In this case, the free energy barrier for the dominant transition is lower for deuterium than for hydrogen because of the smaller splittings between the vibronic energy levels for deuterium, and the KIE increases with increasing temperature. The temperature dependence of the KIE is found to be very sensitive to the interplay among the driving force, the reorganization energy, and the vibronic coupling in this regime.

  19. Direction of information flow in large-scale resting-state networks is frequency-dependent.

    PubMed

    Hillebrand, Arjan; Tewarie, Prejaas; van Dellen, Edwin; Yu, Meichen; Carbo, Ellen W S; Douw, Linda; Gouw, Alida A; van Straaten, Elisabeth C W; Stam, Cornelis J

    2016-04-05

    Normal brain function requires interactions between spatially separated, and functionally specialized, macroscopic regions, yet the directionality of these interactions in large-scale functional networks is unknown. Magnetoencephalography was used to determine the directionality of these interactions, where directionality was inferred from time series of beamformer-reconstructed estimates of neuronal activation, using a recently proposed measure of phase transfer entropy. We observed well-organized posterior-to-anterior patterns of information flow in the higher-frequency bands (alpha1, alpha2, and beta band), dominated by regions in the visual cortex and posterior default mode network. Opposite patterns of anterior-to-posterior flow were found in the theta band, involving mainly regions in the frontal lobe that were sending information to a more distributed network. Many strong information senders in the theta band were also frequent receivers in the alpha2 band, and vice versa. Our results provide evidence that large-scale resting-state patterns of information flow in the human brain form frequency-dependent reentry loops that are dominated by flow from parieto-occipital cortex to integrative frontal areas in the higher-frequency bands, which is mirrored by a theta band anterior-to-posterior flow.

  20. Nonreciprocity in the dynamics of coupled oscillators with nonlinearity, asymmetry, and scale hierarchy

    NASA Astrophysics Data System (ADS)

    Moore, Keegan J.; Bunyan, Jonathan; Tawfick, Sameh; Gendelman, Oleg V.; Li, Shuangbao; Leamy, Michael; Vakakis, Alexander F.

    2018-01-01

    In linear time-invariant dynamical and acoustical systems, reciprocity holds by the Onsager-Casimir principle of microscopic reversibility, and this can be broken only by odd external biases, nonlinearities, or time-dependent properties. A concept is proposed in this work for breaking dynamic reciprocity based on irreversible nonlinear energy transfers from large to small scales in a system with nonlinear hierarchical internal structure, asymmetry, and intentional strong stiffness nonlinearity. The resulting nonreciprocal large-to-small scale energy transfers mimic analogous nonlinear energy transfer cascades that occur in nature (e.g., in turbulent flows), and are caused by the strong frequency-energy dependence of the essentially nonlinear small-scale components of the system considered. The theoretical part of this work is mainly based on action-angle transformations, followed by direct numerical simulations of the resulting system of nonlinear coupled oscillators. The experimental part considers a system with two scales—a linear large-scale oscillator coupled to a small scale by a nonlinear spring—and validates the theoretical findings demonstrating nonreciprocal large-to-small scale energy transfer. The proposed study promotes a paradigm for designing nonreciprocal acoustic materials harnessing strong nonlinearity, which in a future application will be implemented in designing lattices incorporating nonlinear hierarchical internal structures, asymmetry, and scale mixing.

  1. Evolutionary maintenance of selfish homing endonuclease genes in the absence of horizontal transfer.

    PubMed

    Yahara, Koji; Fukuyo, Masaki; Sasaki, Akira; Kobayashi, Ichizo

    2009-11-03

    Homing endonuclease genes are "selfish" mobile genetic elements whose endonuclease promotes the spread of its own gene by creating a break at a specific target site and using the host machinery to repair the break by copying and inserting the gene at this site. Horizontal transfer across the boundary of a species or population within which mating takes place has been thought to be necessary for their evolutionary persistence. This is based on the assumption that they will become fixed in a host population, where opportunities of homing will disappear, and become susceptible to degeneration. To test this hypothesis, we modeled behavior of a homing endonuclease gene that moves during meiosis through double-strand break repair. We mathematically explored conditions for persistence of the homing endonuclease gene and elucidated their parameter dependence as phase diagrams. We found that, if the cost of the pseudogene is lower than that of the homing endonuclease gene, the 2 forms can persist in a population through autonomous periodic oscillation. If the cost of the pseudogene is higher, 2 types of dynamics appear that enable evolutionary persistence: bistability dependent on initial frequency or fixation irrespective of initial frequency. The prediction of long persistence in the absence of horizontal transfer was confirmed by stochastic simulations in finite populations. The average time to extinction of the endonuclease gene was found to be thousands of meiotic generations or more based on realistic parameter values. These results provide a solid theoretical basis for an understanding of these and other extremely selfish elements.

  2. Evolutionary maintenance of selfish homing endonuclease genes in the absence of horizontal transfer

    PubMed Central

    Yahara, Koji; Fukuyo, Masaki; Sasaki, Akira; Kobayashi, Ichizo

    2009-01-01

    Homing endonuclease genes are “selfish” mobile genetic elements whose endonuclease promotes the spread of its own gene by creating a break at a specific target site and using the host machinery to repair the break by copying and inserting the gene at this site. Horizontal transfer across the boundary of a species or population within which mating takes place has been thought to be necessary for their evolutionary persistence. This is based on the assumption that they will become fixed in a host population, where opportunities of homing will disappear, and become susceptible to degeneration. To test this hypothesis, we modeled behavior of a homing endonuclease gene that moves during meiosis through double-strand break repair. We mathematically explored conditions for persistence of the homing endonuclease gene and elucidated their parameter dependence as phase diagrams. We found that, if the cost of the pseudogene is lower than that of the homing endonuclease gene, the 2 forms can persist in a population through autonomous periodic oscillation. If the cost of the pseudogene is higher, 2 types of dynamics appear that enable evolutionary persistence: bistability dependent on initial frequency or fixation irrespective of initial frequency. The prediction of long persistence in the absence of horizontal transfer was confirmed by stochastic simulations in finite populations. The average time to extinction of the endonuclease gene was found to be thousands of meiotic generations or more based on realistic parameter values. These results provide a solid theoretical basis for an understanding of these and other extremely selfish elements. PMID:19837694

  3. Characteristics of low-temperature short heat pipes with a nozzle-shaped vapor channel

    NASA Astrophysics Data System (ADS)

    Seryakov, A. V.

    2016-01-01

    This paper presents the results of experimental and numerical studies of heat transfer and swirling pulsating flows in short low-temperature heat pipes whose vapor channels have the form of a conical nozzle. It has been found that as the evaporator of the heat pipe is heated, pressure pulsations occur in the vapor channel starting at a certain threshold value of the heat power, which is due to the start of boiling in the evaporator. The frequency of the pulsations has been measured, and their dependence on the superheat of the evaporator has been determined. It has been found that in heat pipes with a conical vapor channel, pulsations occur at lower evaporator superheats and the pulsation frequency is greater than in heat pipes of the same size with a standard cylindrical vapor channel. It has been shown that the curve of the heat-transfer coefficient versus thermal load on the evaporator has an inflection corresponding to the start of boiling in the capillary porous evaporator of the heat pipe.

  4. Concept of contrast transfer function for edge illumination x-ray phase-contrast imaging and its comparison with the free-space propagation technique.

    PubMed

    Diemoz, Paul C; Vittoria, Fabio A; Olivo, Alessandro

    2016-05-16

    Previous studies on edge illumination (EI) X-ray phase-contrast imaging (XPCi) have investigated the nature and amplitude of the signal provided by this technique. However, the response of the imaging system to different object spatial frequencies was never explicitly considered and studied. This is required in order to predict the performance of a given EI setup for different classes of objects. To this scope, in the present work we derive analytical expressions for the contrast transfer function of an EI imaging system, using the approximation of near-field regime, and study its dependence upon the main experimental parameters. We then exploit these results to compare the frequency response of an EI system with respect of that of a free-space propagation XPCi one. The results achieved in this work can be useful for predicting the signals obtainable for different types of objects and also as a basis for new retrieval methods.

  5. Investigation and optimization of low-frequency noise performance in readout electronics of dc superconducting quantum interference device

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Jing; Peter Grünberg Institute; Zhang, Yi

    2014-05-15

    We investigated and optimized the low-frequency noise characteristics of a preamplifier used for readout of direct current superconducting quantum interference devices (SQUIDs). When the SQUID output was detected directly using a room-temperature low-voltage-noise preamplifier, the low-frequency noise of a SQUID system was found to be dominated by the input current noise of the preamplifiers in case of a large dynamic resistance of the SQUID. To reduce the current noise of the preamplifier in the low-frequency range, we investigated the dependence of total preamplifier noise on the collector current and source resistance. When the collector current was decreased from 8.4 mAmore » to 3 mA in the preamplifier made of 3 parallel SSM2220 transistor pairs, the low-frequency total voltage noise of the preamplifier (at 0.1 Hz) decreased by about 3 times for a source resistance of 30 Ω whereas the white noise level remained nearly unchanged. Since the relative contribution of preamplifier's input voltage and current noise is different depending on the dynamic resistance or flux-to-voltage transfer of the SQUID, the results showed that the total noise of a SQUID system at low-frequency range can be improved significantly by optimizing the preamplifier circuit parameters, mainly the collector current in case of low-noise bipolar transistor pairs.« less

  6. Investigation and optimization of low-frequency noise performance in readout electronics of dc superconducting quantum interference device

    NASA Astrophysics Data System (ADS)

    Zhao, Jing; Zhang, Yi; Lee, Yong-Ho; Krause, Hans-Joachim

    2014-05-01

    We investigated and optimized the low-frequency noise characteristics of a preamplifier used for readout of direct current superconducting quantum interference devices (SQUIDs). When the SQUID output was detected directly using a room-temperature low-voltage-noise preamplifier, the low-frequency noise of a SQUID system was found to be dominated by the input current noise of the preamplifiers in case of a large dynamic resistance of the SQUID. To reduce the current noise of the preamplifier in the low-frequency range, we investigated the dependence of total preamplifier noise on the collector current and source resistance. When the collector current was decreased from 8.4 mA to 3 mA in the preamplifier made of 3 parallel SSM2220 transistor pairs, the low-frequency total voltage noise of the preamplifier (at 0.1 Hz) decreased by about 3 times for a source resistance of 30 Ω whereas the white noise level remained nearly unchanged. Since the relative contribution of preamplifier's input voltage and current noise is different depending on the dynamic resistance or flux-to-voltage transfer of the SQUID, the results showed that the total noise of a SQUID system at low-frequency range can be improved significantly by optimizing the preamplifier circuit parameters, mainly the collector current in case of low-noise bipolar transistor pairs.

  7. Effect of the scattering delay on time-dependent photon migration in turbid media.

    PubMed

    Yaroslavsky, I V; Yaroslavsky, A N; Tuchin, V V; Schwarzmaier, H J

    1997-09-01

    We modified the diffusion approximation of the time-dependent radiative transfer equation to account for a finite scattering delay time. Under the usual assumptions of the diffusion approximation, the effect of the scattering delay leads to a simple renormalization of the light velocity that appears in the diffusion equation. Accuracy of the model was evaluated by comparison with Monte Carlo simulations in the frequency domain for a semi-infinite geometry. A good agreement is demonstrated for both matched and mismatched boundary conditions when the distance from the source is sufficiently large. The modified diffusion model predicts that the neglect of the scattering delay when the optical properties of the turbid material are derived from normalized frequency- or time-domain measurements should result in an underestimation of the absorption coefficient and an overestimation of the transport coefficient. These observations are consistent with the published experimental data.

  8. Frequency-dependent absorbance of broadband terahertz wave in dense plasma sheet

    NASA Astrophysics Data System (ADS)

    Peng, Yan; Qi, Binbin; Jiang, Xiankai; Zhu, Zhi; Zhao, Hongwei; Zhu, Yiming

    2018-05-01

    Due to the ability of accurate fingerprinting and low-ionization for different substances, terahertz (THz) technology has a lot of crucial applications in material analysis, information transfer, and safety inspection, etc. However, the spectral characteristic of atmospheric gas and ionized gas has not been widely investigated, which is important for the remote sensing application. Here, in this paper, we investigate the absorbance of broadband terahertz wave in dense plasma sheet generated by femtosecond laser pulses. It was found that as the terahertz wave transmits through the plasma sheet formed, respectively, in carbon dioxide, oxygen, argon and nitrogen, spectrum presents completely different and frequency-dependent absorbance. The reasons for these absorption peaks are related to the molecular polarity, electric charge, intermolecular and intramolecular interactions, and collisional absorption of gas molecules. These results have significant implications for the remote sensing of gas medium.

  9. Simultaneous backward data transmission and power harvesting in an ultrasonic transcutaneous energy transfer link employing acoustically dependent electric impedance modulation.

    PubMed

    Ozeri, Shaul; Shmilovitz, Doron

    2014-09-01

    The advancement and miniaturization of body implanted medical devices pose several challenges to Ultrasonic Transcutaneous Energy Transfer (UTET), such as the need to reduce the size of the piezoelectric resonator, and the need to maximize the UTET link power-transfer efficiency. Accordingly, the same piezoelectric resonator that is used for energy harvesting at the body implant, may also be used for ultrasonic backward data transfer, for instance, through impedance modulation. This paper presents physical considerations and design guidelines of the body implanted transducer of a UTET link with impedance modulation for a backward data transfer. The acoustic matching design procedure was based on the 2×2 transfer matrix chain analysis, in addition to the Krimholtz Leedom and Matthaei KLM transmission line model. The UTET power transfer was carried out at a frequency of 765 kHz, continuous wave (CW) mode. The backward data transfer was attained by inserting a 9% load resistance variation around its matched value (550 Ohm), resulting in a 12% increase in the acoustic reflection coefficient. A backward data transmission rate of 1200 bits/s was experimentally demonstrated using amplitude shift keying, simultaneously with an acoustic power transfer of 20 mW to the implant. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Ultrafast direct electron transfer at organic semiconductor and metal interfaces.

    PubMed

    Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei

    2017-11-01

    The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.

  11. Characterization of optical frequency transfer over 154  km of aerial fiber.

    PubMed

    Gozzard, David R; Schediwy, Sascha W; Wallace, Bruce; Gamatham, Romeo; Grainge, Keith

    2017-06-01

    We present measurements of the frequency transfer stability and analysis of the noise characteristics of an optical signal propagating over aerial suspended fiber links up to 153.6 km in length. The measured frequency transfer stability over these links is on the order of 10-11 at an integration time of 1 s dropping to 10-12 for integration times longer than 100 s. We show that wind-loading of the cable spans is the dominant source of short-timescale noise on the fiber links. We also report an attempt to stabilize the optical frequency transfer over these aerial links.

  12. Computer method for identification of boiler transfer functions

    NASA Technical Reports Server (NTRS)

    Miles, J. H.

    1972-01-01

    Iterative computer aided procedure was developed which provides for identification of boiler transfer functions using frequency response data. Method uses frequency response data to obtain satisfactory transfer function for both high and low vapor exit quality data.

  13. Excited-state dynamics of size-dependent colloidal TiO2-Au nanocomposites

    NASA Astrophysics Data System (ADS)

    Karam, Tony E.; Khoury, Rami A.; Haber, Louis H.

    2016-03-01

    The ultrafast excited-state dynamics of size-dependent TiO2-Au nanocomposites synthesized by reducing gold nanoclusters to the surface of colloidal TiO2 nanoparticles are studied using pump-probe transient absorption spectroscopy with 400 nm excitation pulses. The results show that the relaxation processes of the plasmon depletion band, which are described by electron-phonon and phonon-phonon scattering lifetimes, are independent of the gold nanocluster shell size surrounding the TiO2 nanoparticle core. The dynamics corresponding to interfacial electron transfer between the gold nanoclusters and the TiO2 bandgap are observed to spectrally overlap with the gold interband transition signal, and the electron transfer lifetimes are shown to significantly decrease as the nanocluster shell size increases. Additionally, size-dependent periodic oscillations are observed and are attributed to acoustic phonons of a porous shell composed of aggregated gold nanoclusters around the TiO2 core, with frequencies that decrease and damping times that remain constant as the nanocluster shell size increases. These results are important for the development of improved catalytic nanomaterial applications.

  14. Role of Frequency Chirp and Energy Flow Directionality in the Strong Coupling Regime of Brillouin-Based Plasma Amplification.

    PubMed

    Chiaramello, M; Amiranoff, F; Riconda, C; Weber, S

    2016-12-02

    A detailed analysis is presented of the various stages of strong coupling Brillouin plasma amplification, emphasizing the importance of the chirp which can be of threefold origin: the intrinsic one driven by the amplification process, the one originating from the chirped-pulse-generated laser pulses, and the one associated with the plasma profile. Control of the overall chirp can optimize or quench the energy transfer. The time-dependent phase relation explains the energy flow direction during amplification and is characteristic for this strong coupling process. The study is also of potential importance to understand and maybe control cross-beam-energy transfer in inertial confinement fusion.

  15. Infiltration/cure modeling of resin transfer molded composite materials using advanced fiber architectures

    NASA Technical Reports Server (NTRS)

    Loos, Alfred C.; Weideman, Mark H.; Long, Edward R., Jr.; Kranbuehl, David E.; Kinsley, Philip J.; Hart, Sean M.

    1991-01-01

    A model was developed which can be used to simulate infiltration and cure of textile composites by resin transfer molding. Fabric preforms were resin infiltrated and cured using model generated optimized one-step infiltration/cure protocols. Frequency dependent electromagnetic sensing (FDEMS) was used to monitor in situ resin infiltration and cure during processing. FDEMS measurements of infiltration time, resin viscosity, and resin degree of cure agreed well with values predicted by the simulation model. Textile composites fabricated using a one-step infiltration/cure procedure were uniformly resin impregnated and void free. Fiber volume fraction measurements by the resin digestion method compared well with values predicted using the model.

  16. Conductivity measurements on CdCl2 doped PVA solid polymeric electrolyte for battery application

    NASA Astrophysics Data System (ADS)

    Baraker, Basavarajeshwari M.; Lobo, Blaise

    2018-04-01

    Ionic conductivity of pure polyvinyl alcohol (PVA) and 6.3 wt% of CdCl2 doped PVA solid polymeric electrolyte have been studied using DC and AC electrical measurements. From DC electrical results, the determination transference number confirmed that ions are the dominant charge carriers in CdCl2 doped PVA. Interestingly, the ion transference number (ti) for 6.3 wt% CdCl2 doped sample is significantly more (0.993), when compared to that of pure PVA (for which, ti is 0.988). Temperature dependent dielectric studies showed interesting results at different frequencies: 120 Hz, 500 Hz, 1 kHz, 5 kHz, 10 kHz and 100 kHz.

  17. Frequency-selective near-field radiative heat transfer between photonic crystal slabs: a computational approach for arbitrary geometries and materials.

    PubMed

    Rodriguez, Alejandro W; Ilic, Ognjen; Bermel, Peter; Celanovic, Ivan; Joannopoulos, John D; Soljačić, Marin; Johnson, Steven G

    2011-09-09

    We demonstrate the possibility of achieving enhanced frequency-selective near-field radiative heat transfer between patterned (photonic-crystal) slabs at designable frequencies and separations, exploiting a general numerical approach for computing heat transfer in arbitrary geometries and materials based on the finite-difference time-domain method. Our simulations reveal a tradeoff between selectivity and near-field enhancement as the slab-slab separation decreases, with the patterned heat transfer eventually reducing to the unpatterned result multiplied by a fill factor (described by a standard proximity approximation). We also find that heat transfer can be further enhanced at selective frequencies when the slabs are brought into a glide-symmetric configuration, a consequence of the degeneracies associated with the nonsymmorphic symmetry group.

  18. The Influence of Static and Rotating Magnetic Fields on Heat and Mass Transfer in Silicon Floating Zones

    NASA Technical Reports Server (NTRS)

    Croell, Arne; Dold, P.; Kaiser, Th.; Szofran, Frank; Benz, K. W.

    1999-01-01

    Hear and mass transfer in float-zone processing are strongly influenced by convective flows in the zone. They are caused by buoyancy convection, thermocapillary (Marangoni) convection, or artificial sources such as rotation and radio frequency heating. Flows in conducting melts can be controlled by the use of magnetic fields, either by damping fluid motion with static fields or by generating a def@ned flow with rotating fields. The possibilities of using static and rotating magnetic fields in silicon floating-zone growth have been investigated by experiments in axial static fields up to ST and in transverse rotating magnetic fields up to 7.S mT. Static fields of a few 100 MT already suppress most striations but are detrimental to the radial segregation by introducing a coring effect. A complete suppression of dopant striations caused by time-dependent thermocapillary convection and a reduction of the coring to insignificant values, combined with a shift of the axial segregation profile towards a more diffusion-limited case, is possible with static fields ? 1T. However, under certain conditions the use of high axial magnetic fields can lead to the appearance of a new type of pronounced dopant striations, caused by thermoelec:romagnetic convection. The use of a transverse rotating magnetic field influences the microscopic segregation at quite low inductions, of the order of a few mT. The field shifts time-dependent flows and the resulting striation patterns from a broad range of low frequencies at high amplitudes to a few high frequencies at low amplitudes

  19. The Influence of Static and Rotating Magnetic Fields on Heat and Mass Transfer in Silicon Floating Zones

    NASA Technical Reports Server (NTRS)

    Croll, A.; Dold, P.; Kaiser, Th.; Szofran, F. R.; Benz, K. W.

    1999-01-01

    Heat and mass transfer in float-zone processing are strongly influenced by convective flows in the zone. They are caused by buoyancy convection, thermocapillary (Marangoni) convection, or artificial sources such as rotation and radio-frequency heating. Flows in conducting melts can be controlled by the use of magnetic fields, either by damping fluid motion with static fields or by generating a defined flow with rotating fields. The possibilities of using static and rotating magnetic fields in silicon floating-zone growth have been investigated by experiments in axial static fields up to 5 T and in transverse rotating magnetic fields up to 7.5 mT. Static fields of a few 100 mT already suppress most striations but are detrimental to the radial segregation by introducing a coring effect. A complete suppression of dopant striations caused by time-dependent thermocapillary convection and a reduction of the coring to insignificant values, combined with a shift of the axial segregation profile toward a more diffusion-limited case, is possible with static fields greater than or equal to 1 T. However, under certain conditions the use of high axial magnetic fields can lead to the appearance of a new type of pronounced dopant striations, caused by thermoelectromagnetic convection. The use of a transverse rotating magnetic field influences the microscopic segregation at quite low inductions, of the order of a few millitesla. The field shifts time- dependent flows and the resulting striation patterns from a broad range of low frequencies at high amplitudes to a few high frequencies at low amplitudes.

  20. Parametric modulation of thermomagnetic convection in magnetic fluids.

    PubMed

    Engler, H; Odenbach, S

    2008-05-21

    Previous theoretical investigations on thermal flow in a horizontal fluid layer have shown that the critical temperature difference, where heat transfer changes from diffusion to convective flow, depends on the frequency of a time-modulated driving force. The driving force of thermal convection is the buoyancy force resulting from the interaction of gravity and the density gradient provided by a temperature difference in the vertical direction of a horizontal fluid layer. An experimental investigation of such phenomena fails because of technical problems arising if buoyancy is to be changed by altering the temperature difference or gravitational acceleration. The possibility of influencing convective flow in a horizontal magnetic fluid layer by magnetic forces might provide us with a means to solve the problem of a time-modulated magnetic driving force. An experimental setup to investigate the dependence of the critical temperature difference on the frequency of the driving force has been designed and implemented. First results show that the time modulation of the driving force has significant influence on the strength of the convective flow. In particular a pronounced minimum in the strength of convection has been found for a particular frequency.

  1. Nonlinear oscillatory rarefied gas flow inside a rectangular cavity

    NASA Astrophysics Data System (ADS)

    Wang, Peng; Zhu, Lianhua; Su, Wei; Wu, Lei; Zhang, Yonghao

    2018-04-01

    The nonlinear oscillation of rarefied gas flow inside a two-dimensional rectangular cavity is investigated on the basis of the Shakhov kinetic equation. The gas dynamics, heat transfer, and damping force are studied numerically via the discrete unified gas-kinetic scheme for a wide range of parameters, including gas rarefaction, cavity aspect ratio, and oscillation frequency. Contrary to the linear oscillation where the velocity, temperature, and heat flux are symmetrical and oscillate with the same frequency as the oscillating lid, flow properties in nonlinear oscillatory cases turn out to be asymmetrical, and second-harmonic oscillation of the temperature field is observed. As a consequence, the amplitude of the shear stress near the top-right corner of the cavity could be several times larger than that at the top-left corner, while the temperature at the top-right corner could be significantly higher than the wall temperature in nearly the whole oscillation period. For the linear oscillation with the frequency over a critical value, and for the nonlinear oscillation, the heat transfer from the hot to cold region dominates inside the cavity, which is contrary to the anti-Fourier heat transfer in a low-speed rarefied lid-driven cavity flow. The damping force exerted on the oscillating lid is studied in detail, and the scaling laws are developed to describe the dependency of the resonance and antiresonance frequencies (corresponding to the damping force at a local maximum and minimum, respectively) on the reciprocal aspect ratio from the near hydrodynamic to highly rarefied regimes. These findings could be useful in the design of the micro-electro-mechanical devices operating in the nonlinear-flow regime.

  2. Growth phase-dependent control of R27 conjugation is mediated by the interplay between the plasmid-encoded regulatory circuit TrhR/TrhY-HtdA and the cAMP regulon.

    PubMed

    Gibert, Marta; Paytubi, Sonia; Beltrán, Sergi; Juárez, Antonio; Balsalobre, Carlos; Madrid, Cristina

    2016-12-01

    Plasmids of the incompatibility group HI1 (IncHI1) have been isolated from several Gram-negative pathogens and are associated with the spread of multidrug resistance. Their conjugation is tightly regulated and it is inhibited at temperatures higher than 30°C, indicating that conjugation occurs outside warm-blooded hosts. Using R27, the prototype of IncHI1 plasmids, we report that plasmid transfer efficiency in E. coli strongly depends on the physiological state of the donor cells. Conjugation frequency is high when cells are actively growing, dropping sharply when cells enter the stationary phase of growth. Accordingly, our transcriptomic assays show significant downregulation of numerous R27 genes during the stationary phase, including several tra (transfer) genes. Growth phase-dependent regulation of tra genes transcription is independent of H-NS, a silencer of horizontal gene transfer, and ppGpp and RpoS, regulators of the stationary phase, but highly dependent on the plasmid-encoded regulatory circuit TrhR/TrhY-HtdA. The metabolic sensor cAMP, whose synthesis is chromosomally encoded, is also involved in the growth phase regulation of R27 conjugation by modulating htdA expression. Our data suggest that the involvement of regulators encoded by both chromosome and plasmid are required for efficient physiological control of IncHI1 plasmid conjugation. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Optical-frequency transfer over a single-span 1840 km fiber link.

    PubMed

    Droste, S; Ozimek, F; Udem, Th; Predehl, K; Hänsch, T W; Schnatz, H; Grosche, G; Holzwarth, R

    2013-09-13

    To compare the increasing number of optical frequency standards, highly stable optical signals have to be transferred over continental distances. We demonstrate optical-frequency transfer over a 1840-km underground optical fiber link using a single-span stabilization. The low inherent noise introduced by the fiber allows us to reach short term instabilities expressed as the modified Allan deviation of 2×10(-15) for a gate time τ of 1 s reaching 4×10(-19) in just 100 s. We find no systematic offset between the sent and transferred frequencies within the statistical uncertainty of about 3×10(-19). The spectral noise distribution of our fiber link at low Fourier frequencies leads to a τ(-2) slope in the modified Allan deviation, which is also derived theoretically.

  4. Impact Response Characteristics of Polymeric Materials

    DTIC Science & Technology

    1981-11-01

    amplitude-frequency domain. In the language of signal communications an input signal given by some time dependence FAt) is introduced into a " channel ...fixed and not altered by the signal. The channel can be charac- terized by its own function H(t), called the transfer function. This concept can be...rcpresented schematically as follows: Input Signal - [ Channel ] -- Output Signal At) H(t) G(t) In our case the input signal is the impact event, the output

  5. Remote sounding of cloudy atmospheres. I - The single cloud layer

    NASA Technical Reports Server (NTRS)

    Chahine, M. T.

    1974-01-01

    The relaxation method for the inverse solution of the radiative transfer equation is applied in a dual-frequency scheme for the determination of complete vertical temperature profiles in cloudy atmospheres from radiance observations alone, without any additional information related to the expected solutions. The dual-frequency principle employs to advantage a property in the Planck function of the dependence of intensity on frequency. This property leads to the formulation of a new convergence criterion for the selection of cloud-sounding frequencies to be used for reconstructing the clear column radiance from observations made in the presence of a broken cloud layer in all fields of view. The principle is applied to the case of observations in two adjacent or partially overlapping fields of view and to the case of observations in a single field of view. The solutions are illustrated by numerical examples in the dual-frequency ranges of the 4.3 and 15-micron CO2 bands of the terrestrial atmosphere.

  6. Frequency stabilization of a 1083 nm fiber laser to {sup 4}He transition lines with optical heterodyne saturation spectroscopies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gong, W.; Peng, X., E-mail: xiangpeng@pku.edu.cn; Li, W.

    2014-07-15

    Two kinds of optical heterodyne saturation spectroscopies, namely, frequency modulation spectroscopy (FMS) and modulation transfer spectroscopy (MTS), are demonstrated for locking a fiber laser to the transition lines of metastable {sup 4}He atoms around 1083 nm. The servo-loop error signals of FMS and MTS for stabilizing laser frequency are optimized by studying the dependence of the peak-to-peak amplitude and slope on the optical power of pump and probe beams. A comparison of the stabilization performances of FMS/MTS and polarization spectroscopy (PS) is presented, which shows that MTS exhibits relatively superior performance with the least laser frequency fluctuation due to itsmore » flat-background dispersive signal, originated from the four-wave mixing process. The Allan deviation of the stabilized laser frequency is 5.4 × 10{sup −12}@100 s with MTS for data acquired in 1000 s, which is sufficiently applicable for fields like laser cooling, optical pumping, and optical magnetometry.« less

  7. Electrically-driven pure amplitude and frequency modulation in a quantum cascade laser.

    PubMed

    Shehzad, Atif; Brochard, Pierre; Matthey, Renaud; Blaser, Stéphane; Gresch, Tobias; Maulini, Richard; Muller, Antoine; Südmeyer, Thomas; Schilt, Stéphane

    2018-04-30

    We present pure amplitude modulation (AM) and frequency modulation (FM) achieved electrically in a quantum cascade laser (QCL) equipped with an integrated resistive heater (IH). The QCL output power scales linearly with the current applied to the active region (AR), but decreases with the IH current, while the emission frequency decreases with both currents. Hence, a simultaneous modulation applied to the current of the AR and IH sections with a proper relative amplitude and phase can suppress the AM, resulting in a pure FM, or vice-versa. The adequate modulation parameters depend on the applied modulation frequency. Therefore, they were first determined from the individual measurements of the AM and FM transfer functions obtained for a modulation applied to the current of the AR or IH section, respectively. By optimizing the parameters of the two modulations, we demonstrate a reduction of the spurious AM or FM by almost two orders of magnitude at characteristic frequencies of 1 and 10 kHz compared to the use of the AR current only.

  8. Precise and continuous time and frequency synchronisation at the 5×10⁻¹⁹ accuracy level.

    PubMed

    Wang, B; Gao, C; Chen, W L; Miao, J; Zhu, X; Bai, Y; Zhang, J W; Feng, Y Y; Li, T C; Wang, L J

    2012-01-01

    The synchronisation of time and frequency between remote locations is crucial for many important applications. Conventional time and frequency dissemination often makes use of satellite links. Recently, the communication fibre network has become an attractive option for long-distance time and frequency dissemination. Here, we demonstrate accurate frequency transfer and time synchronisation via an 80 km fibre link between Tsinghua University (THU) and the National Institute of Metrology of China (NIM). Using a 9.1 GHz microwave modulation and a timing signal carried by two continuous-wave lasers and transferred across the same 80 km urban fibre link, frequency transfer stability at the level of 5×10⁻¹⁹/day was achieved. Time synchronisation at the 50 ps precision level was also demonstrated. The system is reliable and has operated continuously for several months. We further discuss the feasibility of using such frequency and time transfer over 1000 km and its applications to long-baseline radio astronomy.

  9. Precise and Continuous Time and Frequency Synchronisation at the 5×10-19 Accuracy Level

    PubMed Central

    Wang, B.; Gao, C.; Chen, W. L.; Miao, J.; Zhu, X.; Bai, Y.; Zhang, J. W.; Feng, Y. Y.; Li, T. C.; Wang, L. J.

    2012-01-01

    The synchronisation of time and frequency between remote locations is crucial for many important applications. Conventional time and frequency dissemination often makes use of satellite links. Recently, the communication fibre network has become an attractive option for long-distance time and frequency dissemination. Here, we demonstrate accurate frequency transfer and time synchronisation via an 80 km fibre link between Tsinghua University (THU) and the National Institute of Metrology of China (NIM). Using a 9.1 GHz microwave modulation and a timing signal carried by two continuous-wave lasers and transferred across the same 80 km urban fibre link, frequency transfer stability at the level of 5×10−19/day was achieved. Time synchronisation at the 50 ps precision level was also demonstrated. The system is reliable and has operated continuously for several months. We further discuss the feasibility of using such frequency and time transfer over 1000 km and its applications to long-baseline radio astronomy. PMID:22870385

  10. Modeling and Assessment of Precise Time Transfer by Using BeiDou Navigation Satellite System Triple-Frequency Signals

    PubMed Central

    Zhang, Pengfei; Zhang, Rui; Liu, Jinhai; Lu, Xiaochun

    2018-01-01

    This study proposes two models for precise time transfer using the BeiDou Navigation Satellite System triple-frequency signals: ionosphere-free (IF) combined precise point positioning (PPP) model with two dual-frequency combinations (IF-PPP1) and ionosphere-free combined PPP model with a single triple-frequency combination (IF-PPP2). A dataset with a short baseline (with a common external time frequency) and a long baseline are used for performance assessments. The results show that IF-PPP1 and IF-PPP2 models can both be used for precise time transfer using BeiDou Navigation Satellite System (BDS) triple-frequency signals, and the accuracy and stability of time transfer is the same in both cases, except for a constant system bias caused by the hardware delay of different frequencies, which can be removed by the parameter estimation and prediction with long time datasets or by a priori calibration. PMID:29596330

  11. Temporal modulation transfer functions in auditory receptor fibres of the locust ( Locusta migratoria L.).

    PubMed

    Prinz, P; Ronacher, B

    2002-08-01

    The temporal resolution of auditory receptors of locusts was investigated by applying noise stimuli with sinusoidal amplitude modulations and by computing temporal modulation transfer functions. These transfer functions showed mostly bandpass characteristics, which are rarely found in other species at the level of receptors. From the upper cut-off frequencies of the modulation transfer functions the minimum integration times were calculated. Minimum integration times showed no significant correlation to the receptor spike rates but depended strongly on the body temperature. At 20 degrees C the average minimum integration time was 1.7 ms, dropping to 0.95 ms at 30 degrees C. The values found in this study correspond well to the range of minimum integration times found in birds and mammals. Gap detection is another standard paradigm to investigate temporal resolution. In locusts and other grasshoppers application of this paradigm yielded values of the minimum detectable gap widths that are approximately twice as large than the minimum integration times reported here.

  12. A contradictory phenomenon of deshelving pulses in a dilute medium used for lengthened photon storage time.

    PubMed

    Ham, Byoung S

    2010-08-16

    Lengthening of photon storage time has been an important issue in quantum memories for long distance quantum communications utilizing quantum repeaters. Atom population transfer into an auxiliary spin state has been adapted to increase photon storage time of photon echoes. In this population transfer process phase shift to the collective atoms is inevitable, where the phase recovery condition must be multiple of 2pi to satisfy rephasing mechanism. Recent adaptation of the population transfer method to atomic frequency comb (AFC) echoes [Afzelius et al., Phys. Rev. Lett. 104, 040503 (2010)], where the population transfer method is originated in a controlled reversible inhomogeneous broadening technique [Moiseev and Kroll, Phys. Rev. Lett. 87, 173601 (2001)], however, shows contradictory phenomenon violating the phase recovery condition. This contradiction in AFC is reviewed as a general case of optical locking applied to a dilute medium for an optical depth-dependent coherence leakage resulting in partial retrieval efficiency.

  13. Astronomical Verification of a Stabilized Frequency Reference Transfer System for the Square Kilometer Array

    NASA Astrophysics Data System (ADS)

    Gozzard, David R.; Schediwy, Sascha W.; Dodson, Richard; Rioja, María J.; Hill, Mike; Lennon, Brett; McFee, Jock; Mirtschin, Peter; Stevens, Jamie; Grainge, Keith

    2017-07-01

    In order to meet its cutting-edge scientific objectives, the Square Kilometre Array (SKA) telescope requires high-precision frequency references to be distributed to each of its antennas. The frequency references are distributed via fiber-optic links and must be actively stabilized to compensate for phase noise imposed on the signals by environmental perturbations on the links. SKA engineering requirements demand that any proposed frequency reference distribution system be proved in “astronomical verification” tests. We present results of the astronomical verification of a stabilized frequency reference transfer system proposed for SKA-mid. The dual-receiver architecture of the Australia Telescope Compact Array was exploited to subtract the phase noise of the sky signal from the data, allowing the phase noise of observations performed using a standard frequency reference, as well as the stabilized frequency reference transfer system transmitting over 77 km of fiber-optic cable, to be directly compared. Results are presented for the fractional frequency stability and phase drift of the stabilized frequency reference transfer system for celestial calibrator observations at 5 and 25 GHz. These observations plus additional laboratory results for the transferred signal stability over a 166 km metropolitan fiber-optic link are used to show that the stabilized transfer system under test exceeds all SKA phase-stability requirements within a broad range of observing conditions. Furthermore, we have shown that alternative reference dissemination systems that use multiple synthesizers to supply reference signals to sub-sections of an array may limit the imaging capability of the telescope.

  14. Seismoelectric ground response to local and regional earthquakes

    NASA Astrophysics Data System (ADS)

    Dzieran, Laura; Rabbel, Wolfgang; Thorwart, Martin; Ritter, Oliver

    2017-04-01

    During earthquakes magnetotelluric stations occasionally record electric and magnetic signals similar to seismograms. The major part of these magnetic signals is induced by the seismic movement of the magnetometers (induction coils) in the static magnetic field. In contrast, the electric field signals are caused by the seismoelectric effect. Based on more than 600 earthquakes from Chile, Costa Rica and Europe we established a logarithmic magnitude-distance-relationship describing the magnitude threshold to be exceeded for observing seismoelectric (SE) signals with standard magnetotelluric (MT) recording units at given hypocentral distance r and for noise levels less than 3 μV/m. The log(r) term results from the geometric spreading of the radiated seismic waves. A comparison of SE signals at different hypocentral distances shows that observability is not only influenced by the amplitude of the incoming seismic wave. It also depends on the geological structure underneath the station which causes a unique frequency dependent SE response. To quantify these site effects we computed spectral seismoelectric transfer functions representing the ratios of the spectral amplitudes of SE records and acceleration seismograms (SESRs). Some stations show constant SESRs in the major frequency range, while others show a decrease with increasing frequencies. Based on the current Biot-type seismoelectric theory constant SESRs can be explained by coseismic SE waves alone. The observed SESR amplitudes at some sites are indeed consistent with theoretical expectations for electrically highly resistive soils or rocks, in agreement with the local geology of the investigated areas. The frequency dependence of SESRs observed at other locations can be explained if the incident SE waves consist not only of coseismic arrivals but also of a significant contribution from SE interface response waves which are generated at electrical or mechanical boundaries. Therefore, frequency-dependent SESRs can be regarded as an expression of a seismoelectric site effect, which depends strongly on the hydraulic and lithologic conditions underneath the recording station.

  15. Theoretical investigation of carrier transfer by an optical contacting scheme for optoelectronic application

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Jianfeng, E-mail: jianfeng.yang@student.unsw.edu.au; Zhang, Zhilong; Chen, Weijian

    2016-04-21

    As a promising charge carrier transfer scheme, optical coupling could potentially improve the performance of an optoelectronic device for energy harvesting based on well developed nanotechnology. By extracting carriers optically, the functional features of the nano-structured material could be better used by minimizing the concerns about its electrical properties. In this paper, we present a rigorous electromagnetic model to analyze the optical carrier transfer problem. The flow of the energy is analyzed carefully by the photon transfer spectrum, and the photon emitters (electron-hole pairs) are assumed in a thermal equilibrium described by Bose-Einstein distribution. The result shows that an energymore » selective carrier transfer can be optically achieved at the device level by integrating the emitter and receiver into a nano-optical resonator, where both the photon emission and absorption are significantly amplified by a near-field coupling around the resonant frequency. General design and optimization schemes in practice are addressed by examining the influence of the photonic design and an energy dependent emissivity of the emitter, which can be used to develop the optical contacting concept further.« less

  16. Effect of a rotor wake on heat transfer from a circular cylinder

    NASA Technical Reports Server (NTRS)

    Simoneau, R. J.; Morehouse, K. A.; Vanfossen, G. J.; Behning, F. P.

    1984-01-01

    The effect of a rotor wake on heat transfer to a downstream stator was investigated. The rotor was modeled with a spoked wheel of 24 circular pins 1.59 mm in diameter. One of the stator pins was electrically heated in the midspan region and circumferentially averaged heat transfer coefficients were obtained. The experiment was run in an annular flow wind tunnel using air at ambient temperature and pressure. Reynolds numbers based on stator cylinder diameter ranged from .001 to .00001. Rotor blade passing frequencies ranged from zero to 2500 Hz. Stationary grids were used to vary the rotor inlet turbulence from one to four percent. The rotor-stator spacings were one and two stator pin diameters. In addition to the heat transfer coefficients, turbulence spectra and ensemble averaged wake profiles were measured. At the higher Reynolds numbers, which is the primary range of interest for turbulent heat transfer, the rotor wakes increased Nusselt number from 10 to 45 percent depending on conditions. At lower Reynolds numbers the effect was as much as a factor of two.

  17. Pulse excitation method for measurement of high frequency magnetic properties of large cores (abstract)

    NASA Astrophysics Data System (ADS)

    Hikosaka, Tomoyuki; Miyamoto, Masahiro; Yamada, Mamoru; Morita, Tadashi

    1993-05-01

    It is very important to obtain saturated magnetic properties from reverse saturation (full B-H curve) of ferromagnetic cores to design magnetic switches which are used in high power pulse generators. The magnetic switch is excited in the high frequency range (˜MHz). But, it is extremely difficult to measure full B-H curve of large toroidal cores of which diameter is some hundreds of mm, using the conventional ac excitation method at high frequency. The main reason is poor output ability of power source for core excitation. Therefore we have developed pulse excitation method to get high frequency magnetic properties. The measurement circuit has two sections. One is excitation part composed by charge transfer circuit. The others is reset part for adjustment initial point on direct B-H curve. The sample core is excited by sinusoidal voltage pulse expressed as 1-cos(2π ft). Excitation frequency f is decided by the constants of the elements of the charge transfer circuit. The change of magnetic flux density ΔB and magnetic field H are calculated, respectively, by measuring the induced voltage of search coil and magnetizing current. ΔB-H characteristics from reverse saturation of four different kinds of large cores were measured in frequency range from 50 kHz to 1 MHz. Core loss increases in proportion to Nth powers of the frequency, where the index N depends on each of cores. N is about 0.5 in case of winding ribbon cores, such as Fe-based amorphous, Co-based amorphous, and Finemet, but N is about 0.2 in case of the Ni-Zn ferrite.

  18. Underwater Communications for Video Surveillance Systems at 2.4 GHz

    PubMed Central

    Sendra, Sandra; Lloret, Jaime; Jimenez, Jose Miguel; Rodrigues, Joel J.P.C.

    2016-01-01

    Video surveillance is needed to control many activities performed in underwater environments. The use of wired media can be a problem since the material specially designed for underwater environments is very expensive. In order to transmit the images and videos wirelessly under water, three main technologies can be used: acoustic waves, which do not provide high bandwidth, optical signals, although the effect of light dispersion in water severely penalizes the transmitted signals and therefore, despite offering high transfer rates, the maximum distance is very small, and electromagnetic (EM) waves, which can provide enough bandwidth for video delivery. In the cases where the distance between transmitter and receiver is short, the use of EM waves would be an interesting option since they provide high enough data transfer rates to transmit videos with high resolution. This paper presents a practical study of the behavior of EM waves at 2.4 GHz in freshwater underwater environments. First, we discuss the minimum requirements of a network to allow video delivery. From these results, we measure the maximum distance between nodes and the round trip time (RTT) value depending on several parameters such as data transfer rate, signal modulations, working frequency, and water temperature. The results are statistically analyzed to determine their relation. Finally, the EM waves’ behavior is modeled by a set of equations. The results show that there are some combinations of working frequency, modulation, transfer rate and temperature that offer better results than others. Our work shows that short communication distances with high data transfer rates is feasible. PMID:27782095

  19. Underwater Communications for Video Surveillance Systems at 2.4 GHz.

    PubMed

    Sendra, Sandra; Lloret, Jaime; Jimenez, Jose Miguel; Rodrigues, Joel J P C

    2016-10-23

    Video surveillance is needed to control many activities performed in underwater environments. The use of wired media can be a problem since the material specially designed for underwater environments is very expensive. In order to transmit the images and videos wirelessly under water, three main technologies can be used: acoustic waves, which do not provide high bandwidth, optical signals, although the effect of light dispersion in water severely penalizes the transmitted signals and therefore, despite offering high transfer rates, the maximum distance is very small, and electromagnetic (EM) waves, which can provide enough bandwidth for video delivery. In the cases where the distance between transmitter and receiver is short, the use of EM waves would be an interesting option since they provide high enough data transfer rates to transmit videos with high resolution. This paper presents a practical study of the behavior of EM waves at 2.4 GHz in freshwater underwater environments. First, we discuss the minimum requirements of a network to allow video delivery. From these results, we measure the maximum distance between nodes and the round trip time (RTT) value depending on several parameters such as data transfer rate, signal modulations, working frequency, and water temperature. The results are statistically analyzed to determine their relation. Finally, the EM waves' behavior is modeled by a set of equations. The results show that there are some combinations of working frequency, modulation, transfer rate and temperature that offer better results than others. Our work shows that short communication distances with high data transfer rates is feasible.

  20. Two-Way Satellite Time and Frequency Transfer (TWSTFT) Calibration Constancy From Closure Sums

    DTIC Science & Technology

    2008-12-01

    40th Annual Precise Time and Time Interval (PTTI) Meeting 587 TWO-WAY SATELLITE TIME AND FREQUENCY TRANSFER ( TWSTFT ) CALIBRATION...Paris, France Abstract Two-way Satellite Time and Frequency Transfer ( TWSTFT ) is considered to be the most accurate means of long-distance...explanations for small, but non-zero, biases observed in the closure sums of uncalibrated data are presented. I. INTRODUCTION TWSTFT [1] has

  1. Nothing more than a pair of curvatures: A common mechanism for the detection of both radial and non-radial frequency patterns.

    PubMed

    Schmidtmann, Gunnar; Kingdom, Frederick A A

    2017-05-01

    Radial frequency (RF) patterns, which are sinusoidal modulations of a radius in polar coordinates, are commonly used to study shape perception. Previous studies have argued that the detection of RF patterns is either achieved globally by a specialized global shape mechanism, or locally using as cue the maximum tangent orientation difference between the RF pattern and the circle. Here we challenge both ideas and suggest instead a model that accounts not only for the detection of RF patterns but also for line frequency patterns (LF), i.e. contours sinusoidally modulated around a straight line. The model has two features. The first is that the detection of both RF and LF patterns is based on curvature differences along the contour. The second is that this curvature metric is subject to what we term the Curve Frequency Sensitivity Function, or CFSF, which is characterized by a flat followed by declining response to curvature as a function of modulation frequency, analogous to the modulation transfer function of the eye. The evidence that curvature forms the basis for detection is that at very low modulation frequencies (1-3 cycles for the RF pattern) there is a dramatic difference in thresholds between the RF and LF patterns, a difference however that disappears at medium and high modulation frequencies. The CFSF feature on the other hand explains why thresholds, rather than continuously declining with modulation frequency, asymptote at medium and high modulation frequencies. In summary, our analysis suggests that the detection of shape modulations is processed by a common curvature-sensitive mechanism that is subject to a shape-frequency-dependent transfer function. This mechanism is independent of whether the modulation is applied to a circle or a straight line. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Exciplex formation in bimolecular photoinduced electron-transfer investigated by ultrafast time-resolved infrared spectroscopy.

    PubMed

    Koch, Marius; Letrun, Romain; Vauthey, Eric

    2014-03-12

    The dynamics of bimolecular photoinduced electron-transfer reactions has been investigated with three donor/acceptor (D/A) pairs in tetrahydrofuran (THF) and acetonitrile (ACN) using a combination of ultrafast spectroscopic techniques, including time-resolved infrared absorption. For the D/A pairs with the highest driving force of electron transfer, all transient spectroscopic features can be unambiguously assigned to the excited reactant and the ionic products. For the pair with the lowest driving force, three additional transient infrared bands, more intense in THF than in ACN, with a time dependence that differs from those of the other bands are observed. From their frequency and solvent dependence, these bands can be assigned to an exciplex. Moreover, polarization-resolved measurements point to a relatively well-defined mutual orientation of the constituents and to a slower reorientational time compared to those of the individual reactants. Thanks to the minimal overlap of the infrared signature of all transient species in THF, a detailed reaction scheme including the relevant kinetic and thermodynamic parameters could be deduced for this pair. This analysis reveals that the formation and recombination of the ion pair occur almost exclusively via the exciplex.

  3. Four decades of implicit Monte Carlo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wollaber, Allan B.

    In 1971, Fleck and Cummings derived a system of equations to enable robust Monte Carlo simulations of time-dependent, thermal radiative transfer problems. Denoted the “Implicit Monte Carlo” (IMC) equations, their solution remains the de facto standard of high-fidelity radiative transfer simulations. Over the course of 44 years, their numerical properties have become better understood, and accuracy enhancements, novel acceleration methods, and variance reduction techniques have been suggested. In this review, we rederive the IMC equations—explicitly highlighting assumptions as they are made—and outfit the equations with a Monte Carlo interpretation. We put the IMC equations in context with other approximate formsmore » of the radiative transfer equations and present a new demonstration of their equivalence to another well-used linearization solved with deterministic transport methods for frequency-independent problems. We discuss physical and numerical limitations of the IMC equations for asymptotically small time steps, stability characteristics and the potential of maximum principle violations for large time steps, and solution behaviors in an asymptotically thick diffusive limit. We provide a new stability analysis for opacities with general monomial dependence on temperature. Here, we consider spatial accuracy limitations of the IMC equations and discussion acceleration and variance reduction techniques.« less

  4. Four decades of implicit Monte Carlo

    DOE PAGES

    Wollaber, Allan B.

    2016-02-23

    In 1971, Fleck and Cummings derived a system of equations to enable robust Monte Carlo simulations of time-dependent, thermal radiative transfer problems. Denoted the “Implicit Monte Carlo” (IMC) equations, their solution remains the de facto standard of high-fidelity radiative transfer simulations. Over the course of 44 years, their numerical properties have become better understood, and accuracy enhancements, novel acceleration methods, and variance reduction techniques have been suggested. In this review, we rederive the IMC equations—explicitly highlighting assumptions as they are made—and outfit the equations with a Monte Carlo interpretation. We put the IMC equations in context with other approximate formsmore » of the radiative transfer equations and present a new demonstration of their equivalence to another well-used linearization solved with deterministic transport methods for frequency-independent problems. We discuss physical and numerical limitations of the IMC equations for asymptotically small time steps, stability characteristics and the potential of maximum principle violations for large time steps, and solution behaviors in an asymptotically thick diffusive limit. We provide a new stability analysis for opacities with general monomial dependence on temperature. Here, we consider spatial accuracy limitations of the IMC equations and discussion acceleration and variance reduction techniques.« less

  5. Three-dimensional organization of otolith-ocular reflexes in rhesus monkeys. III. Responses To translation

    NASA Technical Reports Server (NTRS)

    Angelaki, D. E.

    1998-01-01

    The three-dimensional (3-D) properties of the translational vestibulo-ocular reflexes (translational VORs) during lateral and fore-aft oscillations in complete darkness were studied in rhesus monkeys at frequencies between 0.16 and 25 Hz. In addition, constant velocity off-vertical axis rotations extended the frequency range to 0.02 Hz. During lateral motion, horizontal responses were in phase with linear velocity in the frequency range of 2-10 Hz. At both lower and higher frequencies, phase lags were introduced. Torsional response phase changed more than 180 degrees in the tested frequency range such that torsional eye movements, which could be regarded as compensatory to "an apparent roll tilt" at the lowest frequencies, became anticompensatory at all frequencies above approximately 1 Hz. These results suggest two functionally different frequency bandwidths for the translational VORs. In the low-frequency spectrum (<<0.5 Hz), horizontal responses compensatory to translation are small and high-pass-filtered whereas torsional response sensitivity is relatively frequency independent. At higher frequencies however, both horizontal and torsional response sensitivity and phase exhibit a similar frequency dependence, suggesting a common role during head translation. During up-down motion, vertical responses were in phase with translational velocity at 3-5 Hz but phase leads progressively increased for lower frequencies (>90 degrees at frequencies <0.2 Hz). No consistent dependence on static head orientation was observed for the vertical response components during up-down motion and the horizontal and torsional response components during lateral translation. The frequency response characteristics of the translational VORs were fitted by "periphery/brain stem" functions that related the linear acceleration input, transduced by primary otolith afferents, to the velocity signals providing the input to the velocity-to-position neural integrator and the oculomotor plant. The lowest-order, best-fit periphery/brain stem model that approximated the frequency dependence of the data consisted of a second order transfer function with two alternating poles (at 0.4 and 7.2 Hz) and zeros (at 0.035 and 3.4 Hz). In addition to clearly differentiator dynamics at low frequencies (less than approximately 0.5 Hz), there was no frequency bandwidth where the periphery/brain stem function could be approximated by an integrator, as previously suggested. In this scheme, the oculomotor plant dynamics are assumed to perform the necessary high-frequency integration as required by the reflex. The detailed frequency dependence of the data could only be precisely described by higher order functions with nonminimum phase characteristics that preclude simple filtering of afferent inputs and might be suggestive of distributed spatiotemporal processing of otolith signals in the translational VORs.

  6. A straightforward frequency-estimation technique for GPS carrier-phase time transfer.

    PubMed

    Hackman, Christine; Levine, Judah; Parker, Thomas E; Piester, Dirk; Becker, Jürgen

    2006-09-01

    Although Global Positioning System (GPS) carrier-phase time transfer (GPSCPTT) offers frequency stability approaching 10-15 at averaging times of 1 d, a discontinuity occurs in the time-transfer estimates between the end of one processing batch (1-3 d in length) and the beginning of the next. The average frequency over a multiday analysis period often has been computed by first estimating and removing these discontinuities, i.e., through concatenation. We present a new frequency-estimation technique in which frequencies are computed from the individual batches then averaged to obtain the mean frequency for a multiday period. This allows the frequency to be computed without the uncertainty associated with the removal of the discontinuities and requires fewer computational resources. The new technique was tested by comparing the fractional frequency-difference values it yields to those obtained using a GPSCPTT concatenation method and those obtained using two-way satellite time-and-frequency transfer (TWSTFT). The clocks studied were located in Braunschweig, Germany, and in Boulder, CO. The frequencies obtained from the GPSCPTT measurements using either method agreed with those obtained from TWSTFT at several parts in 1016. The frequency values obtained from the GPSCPTT data by use of the new method agreed with those obtained using the concatenation technique at 1-4 x 10(-16).

  7. Spin-locking versus chemical exchange saturation transfer MRI for investigating chemical exchange process between water and labile metabolite protons.

    PubMed

    Jin, Tao; Autio, Joonas; Obata, Takayuki; Kim, Seong-Gi

    2011-05-01

    Chemical exchange saturation transfer (CEST) and spin-locking (SL) experiments were both able to probe the exchange process between protons of nonequivalent chemical environments. To compare the characteristics of the CEST and SL approaches in the study of chemical exchange effects, we performed CEST and SL experiments at varied pH and concentrated metabolite phantoms with exchangeable amide, amine, and hydroxyl protons at 9.4 T. Our results show that: (i) on-resonance SL is most sensitive to chemical exchanges in the intermediate-exchange regime and is able to detect hydroxyl and amine protons on a millimolar concentration scale. Off-resonance SL and CEST approaches are sensitive to slow-exchanging protons when an optimal SL or saturation pulse power matches the exchanging rate, respectively. (ii) Offset frequency-dependent SL and CEST spectra are very similar and can be explained well with an SL model recently developed by Trott and Palmer (J Magn Reson 2002;154:157-160). (iii) The exchange rate and population of metabolite protons can be determined from offset-dependent SL or CEST spectra or from on-resonance SL relaxation dispersion measurements. (iv) The asymmetry of the magnetization transfer ratio (MTR(asym)) is highly dependent on the choice of saturation pulse power. In the intermediate-exchange regime, MTR(asym) becomes complicated and should be interpreted with care. Copyright © 2010 Wiley-Liss, Inc.

  8. Direct enhancement of nitrogen-15 targets at high-field by fast ADAPT-SABRE

    NASA Astrophysics Data System (ADS)

    Roy, Soumya S.; Stevanato, Gabriele; Rayner, Peter J.; Duckett, Simon B.

    2017-12-01

    Signal Amplification by Reversible Exchange (SABRE) is an attractive nuclear spin hyperpolarization technique capable of huge sensitivity enhancement in nuclear magnetic resonance (NMR) detection. The resonance condition of SABRE hyperpolarization depends on coherent spin mixing, which can be achieved naturally at a low magnetic field. The optimum transfer field to spin-1/2 heteronuclei is technically demanding, as it requires field strengths weaker than the earth's magnetic field for efficient spin mixing. In this paper, we illustrate an approach to achieve strong 15N SABRE hyperpolarization at high magnetic field by a radio frequency (RF) driven coherent transfer mechanism based on alternate pulsing and delay to achieve polarization transfer. The presented scheme is found to be highly robust and much faster than existing related methods, producing ∼ 3 orders of magnitude 15N signal enhancement within 2 s of RF pulsing.

  9. Direct enhancement of nitrogen-15 targets at high-field by fast ADAPT-SABRE.

    PubMed

    Roy, Soumya S; Stevanato, Gabriele; Rayner, Peter J; Duckett, Simon B

    2017-12-01

    Signal Amplification by Reversible Exchange (SABRE) is an attractive nuclear spin hyperpolarization technique capable of huge sensitivity enhancement in nuclear magnetic resonance (NMR) detection. The resonance condition of SABRE hyperpolarization depends on coherent spin mixing, which can be achieved naturally at a low magnetic field. The optimum transfer field to spin-1/2 heteronuclei is technically demanding, as it requires field strengths weaker than the earth's magnetic field for efficient spin mixing. In this paper, we illustrate an approach to achieve strong 15 N SABRE hyperpolarization at high magnetic field by a radio frequency (RF) driven coherent transfer mechanism based on alternate pulsing and delay to achieve polarization transfer. The presented scheme is found to be highly robust and much faster than existing related methods, producing ∼3 orders of magnitude 15 N signal enhancement within 2 s of RF pulsing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Interpreting Sky-Averaged 21-cm Measurements

    NASA Astrophysics Data System (ADS)

    Mirocha, Jordan

    2015-01-01

    Within the first ~billion years after the Big Bang, the intergalactic medium (IGM) underwent a remarkable transformation, from a uniform sea of cold neutral hydrogen gas to a fully ionized, metal-enriched plasma. Three milestones during this epoch of reionization -- the emergence of the first stars, black holes (BHs), and full-fledged galaxies -- are expected to manifest themselves as extrema in sky-averaged ("global") measurements of the redshifted 21-cm background. However, interpreting these measurements will be complicated by the presence of strong foregrounds and non-trivialities in the radiative transfer (RT) modeling required to make robust predictions.I have developed numerical models that efficiently solve the frequency-dependent radiative transfer equation, which has led to two advances in studies of the global 21-cm signal. First, frequency-dependent solutions facilitate studies of how the global 21-cm signal may be used to constrain the detailed spectral properties of the first stars, BHs, and galaxies, rather than just the timing of their formation. And second, the speed of these calculations allows one to search vast expanses of a currently unconstrained parameter space, while simultaneously characterizing the degeneracies between parameters of interest. I find principally that (1) physical properties of the IGM, such as its temperature and ionization state, can be constrained robustly from observations of the global 21-cm signal without invoking models for the astrophysical sources themselves, (2) translating IGM properties to galaxy properties is challenging, in large part due to frequency-dependent effects. For instance, evolution in the characteristic spectrum of accreting BHs can modify the 21-cm absorption signal at levels accessible to first generation instruments, but could easily be confused with evolution in the X-ray luminosity star-formation rate relation. Finally, (3) the independent constraints most likely to aide in the interpretation of global 21-cm signal measurements are detections of Lyman Alpha Emitters at high redshifts and constraints on the midpoint of reionization, both of which are among the primary science objectives of ongoing or near-future experiments.

  11. Analysis of band structure, transmission properties, and dispersion behavior of THz wave in one-dimensional parabolic plasma photonic crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Askari, Nasim; Eslami, Esmaeil, E-mail: eeslami@iust.ac.ir; Mirzaie, Reza

    2015-11-15

    The photonic band gap of obliquely incident terahertz electromagnetic waves in a one-dimensional plasma photonic crystal is studied. The periodic structure consists of lossless dielectric and inhomogeneous plasma with a parabolic density profile. The dispersion relation and the THz wave transmittance are analyzed based on the electromagnetic equations and transfer matrix method. The dependence of effective plasma frequency and photonic band gap characteristics on dielectric and plasma thickness, plasma density, and incident angle are discussed in detail. A theoretical calculation for effective plasma frequency is presented and compared with numerical results. Results of these two methods are in good agreement.

  12. Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor.

    PubMed

    van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Noël, Timothy; Arends, Isabel W C E; Hollmann, Frank

    2018-01-01

    The biocatalytic preparation of trans -hex-2-enal from trans -hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii ( Pe AAOx) is reported. As O 2 -dependent enzyme Pe AAOx-dependent reactions are generally plagued by the poor solubility of O 2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s -1 ) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme.

  13. Modification of the magnetization dynamics of a NiFe nanodot due to thermal spin injection

    NASA Astrophysics Data System (ADS)

    Asam, Nagarjuna; Yamanoi, Kazuto; Kimura, Takashi

    2018-06-01

    An array of NiFe nanodots has been prepared on a Cu/CoFeAl film. Since a thermal spin current is expected to be excited owing to a large spin-dependent Seebeck coefficient for the CoFeAl, we investigate the magnetization dynamics of the NiFe dots under the temperature gradient along the vertical direction. By using vector network analyzer measurements, we have demonstrated that the temperature gradient produces modulations of the frequency of ferromagnetic resonance and the linewidth of the resonance spectra. The observed parabolic dependences are well explained by the damping-like and field-like components of spin transfer torque.

  14. Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor

    PubMed Central

    van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Arends, Isabel W C E

    2018-01-01

    The biocatalytic preparation of trans-hex-2-enal from trans-hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii (PeAAOx) is reported. As O2-dependent enzyme PeAAOx-dependent reactions are generally plagued by the poor solubility of O2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s−1) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme. PMID:29719567

  15. Robust interferometric frequency lock between cw lasers and optical frequency combs.

    PubMed

    Benkler, Erik; Rohde, Felix; Telle, Harald R

    2013-02-15

    A transfer interferometer is presented which establishes a versatile and robust optical frequency locking link between a tunable single frequency laser and an optical frequency comb. It enables agile and continuous tuning of the frequency difference between both lasers while fluctuations and drift effects of the transfer interferometer itself are widely eliminated via common mode rejection. Experimental results will be presented for a tunable extended-cavity 1.5 μm laser diode locked to an Er-fiber based frequency comb.

  16. Evaluation of Time Transfer Units for Time and Frequency Transfer in Optical Fibers Utilizing a Passive Technique Based on SONET/SDH

    DTIC Science & Technology

    2012-01-01

    precision and accuracy. For instance, in international time metrology, two-way satellite time and frequency transfer ( TWSTFT ) (see e.g. [1] and...can act as a time transfer system that is complementary to other high quality systems such as TWSTFT and GPS. REFERENCES [1] J. Levine. “A

  17. Para-hydrogen induced polarization of amino acids, peptides and deuterium-hydrogen gas.

    PubMed

    Glöggler, Stefan; Müller, Rafael; Colell, Johannes; Emondts, Meike; Dabrowski, Martin; Blümich, Bernhard; Appelt, Stephan

    2011-08-14

    Signal Amplification by Reversible-Exchange (SABRE) is a method of hyperpolarizing substrates by polarization transfer from para-hydrogen without hydrogenation. Here, we demonstrate that this method can be applied to hyperpolarize small amounts of all proteinogenic amino acids and some chosen peptides down to the nanomole regime and can be detected in a single scan in low-magnetic fields down to 0.25 mT (10 kHz proton frequency). An outstanding feature is that depending on the chemical state of the used catalyst and the investigated amino acid or peptide, hyperpolarized hydrogen-deuterium gas is formed, which was detected with (1)H and (2)H NMR spectroscopy at low magnetic fields of B(0) = 3.9 mT (166 kHz proton frequency) and 3.2 mT (20 kHz deuterium frequency).

  18. Enhancement of Compound Selectivity Using a Radio Frequency Ion-Funnel Proton Transfer Reaction Mass Spectrometer: Improved Specificity for Explosive Compounds.

    PubMed

    González-Méndez, Ramón; Watts, Peter; Olivenza-León, David; Reich, D Fraser; Mullock, Stephen J; Corlett, Clive A; Cairns, Stuart; Hickey, Peter; Brookes, Matthew; Mayhew, Chris A

    2016-11-01

    A key issue with any analytical system based on mass spectrometry with no initial separation of compounds is to have a high level of confidence in chemical assignment. This is particularly true for areas of security, such as airports, and recent terrorist attacks have highlighted the need for reliable analytical instrumentation. Proton transfer reaction mass spectrometry is a useful technology for these purposes because the chances of false positives are small owing to the use of a mass spectrometric analysis. However, the detection of an ion at a given m/z for an explosive does not guarantee that that explosive is present. There is still some ambiguity associated with any chemical assignment owing to the presence of isobaric compounds and, depending on mass resolution, ions with the same nominal m/z. In this article we describe how for the first time the use of a radio frequency ion-funnel (RFIF) in the reaction region (drift tube) of a proton transfer reaction-time-of-flight-mass spectrometer (PTR-ToF-MS) can be used to enhance specificity by manipulating the ion-molecule chemistry through collisional induced processes. Results for trinitrotoluene, dinitrotoluenes, and nitrotoluenes are presented to demonstrate the advantages of this new RFIF-PTR-ToF-MS for analytical chemical purposes.

  19. Influence of Spectral Transfer Processes in Compressible Low Frequency Plasma Turbulence on Scattering and Refraction of Electromagnetic Signals

    DTIC Science & Technology

    2015-01-01

    AFRL-RY-WP-TR-2014-0230 INFLUENCE OF SPECTRAL TRANSFER PROCESSES IN COMPRESSIBLE LOW FREQUENCY PLASMA TURBULENCE ON SCATTERING AND...INFLUENCE OF SPECTRAL TRANSFER PROCESSES IN COMPRESSIBLE LOW FREQUENCY PLASMA TURBULENCE ON SCATTERING AND REFRACTION OF ELECTROMAGNETIC SIGNALS 5a...research is to analyze influence of plasma turbulence on hypersonic sensor systems and NGOTHR applications and to meet the Air Force’s ever-increasing

  20. Time and Frequency Activities at The U.S. Naval Observatory

    DTIC Science & Technology

    2011-01-01

    TWSTFT ) The most accurate means of operational long-distance time transfer is generally believed to be TWSTT [15-18], although the most precise...Frequency Transfer ( TWSTFT ),” Review of Radio Science (Oxford Science Publications), pp. 27-44. [16] L. A. Breakiron, A. L. Smith, B. C. Fonville...Matsakis, L. Breakiron, A. Bauch, D. Piester, D., and Z. Jiang, 2009, “Two-Way Satellite Time and Frequency ( TWSTFT ) Transfer Calibration Constancy from

  1. Studies on Instabilities in Long-Baseline Two-Way Satellite Time and Frequency Transfer (TWSTFT) Including a Troposphere Delay Model

    DTIC Science & Technology

    2007-11-01

    TRANSFER ( TWSTFT ) INCLUDING A TROPOSPHERE DELAY MODEL D. Piester, A. Bauch Physikalisch-Technische Bundesanstalt (PTB) Bundesallee 100...Abstract Two-way satellite time and frequency transfer ( TWSTFT ) is one of the leading techniques for remote comparisons of atomic frequency standards...nanosecond level. These achievements are due to the fact that many delay variations of the transmitted signals cancel out in TWSTFT because of the

  2. Simultaneously precise frequency transfer and time synchronization using feed-forward compensation technique via 120 km fiber link.

    PubMed

    Chen, Xing; Lu, Jinlong; Cui, Yifan; Zhang, Jian; Lu, Xing; Tian, Xusheng; Ci, Cheng; Liu, Bo; Wu, Hong; Tang, Tingsong; Shi, Kebin; Zhang, Zhigang

    2015-12-22

    Precision time synchronization between two remote sites is desired in many applications such as global positioning satellite systems, long-baseline interferometry, coherent radar detection and fundamental physics constant measurements. The recently developed frequency dissemination technologies based on optical fiber link have improved the transfer instability to the level of 10(-19)/day at remote location. Therefore it is possible to keep clock oscillation at remote locations continuously corrected, or to reproduce a "virtual" clock on the remote location. However the initial alignment and the correction of 1 pps timing signal from time to time are still required, besides the highly stabilized clock frequency transfer between distant locations. Here we demonstrate a time synchronization based on an ultra-stable frequency transfer system via 120-km commercial fiber link by transferring an optical frequency comb. Both the phase noise compensation in frequency dissemination and temporal basis alignment in time synchronization were implemented by a feed-forward digital compensation (FFDC) technique. The fractional frequency instability was measured to be 6.18 × 10(-20) at 2000 s. The timing deviation of time synchronization was measured to be 0.6 ps in 1500 s. This technique also can be applied in multi-node fiber network topology.

  3. Simultaneously precise frequency transfer and time synchronization using feed-forward compensation technique via 120 km fiber link

    PubMed Central

    Chen, Xing; Lu, Jinlong; Cui, Yifan; Zhang, Jian; Lu, Xing; Tian, Xusheng; Ci, Cheng; Liu, Bo; Wu, Hong; Tang, Tingsong; Shi, Kebin; Zhang, Zhigang

    2015-01-01

    Precision time synchronization between two remote sites is desired in many applications such as global positioning satellite systems, long-baseline interferometry, coherent radar detection and fundamental physics constant measurements. The recently developed frequency dissemination technologies based on optical fiber link have improved the transfer instability to the level of 10−19/day at remote location. Therefore it is possible to keep clock oscillation at remote locations continuously corrected, or to reproduce a “virtual” clock on the remote location. However the initial alignment and the correction of 1 pps timing signal from time to time are still required, besides the highly stabilized clock frequency transfer between distant locations. Here we demonstrate a time synchronization based on an ultra-stable frequency transfer system via 120-km commercial fiber link by transferring an optical frequency comb. Both the phase noise compensation in frequency dissemination and temporal basis alignment in time synchronization were implemented by a feed-forward digital compensation (FFDC) technique. The fractional frequency instability was measured to be 6.18 × 10−20 at 2000 s. The timing deviation of time synchronization was measured to be 0.6 ps in 1500 s. This technique also can be applied in multi-node fiber network topology. PMID:26691731

  4. Simulation of the modulation transfer function dependent on the partial Fourier fraction in dynamic contrast enhancement magnetic resonance imaging.

    PubMed

    Takatsu, Yasuo; Ueyama, Tsuyoshi; Miyati, Tosiaki; Yamamura, Kenichirou

    2016-12-01

    The image characteristics in dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) depend on the partial Fourier fraction and contrast medium concentration. These characteristics were assessed and the modulation transfer function (MTF) was calculated by computer simulation. A digital phantom was created from signal intensity data acquired at different contrast medium concentrations on a breast model. The frequency images [created by fast Fourier transform (FFT)] were divided into 512 parts and rearranged to form a new image. The inverse FFT of this image yielded the MTF. From the reference data, three linear models (low, medium, and high) and three exponential models (slow, medium, and rapid) of the signal intensity were created. Smaller partial Fourier fractions, and higher gradients in the linear models, corresponded to faster MTF decline. The MTF more gradually decreased in the exponential models than in the linear models. The MTF, which reflects the image characteristics in DCE-MRI, was more degraded as the partial Fourier fraction decreased.

  5. Aerosol scattering and absorption modulation transfer function

    NASA Astrophysics Data System (ADS)

    Sadot, Dan; Kopeika, Norman S.

    1993-08-01

    Recent experimental measurements of overall atmospheric modulation transfer function (MTF) indicate significant difference between the turbulence and overall atmospheric MTFs, except often at midday when turbulence is strong. We suggest here a physical explanation for those results which essentially relates to what we call a practical instrumentation-based atmospheric aerosol MTF which is a modification of the classical aerosol MTF theory. It is shown that system field-of-view and dynamic range affect strongly aerosol and overall atmospheric MTFs. It is often necessary to choose between MTF and SNR depending upon dynamic range requirements. Also, a new approach regarding aerosol absorption is presented. It is shown that aerosol-absorbed irradiance is spatial frequency dependent and enhances the degradation in image quality arising from received scattered light. This is most relevant for thermal imaging. An analytically corrected model for the aerosol MTF is presented which is relevant for imaging. An important conclusion is that the aerosol MTF is often the dominant part in the actual overall atmospheric MTF all across the optical spectral region.

  6. Ultrasonic Data Display and Analysis System Developed (Including Fuzzy Logic Analysis) for the Windows-Based PC

    NASA Technical Reports Server (NTRS)

    Lovelace, Jeffrey J.; Cios, Kryzsztof J.; Roth, Don J.; cAO, wEI n.

    2001-01-01

    Post-Scan Interactive Data Display (PSIDD) III is a user-oriented Windows-based system that facilitates the display and comparison of ultrasonic contact measurement data obtained at NASA Glenn Research Center's Ultrasonic Nondestructive Evaluation measurement facility. The system is optimized to compare ultrasonic measurements made at different locations within a material or at different stages of material degradation. PSIDD III provides complete analysis of the primary waveforms in the time and frequency domains along with the calculation of several frequency-dependent properties including phase velocity and attenuation coefficient and several frequency-independent properties, like the cross correlation velocity. The system allows image generation on all the frequency-dependent properties at any available frequency (limited by the bandwidth used in the scans) and on any of the frequency-independent properties. From ultrasonic contact scans, areas of interest on an image can be studied with regard to underlying raw waveforms and derived ultrasonic properties by simply selecting the point on the image. The system offers various modes of indepth comparison between scan points. Up to five scan points can be selected for comparative analysis at once. The system was developed with Borland Delphi software (Visual Pascal) and is based on an SQL data base. It is ideal for the classification of material properties or the location of microstructure variations in materials. Along with the ultrasonic contact measurement software that it is partnered with, this system is technology ready and can be transferred to users worldwide.

  7. Theory for cross effect dynamic nuclear polarization under magic-angle spinning in solid state nuclear magnetic resonance: the importance of level crossings.

    PubMed

    Thurber, Kent R; Tycko, Robert

    2012-08-28

    We present theoretical calculations of dynamic nuclear polarization (DNP) due to the cross effect in nuclear magnetic resonance under magic-angle spinning (MAS). Using a three-spin model (two electrons and one nucleus), cross effect DNP with MAS for electron spins with a large g-anisotropy can be seen as a series of spin transitions at avoided crossings of the energy levels, with varying degrees of adiabaticity. If the electron spin-lattice relaxation time T(1e) is large relative to the MAS rotation period, the cross effect can happen as two separate events: (i) partial saturation of one electron spin by the applied microwaves as one electron spin resonance (ESR) frequency crosses the microwave frequency and (ii) flip of all three spins, when the difference of the two ESR frequencies crosses the nuclear frequency, which transfers polarization to the nuclear spin if the two electron spins have different polarizations. In addition, adiabatic level crossings at which the two ESR frequencies become equal serve to maintain non-uniform saturation across the ESR line. We present analytical results based on the Landau-Zener theory of adiabatic transitions, as well as numerical quantum mechanical calculations for the evolution of the time-dependent three-spin system. These calculations provide insight into the dependence of cross effect DNP on various experimental parameters, including MAS frequency, microwave field strength, spin relaxation rates, hyperfine and electron-electron dipole coupling strengths, and the nature of the biradical dopants.

  8. Relativistic theory for time and frequency transfer to order c-3

    NASA Astrophysics Data System (ADS)

    Blanchet, L.; Salomon, C.; Teyssandier, P.; Wolf, P.

    2001-04-01

    This paper is motivated by the current development of several space missions (e.g. ACES on International Space Station) that will use Earth-orbit laser cooled atomic clocks, providing a time-keeping accuracy of the order of 5 10-17 in fractional frequency. We show that to such accuracy, the theory of frequency transfer between Earth and Space must be extended from the currently known relativistic order 1/c2 (which has been needed in previous space experiments such as GP-A) to the next relativistic correction of order 1/c3. We find that the frequency transfer includes the first and second-order Doppler contributions, the Einstein gravitational red-shift and, at the order 1/c3, a mixture of these effects. As for the time transfer, it contains the standard Shapiro time delay, and we present an expression also including the first and second-order Sagnac corrections. Higher-order relativistic corrections, at least {cal O}(1/c4), are numerically negligible for time and frequency transfers in these experiments, being for instance of order 10-20 in fractional frequency. Particular attention is paid to the problem of the frequency transfer in the two-way experimental configuration. In this case we find a simple theoretical expression which extends the previous formula (Vessot et al. \\cite{VessotLevine}) to the next order 1/c3. In the Appendix we present the detailed proofs of all the formulas which will be needed in such experiments.

  9. On the calculation of charge transfer transitions with standard density functionals using constrained variational density functional theory.

    PubMed

    Ziegler, Tom; Krykunov, Mykhaylo

    2010-08-21

    It is well known that time-dependent density functional theory (TD-DFT) based on standard gradient corrected functionals affords both a quantitative and qualitative incorrect picture of charge transfer transitions between two spatially separated regions. It is shown here that the well known failure can be traced back to the use of linear response theory. Further, it is demonstrated that the inclusion of higher order terms readily affords a qualitatively correct picture even for simple functionals based on the local density approximation. The inclusion of these terms is done within the framework of a newly developed variational approach to excitation energies called constrained variational density functional theory (CV-DFT). To second order [CV(2)-DFT] this theory is identical to adiabatic TD-DFT within the Tamm-Dancoff approximation. With inclusion of fourth order corrections [CV(4)-DFT] it affords a qualitative correct description of charge transfer transitions. It is finally demonstrated that the relaxation of the ground state Kohn-Sham orbitals to first order in response to the change in density on excitation together with CV(4)-DFT affords charge transfer excitations in good agreement with experiment. The new relaxed theory is termed R-CV(4)-DFT. The relaxed scheme represents an effective way in which to introduce double replacements into the description of single electron excitations, something that would otherwise require a frequency dependent kernel.

  10. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    PubMed Central

    Van Horn, Christopher R.

    2017-01-01

    ABSTRACT The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 (X. fastidiosa subsp. fastidiosa) or Dixon (X. fastidiosa subsp. multiplex) as the donor strain and Temecula (X. fastidiosa subsp. fastidiosa) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa, possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa, or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence in this diverse pathogen. PMID:28808128

  11. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    PubMed

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence in this diverse pathogen.

  12. Spatial frequency discrimination learning in normal and developmentally impaired human vision

    PubMed Central

    Astle, Andrew T.; Webb, Ben S.; McGraw, Paul V.

    2010-01-01

    Perceptual learning effects demonstrate that the adult visual system retains neural plasticity. If perceptual learning holds any value as a treatment tool for amblyopia, trained improvements in performance must generalise. Here we investigate whether spatial frequency discrimination learning generalises within task to other spatial frequencies, and across task to contrast sensitivity. Before and after training, we measured contrast sensitivity and spatial frequency discrimination (at a range of reference frequencies 1, 2, 4, 8, 16 c/deg). During training, normal and amblyopic observers were divided into three groups. Each group trained on a spatial frequency discrimination task at one reference frequency (2, 4, or 8 c/deg). Normal and amblyopic observers who trained at lower frequencies showed a greater rate of within task learning (at their reference frequency) compared to those trained at higher frequencies. Compared to normals, amblyopic observers showed greater within task learning, at the trained reference frequency. Normal and amblyopic observers showed asymmetrical transfer of learning from high to low spatial frequencies. Both normal and amblyopic subjects showed transfer to contrast sensitivity. The direction of transfer for contrast sensitivity measurements was from the trained spatial frequency to higher frequencies, with the bandwidth and magnitude of transfer greater in the amblyopic observers compared to normals. The findings provide further support for the therapeutic efficacy of this approach and establish general principles that may help develop more effective protocols for the treatment of developmental visual deficits. PMID:20832416

  13. Transfer to intermediate forms following concept discrimination by pigeons: chimeras and morphs.

    PubMed Central

    Ghosh, Natasha; Lea, Stephen E G; Noury, Malia

    2004-01-01

    Two experiments examined pigeons' generalization to intermediate forms following training of concept discriminations. In Experiment 1, the training stimuli were sets of images of dogs and cats, and the transfer stimuli were head/body chimeras, which humans tend to categorize more readily in terms of the head part rather than the body part. In Experiment 2, the training stimuli were sets of images of heads of dogs and cats, and the intermediate stimuli were computer-generated morphs. In both experiments, pigeons learned the concept discrimination quickly and generalized with some decrement to novel instances of the categories. In both experiments, transfer tests were carried out with intermediate forms generated from both familiar and novel exemplars of the training sets. In Experiment 1, the pigeons' transfer performance, unlike that of human infants exposed to similar stimuli, was best predicted by the body part of the stimulus when the chimeras were formed from familiar exemplars. Spatial frequency analysis of the stimuli showed that the body parts were richer in high spatial frequencies than the head parts, so these data are consistent with the hypothesis that categorization is more dependent on local stimulus features in pigeons than in humans. There was no corresponding trend when the chimeras were formed from novel exemplars. In Experiment 2, when morphs of training stimuli were used, response rates declined smoothly as the proportion of the morph contributed by the positive stimulus fell, although results with morphs of novel stimuli were again less orderly. PMID:15540501

  14. Regulation control and energy management scheme for wireless power transfer

    DOEpatents

    Miller, John M.

    2015-12-29

    Power transfer rate at a charging facility can be maximized by employing a feedback scheme. The state of charge (SOC) and temperature of the regenerative energy storage system (RESS) pack of a vehicle is monitored to determine the load due to the RESS pack. An optimal frequency that cancels the imaginary component of the input impedance for the output signal from a grid converter is calculated from the load of the RESS pack, and a frequency offset f* is made to the nominal frequency f.sub.0 of the grid converter output based on the resonance frequency of a magnetically coupled circuit. The optimal frequency can maximize the efficiency of the power transfer. Further, an optimal grid converter duty ratio d* can be derived from the charge rate of the RESS pack. The grid converter duty ratio d* regulates wireless power transfer (WPT) power level.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chinthavali, Madhu Sudhan; Wang, Zhiqiang

    This paper presents a detailed parametric sensitivity analysis for a wireless power transfer (WPT) system in electric vehicle application. Specifically, several key parameters for sensitivity analysis of a series-parallel (SP) WPT system are derived first based on analytical modeling approach, which includes the equivalent input impedance, active / reactive power, and DC voltage gain. Based on the derivation, the impact of primary side compensation capacitance, coupling coefficient, transformer leakage inductance, and different load conditions on the DC voltage gain curve and power curve are studied and analyzed. It is shown that the desired power can be achieved by just changingmore » frequency or voltage depending on the design value of coupling coefficient. However, in some cases both have to be modified in order to achieve the required power transfer.« less

  16. The Accuracy of Two-Way Satellite Time Transfer Calibrations

    DTIC Science & Technology

    2005-01-01

    20392, USA Abstract Results from successive calibrations of Two-Way Satellite Time and Frequency Transfer ( TWSTFT ) operational equipment at...USNO and five remote stations using portable TWSTFT equipment are analyzed for internal and external errors, finding an average random error of ±0.35...most accurate means of operational long-distance time transfer are Two-Way Satellite Time and Frequency Transfer ( TWSTFT ) and carrier-phase GPS

  17. Dynamic characterization of AFM probes by laser Doppler vibrometry and stroboscopic holographic methodologies

    NASA Astrophysics Data System (ADS)

    Kuppers, J. D.; Gouverneur, I. M.; Rodgers, M. T.; Wenger, J.; Furlong, C.

    2006-08-01

    In atomic probe microscopy, micro-probes of various sizes, geometries, and materials are used to define the interface between the samples under investigation and the measuring detectors and instrumentation. Therefore, measuring resolution in atomic probe microscopy is highly dependent on the transfer function characterizing the micro-probes used. In this paper, characterization of the dynamic transfer function of specific micro-cantilever probes used in an Atomic Force Microscope (AFM) operating in the tapping mode is presented. Characterization is based on the combined application of laser Doppler vibrometry (LDV) and real-time stroboscopic optoelectronic holographic microscopy (OEHM) methodologies. LDV is used for the rapid measurement of the frequency response of the probes due to an excitation function containing multiple frequency components. Data obtained from the measured frequency response is used to identify the principal harmonics. In order to identify mode shapes corresponding to the harmonics, full-field of view OEHM is applied. This is accomplished by measurements of motion at various points on the excitation curve surrounding the identified harmonics. It is shown that the combined application of LDV and OEHM enables the high-resolution characterization of mode shapes of vibration, damping characteristics, as well as transient response of the micro-cantilever probes. Such characterization is necessary in high-resolution AFM measurements.

  18. Data and Time Transfer Using SONET Radio

    NASA Technical Reports Server (NTRS)

    Graceffo, Gary M.

    1996-01-01

    The need for precise knowledge of time and frequency has become ubiquitous throughout our society. The areas of astronomy, navigation, and high speed wide-area networks are among a few of the many consumers of this type of information. The Global Positioning System (GPS) has the potential to be the most comprehensive source of precise timing information developed to date; however, the introduction of selective availability has made it difficult for many users to recover this information from the GPS system with the precision required for today's systems. The system described in this paper is a 'Synchronous Optical NetWORK (SONET) Radio Data and Time Transfer System'. The objective of this system is to provide precise time and frequency information to a variety of end-users using a two-way data and time-transfer system. Although time and frequency transfers have been done for many years, this system is unique in that time and frequency information are embedded into existing communications traffic. This eliminates the need to make the transfer of time and frequency informatio a dedicated function of the communications system. For this system SONET has been selected as the transport format from which precise time is derived. SONET has been selected because of its high data rates and its increasing acceptance throughout the industry. This paper details a proof-of-concept initiative to perform embedded time and frequency transfers using SONET Radio.

  19. Ultrafast dynamics of liquid water: Energy relaxation and transfer processes of the OH stretch and the HOH bend

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imoto, Sho; Xantheas, Sotiris S.; Saito, Shinji

    2015-08-27

    The vibrational energy relaxation and transfer processes of the OH stretching and the HOH bending vibrations in liquid water are investigated via the theoretical calculation of the pump-probe spectra obtained from non-equilibrium molecular dynamics simulations with the TTM3-F interaction potential. The excitation of the OH stretch induces an instantaneous response of the high frequency librational motions in the 600-1000 cm-1 range. In addition, the excess energy of the OH stretch of a water molecule quickly transfers to the OH stretches of molecules in its first hydration shell with a time constant of ~50 fs, followed by relaxation to the HOHmore » bends of the surrounding molecules with a time constant of 230 fs. The excitation of the HOH bend also results in the ultrafast excitation of the high frequency librational motions. The energy of the excited HOH bend of a water molecule decays, with a time constant of 200 fs, mainly to the relaxation of the HOH bends of its surrounding molecules. The energies of the HOH bends were found to transfer quickly to the intermolecular motions via the coupling with the high frequency librational motions. The excess energy of the OH stretch or the HOH bend relaxes to the high frequency intermolecular librational motions and eventually to the hot ground state with a time scale of ~1 ps via the coupling with the librational and translational motions. The energy relaxation and transfer processes were found to depend on the local hydrogen bonding network; the relaxations of the excess energy of the OH stretch and the HOH bend of four- and five-coordinated molecules are faster than those of a three-coordinated molecule due to the delocalization of the vibrational motions of the former (four- and five-coordinated molecules) compared to those of the later (three-coordinated molecules). The present results highlight the importance of the high frequency intermolecular librational modes in facilitating the ultrafast energy relaxation process in liquid water via their strong nonlinear couplings with the intramolecular OH stretching and HOH bending vibrations. S.S.X. acknowledges the support of the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences. Pacific Northwest National Laboratory (PNNL) is a multiprogram national laboratory operated for DOE by Battelle. The calculation was carried out using the computing resources at the Research Center for Computational Science in Okazaki, Japan.« less

  20. Discrete multi-physics simulations of diffusive and convective mass transfer in boundary layers containing motile cilia in lungs.

    PubMed

    Ariane, Mostapha; Kassinos, Stavros; Velaga, Sitaram; Alexiadis, Alessio

    2018-04-01

    In this paper, the mass transfer coefficient (permeability) of boundary layers containing motile cilia is investigated by means of discrete multi-physics. The idea is to understand the main mechanisms of mass transport occurring in a ciliated-layer; one specific application being inhaled drugs in the respiratory epithelium. The effect of drug diffusivity, cilia beat frequency and cilia flexibility is studied. Our results show the existence of three mass transfer regimes. A low frequency regime, which we called shielding regime, where the presence of the cilia hinders mass transport; an intermediate frequency regime, which we have called diffusive regime, where diffusion is the controlling mechanism; and a high frequency regime, which we have called convective regime, where the degree of bending of the cilia seems to be the most important factor controlling mass transfer in the ciliated-layer. Since the flexibility of the cilia and the frequency of the beat changes with age and health conditions, the knowledge of these three regimes allows prediction of how mass transfer varies with these factors. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Thermal characteristics of time-periodic electroosmotic flow in a circular microchannel

    NASA Astrophysics Data System (ADS)

    Moghadam, Ali Jabari

    2015-10-01

    A theoretical analysis is performed to explore the thermal characteristics of electroosmotic flow in a circular microchannel under an alternating electric field. An analytical approach is presented to solve energy equation, and then, the exact solution of temperature profiles is obtained by using the Green's function method. This study reveals that the temperature field repeats itself for each half-period. Frequency has a strong influence on the thermal behavior of the flow field. For small values of the dimensionless frequency (small channel size, large kinematic viscosity, or small frequency), the advection mechanism is dominant in the whole domain and the resultant heating (Joule heating and wall heat flux) can be transferred by the complete flow field in the axial direction; while, the middle portion of the flow field at high dimensionless frequencies does not have sufficient time to transfer heat by advection, and the bulk fluid temperature, especially in heating, may consequently become greater than the wall temperature. In a particular instance of cooling mode, a constant surface temperature case is temporarily occurred in which the axial temperature gradient will be zero. For relatively high frequencies, the unsteady bulk fluid temperature in some radial positions at some moments may be equal to the wall temperature; hence instantaneous cylindrical surfaces with zero radial heat flux may occur over a period of time. Depending on the value and sign of the thermal scale ratio, the quasi-steady-state Nusselt number (time-averaged at one period) approaches a specific value as the electrokinetic radius becomes infinity.

  2. Laser frequency stabilization using a transfer interferometer

    NASA Astrophysics Data System (ADS)

    Jackson, Shira; Sawaoka, Hiromitsu; Bhatt, Nishant; Potnis, Shreyas; Vutha, Amar C.

    2018-03-01

    We present a laser frequency stabilization system that uses a transfer interferometer to stabilize slave lasers to a reference laser. Our implementation uses off-the-shelf optical components along with microcontroller-based digital feedback, and offers a simple, flexible, and robust way to stabilize multiple laser frequencies to better than 1 MHz.

  3. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2004-12-01

    325-332. [15] D. Kirchner, 1999, “Two Way Satellite Time and Frequency Transfer ( TWSTFT ),” Review of Radio Science (Oxford Science Publications...Time and Frequency Transfer ( TWSTFT ),” in Proceedings of the 36th Annual Precise Time and Time Interval (PTTI) Systems and Applications Meeting, 7-9

  4. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2005-01-01

    Naval Observatory, Washington, D.C.), pp. 325-332. [15] D. Kirchner, 1999, “Two Way Satellite Time and Frequency Transfer ( TWSTFT ),” Review of...of Carrier- Phase-Based Two-Way Satellite Time and Frequency Transfer ( TWSTFT ),” in Proceedings of the 36th Annual Precise Time and Time Interval

  5. Microgravity modulation effects on free convection problems LBM simulation

    NASA Astrophysics Data System (ADS)

    Javadi, Khodayar; Kazemi, Koorosh

    2018-01-01

    In this paper, microgravity modulation effects on free convection in a cavity are investigated using the lattice Boltzmann method. In order to create microgravity modulation, a sinusoidal time-dependent function is considered. Parameters of the flow are chosen such that the maximum Rayleigh number approaches 106. The natural frequency of the system is obtained at first. Afterwards, effects of different frequencies on the flow and heat transfer fields are investigated in detail. Results are presented in four different frequency ratios categorized as (1) ω*=1/200 , 1/100 , 1/20 , and 1/10 ; (2) ω*=1/8 , 1/5 , 1/3 , and 1/2 ; (3) ω* = 0.75, 0.85, and 0.95; and (4) the last one is considered for natural frequency as a special case of ω* = 1. Furthermore, the fast Fourier transformation is used to describe the cavity flow behavior. The results indicated that at low frequency, the system has enough time to adapt itself with the gravity modulation while historical effects do not disappear. Increasing the frequency changes the behavior of the system and different flow patterns appear. Finally, at the natural frequency (ω* = 1), all system modes are stimulated and a strange flow pattern is formed.

  6. A multi-frequency radiometric measurement of soil moisture content over bare and vegetated fields

    NASA Technical Reports Server (NTRS)

    Wang, J. R.; Schmugge, T. J.; Mcmurtrey, J. E., III; Gould, W. I.; Glazar, W. S.; Fuchs, J. E. (Principal Investigator)

    1981-01-01

    A USDA Beltsville Agricultural Research Center site was used for an experiment in which soil moisture remote sensing over bare, grass, and alfalfa fields was conducted over a three-month period using 0.6 GHz, 1.4 GHz, and 10.6 GHz Dicke-type microwave radiometers mounted on mobile towers. Ground truth soil moisture content and ambient air and sil temperatures were obtained concurrently with the radiometric measurements. Biomass of the vegetation cover was sampled about once a week. Soil density for each of the three fields was measured several times during the course of the experiment. Results of the radiometric masurements confirm the frequency dependence of moisture sensing sensitivity reduction reported earlier. Observations over the bare, wet field show that the measured brightness temperature is lowest at 5.0 GHz and highest of 0.6 GHz frequency, a result contrary to expectation based on the estimated dielectric permittivity of soil water mixtures and current radiative transfer model in that frequency range.

  7. Analysis of Single-Frequency GNSS Data for Determination of Time-Dependent Flow and Deformation of Fast-Moving Glaciers

    NASA Astrophysics Data System (ADS)

    Davis, J. L.; Elosegui, P.; Nettles, M.

    2012-12-01

    Single-frequency GNSS data has not generally been used for high-accuracy geodetic applications since the 1990s, but there are significant advantages if single-frequency GNSS receivers can be usefully deployed for studies of fast-moving outlet glaciers. The cost for these receivers is significantly lower (~50%) than for dual-frequency receivers, a significant benefit given the high spatial density at which these system are deployed on the glacier and the high risk for damage or loss in the glacial environment. In addition, the size of the data files that need to be transferred from extremely remote locations, often at very slow transmission rates, is significantly reduced. Consideration of single-frequency systems for this application is viable because of the relatively small extent (< 50 km) of the entire network to be deployed. Unfortunately, the availability of research-quality software that can perform kinematic solutions on single-frequency data is limited. We have developed the BAKAR software employing a stochastic filter to analyze single-frequency GNSS data. The software can implement a range of stochastic models for time-dependent site position. In this presentation, we describe the BAKAR software, and discuss its strengths and weaknesses. On one hand, chief among the challenges we have encountered are determination of accurate prior positions, and bursts of polar ionospheric activity that impede cycle-slip detection, even over intersite distances as short as 10 km. On the other hand, use of a single-frequency observable is theoretically less sensitive to multipath and signal scattering. We will quantitatively assess these effects, and assess the accuracy of BAKAR in a range of situations and applications.

  8. Disturbing the coherent dynamics of an excitonic polarization with strong terahertz fields

    NASA Astrophysics Data System (ADS)

    Drexler, M. J.; Woscholski, R.; Lippert, S.; Stolz, W.; Rahimi-Iman, A.; Koch, M.

    2014-11-01

    We present a paper based on combining four-wave mixing and strong fields in the terahertz frequency range to monitor the time evolution of a disturbed excitonic polarization in a multiple quantum well system. Our findings not only confirm a lower field-dependent ionization threshold for higher excitonic states, but furthermore provide experimental evidence for intraexcitonic Rabi flopping in the time domain. These measurements correspond to the picture of a reversible and irreversible transfer as previously predicted by a microscopic theory.

  9. The frequency of and reasons for acute hospital transfers of older nursing home residents.

    PubMed

    Kirsebom, Marie; Hedström, Mariann; Wadensten, Barbro; Pöder, Ulrika

    2014-01-01

    The purpose of the study was to examine the frequency of and reason for transfer from nursing homes to the emergency department (ED), whether these transfers led to admission to a hospital ward, and whether the transfer rate differs as a function of type of nursing home provider and to identify the frequency of avoidable hospitalizations as defined by the Swedish Association of Local Authorities and Regions (SALAR). The design was retrospective, descriptive. Data were collected in a Swedish municipality where 30,000 inhabitants are 65 years or older. Structured reviews of the electronic healthcare records were performed. Included were residents living in a nursing home age 65+, with healthcare records including documented transfers to the ED during a 9-month period in 2010. The transfer rate to the ED was 594 among a total of 431 residents (M=1.37 each). 63% resulted in hospitalization (M=7.12 days). Nursing home's transfer rate differed between 0.00 and 1.03 transfers/bed and was higher for the private for-profit providers than for public/private non-profit providers. One-fourth of the transfers were caused by falls and/or injuries, including fractures. The frequency of avoidable hospitalizations was 16% among the 375 hospitalizations. The proportion of transfers to the ED ranged widely between nursing homes. The reasons for this finding ought to be explored. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Simulation based estimation of dynamic mechanical properties for viscoelastic materials used for vocal fold models

    NASA Astrophysics Data System (ADS)

    Rupitsch, Stefan J.; Ilg, Jürgen; Sutor, Alexander; Lerch, Reinhard; Döllinger, Michael

    2011-08-01

    In order to obtain a deeper understanding of the human phonation process and the mechanisms generating sound, realistic setups are built up containing artificial vocal folds. Usually, these vocal folds consist of viscoelastic materials (e.g., polyurethane mixtures). Reliable simulation based studies on the setups require the mechanical properties of the utilized viscoelastic materials. The aim of this work is the identification of mechanical material parameters (Young's modulus, Poisson's ratio, and loss factor) for those materials. Therefore, we suggest a low-cost measurement setup, the so-called vibration transmission analyzer (VTA) enabling to analyze the transfer behavior of viscoelastic materials for propagating mechanical waves. With the aid of a mathematical Inverse Method, the material parameters are adjusted in a convenient way so that the simulation results coincide with the measurement results for the transfer behavior. Contrary to other works, we determine frequency dependent functions for the mechanical properties characterizing the viscoelastic material in the frequency range of human speech (100-250 Hz). The results for three different materials clearly show that the Poisson's ratio is close to 0.5 and that the Young's modulus increases with higher frequencies. For a frequency of 400 Hz, the Young's modulus of the investigated viscoelastic materials is approximately 80% higher than for the static case (0 Hz). We verify the identified mechanical properties with experiments on fabricated vocal fold models. Thereby, only small deviations between measurements and simulations occur.

  11. A novel x-ray detector design with higher DQE and reduced aliasing: Theoretical analysis of x-ray reabsoprtion in detector converter material

    NASA Astrophysics Data System (ADS)

    Nano, Tomi; Escartin, Terenz; Karim, Karim S.; Cunningham, Ian A.

    2016-03-01

    The ability to improve visualization of structural information in digital radiography without increasing radiation exposures requires improved image quality across all spatial frequencies, especially at high frequencies. The detective quantum efficiency (DQE) as a function of spatial frequency quantifies image quality given by an x-ray detector. We present a method of increasing DQE at high spatial frequencies by improving the modulation transfer function (MTF) and reducing noise aliasing. The Apodized Aperature Pixel (AAP) design uses a detector with micro-elements to synthesize desired pixels and provide higher DQE than conventional detector designs. A cascaded system analysis (CSA) that incorporates x-ray interactions is used for comparison of the theoretical MTF, noise power spectrum (NPS), and DQE. Signal and noise transfer through the converter material is shown to consist of correlated an uncorrelated terms. The AAP design was shown to improve the DQE of both material types that have predominantly correlated transfer (such as CsI) and predominantly uncorrelated transfer (such as Se). Improvement in the MTF by 50% and the DQE by 100% at the sampling cut-off frequency is obtained when uncorrelated transfer is prevalent through the converter material. Optimizing high-frequency DQE results in improved image contrast and visualization of small structures and fine-detail.

  12. pH imaging of mouse kidneys in vivo using a frequency-dependent paraCEST agent.

    PubMed

    Wu, Yunkou; Zhang, Shanrong; Soesbe, Todd C; Yu, Jing; Vinogradov, Elena; Lenkinski, Robert E; Sherry, A Dean

    2016-06-01

    This study explored the feasibility of using a pH responsive paramagnetic chemical exchange saturation transfer (paraCEST) agent to image the pH gradient in kidneys of healthy mice. CEST signals were acquired on an Agilent 9.4 Tesla small animal MRI system using a steady-state gradient echo pulse sequence after a bolus injection of agent. The magnetic field inhomogeneity across each kidney was corrected using the WASSR method and pH maps were calculated by measuring the frequency of water exchange signal arising from the agent. Dynamic CEST studies demonstrated that the agent was readily detectable in kidneys only between 4 to 12 min postinjection. The CEST images showed a higher signal intensity in the pelvis and calyx regions and lower signal intensity in the medulla and cortex regions. The pH maps reflected tissue pH values spanning from 6.0 to 7.5 in kidneys of healthy mice. This study demonstrated that pH maps of the kidney can be imaged in vivo by measuring the pH-dependent chemical shift of a single water exchange CEST peak without prior knowledge of the agent concentration in vivo. The results demonstrate the potential of using a simple frequency-dependent paraCEST agent for mapping tissue pH in vivo. Magn Reson Med 75:2432-2441, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  13. Analysis of temperature rise for piezoelectric transformer using finite-element method.

    PubMed

    Joo, Hyun-Woo; Lee, Chang-Hwan; Rho, Jong-Seok; Jung, Hyun-Kyo

    2006-08-01

    Analysis of heat problem and temperature field of a piezoelectric transformer, operated at steady-state conditions, is described. The resonance frequency of the transformer is calculated from impedance and electrical gain analysis using a finite-element method. Mechanical displacement and electric potential of the transformer at the calculated resonance frequency are used to calculate the loss distribution of the transformer. Temperature distribution using discretized heat transfer equation is calculated from the obtained losses of the transformer. Properties of the piezoelectric material, dependent on the temperature field, are measured to recalculate the losses, temperature distribution, and new resonance characteristics of the transformer. Iterative method is adopted to recalculate the losses and resonance frequency due to the changes of the material constants from temperature increase. Computed temperature distributions and new resonance characteristics of the transformer at steady-state temperature are verified by comparison with experimental results.

  14. Proceedings of the Sixteenth Annual Precise Time and Time Interval (PTTI) Applications and Planning Meeting

    NASA Technical Reports Server (NTRS)

    1984-01-01

    The effects of ionospheric and tropospheric propagation on time and frequency transfer, advances in the generation of precise time and frequency, time transfer techniques and filtering and modeling were among the topics emphasized. Rubidium and cesium frequency standard, crystal oscillators, masers, Kalman filters, and atomic clocks were discussed.

  15. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2008-12-01

    USA (Institute of Navigation, Alexandria, Virginia). [22] D. Kirchner, 1999, “Two Way Satellite Time and Frequency Transfer ( TWSTFT ),” Review of...Shäfer, and A. Pawlitzki, 2005, “Development of Carrier- Phase-Based Two-Way Satellite Time and Frequency Transfer ( TWSTFT ),” in Proceedings of the 36th

  16. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2007-01-01

    Time and Frequency Transfer ( TWSTFT ),” Review of Radio Science (Oxford Science Publications), pp. 27-44. 14 38th Annual Precise Time and Time Interval...Fonville, D. Matsakis, W. Shäfer, and A. Pawlitzki, 2005, “Development of Carrier- Phase-Based Two-Way Satellite Time and Frequency Transfer ( TWSTFT

  17. The modelling of the flow-induced vibrations of periodic flat and axial-symmetric structures with a wave-based method

    NASA Astrophysics Data System (ADS)

    Errico, F.; Ichchou, M.; De Rosa, S.; Bareille, O.; Franco, F.

    2018-06-01

    The stochastic response of periodic flat and axial-symmetric structures, subjected to random and spatially-correlated loads, is here analysed through an approach based on the combination of a wave finite element and a transfer matrix method. Although giving a lower computational cost, the present approach keeps the same accuracy of classic finite element methods. When dealing with homogeneous structures, the accuracy is also extended to higher frequencies, without increasing the time of calculation. Depending on the complexity of the structure and the frequency range, the computational cost can be reduced more than two orders of magnitude. The presented methodology is validated both for simple and complex structural shapes, under deterministic and random loads.

  18. Aperture shape dependencies in extended depth of focus for imaging camera by wavefront coding

    NASA Astrophysics Data System (ADS)

    Sakita, Koichi; Ohta, Mitsuhiko; Shimano, Takeshi; Sakemoto, Akito

    2015-02-01

    Optical transfer functions (OTFs) on various directional spatial frequency axes for cubic phase mask (CPM) with circular and square apertures are investigated. Although OTF has no zero points, it has a very close value to zero for a circular aperture at low frequencies on diagonal axis, which results in degradation of restored images. The reason for close-to-zero value in OTF is also analyzed in connection with point spread function profiles using Fourier slice theorem. To avoid close-to-zero condition, square aperture with CPM is indispensable in WFC. We optimized cubic coefficient α of CPM and coefficients of digital filter, and succeeded to get excellent de-blurred images at large depth of field.

  19. Applications of free-electron lasers to measurements of energy transfer in biopolymers and materials

    NASA Astrophysics Data System (ADS)

    Edwards, Glenn S.; Johnson, J. B.; Kozub, John A.; Tribble, Jerri A.; Wagner, Katrina

    1992-08-01

    Free-electron lasers (FELs) provide tunable, pulsed radiation in the infrared. Using the FEL as a pump beam, we are investigating the mechanisms for energy transfer between localized vibrational modes and between vibrational modes and lattice or phonon modes. Either a laser-Raman system or a Fourier transform infrared (FTIR) spectrometer will serve as the probe beam, with the attribute of placing the burden of detection on two conventional spectroscopic techniques that circumvent the limited response of infrared detectors. More specifically, the Raman effect inelastically shifts an exciting laser line, typically a visible frequency, by the energy of the vibrational mode; however, the shifted Raman lines also lie in the visible, allowing for detection with highly efficient visible detectors. With regards to FTIR spectroscopy, the multiplex advantage yields a distinct benefit for infrared detector response. Our group is investigating intramolecular and intermolecular energy transfer processes in both biopolymers and more traditional materials. For example, alkali halides contain a number of defect types that effectively transfer energy in an intermolecular process. Similarly, the functioning of biopolymers depends on efficient intramolecular energy transfer. Understanding these mechanisms will enhance our ability to modify biopolymers and materials with applications to biology, medecine, and materials science.

  20. Theory of ITG turbulent saturation in stellarators: identifying mechanisms to reduce turbulent transport

    DOE PAGES

    Hegna, Chris C.; Terry, Paul W.; Faber, Ben J.

    2018-02-01

    A three-field fluid model that allows for general three-dimensional equilibrium geometry is developed to describe ion temperature gradient turbulent saturation processes in stellarators. The theory relies on the paradigm of nonlinear transfer of energy from unstable to damped modes at comparable wavelength as the dominant saturation mechanism. The unstable-to-damped mode interaction is enabled by a third mode that for dominant energy transfer channels primarily serves as a regulator of the nonlinear energy transfer rate. The identity of the third wave in the interaction defines different scenarios for turbulent saturation with the dominant scenario depending upon the properties of the 3Dmore » geometry. The nonlinear energy transfer physics is quantified by the product of a turbulent correlation lifetime and a geometric coupling coefficient. The turbulent correlation time is determined by a three-wave frequency mismatch, which at long wavelength can be calculated from the sum of the linear eigenfrequencies of the three modes. Larger turbulent correlation times denote larger levels of nonlinear energy transfer and hence smaller turbulent transport. The theory provides an analytic prediction for how 3D shaping can be tuned to lower turbulent transport through saturation processes.« less

  1. Theory of ITG turbulent saturation in stellarators: identifying mechanisms to reduce turbulent transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hegna, Chris C.; Terry, Paul W.; Faber, Ben J.

    A three-field fluid model that allows for general three-dimensional equilibrium geometry is developed to describe ion temperature gradient turbulent saturation processes in stellarators. The theory relies on the paradigm of nonlinear transfer of energy from unstable to damped modes at comparable wavelength as the dominant saturation mechanism. The unstable-to-damped mode interaction is enabled by a third mode that for dominant energy transfer channels primarily serves as a regulator of the nonlinear energy transfer rate. The identity of the third wave in the interaction defines different scenarios for turbulent saturation with the dominant scenario depending upon the properties of the 3Dmore » geometry. The nonlinear energy transfer physics is quantified by the product of a turbulent correlation lifetime and a geometric coupling coefficient. The turbulent correlation time is determined by a three-wave frequency mismatch, which at long wavelength can be calculated from the sum of the linear eigenfrequencies of the three modes. Larger turbulent correlation times denote larger levels of nonlinear energy transfer and hence smaller turbulent transport. The theory provides an analytic prediction for how 3D shaping can be tuned to lower turbulent transport through saturation processes.« less

  2. Local control theory using trajectory surface hopping and linear-response time-dependent density functional theory.

    PubMed

    Curchod, Basile F E; Penfold, Thomas J; Rothlisberger, Ursula; Tavernelli, Ivano

    2013-01-01

    The implementation of local control theory using nonadiabatic molecular dynamics within the framework of linear-response time-dependent density functional theory is discussed. The method is applied to study the photoexcitation of lithium fluoride, for which we demonstrate that this approach can efficiently generate a pulse, on-the-fly, able to control the population transfer between two selected electronic states. Analysis of the computed control pulse yields insights into the photophysics of the process identifying the relevant frequencies associated to the curvature of the initial and final state potential energy curves and their energy differences. The limitations inherent to the use of the trajectory surface hopping approach are also discussed.

  3. Gauss-Seidel and Successive Overrelaxation Methods for Radiative Transfer with Partial Frequency Redistribution

    NASA Astrophysics Data System (ADS)

    Sampoorna, M.; Trujillo Bueno, J.

    2010-04-01

    The linearly polarized solar limb spectrum that is produced by scattering processes contains a wealth of information on the physical conditions and magnetic fields of the solar outer atmosphere, but the modeling of many of its strongest spectral lines requires solving an involved non-local thermodynamic equilibrium radiative transfer problem accounting for partial redistribution (PRD) effects. Fast radiative transfer methods for the numerical solution of PRD problems are also needed for a proper treatment of hydrogen lines when aiming at realistic time-dependent magnetohydrodynamic simulations of the solar chromosphere. Here we show how the two-level atom PRD problem with and without polarization can be solved accurately and efficiently via the application of highly convergent iterative schemes based on the Gauss-Seidel and successive overrelaxation (SOR) radiative transfer methods that had been previously developed for the complete redistribution case. Of particular interest is the Symmetric SOR method, which allows us to reach the fully converged solution with an order of magnitude of improvement in the total computational time with respect to the Jacobi-based local accelerated lambda iteration method.

  4. High-Energy, Multi-Octave-Spanning Mid-IR Sources via Adiabatic Difference Frequency Generation

    DTIC Science & Technology

    2016-10-17

    plan. We have evaluated a brand -new concept in nonlinear optics, adiabatic difference frequency generation (ADFG) for the efficient transfer of...achieved the main goals of our research plan. We have evaluated a brand -new concept in nonlinear optics, adiabatic difference frequency generation (ADFG...research plan. We have evaluated a brand -new concept in nonlinear optics, adiabatic difference frequency generation (ADFG) for the efficient transfer of

  5. Sharpening coarse-to-fine stereo vision by perceptual learning: asymmetric transfer across the spatial frequency spectrum

    PubMed Central

    Tran, Truyet T.; Craven, Ashley P.; Leung, Tsz-Wing; Chat, Sandy W.; Levi, Dennis M.

    2016-01-01

    Neurons in the early visual cortex are finely tuned to different low-level visual features, forming a multi-channel system analysing the visual image formed on the retina in a parallel manner. However, little is known about the potential ‘cross-talk’ among these channels. Here, we systematically investigated whether stereoacuity, over a large range of target spatial frequencies, can be enhanced by perceptual learning. Using narrow-band visual stimuli, we found that practice with coarse (low spatial frequency) targets substantially improves performance, and that the improvement spreads from coarse to fine (high spatial frequency) three-dimensional perception, generalizing broadly across untrained spatial frequencies and orientations. Notably, we observed an asymmetric transfer of learning across the spatial frequency spectrum. The bandwidth of transfer was broader when training was at a high spatial frequency than at a low spatial frequency. Stereoacuity training is most beneficial when trained with fine targets. This broad transfer of stereoacuity learning contrasts with the highly specific learning reported for other basic visual functions. We also revealed strategies to boost learning outcomes ‘beyond-the-plateau’. Our investigations contribute to understanding the functional properties of the network subserving stereovision. The ability to generalize may provide a key principle for restoring impaired binocular vision in clinical situations. PMID:26909178

  6. On the non-Arrhenius temperature dependence of the interwell electron tunneling rate in quasi two dimensional organic quantum wells

    NASA Astrophysics Data System (ADS)

    Jeong, I. S.; Scott, K.; Donovan, K. J.; Wilson, E. G.

    2000-11-01

    The tunneling rate of photocreated charge carriers between layers in Langmuir-Blodgett multilayer structures is measured indirectly using the novel technique of bimolecular recombination quenching. The tunneling rate is measured as a function of the applied electrostatic potential difference between the layers as the temperature is varied between 300 and 4 K. This dependence is examined in light of the Marcus theory of charge transfer where the electrostatic potential replaces the chemical potential as the driving potential. The expectations of the Marcus theory are not met and the rate is effectively temperature independent, contrary to expectation. Other mechanisms are explored that may explain the lack of temperature dependence including the role of high frequency vibrations and the role of the zero point energy of those vibrations. The temperature dependence of the exciton dissociation probability is also examined.

  7. Spectral Attenuation of Sound in Dilute Suspensions with Nonlinear Particle Relaxation

    NASA Technical Reports Server (NTRS)

    Kandula, Max

    2008-01-01

    Previous studies on the sound attenuation in particle-laden flows under Stokesian drag and conduction-controlled heat transfer have been extended to accommodate the nonlinear drag and heat transfer. It has been shown that for large particle-to-fluid density ratio, the particle Reynolds number bears a cubic relationship with (omega(tau))(sub d) (where omega is the circular frequency and (tau)(sub d) the Stokesian particle relaxation time). This dependence leads to the existence of a peak value in the linear absorption coefficient occurring at a finite value of(omega(tau))(sub d). Comparison of the predictions with the test data for the spectral attenuation of sound with water injection in a perfectly expanded supersonic air jet shows a satisfactory trend of the theory accounting for nonlinear particle relaxation processes.

  8. Ultrahigh-mobility graphene devices from chemical vapor deposition on reusable copper

    PubMed Central

    Banszerus, Luca; Schmitz, Michael; Engels, Stephan; Dauber, Jan; Oellers, Martin; Haupt, Federica; Watanabe, Kenji; Taniguchi, Takashi; Beschoten, Bernd; Stampfer, Christoph

    2015-01-01

    Graphene research has prospered impressively in the past few years, and promising applications such as high-frequency transistors, magnetic field sensors, and flexible optoelectronics are just waiting for a scalable and cost-efficient fabrication technology to produce high-mobility graphene. Although significant progress has been made in chemical vapor deposition (CVD) and epitaxial growth of graphene, the carrier mobility obtained with these techniques is still significantly lower than what is achieved using exfoliated graphene. We show that the quality of CVD-grown graphene depends critically on the used transfer process, and we report on an advanced transfer technique that allows both reusing the copper substrate of the CVD growth and making devices with mobilities as high as 350,000 cm2 V–1 s–1, thus rivaling exfoliated graphene. PMID:26601221

  9. Two-dimensional radiative transfer. I - Planar geometry. [in stellar atmospheres

    NASA Technical Reports Server (NTRS)

    Mihalas, D.; Auer, L. H.; Mihalas, B. R.

    1978-01-01

    Differential-equation methods for solving the transfer equation in two-dimensional planar geometries are developed. One method, which uses a Hermitian integration formula on ray segments through grid points, proves to be extremely well suited to velocity-dependent problems. An efficient elimination scheme is developed for which the computing time scales linearly with the number of angles and frequencies; problems with large velocity amplitudes can thus be treated accurately. A very accurate and efficient method for performing a formal solution is also presented. A discussion is given of several examples of periodic media and free-standing slabs, both in static cases and with velocity fields. For the free-standing slabs, two-dimensional transport effects are significant near boundaries, but no important effects were found in any of the periodic cases studied.

  10. {open_quotes}Horizontal{close_quotes} gene transfer from a transgenic potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs - if at all - at an extremely low frequency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlueter, K.; Fuetterer, J.; Potrykus, I.

    1995-10-01

    The frequency of possible {open_quotes}horizontal{close_quotes} gene transfer between a plant and a tightly associated bacterial pathogen was studied in a model system consisting of transgenic Solanum tuberosum, containing a {beta}-lactamase gene linked to a pBR322 origin of replication, and Erwinia chrysanthemi. This experimental system offers optimal conditions for the detection of possible horizontal gene transfer events, even when they occur at very low frequency. Horizontal gene transfer was not detected under conditions mimicking a {open_quotes}natural{close_quotes} infection. The gradual, stepwise alteration of artificial, positive control conditions to idealized natural conditions, however, allowed the characterization of factors that affected gene transfer, andmore » revealed a gradual decrease of the gene transfer frequency from 6.3 x 10{sup -2} under optimal control conditions to a calculated 2.0 x 10{sub -17} under idealized natural conditions. These data, in combination with other published studies, argue that horizontal gene transfer is so rare as to be essentially irrelevant to any realistic assessment of the risk involved in release experiments involving transgenic plants. 22 refs., 3 figs., 2 tabs.« less

  11. Exercise training augments the dynamic heart rate response to vagal but not sympathetic stimulation in rats.

    PubMed

    Mizuno, Masaki; Kawada, Toru; Kamiya, Atsunori; Miyamoto, Tadayoshi; Shimizu, Shuji; Shishido, Toshiaki; Smith, Scott A; Sugimachi, Masaru

    2011-04-01

    We examined the transfer function of autonomic heart rate (HR) control in anesthetized sedentary and exercise-trained (16 wk, treadmill for 1 h, 5 times/wk at 15 m/min and 15-degree grade) rats for comparison to HR variability assessed in the conscious resting state. The transfer function from sympathetic stimulation to HR response was similar between groups (gain, 4.2 ± 1.5 vs. 4.5 ± 1.5 beats·min(-1)·Hz(-1); natural frequency, 0.07 ± 0.01 vs. 0.08 ± 0.01 Hz; damping coefficient, 1.96 ± 0.55 vs. 1.69 ± 0.15; and lag time, 0.7 ± 0.1 vs. 0.6 ± 0.1 s; sedentary vs. exercise trained, respectively, means ± SD). The transfer gain from vagal stimulation to HR response was 6.1 ± 3.0 in the sedentary and 9.7 ± 5.1 beats·min(-1)·Hz(-1) in the exercise-trained group (P = 0.06). The corner frequency (0.11 ± 0.05 vs. 0.17 ± 0.09 Hz) and lag time (0.1 ± 0.1 vs. 0.2 ± 0.1 s) did not differ between groups. When the sympathetic transfer gain was averaged for very-low-frequency and low-frequency bands, no significant group effect was observed. In contrast, when the vagal transfer gain was averaged for very-low-frequency, low-frequency, and high-frequency bands, exercise training produced a significant group effect (P < 0.05 by two-way, repeated-measures ANOVA). These findings suggest that, in the frequency domain, exercise training augments the dynamic HR response to vagal stimulation but not sympathetic stimulation, regardless of the frequency bands.

  12. Study of the GPS inter-frequency calibration of timing receivers

    NASA Astrophysics Data System (ADS)

    Defraigne, P.; Huang, W.; Bertrand, B.; Rovera, D.

    2018-02-01

    When calibrating Global Positioning System (GPS) stations dedicated to timing, the hardware delays of P1 and P2, the P(Y)-codes on frequencies L1 and L2, are determined separately. In the international atomic time (TAI) network the GPS stations of the time laboratories are calibrated relatively against reference stations. This paper aims at determining the consistency between the P1 and P2 hardware delays (called dP1 and dP2) of these reference stations, and to look at the stability of the inter-signal hardware delays dP1-dP2 of all the stations in the network. The method consists of determining the dP1-dP2 directly from the GPS pseudorange measurements corrected for the frequency-dependent antenna phase center and the frequency-dependent ionosphere corrections, and then to compare these computed dP1-dP2 to the calibrated values. Our results show that the differences between the computed and calibrated dP1-dP2 are well inside the expected combined uncertainty of the two quantities. Furthermore, the consistency between the calibrated time transfer solution obtained from either single-frequency P1 or dual-frequency P3 for reference laboratories is shown to be about 1.0 ns, well inside the 2.1 ns uB uncertainty of a time transfer link based on GPS P3 or Precise Point Positioning. This demonstrates the good consistency between the P1 and P2 hardware delays of the reference stations used for calibration in the TAI network. The long-term stability of the inter-signal hardware delays is also analysed from the computed dP1-dP2. It is shown that only variations larger than 2 ns can be detected for a particular station, while variations of 200 ps can be detected when differentiating the results between two stations. Finally, we also show that in the differential calibration process as used in the TAI network, using the same antenna phase center or using different positions for L1 and L2 signals gives maximum differences of 200 ps on the hardware delays of the separate codes P1 and P2; however, the final impact on the P3 combination is less than 10 ps.

  13. A study on the maximum power transfer condition in an inductively coupled plasma using transformer circuit model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Young-Do; Lee, Hyo-Chang; Chung, Chin-Wook

    Correlations between the external discharge parameters (the driving frequency ω and the chamber dimension R) and plasma characteristics (the skin depth δ and the electron-neutral collision frequency ν{sub m}) are studied using the transformer circuit model [R. B. Piejak et al., Plasma Sources Sci. Technol. 1, 179 (1992)] when the absorbed power is maximized in an inductively coupled plasma. From the analysis of the transformer circuit model, the maximum power transfer conditions, which depend on the external discharge parameters and the internal plasma characteristics, were obtained. It was found that a maximum power transfer occurs when δ≈0.38R for the dischargemore » condition at which ν{sub m}/ω≪1, while it occurs when δ≈√(2)√(ω/ν{sub m})R for the discharge condition at which ν{sub m}/ω≫1. The results of this circuit analysis are consistent with the stable last inductive mode region of an inductive-to-capacitive mode transition [Lee and Chung, Phys. Plasmas 13, 063510 (2006)], which was theoretically derived from Maxwell's equations. Our results were also in agreement with the experimental results. From this work, we demonstrate that a simple circuit analysis can be applied to explain complex physical phenomena to a certain extent.« less

  14. Epsilon-toxin plasmids of Clostridium perfringens type D are conjugative.

    PubMed

    Hughes, Meredith L; Poon, Rachael; Adams, Vicki; Sayeed, Sameera; Saputo, Juliann; Uzal, Francisco A; McClane, Bruce A; Rood, Julian I

    2007-11-01

    Isolates of Clostridium perfringens type D produce the potent epsilon-toxin (a CDC/U.S. Department of Agriculture overlap class B select agent) and are responsible for several economically significant enterotoxemias of domestic livestock. It is well established that the epsilon-toxin structural gene, etx, occurs on large plasmids. We show here that at least two of these plasmids are conjugative. The etx gene on these plasmids was insertionally inactivated using a chloramphenicol resistance cassette to phenotypically tag the plasmid. High-frequency conjugative transfer of the tagged plasmids into the C. perfringens type A strain JIR325 was demonstrated, and the resultant transconjugants were shown to act as donors in subsequent mating experiments. We also demonstrated the transfer of "unmarked" native epsilon-toxin plasmids into strain JIR325 by exploiting the high transfer frequency. The transconjugants isolated in these experiments expressed functional epsilon-toxin since their supernatants had cytopathic effects on MDCK cells and were toxic in mice. Using the widely accepted multiplex PCR approach for toxin genotyping, these type A-derived transconjugants were genotypically type D. These findings have significant implications for the C. perfringens typing system since it is based on the toxin profile of each strain. Our study demonstrated the fluid nature of the toxinotypes and their dependence upon the presence or absence of toxin plasmids, some of which have for the first time been shown to be conjugative.

  15. ENERGY TRANSFERS IN THREE-FREQUENCY CIRCUITS WITH MAGNETIC COUPLING,

    DTIC Science & Technology

    core are studied. Rules are given to determine the type of nonlinear characteristic needed to make energy transfers possible for given frequency...combinations. General energy relations of the Manley Rowe type are discussed, examining the validity and limitations of these relations for the practical...case where the frequency ratios are not irrational. Examples of the use of the analysis are given for oscillators, subringers and amplifiers with a variety of frequency ratios. (Author)

  16. Order reduction of z-transfer functions via multipoint Jordan continued-fraction expansion

    NASA Technical Reports Server (NTRS)

    Lee, Ying-Chin; Hwang, Chyi; Shieh, Leang S.

    1992-01-01

    The order reduction problem of z-transfer functions is solved by using the multipoint Jordan continued-fraction expansion (MJCFE) technique. An efficient algorithm that does not require the use of complex algebra is presented for obtaining an MJCFE from a stable z-transfer function with expansion points selected from the unit circle and/or the positive real axis of the z-plane. The reduced-order models are exactly the multipoint Pade approximants of the original system and, therefore, they match the (weighted) time-moments of the impulse response and preserve the frequency responses of the system at some characteristic frequencies, such as gain crossover frequency, phase crossover frequency, bandwidth, etc.

  17. A space system for high-accuracy global time and frequency comparison of clocks

    NASA Technical Reports Server (NTRS)

    Decher, R.; Allan, D. W.; Alley, C. O.; Vessot, R. F. C.; Winkler, G. M. R.

    1981-01-01

    A Space Shuttle experiment in which a hydrogen maser clock on board the Space Shuttle will be compared with clocks on the ground using two-way microwave and short pulse laser signals is described. The accuracy goal for the experiment is 1 nsec or better for the time transfer and 10 to the minus 14th power for the frequency comparison. A direct frequency comparison of primary standards at the 10 to the minus 14th power accuracy level is a unique feature of the proposed system. Both time and frequency transfer will be accomplished by microwave transmission, while the laser signals provide calibration of the system as well as subnanosecond time transfer.

  18. Atomic clocks for geodesy.

    PubMed

    Mehlstäubler, Tanja E; Grosche, Gesine; Lisdat, Christian; Schmidt, Piet O; Denker, Heiner

    2018-06-01

    We review experimental progress on optical atomic clocks and frequency transfer, and consider the prospects of using these technologies for geodetic measurements. Today, optical atomic frequency standards have reached relative frequency inaccuracies below 10 -17 , opening new fields of fundamental and applied research. The dependence of atomic frequencies on the gravitational potential makes atomic clocks ideal candidates for the search for deviations in the predictions of Einstein's general relativity, tests of modern unifying theories and the development of new gravity field sensors. In this review, we introduce the concepts of optical atomic clocks and present the status of international clock development and comparison. Besides further improvement in stability and accuracy of today's best clocks, a large effort is put into increasing the reliability and technological readiness for applications outside of specialized laboratories with compact, portable devices. With relative frequency uncertainties of 10 -18 , comparisons of optical frequency standards are foreseen to contribute together with satellite and terrestrial data to the precise determination of fundamental height reference systems in geodesy with a resolution at the cm-level. The long-term stability of atomic standards will deliver excellent long-term height references for geodetic measurements and for the modelling and understanding of our Earth.

  19. Molecular Electronic Angular Motion Transducer Broad Band Self-Noise.

    PubMed

    Zaitsev, Dmitry; Agafonov, Vadim; Egorov, Egor; Antonov, Alexander; Shabalina, Anna

    2015-11-20

    Modern molecular electronic transfer (MET) angular motion sensors combine high technical characteristics with low cost. Self-noise is one of the key characteristics which determine applications for MET sensors. However, until the present there has not been a model describing the sensor noise in the complete operating frequency range. The present work reports the results of an experimental study of the self-noise level of such sensors in the frequency range of 0.01-200 Hz. Based on the experimental data, a theoretical model is developed. According to the model, self-noise is conditioned by thermal hydrodynamic fluctuations of the operating fluid flow in the frequency range of 0.01-2 Hz. At the frequency range of 2-100 Hz, the noise power spectral density has a specific inversely proportional dependence of the power spectral density on the frequency that could be attributed to convective processes. In the high frequency range of 100-200 Hz, the noise is conditioned by the voltage noise of the electronics module input stage operational amplifiers and is heavily reliant to the sensor electrical impedance. The presented results allow a deeper understanding of the molecular electronic sensor noise nature to suggest the ways to reduce it.

  20. Frequency characteristics of vibration generated by dual acoustic radiation force for estimating viscoelastic properties of biological tissues

    NASA Astrophysics Data System (ADS)

    Watanabe, Ryoichi; Arakawa, Mototaka; Kanai, Hiroshi

    2018-07-01

    We proposed a new method for estimating the viscoelastic property of the local region of a sample. The viscoelastic parameters of the phantoms simulating the biological tissues were quantitatively estimated by analyzing the frequency characteristics of displacement generated by acoustic excitation. The samples were locally strained by irradiating them with the ultrasound simultaneously generated from two point-focusing transducers by applying the sum of two signals with slightly different frequencies of approximately 1 MHz. The surface of a phantom was excited in the frequency range of 20–2,000 Hz, and its displacement was measured. The frequency dependence of the acceleration provided by the acoustic radiation force was also measured. From these results, we determined the frequency characteristics of the transfer function from the stress to the strain and estimated the ratio of the elastic modulus to the viscosity modulus (K/η) by fitting the data to the Maxwell model. Moreover, the elastic modulus K was separately estimated from the measured sound velocity and density of the phantom, and the viscosity modulus η was evaluated by substituting the estimated elastic modulus into the obtained K/η ratio.

  1. Atomic clocks for geodesy

    NASA Astrophysics Data System (ADS)

    Mehlstäubler, Tanja E.; Grosche, Gesine; Lisdat, Christian; Schmidt, Piet O.; Denker, Heiner

    2018-06-01

    We review experimental progress on optical atomic clocks and frequency transfer, and consider the prospects of using these technologies for geodetic measurements. Today, optical atomic frequency standards have reached relative frequency inaccuracies below 10‑17, opening new fields of fundamental and applied research. The dependence of atomic frequencies on the gravitational potential makes atomic clocks ideal candidates for the search for deviations in the predictions of Einstein’s general relativity, tests of modern unifying theories and the development of new gravity field sensors. In this review, we introduce the concepts of optical atomic clocks and present the status of international clock development and comparison. Besides further improvement in stability and accuracy of today’s best clocks, a large effort is put into increasing the reliability and technological readiness for applications outside of specialized laboratories with compact, portable devices. With relative frequency uncertainties of 10‑18, comparisons of optical frequency standards are foreseen to contribute together with satellite and terrestrial data to the precise determination of fundamental height reference systems in geodesy with a resolution at the cm-level. The long-term stability of atomic standards will deliver excellent long-term height references for geodetic measurements and for the modelling and understanding of our Earth.

  2. Localized radio frequency communication using asynchronous transfer mode protocol

    DOEpatents

    Witzke, Edward L [Edgewood, NM; Robertson, Perry J [Albuquerque, NM; Pierson, Lyndon G [Albuquerque, NM

    2007-08-14

    A localized wireless communication system for communication between a plurality of circuit boards, and between electronic components on the circuit boards. Transceivers are located on each circuit board and electronic component. The transceivers communicate with one another over spread spectrum radio frequencies. An asynchronous transfer mode protocol controls communication flow with asynchronous transfer mode switches located on the circuit boards.

  3. Effects of Feedback Frequency and Timing on Acquisition, Retention, and Transfer of Speech Skills in Acquired Apraxia of Speech

    ERIC Educational Resources Information Center

    Hula, Shannon N. Austermann; Robin, Donald A.; Maas, Edwin; Ballard, Kirrie J.; Schmidt, Richard A.

    2008-01-01

    Purpose: Two studies examined speech skill learning in persons with apraxia of speech (AOS). Motor-learning research shows that delaying or reducing the frequency of feedback promotes retention and transfer of skills. By contrast, immediate or frequent feedback promotes temporary performance enhancement but interferes with retention and transfer.…

  4. Experimental estimation of convective heat transfer coefficient from pulsating semi-confined impingement air slot jet by using inverse method

    NASA Astrophysics Data System (ADS)

    Farahani, Somayeh Davoodabadi; Kowsary, Farshad

    2017-09-01

    An experimental study on pulsating impingement semi-confined slot jet has been performed. The effect of pulsations frequency was examined for various Reynolds numbers and Nozzle to plate distances. Convective heat transfer coefficient is estimated using the measured temperatures in the target plate and conjugate gradient method with adjoint equation. Heat transfer coefficient in Re < 3000 tended to increase with increasing frequency. The pulsations enhance mixing, which results in an enhancement of mean flow velocity. In case of turbulent jet (Re > 3000), heat transfer coefficient is affected by the pulsation from particular frequency. In this study, the threshold Strouhal number (St) is 0.11. No significant heat transfer enhancement was obtained for St < 0.11. The thermal resistance is smaller each time due to the newly forming thermal boundary layers. Heat transfer coefficient increases due to decrease thermal resistance. This study shows that maximum enhancement in heat transfer due to pulsations occurs in St = 0.169. Results show the configuration geometry has an important effect on the heat transfer performances in pulsed impinging jet. Heat transfer enhancement can be described to reflect flow by the confinement plate.

  5. High-frequency self-aligned graphene transistors with transferred gate stacks.

    PubMed

    Cheng, Rui; Bai, Jingwei; Liao, Lei; Zhou, Hailong; Chen, Yu; Liu, Lixin; Lin, Yung-Chen; Jiang, Shan; Huang, Yu; Duan, Xiangfeng

    2012-07-17

    Graphene has attracted enormous attention for radio-frequency transistor applications because of its exceptional high carrier mobility, high carrier saturation velocity, and large critical current density. Herein we report a new approach for the scalable fabrication of high-performance graphene transistors with transferred gate stacks. Specifically, arrays of gate stacks are first patterned on a sacrificial substrate, and then transferred onto arbitrary substrates with graphene on top. A self-aligned process, enabled by the unique structure of the transferred gate stacks, is then used to position precisely the source and drain electrodes with minimized access resistance or parasitic capacitance. This process has therefore enabled scalable fabrication of self-aligned graphene transistors with unprecedented performance including a record-high cutoff frequency up to 427 GHz. Our study defines a unique pathway to large-scale fabrication of high-performance graphene transistors, and holds significant potential for future application of graphene-based devices in ultra-high-frequency circuits.

  6. A general methodology for inverse estimation of the elastic and anelastic properties of anisotropic open-cell porous materials—with application to a melamine foam

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuenca, Jacques, E-mail: jcuenca@kth.se; Van der Kelen, Christophe; Göransson, Peter

    2014-02-28

    This paper proposes an inverse estimation method for the characterisation of the elastic and anelastic properties of the frame of anisotropic open-cell foams used for sound absorption. A model of viscoelasticity based on a fractional differential constitutive equation is used, leading to an augmented Hooke's law in the frequency domain, where the elastic and anelastic phenomena appear as distinctive terms in the stiffness matrix. The parameters of the model are nine orthotropic elastic moduli, three angles of orientation of the material principal directions and three parameters governing the anelastic frequency dependence. The inverse estimation consists in numerically fitting the modelmore » on a set of transfer functions extracted from a sample of material. The setup uses a seismic-mass measurement repeated in the three directions of space and is placed in a vacuum chamber in order to remove the air from the pores of the sample. The method allows to reconstruct the full frequency-dependent complex stiffness matrix of the frame of an anisotropic open-cell foam and in particular it provides the frequency of maximum energy dissipation by viscoelastic effects. The characterisation of a melamine foam sample is performed and the relation between the fractional-derivative model and other types of parameterisations of the augmented Hooke's law is discussed.« less

  7. A general methodology for inverse estimation of the elastic and anelastic properties of anisotropic open-cell porous materials—with application to a melamine foam

    NASA Astrophysics Data System (ADS)

    Cuenca, Jacques; Van der Kelen, Christophe; Göransson, Peter

    2014-02-01

    This paper proposes an inverse estimation method for the characterisation of the elastic and anelastic properties of the frame of anisotropic open-cell foams used for sound absorption. A model of viscoelasticity based on a fractional differential constitutive equation is used, leading to an augmented Hooke's law in the frequency domain, where the elastic and anelastic phenomena appear as distinctive terms in the stiffness matrix. The parameters of the model are nine orthotropic elastic moduli, three angles of orientation of the material principal directions and three parameters governing the anelastic frequency dependence. The inverse estimation consists in numerically fitting the model on a set of transfer functions extracted from a sample of material. The setup uses a seismic-mass measurement repeated in the three directions of space and is placed in a vacuum chamber in order to remove the air from the pores of the sample. The method allows to reconstruct the full frequency-dependent complex stiffness matrix of the frame of an anisotropic open-cell foam and in particular it provides the frequency of maximum energy dissipation by viscoelastic effects. The characterisation of a melamine foam sample is performed and the relation between the fractional-derivative model and other types of parameterisations of the augmented Hooke's law is discussed.

  8. Simulation of Oscillatory Domain Wall Motion Driven by Spin Waves in Nanostrip with Perpendicular Magnetic Anisotropy

    NASA Astrophysics Data System (ADS)

    Lee, Shang Fan; Chang, Liang Juan; Spintronics Laboratory Team

    2014-03-01

    We numerically investigate the spin waves (SW) induced domain wall (DW) oscillatory motion in a nanostrip with perpendicular magnetic anisotropy by means of micromagnetic simulation. SW carries spin angular momentum and can interact with DWs via Spin Transfer Torque (STT). Propagating SW can drive a DW motion depending on the in-plane tilt angle φ of the wall magnetization. We calculate the instantaneous velocity of DWs as a function of φwith different SW frequency f. We find that the DW motion under propagating SW depends not only on the frequencies f, but also on the in-plane tilt angle φ. The nanostrip considered is 50 nm wide and 4000 nm long. A DW at the center is subjected to a SW source 500 nm apart on the left with amplitude in the transverse direction and varying frequency f. The motions of the DW induced by the SW are accompanied by in-plane rotation of magnetization of DW. Once rotated by 90 degrees, the DW shows a backward motion towards the SW source. The oscillatory amplitude and frequency of the DW motion is analyzed. A phase diagram will be presented. This study provides new perspectives for the control and manipulation of DW in a nanostrip. Financial supports by Academia Sinica and National Science Council are acknowledged

  9. Proton assisted recoupling and protein structure determination

    NASA Astrophysics Data System (ADS)

    de Paëpe, Gaël; Lewandowski, Józef R.; Loquet, Antoine; Böckmann, Anja; Griffin, Robert G.

    2008-12-01

    We introduce a homonuclear version of third spin assisted recoupling, a second-order mechanism that can be used for polarization transfer between 13C or 15N spins in magic angle spinning (MAS) NMR experiments, particularly at high spinning frequencies employed in contemporary high field MAS experiments. The resulting sequence, which we refer to as proton assisted recoupling (PAR), relies on a cross-term between 1H-13C (or 1H-15N) couplings to mediate zero quantum 13C-13C (or 15N-15N recoupling). In particular, using average Hamiltonian theory we derive an effective Hamiltonian for PAR and show that the transfer is mediated by trilinear terms of the form C1+/-C2-/+HZ for 13C-13C recoupling experiments (or N1+/-N2-/+HZ for 15N-15N). We use analytical and numerical simulations to explain the structure of the PAR optimization maps and to delineate the PAR matching conditions. We also detail the PAR polarization transfer dependence with respect to the local molecular geometry and explain the observed reduction in dipolar truncation. Finally, we demonstrate the utility of PAR in structural studies of proteins with 13C-13C spectra of uniformly 13C, 15N labeled microcrystalline Crh, a 85 amino acid model protein that forms a domain swapped dimer (MW=2×10.4 kDa). The spectra, which were acquired at high MAS frequencies (ωr2π>20 kHz) and magnetic fields (750-900 MHz 1H frequencies) using moderate rf fields, exhibit numerous cross peaks corresponding to long (up to 6-7 A˚) 13C-13C distances which are particularly useful in protein structure determination. Using results from PAR spectra we calculate the structure of the Crh protein.

  10. Wavelet assessment of cerebrospinal compensatory reserve and cerebrovascular reactivity.

    PubMed

    Latka, M; Kolodziej, W; Turalska, M; Latka, D; Zub, W; West, B J

    2007-05-01

    We introduce a wavelet transfer model to relate spontaneous arterial blood pressure (ABP) fluctuations to intracranial pressure (ICP) fluctuations. We employ a complex continuous wavelet transform to develop a consistent mathematical framework capable of parametrizing both cerebral compensatory reserve and cerebrovascular reactivity. The frequency-dependent gain and phase of the wavelet transfer function are introduced because of the non-stationary character of the ICP and ABP time series. The gain characterizes the dampening of spontaneous ABP fluctuations and is interpreted as a novel measure of cerebrospinal compensatory reserve. For a group of 12 patients who died as a result of cerebral lesions (Glasgow Outcome Scale (GOS) = 1) the average gain in the low-frequency (0.02- 0.07 Hz) range was 0.51 +/- 0.13 and significantly exceeded that of 17 patients with GOS = 2 having an average gain of 0.26 +/- 0.11 with p = 1x10(-4) (Kruskal-Wallis test). A time-averaged synchronization index (which may vary from 0 to 1) defined in terms of the wavelet transfer function phase yields information about the stability of the phase difference of the ABP and ICP signals and is used as a cerebrovascular reactivity index. A low value of synchronization index reflects a normally reactive vascular bed, while a high value indicates pathological entrainment of ABP and ICP fluctuations. Such entrainment is strongly pronounced in patients with fatal outcome (for this group the low-frequency synchronization index was 0.69 +/- 0.17). The gain and synchronization parameters define a cerebral hemodynamic state space (CHS) in which the patients with GOS = 1 are to large extent partitioned away from those with GOS = 2. The concept of CHS elucidates the interplay of vascular and compensatory mechanisms.

  11. Using frequency-domain methods to identify XV-15 aeroelastic modes

    NASA Technical Reports Server (NTRS)

    Acree, C. W., Jr.; Tischler, Mark B.

    1987-01-01

    The XV-15 Tilt-Rotor wing has six major aeroelastic modes that are close in frequency. To precisely excite individual modes during flight test, dual flaperon exciters with automatic frequency-sweep controls were installed. The resulting structural data were analyzed in the frequency domain (Fourier transformed) with cross spectral and transfer function methods. Modal frequencies and damping were determined by performing curve fits to transfer function magnitude and phase data and to cross spectral magnitude data. Results are given for the XV-15 with its original metal rotor blades. Frequency and damping values are also compared with earlier predictions.

  12. Numerical investigation of frequency spectrum in the Hasegawa-Wakatani model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Juhyung; Terry, P. W.

    2013-10-15

    The wavenumber-frequency spectrum of the two-dimensional Hasegawa-Wakatani model is investigated in the hydrodynamic, intermediate, and adiabatic regimes. A nonlinear frequency and a line width related to energy transfer properties provide a measure of the average frequency and spectral broadening, respectively. In the adiabatic regime, narrow spectra, typical of wave turbulence, are observed with a nonlinear frequency shift in the electron drift direction. In the hydrodynamic regime, broad spectra with almost zero nonlinear frequencies are observed. Nonlinear frequency shifts are shown to be related to nonlinear energy transfer by vorticity advection through the high frequency region of the spectrum. In themore » intermediate regime, the nonlinear frequency shift for density fluctuations is observed to be weaker than that of electrostatic potential fluctuations. The weaker frequency shift of the density fluctuations is due to nonlinear density advection, which favors energy transfer in the low frequency range. Both the nonlinear frequency and the spectral width increase with poloidal wavenumber k{sub y}. In addition, in the adiabatic regime where the nonlinear interactions manifest themselves in the nonlinear frequency shift, the cross-phase between the density and potential fluctuations is observed to match a linear relation, but only if the linear response of the linearly stable eigenmode branch is included. Implications of these numerical observations are discussed.« less

  13. Improvement of the Asia-Pacific TWSTFT network solutions by using DPN results.

    PubMed

    Lin, Huang-Tien; Huang, Yi-Jiun; Liao, Chia-Shu; Chu, Fang-Dar; Tseng, Wen-Hung

    2012-03-01

    Two major time and frequency transfer techniques, two-way satellite time and frequency transfer (TWSTFT) and global navigation satellite systems (GNSS: GPS, GALILEO, GLONASS, etc.), are used for the generation of Coordinated Universal Time (UTC)/International Atomic Time (TAI). These time and frequency transfer links comprise a worldwide network and the utilization of the highly redundant time and frequency data is an important topic. Two methods, either TW-only network (i.e., TWSTFT) or single-link combination of TW and Global Positioning System (GPS), have been developed for combining the redundant data from different techniques. In our previous study, we have proposed a feasible method, utilizing full time-transfer network data, to improve the results of TWSTFT network. The National Institute of Information and Communications Technology (NICT) has recently developed a software-based two-way time-transfer modem using a dual pseudo-random noise (DPN) signal. The first international DPN TWSTFT experiment, using these modems, was performed between NICT (Japan) and Telecommunication Laboratories (TL; Taiwan)and its ability to improve the time transfer precision was demonstrated. In comparison with the conventional NICT–TLTWSTFT link, the DPN time transfer results have higher precision and lower diurnal effects. The estimation also shows that DPN is comparable to GPS precise point positioning (PPP).Because the DPN results show better performance than the conventional TWSTFT results, we would adopt the DPN data for the NICT–TL link and solve the TW+DPN network solutions by using our proposed method. The concept of this application is similar to the so-called multi-technique-network time/frequency transfer. The encouraging results confirm that the TWSTFT network performance can benefit from DPN data by improving short-term stabilities and reducing diurnal effects.The results of TW+PPP network solutions are also illustrated.

  14. Localized surface plasmon mediated energy transfer in the vicinity of core-shell nanoparticle

    NASA Astrophysics Data System (ADS)

    Shishodia, Manmohan Singh; Juneja, Soniya

    2016-05-01

    Multipole spectral expansion based theory of energy transfer interactions between a donor and an acceptor molecule in the vicinity of a core-shell (nanoshell or core@shell) based plasmonic nanostructure is developed. In view of the diverse applications and rich plasmonic features such as tuning capability of surface plasmon (SP) frequencies, greater sensitivity to the change of dielectric environment, controllable redirection of electromagnetic radiation, closed form expressions for Energy Transfer Rate Enhancement Factor (ETREF) near core-shell particle are reported. The dependence of ETREF on different parameters is established through fitting equations, perceived to be of key importance for developing appropriate designs. The theoretical approach developed in the present work is capable of treating higher order multipoles, which, in turn, are also shown to play a crucial role in the present context. Moreover, closed form expressions derived in the present work can directly be used as formula, e.g., for designing SP based biosensors and estimating energy exchange between proteins and excitonic interactions in quantum dots.

  15. Spontaneous fluctuations in cerebral blood flow: insights from extended-duration recordings in humans

    NASA Technical Reports Server (NTRS)

    Zhang, R.; Zuckerman, J. H.; Levine, B. D.; Blomqvist, C. G. (Principal Investigator)

    2000-01-01

    To determine the dependence of cerebral blood flow (CBF) on arterial pressure over prolonged time periods, we measured beat-to-beat changes in mean CBF velocity in the middle cerebral artery (transcranial Doppler) and mean arterial pressure (Finapres) continuously for 2 h in six healthy subjects (5 men and 1 woman, 18-40 yr old) during supine rest. Fluctuations in velocity and pressure were quantified by the range [(peak - trough)/mean] and coefficients of variation (SD/mean) in the time domain and by spectral analysis in the frequency domain. Mean velocity and pressure over the 2-h recordings were 60 +/- 7 cm/s and 83 +/- 8 mmHg, associated with ranges of 77 +/- 8 and 89 +/- 10% and coefficients of variation of 9.3 +/- 2.2 and 7.9 +/- 2.3%, respectively. Spectral power of the velocity and pressure was predominantly distributed in the frequency range of 0.00014-0.1 Hz and increased inversely with frequency, indicating characteristics of an inverse power law (1/f(alpha)). However, linear regression on a log-log scale revealed that the slope of spectral power of pressure and velocity was steeper in the high-frequency (0.02-0.5 Hz) than in the low-frequency range (0.002-0.02 Hz), suggesting different regulatory mechanisms in these two frequency ranges. Furthermore, the spectral slope of pressure was significantly steeper than that of velocity in the low-frequency range, consistent with the low transfer function gain and low coherence estimated at these frequencies. We conclude that 1) long-term fluctuations in CBF velocity are prominent and similar to those observed in arterial pressure, 2) spectral power of CBF velocity reveals characteristics of 1/f(alpha), and 3) cerebral attenuation of oscillations in CBF velocity in response to changes in pressure may be more effective at low than that at high frequencies, emphasizing the frequency dependence of cerebral autoregulation.

  16. Long-Term Instability of GPS-Based Time Transfer and Proposals for Improvements

    DTIC Science & Technology

    2011-01-01

    receiver, or use of a completely independent technique such as Two-Way Satellite Time and Frequency Transfer ( TWSTFT ), helps to identify which receiver...is generated using not only the PTB’s Two-Way Satellite Time and Frequency Transfer ( TWSTFT or TW) links, but also links based on other PTB GNSS...including the PTB by X WX [1,2]; delay variations in other PTB time transfer systems would have an additive effect whether they were TWSTFT or GNSS

  17. The Transfer Function Model as a Tool to Study and Describe Space Weather Phenomena

    NASA Technical Reports Server (NTRS)

    Porter, Hayden S.; Mayr, Hans G.; Bhartia, P. K. (Technical Monitor)

    2001-01-01

    The Transfer Function Model (TFM) is a semi-analytical, linear model that is designed especially to describe thermospheric perturbations associated with magnetic storms and substorm. activity. It is a multi-constituent model (N2, O, He H, Ar) that accounts for wind induced diffusion, which significantly affects not only the composition and mass density but also the temperature and wind fields. Because the TFM adopts a semianalytic approach in which the geometry and temporal dependencies of the driving sources are removed through the use of height-integrated Green's functions, it provides physical insight into the essential properties of processes being considered, which are uncluttered by the accidental complexities that arise from particular source geometrie and time dependences. Extending from the ground to 700 km, the TFM eliminates spurious effects due to arbitrarily chosen boundary conditions. A database of transfer functions, computed only once, can be used to synthesize a wide range of spatial and temporal sources dependencies. The response synthesis can be performed quickly in real-time using only limited computing capabilities. These features make the TFM unique among global dynamical models. Given these desirable properties, a version of the TFM has been developed for personal computers (PC) using advanced platform-independent 3D visualization capabilities. We demonstrate the model capabilities with simulations for different auroral sources, including the response of ducted gravity waves modes that propagate around the globe. The thermospheric response is found to depend strongly on the spatial and temporal frequency spectra of the storm. Such varied behavior is difficult to describe in statistical empirical models. To improve the capability of space weather prediction, the TFM thus could be grafted naturally onto existing statistical models using data assimilation.

  18. Computer method for identification of boiler transfer functions

    NASA Technical Reports Server (NTRS)

    Miles, J. H.

    1971-01-01

    An iterative computer method is described for identifying boiler transfer functions using frequency response data. An objective penalized performance measure and a nonlinear minimization technique are used to cause the locus of points generated by a transfer function to resemble the locus of points obtained from frequency response measurements. Different transfer functions can be tried until a satisfactory empirical transfer function to the system is found. To illustrate the method, some examples and some results from a study of a set of data consisting of measurements of the inlet impedance of a single tube forced flow boiler with inserts are given.

  19. An improved biomechanical model for simulating the strain of the hand-arm system under vibration stress.

    PubMed

    Fritz, M

    1991-01-01

    In order to define relationships between the vibration stress and the strain of the human hand-arm system a biomechanical model was developed. The four masses of the model representing the hand, the forearm and the upper arm were connected by dampers and springs in two perpendicular directions. Simulating muscle activity, damped torsion springs were included additionally. The motions of the model were described by a differential matrix equation which was solved by using a 'transfer matrix routine' as well as by numerical integration. Thus, functions with harmonic or transient time courses could be selected as an excitation. The simulated vibrations were compared with those of other hand-arm models. The forces and torques transmitted between the masses, and the energy dissipated by the dampers were computed for several combinations of exciter frequencies and accelerations. The dependence of torques upon excitation agreed fairly well with the behaviour of the arm muscles under vibration as described by various investigators. At frequencies above 100 Hz the energy was dissipated mainly by the dampers between the masses near to the exciter. Transferring this result to the hand-arm system it shows that at high frequencies energy is dissipated by the hand and its palmar tissues and this might be one cause for the incidence of vibration-induced white finger disease.

  20. Measurements of ocean wave spectra and modulation transfer function with the airborne two frequency scatterometer

    NASA Technical Reports Server (NTRS)

    Weissman, D. E.; Johnson, J. W.

    1984-01-01

    The directional spectrum and the microwave modulation transfer function of ocean waves can be measured with the airborne two frequency scatterometer technique. Similar to tower based observations, the aircraft measurements of the Modulation Transfer Function (MTF) show that it is strongly affected by both wind speed and sea state. Also detected are small differences in the magnitudes of the MTF between downwind and upwind radar look directions, and variations with ocean wavenumber. The MTF inferred from the two frequency radar is larger than that measured using single frequency, wave orbital velocity techniques such as tower based radars or ROWS measurements from low altitude aircraft. Possible reasons for this are discussed. The ability to measure the ocean directional spectrum with the two frequency scatterometer, with supporting MTF data, is demonstrated.

  1. Measurements of ocean wave spectra and modulation transfer function with the airborne two-frequency scatterometer

    NASA Technical Reports Server (NTRS)

    Weissman, D. E.; Johnson, J. W.

    1986-01-01

    The directional spectrum and the microwave modulation transfer function of ocean waves can be measured with the airborne two frequency scatterometer technique. Similar to tower based observations, the aircraft measurements of the Modulation Transfer Function (MTF) show that it is strongly affected by both wind speed and sea state. Also detected are small differences in the magnitudes of the MTF between downwind and upwind radar look directions, and variations with ocean wavenumber. The MTF inferred from the two frequency radar is larger than that measured using single frequency, wave orbital velocity techniques such as tower based radars or ROWS measurements from low altitude aircraft. Possible reasons for this are discussed. The ability to measure the ocean directional spectrum with the two frequency scatterometer, with supporting MTF data, is demonstrated.

  2. A NUMERICAL SCHEME FOR SPECIAL RELATIVISTIC RADIATION MAGNETOHYDRODYNAMICS BASED ON SOLVING THE TIME-DEPENDENT RADIATIVE TRANSFER EQUATION

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohsuga, Ken; Takahashi, Hiroyuki R.

    2016-02-20

    We develop a numerical scheme for solving the equations of fully special relativistic, radiation magnetohydrodynamics (MHDs), in which the frequency-integrated, time-dependent radiation transfer equation is solved to calculate the specific intensity. The radiation energy density, the radiation flux, and the radiation stress tensor are obtained by the angular quadrature of the intensity. In the present method, conservation of total mass, momentum, and energy of the radiation magnetofluids is guaranteed. We treat not only the isotropic scattering but also the Thomson scattering. The numerical method of MHDs is the same as that of our previous work. The advection terms are explicitlymore » solved, and the source terms, which describe the gas–radiation interaction, are implicitly integrated. Our code is suitable for massive parallel computing. We present that our code shows reasonable results in some numerical tests for propagating radiation and radiation hydrodynamics. Particularly, the correct solution is given even in the optically very thin or moderately thin regimes, and the special relativistic effects are nicely reproduced.« less

  3. [Accuracy of Modulation Transfer Function for Target Size and Field of View in a Circular Edge Strategy Using the CT Image Measurement Program].

    PubMed

    Fukunaga, Masaaki; Onishi, Hideo; Matsutomo, Norikazu; Yamamoto, Hiroyuki

    2016-06-01

    The purpose of this study was to evaluate the effects of target diameter and display-field of view (D-FOV) in modulation transfer function (MTF) by circular edge strategy using the computed tomography (CT) image measurement program "CTmeasure". We calculated the MTF (MTF(edge)) using the circular edge strategy applied to cylindrical phantom (200 mmφ) that inserted with cylinders have 10, 20, 30, and 40 mm diameters. The phantom images were reconstructed using filtered back projection method varied with D-FOV (240, 320, 400, and 500 mm). The study compared both MTF(edge) and MTF(wire) at MTF50% and MTF(10%) for target diameter and D-FOV, respectively. The MTF(edge) by the different of target diameter indicated in rough compatibility. However, MTF(edge) of D-FOV diameters (320, 400, and 500 mm) decreased in the high frequency range. The circular edge strategy for MTF depended on the D-FOV, however, it was little dependent on target diameter using the CT image measurement program "CTmeasure".

  4. Optical impedance spectroscopy with single-mode electro-active-integrated optical waveguides.

    PubMed

    Han, Xue; Mendes, Sergio B

    2014-02-04

    An optical impedance spectroscopy (OIS) technique based on a single-mode electro-active-integrated optical waveguide (EA-IOW) was developed to investigate electron-transfer processes of redox adsorbates. A highly sensitive single-mode EA-IOW device was used to optically follow the time-dependent faradaic current originated from a submonolayer of cytochrome c undergoing redox exchanges driven by a harmonic modulation of the electric potential at several dc bias potentials and at several frequencies. To properly retrieve the faradaic current density from the ac-modulated optical signal, we introduce here a mathematical formalism that (i) accounts for intrinsic changes that invariably occur in the optical baseline of the EA-IOW device during potential modulation and (ii) provides accurate results for the electro-chemical parameters. We are able to optically reconstruct the faradaic current density profile against the dc bias potential in the working electrode, identify the formal potential, and determine the energy-width of the electron-transfer process. In addition, by combining the optically reconstructed faradaic signal with simple electrical measurements of impedance across the whole electrochemical cell and the capacitance of the electric double-layer, we are able to determine the time-constant connected to the redox reaction of the adsorbed protein assembly. For cytochrome c directly immobilized onto the indium tin oxide (ITO) surface, we measured a reaction rate constant of 26.5 s(-1). Finally, we calculate the charge-transfer resistance and pseudocapacitance associated with the electron-transfer process and show that the frequency dependence of the redox reaction of the protein submonolayer follows as expected the electrical equivalent of an RC-series admittance diagram. Above all, we show here that OIS with single-mode EA-IOW's provide strong analytical signals that can be readily monitored even for small surface-densities of species involved in the redox process (e.g., fmol/cm(2), 0.1% of a full protein monolayer). This experimental approach, when combined with the analytical formalism described here, brings additional sensitivity, accuracy, and simplicity to electro-chemical analysis and is expected to become a useful tool in investigations of redox processes.

  5. High-cut characteristics of the baroreflex neural arc preserve baroreflex gain against pulsatile pressure.

    PubMed

    Kawada, Toru; Zheng, Can; Yanagiya, Yusuke; Uemura, Kazunori; Miyamoto, Tadayoshi; Inagaki, Masashi; Shishido, Toshiaki; Sugimachi, Masaru; Sunagawa, Kenji

    2002-03-01

    A transfer function from baroreceptor pressure input to sympathetic nerve activity (SNA) shows derivative characteristics in the frequency range below 0.8 Hz in rabbits. These derivative characteristics contribute to a quick and stable arterial pressure (AP) regulation. However, if the derivative characteristics hold up to heart rate frequency, the pulsatile pressure input will yield a markedly augmented SNA signal. Such a signal would saturate the baroreflex signal transduction, thereby disabling the baroreflex regulation of AP. We hypothesized that the transfer gain at heart rate frequency would be much smaller than that predicted from extrapolating the derivative characteristics. In anesthetized rabbits (n = 6), we estimated the neural arc transfer function in the frequency range up to 10 Hz. The transfer gain was lost at a rate of -20 dB/decade when the input frequency exceeded 0.8 Hz. A numerical simulation indicated that the high-cut characteristics above 0.8 Hz were effective to attenuate the pulsatile signal and preserve the open-loop gain when the baroreflex dynamic range was finite.

  6. Auditory Discrimination Learning: Role of Working Memory.

    PubMed

    Zhang, Yu-Xuan; Moore, David R; Guiraud, Jeanne; Molloy, Katharine; Yan, Ting-Ting; Amitay, Sygal

    2016-01-01

    Perceptual training is generally assumed to improve perception by modifying the encoding or decoding of sensory information. However, this assumption is incompatible with recent demonstrations that transfer of learning can be enhanced by across-trial variation of training stimuli or task. Here we present three lines of evidence from healthy adults in support of the idea that the enhanced transfer of auditory discrimination learning is mediated by working memory (WM). First, the ability to discriminate small differences in tone frequency or duration was correlated with WM measured with a tone n-back task. Second, training frequency discrimination around a variable frequency transferred to and from WM learning, but training around a fixed frequency did not. The transfer of learning in both directions was correlated with a reduction of the influence of stimulus variation in the discrimination task, linking WM and its improvement to across-trial stimulus interaction in auditory discrimination. Third, while WM training transferred broadly to other WM and auditory discrimination tasks, variable-frequency training on duration discrimination did not improve WM, indicating that stimulus variation challenges and trains WM only if the task demands stimulus updating in the varied dimension. The results provide empirical evidence as well as a theoretic framework for interactions between cognitive and sensory plasticity during perceptual experience.

  7. Auditory Discrimination Learning: Role of Working Memory

    PubMed Central

    Zhang, Yu-Xuan; Moore, David R.; Guiraud, Jeanne; Molloy, Katharine; Yan, Ting-Ting; Amitay, Sygal

    2016-01-01

    Perceptual training is generally assumed to improve perception by modifying the encoding or decoding of sensory information. However, this assumption is incompatible with recent demonstrations that transfer of learning can be enhanced by across-trial variation of training stimuli or task. Here we present three lines of evidence from healthy adults in support of the idea that the enhanced transfer of auditory discrimination learning is mediated by working memory (WM). First, the ability to discriminate small differences in tone frequency or duration was correlated with WM measured with a tone n-back task. Second, training frequency discrimination around a variable frequency transferred to and from WM learning, but training around a fixed frequency did not. The transfer of learning in both directions was correlated with a reduction of the influence of stimulus variation in the discrimination task, linking WM and its improvement to across-trial stimulus interaction in auditory discrimination. Third, while WM training transferred broadly to other WM and auditory discrimination tasks, variable-frequency training on duration discrimination did not improve WM, indicating that stimulus variation challenges and trains WM only if the task demands stimulus updating in the varied dimension. The results provide empirical evidence as well as a theoretic framework for interactions between cognitive and sensory plasticity during perceptual experience. PMID:26799068

  8. Stable fiber-optic time transfer by active radio frequency phase locking.

    PubMed

    Yin, Feifei; Wu, Zhongle; Dai, Yitang; Ren, Tianpeng; Xu, Kun; Lin, Jintong; Tang, Geshi

    2014-05-15

    In this Letter we demonstrate a fiber link capable of stable time signal transfer utilizing our active long-distance radio frequency (RF) stabilization technology. Taking advantage of the chromatic dispersion in optical fiber, our scheme compensates dynamically the link delay variation by tuning the optical carrier wavelength to phase lock a round-trip RF reference. Since the time signal and the RF reference are carried by the same optical carrier, a highly stable time transfer is achieved at the same time. Experimentally, we demonstrate a stability of the time signal transfer over 50-km fiber with a time deviation of 40 ps at 1-s average and 2.3 ps at 1000-s average. The performance of the RF reference delivery is also tested, with an Allan deviation of 2×10(-15) at 1000-s average. According to our proposal, a simultaneous stable time and frequency transfer is expected.

  9. In vitro flowering ofDendrobium candidum.

    PubMed

    Wang, G; Xu, Z; Chia, T F; Chua, N H

    1997-02-01

    Dendrobium candidum, a wild orchid species from China, normally requires three to four years of cultivation before it can produce flowers. The effects of plant hormones and polyamines on flower initiation of this species in tissue culture were investigated. The addition of spermidine, or BA, or the combination of NAA and BA to the culture medium can induce protocorms or shoots to flower within three to six months with a frequency of 31.6%-45.8%. The flowering frequency can be further increased to 82.8 % on the average by pre-treatment of protocorms in an ABA-containing medium followed by transfer onto MS medium with BA. The induction of precocious flowering depends on the developmental stage of the experimental materials (protocorms, shoots and plantlets) used, and usually occurs only when mt formation is inhibited.

  10. An automatic optimum kernel-size selection technique for edge enhancement

    USGS Publications Warehouse

    Chavez, Pat S.; Bauer, Brian P.

    1982-01-01

    Edge enhancement is a technique that can be considered, to a first order, a correction for the modulation transfer function of an imaging system. Digital imaging systems sample a continuous function at discrete intervals so that high-frequency information cannot be recorded at the same precision as lower frequency data. Because of this, fine detail or edge information in digital images is lost. Spatial filtering techniques can be used to enhance the fine detail information that does exist in the digital image, but the filter size is dependent on the type of area being processed. A technique has been developed by the authors that uses the horizontal first difference to automatically select the optimum kernel-size that should be used to enhance the edges that are contained in the image. 

  11. Autoclave treatment of pig manure does not reduce the risk of transmission and transfer of tetracycline resistance genes in soil: successive determinations with soil column experiments.

    PubMed

    Kang, Yijun; Gu, Xian; Hao, Yangyang; Hu, Jian

    2016-03-01

    The increasing use of antibiotics, especially tetracycline, in livestock feed adversely affects animal health and ecological integrity. Therefore, approaches to decrease this risk are urgently needed. High temperatures facilitate antibiotic degradation; whether this reduces transmission risk and transfer of tetracycline-resistant bacteria (TRBs) and tetracycline resistance genes (TRGs) in soil remains unknown. Successive experiments with soil columns evaluated the effects of autoclaving pig manure (APM) on soil TRB populations and TRGs over time at different soil depths. The data showed sharp increases in TRB populations and TRGs in each subsoil layer of PM (non-APM) and APM treatments within 30 days, indicating that TRBs and TRGs transferred rapidly. The level of TRBs in the upper soil layers was approximately 15-fold higher than in subsoils. TRBs were not dependent on PM and APM levels, especially in the late phase. Nevertheless, higher levels of APM led to rapid expansion of TRBs as compared to PM. Moreover, temporal changes in TRB frequencies in total culturable bacteria (TCBs) were similar to TRBs, indicating that the impact of PM or APM on TRBs was more obvious than for TCBs. TRBs were hypothesized to depend on the numbers of TRGs and indigenous recipient bacteria. In the plough layer, five TRGs (tetB, tetG, tetM, tetW, and tetB/P) existed in each treatment within 150 days. Selective pressure of TC may not be a necessary condition for the transfer and persistence of TRGs in soil. High temperatures might reduce TRBs in PM, which had minimal impact on the transmission and transfer of TRGs in soil. Identifying alternatives to decrease TRG transmission remains a major challenge.

  12. Progress of the LANL Low Temperature/Low Frequency Air Opacity Project - Optical Theory for HET-project: an update, April 2015

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timmermans, Eddy Marcel Elvire; Nisoli, Cristiano; Mozyrsky, Dima

    Light radiated from a hot, opaque thermal emitter originates mostly from near the surface at which the object becomes opaque (the surface of last scattering). To be specific, we define the “optical surface” as the surface at which the optical depth, as observed from a detector, takes on the value of 1. The optical depth along a line of sight depends on the wavelength dependent. Accumulating light in different spectral bands, spectral detector then records light from different surfaces, a structure that we can picture somewhat like the layers of an onion. The theoretical framework that predicts the emitted spectralmore » signal is radioactive transfer.« less

  13. Parasitic momentum flux in the tokamak core

    DOE PAGES

    Stoltzfus-Dueck, T.

    2017-03-06

    A geometrical correction to the E × B drift causes an outward flux of co-current momentum whenever electrostatic potential energy is transferred to ion parallel flows. The robust, fully nonlinear symmetry breaking follows from the free-energy flow in phase space and does not depend on any assumed linear eigenmode structure. The resulting rotation peaking is counter-current and scales as temperature over plasma current. Lastly, this peaking mechanism can only act when fluctuations are low-frequency enough to excite ion parallel flows, which may explain some recent experimental observations related to rotation reversals.

  14. Accreting X-ray pulsar atmospheres heated by Coulomb deceleration of protons

    NASA Technical Reports Server (NTRS)

    Meszaros, P.; Harding, A. K.; Kirk, J. G.; Galloway, D. J.

    1983-01-01

    Results are presented from detailed self-consistent models of accreting magnetized neutron star atmospheres, heated by the gradual deceleration of infalling protons via Coulomb encounters. The temperature and density gradients are calculated assuming momentum and energy balance, coupled with the radiative transfer for two polarizations. The cyclotron resonance effects were treated approximately. These models are characterized by power-law energy spectra, with single pulses at higher frequencies and multiple pulses at lower ones for some aspect angles, as well as a phase-dependent spectral index.

  15. UHF Radar observations at HAARP with HF pump frequencies near electron gyro-harmonics and associated ionospheric effects

    NASA Astrophysics Data System (ADS)

    Watkins, Brenton; Fallen, Christopher; Secan, James

    Results for HF modification experiments at the HAARP facility in Alaska are presented for experiments with the HF pump frequency near third and fourth electron gyro-harmonics. A UHF diagnostic radar with range resolution of 600 m was used to determine time-dependent altitudes of scattering from plasma turbulence during heating experiments. Experiments were conducted with multiple HF frequencies stepped by 20 kHz above and below the gyro-harmonic values. During times of HF heating the HAARP facility has sufficient power to enhance large-scale ionospheric densities in the lower ionosphere (about 150-200 km altitude) and also in the topside ionosphere (above about 350 km). In the lower ionosphere, time-dependent decreases of the altitude of radar scatter result from electron density enhancements. The effects are substantially different even for relatively small frequency steps of 20 kHz. In all cases the time-varying altitude decrease of radar scatter stops about 5-10 km below the gyro-harmonic altitude that is frequency dependent; we infer that electron density enhancements stop at this altitude where the radar signals stop decreasing with altitude. Experiments with corresponding total electron content (TEC) data show that for HF interaction altitudes above about 170 km there is substantial topside electron density increases due to upward electron thermal conduction. For lower altitudes of HF interaction the majority of the thermal energy is transferred to the neutral gas and no significant topside density increases are observed. By selecting an appropriate HF frequency a little greater than the gyro-harmonic value we have demonstrated that the ionospheric response to HF heating is a self-oscillating mode where the HF interaction altitude moves up and down with a period of several minutes. If the interaction region is above about 170 km this also produces a continuously enhanced topside electron density and upward plasma flux. Experiments using an FM scan with the HF frequency increasing near the gyro-harmonic value were conducted. The FM scan rate was sufficiently slow that the electron density was approximately in an equilibrium state. For these experiments the altitude of the HF interaction follows a near straight line downward parallel to the altitude-dependent gyro-harmonic level.

  16. Transfer in motion perceptual learning depends on the difficulty of the training task.

    PubMed

    Wang, Xiaoxiao; Zhou, Yifeng; Liu, Zili

    2013-06-07

    One hypothesis in visual perceptual learning is that the amount of transfer depends on the difficulty of the training and transfer tasks (Ahissar & Hochstein, 1997; Liu, 1995, 1999). Jeter, Dosher, Petrov, and Lu (2009), using an orientation discrimination task, challenged this hypothesis by arguing that the amount of transfer depends only on the transfer task but not on the training task. Here we show in a motion direction discrimination task that the amount of transfer indeed depends on the difficulty of the training task. Specifically, participants were first trained with either 4° or 8° direction discrimination along one average direction. Their transfer performance was then tested along an average direction 90° away from the trained direction. A variety of transfer measures consistently demonstrated that transfer performance depended on whether the participants were trained on 4° or 8° directional difference. The results contradicted the prediction that transfer was independent of the training task difficulty.

  17. New Trends in Two-Way Time and Frequency Transfer via Satellite

    DTIC Science & Technology

    1999-12-01

    Recent developments performed with SATRE two-way time transfer ( TWSTFT ) modems resulted in significant performance upgrades and operational...improvements of the TWSTFT method These are aimed to reduce : manpower effort and to provide reliable, real-time data via a centralized monitoring and...collection have been used throughout the experiment INTRODUCTION Two-Way Time and Frequency Transfer via Satellite ( TWSTFT ) is a well established method to

  18. Investigation of Hypersonic Laminar Heating Augmentation in the Stagnation Region

    NASA Technical Reports Server (NTRS)

    Marineau, Eric C.; Lewis, Daniel R.; Smith, Michael S.; Lafferty, John F.; White, Molly E.; Amar, Adam J.

    2012-01-01

    Laminar stagnation region heating augmentation is investigated in the AEDC Tunnel 9 at Mach 10 by performing high frequency surface pressure and heat transfer measurements on the Orion CEV capsule at zero degree angle-of-attack for unit Reynolds numbers between 0.5 and 15 million per foot. Heating augmentation increases with Reynolds number, but is also model size dependent as it is absent on a 1.25-inch diameter model at Reynolds numbers where it reaches up to 15% on a 7-inch model. Heat transfer space-time correlations on the 7-inch model show that disturbances convect at the boundary layer edge velocity and that the streamwise integral scale increases with distance. Therefore, vorticity amplification due to stretching and piling-up in the stagnation region appears to be responsible for the stagnation point heating augmentation on the larger model. This assumption is reinforced by the f(exp -11/3) dependence of the surface pressure spectrum compared to the f(exp -1) dependence in the free stream. Vorticity amplification does not occur on the 1.25- inch model because the disturbances are too large. Improved free stream fluctuation measurements will be required to determine if significant vorticity is present upstream or mostly generated behind the bow shock.

  19. Delay-dependent stability and added damping of SDOF real-time dynamic hybrid testing

    NASA Astrophysics Data System (ADS)

    Chi, Fudong; Wang, Jinting; Jin, Feng

    2010-09-01

    It is well-recognized that a transfer system response delay that reduces the test stability inevitably exists in real-time dynamic hybrid testing (RTDHT). This paper focuses on the delay-dependent stability and added damping of SDOF systems in RTDHT. The exponential delay term is transferred into a rational fraction by the Padé approximation, and the delay-dependent stability conditions and instability mechanism of SDOF RTDHT systems are investigated by the root locus technique. First, the stability conditions are discussed separately for the cases of stiffness, mass, and damping experimental substructure. The use of root locus plots shows that the added damping effect and instability mechanism for mass are different from those for stiffness. For the stiffness experimental substructure case, the instability results from the inherent mode because of an obvious negative damping effect of the delay. For the mass case, the delay introduces an equivalent positive damping into the inherent mode, and instability occurs at an added high frequency mode. Then, the compound stability condition is investigated for a general case and the results show that the mass ratio may have both upper and lower limits to remain stable. Finally, a high-emulational virtual shaking table model is built to validate the stability conclusions.

  20. Effects of eye-glasses, hair, headgear, and clothing on measured head-related transfer functions Part Ib

    NASA Astrophysics Data System (ADS)

    Riederer, Klaus A. J.

    2003-10-01

    Extensive head-related transfer function (HRTF) measurements show high HRTF repeatability, consequences of different measurement methods, and conditions covering the whole three-dimensional space [Riederer, J. Audio Eng. Soc. (Abstracts) 46, 1036 (1998), preprint 4846]. This study concentrates on specific effects on HRTFs carefully re-measured on the same Cortex dummy head applying Sennheiser KE4-211-2 microphones at its silicone putty blocked ear-canal entrances, employing 252 sound incidents including seven elevations. The effects of five different wigs (synthetic, natural, thick, thin, long and short hair) with varied hairstyles, four hats (cap, bicycle helmet, mens and womens trilby), clothes (alpaca pullover, bicycling drymax-jacket) and spectacles were investigated under 28 combinations. The influences are highly dependent on direction, frequency, and case. Clothes and eye-glasses affect minimally HRTF; hair has a stronger effect, depending on the actual hairdo (typically above 7 kHz). Hats alter intensively HRTFs (typically above 5 kHz), depending on the model. The measurements give deeper insight to the development of idiosyncratic features in binaural localization cues. The second part of the study addresses their perceptual effects [Riederer, J. Acoust. Soc. Am., this issue]. [Work supported by Graduate School of Electronics, Telecommunication and Automation; thanks to Finnish Broadcasting Company, Mr. Hellstrom; Mrs. Chen.

  1. Some Operational Aspects of the International Two-Way Satellite Time and Frequency Transfer (TWSTFT) Experiment Using INTELSAT Satellites at 307 Degrees East

    NASA Technical Reports Server (NTRS)

    DeYoung, J. A.; McKinley, A.; Davis, J. A.; Hetzel, P.; Bauch, A.

    1996-01-01

    Eight laboratories are participating in an international two-way satellite time and frequency transfer (TWSTFT) experiment. Regular time and frequency transfers have been performed over a period of almost two years, including both European and transatlantic time transfers. The performance of the regular TWSTFT sessions over an extended period has demonstrated conclusively the usefulness of the TWSTFT method for routine international time and frequency comparisons. Regular measurements are performed three times per week resulting in a regular but unevenly spaced data set. A method is presented that allows an estimate of the values of delta (sub y)(gamma) to be formed from these data. In order to maximize efficient use of paid satellite time an investigation to determine the optimal length of a single TWSTFT session is presented. The optimal experiment length is determined by evaluating how long white phase modulation (PM) instabilities are the dominant noise source during the typical 300-second sampling times currently used. A detailed investigation of the frequency transfers realized via the transatlantic TWSTFT links UTC(USNO)-UTC(NPL), UTC(USNO)-UTC(PTB), and UTC(PTB)-UTC(NPL) is presented. The investigation focuses on the frequency instabilities realized, a three cornered hat resolution of the delta (sub y) (gamma) values, and a comparison of the transatlantic and inter-European determination of UTC(PTB)-UTC(NPL). Future directions of this TWSTFT experiment are outlined.

  2. Evaluation of cross-connected waveguides as transfer standards of transmission at high millimetre-wave frequencies

    NASA Astrophysics Data System (ADS)

    Ridler, Nick; Clarke, Roland; Huang, Hui; Zinal, Sherko

    2016-08-01

    At the present time, transfer and verification standards of transmission coefficient (or, equivalently, transmission loss) are not readily available at high millimetre-wave frequencies (i.e. at frequencies ranging typically from 100 GHz to 300 GHz). In recent years, cross-connected waveguide devices have been proposed to provide calculable standards of transmission loss at these frequencies. This paper investigates the viability of these cross-connected waveguides as transfer standards of transmission for inter-laboratory measurement comparison exercises. This relates to their potential use in activities such as international key comparison exercises and measurement audit programmes. A trial inter-laboratory comparison involving four laboratories using two cross-connected waveguides in the WR-05 waveguide size (covering frequencies from 140 GHz to 220 GHz) is described and includes an analysis of the measurement results obtained during the comparison exercise.

  3. CSDP: The seismology of continental thermal regimes

    NASA Astrophysics Data System (ADS)

    Aki, K.

    1991-05-01

    The past year continued to be extremely productive following up two major breakthroughs made in the preceding year. One of the breakthroughs was the derivation of an integral equation for time-dependent power spectra, which unified all the existing theories on seismic scattering including the radiative transfer theory for total energy and single-multiple scattering theories based on the ray approach. We successfully applied the method to the data from the United States Geological Survey (USGS) regional seismic arrays in central California, Long Valley and Island of Hawaii, and obtained convincing results on the scattering Q(sup -1) and intrinsic Q(sup -1) in these areas for the frequency range from 1 Hz to 20 Hz. The frequency dependence of scattering Q(sup -1) is, then, interpreted in terms of random medium with continuous or discrete scatterers. The other breakthrough was the application of T-matrix formulation to the seismic scattering problem. We are currently working on two dimensional inclusions with high and low velocity contrast with the surrounding medium. In addition to the above two main lines of research, we were able to use so-called 'T-phase' observed on the Island of Hawaii to map the Q value with a good spatial resolution. The T-phase is seismic waves converted from acoustic waves propagated through the sofar channel of the ocean. We found that we can eliminate remarkably well the frequency dependent recording site effect from the T-phase amplitude using the amplification factor for coda waves, further confirming the fundamental separability of source, path and site effects for coda waves, and proving the effectiveness of stochastic modeling of high-frequency seismic waves.

  4. Active laser ranging with frequency transfer using frequency comb

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hongyuan; Wei, Haoyun; Yang, Honglei

    2016-05-02

    A comb-based active laser ranging scheme is proposed for enhanced distance resolution and a common time standard for the entire system. Three frequency combs with different repetition rates are used as light sources at the two ends where the distance is measured. Pulse positions are determined through asynchronous optical sampling and type II second harmonic generation. Results show that the system achieves a maximum residual of 379.6 nm and a standard deviation of 92.9 nm with 2000 averages over 23.6 m. Moreover, as for the frequency transfer, an atom clock and an adjustable signal generator, synchronized to the atom clock, are used asmore » time standards for the two ends to appraise the frequency deviation introduced by the proposed system. The system achieves a residual fractional deviation of 1.3 × 10{sup −16} for 1 s, allowing precise frequency transfer between the two clocks at the two ends.« less

  5. Identification of boiler inlet transfer functions and estimation of system parameters

    NASA Technical Reports Server (NTRS)

    Miles, J. H.

    1972-01-01

    An iterative computer method is described for identifying boiler transfer functions using frequency response data. An objective penalized performance measure and a nonlinear minimization technique are used to cause the locus of points generated by a transfer function to resemble the locus of points obtained from frequency response measurements. Different transfer functions can be tried until a satisfactory empirical transfer function of the system is found. To illustrate the method, some examples and some results from a study of a set of data consisting of measurements of the inlet impedance of a single tube forced flow boiler with inserts are given.

  6. Sensory Bias Predicts Postural Stability, Anxiety, and Cognitive Performance in Healthy Adults Walking in Novel Discordant Conditions

    NASA Technical Reports Server (NTRS)

    Brady, Rachel A.; Batson, Crystal D.; Peters, Brian T.; Mulavara, Ajitkumar P.; Bloomberg, Jacob J.

    2010-01-01

    We designed a gait training study that presented combinations of visual flow and support surface manipulations to investigate the response of healthy adults to novel discordant sensorimotor conditions. We aimed to determine whether a relationship existed between subjects visual dependence and their scores on a collective measure of anxiety, cognition, and postural stability in a new discordant environment presented at the conclusion of training (Transfer Test). A treadmill was mounted to a motion base platform positioned 2 m behind a large visual screen. Training consisted of three walking sessions, each within a week of the previous visit, that presented four 5-minute exposures to various combinations of support surface and visual scene manipulations, all lateral sinusoids. The conditions were scene translation only, support surface translation only, simultaneous scene and support surface translations in-phase, and simultaneous scene and support surface translations 180 out-of-phase. During the Transfer Test, the trained participants received a 2-minute novel exposure. A visual sinusoidal roll perturbation, with twice the original flow rate, was superimposed on a sinusoidal support surface roll perturbation that was 90 out of phase with the scene. A high correlation existed between normalized torso translation, measured in the scene-only condition at the first visit, and a combined measure of normalized heart rate, stride frequency, and reaction time at the transfer test. Results suggest that visually dependent participants experience decreased postural stability, increased anxiety, and increased reaction times compared to their less visually dependent counterparts when negotiating novel discordant conditions.

  7. Simple model to estimate the contribution of atmospheric CO2 to the Earth's greenhouse effect

    NASA Astrophysics Data System (ADS)

    Wilson, Derrek J.; Gea-Banacloche, Julio

    2012-04-01

    We show how the CO2 contribution to the Earth's greenhouse effect can be estimated from relatively simple physical considerations and readily available spectroscopic data. In particular, we present a calculation of the "climate sensitivity" (that is, the increase in temperature caused by a doubling of the concentration of CO2) in the absence of feedbacks. Our treatment highlights the important role played by the frequency dependence of the CO2 absorption spectrum. For pedagogical purposes, we provide two simple models to visualize different ways in which the atmosphere might return infrared radiation back to the Earth. The more physically realistic model, based on the Schwarzschild radiative transfer equations, uses as input an approximate form of the atmosphere's temperature profile, and thus includes implicitly the effect of heat transfer mechanisms other than radiation.

  8. High-frequency self-aligned graphene transistors with transferred gate stacks

    PubMed Central

    Cheng, Rui; Bai, Jingwei; Liao, Lei; Zhou, Hailong; Chen, Yu; Liu, Lixin; Lin, Yung-Chen; Jiang, Shan; Huang, Yu; Duan, Xiangfeng

    2012-01-01

    Graphene has attracted enormous attention for radio-frequency transistor applications because of its exceptional high carrier mobility, high carrier saturation velocity, and large critical current density. Herein we report a new approach for the scalable fabrication of high-performance graphene transistors with transferred gate stacks. Specifically, arrays of gate stacks are first patterned on a sacrificial substrate, and then transferred onto arbitrary substrates with graphene on top. A self-aligned process, enabled by the unique structure of the transferred gate stacks, is then used to position precisely the source and drain electrodes with minimized access resistance or parasitic capacitance. This process has therefore enabled scalable fabrication of self-aligned graphene transistors with unprecedented performance including a record-high cutoff frequency up to 427 GHz. Our study defines a unique pathway to large-scale fabrication of high-performance graphene transistors, and holds significant potential for future application of graphene-based devices in ultra–high-frequency circuits. PMID:22753503

  9. Temperature and frequency dependent conductivity of bismuth zinc vanadate semiconducting glassy system

    NASA Astrophysics Data System (ADS)

    Punia, R.; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Kishore, N.

    2012-10-01

    The ac conductivity of bismuth zinc vanadate glasses with compositions 50V2O5. xBi2O3. (50-x) ZnO has been studied in the frequency range 10-1 Hz to 2 MHz and in temperature range 333.16 K to 533.16 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of bismuth zinc vanadate glass system. The dc conductivity (σdc), crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. It has been observed that mobility of charge carriers and ac conductivity in case of zinc vanadate glass system increases with increase in Bi2O3 content. In order to determine the conduction mechanism, the ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models based on classical hopping over barriers and quantum mechanical tunneling. The ac conduction takes place via tunneling of overlapping large polarons in all the compositions of presently studied vanadate glasses. The fitting of experimental data of ac conductivity with overlapping large polarons tunneling model has also been done. The parameters; density of states at Fermi level (N(EF)), activation energy associated with charge transfer between the overlapping sites (WHO), inverse localization length (α) and polaron radius (rp) obtained from fitting of this model with experimental data are reasonable.

  10. A self-adaptive metamaterial beam with digitally controlled resonators for subwavelength broadband flexural wave attenuation

    NASA Astrophysics Data System (ADS)

    Li, Xiaopeng; Chen, Yangyang; Hu, Gengkai; Huang, Guoliang

    2018-04-01

    Designing lightweight materials and/or structures for broadband low-frequency noise/vibration mitigation is an issue of fundamental importance both practically and theoretically. In this paper, by leveraging the concept of frequency-dependent effective stiffness control, we numerically and experimentally demonstrate, for the first time, a self-adaptive metamaterial beam with digital circuit controlled mechanical resonators for strong and broadband flexural wave attenuation at subwavelength scales. The digital controllers that are capable of feedback control of piezoelectric shunts are integrated into mechanical resonators in the metamaterial, and the transfer function is semi-analytically determined to realize an effective bending stiffness in a quadratic function of the wave frequency for adaptive band gaps. The digital as well as analog control circuits as the backbone of the system are experimentally realized with the guarantee stability of the whole electromechanical system in whole frequency regions, which is the most challenging problem so far. Our experimental results are in good agreement with numerical predictions and demonstrate the strong wave attenuation in almost a three times larger frequency region over the bandwidth of a passive metamaterial. The proposed metamaterial could be applied in a range of applications in the design of elastic wave control devices.

  11. Otoliths - Accelerometer and seismometer; Implications in Vestibular Evoked Myogenic Potential (VEMP).

    PubMed

    Grant, Wally; Curthoys, Ian

    2017-09-01

    Vestibular otolithic organs are recognized as transducers of head acceleration and they function as such up to their corner frequency or undamped natural frequency. It is well recognized that these organs respond to frequencies above their corner frequency up to the 2-3 kHz range (Curthoys et al., 2016). A mechanics model for the transduction of these organs is developed that predicts the response below the undamped natural frequency as an accelerometer and above that frequency as a seismometer. The model is converted to a transfer function using hair cell bundle deflection. Measured threshold acceleration stimuli are used along with threshold deflections for threshold transfer function values. These are compared to model predicted values, both below and above their undamped natural frequency. Threshold deflection values are adjusted to match the model transfer function. The resulting threshold deflection values were well within in measure threshold bundle deflection ranges. Vestibular Evoked Myogenic Potentials (VEMPs) today routinely uses stimulus frequencies of 500 and 1000 Hz, and otoliths have been established incontrovertibly by clinical and neural evidence as the stimulus source. The mechanism for stimulus at these frequencies above the undamped natural frequency of otoliths is presented where otoliths are utilizing a seismometer mode of response for VEMP transduction. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Chemical-exchange-saturation-transfer magnetic resonance imaging to map gamma-aminobutyric acid, glutamate, myoinositol, glycine, and asparagine: Phantom experiments

    NASA Astrophysics Data System (ADS)

    Oh, Jang-Hoon; Kim, Hyug-Gi; Woo, Dong-Cheol; Jeong, Ha-Kyu; Lee, Soo Yeol; Jahng, Geon-Ho

    2017-03-01

    The physical and technical development of chemical-exchange-saturation-transfer (CEST) magnetic resonance imaging (MRI) using clinical 3 T MRI was explored with the goal of mapping asparagine (Asn), gamma-aminobutyric acid (GABA), glutamate (Glu), glycine (Gly), and myoinositol (MI), which exist in the brain. Phantoms with nine different conditions at concentrations of 10, 30, and 50 mM and pH values of 5.6, 6.2, and 7.4 were prepared for the five target molecules to evaluate the dependence of the CEST effect in the concentration, the pH, and the amplitude of the applied radiofrequency field B1. CEST images in the offset frequency range of ±6 parts per million (ppm) were acquired using a pulsed radio-frequency saturation scheme with a clinical 3 T MRI system. A voxel-based main magnetic field B0 inhomogeneity correction, where B0 is the center frequency offset at zero ppm, was performed by using the spline interpolation method to fit the full Z-spectrum to estimate the center frequency. A voxel-based CEST asymmetry map was calculated to evaluate amide (-NH), amine (-NH2), and hydroxyl (-OH) groups for the five target molecules. The CEST effect for Glu, GABA, and Gly clearly increased with increasing concentrations. The CEST effect for MI was minimal, with no noticeable differences at different concentrations. The CEST effect for Glu and Gly increased with increasing acidity. The highest CEST asymmetry for GABA was observed at pH 6.2. The CEST effect for Glu, GABA, and Gly increased with increasing B1 amplitude. For all target molecules, the CEST effect for the human 3 T MRI system increased with increasing concentration and B1 amplitude, but varied with pH, depending on the characteristics of the molecules. The CEST effect for MI may be not suitable with clinical MRI systems. These results show that CEST imaging in the brain with the amine protons by using 3 T MRI is possible for several neuronal diseases.

  13. A Transfer Voltage Simulation Method for Generator Step Up Transformers

    NASA Astrophysics Data System (ADS)

    Funabashi, Toshihisa; Sugimoto, Toshirou; Ueda, Toshiaki; Ametani, Akihiro

    It has been found from measurements for 13 sets of GSU transformers that a transfer voltage of a generator step-up (GSU) transformer involves one dominant oscillation frequency. The frequency can be estimated from the inductance and capacitance values of the GSU transformer low-voltage-side. This observation has led to a new method for simulating a GSU transformer transfer voltage. The method is based on the EMTP TRANSFORMER model, but stray capacitances are added. The leakage inductance and the magnetizing resistance are modified using approximate curves for their frequency characteristics determined from the measured results. The new method is validated in comparison with the measured results.

  14. Computational nanometrology of line-edge roughness: noise effects, cross-line correlations and the role of etch transfer

    NASA Astrophysics Data System (ADS)

    Constantoudis, Vassilios; Papavieros, George; Lorusso, Gian; Rutigliani, Vito; Van Roey, Frieda; Gogolides, Evangelos

    2018-03-01

    The aim of this paper is to investigate the role of etch transfer in two challenges of LER metrology raised by recent evolutions in lithography: the effects of SEM noise and the cross-line and edge correlations. The first comes from the ongoing scaling down of linewidths, which dictates SEM imaging with less scanning frames to reduce specimen damage and hence with more noise. During the last decade, it has been shown that image noise can be an important budget of the measured LER while systematically affects and alter the PSD curve of LER at high frequencies. A recent method for unbiased LER measurement is based on the systematic Fourier or correlation analysis to decompose the effects of noise from true LER (Fourier-Correlation filtering method). The success of the method depends on the PSD and HHCF curve. Previous experimental and model works have revealed that etch transfer affects the PSD of LER reducing its high frequency values. In this work, we estimate the noise contribution to the biased LER through PSD flat floor at high frequencies and relate it with the differences between the PSDs of lithography and etched LER. Based on this comparison, we propose an improvement of the PSD/HHCF-based method for noise-free LER measurement to include the missed high frequency real LER. The second issue is related with the increased density of lithographic patterns and the special characteristics of DSA and MP lithography patterns exhibits. In a previous work, we presented an enlarged LER characterization methodology for such patterns, which includes updated versions of the old metrics along with new metrics defined and developed to capture cross-edge and cross-line correlations. The fundamental concept has been the Line Center Roughness (LCR), the edge c-factor and the line c-factor correlation function and length quantifying the line fluctuations and the extent of cross-edge and cross-line correlations. In this work, we focus on the role of etch steps on cross-edge and line correlation metrics in SAQP data. We find that the spacer etch steps reduce edge correlations while etch steps with pattern transfer increase these. Furthermore, the density doubling and quadrupling increase edge correlations as well as cross-line correlations.

  15. Analysis and design of an ultrahigh temperature hydrogen-fueled MHD generator

    NASA Technical Reports Server (NTRS)

    Moder, Jeffrey P.; Myrabo, Leik N.; Kaminski, Deborah A.

    1993-01-01

    A coupled gas dynamics/radiative heat transfer analysis of partially ionized hydrogen, in local thermodynamic equilibrium, flowing through an ultrahigh temperature (10,000-20,000 K) magnetohydrodynamic (MHD) generator is performed. Gas dynamics are modeled by a set of quasi-one-dimensional, nonlinear differential equations which account for friction, convective and radiative heat transfer, and the interaction between the ionized gas and applied magnetic field. Radiative heat transfer is modeled using nongray, absorbing-emitting 2D and 3D P-1 approximations which permit an arbitrary variation of the spectral absorption coefficient with frequency. Gas dynamics and radiative heat transfer are coupled through the energy equation and through the temperature- and density-dependent absorption coefficient. The resulting nonlinear elliptic problem is solved by iterative methods. Design of such MHD generators as onboard, open-cycle, electric power supplies for a particular advanced airbreathing propulsion concept produced an efficient and compact 128-MWe generator characterized by an extraction ratio of 35.5 percent, a power density of 10,500 MWe/cu m, and a specific (extracted) energy of 324 MJe/kg of hydrogen. The maximum wall heat flux and total wall heat load were 453 MW/sq m and 62 MW, respectively.

  16. On the nature of intramolecular vibrational energy transfer in dense molecular environments

    NASA Astrophysics Data System (ADS)

    von Benten, Rebekka S.; Abel, Bernd

    2010-12-01

    Transient femtosecond-IR-pump-UV-absorption probe-spectroscopy has been employed to shed light on the nature of intramolecular vibrational energy transfer (IVR) in dense molecular environments ranging from the diluted gas phase to the liquid. A general feature in our experiments and those of others is that IVR proceeds via multiple timescales if overtones or combination vibrations of high frequency modes are excited. It has been found that collisions enhance IVR if its (slower) timescales can compete with collisions. This enhancement is, however, much more weaker and rather inefficient as opposed to the effect of collisions on intermolecular energy transfer which is well known. In a series of experiments we found that IVR depends not significantly on the average energy transferred in a collision but rather on the number of collisions. The collisions are much less efficient in affecting IVR than VET. We conclude that collision induced broadening of vibrational energy levels reduces the energy gaps and enhances existing couplings between tiers. The present results are an important step forward to rationalize and understand apparently different and not consistent results from different groups on different molecular systems between gas and liquid phases.

  17. Energy Transfer Between Coherently Delocalized States in Thin Films of the Explosive Pentaerythritol Tetranitrate (PETN) Revealed by Two-Dimensional Infrared Spectroscopy

    NASA Astrophysics Data System (ADS)

    Ostrander, Joshua; Knepper, Robert; Tappan, Alexander; Kay, Jeffery; Zanni, Martin; Farrow, Darcie

    2017-06-01

    Pentaerythritol tetranitrate (PETN) is a common secondary explosive and has been used extensively to study shock initiation and energy propagation in energetic materials. We report 2D IR measurements of PETN thin films that resolve vibrational energy transfer and relaxation mechanisms. Ultrafast anisotropy measurements reveal a sub-500 fs reorientation of transition dipoles in thin films of vapor-deposited PETN that is absent in solution measurements, consistent with intermolecular energy transfer. The anisotropy is frequency dependent, suggesting spectrally heterogeneous vibrational relaxation. Cross peaks are observed in 2D IR spectra that resolve a specific energy transfer pathway with a 2 ps time scale. Measurements of the transition dipole strength indicate that these vibrational modes are coherently delocalized over at least 15-30 molecules. We discuss the implications of vibrational relaxation between coherently delocalized eigenstates for mechanisms relevant to explosives. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  18. Detector Apparatus and Method

    NASA Technical Reports Server (NTRS)

    Arndt, G. Dickey (Inventor); Ngo, Phong H. (Inventor); Carl, James R. (Inventor); Byerly, Kent A. (Inventor); Dusl, John (Inventor)

    2003-01-01

    Transceiver and methods are included that are especially suitable for detecting metallic materials, such as metallic mines, within an environment. The transceiver includes a digital waveform generator used to transmit a signal into the environment and a receiver that produces a digital received signal. A tracking module preferably compares an in-phase and quadrature transmitted signal with an in-phase and quadrature received signal to produce a spectral transfer function of the magnetic transceiver over a selected range of frequencies. The transceiver initially preferably creates a reference transfer function which is then stored in a memory. Subsequently measured transfer functions will vary depending on the presence of metal in the environment which was not in the environment when the reference transfer function was determined. The system may be utilized in the presence of other antennas, metal, and electronics which may comprise a plastic mine detector for detecting plastic mines. Despite the additional antennas and other metallic materials that may be in the environment due to the plastic mine detector, the magnetic transceiver remains highly sensitive to metallic material which may be located in various portions of the environment and which may be detected by sweeping the detector over ground that may contain metals or mines.

  19. PTB’s Time and Frequency Activities in 2008 and 2009

    DTIC Science & Technology

    2009-11-01

    techniques (C/A code, P3, carrier phase, PPP). Two-way satellite time and fre- quency transfer ( TWSTFT ) is made routinely with several stations in...and frequency transfer ( TWSTFT ) is routinely per- formed with several European and US stations. PTB provides services to disseminate time and...years 2008 and 2009 are pre- sented. TWSTT AND GPS ACTIVITIES PTB uses TWSTFT and GPS Time Transfer to compare the local time scale UTC (PTB

  20. Long-Term Stability of Remote Clock Comparisons with IGS Clock Products

    DTIC Science & Technology

    2007-11-01

    in-view (AV) time and frequency transfer and the two-way satellite time and frequency transfer ( TWSTFT ) techniques are used in the daily operations of...multichannel CV and AV can reach subnanosecond at 1 day as measured by the time deviation (TDEV). TWSTFT uses communication satellites for...simultaneously exchanging timing signals among the pairs of timing laboratories [4]. TWSTFT regularly delivers time transfer stability at a few hundreds of

  1. On the Dependence of the Ionospheric E-Region Electric Field of the Solar Activity

    NASA Astrophysics Data System (ADS)

    Denardini, Clezio Marcos; Schuch, Nelson Jorge; Moro, Juliano; Araujo Resende, Laysa Cristina; Chen, Sony Su; Costa, D. Joaquim

    2016-07-01

    We have being studying the zonal and vertical E region electric field components inferred from the Doppler shifts of type 2 echoes (gradient drift irregularities) detected with the 50 MHz backscatter coherent (RESCO) radar set at Sao Luis, Brazil (SLZ, 2.3° S, 44.2° W) during the solar cycle 24. In this report we present the dependence of the vertical and zonal components of this electric field with the solar activity, based on the solar flux F10.7. For this study we consider the geomagnetically quiet days only (Kp <= 3+). A magnetic field-aligned-integrated conductivity model was developed for proving the conductivities, using the IRI-2007, the MISIS-2000 and the IGRF-11 models as input parameters for ionosphere, neutral atmosphere and Earth magnetic field, respectively. The ion-neutron collision frequencies of all the species are combined through the momentum transfer collision frequency equation. The mean zonal component of the electric field, which normally ranged from 0.19 to 0.35 mV/m between the 8 and 18 h (LT) in the Brazilian sector, show a small dependency with the solar activity. Whereas, the mean vertical component of the electric field, which normally ranges from 4.65 to 10.12 mV/m, highlight the more pronounced dependency of the solar flux.

  2. Polarized Line Formation in Arbitrary Strength Magnetic Fields Angle-averaged and Angle-dependent Partial Frequency Redistribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sampoorna, M.; Nagendra, K. N.; Stenflo, J. O., E-mail: sampoorna@iiap.res.in, E-mail: knn@iiap.res.in, E-mail: stenflo@astro.phys.ethz.ch

    Magnetic fields in the solar atmosphere leave their fingerprints in the polarized spectrum of the Sun via the Hanle and Zeeman effects. While the Hanle and Zeeman effects dominate, respectively, in the weak and strong field regimes, both these effects jointly operate in the intermediate field strength regime. Therefore, it is necessary to solve the polarized line transfer equation, including the combined influence of Hanle and Zeeman effects. Furthermore, it is required to take into account the effects of partial frequency redistribution (PRD) in scattering when dealing with strong chromospheric lines with broad damping wings. In this paper, we presentmore » a numerical method to solve the problem of polarized PRD line formation in magnetic fields of arbitrary strength and orientation. This numerical method is based on the concept of operator perturbation. For our studies, we consider a two-level atom model without hyperfine structure and lower-level polarization. We compare the PRD idealization of angle-averaged Hanle–Zeeman redistribution matrices with the full treatment of angle-dependent PRD, to indicate when the idealized treatment is inadequate and what kind of polarization effects are specific to angle-dependent PRD. Because the angle-dependent treatment is presently computationally prohibitive when applied to realistic model atmospheres, we present the computed emergent Stokes profiles for a range of magnetic fields, with the assumption of an isothermal one-dimensional medium.« less

  3. Long distance measurement with a femtosecond laser based frequency comb

    NASA Astrophysics Data System (ADS)

    Bhattacharya, N.; Cui, M.; Zeitouny, M. G.; Urbach, H. P.; van den Berg, S. A.

    2017-11-01

    Recent advances in the field of ultra-short pulse lasers have led to the development of reliable sources of carrier envelope phase stabilized femtosecond pulses. The pulse train generated by such a source has a frequency spectrum that consists of discrete, regularly spaced lines known as a frequency comb. In this case both the frequency repetition and the carrier-envelope-offset frequency are referenced to a frequency standard, like an atomic clock. As a result the accuracy of the frequency standard is transferred to the optical domain, with the frequency comb as transfer oscillator. These unique properties allow the frequency comb to be applied as a versatile tool, not only for time and frequency metrology, but also in fundamental physics, high-precision spectroscopy, and laser noise characterization. The pulse-to-pulse phase relationship of the light emitted by the frequency comb has opened up new directions for long range highly accurate distance measurement.

  4. Simultaneous transfer of optical frequency and time over 306 km long-haul optical fibre link

    NASA Astrophysics Data System (ADS)

    Hucl, Vaclav; Cizek, Martin; Pravdova, Lenka; Rerucha, Simon; Hrabina, Jan; Mikel, Bretislav; Smotlacha, Vladimir; Vojtech, Josef; Lazar, Josef; Cip, Ondrej

    2016-12-01

    Optical fibre links for distributing optical frequencies and time stamps were researched and experimentally tested in the past fifteen years. They have been used mainly for stability comparison of experimental optical clocks. But recent development puts demands on a technology transfer from laboratory experiments to the real industry. The remote calibration of interrogators of Fibre Bragg Grating strain sensory networks is one of important examples. The first step of the adoption the time and frequency broadcasting should be the drop-out free long-term operation of this technology between research laboratories connected via long-haul fibre links. We present a 306 km long-haul optical fibre link between the cities of Prague and Brno in the Czech Republic where a coherent transfer of stable optical frequency and a stable time signal has been firstly demonstrated. The link between ISI CAS Brno and CESNET Prague uses an internet communication fibre where a window of 1540-1546 nm is dedicated for the coherent transfer and 1PPS signal. The link is equipped with 6 bidirectional EDFA amplifiers. The optical frequency standard based on the highly-coherent laser Koheras Adjustik working at 1540.5 nm and stabilized with a saturation absorption spectroscopy technique was used for the coherent wave transfer. The suppression of the Doppler shift induced by the optical fibre was based on an accoustooptical modulator with a servo-loop including a fast PID controller processing the beat-note frequency given by mixing of the Adjustik laser (Brno) and the reflected frequency of this laser from the far end of 306 km long-haul fibre link (Prague). We verified the Doppler shift suppression for the coherent wave with a measuring method analysing the transport delay of the 1PPS signal.

  5. Thunder-induced ground motions: 1. Observations

    NASA Astrophysics Data System (ADS)

    Lin, Ting-L.; Langston, Charles A.

    2009-04-01

    Acoustic pressure from thunder and its induced ground motions were investigated using a small array consisting of five three-component short-period surface seismometers, a three-component borehole seismometer, and five infrasound microphones. We used the array to constrain wave parameters of the incident acoustic and seismic waves. The incident slowness differences between acoustic pressure and ground motions suggest that ground reverberations were first initiated somewhat away from the array. Using slowness inferred from ground motions is preferable to obtain the seismic source parameters. We propose a source equalization procedure for acoustic/seismic deconvolution to generate the time domain transfer function, a procedure similar to that of obtaining teleseismic earthquake receiver functions. The time domain transfer function removes the incident pressure time history from the seismogram. An additional vertical-to-radial ground motion transfer function was used to identify the Rayleigh wave propagation mode of induced seismic waves complementing that found using the particle motions and amplitude variations in the borehole. The initial motions obtained by the time domain transfer functions suggest a low Poisson's ratio for the near-surface layer. The acoustic-to-seismic transfer functions show a consistent reverberation series at frequencies near 5 Hz. This gives an empirical measure of site resonance that depends on the ratio of the layer velocity to layer thickness for earthquake P and S waves. The time domain transfer function approach by transferring a spectral division into the time domain provides an alternative method for studying acoustic-to-seismic coupling.

  6. Faraday Rotation: Effect of Magnetic Field Reversals

    NASA Astrophysics Data System (ADS)

    Melrose, D. B.

    2010-12-01

    The standard formula for the rotation measure (RM), which determines the position angle, ψ = RMλ2, due to Faraday rotation, includes contributions only from the portions of the ray path where the natural modes of the plasma are circularly polarized. In small regions of the ray path where the projection of the magnetic field on the ray path reverses sign (called QT regions) the modes are nearly linearly polarized. The neglect of QT regions in estimating RM is not well justified at frequencies below a transition frequency where mode coupling changes from strong to weak. By integrating the polarization transfer equation across a QT region in the latter limit, I estimate the additional contribution Δψ needed to correct this omission. In contrast with a result proposed by Broderick & Blandford, Δψ is small and probably unobservable. I identify a new source of circular polarization, due to mode coupling in an asymmetric QT region. I also identify a new circular-polarization-dependent correction to the dispersion measure at low frequencies.

  7. Backscatter and attenuation properties of mammalian brain tissues

    NASA Astrophysics Data System (ADS)

    Wijekularatne, Pushpani Vihara

    Traumatic Brain Injury (TBI) is a common category of brain injuries, which contributes to a substantial number of deaths and permanent disability all over the world. Ultrasound technology plays a major role in tissue characterization due to its low cost and portability that could be used to bridge a wide gap in the TBI diagnostic process. This research addresses the ultrasonic properties of mammalian brain tissues focusing on backscatter and attenuation. Orientation dependence and spatial averaging of data were analyzed using the same method resulting from insertion of tissue sample between a transducer and a reference reflector. Apparent backscatter transfer function (ABTF) at 1 to 10 MHz, attenuation coefficient and backscatter coefficient (BSC) at 1 to 5 MHz frequency ranges were measured on ovine brain tissue samples. The resulting ABTF was a monotonically decreasing function of frequency and the attenuation coefficient and BSC generally were increasing functions of frequency, results consistent with other soft tissues such as liver, blood and heart.

  8. Weld pool oscillation during GTA welding of mild steel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Y.H.; Ouden, G. den

    1993-08-01

    In this paper the results are reported of a study dealing with the oscillation behavior of weld pools in the case of GTA bead-on-plate welding of mild steel, Fe 360. During welding, the weld pool was brought into oscillation by applying short current pulses, and the oscillation frequency and amplitude were measured by monitoring the arc voltage. It was found that the oscillation of the partially penetrated weld pool is dominated by one of two different oscillation modes (Mode 1 and Mode 2) depending on the welding conditions, whereas the oscillation of the fully penetrated weld pool is characterized bymore » a third oscillation mode (Mode 3). It is possible to maintain partially penetrated weld pool oscillation in Mode 1 by choosing appropriate welding conditions. Under these conditions, an abrupt decrease in oscillation frequency occurs when the weld pool transfers from partial penetration to full penetration. Thus, weld penetration can be in-process controlled by monitoring the oscillation frequency during welding.« less

  9. Photoacoustic signal and noise analysis for Si thin plate: signal correction in frequency domain.

    PubMed

    Markushev, D D; Rabasović, M D; Todorović, D M; Galović, S; Bialkowski, S E

    2015-03-01

    Methods for photoacoustic signal measurement, rectification, and analysis for 85 μm thin Si samples in the 20-20 000 Hz modulation frequency range are presented. Methods for frequency-dependent amplitude and phase signal rectification in the presence of coherent and incoherent noise as well as distortion due to microphone characteristics are presented. Signal correction is accomplished using inverse system response functions deduced by comparing real to ideal signals for a sample with well-known bulk parameters and dimensions. The system response is a piece-wise construction, each component being due to a particular effect of the measurement system. Heat transfer and elastic effects are modeled using standard Rosencweig-Gersho and elastic-bending theories. Thermal diffusion, thermoelastic, and plasmaelastic signal components are calculated and compared to measurements. The differences between theory and experiment are used to detect and correct signal distortion and to determine detector and sound-card characteristics. Corrected signal analysis is found to faithfully reflect known sample parameters.

  10. Human cortical–hippocampal dialogue in wake and slow-wave sleep

    PubMed Central

    Mitra, Anish; Hacker, Carl D.; Pahwa, Mrinal; Tagliazucchi, Enzo; Laufs, Helmut; Leuthardt, Eric C.; Raichle, Marcus E.

    2016-01-01

    Declarative memory consolidation is hypothesized to require a two-stage, reciprocal cortical–hippocampal dialogue. According to this model, higher frequency signals convey information from the cortex to hippocampus during wakefulness, but in the reverse direction during slow-wave sleep (SWS). Conversely, lower-frequency activity propagates from the information “receiver” to the “sender” to coordinate the timing of information transfer. Reversal of sender/receiver roles across wake and SWS implies that higher- and lower-frequency signaling should reverse direction between the cortex and hippocampus. However, direct evidence of such a reversal has been lacking in humans. Here, we use human resting-state fMRI and electrocorticography to demonstrate that δ-band activity and infraslow activity propagate in opposite directions between the hippocampus and cerebral cortex. Moreover, both δ activity and infraslow activity reverse propagation directions between the hippocampus and cerebral cortex across wake and SWS. These findings provide direct evidence for state-dependent reversals in human cortical–hippocampal communication. PMID:27791089

  11. Measuring and engineering the atomic mass density wave of a Gaussian mass-polariton pulse in optical fibers

    NASA Astrophysics Data System (ADS)

    Partanen, Mikko; Tulkki, Jukka

    2018-02-01

    Conventional theories of electromagnetic waves in a medium assume that only the energy of the field propagates inside the medium. Consequently, they neglect the transport of mass density by the medium atoms. We have recently presented foundations of a covariant theory of light propagation in a nondispersive medium by considering a light wave simultaneously with the dynamics of the medium atoms driven by optoelastic forces [Phys. Rev. A 95, 063850 (2017)]. In particular, we have shown that the mass is transferred by an atomic mass density wave (MDW), which gives rise to mass-polariton (MP) quasiparticles, i.e., covariant coupled states of the field and matter having a nonzero rest mass. Another key observation of the mass-polariton theory of light is that, in common semiconductors, most of the momentum of light is transferred by moving atoms, e.g., 92% in the case of silicon. In this work, we generalize the MP theory of light for dispersive media and consider experimental measurement of the mass transferred by the MDW atoms when an intense light pulse propagates in a silicon fiber. In particular, we consider optimal intensity and time dependence of a Gaussian pulse and account for the breakdown threshold irradiance of the material. The optical shock wave property of the MDW, which propagates with the velocity of light instead of the velocity of sound, prompts for engineering of novel device concepts like very high frequency mechanical oscillators not limited by the acoustic cutoff frequency.

  12. Radarclinometry: Bootstrapping the radar reflectance function from the image pixel-signal frequency distribution and an altimetry profile

    USGS Publications Warehouse

    Wildey, R.L.

    1988-01-01

    A method is derived for determining the dependence of radar backscatter on incidence angle that is applicable to the region corresponding to a particular radar image. The method is based on enforcing mathematical consistency between the frequency distribution of the image's pixel signals (histogram of DN values with suitable normalizations) and a one-dimensional frequency distribution of slope component, as might be obtained from a radar or laser altimetry profile in or near the area imaged. In order to achieve a unique solution, the auxiliary assumption is made that the two-dimensional frequency distribution of slope is isotropic. The backscatter is not derived in absolute units. The method is developed in such a way as to separate the reflectance function from the pixel-signal transfer characteristic. However, these two sources of variation are distinguishable only on the basis of a weak dependence on the azimuthal component of slope; therefore such an approach can be expected to be ill-conditioned unless the revision of the transfer characteristic is limited to the determination of an additive instrumental background level. The altimetry profile does not have to be registered in the image, and the statistical nature of the approach minimizes pixel noise effects and the effects of a disparity between the resolutions of the image and the altimetry profile, except in the wings of the distribution where low-number statistics preclude accuracy anyway. The problem of dealing with unknown slope components perpendicular to the profiling traverse, which besets the one-to-one comparison between individual slope components and pixel-signal values, disappears in the present approach. In order to test the resulting algorithm, an artificial radar image was generated from the digitized topographic map of the Lake Champlain West quadrangle in the Adirondack Mountains, U.S.A., using an arbitrarily selected reflectance function. From the same map, a one-dimensional frequency distribution of slope component was extracted. The algorithm recaptured the original reflectance function to the degree that, for the central 90% of the data, the discrepancy translates to a RMS slope error of 0.1 ???. For the central 99% of the data, the maximum error translates to 1 ???; at the absolute extremes of the data the error grows to 6 ???. ?? 1988 Kluwer Academic Publishers.

  13. Stable continuous-wave single-frequency Nd:YAG blue laser at 473 nm considering the influence of the energy-transfer upconversion.

    PubMed

    Wang, Yaoting; Liu, Jianli; Liu, Qin; Li, Yuanji; Zhang, Kuanshou

    2010-06-07

    We report a continuous-wave (cw) single frequency Nd:YAG blue laser at 473 nm end-pumped by a laser diode. A ring laser resonator was designed, the frequency doubling efficiency and the length of nonlinear crystal were optimized based on the investigation of the influence of the frequency doubling efficiency on the thermal lensing effect induced by energy-transfer upconversion. By intracavity frequency doubling with PPKTP crystal, an output power of 1 W all-solid-state cw blue laser of single-frequency operation was achieved. The stability of the blue output power was better than +/- 1.8% in the given four hours.

  14. (abstract) Precision Time and Frequency Transfer Utilizing SONET OC-3

    NASA Technical Reports Server (NTRS)

    Stein, Sam; Calhoun, Malcom; Kuhnle, Paul; Sydnor, Richard; Gifford, Al

    1996-01-01

    An innovative method of distributing precise time and reference frequency to users located several kilometers from a frequency standard and master clock has been developed by the Timing Solutions Corporation of Boulder, CO. The Optical Two-Way Time Transfer System (OTWTTS) utilizes a commercial SONET OC-3 facility interface to physically connect a master unit to multiple slave units at remote locations. Optical fiber is a viable alternative to standard copper cable and microwave transmission. This paper discusses measurements of frequency and timing stability over the OTWTTS.

  15. Development of pulsating twin jets mechanism for mixing flow heat transfer analysis.

    PubMed

    Gitan, Ali Ahmed; Zulkifli, Rozli; Abdullah, Shahrir; Sopian, Kamaruzzaman

    2014-01-01

    Pulsating twin jets mechanism (PTJM) was developed in the present work to study the effect of pulsating twin jets mixing region on the enhancement of heat transfer. Controllable characteristics twin pulsed jets were the main objective of our design. The variable nozzle-nozzle distance was considered to study the effect of two jets interaction at the mixing region. Also, the phase change between the frequencies of twin jets was taken into account to develop PTJM. All of these factors in addition to the ability of producing high velocity pulsed jet led to more appropriate design for a comprehensive study of multijet impingement heat transfer problems. The performance of PTJM was verified by measuring the pulse profile at frequency of 20 Hz, where equal velocity peak of around 64 m/s for both jets was obtained. Moreover, the jet velocity profile at different pulsation frequencies was tested to verify system performance, so the results revealed reasonable velocity profile configuration. Furthermore, the effect of pulsation frequency on surface temperature of flat hot plate in the midpoint between twin jets was studied experimentally. Noticeable enhancement in heat transfer was obtained with the increasing of pulsation frequency.

  16. Development of Pulsating Twin Jets Mechanism for Mixing Flow Heat Transfer Analysis

    PubMed Central

    Abdullah, Shahrir

    2014-01-01

    Pulsating twin jets mechanism (PTJM) was developed in the present work to study the effect of pulsating twin jets mixing region on the enhancement of heat transfer. Controllable characteristics twin pulsed jets were the main objective of our design. The variable nozzle-nozzle distance was considered to study the effect of two jets interaction at the mixing region. Also, the phase change between the frequencies of twin jets was taken into account to develop PTJM. All of these factors in addition to the ability of producing high velocity pulsed jet led to more appropriate design for a comprehensive study of multijet impingement heat transfer problems. The performance of PTJM was verified by measuring the pulse profile at frequency of 20 Hz, where equal velocity peak of around 64 m/s for both jets was obtained. Moreover, the jet velocity profile at different pulsation frequencies was tested to verify system performance, so the results revealed reasonable velocity profile configuration. Furthermore, the effect of pulsation frequency on surface temperature of flat hot plate in the midpoint between twin jets was studied experimentally. Noticeable enhancement in heat transfer was obtained with the increasing of pulsation frequency. PMID:24672370

  17. Molecular Electronic Angular Motion Transducer Broad Band Self-Noise

    PubMed Central

    Zaitsev, Dmitry; Agafonov, Vadim; Egorov, Egor; Antonov, Alexander; Shabalina, Anna

    2015-01-01

    Modern molecular electronic transfer (MET) angular motion sensors combine high technical characteristics with low cost. Self-noise is one of the key characteristics which determine applications for MET sensors. However, until the present there has not been a model describing the sensor noise in the complete operating frequency range. The present work reports the results of an experimental study of the self-noise level of such sensors in the frequency range of 0.01–200 Hz. Based on the experimental data, a theoretical model is developed. According to the model, self-noise is conditioned by thermal hydrodynamic fluctuations of the operating fluid flow in the frequency range of 0.01–2 Hz. At the frequency range of 2–100 Hz, the noise power spectral density has a specific inversely proportional dependence of the power spectral density on the frequency that could be attributed to convective processes. In the high frequency range of 100–200 Hz, the noise is conditioned by the voltage noise of the electronics module input stage operational amplifiers and is heavily reliant to the sensor electrical impedance. The presented results allow a deeper understanding of the molecular electronic sensor noise nature to suggest the ways to reduce it. PMID:26610502

  18. Imaging of endogenous exchangeable proton signals in the human brain using frequency labeled exchange transfer imaging.

    PubMed

    Yadav, Nirbhay N; Jones, Craig K; Hua, Jun; Xu, Jiadi; van Zijl, Peter C M

    2013-04-01

    To image endogenous exchangeable proton signals in the human brain using a recently reported method called frequency labeled exchange transfer (FLEX) MRI. As opposed to labeling exchangeable protons using saturation (i.e., chemical exchange saturation transfer, or CEST), FLEX labels exchangeable protons with their chemical shift evolution. The use of short high-power frequency pulses allows more efficient labeling of rapidly exchanging protons, while time domain acquisition allows removal of contamination from semi-solid magnetization transfer effects. FLEX-based exchangeable proton signals were detected in human brain over the 1-5 ppm frequency range from water. Conventional magnetization transfer contrast and the bulk water signal did not interfere in the FLEX spectrum. The information content of these signals differed from in vivo CEST data in that the average exchange rate of these signals was 350-400 s(-1) , much faster than the amide signal usually detected using direct saturation (∼30 s(-1) ). Similarly, fast exchanging protons could be detected in egg white in the same frequency range where amide and amine protons of mobile proteins and peptides are known to resonate. FLEX MRI in the human brain preferentially detects more rapidly exchanging amide/amine protons compared to traditional CEST experiments, thereby changing the information content of the exchangeable proton spectrum. This has the potential to open up different types of endogenous applications as well as more easy detection of rapidly exchanging protons in diaCEST agents or fast exchanging units such as water molecules in paracest agents without interference of conventional magnetization transfer contrast. Copyright © 2013 Wiley Periodicals, Inc.

  19. Investigation of mass transfer intensification under power ultrasound irradiation using 3D computational simulation: A comparative analysis.

    PubMed

    Sajjadi, Baharak; Asgharzadehahmadi, Seyedali; Asaithambi, Perumal; Raman, Abdul Aziz Abdul; Parthasarathy, Rajarathinam

    2017-01-01

    This paper aims at investigating the influence of acoustic streaming induced by low-frequency (24kHz) ultrasound irradiation on mass transfer in a two-phase system. The main objective is to discuss the possible mass transfer improvements under ultrasound irradiation. Three analyses were conducted: i) experimental analysis of mass transfer under ultrasound irradiation; ii) comparative analysis between the results of the ultrasound assisted mass transfer with that obtained from mechanically stirring; and iii) computational analysis of the systems using 3D CFD simulation. In the experimental part, the interactive effects of liquid rheological properties, ultrasound power and superficial gas velocity on mass transfer were investigated in two different sonicators. The results were then compared with that of mechanical stirring. In the computational part, the results were illustrated as a function of acoustic streaming behaviour, fluid flow pattern, gas/liquid volume fraction and turbulence in the two-phase system and finally the mass transfer coefficient was specified. It was found that additional turbulence created by ultrasound played the most important role on intensifying the mass transfer phenomena compared to that in stirred vessel. Furthermore, long residence time which depends on geometrical parameters is another key for mass transfer. The results obtained in the present study would help researchers understand the role of ultrasound as an energy source and acoustic streaming as one of the most important of ultrasound waves on intensifying gas-liquid mass transfer in a two-phase system and can be a breakthrough in the design procedure as no similar studies were found in the existing literature. Copyright © 2016. Published by Elsevier B.V.

  20. Transferable Drug Resistance in Pseudomonas aeruginosa1

    PubMed Central

    Bryan, L. E.; Elzen, H. M. Van Den; Tseng, Jui Teng

    1972-01-01

    Three strains of Pseudomonas aeruginosa were demonstrated to transfer double-drug resistance by conjugation to a P. aeruginosa recipient at frequencies of 10−4 to 10−2 per recipient cell. Two of the three strains also transferred to Escherichia coli at frequencies which were 103- to 105-fold lower, but the third strain could not be demonstrated to do so. The latter strain, however, conferred maleness on the Pseudomonas recipient. The transfer of streptomycin resistance was associated with the acquisition of streptomycin phosphorylase by both P. aeruginosa and E. coli recipients. Maximal broth mating frequencies were obtained with nonagitated cultures less than 1 mm in depth. A pyocine selection system based on donor sensitivity and recipient resistance is described and appears to have future value as a generalized selective device for use after matings. PMID:4207756

  1. Time and Frequency Activities at the U.S. Naval Observatory

    DTIC Science & Technology

    2007-11-01

    Institute of Navigation, Alexandria, Virginia). [21] D. Kirchner, 1999, “Two Way Satellite Time and Frequency Transfer ( TWSTFT ),” Review of Radio Science...Transfer ( TWSTFT ),” in Proceedings of the 36th Annual Precise Time and Time Interval (PTTI) Systems and Applications Meeting, 7-9 December 2004

  2. Time and Frequency Activities at the National Physical Laboratory

    DTIC Science & Technology

    1999-12-01

    TWSTFT ) time transfers are routinely forwarded to BIPM. The TWSTFT and GPS common-view measurements are used in the calculation of TAI. During recent...accuracy time and frequency dissemination methods in the UK. Two-Way Satellite Time and Frequency Transfer ( TWSTFT ) has been under development at NPL...since 1992, and regular TWSTFT sessions began in 1993. NPL was heavily involved in the early TWSTFT work, in particular studies of closing errors

  3. Influence of shielding gas pressure on welding characteristics in CO2 laser-MIG hybrid welding process

    NASA Astrophysics Data System (ADS)

    Chen, Yanbin; Lei, Zhenglong; Li, Liqun; Wu, Lin

    2006-01-01

    The droplet transfer behavior and weld characteristics have been investigated under different pressures of shielding gas in CO2 laser and metal inert/active gas (laser-MIG) hybrid welding process. The experimental results indicate that the inherent droplet transfer frequency and stable welding range of conventional MIG arc are changed due to the interaction between CO2 laser beam and MIG arc in laser-MIG hybrid welding process, and the shielding gas pressure has a crucial effect on welding characteristics. When the pressure of shielding gas is low in comparison with MIG welding, the frequency of droplet transfer decreases, and the droplet transfer becomes unstable in laser-MIG hybrid welding. So the penetration depth decreases, which shows the characteristic of unstable hybrid welding. However, when the pressure of shielding gas increases to a critical value, the hybrid welding characteristic is changed from unstable hybrid welding to stable hybrid welding, and the frequency of droplet transfer and the penetration depth increase significantly.

  4. Underlying neural alpha frequency patterns associated with intra-hemispheric inhibition during an interhemispheric transfer task.

    PubMed

    Simon-Dack, Stephanie L; Kraus, Brian; Walter, Zachary; Smith, Shelby; Cadle, Chelsea

    2018-05-18

    Interhemispheric transfer measured via differences in right- or left-handed motoric responses to lateralized visual stimuli, known as the crossed-uncrossed difference (CUD), is one way of identifying patterns of processing that are vital for understanding the transfer of neural signals. Examination of interhemispheric transfer by means of the CUD is not entirely explained by simple measures of response time. Multiple processes contribute to wide variability observed in CUD reaction times. Prior research has suggested that intra-hemispheric inhibitory processes may be involved in regulation of speed of transfer. Our study examined electroencephalography recordings and time-locked alpha frequency activity while 18 participants responded to lateralized targets during performance of the Poffenberger Paradigm. Our results suggest that there are alpha frequency differences at fronto-central lateral electrodes based on target, hand-of-response, and receiving hemisphere. These findings suggest that early motoric inhibitory mechanisms may help explain the wide range of variability typically seen with the CUD. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Reducing injection loss in drill strings

    DOEpatents

    Drumheller, Douglas S.

    2004-09-14

    A system and method for transferring wave energy into or out of a periodic structure having a characteristic wave impedance profile at a prime frequency, the characteristic wave impedance profile comprising a real portion and an imaginary portion, comprising: locating one or more energy transfer elements each having a wave impedance at the prime frequency approximately equal to the real portion of the characteristic wave impedance at one or more points on the periodic structure with the imaginary portion approximately equaling zero; and employing the one or more energy transfer elements to transfer wave energy into or out of the periodic structure. The energy transfer may be repeaters. Quarter-wave transformers can be provided at one or more points on the periodic structure with the imaginary portion approximately equaling zero to transmit waves across one or more discontinuities. A terminator can be employed for cancellation of waves. The invention substantially eliminates reflections of the wave energy at the prime frequency by joints between sections of the periodic structure.

  6. Numerical Simulation of Flow and Heat Transfer Characteristic of 4k Regenerators at High Frequency

    NASA Astrophysics Data System (ADS)

    Li, Zhuopei; Jiang, Yanlong; Gan, Zhihua; Qiu, Limin

    Regenerator is a key component for all regenerative cryocoolers. 4K regenerative cryocoolers can be applied to provide cooling for low temperature superconductors, space and military infrared detectors, and medical examination etc. Stirling type pulse tube cryocoolers (SPTC), one type of regenerative cryocoolers, operate at high frequencies. As a result, SPTCs have the advantage of compact structure and low weight compared with G-M type pulse tube cryocoolers operating at low frequencies. However, as the frequency increase the thermal penetration depth of helium gas in the regenerator is greatly reduced which makes the heat transfer between the gas and the regenerator worse. In order to improve the heat transfer efficiency, regenerator materials with smaller hydraulic diameters are used. Therefore the flow resistance between the gas and the regenerator material will increase leading to larger pressure drop from the hot end to the cold end of the regenerator. The cooling performance is deteriorated due to the decreased pressure ratio (maximum pressure divided by minimum pressure) at the cold end. Also, behavior of helium at 4K deviates remarkably from that of ideal gas which has a significant influence both the flow and heat transfer characteristic within a regenerator. In this paper numerical simulation on the behavior of a 4K regenerator at high frequency is carried out to provide guidance for the optimization of the flow and heat transfer performance within a regenerator. Thermodynamic analysis of effect of the non-ideal gas behavior of helium at 4K on 4K regenerator at high frequency is investigated.

  7. Vibrational tug-of-war: The pKA dependence of the broad vibrational features of strongly hydrogen-bonded carboxylic acids

    NASA Astrophysics Data System (ADS)

    Van Hoozen, Brian L.; Petersen, Poul B.

    2018-04-01

    Medium and strong hydrogen bonds give rise to broad vibrational features frequently spanning several hundred wavenumbers and oftentimes exhibiting unusual substructures. These broad vibrational features can be modeled from first principles, in a reduced dimensional calculation, that adiabatically separates low-frequency modes, which modulate the hydrogen bond length, from high-frequency OH stretch and bend modes that contribute to the vibrational structure. Previously this method was used to investigate the origin of an unusual vibrational feature frequently found in the spectra of dimers between carboxylic acids and nitrogen-containing aromatic bases that spans over 900 cm-1 and contains two broad peaks. It was found that the width of this feature largely originates from low-frequency modes modulating the hydrogen bond length and that the structure results from Fermi resonance interactions. In this report, we examine how these features change with the relative acid and base strength of the components as reflected by their aqueous pKA values. Dimers with large pKA differences are found to have features that can extend to frequencies below 1000 cm-1. The relationships between mean OH/NH frequency, aqueous pKA, and O-N distance are examined in order to obtain a more rigorous understanding of the origin and shape of the vibrational features. The mean OH/NH frequencies are found to correlate well with O-N distances. The lowest OH stretch frequencies are found in dimer geometries with O-N distances between 2.5 and 2.6 Å. At larger O-N distances, the hydrogen bonding interaction is not as strong, resulting in higher OH stretch frequencies. When the O-N distance is smaller than 2.5 Å, the limited space between the O and N determines the OH stretch frequency, which gives rise to frequencies that decrease with O-N distances. These two effects place a lower limit on the OH stretch frequency which is calculated to be near 700 cm-1. Understanding how the vibrational features of strongly hydrogen-bonded structures depend on the relative pKA and other structural parameters will guide studies of biological structures and analysis of proton transfer studies using photoacids.

  8. Resonant-cavity antenna for plasma heating

    DOEpatents

    Perkins, F.W. Jr.; Chiu, S.C.; Parks, P.; Rawls, J.M.

    1984-01-10

    This invention relates generally to a method and apparatus for transferring energy to a plasma immersed in a magnetic field, and relates particularly to an apparatus for heating a plasma of low atomic number ions to high temperatures by transfer of energy to plasma resonances, particularly the fundamental and harmonics of the ion cyclotron frequency of the plasma ions. This invention transfers energy from an oscillating radio-frequency field to a plasma resonance of a plasma immersed in a magnetic field.

  9. On Optimizing the Configuration of Time-Transfer Links Used to Generate TAI

    DTIC Science & Technology

    2007-01-01

    TAI be generated through combinations of Two Way Satellite Time and Frequency Transfer ( TWSTFT ) links and GPS links. It is assumed that Study Group I...the lack of low-noise connectivity between the Asian and American-European TWSTFT links may require two pivot sites instead of one. We recommend...band Two Way Satellite Time and Frequency Transfer ( TWSTFT ), and X-band TWSTFT [1]. In order to improve TAI-generation, the BIPM Time Section asked

  10. Dynamics of magnetization in ferromagnet with spin-transfer torque

    NASA Astrophysics Data System (ADS)

    Li, Zai-Dong; He, Peng-Bin; Liu, Wu-Ming

    2014-11-01

    We review our recent works on dynamics of magnetization in ferromagnet with spin-transfer torque. Driven by constant spin-polarized current, the spin-transfer torque counteracts both the precession driven by the effective field and the Gilbert damping term different from the common understanding. When the spin current exceeds the critical value, the conjunctive action of Gilbert damping and spin-transfer torque leads naturally the novel screw-pitch effect characterized by the temporal oscillation of domain wall velocity and width. Driven by space- and time-dependent spin-polarized current and magnetic field, we expatiate the formation of domain wall velocity in ferromagnetic nanowire. We discuss the properties of dynamic magnetic soliton in uniaxial anisotropic ferromagnetic nanowire driven by spin-transfer torque, and analyze the modulation instability and dark soliton on the spin wave background, which shows the characteristic breather behavior of the soliton as it propagates along the ferromagnetic nanowire. With stronger breather character, we get the novel magnetic rogue wave and clarify its formation mechanism. The generation of magnetic rogue wave mainly arises from the accumulation of energy and magnons toward to its central part. We also observe that the spin-polarized current can control the exchange rate of magnons between the envelope soliton and the background, and the critical current condition is obtained analytically. At last, we have theoretically investigated the current-excited and frequency-adjusted ferromagnetic resonance in magnetic trilayers. A particular case of the perpendicular analyzer reveals that the ferromagnetic resonance curves, including the resonant location and the resonant linewidth, can be adjusted by changing the pinned magnetization direction and the direct current. Under the control of the current and external magnetic field, several magnetic states, such as quasi-parallel and quasi-antiparallel stable states, out-of-plane precession, and bistable states can be realized. The precession frequency can be expressed as a function of the current and external magnetic field.

  11. Simulations of string vibrations with boundary conditions of third kind using the functional transformation method

    NASA Astrophysics Data System (ADS)

    Trautmann, L.; Petrausch, S.; Bauer, M.

    2005-09-01

    The functional transformation method (FTM) is an established mathematical method for accurate simulation of multidimensional physical systems from various fields of science, including optics, heat and mass transfer, electrical engineering, and acoustics. It is a frequency-domain method based on the decomposition into eigenvectors and eigenfrequencies of the underlying physical problem. In this article, the FTM is applied to real-time simulations of vibrating strings which are ideally fixed at one end while the fixing at the other end is modeled by a frequency-dependent input impedance. Thus, boundary conditions of third kind are applied to the model at the end fixed with the input impedance. It is shown that accurate and stable simulations are achieved with nearly the same computational cost as with strings ideally fixed at both ends.

  12. Frequency dependence of sensitivities in second-order RC active filters

    NASA Astrophysics Data System (ADS)

    Kunieda, T.; Hiramatsu, Y.; Fukui, A.

    1980-02-01

    This paper presents that gain and phase sensitivities to some element in biquadratic filters approximately constitute a circle on the complex sensitivity plane, provided that the quality factor Q of the circuit is appreciably larger than unity. Moreover, the group delay sensitivity is represented by the imaginary part of a cardioid. Using these results, bounds of maximum values of gain, phase, and group delay sensitivities are obtained. Further, it is proved that the maximum values of these sensitivities can be simultaneously minimized by minimizing the absolute value of the transfer function sensitivity at the center frequency provided that w(0)-sensitivities are constant and do not contain design parameters. Next, a statistical variability measure for the optimal-filter design is proposed. Finally, the relation between some variability measures proposed to the present time is made clear.

  13. Optimum conditions for producing Cs2 molecular condensates by stimulated Raman adiabatic passage

    NASA Astrophysics Data System (ADS)

    Feng, Zhifang; Li, Weidong; Wang, Lirong; Xiao, Liantuan; Jia, Suotang

    2009-10-01

    The optimum conditions for producing Cs2 molecular condensates from Cs atomic condensates with high transfer efficiency by stimulated Raman adiabatic passage are presented. Under the extended “two-photon” resonance condition, including the two-photon process, the mean-field correction, and the tunneling coupling between two upper excited molecular levels, a high and stable conversion efficiency is realized. The high conversion efficiency could be achieved by following two methods under experimentally less demanding conditions (relatively small effective Rabi frequency for pump laser pulse). One is adjusting the detuning difference between two laser pulses for same effective Rabi frequencies with up to 87.2% transfer efficiency. Another one is adjusting the effective Rabi frequency, the detuning of dump laser for given effective Rabi frequency, and the detuning of pump laser with up to 80.7% transfer efficiency.

  14. Frequency-Rank Distributions

    ERIC Educational Resources Information Center

    Brookes, Bertram C.; Griffiths, Jose M.

    1978-01-01

    Frequency, rank, and frequency rank distributions are defined. Extensive discussion on several aspects of frequency rank distributions includes the Poisson process as a means of exploring the stability of ranks; the correlation of frequency rank distributions; and the transfer coefficient, a new measure in frequency rank distribution. (MBR)

  15. Thermal noise limit for ultra-high vacuum noncontact atomic force microscopy

    PubMed Central

    Lübbe, Jannis; Temmen, Matthias; Rode, Sebastian; Rahe, Philipp; Kühnle, Angelika

    2013-01-01

    Summary The noise of the frequency-shift signal Δf in noncontact atomic force microscopy (NC-AFM) consists of cantilever thermal noise, tip–surface-interaction noise and instrumental noise from the detection and signal processing systems. We investigate how the displacement-noise spectral density d z at the input of the frequency demodulator propagates to the frequency-shift-noise spectral density d Δ f at the demodulator output in dependence of cantilever properties and settings of the signal processing electronics in the limit of a negligible tip–surface interaction and a measurement under ultrahigh-vacuum conditions. For a quantification of the noise figures, we calibrate the cantilever displacement signal and determine the transfer function of the signal-processing electronics. From the transfer function and the measured d z, we predict d Δ f for specific filter settings, a given level of detection-system noise spectral density d z ds and the cantilever-thermal-noise spectral density d z th. We find an excellent agreement between the calculated and measured values for d Δ f. Furthermore, we demonstrate that thermal noise in d Δ f, defining the ultimate limit in NC-AFM signal detection, can be kept low by a proper choice of the cantilever whereby its Q-factor should be given most attention. A system with a low-noise signal detection and a suitable cantilever, operated with appropriate filter and feedback-loop settings allows room temperature NC-AFM measurements at a low thermal-noise limit with a significant bandwidth. PMID:23400758

  16. Thermal noise limit for ultra-high vacuum noncontact atomic force microscopy.

    PubMed

    Lübbe, Jannis; Temmen, Matthias; Rode, Sebastian; Rahe, Philipp; Kühnle, Angelika; Reichling, Michael

    2013-01-01

    The noise of the frequency-shift signal Δf in noncontact atomic force microscopy (NC-AFM) consists of cantilever thermal noise, tip-surface-interaction noise and instrumental noise from the detection and signal processing systems. We investigate how the displacement-noise spectral density d(z) at the input of the frequency demodulator propagates to the frequency-shift-noise spectral density d(Δ) (f) at the demodulator output in dependence of cantilever properties and settings of the signal processing electronics in the limit of a negligible tip-surface interaction and a measurement under ultrahigh-vacuum conditions. For a quantification of the noise figures, we calibrate the cantilever displacement signal and determine the transfer function of the signal-processing electronics. From the transfer function and the measured d(z), we predict d(Δ) (f) for specific filter settings, a given level of detection-system noise spectral density d(z) (ds) and the cantilever-thermal-noise spectral density d(z) (th). We find an excellent agreement between the calculated and measured values for d(Δ) (f). Furthermore, we demonstrate that thermal noise in d(Δ) (f), defining the ultimate limit in NC-AFM signal detection, can be kept low by a proper choice of the cantilever whereby its Q-factor should be given most attention. A system with a low-noise signal detection and a suitable cantilever, operated with appropriate filter and feedback-loop settings allows room temperature NC-AFM measurements at a low thermal-noise limit with a significant bandwidth.

  17. Carrier-Envelope Phase Effect on Atomic Excitation by Few-Cycle rf Pulses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li Hebin; Welch, George R.; Sautenkov, Vladimir A.

    2010-03-12

    We present an experimental and theoretical study of the carrier-envelope phase effects on population transfer between two bound atomic states interacting with intense ultrashort pulses. Radio frequency pulses are used to transfer population among the ground state hyperfine levels in rubidium atoms. These pulses are only a few cycles in duration and have Rabi frequencies of the order of the carrier frequency. The phase difference between the carrier and the envelope of the pulses has a significant effect on the excitation of atomic coherence and population transfer. We provide a theoretical description of this phenomenon using density matrix equations. Wemore » discuss the implications and possible applications of our results.« less

  18. Ensuring correct rollback recovery in distributed shared memory systems

    NASA Technical Reports Server (NTRS)

    Janssens, Bob; Fuchs, W. Kent

    1995-01-01

    Distributed shared memory (DSM) implemented on a cluster of workstations is an increasingly attractive platform for executing parallel scientific applications. Checkpointing and rollback techniques can be used in such a system to allow the computation to progress in spite of the temporary failure of one or more processing nodes. This paper presents the design of an independent checkpointing method for DSM that takes advantage of DSM's specific properties to reduce error-free and rollback overhead. The scheme reduces the dependencies that need to be considered for correct rollback to those resulting from transfers of pages. Furthermore, in-transit messages can be recovered without the use of logging. We extend the scheme to a DSM implementation using lazy release consistency, where the frequency of dependencies is further reduced.

  19. Assessing the sensitivity of a land-surface scheme to the parameter values using a single column model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pitman, A.J.

    The sensitivity of a land-surface scheme (the Biosphere Atmosphere Transfer Scheme, BATS) to its parameter values was investigated using a single column model. Identifying which parameters were important in controlling the turbulent energy fluxes, temperature, soil moisture, and runoff was dependent upon many factors. In the simulation of a nonmoisture-stressed tropical forest, results were dependent on a combination of reservoir terms (soil depth, root distribution), flux efficiency terms (roughness length, stomatal resistance), and available energy (albedo). If moisture became limited, the reservoir terms increased in importance because the total fluxes predicted depended on moisture availability and not on the ratemore » of transfer between the surface and the atmosphere. The sensitivity shown by BATS depended on which vegetation type was being simulated, which variable was used to determine sensitivity, the magnitude and sign of the parameter change, the climate regime (precipitation amount and frequency), and soil moisture levels and proximity to wilting. The interactions between these factors made it difficult to identify the most important parameters in BATS. Therefore, this paper does not argue that a particular set of parameters is important in BATS, rather it shows that no general ranking of parameters is possible. It is also emphasized that using `stand-alone` forcing to examine the sensitivity of a land-surface scheme to perturbations, in either parameters or the atmosphere, is unreliable due to the lack of surface-atmospheric feedbacks.« less

  20. Modeling of high‐frequency seismic‐wave scattering and propagation using radiative transfer theory

    USGS Publications Warehouse

    Zeng, Yuehua

    2017-01-01

    This is a study of the nonisotropic scattering process based on radiative transfer theory and its application to the observation of the M 4.3 aftershock recording of the 2008 Wells earthquake sequence in Nevada. Given a wide range of recording distances from 29 to 320 km, the data provide a unique opportunity to discriminate scattering models based on their distance‐dependent behaviors. First, we develop a stable numerical procedure to simulate nonisotropic scattering waves based on the 3D nonisotropic scattering theory proposed by Sato (1995). By applying the simulation method to the inversion of M 4.3 Wells aftershock recordings, we find that a nonisotropic scattering model, dominated by forward scattering, provides the best fit to the observed high‐frequency direct S waves and S‐wave coda velocity envelopes. The scattering process is governed by a Gaussian autocorrelation function, suggesting a Gaussian random heterogeneous structure for the Nevada crust. The model successfully explains the common decay of seismic coda independent of source–station locations as a result of energy leaking from multiple strong forward scattering, instead of backscattering governed by the diffusion solution at large lapse times. The model also explains the pulse‐broadening effect in the high‐frequency direct and early arriving S waves, as other studies have found, and could be very important to applications of high‐frequency wave simulation in which scattering has a strong effect. We also find that regardless of its physical implications, the isotropic scattering model provides the same effective scattering coefficient and intrinsic attenuation estimates as the forward scattering model, suggesting that the isotropic scattering model is still a viable tool for the study of seismic scattering and intrinsic attenuation coefficients in the Earth.

  1. Localized surface plasmon mediated energy transfer in the vicinity of core-shell nanoparticle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shishodia, Manmohan Singh, E-mail: manmohan@gbu.ac.in; Juneja, Soniya

    2016-05-28

    Multipole spectral expansion based theory of energy transfer interactions between a donor and an acceptor molecule in the vicinity of a core-shell (nanoshell or core@shell) based plasmonic nanostructure is developed. In view of the diverse applications and rich plasmonic features such as tuning capability of surface plasmon (SP) frequencies, greater sensitivity to the change of dielectric environment, controllable redirection of electromagnetic radiation, closed form expressions for Energy Transfer Rate Enhancement Factor (ETREF) near core-shell particle are reported. The dependence of ETREF on different parameters is established through fitting equations, perceived to be of key importance for developing appropriate designs. Themore » theoretical approach developed in the present work is capable of treating higher order multipoles, which, in turn, are also shown to play a crucial role in the present context. Moreover, closed form expressions derived in the present work can directly be used as formula, e.g., for designing SP based biosensors and estimating energy exchange between proteins and excitonic interactions in quantum dots.« less

  2. Improving Spelling of High Frequency Words for Transfer in Written Work

    ERIC Educational Resources Information Center

    DuBois, Kathleen; Erickson, Kristie; Jacobs, Monica

    2007-01-01

    This project describes a 12-week program developed to improve student spelling of high frequency words for transfer in written work across the curriculum. The targeted population consists of kindergarten, first, and third graders in two public elementary schools in a community located in central Illinois. Following an extensive literature review,…

  3. Optical frequency transfer via a 660 km underground fiber link using a remote Brillouin amplifier.

    PubMed

    Raupach, S M F; Koczwara, A; Grosche, G

    2014-11-03

    In long-distance, optical continuous-wave frequency transfer via fiber, remote bidirectional Er³ ⁺ -doped fiber amplifiers are commonly used to mitigate signal attenuation. We demonstrate for the first time the ultrastable transfer of an optical frequency using a remote fiber Brillouin amplifier, placed in a server room along the link. Using it as the only means of remote amplification, on a 660 km loop of installed underground fiber we bridge distances of 250 km and 160 km between amplifications. Over several days of uninterrupted measurement, we find an instability of the frequency transfer (Allan deviation of Λ-weighted data with 1 s gate time) of around 1 × 10(-19) and less for averaging times longer than 3000 s. The modified Allan deviation reaches 3 × 10(-19) at an averaging time of 100 s. Beyond 100 s it follows the interferometer noise floor, and for averaging times longer than 1000 s the modified Allan deviation is in the 10(-20) range. A conservative value of the overall accuracy is 1 × 10(-19)

  4. Efficient dynamic coherence transfer relying on offset locking using optical phase-locked loop

    NASA Astrophysics Data System (ADS)

    Xie, Weilin; Dong, Yi; Bretenaker, Fabien; Shi, Hongxiao; Zhou, Qian; Xia, Zongyang; Qin, Jie; Zhang, Lin; Lin, Xi; Hu, Weisheng

    2018-01-01

    We design and experimentally demonstrate a highly efficient coherence transfer based on composite optical phaselocked loop comprising multiple feedback servo loops. The heterodyne offset-locking is achieved by conducting an acousto-optic frequency shifter in combination with the current tuning and the temperature controlling of the semiconductor laser. The adaptation of the composite optical phase-locked loop enables the tight coherence transfer from a frequency comb to a semiconductor laser in a fully dynamic manner.

  5. Signal Delay-Stability of a Ku-Band Two-Way Satellite Time Transfer Terminal

    DTIC Science & Technology

    1995-12-01

    Robnik Space Research Institute, Graz, Austria Abstract A filly automated huo-way time and frequency transfer ( TWSTFT ) system including a sateme...station. Such a system has been operated for longer than a year together with the two-way satellite time and frequency transfer ( TWSTFT ) station of...accuracy. MEASUREMENT SETUP A detailed description of the TWSTFT system used at TUG is given in [I]. The SATSIM used is of the de Jong type13,41 - this

  6. Phage-inducible chromosomal islands are ubiquitous within the bacterial universe.

    PubMed

    Fillol-Salom, Alfred; Martínez-Rubio, Roser; Abdulrahman, Rezheen F; Chen, John; Davies, Robert; Penadés, José R

    2018-06-06

    Phage-inducible chromosomal islands (PICIs) are a recently discovered family of pathogenicity islands that contribute substantively to horizontal gene transfer, host adaptation and virulence in Gram-positive cocci. Here we report that similar elements also occur widely in Gram-negative bacteria. As with the PICIs from Gram-positive cocci, their uniqueness is defined by a constellation of features: unique and specific attachment sites, exclusive PICI genes, a phage-dependent mechanism of induction, conserved replication origin organization, convergent mechanisms of phage interference, and specific packaging of PICI DNA into phage-like infectious particles, resulting in very high transfer frequencies. We suggest that the PICIs represent two or more distinct lineages, have spread widely throughout the bacterial world, and have diverged much more slowly than their host organisms or their prophage cousins. Overall, these findings represent the discovery of a universal class of mobile genetic elements.

  7. Robust entanglement between a movable mirror and atomic ensemble and entanglement transfer in coupled optomechanical system

    PubMed Central

    Bai, Cheng-Hua; Wang, Dong-Yang; Wang, Hong-Fu; Zhu, Ai-Dong; Zhang, Shou

    2016-01-01

    We propose a scheme for the creation of robust entanglement between a movable mirror and atomic ensemble at the macroscopic level in coupled optomechanical system. We numerically simulate the degree of entanglement of the bipartite macroscopic entanglement and show that it depends on the coupling strength between the cavities and is robust with respect to the certain environment temperature. Inspiringly and surprisingly, according to the reported relation between the mechanical damping rate and the mechanical frequency of the movable mirror, the numerical simulation result shows that such bipartite macroscopic entanglement persists for environment temperature up to 170 K, which breaks the liquid nitrogen cooling and liquid helium cooling and largely lowers down the experiment cost. We also investigate the entanglement transfer based on this coupled system. The scheme can be used for the realization of quantum memories for continuous variable quantum information processing and quantum-limited displacement measurements. PMID:27624534

  8. Spectral Attenuation of Sound in Dilute Suspensions with Nonlinear Particle Relaxation

    NASA Technical Reports Server (NTRS)

    Kandula, M.; Lonegran, M.

    2008-01-01

    Theoretical studies on the dissipation and dispersion of sound in two-phase suspensions have been briefly reviewed. Previous studies on the sound attenuation in particle-laden flows under Stokesian drag and conduction-controlled heat transfer have been extended to accommodate the nonlinear drag and heat transfer. It has been shown that for large particle-to-fluid density ratio, the particle Reynolds number bears a cubic relationship with Omega Tau(sub d) (where Omega is the circular frequency and Tau(sub d) the Stokesian particle relaxation time). This dependence leads to the existence of a peak value in the linear absorption coefficient occurring at a finite value Omega Tau (sub d). Comparison of the predictions with the test data for the spectral attenuation of sound with water injection in a perfectly expanded supersonic air jet shows a satisfactory trend of the theory accounting for nonlinear particle relaxation processes.

  9. First-principles spin-transfer torque in CuMnAs |GaP |CuMnAs junctions

    NASA Astrophysics Data System (ADS)

    Stamenova, Maria; Mohebbi, Razie; Seyed-Yazdi, Jamileh; Rungger, Ivan; Sanvito, Stefano

    2017-02-01

    We demonstrate that an all-antiferromagnetic tunnel junction with current perpendicular to the plane geometry can be used as an efficient spintronic device with potential high-frequency operation. By using state-of-the-art density functional theory combined with quantum transport, we show that the Néel vector of the electrodes can be manipulated by spin-transfer torque. This is staggered over the two different magnetic sublattices and can generate dynamics and switching. At the same time the different magnetization states of the junction can be read by standard tunneling magnetoresistance. Calculations are performed for CuMnAs |GaP |CuMnAs junctions with different surface terminations between the antiferromagnetic CuMnAs electrodes and the insulating GaP spacer. We find that the torque remains staggered regardless of the termination, while the magnetoresistance depends on the microscopic details of the interface.

  10. Theoretical linear approach to the combined man-manipulator system in manual control of an aircraft

    NASA Technical Reports Server (NTRS)

    Brauser, K.

    1981-01-01

    An approach to the calculation of the dynamic characteristics of the combined man manipulator system in manual aircraft control was derived from a model of the neuromuscular system. This model combines the neuromuscular properties of man with the physical properties of the manipulator system which is introduced as pilot manipulator model into the manual aircraft control. The assumption of man as a quasilinear and time invariant control operator adapted to operating states, depending on the flight phases, of the control system gives rise to interesting solutions of the frequency domain transfer functions of both the man manipulator system and the closed loop pilot aircraft control system. It is shown that it is necessary to introduce the complete precision pilot manipulator model into the closed loop pilot aircraft transfer function in order to understand the well known handling quality criteria, and to derive these criteria directly from human operator properties.

  11. The application of dual-electrode through vial impedance spectroscopy for the determination of ice interface temperatures, primary drying rate and vial heat transfer coefficient in lyophilization process development.

    PubMed

    Smith, Geoff; Jeeraruangrattana, Yowwares; Ermolina, Irina

    2018-06-22

    Through vial impedance spectroscopy (TVIS) is a product non-invasive process analytical technology which exploits the frequency dependence of the complex impedance spectrum of a composite object (i.e. the freeze-drying vial and its contents) in order to track the progression of the freeze-drying cycle. This work demonstrates the use of a dual electrode system, attached to the external surface of a type I glass tubing vial (nominal capacity 10 mL) in the prediction of (i) the ice interface temperatures at the sublimation front and at the base of the vial, and (ii) the primary drying rate. A value for the heat transfer coefficient (for a chamber pressure of 270 µbar) was then calculated from these parameters and shown to be comparable to that published by Tchessalov[1]. Copyright © 2018. Published by Elsevier B.V.

  12. Photoexcitation of lasers and chemical reactions for NASA missions: A theoretical study. [optical pumping in high pressure gas

    NASA Technical Reports Server (NTRS)

    Javan, A.; Guerra, M.

    1981-01-01

    The possibility of obtaining CW laser oscillation by optical pumping in the infrared at an elevated gas pressure is reviewed. A specific example utilizing a mixture of CO and NO gases is included. The gas pressures considered are in excess of several atmospheres. Laser frequency tuning over a broad region becomes possible at such elevated gas pressures due to collisional broadening of the amplifying transitions. The prior-rate and surprisal analysis are applied to obtain detailed VV and VT rates for CO and NO molecules and the transfer rates in a CO-NO gas mixture. The analysis is capable of giving temperature dependence of the rate constants. Computer estimates of the rates are presented for vibrational levels up to v = 50. The results show that in the high-lying vibrational states the VV transfer rates with Delta nu = 2 become appreciable.

  13. VLBI and GPS-based Time-Transfer Using CONT08 Data

    NASA Technical Reports Server (NTRS)

    Rieck, Carsten; Haas, Ruediger; Jaldehag, Kenneth; Jahansson, Jan

    2010-01-01

    One important prerequisite for geodetic Very Long Baseline Interferometry (VLBI) is the use of frequency standards with excellent short term stability. This makes VLBI stations, which are often co-located with Global Navigation Satellite System (GNSS) receiving stations, interesting for studies of time- and frequency-transfer techniques. We present an assessment of VLBI time-transfer based on the data of the two week long consecutive IVS CONT08 VLBI campaign by using GPS Carrier Phase (GPSCP). CONT08 was a 15 day long campaign in August 2008 that involved eleven VLBI stations on five continents. For CONT08 we estimated the worst case VLBI frequency link stability between the stations of Onsala and Wettzell to 1e-15 at one day. Comparisons with GPSCP confirm the VLBI results. We also identify time-transfer related challenges of the VLBI technique as used today.

  14. Generation of constant-amplitude radio-frequency sweeps at a tunnel junction for spin resonance STM

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paul, William; Lutz, Christopher P.; Heinrich, Andreas J.

    2016-07-15

    We describe the measurement and successful compensation of the radio-frequency transfer function of a scanning tunneling microscope over a wide frequency range (15.5–35.5 GHz) and with high dynamic range (>50 dB). The precise compensation of cabling resonances and attenuations is critical for the production of constant-voltage frequency sweeps for electric-field driven electron spin resonance (ESR) experiments. We also demonstrate that a well-calibrated tunnel junction voltage is necessary to avoid spurious ESR peaks that can arise due to a non-flat transfer function.

  15. Monochromatic, Rosseland mean, and Planck mean opacity routine

    NASA Astrophysics Data System (ADS)

    Semenov, D.

    2006-11-01

    Several FORTRAN77 codes were developed to compute frequency-dependent, Rosseland and Planck mean opacities of gas and dust in protoplanetary disks. The opacities can be computed for an ensemble of dust grains having various compositions (ices, silicates, organics, etc), sizes, topologies (homogeneous/composite aggregates, homogeneous/layered/composite spheres, etc.), porosities, and dust-to-gas ratio. Several examples are available. In addition, a very fast opacity routine to be used in modeling of the radiative transfer in hydro simulations of disks is available upon request (10^8 routine calls require about 30s on Pentium 4 3.0GHz).

  16. Transfer path analysis: Current practice, trade-offs and consideration of damping

    NASA Astrophysics Data System (ADS)

    Oktav, Akın; Yılmaz, Çetin; Anlaş, Günay

    2017-02-01

    Current practice of experimental transfer path analysis is discussed in the context of trade-offs between accuracy and time cost. An overview of methods, which propose solutions for structure borne noise, is given, where assumptions, drawbacks and advantages of methods are stated theoretically. Applicability of methods is also investigated, where an engine induced structure borne noise of an automobile is taken as a reference problem. Depending on this particular problem, sources of measurement errors, processing operations that affect results and physical obstacles faced in the application are analysed. While an operational measurement is common in all stated methods, when it comes to removal of source, or the need for an external excitation, discrepancies are present. Depending on the chosen method, promised outcomes like independent characterisation of the source, or getting information about mounts also differ. Although many aspects of the problem are reported in the literature, damping and its effects are not considered. Damping effect is embedded in the measured complex frequency response functions, and it is needed to be analysed in the post processing step. Effects of damping, reasons and methods to analyse them are discussed in detail. In this regard, a new procedure, which increases the accuracy of results, is also proposed.

  17. Dendroclimatic transfer functions revisited: Little Ice Age and Medieval Warm Period summer temperatures reconstructed using artificial neural networks and linear algorithms

    NASA Astrophysics Data System (ADS)

    Helama, S.; Makarenko, N. G.; Karimova, L. M.; Kruglun, O. A.; Timonen, M.; Holopainen, J.; Meriläinen, J.; Eronen, M.

    2009-03-01

    Tree-rings tell of past climates. To do so, tree-ring chronologies comprising numerous climate-sensitive living-tree and subfossil time-series need to be "transferred" into palaeoclimate estimates using transfer functions. The purpose of this study is to compare different types of transfer functions, especially linear and nonlinear algorithms. Accordingly, multiple linear regression (MLR), linear scaling (LSC) and artificial neural networks (ANN, nonlinear algorithm) were compared. Transfer functions were built using a regional tree-ring chronology and instrumental temperature observations from Lapland (northern Finland and Sweden). In addition, conventional MLR was compared with a hybrid model whereby climate was reconstructed separately for short- and long-period timescales prior to combining the bands of timescales into a single hybrid model. The fidelity of the different reconstructions was validated against instrumental climate data. The reconstructions by MLR and ANN showed reliable reconstruction capabilities over the instrumental period (AD 1802-1998). LCS failed to reach reasonable verification statistics and did not qualify as a reliable reconstruction: this was due mainly to exaggeration of the low-frequency climatic variance. Over this instrumental period, the reconstructed low-frequency amplitudes of climate variability were rather similar by MLR and ANN. Notably greater differences between the models were found over the actual reconstruction period (AD 802-1801). A marked temperature decline, as reconstructed by MLR, from the Medieval Warm Period (AD 931-1180) to the Little Ice Age (AD 1601-1850), was evident in all the models. This decline was approx. 0.5°C as reconstructed by MLR. Different ANN based palaeotemperatures showed simultaneous cooling of 0.2 to 0.5°C, depending on algorithm. The hybrid MLR did not seem to provide further benefit above conventional MLR in our sample. The robustness of the conventional MLR over the calibration, verification and reconstruction periods qualified it as a reasonable transfer function for our forest-limit (i.e., timberline) dataset. ANN appears a potential tool for other environments and/or proxies having more complex and noisier climatic relationships.

  18. Limitations of STIRAP-like population transfer in extended systems: the three-level system embedded in a web of background states.

    PubMed

    Jakubetz, Werner

    2012-12-14

    This paper presents a systematic numerical investigation of background state participation in STIRAP (stimulated Raman-adiabatic passage) population transfer among vibrational states, focusing on the consequences for the robustness of the method. The simulations, which are performed over extended grids in the parameter space of the Stokes- and pump pulses (frequencies, field strengths, and pulse lengths), involve hierarchies of (3 + N)-level systems of increasing complexity, ranging from the standard three-level STIRAP setup, (N = 0) in Λ-configuration, up to N = 446. A strongly coupled three-level core system is selected from the full Hamiltonian of the double-well HCN∕HNC system, and the couplings connecting this core system to the remaining states are (re-) parameterized in different ways, from very weak to very strong. The systems so obtained represent a three-level system embedded in various ways in webs of cross-linked vibrational background states and incorporate typical molecular properties. We first summarize essential properties of population transfer in the standard three-level system and quantify the robustness of the method and its dependence on the pulse parameters. Against these reference results, we present results obtained for four (3 + 446)-level systems and several subsystems. For pulse lengths of at most few picoseconds the intrinsic robustness of STIRAP with respect to variations in the field strength disappears as soon as the largest core-background couplings exceed about one tenth of the STIRAP couplings. In such cases robustness with respect to variations in the field strength is entirely lost, since at higher field strengths, except for irregularly spaced narrow frequency ranges, transfer probabilities are strongly reduced. STIRAP-like population transfer is maintained, with some restrictions, at low field strengths near the onset of adiabatic transfer. The suppression of STIRAP is traced back to different mechanisms based on a plentitude of single- and multiphoton transitions to background states, which at the high field strengths characteristic for STIRAP proceed readily even along weakly coupled pathways.

  19. Prospects of Using High-Intensity THz Pulses To Induce Ultrafast Temperature-Jumps in Liquid Water.

    PubMed

    Mishra, Pankaj Kr; Bettaque, Vincent; Vendrell, Oriol; Santra, Robin; Welsch, Ralph

    2018-06-01

    Ultrashort, high-intensity terahertz (THz) pulses, e.g., generated at free-electron laser facilities, allow for direct investigation as well as the driving of intermolecular modes in liquids like water and thus will deepen our understanding of the hydrogen bonding network. In this work, the temperature-jump (T-jump) of water induced by THz radiation is simulated for ten different THz frequencies in the range from 3 to 30 THz and five different pulse intensities in the range from 1 × 10 11 to 5 × 10 12 W/cm 2 employing both ab initio molecular dynamics (AIMD) and force field molecular dynamics (FFMD) approaches. The most efficient T-jump can be achieved with 16 THz pulses. Three distinct T-jump mechanisms can be uncovered. For all cases, the T-jump mechanism proceeds within tens of femtoseconds (fs). For frequencies between 10 and 25 THz, most of the energy is initially transferred to the rotational degrees of freedom. Subsequently, the energy is redistributed to the translational and intramolecular vibrational degrees of freedom within a maximum of 500 fs. For the lowest frequencies considered (7 THz and below), translational and rotational degrees of freedom are heated within tens of fs as the THz pulse also couples to the intermolecular vibrations. Subsequently, the intramolecular vibrational modes are heated within a few hundred fs. At the highest frequencies considered (25 THz and above), vibrational and rotational degrees of freedom are heated within tens of fs, and energy redistribution to the translational degrees of freedom happens within several hundred fs. Both AIMD and FFMD simulations show a similar dependence of the T-jump on the frequency employed. However, the FFMD simulations overestimate the total energy transfer around the main peak and drop off too fast toward frequencies higher and lower than the main peak. These differences can be rationalized by missing elements, such as the polarizability, in the TIP4P/2005f force field employed. The feasibility of performing experiments at the studied frequencies and intensities as well as important issues such as energy efficiency, penetration depth, and focusing are discussed.

  20. Is back-electron transfer process in Betaine-30 coherent?

    NASA Astrophysics Data System (ADS)

    Rafiq, Shahnawaz; Scholes, Gregory D.

    2017-09-01

    The possible role of coherent vibrational motion in ultrafast photo-induced electron transfer remains unclear despite considerable experimental and theoretical advances. We revisited this problem by tracking the back-electron transfer (bET) process in Betaine-30 with broadband pump-probe spectroscopy. Dephasing time constant of certain high-frequency vibrations as a function of solvent shows a trend similar to the ET rates. In the purview of Bixon-Jortner model, high-frequency quantum vibrations bridge the reactant-product energy gap by providing activationless vibronic channels. Such interaction reduces the effective coupling significantly and thereby the coherence effects are eliminated due to energy gap fluctuations, making the back-electron transfer incoherent.

  1. Effect of a timebase mismatch in two-way optical frequency transfer

    NASA Astrophysics Data System (ADS)

    Tampellini, Anna; Clivati, Cecilia; Levi, Filippo; Mura, Alberto; Calonico, Davide

    2017-12-01

    Two-way frequency transfer on optical fibers is a powerful technique for the comparison of distant clocks over long and ultra-long hauls. In contrast to traditional Doppler noise cancellation, it is capable of sustaining higher link attenuation, mitigating the need of optical amplification and regeneration and thus reducing the setup complexity. We investigate the ultimate limitations of the two-way approach on a 300 km multiplexed fiber haul, considering fully independent setups and acquisition systems at the two link ends. We derive a theoretical model to predict the performance deterioration due to a bad synchronisation of the measurements, which is confirmed by experimental results. This study demonstrates that two-way optical frequency transfer is a reliable and performing technique, capable of sustaining remote clocks comparisons at the 10-19 resolution, and is relevant for the development of a fiber network of continental scale for frequency metrology in Europe.

  2. 47 CFR 24.839 - Transfer of control or assignment of license.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Transfer of control or assignment of license... Broadband PCS § 24.839 Transfer of control or assignment of license. (a) Restrictions on Assignments and Transfers of Licenses for Frequency Blocks C and F won in closed bidding. No assignment or transfer of...

  3. The Derivation of Simple Poles in a Transfer Function from Real Frequency Information. Part 3. Object Classification and Identification,

    DTIC Science & Technology

    1977-01-10

    This report is the third in a series of three that evaluate a technique (frequency-domain Prony) for obtaining the poles of a transfer function. The...main objective was to assess the feasibility of classifying or identifying ship-like targets by using pole sets derived from frequency-domain data. A...predictor-correlator procedure for using spectral data and library pole sets for this purpose was developed. Also studied was an iterative method for

  4. Golden rule kinetics of transfer reactions in condensed phase: The microscopic model of electron transfer reactions in disordered solid matrices

    NASA Astrophysics Data System (ADS)

    Basilevsky, M. V.; Odinokov, A. V.; Titov, S. V.; Mitina, E. A.

    2013-12-01

    The algorithm for a theoretical calculation of transfer reaction rates for light quantum particles (i.e., the electron and H-atom transfers) in non-polar solid matrices is formulated and justified. The mechanism postulated involves a local mode (an either intra- or inter-molecular one) serving as a mediator which accomplishes the energy exchange between the reacting high-frequency quantum mode and the phonon modes belonging to the environment. This approach uses as a background the Fermi golden rule beyond the usually applied spin-boson approximation. The dynamical treatment rests on the one-dimensional version of the standard quantum relaxation equation for the reduced density matrix, which describes the frequency fluctuation spectrum for the local mode under consideration. The temperature dependence of a reaction rate is controlled by the dimensionless parameter ξ0 = ℏω0/kBT where ω0 is the frequency of the local mode and T is the temperature. The realization of the computational scheme is different for the high/intermediate (ξ0 < 1 - 3) and for low (ξ0 ≫ 1) temperature ranges. For the first (quasi-classical) kinetic regime, the Redfield approximation to the solution of the relaxation equation proved to be sufficient and efficient in practical applications. The study of the essentially quantum-mechanical low-temperature kinetic regime in its asymptotic limit requires the implementation of the exact relaxation equation. The coherent mechanism providing a non-vanishing reaction rate has been revealed when T → 0. An accurate computational methodology for the cross-over kinetic regime needs a further elaboration. The original model of the hopping mechanism for electronic conduction in photosensitive organic materials is considered, based on the above techniques. The electron transfer (ET) in active centers of such systems proceeds via local intra- and intermolecular modes. The active modes, as a rule, operate beyond the kinetic regimes, which are usually postulated in the existing theories of the ET. Our alternative dynamic ET model for local modes immersed in the continuum harmonic medium is formulated for both classical and quantum regimes, and accounts explicitly for the mode/medium interaction. The kinetics of the energy exchange between the local ET subsystem and the surrounding environment essentially determine the total ET rate. The efficient computer code for rate computations is elaborated on. The computations are available for a wide range of system parameters, such as the temperature, external field, local mode frequency, and characteristics of mode/medium interaction. The relation of the present approach to the Marcus ET theory and to the quantum-statistical reaction rate theory [V. G. Levich and R. R. Dogonadze, Dokl. Akad. Nauk SSSR, Ser. Fiz. Khim. 124, 213 (1959); J. Ulstrup, Charge Transfer in Condensed Media (Springer, Berlin, 1979); M. Bixon and J. Jortner, Adv. Chem. Phys. 106, 35 (1999)] underlying it is discussed and illustrated by the results of computations for practically important target systems.

  5. Golden rule kinetics of transfer reactions in condensed phase: the microscopic model of electron transfer reactions in disordered solid matrices.

    PubMed

    Basilevsky, M V; Odinokov, A V; Titov, S V; Mitina, E A

    2013-12-21

    The algorithm for a theoretical calculation of transfer reaction rates for light quantum particles (i.e., the electron and H-atom transfers) in non-polar solid matrices is formulated and justified. The mechanism postulated involves a local mode (an either intra- or inter-molecular one) serving as a mediator which accomplishes the energy exchange between the reacting high-frequency quantum mode and the phonon modes belonging to the environment. This approach uses as a background the Fermi golden rule beyond the usually applied spin-boson approximation. The dynamical treatment rests on the one-dimensional version of the standard quantum relaxation equation for the reduced density matrix, which describes the frequency fluctuation spectrum for the local mode under consideration. The temperature dependence of a reaction rate is controlled by the dimensionless parameter ξ0 = ℏω0/k(B)T where ω0 is the frequency of the local mode and T is the temperature. The realization of the computational scheme is different for the high/intermediate (ξ0 < 1 - 3) and for low (ξ0 ≫ 1) temperature ranges. For the first (quasi-classical) kinetic regime, the Redfield approximation to the solution of the relaxation equation proved to be sufficient and efficient in practical applications. The study of the essentially quantum-mechanical low-temperature kinetic regime in its asymptotic limit requires the implementation of the exact relaxation equation. The coherent mechanism providing a non-vanishing reaction rate has been revealed when T → 0. An accurate computational methodology for the cross-over kinetic regime needs a further elaboration. The original model of the hopping mechanism for electronic conduction in photosensitive organic materials is considered, based on the above techniques. The electron transfer (ET) in active centers of such systems proceeds via local intra- and intermolecular modes. The active modes, as a rule, operate beyond the kinetic regimes, which are usually postulated in the existing theories of the ET. Our alternative dynamic ET model for local modes immersed in the continuum harmonic medium is formulated for both classical and quantum regimes, and accounts explicitly for the mode∕medium interaction. The kinetics of the energy exchange between the local ET subsystem and the surrounding environment essentially determine the total ET rate. The efficient computer code for rate computations is elaborated on. The computations are available for a wide range of system parameters, such as the temperature, external field, local mode frequency, and characteristics of mode/medium interaction. The relation of the present approach to the Marcus ET theory and to the quantum-statistical reaction rate theory [V. G. Levich and R. R. Dogonadze, Dokl. Akad. Nauk SSSR, Ser. Fiz. Khim. 124, 213 (1959); J. Ulstrup, Charge Transfer in Condensed Media (Springer, Berlin, 1979); M. Bixon and J. Jortner, Adv. Chem. Phys. 106, 35 (1999)] underlying it is discussed and illustrated by the results of computations for practically important target systems.

  6. Preliminary Comparison of Two-Way Satellite Time and Frequency Transfer and GPS Common-View Time Transfer During the INTELSAT Field Trial

    NASA Technical Reports Server (NTRS)

    Davis, John A.; Lewandowski, W.; DeYoung, James A.; Kirchner, Dieter; Hetzel, Peter; deJong, Gerrit; Soering, A.; Baumont, F.; Klepczynski, William; McKinley, Angela Davis; hide

    1996-01-01

    For a decade and a half Global Positioning System (GPS) common-view time transfer has greatly served the needs of primary timing laboratories for regular intercomparisons of remote atomic clocks. However, GPS as a one-way technique has natural limits and may not meet all challenges of the comparison of the coming new generation of atomic clocks. Two-way satellite time and frequency transfer (TWSTFT) is a promising technique which may successfully complement GPS. For two years, regular TWSTFT's have been performed between eight laboratories situated in both Europe and North America, using INTELSAT satellites. This has enabled an extensive direct comparison to be made between these two high performance time transfer methods. The performance of the TWSTFT and GPS common view methods are compared over a number of time-transfer links. These links use a variety of time-transfer hardware and atomic clocks and have baselines of substantially different lengths. The relative merits of the two time-transfer systems are discussed.

  7. On the potential of Galileo E5 for time transfer.

    PubMed

    Martínez-Belda, Mari Carmen; Defraigne, Pascale; Bruyninx, Carine

    2013-01-01

    The main global navigation satellite systems (GNSS) technique currently used for accurate time and frequency transfer is based on an analysis of the ionosphere-free combinations of dual-frequency code and carrier phase measurements in a precise point positioning (PPP) mode. This technique analyses the observations of one GNSS station using external products for satellite clocks and orbits to determine the position and clock synchronization errors of this station. The frequency stability of this time transfer is limited by the noise and multipath of the Global Positioning System (GPS) and Globalnaya Navigatsionnaya Sputnikovaya Sistema (GLONASS) codes. In the near future, Galileo will offer a broadband signal E5, with low noise in the centimeter range and with the lowest multipath error ever observed. This paper investigates new analysis procedures based on the E5 codeplus- carrier (CPC) combination for time transfer. The CPC combination with E5 provides a noise level 10 times lower than the ionosphere-free combination of Galileo E1 and E5, which is very promising for improving GNSS time transfer performances. From some tests with simulated Galileo data, it is shown here that the use of the CPC combination with E5 does not improve, at present, the medium- and long-term stability of time transfer with respect to the ionosphere-free combination of Galileo E1 and E5 codes, because of the need for a second frequency signal to correct for the ionospheric delays and ambiguities.

  8. High frequency electromagnetism, heat transfer and fluid flow coupling in ANSYS multiphysics.

    PubMed

    Sabliov, Cristina M; Salvi, Deepti A; Boldor, Dorin

    2007-01-01

    The goal of this study was to numerically predict the temperature of a liquid product heated in a continuous-flow focused microwave system by coupling high frequency electromagnetism, heat transfer, and fluid flow in ANSYS Multiphysics. The developed model was used to determine the temperature change in water processed in a 915 MHz microwave unit, under steady-state conditions. The influence of the flow rates on the temperature distribution in the liquid was assessed. Results showed that the average temperature of water increased from 25 degrees C to 34 degrees C at 2 l/min, and to 42 degrees C at 1 l/min. The highest temperature regions were found in the liquid near the center of the tube, followed by progressively lower temperature regions as the radial distance from the center increased, and finally followed by a slightly higher temperature region near the tube's wall corresponding to the energy distribution given by the Mathieu function. The energy distribution resulted in a similar temperature pattern, with the highest temperatures close to the center of the tube and lower at the walls. The presented ANSYS Multiphysics model can be easily improved to account for complex boundary conditions, phase change, temperature dependent properties, and non-Newtonian flows, which makes for an objective of future studies.

  9. Data Quality Assessment of FY-3C MWRI Microwave Imager from CMA, ECMWF and the Met Office

    NASA Astrophysics Data System (ADS)

    Lu, Q.; WU, S.; Dou, F.; Sun, F.; Lawrence, H.; Geer, A.; English, S.; Newman, S.; Bell, W.; Bormann, N.; Carminati, F.

    2017-12-01

    MWRI is a conical-scanning microwave imager following on from the heritage of similar instruments such as SSMI/S and AMSR-2, with ten channels at frequencies between 10.65 GHz and 89 GHz. MWRI is flown on the China Meteorological Administration's (CMA's) Feng-Yun-3 (FY-3) satellite series, including on FY-3C and the upcoming FY-3D, scheduled for launch in September 2017. Here we present an evaluation of the data from MWRI on the FY-3C satellite launched in 2013. At CMA, the MWRI instrumental parameters and statistics between observation and simulation from RTTOV and CRTM radiative transfer modeling were monitored to characterise instrumental uncertainty from calibration and assess the data quality. The data were also assessed using model-equivalent brightness temperatures from the ECMWF and Met Office short-range forecasts. The forecasts were first transformed into brightness temperature space using the RTTOV radiative transfer code. By analysing observed minus model background ("O-B") brightness temperature departures we were able to investigate the instrument and geophysical state dependence of biases. We show examples of how biases can impact the data quality, related to ascending/descending node differences and radio frequency interference. We discuss the prospects of assimilation of MWRI data at NWP centres.

  10. Normalized power transmission between ABP and ICP in TBI.

    PubMed

    Shahsavari, S; Hallen, T; McKelvey, T; Ritzen, C; Rydenhag, B

    2009-01-01

    A new approach to study the pulse transmission between the cerebrovascular bed and the intracranial space is presented. In the proposed approach, the normalized power transmission between ABP and ICP has got the main attention rather than the actual power transmission. Evaluating the gain of the proposed transfer function at any single frequency can reveal how the percentage of contribution of that specific frequency component has been changed through the cerebrospinal system. The gain of the new transfer function at the fundamental cardiac frequency was utilized to evaluate the state of the brain in three TBI patients. Results were assessed using the reference evaluations achieved by a novel CT scan-based scoring scheme. In all three study cases, the gain of the transfer function showed a good capability to follow the trend of the CT scores and describe the brain state. Comparing the new transfer function with the traditional one and also the index of compensatory reserve, the proposed transfer function was found more informative about the state of the brain in the patients under study.

  11. Sensitivity of Spacebased Microwave Radiometer Observations to Ocean Surface Evaporation

    NASA Technical Reports Server (NTRS)

    Liu, Timothy W.; Li, Li

    2000-01-01

    Ocean surface evaporation and the latent heat it carries are the major components of the hydrologic and thermal forcing on the global oceans. However, there is practically no direct in situ measurements. Evaporation estimated from bulk parameterization methods depends on the quality and distribution of volunteer-ship reports which are far less than satisfactory. The only way to monitor evaporation with sufficient temporal and spatial resolutions to study global environment changes is by spaceborne sensors. The estimation of seasonal-to-interannual variation of ocean evaporation, using spacebased measurements of wind speed, sea surface temperature (SST), and integrated water vapor, through bulk parameterization method,s was achieved with reasonable success over most of the global ocean, in the past decade. Because all the three geophysical parameters can be retrieved from the radiance at the frequencies measured by the Scanning Multichannel Microwave Radiometer (SMMR) on Nimbus-7, the feasibility of retrieving evaporation directly from the measured radiance was suggested and demonstrated using coincident brightness temperatures observed by SMMR and latent heat flux computed from ship data, in the monthly time scale. However, the operational microwave radiometers that followed SMMR, the Special Sensor Microwave/Imager (SSM/I), lack the low frequency channels which are sensitive to SST. This low frequency channels are again included in the microwave imager (TMI) of the recently launched Tropical Rain Measuring Mission (TRMM). The radiance at the frequencies observed by both TMI and SSM/I were simulated through an atmospheric radiative transfer model using ocean surface parameters and atmospheric temperature and humidity profiles produced by the reanalysis of the European Center for Medium Range Weather Forecast (ECMWF). From the same ECMWF data set, coincident evaporation is computed using a surface layer turbulent transfer model. The sensitivity of the radiance to evaporation over various seasons and geographic locations are examined. The microwave frequencies with radiance that are significant correlated with evaporation are identify and capability of estimating evaporation directly from TMI will be discussed.

  12. A Hybrid Solution for Simultaneous Transfer of Ultrastable Optical Frequency, RF Frequency, and UTC Time-Tags Over Optical Fiber.

    PubMed

    Krehlik, Przemyslaw; Schnatz, Harald; Sliwczynski, Lukasz

    2017-12-01

    We describe a fiber-optic solution for simultaneous distribution of all signals generated at today's most advanced time and frequency laboratories, i.e., an ultrastable optical reference frequency derived from an optical atomic clock, a radio frequency precisely linked to a realization of the SI-Second, and a realization of an atomic timescale, being the local representation of the virtual, global UTC timescale. In our solution both the phase of the optical carrier and the delay of electrical signals (10-MHz frequency reference and one-pulse-per-second time tags) are stabilized against environmental perturbations influencing the fiber link instability and accuracy. We experimentally demonstrate optical transfer stabilities of and for 100 s averaging period, for optical carrier and 10-MHz signals, respectively.

  13. Reverberant acoustic energy in auditoria that comprise systems of coupled rooms

    NASA Astrophysics Data System (ADS)

    Summers, Jason E.

    2003-11-01

    A frequency-dependent model for reverberant energy in coupled rooms is developed and compared with measurements for a 1:10 scale model and for Bass Hall, Ft. Worth, TX. At high frequencies, prior statistical-acoustics models are improved by geometrical-acoustics corrections for decay within sub-rooms and for energy transfer between sub-rooms. Comparisons of computational geometrical acoustics predictions based on beam-axis tracing with scale model measurements indicate errors resulting from tail-correction assuming constant quadratic growth of reflection density. Using ray tracing in the late part corrects this error. For mid-frequencies, the models are modified to account for wave effects at coupling apertures by including power transmission coefficients. Similarly, statical-acoustics models are improved through more accurate estimates of power transmission measurements. Scale model measurements are in accord with the predicted behavior. The edge-diffraction model is adapted to study transmission through apertures. Multiple-order scattering is theoretically and experimentally shown inaccurate due to neglect of slope diffraction. At low frequencies, perturbation models qualitatively explain scale model measurements. Measurements confirm relation of coupling strength to unperturbed pressure distribution on coupling surfaces. Measurements in Bass Hall exhibit effects of the coupled stage house. High frequency predictions of statistical acoustics and geometrical acoustics models and predictions of coupling apertures all agree with measurements.

  14. Characteristics of microseisms in South China

    NASA Astrophysics Data System (ADS)

    Xiao, H.; Xue, M.; Pan, M.

    2017-12-01

    Microseisms are generated by coupling ocean waves and the solid earth, and their main frequencies and sources vary in different regions of the world. We use continuous waveforms from three arrays along the southern coast of China to study the types and sources of microseisms in South China. Using cross-correlation functions and a three-component F-K analysis, we found that the main type of microseisms in this area propagates as surface waves, arriving mainly from the east and southeast. We also found that the surface waves have different characteristics: the Rayleigh waves and Love waves have diverse sources, are frequency dependent and have no obvious seasonal changes. In the 0.2-0.25 Hz frequency band, the Rayleigh and Love waves at the W01, W02 and ST arrays show the influences of common microseisms sources from Taiwan and the Luzon Strait. However, in the 0.27-0.5 Hz frequency band, the energy of the microseisms tends to be governed by the offshore sources near the stations. In addition, the Love waves have broader back azimuths than those of the Rayleigh waves, which may due to the energy transfer between Rayleigh and Love waves in the thick sediment layers.

  15. Approximate analytical solution for induction heating of solid cylinders

    DOE PAGES

    Jankowski, Todd Andrew; Pawley, Norma Helen; Gonzales, Lindsey Michal; ...

    2015-10-20

    An approximate solution to the mathematical model for induction heating of a solid cylinder in a cylindrical induction coil is presented here. The coupled multiphysics model includes equations describing the electromagnetic field in the heated object, a heat transfer simulation to determine temperature of the heated object, and an AC circuit simulation of the induction heating power supply. A multiple-scale perturbation method is used to solve the multiphysics model. The approximate analytical solution yields simple closed-form expressions for the electromagnetic field and heat generation rate in the solid cylinder, for the equivalent impedance of the associated tank circuit, and formore » the frequency response of a variable frequency power supply driving the tank circuit. The solution developed here is validated by comparing predicted power supply frequency to both experimental measurements and calculated values from finite element analysis for heating of graphite cylinders in an induction furnace. The simple expressions from the analytical solution clearly show the functional dependence of the power supply frequency on the material properties of the load and the geometrical characteristics of the furnace installation. In conclusion, the expressions developed here provide physical insight into observations made during load signature analysis of induction heating.« less

  16. Development of the sound localization cues in cats

    NASA Astrophysics Data System (ADS)

    Tollin, Daniel J.

    2004-05-01

    Cats are a common model for developmental studies of the psychophysical and physiological mechanisms of sound localization. Yet, there are few studies on the development of the acoustical cues to location in cats. The magnitude of the three main cues, interaural differences in time (ITDs) and level (ILDs), and monaural spectral shape cues, vary with location in adults. However, the increasing interaural distance associated with a growing head and pinnae during development will result in cues that change continuously until maturation is complete. Here, we report measurements, in cats aged 1 week to adulthood, of the physical dimensions of the head and pinnae and the localization cues, computed from measurements of directional transfer functions. At 1 week, ILD depended little on azimuth for frequencies <6-7 kHz, maximum ITD was 175 μs, and for sources varying in elevation, a prominent spectral notch was located at higher frequencies than in the older cats. As cats develop, the spectral cues and the frequencies at which ILDs become substantial (>10 dB) shift to lower frequencies, and the maximum ITD increases to nearly 370 μs. Changes in the cues are correlated with the increasing size of the head and pinnae. [Work supported by NIDCD DC05122.

  17. About Mass Transfer in Capillaries of Biological Systems under Influence of Vibrations

    NASA Astrophysics Data System (ADS)

    Prisniakov, K.

    Vibrations accompany the flight of the manned spacecraft both at a stage of a orbital injection to an orbit, and during long flights (as noise), rendering undesirable physiological influence on crew, reducing serviceability and creating constant discomfort. The report represents attempt to predict a state of the cosmonaut in conditions of influence of vibrations for the period of start and stay in Space, being based on researches of mass transfer processes in capillary systems. For this purpose the original researches on heat and mass transfer processes with evaporation of liquids in capillary - porous structures in conditions of vibration actions and changes of a direction of action of gravitation are generalized. Report demonstrates the existence of modes at which increased or lowered mass transfer is achieved on border of separation "liquid - gas". The possible mechanism of influence of vibrations on evaporation of a liquid in capillaries is examined. The magnitudes of frequencies and amplitudes are submitted at which minimax characteristics are observed. The opportunity of application of the developed mathematical model of heat and mass transfer in capillary - porous structures to forecasting influence of vibrations for biological processes in capillaries of alive essences is analyzed. Such approach is justified on the mechanical nature of harmful influence of vibrations on an organism of the person. In addition the range of vibration frequencies which arise during space flights, corresponds to own resonant frequencies of a human body and his separate organs. Comparison of these resonant frequencies of a body of the person (5-80 Hertz) with vibration frequencies of optimum modes of heat and mass transfer in capillary - porous structures (20-40 Hertz) is shown their ranges of coverage. It gives the basis to assume existence of similar effects in capillaries of human body. It is supposed, that the difficulty of breath, change of a rhythm of breath, the subsequent weariness under vibration action are attributable to infringements of normal mass transfer between the inhaled air and blood. The opportunity of use of the received laws is discussed for assessment of influence of gravitational fields on intensity mass transfer in capillaries of biosystems also.

  18. Exchange-mediated contrast in CEST and spin-lock imaging.

    PubMed

    Cobb, Jared Guthrie; Li, Ke; Xie, Jingping; Gochberg, Daniel F; Gore, John C

    2014-01-01

    Magnetic resonance images of biological media based on chemical exchange saturation transfer (CEST) show contrast that depends on chemical exchange between water and other protons. In addition, spin-lattice relaxation rates in the rotating frame (R1ρ) are also affected by exchange, especially at high fields, and can be exploited to provide novel, exchange-dependent contrast. Here, we evaluate and compare the factors that modulate the exchange contrast for these methods using simulations and experiments on simple, biologically relevant samples. Simulations and experimental measurements at 9.4 T of rotating frame relaxation rate dispersion and CEST contrast were performed on solutions of macromolecules containing amide and hydroxyl exchanging protons. The simulations and experimental measurements confirm that both CEST and R1ρ measurements depend on similar exchange parameters, but they manifest themselves differently in their effects on contrast. CEST contrast may be larger in the slow and intermediate exchange regimes for protons with large resonant frequency offsets (e.g. >2 ppm). Spin-locking techniques can produce larger contrast enhancement when resonant frequency offsets are small (<2 ppm) and exchange is in the intermediate-to-fast regime. The image contrasts scale differently with field strength, exchange rate and concentration. CEST and R1ρ measurements provide different and somewhat complementary information about exchange in tissues. Whereas CEST can depict exchange of protons with specific chemical shifts, appropriate R1ρ-dependent acquisitions can be employed to selectively portray protons of specific exchange rates. © 2013.

  19. Exchange-Mediated Contrast in CEST and Spin-Lock Imaging

    PubMed Central

    Cobb, Jared Guthrie; Li, Ke; Xie, Jingping; Gochberg, Daniel F.; Gore, John C.

    2014-01-01

    PURPOSE Magnetic resonance images of biological media based on chemical exchange saturation transfer (CEST) show contrast that depends on chemical exchange between water and other protons. In addition, spin-lattice relaxation rates in the rotating frame (R1ρ) are also affected by exchange, especially at high fields, and can be exploited to provide novel, exchange-dependent contrast. Here, we evaluate and compare the factors that modulate the exchange contrast for these methods using simulations and experiments on simple, biologically relevant samples. METHODS Simulations and experimental measurements at 9.4T of rotating frame relaxation rate dispersion and CEST contrast were performed on solutions of macromolecules containing amide and hydroxyl exchanging protons. RESULTS The simulations and experimental measurements confirm that both CEST and R1ρ measurements depend on similar exchange parameters, but they manifest themselves differently in their effects on contrast. CEST contrast may be larger in the slow and intermediate exchange regimes for protons with large resonant frequency offsets (e.g. > 2ppm). Spin-locking techniques can produce larger contrast enhancement when resonant frequency offsets are small (< 2 ppm) and exchange is in the intermediate to fast regime. The image contrasts scale differently with field strength, exchange rate and concentration. CONCLUSION CEST and R1ρ measurements provide different and somewhat complementary information about exchange in tissues. Whereas CEST can depict exchange of protons with specific chemical shifts, appropriate R1ρ dependent acquisitions can be employed to selectively portray protons of specific exchange rates. PMID:24239335

  20. Numerical Evaluation of Parameter Correlation in the Hartmann-Tran Line Profile

    NASA Astrophysics Data System (ADS)

    Adkins, Erin M.; Reed, Zachary; Hodges, Joseph T.

    2017-06-01

    The partially correlated quadratic, speed-dependent hard-collision profile (pCqSDHCP), for simplicity referred to as the Hartmann-Tran profile (HTP), has been recommended as a generalized lineshape for high resolution spectroscopy. The HTP parameterizes complex collisional effects such as Dicke narrowing, speed dependent narrowing, and correlations between velocity-changing and dephasing collisions, while also simplifying to simpler profiles that are widely used, such as the Voigt profile. As advanced lineshape profiles are adopted by more researchers, it is important to understand the limitations that data quality has on the ability to retrieve physically meaningful parameters using sophisticated lineshapes that are fit to spectra of finite signal-to-noise ratio. In this work, spectra were simulated using the HITRAN Application Programming Interface (HAPI) across a full range of line parameters. Simulated spectra were evaluated to quantify the precision with which fitted lineshape parameters can be determined at a given signal-to-noise ratio, focusing on the numerical correlation between the retrieved Dicke narrowing frequency and the velocity-changing and dephasing collisions correlation parameter. Tran, H., N. Ngo, and J.-M. Hartmann, Journal of Quantitative Spectroscopy and Radiative Transfer 2013. 129: p. 89-100. Tennyson, et al., Pure Appl. Chem. 2014, 86: p. 1931-1943. Kochanov, R.V., et al., Journal of Quantitative Spectroscopy and Radiative Transfer 2016. 177: p. 15-30. Tran, H., N. Ngo, and J.-M. Hartmann, Journal of Quantitative Spectroscopy and Radiative Transfer 2013. 129: p. 199-203.

  1. Synthesis and characterization of highly conductive charge-transfer complexes using positron annihilation spectroscopy

    NASA Astrophysics Data System (ADS)

    Adam, Abdel Majid A.; Refat, Moamen S.; Sharshar, T.; Heiba, Z. K.

    Molecular charge-transfer complexes of the tetramethylethylenediamine (TMEDA) with picric acid (Pi-OH), benzene-1,4-diol (QL), tin(IV) tetrachloride (SnCl4), iodine, bromine, and zinc chloride (ZnCl2) have been synthesized and investigated by elemental and thermal analysis, electronic, infrared, Raman and proton-NMR, energy-dispersive X-ray spectroscopy, X-ray powder diffraction and positron annihilation lifetime spectroscopy, and scanning electron microscopy. In this work, three types of acceptors π-acceptors (Pi-OH and QL), σ-acceptors (iodine and bromine), and vacant orbital acceptors (SnCl4 and ZnCl2) were covered. The results of elemental analysis indicated that the CT complexes were formed with ratios 1:1 and 1:2 for QL, SnCl4, and ZnCl2 acceptors and iodine, Pi-OH, and Br2 acceptors, respectively. The type of chelating between the TMEDA donor and the mentioned acceptors depends upon the behavior of both items. The positron annihilation lifetime parameters were found to be dependent on the structure, electronic configuration, and the power of acceptors. The correlation between these parameters and the molecular weight and biological activities of studied complexes was also observed. Regarding the electrical properties, the AC conductivity and the dielectric coefficients were measured as a function of frequency at room temperature. The TMEDA charge-transfer complexes were screened against antibacterial (Escherichia coli, Staphylococcus aureus, Bacillus subtilis, and Pseudomonas aeruginosa) and antifungal (Aspergillus flavus and Candida albicans) activities.

  2. Conversion and origin of normal and abnormal temperature dependences of kinetic isotope effect in hydride transfer reactions.

    PubMed

    Zhu, Xiao-Qing; Li, Xiu-Tao; Han, Su-Hui; Mei, Lian-Rui

    2012-05-18

    The effects of substituents on the temperature dependences of kinetic isotope effect (KIE) for the reactions of the hydride transfer from the substituted 5-methyl-6-phenyl-5,6-dihydrophenanthridine (G-PDH) to thioxanthylium (TX(+)) in acetonitrile were examined, and the results show that the temperature dependences of KIE for the hydride transfer reactions can be converted by adjusting the nature of the substituents in the molecule of the hydride donor. In general, electron-withdrawing groups can make the KIE to have normal temperature dependence, but electron-donating groups can make the KIE to have abnormal temperature dependence. Thermodynamic analysis on the possible pathways of the hydride transfer from G-PDH to TX(+) in acetonitrile suggests that the transfers of the hydride anion in the reactions are all carried out by the concerted one-step mechanism whether the substituent is an electron-withdrawing group or an electron-donating group. But the examination of Hammett-type free energy analysis on the hydride transfer reactions supports that the concerted one-step hydride transfer is not due to an elementary chemical reaction. The experimental values of KIE at different temperatures for the hydride transfer reactions were modeled by using a kinetic equation formed according to a multistage mechanism of the hydride transfer including a returnable charge-transfer complex as the reaction intermediate; the real mechanism of the hydride transfer and the root that why the temperature dependences of KIE can be converted as the nature of the substituents are changed were discovered.

  3. Relativistic radiative transfer in a moving stratus irradiated by a luminous flat source

    NASA Astrophysics Data System (ADS)

    Fukue, Jun

    2015-06-01

    Relativistic radiative transfer in a geometrically thin stratus (sheet-like gaseous cloud with finite optical depth), which is moving at a relativistic speed around a luminous flat source, such as accretion disks, and is irradiated by the source, is examined under the special relativistic treatment. Incident radiation is aberrated and Doppler-shifted when it is received by the stratus, and emitted radiation is also aberrated and Doppler-shifted when it leaves the stratus. Considering these relativistic effects, we analytically obtain the emergent intensity as well as other radiative quantities in the purely scattering case for both infinite and finite strati. We mainly consider the frequency-integrated case, but also briefly show the frequency-dependent one. We also solve the relativistic radiative transfer equation numerically, and compare the results with the analytical solutions. In the infinite stratus, the mean intensity in the comoving and inertial frames decreases and becomes constant, as the stratus speed increases. The flux in the comoving frame decreases exponentially with the optical depth. The emergent intensity decreases as the speed increases, since the incident photons are redshifted at the bottom-side of the stratus. In the finite stratus, the mean intensity in the comoving and inertial frames quickly increases in the top-side region due to the aberrated photons. The flux in the comoving frame is positive in the range of 0 < β ≤ 0.4, while it becomes negative for β ≳ 0.5. The behavior of the emergent intensity is similar to that of the infinite case, although there is an irradiation effect caused by the aberrated photons.

  4. Momentum deposition on Wolf-Rayet winds: Nonisotropic diffusion with effective gray opacity

    NASA Technical Reports Server (NTRS)

    Gayley, Kenneth G.; Owocki, Stanley P.; Cranmer, Steven R.

    1995-01-01

    We derive the velocity and mass-loss rate of a steady state Wolf-Rayet (WR) wind, using a nonisotropic diffusion approximation applied to the transfer between strongly overlapping spectral lines. Following the approach of Friend & Castor (1983), the line list is assumed to approximate a statistically parameterized Poisson distribution in frequency, so that photon transport is controlled by an angle-dependent, effectively gray opacity. We show the nonisotropic diffusion approximation yields good agreement with more accurate numerical treatments of the radiative transfer, while providing analytic insight into wind driving by multiple scattering. We illustrate, in particular, that multiple radiative momentum deposition does not require that potons be repeatedly reflected across substantial distances within the spherical envelope, but indeed is greatest when photons undergo a nearly local diffusion, e.g., through scattering by many lines closely spaced in frequency. Our results reiterate the view that the so-called 'momentum problem' of Wolf-Rayet winds is better characterized as an 'opacity problem' of simply identfying enough lines. One way of increasing the number of thick lines in Wolf-Rayet winds is to transfer opacity from saturated to unsaturated lines, yielding a steeper opacity distribution than that found in OB winds. We discuss the implications of this perspective for extending our approach to W-R wind models that incorporate a more fundamental treatment of the ionization and excitation processes that determine the line opacity. In particular, we argue that developing statistical descriptions of the lines to allow an improved effective opacity for the line ensemble would offer several advantages for deriving such more fundamental W-R wind models.

  5. Momentum deposition on Wolf-Rayet winds: Nonisotropic diffusion with effective gray opacity

    NASA Astrophysics Data System (ADS)

    Gayley, Kenneth G.; Owocki, Stanley P.; Cranmer, Steven R.

    1995-03-01

    We derive the velocity and mass-loss rate of a steady state Wolf-Rayet (WR) wind, using a nonisotropic diffusion approximation applied to the transfer between strongly overlapping spectral lines. Following the approach of Friend & Castor (1983), the line list is assumed to approximate a statistically parameterized Poisson distribution in frequency, so that photon transport is controlled by an angle-dependent, effectively gray opacity. We show the nonisotropic diffusion approximation yields good agreement with more accurate numerical treatments of the radiative transfer, while providing analytic insight into wind driving by multiple scattering. We illustrate, in particular, that multiple radiative momentum deposition does not require that photons be repeatedly reflected across substantial distances within the spherical envelope, but indeed is greatest when photons undergo a nearly local diffusion, e.g., through scattering by many lines closely spaced in frequency. Our results reiterate the view that the so-called 'momentum problem' of Wolf-Rayet winds is better characterized as an 'opacity problem' of simply identifying enough lines. One way of increasing the number of thick lines in Wolf-Rayet winds is to transfer opacity from saturated to unsaturated lines, yielding a steeper opacity distribution than that found in OB winds. We discuss the implications of this perspective for extending our approach to W-R wind models that incorporate a more fundamental treatment of the ionization and excitation processes that determine the line opacity. In particular, we argue that developing statistical descriptions of the lines to allow an improved effective opacity for the line ensemble would offer several advantages for deriving such more fundamental W-R wind models.

  6. Optimal and robust control of quantum state transfer by shaping the spectral phase of ultrafast laser pulses.

    PubMed

    Guo, Yu; Dong, Daoyi; Shu, Chuan-Cun

    2018-04-04

    Achieving fast and efficient quantum state transfer is a fundamental task in physics, chemistry and quantum information science. However, the successful implementation of the perfect quantum state transfer also requires robustness under practically inevitable perturbative defects. Here, we demonstrate how an optimal and robust quantum state transfer can be achieved by shaping the spectral phase of an ultrafast laser pulse in the framework of frequency domain quantum optimal control theory. Our numerical simulations of the single dibenzoterrylene molecule as well as in atomic rubidium show that optimal and robust quantum state transfer via spectral phase modulated laser pulses can be achieved by incorporating a filtering function of the frequency into the optimization algorithm, which in turn has potential applications for ultrafast robust control of photochemical reactions.

  7. Laser-driven high-frequency vibrations of metal blister surface

    NASA Astrophysics Data System (ADS)

    Kononenko, T. V.; Sinyavsky, M. N.; Konov, V. I.; Sentis, M.

    2013-09-01

    Time-resolved interferometric microscopy was applied to investigate laser-induced blistering of a titanium film on a silica substrate. Ablation of the titanium/silica interface by single 0.7 ns pulses within a certain fluence range results in local exfoliation of the metal film from the substrate avoiding, however, complete film destruction. Time-dependent transformation of the metal surface profile was reconstructed from the interference patterns within 0-13 ns time delay range. Transverse annular waves with typical amplitude of one hundred of nanometers and estimated traveling speed of few kilometers per second were revealed on the blister surface. The wave occurrence was attributed to fast inhomogeneous bending of the film covering the expanding blister. The resultant high-frequency (˜1 GHz) vibrations of the metal surface provide intensive inertial forces when such metalized target is used for blister-based laser-induced forward transfer of nanopowders and organic molecules.

  8. Mixing Of Mode Symmetries In Top Gated Bilayer And Multilayer Graphene Field Effect Devices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Biswanath; Das, Anindya; Sood, A. K.

    2011-07-15

    We report Raman study to investigate the influence of stacking on the inversion symmetry breaking in top gated bi- and multi-layer ({approx}10 layers) graphene field effect transistors. The G phonon mode splits into a low frequency (G{sub low}) and a high frequency (G{sub high}) mode in bi- and multi-layer graphene and the two modes show different dependence on doping. The mode splitting is explained in terms of mixing of zone-center in-plane optical phonons representing in-phase and out-of-phase inter-layer atomic motions. Unlike in bilayer graphene, there is no transfer of intensity from G{sub low} to G{sub high} in multilayer graphene. Amore » comparison is made for the bilayer graphene data with the recent theory of Gava et al. [Phys. Rev. B 80, 155422 (2009)].« less

  9. Fusion of spectral models for dynamic modeling of sEMG and skeletal muscle force.

    PubMed

    Potluri, Chandrasekhar; Anugolu, Madhavi; Chiu, Steve; Urfer, Alex; Schoen, Marco P; Naidu, D Subbaram

    2012-01-01

    In this paper, we present a method of combining spectral models using a Kullback Information Criterion (KIC) data fusion algorithm. Surface Electromyographic (sEMG) signals and their corresponding skeletal muscle force signals are acquired from three sensors and pre-processed using a Half-Gaussian filter and a Chebyshev Type- II filter, respectively. Spectral models - Spectral Analysis (SPA), Empirical Transfer Function Estimate (ETFE), Spectral Analysis with Frequency Dependent Resolution (SPFRD) - are extracted from sEMG signals as input and skeletal muscle force as output signal. These signals are then employed in a System Identification (SI) routine to establish the dynamic models relating the input and output. After the individual models are extracted, the models are fused by a probability based KIC fusion algorithm. The results show that the SPFRD spectral models perform better than SPA and ETFE models in modeling the frequency content of the sEMG/skeletal muscle force data.

  10. Measurement of thin films using very long acoustic wavelengths

    NASA Astrophysics Data System (ADS)

    Clement, G. T.; Nomura, H.; Adachi, H.; Kamakura, T.

    2013-12-01

    A procedure for measuring material thickness by means of necessarily long acoustic wavelengths is examined. The approach utilizes a temporal phase lag caused by the impulse time of wave momentum transferred through a thin layer that is much denser than its surrounding medium. In air, it is predicted that solid or liquid layers below approximately 1/2000 of the acoustic wavelength will exhibit a phase shift with an arctangent functional dependence on thickness and layer density. The effect is verified for thin films on the scale of 10 μm using audible frequency sound (7 kHz). Soap films as thin as 100 nm are then measured using 40 kHz air ultrasound. The method's potential for imaging applications is demonstrated by combining the approach with near-field holography, resulting in reconstructions with sub-wavelength resolution in both the depth and lateral directions. Potential implications at very high and very low acoustic frequencies are discussed.

  11. Quantum beats in conductance oscillations in graphene-based asymmetric double velocity wells and electrostatic wells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Lei; Department of Medical Physics, Basic Medical College, Hebei Medical University, Shijiazhuang, Hebei 050017; Li, Yu-Xian

    2014-01-14

    The transport properties in graphene-based asymmetric double velocity well (Fermi velocity inside the well less than that outside the well) and electrostatic well structures are investigated using the transfer matrix method. The results show that quantum beats occur in the oscillations of the conductance for asymmetric double velocity wells. The beating effect can also be found in asymmetric double electrostatic wells, but only if the widths of the two wells are different. The beat frequency for the asymmetric double well is exactly equal to the frequency difference between the oscillation rates in two isolated single wells with the same structuresmore » as the individual wells in the double well structure. A qualitative interpretation is proposed based on the fact that the resonant levels depend upon the sizes of the quantum wells. The beating behavior can provide a new way to identify the symmetry of double well structures.« less

  12. Molecular structure, vibrational spectra and DFT molecular orbital calculations (TD-DFT and NMR) of the antiproliferative drug Methotrexate

    NASA Astrophysics Data System (ADS)

    Ayyappan, S.; Sundaraganesan, N.; Aroulmoji, V.; Murano, E.; Sebastian, S.

    2010-09-01

    The FT-IR and FT-Raman spectral studies of the Methotrexate (MTX) were carried out. The equilibrium geometry, various bonding features and harmonic vibrational frequencies of MTX have been investigated with the help of B3LYP density functional theory (DFT) using 6-31G(d) as basis set. Detailed analysis of the vibrational spectra has been made with the aid of theoretically predicted vibrational frequencies. The vibrational analysis confirms the differently acting ring modes, steric repulsion, conjugation and back-donation. The energy and oscillator strength calculated by Time-Dependent Density Functional Theory (TD-DFT) results complement with the experimental findings. The calculated HOMO and LUMO energies show that charge transfer occur within the molecule. Good correlations between the experimental 1H and 13C NMR chemical shifts in DMSO solution and calculated GIAO shielding tensors were found.

  13. Cyclotron line resonant transfer through neutron star atmospheres

    NASA Technical Reports Server (NTRS)

    Wang, John C. L.; Wasserman, Ira M.; Salpeter, Edwin E.

    1988-01-01

    Monte Carlo methods are used to study in detail the resonant radiative transfer of cyclotron line photons with recoil through a purely scattering neutron star atmosphere for both the polarized and unpolarized cases. For each case, the number of scatters, the path length traveled, the escape frequency shift, the escape direction cosine, the emergent frequency spectra, and the angular distribution of escaping photons are investigated. In the polarized case, transfer is calculated using both the cold plasma e- and o-modes and the magnetic vacuum perpendicular and parallel modes.

  14. Neuromuscular mechanisms and neural strategies in the control of time-varying muscle contractions.

    PubMed

    Erimaki, Sophia; Agapaki, Orsalia M; Christakos, Constantinos N

    2013-09-01

    The organization of the neural input to motoneurons that underlies time-varying muscle force is assumed to depend on muscle transfer characteristics and neural strategies or control modes utilizing sensory signals. We jointly addressed these interlinked, but previously studied individually and partially, issues for sinusoidal (range 0.5-5.0 Hz) force-tracking contractions of a human finger muscle. Using spectral and correlation analyses of target signal, force signal, and motor unit (MU) discharges, we studied 1) patterns of such discharges, allowing inferences on the motoneuronal input; 2) transformation of MU population activity (EMG) into quasi-sinusoidal force; and 3) relation of force oscillation to target, carrying information on the input's organization. A broad view of force control mechanisms and strategies emerged. Specifically, synchronized MU and EMG modulations, reflecting a frequency-modulated motoneuronal input, accompanied the force variations. Gain and delay drops between EMG modulation and force oscillation, critical for the appropriate organization of this input, occurred with increasing target frequency. According to our analyses, gain compensation was achieved primarily through rhythmical activation/deactivation of higher-threshold MUs and secondarily through the adaptation of the input's strength expected during tracking tasks. However, the input's timing was not adapted to delay behaviors and seemed to depend on the control modes employed. Thus, for low-frequency targets, the force oscillation was highly coherent with, but led, a target, this timing error being compatible with predictive feedforward control partly based on the target's derivatives. In contrast, the force oscillation was weakly coherent, but in phase, with high-frequency targets, suggesting control mainly based on a target's rhythm.

  15. Advanced Satellite-Based Frequency Transfer at the 10-16 Level.

    PubMed

    Fujieda, Miho; Yang, Sung-Hoon; Gotoh, Tadahiro; Hwang, Sang-Wook; Hachisu, Hidekazu; Kim, Huidong; Lee, Young Kyu; Tabuchi, Ryo; Ido, Tetsuya; Lee, Won-Kyu; Heo, Myoung-Sun; Park, Chang Yong; Yu, Dai-Hyuk; Petit, Gerard

    2018-06-01

    Advanced satellite-based frequency transfers by two-way carrier-phase (TWCP) and integer precise point positioning have been performed between the National Institute of Information and Communications Technology and Korea Research Institute of Standards and Science. We confirm that the disagreement between them is less than at an averaging time of several days. In addition, an overseas frequency ratio measurement of Sr and Yb optical lattice clocks was directly performed by TWCP. We achieved an uncertainty at the mid-10 -16 level after a total measurement time of 12 h. The frequency ratio was consistent with the recently reported values within the uncertainty.

  16. Characteristics of sound radiation from turbulent premixed flames

    NASA Astrophysics Data System (ADS)

    Rajaram, Rajesh

    Turbulent combustion processes are inherently unsteady and, thus, a source of acoustic radiation, which occurs due to the unsteady expansion of reacting gases. While prior studies have extensively characterized the total sound power radiated by turbulent flames, their spectral characteristics are not well understood. The objective of this research work is to measure the flow and acoustic properties of an open turbulent premixed jet flame and explain the spectral trends of combustion noise. The flame dynamics were characterized using high speed chemiluminescence images of the flame. A model based on the solution of the wave equation with unsteady heat release as the source was developed and was used to relate the measured chemiluminescence fluctuations to its acoustic emission. Acoustic measurements were performed in an anechoic environment for several burner diameters, flow velocities, turbulence intensities, fuels, and equivalence ratios. The acoustic emissions are shown to be characterized by four parameters: peak frequency (Fpeak), low frequency slope (beta), high frequency slope (alpha) and Overall Sound Pressure Level (OASPL). The peak frequency (Fpeak) is characterized by a Strouhal number based on the mean velocity and a flame length. The transfer function between the acoustic spectrum and the spectrum of heat release fluctuations has an f2 dependence at low frequencies, while it converged to a constant value at high frequencies. Furthermore, the OASPL was found to be characterized by (Fpeak mfH)2, which resembles the source term in the wave equation.

  17. Modellierung dreidimensionaler Strahlungsfelder im frühen Universum %t Modelling three dimensional radiation fields in the early universe

    NASA Astrophysics Data System (ADS)

    Meinköhn, Erik

    2002-11-01

    The present work aims at the modelling of three-dimensional radiation fields in gas clouds from the early universe, in particular as to the influence of varying distributions of density and velocity. In observations of high-redshift gas clouds, the Lyα transition from the first excited energy level to the ground state of the hydrogen atom is usually found to be the only prominent emission lines in the entire spectrum. It is a well-known assumption that high-redshifted hydrogen clouds are the precursors of present-day galaxies. Thus, the investigation of the Lyα line is of paramount importance of the theory of galaxy formation and evolution. The observed Lyα line - or rather, to be precise, its profile - reveals both the complexity of the spatial distribution and of the kinematics of the interstellar gas, and also the nature of the photon source. In this thesis we have developed a code which is capable of solving the three-dimensional frequency-dependent radiative transfer equation for arbitrarily nonrelativistically moving media. The numerical treatment of the associated partial integro-differential equation is an extremely challenging task, since radiation intensity depends on 6 variables, namely 3 space variables, 2 variables describing the direction of photon propagation, and the frequency. With the goal of a quantitative comparison with observational data in mind, the implementation of very efficient methods for a sufficiently accurate solution of the complex radiative transfer problems turned out to be a necessity. The size of the resulting linear system of equations makes the use of parallelization techniques and grid refinement strategies indispensable.

  18. Characterization of IntA, a Bidirectional Site-Specific Recombinase Required for Conjugative Transfer of the Symbiotic Plasmid of Rhizobium etli CFN42

    PubMed Central

    Hernández-Tamayo, Rogelio; Sohlenkamp, Christian; Puente, José Luis; Brom, Susana

    2013-01-01

    Site-specific recombination occurs at short specific sequences, mediated by the cognate recombinases. IntA is a recombinase from Rhizobium etli CFN42 and belongs to the tyrosine recombinase family. It allows cointegration of plasmid p42a and the symbiotic plasmid via site-specific recombination between attachment regions (attA and attD) located in each replicon. Cointegration is needed for conjugative transfer of the symbiotic plasmid. To characterize this system, two plasmids harboring the corresponding attachment sites and intA were constructed. Introduction of these plasmids into R. etli revealed IntA-dependent recombination events occurring at high frequency. Interestingly, IntA promotes not only integration, but also excision events, albeit at a lower frequency. Thus, R. etli IntA appears to be a bidirectional recombinase. IntA was purified and used to set up electrophoretic mobility shift assays with linear fragments containing attA and attD. IntA-dependent retarded complexes were observed only with fragments containing either attA or attD. Specific retarded complexes, as well as normal in vivo recombination abilities, were seen even in derivatives harboring only a minimal attachment region (comprising the 5-bp central region flanked by 9- to 11-bp inverted repeats). DNase I-footprinting assays with IntA revealed specific protection of these zones. Mutations that disrupt the integrity of the 9- to 11-bp inverted repeats abolish both specific binding and recombination ability, while mutations in the 5-bp central region severely reduce both binding and recombination. These results show that IntA is a bidirectional recombinase that binds to att regions without requiring neighboring sequences as enhancers of recombination. PMID:23935046

  19. Information Transfer Analysis of Spontaneous Low-frequency Fluctuations in Cerebral Hemodynamics and Cardiovascular Dynamics

    NASA Astrophysics Data System (ADS)

    Katura, Takusige; Tanaka, Naoki; Obata, Akiko; Sato, Hiroki; Maki, Atsushi

    2005-08-01

    In this study, from the information-theoretic viewpoint, we analyzed the interrelation between the spontaneous low-frequency fluctuations around 0.1Hz in the hemoglobin concentration in the cerebral cortex, mean arterial blood pressure and the heart rate. For this analysis, as measures of information transfer, we used transfer entropy (TE) proposed for two-factor systems by Schreiber and intrinsic transfer entropy (ITE) introduced for further analysis of three-factor systems by extending the original TE. In our analysis, information transfer analysis based on both TE and ITE suggests the systemic cardiovascular fluctuations alone cannot account for the cerebrovascular fluctuations, that is, the regulation of the regional cerebral energetic metabolism is important as a candidate of its generation mechanism Such an information transfer analysis seems useful to reveal the interrelation between the elements regulated each other in a complex manner.

  20. Experimental Determination of Operating and Maximum Power Transfer Efficiencies at Resonant Frequency in a Wireless Power Transfer System using PP Network Topology with Top Coupling

    NASA Astrophysics Data System (ADS)

    Ramachandran, Hema; Pillai, K. P. P.; Bindu, G. R.

    2017-08-01

    A two-port network model for a wireless power transfer system taking into account the distributed capacitances using PP network topology with top coupling is developed in this work. The operating and maximum power transfer efficiencies are determined analytically in terms of S-parameters. The system performance predicted by the model is verified with an experiment consisting of a high power home light load of 230 V, 100 W and is tested for two forced resonant frequencies namely, 600 kHz and 1.2 MHz. The experimental results are in close agreement with the proposed model.

  1. Frequency Domain Modelling of Electromagnetic Wave Propagation in Layered Media

    NASA Astrophysics Data System (ADS)

    Schmidt, Felix; Lünenschloss, Peter; Mai, Juliane; Wagner, Norman; Töpfer, Hannes; Bumberger, Jan

    2016-04-01

    The amount of water in porous media such as soils and rocks is a key parameter when water resources are under investigation. Especially the quantitative spatial distribution and temporal evolution of water contents in soil formations are needed. In high frequency electromagnetic applications soil water content is quantitatively derived from the propagation behavior of electromagnetic waves along waveguides embedded in soil formations. The spatial distribution of the dielectric material properties along the waveguide can be estimated by numerical solving of the inverse problem based on the full wave forward model in time or frequency domain. However, current approaches mostly neglect or approximate the frequency dependence of the electromagnetic material properties of transfer function of the waveguide. As a first prove of concept a full two port broadband frequency domain forward model for propagation of transverse electromagnetic (TEM) waves in coaxial waveguide has been implemented. It is based on the propagation matrix approach for layered transmission line sections. Depending on the complexity of the material different models for the frequency dependent complex permittivity were applied. For the validation of the model a broadband frequency domain measurement with network analyzer technique was used. The measurement is based on a 20 cm long 50 Ohm 20/46 coaxial transmission line cell considering inhomogeneous material distributions. This approach allows (i) an increase of the waveguide calibration accuracy in comparison to conventional TDR based technique and (ii) the consideration of the broadband permittivity spectrum of the porous material. In order to systematic analyze the model, theoretical results were compared with measurements as well as 3D broadband finite element modeling of homogeneous and layered media in the coaxial transmission line cell. Defined standards (Teflon, dry glass beads, de-ionized water) were placed inside the line as the dielectric layers in different configurations. With a Thru Reflect Line calibration (TRL) the influences of connectors and adapters at the coaxial line sample holder were removed. The combination of the full two port calibration procedure and broadband modeling approach turns out to achieve a good accordance of modeling and experimental results. The next step is the implementation of an inversion to calculate the material parameters of every layer out of the s-parameters of the layered sample.

  2. Frequency Domain Modelling of Electromagnetic Wave Propagation in Layered Media

    NASA Astrophysics Data System (ADS)

    Schmidt, Felix; Wagner, Norman; Lünenschloß, Peter; Toepfer, Hannes; Dietrich, Peter; Kaliorias, Andreas; Bumberger, Jan

    2015-04-01

    The amount of water in porous media such as soils and rocks is a key parameter when water resources are under investigation. Especially the quantitative spatial distribution and temporal evolution of water contents in soil formations are needed. In high frequency electromagnetic applications soil water content is quantitatively derived from the propagation behavior of electromagnetic waves along waveguides embedded in soil formations. The spatial distribution of the dielectric material properties along the waveguide can be estimated by numerical solving of the inverse problem based on the full wave forward model in time or frequency domain. However, current approaches mostly neglect or approximate the frequency dependence of the electromagnetic material properties of transfer function of the waveguide. As a first prove of concept a full two port broadband frequency domain forward model for propagation of transverse electromagnetic (TEM) waves in coaxial waveguide has been implemented. It is based on the propagation matrix approach for layered transmission line sections Depending on the complexity of the material different models for the frequency dependent complex permittivity were applied. For the validation of the model a broadband frequency domain measurement with network analyzer technique was used. The measurement is based on a 20 cm long 50 Ohm 20/46 coaxial transmission line cell considering inhomogeneous material distributions. This approach allows (i) an increase of the waveguide calibration accuracy in comparison to conventional TDR based technique and (ii) the consideration of the broadband permittivity spectrum of the porous material. In order to systematic analyze the model, theoretical results were compared with measurements as well as 3D broadband finite element modeling of homogeneous and layered media in the coaxial transmission line cell. Defined standards (Teflon, dry glass beads, de-ionized water) were placed inside the line as the dielectric layers in different configurations. With a Thru Reflect Line calibration (TRL) the influences of connectors and adapters at the coaxial line sample holder were removed. The combination of the full two port calibration procedure and broadband modeling approach turns out to achieve a good accordance of modeling and experimental results. The next step is the implementation of an inversion to calculate the material parameters of every layer out of the s-parameters of the layered sample.

  3. Transfer of Solutions to Conditional Probability Problems: Effects of Example Problem Format, Solution Format, and Problem Context

    ERIC Educational Resources Information Center

    Chow, Alan F.; Van Haneghan, James P.

    2016-01-01

    This study reports the results of a study examining how easily students are able to transfer frequency solutions to conditional probability problems to novel situations. University students studied either a problem solved using the traditional Bayes formula format or using a natural frequency (tree diagram) format. In addition, the example problem…

  4. Dynamic impedance compensation for wireless power transfer using conjugate power

    NASA Astrophysics Data System (ADS)

    Liu, Suqi; Tan, Jianping; Wen, Xue

    2018-02-01

    Wireless power transfer (WPT) via coupled magnetic resonances has been in development for over a decade. However, the frequency splitting phenomenon occurs in the over-coupled region. Thus, the output power of the two-coil system achieves the maximum output power at the two splitting angular frequencies, and not at the natural resonant angular frequency. According to the maximum power transfer theorem, the impedance compensation method was adopted in many WPT projects. However, it remains a challenge to achieve the maximum output power and transmission efficiency in a fixed-frequency mode. In this study, dynamic impedance compensation for WPT was presented by utilizing the compensator within a virtual three-coil WPT system. First, the circuit model was established and transfer characteristics of a system were studied by utilizing circuit theories. Second, the power superposition of the WPT system was carefully researched. When a pair of compensating coils was inserted into the transmitter loop, the conjugate power of the compensator loop was created via magnetic coupling of the two compensating coils that insert into the transmitter loop. The mechanism for dynamic impedance compensation for wireless power transfer was then provided by investigating a virtual three-coil WPT system. Finally, the experimental circuit of a virtual three-coil WPT system was designed, and experimental results are consistent with the theoretical analysis, which achieves the maximum output power and transmission efficiency.

  5. An investigation of soil-structure interaction effects observed at the MIT Green Building

    USGS Publications Warehouse

    Taciroglu, Ertugrul; Çelebi, Mehmet; Ghahari, S. Farid; Abazarsa, Fariba

    2016-01-01

    The soil-foundation impedance function of the MIT Green Building is identified from its response signals recorded during an earthquake. Estimation of foundation impedance functions from seismic response signals is a challenging task, because: (1) the foundation input motions (FIMs) are not directly measurable, (2) the as-built properties of the super-structure are only approximately known, and (3) the soil-foundation impedance functions are inherently frequency-dependent. In the present study, aforementioned difficulties are circumvented by using, in succession, a blind modal identification (BMID) method, a simplified Timoshenko beam model (TBM), and a parametric updating of transfer functions (TFs). First, the flexible-base modal properties of the building are identified from response signals using the BMID method. Then, a flexible-base TBM is updated using the identified modal data. Finally, the frequency-dependent soil-foundation impedance function is estimated by minimizing the discrepancy between TFs (of pairs instrumented floors) that are (1) obtained experimentally from earthquake data and (2) analytically from the updated TBM. Using the fully identified flexible-base TBM, the FIMs as well as building responses at locations without instruments can be predicted, as demonstrated in the present study.

  6. Time-dependent electrokinetic flows of non-Newtonian fluids in microchannel-array for energy conversion

    NASA Astrophysics Data System (ADS)

    Chun, Myung-Suk; Chun, Byoungjin; Lee, Ji-Young; Complex Fluids Team

    2016-11-01

    We investigate the externally time-dependent pulsatile electrokinetic viscous flows by extending the previous simulations concerning the electrokinetic microfluidics for different geometries. The external body force originated from between the nonlinear Poisson-Boltzmann field and the flow-induced electric field is employed in the Cauchy momentum equation, and then the Nernst-Planck equation in connection with the net current conservation is coupled. Our explicit model allows one to quantify the effects of the oscillating frequency and conductance of the Stern layer, considering the shear thinning effect and the strong electric double layer interaction. This presentation reports the new results regarding the implication of optimum frequency pressure pulsations toward realizing mechanical to electrical energy transfer with high conversion efficiencies. These combined factors for different channel dimension are examined in depth to obtain possible enhancements of streaming current, with taking advantage of pulsating pressure field. From experimental verifications by using electrokinetic power chip, it is concluded that our theoretical framework can serve as a useful basis for micro/nanofluidics design and potential applications to the enhanced energy conversion. NRF of Korea (No.2015R1A2A1A15052979) and KIST (No.2E26490).

  7. Oxygen transfer phenomena in 48-well microtiter plates: determination by optical monitoring of sulfite oxidation and verification by real-time measurement during microbial growth.

    PubMed

    Kensy, Frank; Zimmermann, Hartmut F; Knabben, Ingo; Anderlei, Tibor; Trauthwein, Harald; Dingerdissen, Uwe; Büchs, Jochen

    2005-03-20

    Oxygen limitation is one of the most frequent problems associated with the application of shaking bioreactors. The gas-liquid oxygen transfer properties of shaken 48-well microtiter plates (MTPs) were analyzed at different filling volumes, shaking diameters, and shaking frequencies. On the one hand, an optical method based on sulfite oxidation was used as a chemical model system to determine the maximum oxygen transfer capacity (OTR(max)). On the other hand, the Respiration Activity Monitoring System (RAMOS) was applied for online measurement of the oxygen transfer rate (OTR) during growth of the methylotropic yeast Hansenula polymorpha. A proportionality constant between the OTR(max) of the biological system and the OTR(max) of the chemical system were indicated from these data, offering the possibility to transform the whole set of chemical data to biologically relevant conditions. The results exposed "out of phase" shaking conditions at a shaking diameter of 1 mm, which were confirmed by theoretical consideration with the phase number (Ph). At larger shaking diameters (2-50 mm) the oxygen transfer rate in MTPs shaken at high frequencies reached values of up to 0.28 mol/L/h, corresponding to a volumetric mass transfer coefficient (k(L)a) of 1,600 1/h. The specific mass transfer area (a) increases exponentially with the shaking frequency up to values of 2,400 1/m. On the contrary, the mass transfer coefficient (k(L)) is constant at a level of about 0.15 m/h over a wide range of shaking frequencies and shaking diameters. However, at high shaking frequencies, when the complete liquid volume forms a thin film on the cylindric wall of the well, the mass transfer coefficient (k(L)) increases linearly to values of up to 0.76 m/h. Essentially, the present investigation demonstrates that the 48-well plate outperforms the 96-well MTP and shake flasks at widely used operating conditions with respect to oxygen supply. The 48-well plates emerge, therefore, as an excellent alternative for microbial cultivation and expression studies combining the advantages of both the high-throughput 96-well MTP and the classical shaken Erlenmeyer flask.

  8. Laser frequency stabilization and shifting by using modulation transfer spectroscopy

    NASA Astrophysics Data System (ADS)

    Cheng, Bing; Wang, Zhao-Ying; Wu, Bin; Xu, Ao-Peng; Wang, Qi-Yu; Xu, Yun-Fei; Lin, Qiang

    2014-10-01

    The stabilizing and shifting of laser frequency are very important for the interaction between the laser and atoms. The modulation transfer spectroscopy for the 87Rb atom with D2 line transition F = 2 → F' = 3 is used for stabilizing and shifting the frequency of the external cavity grating feedback diode laser. The resonant phase modulator with electro—optical effect is used to generate frequency sideband to lock the laser frequency. In the locking scheme, circularly polarized pump- and probe-beams are used. By optimizing the temperature of the vapor, the pump- and probe-beam intensity, the laser linewidth of 280 kHz is obtained. Furthermore, the magnetic field generated by a solenoid is added into the system. Therefore the system can achieve the frequency locking at any point in a range of hundreds of megahertz frequency shifting with very low power loss.

  9. Laser frequency stabilization by combining modulation transfer and frequency modulation spectroscopy.

    PubMed

    Zi, Fei; Wu, Xuejian; Zhong, Weicheng; Parker, Richard H; Yu, Chenghui; Budker, Simon; Lu, Xuanhui; Müller, Holger

    2017-04-01

    We present a hybrid laser frequency stabilization method combining modulation transfer spectroscopy (MTS) and frequency modulation spectroscopy (FMS) for the cesium D2 transition. In a typical pump-probe setup, the error signal is a combination of the DC-coupled MTS error signal and the AC-coupled FMS error signal. This combines the long-term stability of the former with the high signal-to-noise ratio of the latter. In addition, we enhance the long-term frequency stability with laser intensity stabilization. By measuring the frequency difference between two independent hybrid spectroscopies, we investigate the short-and long-term stability. We find a long-term stability of 7.8 kHz characterized by a standard deviation of the beating frequency drift over the course of 10 h and a short-term stability of 1.9 kHz characterized by an Allan deviation of that at 2 s of integration time.

  10. Effect of soil temperature on optical frequency transfer through unidirectional dense-wavelength-division-multiplexing fiber-optic links.

    PubMed

    Pinkert, T J; Böll, O; Willmann, L; Jansen, G S M; Dijck, E A; Groeneveld, B G H M; Smets, R; Bosveld, F C; Ubachs, W; Jungmann, K; Eikema, K S E; Koelemeij, J C J

    2015-02-01

    Results of optical frequency transfer over a carrier-grade dense-wavelength-division-multiplexing (DWDM) optical fiber network are presented. The relation between soil temperature changes on a buried optical fiber and frequency changes of an optical carrier through the fiber is modeled. Soil temperatures, measured at various depths by the Royal Netherlands Meteorology Institute (KNMI) are compared with observed frequency variations through this model. A comparison of a nine-day record of optical frequency measurements through the 2×298  km fiber link with soil temperature data shows qualitative agreement. A soil temperature model is used to predict the link stability over longer periods (days-months-years). We show that optical frequency dissemination is sufficiently stable to distribute and compare, e.g., rubidium frequency standards over standard DWDM optical fiber networks using unidirectional fibers.

  11. Real-time photonic sampling with improved signal-to-noise and distortion ratio using polarization-dependent modulators

    NASA Astrophysics Data System (ADS)

    Liang, Dong; Zhang, Zhiyao; Liu, Yong; Li, Xiaojun; Jiang, Wei; Tan, Qinggui

    2018-04-01

    A real-time photonic sampling structure with effective nonlinearity suppression and excellent signal-to-noise ratio (SNR) performance is proposed. The key points of this scheme are the polarization-dependent modulators (P-DMZMs) and the sagnac loop structure. Thanks to the polarization sensitive characteristic of P-DMZMs, the differences between transfer functions of the fundamental signal and the distortion become visible. Meanwhile, the selection of specific biases in P-DMZMs is helpful to achieve a preferable linearized performance with a low noise level for real-time photonic sampling. Compared with the quadrature-biased scheme, the proposed scheme is capable of valid nonlinearity suppression and is able to provide a better SNR performance even in a large frequency range. The proposed scheme is proved to be effective and easily implemented for real time photonic applications.

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Perceptual Space of Superimposed Dual-Frequency Vibrations in the Hands.

    PubMed

    Hwang, Inwook; Seo, Jeongil; Choi, Seungmoon

    2017-01-01

    The use of distinguishable complex vibrations that have multiple spectral components can improve the transfer of information by vibrotactile interfaces. We investigated the qualitative characteristics of dual-frequency vibrations as the simplest complex vibrations compared to single-frequency vibrations. Two psychophysical experiments were conducted to elucidate the perceptual characteristics of these vibrations by measuring the perceptual distances among single-frequency and dual-frequency vibrations. The perceptual distances of dual-frequency vibrations between their two frequency components along their relative intensity ratio were measured in Experiment I. The estimated perceptual spaces for three frequency conditions showed non-linear perceptual differences between the dual-frequency and single-frequency vibrations. A perceptual space was estimated from the measured perceptual distances among ten dual-frequency compositions and five single-frequency vibrations in Experiment II. The effect of the component frequency and the frequency ratio was revealed in the perceptual space. In a percept of dual-frequency vibration, the lower frequency component showed a dominant effect. Additionally, the perceptual difference among single-frequency and dual-frequency vibrations were increased with a low relative difference between two frequencies of a dual-frequency vibration. These results are expected to provide a fundamental understanding about the perception of complex vibrations to enrich the transfer of information using vibrotactile stimuli.

  14. Probing and Exploiting the Interplay between Nuclear and Electronic Motion in Charge Transfer Processes.

    PubMed

    Delor, Milan; Sazanovich, Igor V; Towrie, Michael; Weinstein, Julia A

    2015-04-21

    The Born-Oppenheimer approximation refers to the assumption that the nuclear and electronic wave functions describing a molecular system evolve and can be determined independently. It is now well-known that this approximation often breaks down and that nuclear-electronic (vibronic) coupling contributes greatly to the ultrafast photophysics and photochemistry observed in many systems ranging from simple molecules to biological organisms. In order to probe vibronic coupling in a time-dependent manner, one must use spectroscopic tools capable of correlating the motions of electrons and nuclei on an ultrafast time scale. Recent developments in nonlinear multidimensional electronic and vibrational spectroscopies allow monitoring both electronic and structural factors with unprecedented time and spatial resolution. In this Account, we present recent studies from our group that make use of different variants of frequency-domain transient two-dimensional infrared (T-2DIR) spectroscopy, a pulse sequence combining electronic and vibrational excitations in the form of a UV-visible pump, a narrowband (12 cm(-1)) IR pump, and a broadband (400 cm(-1)) IR probe. In the first example, T-2DIR is used to directly compare vibrational dynamics in the ground and relaxed electronic excited states of Re(Cl)(CO)3(4,4'-diethylester-2,2'-bipyridine) and Ru(4,4'-diethylester-2,2'-bipyridine)2(NCS)2, prototypical charge transfer complexes used in photocatalytic CO2 reduction and electron injection in dye-sensitized solar cells. The experiments show that intramolecular vibrational redistribution (IVR) and vibrational energy transfer (VET) are up to an order of magnitude faster in the triplet charge transfer excited state than in the ground state. These results show the influence of electronic arrangement on vibrational coupling patterns, with direct implications for vibronic coupling mechanisms in charge transfer excited states. In the second example, we show unambiguously that electronic and vibrational movement are coupled in a donor-bridge-acceptor complex based on a Pt(II) trans-acetylide design motif. Time-resolved IR (TRIR) spectroscopy reveals that the rate of electron transfer (ET) is highly dependent on the amount of excess energy localized on the bridge following electronic excitation. Using an adaptation of T-2DIR, we are able to selectively perturb bridge-localized vibrational modes during charge separation, resulting in the donor-acceptor charge separation pathway being completely switched off, with all excess energy redirected toward the formation of a long-lived intraligand triplet state. A series of control experiments reveal that this effect is mode specific: it is only when the high-frequency bridging C≡C stretching mode is pumped that radical changes in photoproduct yields are observed. These experiments therefore suggest that one may perturb electronic movement by stimulating structural motion along the reaction coordinate using IR light. These studies add to a growing body of evidence suggesting that controlling the pathways and efficiency of charge transfer may be achieved through synthetic and perturbative approaches aiming to modulate vibronic coupling. Achieving such control would represent a breakthrough for charge transfer-based applications such as solar energy conversion and molecular electronics.

  15. FREQ: A computational package for multivariable system loop-shaping procedures

    NASA Technical Reports Server (NTRS)

    Giesy, Daniel P.; Armstrong, Ernest S.

    1989-01-01

    Many approaches in the field of linear, multivariable time-invariant systems analysis and controller synthesis employ loop-sharing procedures wherein design parameters are chosen to shape frequency-response singular value plots of selected transfer matrices. A software package, FREQ, is documented for computing within on unified framework many of the most used multivariable transfer matrices for both continuous and discrete systems. The matrices are evaluated at user-selected frequency-response values, and singular values against frequency. Example computations are presented to demonstrate the use of the FREQ code.

  16. Modulation Transfer Through Coherence and Its Application to Atomic Frequency Offset Locking

    NASA Astrophysics Data System (ADS)

    Jagatap, B. N.; Ray, Ayan; Kale, Y. B.; Singh, Niharika; Lawande, Q. V.

    We discuss the process of modulation transfer in a coherently prepared three-level atomic medium and its prospective application to atomic frequency offset locking (AFOL). The issue of modulation transfer through coherence is treated in the framework of temporal evolution of dressed atomic system with externally superimposed deterministic flow. This dynamical description of the atom-field system offers distinctive advantage of using a single modulation source to dither passively the coherent phenomenon as probed by an independent laser system under pump-probe configuration. Modulation transfer is demonstrated experimentally using frequency modulation spectroscopy on a subnatural linewidth electromagnetically induced transparency (EIT) and a sub-Doppler linewidth Autler-Townes (AT) resonance in Doppler broadened alkali vapor medium, and AFOL is realized by stabilizing the probe laser on the first/third derivative signals. The stability of AFOL is discussed in terms of the frequency noise power spectral density and Allan variance. Analysis of AFOL schemes is carried out at the backdrop of closed loop active frequency control in a conventional master-slave scheme to point out the contrasting behavior of AFOL schemes based on EIT and AT resonances. This work adds up to the discussion on the subtle link between dressed state spectroscopy and AFOL, which is relevant for developing a master-slave type laser system in the domain of coherent photon-atom interaction.

  17. Biomass drying in a pulsed fluidized bed without inert bed particles

    DOE PAGES

    Jia, Dening; Bi, Xiaotao; Lim, C. Jim; ...

    2016-08-29

    Batch drying was performed in the pulsed fluidized bed with various species of biomass particles as an indicator of gas–solid contact efficiency and mass transfer rate under different operating conditions including pulsation duty cycle and particle size distribution. The fluidization of cohesive biomass particles benefited from the shorter opening time of pulsed gas flow and increased peak pressure drop. The presence of fines enhanced gas–solid contact of large and irregular biomass particles, as well as the mass transfer efficiency. A drying model based on two-phase theory was proposed, from which effective diffusivity was calculated for various gas flow rates, temperaturemore » and pulsation frequency. Intricate relationship was discovered between pulsation frequency and effective diffusivity, as mass transfer was deeply connected with the hydrodynamics. Effective diffusivity was also found to be proportional to gas flow rate and drying temperature. In conclusion, operating near the natural frequency of the system also favored drying and mass transfer.« less

  18. Parameter Estimation of Actuators for Benchmark Active Control Technology (BACT) Wind Tunnel Model with Analysis of Wear and Aerodynamic Loading Effects

    NASA Technical Reports Server (NTRS)

    Waszak, Martin R.; Fung, Jimmy

    1998-01-01

    This report describes the development of transfer function models for the trailing-edge and upper and lower spoiler actuators of the Benchmark Active Control Technology (BACT) wind tunnel model for application to control system analysis and design. A simple nonlinear least-squares parameter estimation approach is applied to determine transfer function parameters from frequency response data. Unconstrained quasi-Newton minimization of weighted frequency response error was employed to estimate the transfer function parameters. An analysis of the behavior of the actuators over time to assess the effects of wear and aerodynamic load by using the transfer function models is also presented. The frequency responses indicate consistent actuator behavior throughout the wind tunnel test and only slight degradation in effectiveness due to aerodynamic hinge loading. The resulting actuator models have been used in design, analysis, and simulation of controllers for the BACT to successfully suppress flutter over a wide range of conditions.

  19. Few-femtosecond-resolution characterization and suppression of excess timing jitter and drift in indoor atmospheric frequency comb transfer.

    PubMed

    Kang, Jinho; Shin, Junho; Kim, Chur; Jung, Kwangyun; Park, Suhyeon; Kim, Jungwon

    2014-10-20

    We characterize the timing jitter spectral density of the time-of-flight (TOF) in the indoor atmospheric transfer of optical pulse train over 10 decades of Fourier frequency range (10 μHz - 100 kHz) with sub-100-as resolution using a balanced optical cross-correlator (BOC). Based on the well-known theory for atmospheric transfer of a laser beam, we could fit the measured timing jitter power spectral density to the theory and analyze it with a fairly good agreement from 20 mHz to 10 Hz Fourier frequency range. Moreover, we demonstrate that the BOC-based timing stabilization method can suppress the excess fluctuations in timing from >200 fs (rms) to 2.6 fs (rms) maintained over 130 hours when an optical pulse train is transferred over a 76.2-m long free-space beam path in laboratory environment. The demonstrated stabilization result corresponds to 4 × 10(-20) overlapping Allan deviation at 117,000 s averaging time.

  20. Patient Transfers and Risk of Back Injury: Protocol for a Prospective Cohort Study With Technical Measurements of Exposure.

    PubMed

    Vinstrup, Jonas; Madeleine, Pascal; Jakobsen, Markus Due; Jay, Kenneth; Andersen, Lars Louis

    2017-11-08

    More than one third of nurses experience musculoskeletal pain several times during a normal work week. Consistent use of assistive devices during patient transfers is associated with a lower risk of occupational back injuries and low back pain (LBP). While uncertainties exist regarding which type of assistive devices most efficiently prevent LBP, exposure assessments using technological advancements allow for quantification of muscle load and body positions during common work tasks. The main objectives of this study are (1) to quantify low back and neck/shoulder muscle load in Danish nurses during patient transfers performed with different types of assistive devices, and (2) to combine the exposure profile for each type of assistive device with fortnightly questionnaires to identify the importance of muscle load (intensity and frequency of transfers) and body position (degree of back inclination and frequency) on LBP intensity and risk of back injury during a patient transfer. A combination of technical measurements (n=50) and a prospective study design (n=2000) will be applied on a cohort of female nurses in Danish hospitals. The technical measurements will be comprised of surface electromyography and accelerometers, with the aim of quantifying muscle load and body positions during various patient transfers, including different types of assistive devices throughout a workday. The study will thereby gather measurements during real-life working conditions. The prospective cohort study will consist of questionnaires at baseline and 1-year follow-up, as well as follow-up via email every other week for one year on questions regarding the frequency of patient transfers, use of assistive devices, intensity of LBP, and back injuries related to patient transfers. The objective measurements on muscle load and body positions during patient handlings will be applied to the fortnightly replies regarding frequency of patient transfer and use of different assistive devices, in order to identify risk factors for back injuries related to patient transfers and intensity of LBP. Data collection is scheduled to commence during the winter of 2017. The design of this study is novel in its combination of technical measurements applied on a prospective cohort, and the results will provide important information about which assistive devices are associated with intensity of LBP and risk of back injury related to patient transfers. Furthermore, this study will shed light on the dose-response relationship between intensity, duration, and frequency of patient transfers and the intensity of LPB in Danish nurses, and will thereby help to guide and improve electronic health practices among this population. ©Jonas Vinstrup, Pascal Madeleine, Markus Due Jakobsen, Kenneth Jay, Lars Louis Andersen. Originally published in JMIR Research Protocols (http://www.researchprotocols.org), 08.11.2017.

  1. Chemical Exchange Saturation Transfer (CEST): what is in a name and what isn’t?

    PubMed Central

    van Zijl, Peter C.M.; Yadav, Nirbhay N.

    2011-01-01

    Chemical exchange saturation transfer (CEST) imaging is a relatively new MRI contrast approach in which exogenous or endogenous compounds containing either exchangeable protons or exchangeable molecules are selectively saturated and, after transfer of this saturation, detected indirectly through the water signal with enhanced sensitivity. The focus of this review is on basic MR principles underlying CEST and similarities to and differences with conventional magnetization transfer contrast (MTC). In CEST MRI, transfer of magnetization is studied in mobile compounds instead of semisolids. Similar to MTC, CEST has contributions of both chemical exchange and dipolar cross-relaxation, but the latter can often be neglected if exchange is fast. Contrary to MTC, CEST imaging requires sufficiently slow exchange on the MR time scale to allow selective irradiation of the protons of interest. As a consequence, magnetic labeling is not limited to radio-frequency saturation but can be expanded with slower frequency-selective approaches such as inversion, gradient dephasing and frequency labeling. The basic theory, design criteria, and experimental issues for exchange transfer imaging are discussed. A new classification for CEST agents based on exchange type is proposed. The potential of this young field is discussed, especially with respect to in vivo application and translation to humans. PMID:21337419

  2. Compensating for Tissue Changes in an Ultrasonic Power Link for Implanted Medical Devices.

    PubMed

    Vihvelin, Hugo; Leadbetter, Jeff; Bance, Manohar; Brown, Jeremy A; Adamson, Robert B A

    2016-04-01

    Ultrasonic power transfer using piezoelectric devices is a promising wireless power transfer technology for biomedical implants. However, for sub-dermal implants where the separation between the transmitter and receiver is on the order of several acoustic wavelengths, the ultrasonic power transfer efficiency (PTE) is highly sensitive to the distance between the transmitter and receiver. This sensitivity can cause large swings in efficiency and presents a serious limitation on battery life and overall performance. A practical ultrasonic transcutaneous energy transfer (UTET) system design must accommodate different implant depths and unpredictable acoustic changes caused by tissue growth, hydration, ambient temperature, and movement. This paper describes a method used to compensate for acoustic separation distance by varying the transmit (Tx) frequency in a UTET system. In a benchtop UTET system we experimentally show that without compensation, power transfer efficiency can range from 9% to 25% as a 5 mm porcine tissue sample is manipulated to simulate in situ implant conditions. Using an active frequency compensation method, we show that the power transfer efficiency can be kept uniformly high, ranging from 20% to 27%. The frequency compensation strategy we propose is low-power, non-invasive, and uses only transmit-side measurements, making it suitable for active implanted medical device applications.

  3. Resonance line transfer calculations by doubling thin layers. I - Comparison with other techniques. II - The use of the R-parallel redistribution function. [planetary atmospheres

    NASA Technical Reports Server (NTRS)

    Yelle, Roger V.; Wallace, Lloyd

    1989-01-01

    A versatile and efficient technique for the solution of the resonance line scattering problem with frequency redistribution in planetary atmospheres is introduced. Similar to the doubling approach commonly used in monochromatic scattering problems, the technique has been extended to include the frequency dependence of the radiation field. Methods for solving problems with external or internal sources and coupled spectral lines are presented, along with comparison of some sample calculations with results from Monte Carlo and Feautrier techniques. The doubling technique has also been applied to the solution of resonance line scattering problems where the R-parallel redistribution function is appropriate, both neglecting and including polarization as developed by Yelle and Wallace (1989). With the constraint that the atmosphere is illuminated from the zenith, the only difficulty of consequence is that of performing precise frequency integrations over the line profiles. With that problem solved, it is no longer necessary to use the Monte Carlo method to solve this class of problem.

  4. Efficiency optimization of class-D biomedical inductive wireless power transfer systems by means of frequency adjustment.

    PubMed

    Schormans, Matthew; Valente, Virgilio; Demosthenous, Andreas

    2015-01-01

    Inductive powering for implanted medical devices is a commonly employed technique, that allows for implants to avoid more dangerous methods such as the use of transcutaneous wires or implanted batteries. However, wireless powering in this way also comes with a number of difficulties and conflicting requirements, which are often met by using designs based on compromise. In particular, one aspect common to most inductive power links is that they are driven with a fixed frequency, which may not be optimal depending on factors such as coupling and load. In this paper, a method is proposed in which an inductive power link is driven by a frequency that is maintained at an optimum value f(opt), to ensure that the link is in resonance. In order to maintain this resonance, a phase tracking technique is employed at the primary side of the link; this allows for compensation of changes in coil separation and load. The technique is shown to provide significant improvements in maintained secondary voltage and efficiency for a range of loads when the link is overcoupled.

  5. Treatment with Cefotaxime Affects Expression of Conjugation Associated Proteins and Conjugation Transfer Frequency of an IncI1 Plasmid in Escherichia coli

    PubMed Central

    Møller, Thea S. B.; Liu, Gang; Boysen, Anders; Thomsen, Line E.; Lüthje, Freja L.; Mortensen, Sisse; Møller-Jensen, Jakob; Olsen, John E.

    2017-01-01

    Horizontal gene transfer (HGT) is the major mechanism responsible for spread of antibiotic resistance. Antibiotic treatment has been suggested to promote HGT, either by directly affecting the conjugation process itself or by selecting for conjugations subsequent to DNA transfer. However, recent research suggests that the effect of antibiotic treatment on plasmid conjugation frequencies, and hence the spread of resistance plasmids, may have been overestimated. We addressed the question by quantifying transfer proteins and conjugation frequencies of a blaCTX−M−1 encoding IncI1 resistance plasmid in Escherichia coli MG1655 in the presence and absence of therapeutically relevant concentrations of cefotaxime (CTX). Analysis of the proteome by iTRAQ labeling and liquid chromatography tandem mass spectrometry revealed that Tra proteins were significantly up-regulated in the presence of CTX. The up-regulation of the transfer machinery was confirmed at the transcriptional level for five selected genes. The CTX treatment did not cause induction of the SOS-response as revealed by absence of significantly regulated SOS associated proteins in the proteome and no significant up-regulation of recA and sfiA genes. The frequency of plasmid conjugation, measured in an antibiotic free environment, increased significantly when the donor was pre-grown in broth containing CTX compared to growth without this drug, regardless of whether blaCTX-M-1 was located on the plasmid or in trans on the chromosome. The results shows that antibiotic treatment can affect expression of a plasmid conjugation machinery and subsequent DNA transfer. PMID:29238335

  6. Solar Radiation Measurements Onboard the Research Aircraft HALO

    NASA Astrophysics Data System (ADS)

    Lohse, I.; Bohn, B.; Werner, F.; Ehrlich, A.; Wendisch, M.

    2014-12-01

    Airborne measurements of the separated upward and downward components of solar spectral actinic flux densities for the determination of photolysis frequencies and of upward nadir spectral radiance were performed with the HALO Solar Radiation (HALO-SR) instrument package onboard the High Altitude and Long Range Research Aircraft (HALO). The instrumentation of HALO-SR is characterized and first measurement data from the Next-generation Aircraft Remote-Sensing for Validation Studies (NARVAL) campaigns in 2013 and 2014 are presented. The measured data are analyzed in the context of the retrieved microphysical and optical properties of clouds which were observed underneath the aircraft. Detailed angular sensitivities of the two optical actinic flux receivers were determined in the laboratory. The effects of deviations from the ideal response are investigated using radiative transfer calculations of atmospheric radiance distributions under various atmospheric conditions and different ground albedos. Corresponding correction factors are derived. Example photolysis frequencies are presented, which were sampled in the free troposphere and lower stratosphere over the Atlantic Ocean during the 2013/14 HALO NARVAL campaigns. Dependencies of photolysis frequencies on cloud cover, flight altitude and wavelength range of the photolysis process are investigated. Calculated actinic flux densities in the presence of clouds benefit from the measured spectral radiances. Retrieved cloud optical thicknesses and effective droplet radii are used as model input for the radiative transfer calculations. By comparison with the concurrent measurements of actinic flux densities the retrieval approach is validated. Acknowledgements: Funding by the Deutsche Forschungsgemeinschaft within the priority program HALO (BO 1580/4-1, WE 1900/21-1) is gratefully acknowledged.

  7. One-Way Temperature Compensated Fiber Link

    DTIC Science & Technology

    2011-05-01

    frequency is through two way satellite time and frequency transfer ( TWSTFT ). While it is practical for transmitting time and frequency over long distance...the performance is not acceptable for some of the newer high quality clocks. Currently, TWSTFT can transmit frequencies with instabilities at the

  8. Prediction and reduction of aircraft noise in outdoor environments

    NASA Astrophysics Data System (ADS)

    Tong, Bao N.

    This dissertation investigates the noise due to an en-route aircraft cruising at high altitudes. It offers an improved understanding into the combined effects of atmospheric propagation, ground reflection, and source motion on the impact of en-route aircraft noise. A numerical model has been developed to compute pressure time-histories due to a uniformly moving source above a flat ground surface in the presence of a horizontally stratified atmosphere. For a moving source at high elevations, contributions from a direct and specularly reflected wave are sufficient in predicting the sound field close to the ground. In the absence of wind effects, the predicted sound field from a single overhead flight trajectory can be used to interpolate pressure time histories at all other receiver locations via a simplified ray model for the incoherent sound field. This approach provides an efficient method for generating pressure time histories in a three-dimensional space for noise impact studies. A variety of different noise propagation methods are adapted to a uniformly moving source to evaluate the accuracy and efficiency of their predictions. The techniques include: analytical methods, the Fast Field Program (FFP), and asymptotic analysis methods (e.g., ray tracing and more advanced formulations). Source motion effects are introduced via either a retarded time analysis or a Lorentz transform approach depending on the complexity of the problem. The noise spectrum from a single emission frequency, moving source has broadband characteristics. This is a consequence of the Doppler shift which continuously modifies the perceived frequency of the source as it moves relative to a stationary observer on the ground. Thus, the instantaneous wavefronts must be considered in both the frequency dependent ground impedance model and the atmospheric absorption model. It can be shown that the Doppler factor is invariant along each ray path. This gives rise to a path dependent atmospheric absorption mechanism due to the source's motion. To help mitigate the noise that propagates to the ground, multi-layered acoustic treatments can be applied to provide good performance over a wide range of frequencies. An accurate representation of material properties for each of the constituent layers is needed in the design of such treatments. The parameter of interest is the specific acoustic impedance, which can be obtained via inversion of acoustic transfer function measurements. However, several different impedance values can correspond to the same sound field predictions. The boundary loss factor F (associated with spherical wave reflection) is the source of this ambiguity. A method for identifying the family of solutions and selecting the physically meaningful branch is proposed to resolve this non-uniqueness issue. Accurate deduction of the acoustic impedance depends on precise measurements of the acoustic transfer function. However, measurement uncertainties exists in both the magnitude and the phase of the acoustic transfer function. The ASA/ANSI S1.18 standard impedance deduction method uses phase information, which can be unreliable in many outdoor environments. An improved technique which only relies on magnitude information is developed in this dissertation. A selection of optimal geometries become necessary to reduce the sensitivity of the deduced impedance to small variations in the measured data. A graphical approach is provided which offers greater insight into the optimization problem. A downhill simplex algorithm has been implemented to automate the impedance deduction procedure. Physical constraints are applied to limit the search region and to eliminate rogue solutions. Several case studies consisting of both indoor and outdoor acoustical measurements are presented to validate the proposed technique. The current analysis is limited to locally reacting materials where the acoustic impedance does not depend on the incidence angle of the reflected wave.

  9. Doppler-resolved kinetics of saturation recovery

    DOE PAGES

    Forthomme, Damien; Hause, Michael L.; Yu, Hua -Gen; ...

    2015-04-08

    Frequency modulated laser transient absorption has been used to monitor the ground state rotational energy transfer rates of CN radicals in a double-resonance, depletion recovery experiment. When a pulsed laser is used to burn a hole in the equilibrium ground state population of one rotational state without velocity selection, the population recovery rate is found to depend strongly on the Doppler detuning of a narrow-band probe laser. Similar effects should be apparent for any relaxation rate process that competes effectively with velocity randomization. Alternative methods of extracting thermal rate constants in the presence of these non-thermal conditions are evaluated. Totalmore » recovery rate constants, analogous to total removal rate constants in an experiment preparing a single initial rotational level, are in good agreement with quantum scattering calculations, but are slower than previously reported experiments and show qualitatively different rotational state dependence between Ar and He collision partners. As a result, quasi-classical trajectory studies confirm that the differing rotational state dependence is primarily a kinematic effect.« less

  10. Camphor Plasmid-Mediated Chromosomal Transfer in Pseudomonas putida

    PubMed Central

    Shaham, M.; Chakrabarty, A. M.; Gunsalus, I. C.

    1973-01-01

    Camphor-utilizing strains of Pseudomonas putida have been shown to carry the genetic information required for camphor degradation on a plasmid. The plasmid-carrying strains can serve as donors of both plasmid-borne and chromosomal genes. As recipients, plasmid-deleted strains are much superior to those carrying the camphor pathway genes. The transfer frequency of chromosomal, but not plasmid-borne, genes is markedly enhanced if the donor cells are irradiated with ultraviolet light followed by 3-h of growth on a rich medium in the dark. Recombinants selected for prototrophy are stable and most acquire the camphor (CAM) plasmid concomitantly; only a few of the Cam+ recombinants inherit the donor's ability to transfer chromosomal genes at a high frequency. Transfer-defective mutations occur on the CAM plasmid, affecting both CAM and chromosomal gene transfer. PMID:4745436

  11. Nucleate boiling performance evaluation of cavities at mesoscale level

    DOE PAGES

    Mu, Yu-Tong; Chen, Li; He, Ya-Ling; ...

    2016-09-29

    Nucleate boiling heat transfer (NBHT) from enhanced structures is an effective way to dissipate high heat flux. Here, a 3D multi-relaxation-time (MRT) phase-change lattice Boltzmann method in conjunction with conjugated heat transfer treatment is proposed and then applied to the study of cavities behaviours for nucleation on roughened surfaces for an entire ebullition cycle without introducing any artificial disturbance. The bubble departure diameter, departure frequency and total boiling heat transfer rate are also explored. We demonstrate that the cavity shapes show significant influence on the features of NBHT. The total heat transfer rate increases with the cavity mouth and cavitymore » base area while decreases with the increase in cavity bottom wall thickness. The cavity with low wetting can enhance the heat transfer and improve the bubble release frequency.« less

  12. Selective visual scaling of time-scale processes facilitates broadband learning of isometric force frequency tracking.

    PubMed

    King, Adam C; Newell, Karl M

    2015-10-01

    The experiment investigated the effect of selectively augmenting faster time scales of visual feedback information on the learning and transfer of continuous isometric force tracking tasks to test the generality of the self-organization of 1/f properties of force output. Three experimental groups tracked an irregular target pattern either under a standard fixed gain condition or with selectively enhancement in the visual feedback display of intermediate (4-8 Hz) or high (8-12 Hz) frequency components of the force output. All groups reduced tracking error over practice, with the error lowest in the intermediate scaling condition followed by the high scaling and fixed gain conditions, respectively. Selective visual scaling induced persistent changes across the frequency spectrum, with the strongest effect in the intermediate scaling condition and positive transfer to novel feedback displays. The findings reveal an interdependence of the timescales in the learning and transfer of isometric force output frequency structures consistent with 1/f process models of the time scales of motor output variability.

  13. Linear and nonlinear Biot waves in a noncohesive granular medium slab: transfer function, self-action, second harmonic generation.

    PubMed

    Legland, J-B; Tournat, V; Dazel, O; Novak, A; Gusev, V

    2012-06-01

    Experimental results are reported on second harmonic generation and self-action in a noncohesive granular medium supporting wave energy propagation both in the solid frame and in the saturating fluid. The acoustic transfer function of the probed granular slab can be separated into two main frequency regions: a low frequency region where the wave propagation is controlled by the solid skeleton elastic properties, and a higher frequency region where the behavior is dominantly due to the air saturating the beads. Experimental results agree well with a recently developed nonlinear Biot wave model applied to granular media. The linear transfer function, second harmonic generation, and self-action effect are studied as a function of bead diameter, compaction step, excitation amplitude, and frequency. This parametric study allows one to isolate different propagation regimes involving a range of described and interpreted linear and nonlinear processes that are encountered in granular media experiments. In particular, a theoretical interpretation is proposed for the observed strong self-action effect.

  14. Vibrational tug-of-war: The pKA dependence of the broad vibrational features of strongly hydrogen-bonded carboxylic acids.

    PubMed

    Van Hoozen, Brian L; Petersen, Poul B

    2018-04-07

    Medium and strong hydrogen bonds give rise to broad vibrational features frequently spanning several hundred wavenumbers and oftentimes exhibiting unusual substructures. These broad vibrational features can be modeled from first principles, in a reduced dimensional calculation, that adiabatically separates low-frequency modes, which modulate the hydrogen bond length, from high-frequency OH stretch and bend modes that contribute to the vibrational structure. Previously this method was used to investigate the origin of an unusual vibrational feature frequently found in the spectra of dimers between carboxylic acids and nitrogen-containing aromatic bases that spans over 900 cm -1 and contains two broad peaks. It was found that the width of this feature largely originates from low-frequency modes modulating the hydrogen bond length and that the structure results from Fermi resonance interactions. In this report, we examine how these features change with the relative acid and base strength of the components as reflected by their aqueous pK A values. Dimers with large pK A differences are found to have features that can extend to frequencies below 1000 cm -1 . The relationships between mean OH/NH frequency, aqueous pK A , and O-N distance are examined in order to obtain a more rigorous understanding of the origin and shape of the vibrational features. The mean OH/NH frequencies are found to correlate well with O-N distances. The lowest OH stretch frequencies are found in dimer geometries with O-N distances between 2.5 and 2.6 Å. At larger O-N distances, the hydrogen bonding interaction is not as strong, resulting in higher OH stretch frequencies. When the O-N distance is smaller than 2.5 Å, the limited space between the O and N determines the OH stretch frequency, which gives rise to frequencies that decrease with O-N distances. These two effects place a lower limit on the OH stretch frequency which is calculated to be near 700 cm -1 . Understanding how the vibrational features of strongly hydrogen-bonded structures depend on the relative pK A and other structural parameters will guide studies of biological structures and analysis of proton transfer studies using photoacids.

  15. Spectral modification of seismic waves propagating through solids exhibiting a resonance frequency: a 1-D coupled wave propagation-oscillation model

    NASA Astrophysics Data System (ADS)

    Frehner, Marcel; Schmalholz, Stefan M.; Podladchikov, Yuri

    2009-02-01

    A 1-D model is presented that couples the microscale oscillations of non-wetting fluid blobs in a partially saturated poroelastic medium with the macroscale wave propagation through the elastic skeleton. The fluid oscillations are caused by surface tension forces that act as the restoring forces driving the oscillations. The oscillations are described mathematically with the equation for a linear oscillator and the wave propagation is described with the 1-D elastic wave equation. Coupling is done using Hamilton's variational principle for continuous systems. The resulting linear system of two partial differential equations is solved numerically with explicit finite differences. Numerical simulations are used to analyse the effect of solids exhibiting internal oscillations, and consequently a resonance frequency, on seismic waves propagating through such media. The phase velocity dispersion relation shows a higher phase velocity in the high-frequency limit and a lower phase velocity in the low-frequency limit. At the resonance frequency a singularity in the dispersion relation occurs. Seismic waves can initiate oscillations of the fluid by transferring energy from solid to fluid at the resonance frequency. Due to this transfer, the spectral amplitude of the solid particle velocity decreases at the resonance frequency. After initiation, the oscillatory movement of the fluid continuously transfers energy at the resonance frequency back to the solid. Therefore, the spectral amplitude of the solid particle velocity is increased at the resonance frequency. Once initiated, fluid oscillations decrease in amplitude with increasing time. Consequently, the spectral peak of the solid particle velocity at the resonance frequency decreases with time.

  16. Radius of the neutron star magnetosphere during disk accretion

    NASA Astrophysics Data System (ADS)

    Filippova, E. V.; Mereminskiy, I. A.; Lutovinov, A. A.; Molkov, S. V.; Tsygankov, S. S.

    2017-11-01

    The dependence of the spin frequency derivative \\dot ν of accreting neutron stars with a strongmagnetic field (X-ray pulsars) on the mass accretion rate (bolometric luminosity, L bol) has been investigated for eight transient pulsars in binary systems with Be stars. Using data from the Fermi/GBM and Swift/BAT telescopes, we have shown that for seven of the eight systems the dependence \\dot ν ( L bol) can be fitted by the model of angular momentum transfer through an accretion disk, which predicts the relation \\dot ν ˜ L 6/7 bol. Hysteresis in the dependence \\dot ν ( L bol) has been confirmed in the system V 0332+53 and has been detected for the first time in the systems KS 1947+300, GRO J1008-57, and 1A 0535+26. Estimates for the radius of the neutron star magnetosphere in all of the investigated systems have been obtained. We show that this quantity varies from pulsar to pulsar and depends strongly on the analytical model and the estimates for the neutron star and binary system parameters.

  17. Accurate frequency and time dissemination in the optical domain

    NASA Astrophysics Data System (ADS)

    Khabarova, K. Yu; Kalganova, E. S.; Kolachevsky, N. N.

    2018-02-01

    The development of the optical frequency comb technique has enabled a wide use of atomic optical clocks by allowing frequency conversion from the optical to the radio frequency range. Today, the fractional instability of such clocks has reached the record eighteen-digit level, two orders of magnitude better than for cesium fountains representing the primary frequency standard. This is paralleled by the development of techniques for transferring accurate time and optical frequency signals, including fiber links. With this technology, the fractional instability of transferred frequency can be lowered to below 10‑18 with an averaging time of 1000 s for a 1000 km optical link. At a distance of 500 km, a time signal uncertainty of 250 ps has been achieved. Optical links allow comparing optical clocks and creating a synchronized time and frequency standard network at a new level of precision. Prospects for solving new problems arise, including the determination of the gravitational potential, the measurement of the continental Sagnac effect, and precise tests of fundamental theories.

  18. Wideband laser locking to an atomic reference with modulation transfer spectroscopy.

    PubMed

    Negnevitsky, V; Turner, L D

    2013-02-11

    We demonstrate that conventional modulated spectroscopy apparatus, used for laser frequency stabilization in many atomic physics laboratories, can be enhanced to provide a wideband lock delivering deep suppression of frequency noise across the acoustic range. Using an acousto-optic modulator driven with an agile oscillator, we show that wideband frequency modulation of the pump laser in modulation transfer spectroscopy produces the unique single lock-point spectrum previously demonstrated with electro-optic phase modulation. We achieve a laser lock with 100 kHz feedback bandwidth, limited by our laser control electronics. This bandwidth is sufficient to reduce frequency noise by 30 dB across the acoustic range and narrows the imputed linewidth by a factor of five.

  19. Cost Implications for Subsequent Perinatal Outcomes After IVF Stratified by Number of Embryos Transferred: A Five Year Analysis of Vermont Data.

    PubMed

    Carpinello, Olivia J; Casson, Peter R; Kuo, Chia-Ling; Raj, Renju S; Sills, E Scott; Jones, Christopher A

    2016-06-01

    In states in the USA without in vitro fertilzation coverage (IVF) insurance coverage, more embryos are transferred per cycle leading to higher risks of multi-fetal pregnancies and adverse pregnancy outcomes. To determine frequency and cost of selected adverse perinatal complications based on number of embryos transferred during IVF, and calculate incremental cost per IVF live birth. Medical records of patients who conceived with IVF (n = 116) and delivered at >20 weeks gestational age between 2007 and 2011 were evaluated. Gestational age at delivery, low birth weight (LBW) term births, and delivery mode were tabulated. Healthcare costs per cohort, extrapolated costs assuming 100 patients per cohort, and incremental costs per infant delivered were calculated. The highest prematurity and cesarean section rates were recorded after double embryo transfers (DET), while the lowest rates were found in single embryo transfers (SET). Premature singleton deliveries increased directly with number of transferred embryos [6.3 % (SET), 9.1 % (DET) and 10.0 % for ≥3 embryos transferred]. This trend was also noted for rate of cesarean delivery [26.7 % (SET), 36.6 % (DET), and 47.1 % for ≥3 embryos transferred]. The proportion of LBW infants among deliveries after DET and for ≥3 embryos transferred was 3.9 and 9.1 %, respectively. Extrapolated costs per cohort were US$718,616, US$1,713,470 and US$1,227,396 for SET, DET, and ≥3 embryos transferred, respectively. Attempting to improve IVF pregnancy rates by permitting multiple embryo transfers results in sharply increased rates of multiple gestation and preterm delivery. This practice yields a greater frequency of adverse perinatal outcomes and substantially increased healthcare spending. Better efforts to encourage SET are necessary to normalize healthcare expenditures considering the frequency of very high cost sequela associated with IVF where multiple embryo transfers occur.

  20. Nonlinear thermotics: nonlinearity enhancement and harmonic generation in thermal metasurfaces

    NASA Astrophysics Data System (ADS)

    Dai, Gaole; Shang, Jin; Wang, Ruizhe; Huang, Jiping

    2018-03-01

    We propose and investigate a class of structural surfaces (metasurfaces). We develop the perturbation theory and the effective medium theory to study the thermal properties of the metasurface. We report that the coefficient of temperature-dependent (nonlinear) item in thermal conductivity can be enhanced under certain conditions. Furthermore, the existence of nonlinear item helps to generate high-order harmonic frequencies of heat flux in the presence of a heat source with periodic temperature. This work paves a different way to control and manipulate the transfer of heat, and it also makes it possible to develop nonlinear thermotics in the light of nonlinear optics.

  1. Statistical simulation of information transfer through non-line-of-sight atmospheric optical communication channels

    NASA Astrophysics Data System (ADS)

    Tarasenkov, M. V.; Belov, V. V.; Poznakharev, E. S.

    2017-11-01

    Impulse response of non-line-of-sight atmospheric communication channels at wavelengths of 0.3, 0.5, and 0.9 μm are compared for the case in which the optical axes of the receiver and laser radiation lie in the plane perpendicular to the Earth's surface. The most efficient communication channel depending on the base distance is determined. For a wavelength of 0.5 μm and a concrete variant of the transceiving part of the communication system, the limiting communication range and the limiting repetition frequency of pulses that can be transmitted through the communication channel are estimated.

  2. Heightened odds of large earthquakes near Istanbul: an interaction-based probability calculation

    USGS Publications Warehouse

    Parsons, T.; Toda, S.; Stein, R.S.; Barka, A.; Dieterich, J.H.

    2000-01-01

    We calculate the probability of strong shaking in Istanbul, an urban center of 10 million people, from the description of earthquakes on the North Anatolian fault system in the Marmara Sea during the past 500 years and test the resulting catalog against the frequency of damage in Istanbul during the preceding millennium, departing from current practice, we include the time-dependent effect of stress transferred by the 1999 moment magnitude M = 7.4 Izmit earthquake to faults nearer to Istanbul. We find a 62 ± 15% probability (one standard deviation) of strong shaking during the next 30 years and 32 ± 12% during the next decade.

  3. Unravelling Responses for the Canadian National Seismic Network

    NASA Astrophysics Data System (ADS)

    Mulder, T. L.

    2009-12-01

    There are a number of attendant difficulties any network must deal with that range from defining the transfer function to instrument naming conventions to choices of final local file format representation. These choices ultimately result in the ease of conversion to other data formats and therefore directly impact useability. In particular, the ease of data exhange and use of established software that is dependent on standard data types is impacted. This becomes particularly critical with large (terabyte) dataset processing and when integrating external datasets into analysis procedures. Transfer functions, often referred to as instrument responses, are a key component in describing instrumentation. The transfer function describes the complete response of the seismic system. The seismic system is designed to be a linear system that can be decomposed into discrete components. Analogue or digital convolution can be represented as multiplication in the frequency domain. The two basic elements of a seismic system are the sensor and datalogger. The analogue sensor can be represented mathmatically as poles and zeroes. The datalogger can be further broken down into its discrete analogue and digital components: the preamp, A/D converter, and fir filters. The Canadian seismic network (CNSN) digitizers have an additional complication. To save telemetry band-width, the 32 bit signal from the digitizer has a transmission gain removed. The transmission gain (txgain) represents the number of the least significant bits truncated from the sample (2^txgain) after which the data is compressed and transmitted. While telemetry band-width is not the issue it was, now that many sites have ip connectivity, this user programmable transmission gain is still in use and can vary from station to station. The processes receiving the transmitted data do not restore the pre-transmission scaling, consequently the archived waveform files can vary in bit weight over time from station to station depending on the value of the transmission gain. Consequently the transmission gain must be factored into the transfer function. This presentation describes the process for generating the transfer function based on the constituent components discussed here. A matlab routine run on the database generates the transfer function plots for the network.

  4. Heat convection in a micro impinging jet system

    NASA Astrophysics Data System (ADS)

    Mai, John Dzung Hoang

    2000-10-01

    This thesis covers the development of an efficient micro impinging jet heat exchanger, using MEMS technology, to provide localized cooling for present and next generation microelectronic computer chips. Before designing an efficient localized heat exchanger, it is necessary to investigate fluid dynamics and heat transfer in the micro scale. MEMS technology has been used in this project because it is the only tool currently available that can provide a large array of batch-fabricated, micro-scale nozzles for localized cooling. Our investigation of potential MEMS heat exchanger designs begins with experiments that measure the pressure drops and temperature changes in a micro scale tubing system that will be necessary to carry fluid to the impingement point. Our basic MEMS model is a freestanding micro channel with integrated temperature microsensors. The temperature distribution along the channel in a vacuum is measured. The measured flow rates are compared with an analytical model developed for capillary flow that accounts for 2-D, slip and compressibility effects. The work is focused on obtaining correlations in the form of the Nussult number, the Reynolds number and a H/d geometric factor. A set of single MEMS nozzles have been designed to test heat transfer effectiveness as a function of nozzle diameter, ranging from 1.0 mm to 250 um. In addition, nozzle and slot array MEMS devices have been fabricated. In order to obtain quantitative measurements from these micron scale devices, a series of target temperature sensor chips were custom made and characterized for these experiments. The heat transfer characteristics of various MEMS nozzle configurations operating at various steady inlet pressures, at different heights above the heated substrate, have been characterized. These steady results showed that the average heat transfer coefficient, averaged over a 1 cm2 test area, was usually less than 0.035 W/cm 2K for any situation. However, the local heat transfer coefficient, as measured by a single 4mum x 4mum temperature sensor, was as high as 0.5 W/cm2K. Using a mechanical valve and piezo actuator to perturb the flow at frequencies from 10 Hz to 1 kHz, we identify that enhanced heat transfer can occur in an unsteady forced jet. The functional dependence of the enhanced heat transfer on the mean jet speed, perturbation level and perturbing frequency has been established. The expected trend that increased heat transfer at higher values of St number was noticed. In addition the effect of a confined and free jet geometry on an unsteady flow was observed.

  5. Tailored Waveform of Dielectric Barrier Discharge to Control Composite Thin Film Morphology.

    PubMed

    Brunet, Paul; Rincón, Rocío; Matouk, Zineb; Chaker, Mohamed; Massines, Françoise

    2018-02-06

    Nanocomposite thin films of TiO 2 in a polymer-like matrix are grown in a filamentary argon (Ar) dielectric barrier discharge (DBD) from a suspension of TiO 2 nanoparticles in isopropanol (IPA). The sinusoidal voltage producing the plasma is designed to independently control the matrix growth rate and the transport of nanoparticle (NP) aggregates to the surface. The useful FSK (frequency shift keying) modulation mode is chosen to successively generate two sinusoidal voltages: a high frequency of 15 kHz and a low frequency ranging from 0.5 to 3 kHz. The coating surface coverage by the NPs and the thickness of the matrix are measured as a function of the FSK parameters. The duty cycle between these two signals is varied from 0 to 100%. It is observed that the matrix thickness is mainly controlled by the power of the discharge, which largely depends on the high-frequency value. The quantity of NPs deposited in the composite thin film is proportional to the duration of the low frequency applied. The FSK waveform has a double modulation effect, allowing us to obtain a uniform coating as the NPs are not affected by the high frequency and the matrix growth rate is limited when the low frequency is applied. When it is close to a frequency limit, the low frequency acts like a filter for the NP aggregates. The higher the frequency, the smaller the size of the aggregates transferred to the surface. By changing only the FSK modulation parameters, the thin film can be switched from superhydrophobic to superhydrophilic, and under suitable conditions, a nanocomposite thin film is obtained.

  6. Transport of iodine and cesium via the grass-cow-milk pathway after the Chernobyl accident

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kirchner, G.

    1994-06-01

    More than 150 data sets giving time-dependent concentrations of {sup 131}I and {sup 137}Cs in feed and milk of cows after the Chernobyl accident are evaluated using a minimal compartmental modeling approach. Transfer of cesium via the grass-cow-milk pathway is adequately described by a three-compartmental model. No unique model results for {sup 131}I, as a compartment with slow secretion of {sup 131}I into milk, are identified for some datasets only. Frequency distributions of weathering half-lives on grass and of equilibrium feed-to-milk transfer coefficients are approximately lognormal. Mean values of weathering half-lives on plants are 9.1 {plus_minus} 0.6 d for iodinemore » and 11.1 {plus_minus} 0.8 d for cesium, in good agreement with means established from experiments performed before 1986. Mean values of equilibrium feed-to-milk transfer coefficients are 3.4 {plus_minus} 0.4 10{sup {minus}3} d L{sup {minus}1} for {sup 131}I and 5.4 {plus_minus} 0.5 10{sup {minus}3} d L{sup {minus}1} for {sup 137}Cs. Both are lower than means calculated from the pre-Chernobyl data base. Plausible explanations of the differences include (1) reduced availability of fallout compared to soluble tracer; (2) underestimation of post-Chernobyl transfer coefficients by some experiments concluded too early to record slow transport processes; and (3) reduced transfer of {sup 131}I compared to long-lived iodine isotopes due to decay during fixation in the thyroid. Feed-to-milk transfer of {sup 131}I is related to milk yield, but no influence of milk yield and type of feed on transfer is apparent for cesium. 73 refs., 3 figs., 5 tabs.« less

  7. Exercise in Young Adulthood with Simultaneous and Future Changes in Fruit and Vegetable Intake.

    PubMed

    Jayawardene, Wasantha P; Torabi, Mohammad R; Lohrmann, David K

    2016-01-01

    Regarding weight management, changes in exercise behavior can also influence nutrition behavior by application of self-regulatory psychological resources across behaviors (transfer effect). This study aimed to determine: (1) if changes in exercise frequency in young adulthood predict simultaneous changes in fruit/vegetable intake (transfer as co-occurrence); and (2) if exercise frequency affects future fruit/vegetable intake (transfer as carry-over). 6244 respondents of the National Longitudinal Survey of Youth 1997 were followed at ages 18-22 (Time-1), 23-27 (Time-2), and 27-31 (Time-3). Repeated measures analysis of variance and hierarchical multiple regression determined if the change in exercise frequency between Time-1 and Time-2 was associated with simultaneous and sequential changes in fruit/vegetable intake frequency, controlling for sex, race/ethnicity, education, income, body mass index, and baseline fruit/vegetable intake. Only 9% continued exercising for 30 minutes more than 5 days/week, while 15% transitioned to adequate exercise and another 15% transitioned to inadequate exercise; for both fruits and vegetables, intake of once per day or more increased with age. Males were more likely to exercise adequately and females to consume fruits/vegetables adequately. Exercise frequency transition was linearly associated with concurrent fruit/vegetable intake during Time-1 and Time-2. The highest increase in mean fruit/vegetable intake occurred for participants who transitioned from inadequate to adequate exercise. A significant Time-2 exercise frequency effect on Time-3 fruit/vegetable intake emerged, after accounting for baseline intake. Increase in Time-2 exercise by one day/week resulted in increased Time-3 fruit and vegetable intakes by 0.17 and 0.13 times/week, respectively. Transfer effects, although usually discussed in interventions, may also be applicable to voluntary behavior change processes. Newly engaging in and continuing exercise behavior over time may establish exercise habits that facilitate improved fruit/vegetable consumption. Interventions that facilitate transferring resources across behaviors likely will enhance this effect.

  8. Effect of Marangoni Convection on Surfactant Transfer Between the Drop Connected to the Reservoir and Surrounding Liquid

    NASA Astrophysics Data System (ADS)

    Kostarev, K.; Denisova, M.; Shmyrov, A.

    2018-03-01

    The paper presents the results of comparative investigation of the interaction between the capillary and buoyant mechanisms of motion in a problem of surfactant mass transfer between an insoluble drop and surrounding fluid under different gravity conditions. The research was performed for the drop that is coupled with the reservoir filled with a source mixture through a long thin tube (needle). Visualization of the flow patterns and concentration fields has shown that surfactant diffusion from the needle at normal gravity leads to the onset of the oscillatory mode of the capillary convection in the drop. It has been found that the frequency of the Marangoni convection outbursts, the lifetime of the oscillatory flow modes and the amount of the source mixture involved in the process of mass transfer depend on the drop size and initial concentration of the surfactant. The obtained results are compared with the cases of surfactant diffusion from the isolated drop under terrestrial conditions and from the drop coupled with reservoir in microgravity. Additionally, a series of experiments were performed to investigate diffusion of a surfactant from the surrounding solution into a drop.

  9. Trajectory study of supercollision relaxation in highly vibrationally excited pyrazine and CO2.

    PubMed

    Li, Ziman; Sansom, Rebecca; Bonella, Sara; Coker, David F; Mullin, Amy S

    2005-09-01

    Classical trajectory calculations were performed to simulate state-resolved energy transfer experiments of highly vibrationally excited pyrazine (E(vib) = 37,900 cm(-1)) and CO(2), which were conducted using a high-resolution transient infrared absorption spectrometer. The goal here is to use classical trajectories to simulate the supercollision energy transfer pathway wherein large amounts of energy are transferred in single collisions in order to compare with experimental results. In the trajectory calculations, Newton's laws of motion are used for the molecular motion, isolated molecules are treated as collections of harmonic oscillators, and intermolecular potentials are formed by pairwise Lennard-Jones potentials. The calculations qualitatively reproduce the observed energy partitioning in the scattered CO(2) molecules and show that the relative partitioning between bath rotation and translation is dependent on the moment of inertia of the bath molecule. The simulations show that the low-frequency modes of the vibrationally excited pyrazine contribute most to the strong collisions. The majority of collisions lead to small DeltaE values and primarily involve single encounters between the energy donor and acceptor. The large DeltaE exchanges result from both single impulsive encounters and chattering collisions that involve multiple encounters.

  10. Animal models for prenatal gene therapy: rodent models for prenatal gene therapy.

    PubMed

    Roybal, Jessica L; Endo, Masayuki; Buckley, Suzanne M K; Herbert, Bronwen R; Waddington, Simon N; Flake, Alan W

    2012-01-01

    Fetal gene transfer has been studied in various animal models, including rabbits, guinea pigs, cats, dogs, and nonhuman primate; however, the most common model is the rodent, particularly the mouse. There are numerous advantages to mouse models, including a short gestation time of around 20 days, large litter size usually of more than six pups, ease of colony maintenance due to the small physical size, and the relatively low expense of doing so. Moreover, the mouse genome is well defined, there are many transgenic models particularly of human monogenetic disorders, and mouse-specific biological reagents are readily available. One criticism has been that it is difficult to perform procedures on the fetal mouse with suitable accuracy. Over the past decade, accumulation of technical expertise and development of technology such as high-frequency ultrasound have permitted accurate vector delivery to organs and tissues. Here, we describe our experiences of gene transfer to the fetal mouse with and without ultrasound guidance from mid to late gestation. Depending upon the vector type, the route of delivery and the age of the fetus, specific or widespread gene transfer can be achieved, making fetal mice excellent models for exploratory biodistribution studies.

  11. Sensitivity function analysis of gravitational wave detection with single-laser and large-momentum-transfer atomic sensors

    NASA Astrophysics Data System (ADS)

    Tang, Biao; Zhang, Bao-Cheng; Zhou, Lin; Wang, Jin; Zhan, Ming-Sheng

    2015-03-01

    Recently, a configuration using atomic interferometers (AIs) had been suggested for the detection of gravitational waves. A new AI with some additional laser pulses for implementing large momentum transfer was also put forward, in order to reduce the effect of shot noise and laser frequency noise. We use a sensitivity function to analyze all possible configurations of the new AI and to distinguish how many momenta are transferred in a specific configuration. By analyzing the new configuration, we further explore a detection scheme for gravitational waves, in particular, that ameliorates laser frequency noise. We find that the amelioration occurs in such a scheme, but novelly, in some cases, the frequency noise can be canceled completely by using a proper data processing method. Supported by the National Natural Science Foundation of China.

  12. Stable radio-frequency transfer over optical fiber by phase-conjugate frequency mixing.

    PubMed

    He, Yabai; Orr, Brian J; Baldwin, Kenneth G H; Wouters, Michael J; Luiten, Andre N; Aben, Guido; Warrington, R Bruce

    2013-08-12

    We demonstrate long-distance (≥100-km) synchronization of the phase of a radio-frequency reference over an optical-fiber network without needing to actively stabilize the optical path length. Frequency mixing is used to achieve passive phase-conjugate cancellation of fiber-length fluctuations, ensuring that the phase difference between the reference and synchronized oscillators is independent of the link length. The fractional radio-frequency-transfer stability through a 100-km "real-world" urban optical-fiber network is 6 × 10(-17) with an averaging time of 10(4) s. Our compensation technique is robust, providing long-term stability superior to that of a hydrogen maser. By combining our technique with the short-term stability provided by a remote, high-quality quartz oscillator, this system is potentially applicable to transcontinental optical-fiber time and frequency dissemination where the optical round-trip propagation time is significant.

  13. A simple-architecture fibered transmission system for dissemination of high stability 100 MHz signals

    NASA Astrophysics Data System (ADS)

    Bakir, A.; Rocher, C.; Maréchal, B.; Bigler, E.; Boudot, R.; Kersalé, Y.; Millo, J.

    2018-05-01

    We report on the development of a simple-architecture fiber-based frequency distribution system used to transfer high frequency stability 100 MHz signals. This work is focused on the emitter and the receiver performances that allow the transmission of the radio-frequency signal over an optical fiber. The system exhibits a residual fractional frequency stability of 1 × 10-14 at 1 s integration time and in the low 10-16 range after 100 s. These performances are suitable to transfer the signal of frequency references such as those of a state-of-the-art hydrogen maser without any phase noise compensation scheme. As an application, we demonstrate the dissemination of such a signal through a 100 m long optical fiber without any degradation. The proposed setup could be easily extended for operating frequencies in the 10 MHz-1 GHz range.

  14. Frequency of pubic hair transfer during sexual intercourse.

    PubMed

    Exline, D L; Smith, F P; Drexler, S G

    1998-05-01

    This study measured the frequency of pubic hair transfer between a limited number of consenting heterosexual partners. The results derive from controlled experiments with a number of human subjects rather than forensic casework. Standardized collection procedures were observed, situational variables were tracked. Participants (forensic laboratory employees and their spouses) were six Caucasian couples who collected their pubic hair combings immediately following intercourse. Subjects provided informed consent in accordance with the protocol for human subjects approved by the U.A.B. institutional review board. The experiment was replicated ten times for five couples, and five times for another couple (total n = 110). Transfer frequencies were calculated from instances where foreign (exogenous) hairs were observed. Results showed at least one exogenous pubic hair in 17.3% (19/110) of combings. Transfers to males (23.6%, or 13/55) were more prevalent than transfers to females (10.9%, or 6/55). Only once were transfers observed simultaneously between both male and female. A total of 28 exogenous pubic hairs were identified. Subjects reported intercourse duration of 2-25 min, intervening intervals of 1-240 h, pre-coital bathing intervals of 0.25-24 h, and predominantly missionary position (76%). No clear relationship among these other survey variables was observed. The prevalence of female-to-male pubic hair transfers suggests the importance of collecting pubic hair combings from the male suspects as well as from female victims, provided the time interval is not extreme. Even under these optimum collection conditions, pubic hair transfers were observed only 17.3% of the time.

  15. Transfer of dimensional associability in human contingency learning.

    PubMed

    Kattner, Florian; Green, C Shawn

    2016-01-01

    Several studies have demonstrated processing advantages for stimuli that were experienced to be reliable predictors of an outcome relative to other stimuli. The present study tested whether such increases in associability apply at the level of entire stimulus dimensions (as suggested by Sutherland & Mackintosh, 1971). In 4 experiments, participants had to learn associations between Gabor gratings and particular responses. In a first experiment, some gratings were more predictive of the response than other gratings, whereas in 3 subsequent experiments, one stimulus dimension (i.e., either the orientation or spatial frequency of the grating) was more predictive than the other dimension. In contrast to the learned predictiveness of individual gratings (Experiment 1), dimensional predictiveness did not affect the subsequent rate of learning (Experiments 2 and 3), suggesting changes in the associability of specific stimuli, but not of stimulus dimensions. Moreover, greater transfer of predictiveness was found in all experiments when particular stimulus values of the test discrimination did not lie between the previously relevant stimuli. In Experiment 4, an increased learning rate was found for discriminations along the previously predictive dimension compared with a dimension that was indicative of uncertainty, but again the transfer was more pronounced for specific stimuli that were compatible with the previously learned discrimination. Taken together, the results imply that a transfer of associability typically applies to individual stimuli and depends on how the transfer stimuli relate to those stimuli that individuals previously learned to attend. (c) 2016 APA, all rights reserved).

  16. Impact of undamped and damped intramolecular vibrations on the efficiency of photosynthetic exciton energy transfer

    NASA Astrophysics Data System (ADS)

    Juhász, Imre Benedek; Csurgay, Árpád I.

    2018-04-01

    In recent years, the role of molecular vibrations in exciton energy transfer taking place during the first stage of photosynthesis attracted increasing interest. Here, we present a model formulated as a Lindblad-type master equation that enables us to investigate the impact of undamped and especially damped intramolecular vibrational modes on the exciton energy transfer, particularly its efficiency. Our simulations confirm the already reported effects that the presence of an intramolecular vibrational mode can compensate the energy detuning of electronic states, thus promoting the energy transfer; and, moreover, that the damping of such a vibrational mode (in other words, vibrational relaxation) can further enhance the efficiency of the process by generating directionality in the energy flow. As a novel result, we show that this enhancement surpasses the one caused by pure dephasing, and we present its dependence on various system parameters (time constants of the environment-induced relaxation and excitation processes, detuning of the electronic energy levels, frequency of the intramolecular vibrational modes, Huang-Rhys factors, temperature) in dimer model systems. We demonstrate that vibrational-relaxation-enhanced exciton energy transfer (VREEET) is robust against the change of these characteristics of the system and occurs in wide ranges of the investigated parameters. With simulations performed on a heptamer model inspired by the Fenna-Matthews-Olson (FMO) complex, we show that this mechanism can be even more significant in larger systems at T = 300 K. Our results suggests that VREEET might be prevalent in light-harvesting complexes.

  17. Numerical solution of non-linear dual-phase-lag bioheat transfer equation within skin tissues.

    PubMed

    Kumar, Dinesh; Kumar, P; Rai, K N

    2017-11-01

    This paper deals with numerical modeling and simulation of heat transfer in skin tissues using non-linear dual-phase-lag (DPL) bioheat transfer model under periodic heat flux boundary condition. The blood perfusion is assumed temperature-dependent which results in non-linear DPL bioheat transfer model in order to predict more accurate results. A numerical method of line which is based on finite difference and Runge-Kutta (4,5) schemes, is used to solve the present non-linear problem. Under specific case, the exact solution has been obtained and compared with the present numerical scheme, and we found that those are in good agreement. A comparison based on model selection criterion (AIC) has been made among non-linear DPL models when the variation of blood perfusion rate with temperature is of constant, linear and exponential type with the experimental data and it has been found that non-linear DPL model with exponential variation of blood perfusion rate is closest to the experimental data. In addition, it is found that due to absence of phase-lag phenomena in Pennes bioheat transfer model, it achieves steady state more quickly and always predict higher temperature than thermal and DPL non-linear models. The effect of coefficient of blood perfusion rate, dimensionless heating frequency and Kirchoff number on dimensionless temperature distribution has also been analyzed. The whole analysis is presented in dimensionless form. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Multistate empirical valence bond study of temperature and confinement effects on proton transfer in water inside hydrophobic nanochannels.

    PubMed

    Tahat, Amani; Martí, Jordi

    2016-07-01

    Microscopic characteristics of an aqueous excess proton in a wide range of thermodynamic states, from low density amorphous ices (down to 100 K) to high temperature liquids under the critical point (up to 600 K), placed inside hydrophobic graphene slabs at the nanometric scale (with interplate distances between 3.1 and 0.7 nm wide) have been analyzed by means of molecular dynamics simulations. Water-proton and carbon-proton forces were modeled with a multistate empirical valence bond method. Densities between 0.07 and 0.02 Å(-3) have been considered. As a general trend, we observed a competition between effects of confinement and temperature on structure and dynamical properties of the lone proton. Confinement has strong influence on the local structure of the proton, whereas the main effect of temperature on proton properties is observed on its dynamics, with significant variation of proton transfer rates, proton diffusion coefficients, and characteristic frequencies of vibrational motions. Proton transfer is an activated process with energy barriers between 1 and 10 kJ/mol for both proton transfer and diffusion, depending of the temperature range considered and also on the interplate distance. Arrhenius-like behavior of the transfer rates and of proton diffusion are clearly observed for states above 100 K. Spectral densities of proton species indicated that in all states Zundel-like and Eigen-like complexes survive at some extent. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Vibro-Shock Dynamics Analysis of a Tandem Low Frequency Resonator-High Frequency Piezoelectric Energy Harvester.

    PubMed

    Žižys, Darius; Gaidys, Rimvydas; Ostaševičius, Vytautas; Narijauskaitė, Birutė

    2017-04-27

    Frequency up-conversion is a promising technique for energy harvesting in low frequency environments. In this approach, abundantly available environmental motion energy is absorbed by a Low Frequency Resonator (LFR) which transfers it to a high frequency Piezoelectric Vibration Energy Harvester (PVEH) via impact or magnetic coupling. As a result, a decaying alternating output signal is produced, that can later be collected using a battery or be transferred directly to the electric load. The paper reports an impact-coupled frequency up-converting tandem setup with different LFR to PVEH natural frequency ratios and varying contact point location along the length of the harvester. RMS power output of different frequency up-converting tandems with optimal resistive values was found from the transient analysis revealing a strong relation between power output and LFR-PVEH natural frequency ratio as well as impact point location. Simulations revealed that higher power output is obtained from a higher natural frequency ratio between LFR and PVEH, an increase of power output by one order of magnitude for a doubled natural frequency ratio and up to 150% difference in power output from different impact point locations. The theoretical results were experimentally verified.

  20. Methods, computer readable media, and graphical user interfaces for analysis of frequency selective surfaces

    DOEpatents

    Kotter, Dale K [Shelley, ID; Rohrbaugh, David T [Idaho Falls, ID

    2010-09-07

    A frequency selective surface (FSS) and associated methods for modeling, analyzing and designing the FSS are disclosed. The FSS includes a pattern of conductive material formed on a substrate to form an array of resonance elements. At least one aspect of the frequency selective surface is determined by defining a frequency range including multiple frequency values, determining a frequency dependent permittivity across the frequency range for the substrate, determining a frequency dependent conductivity across the frequency range for the conductive material, and analyzing the frequency selective surface using a method of moments analysis at each of the multiple frequency values for an incident electromagnetic energy impinging on the frequency selective surface. The frequency dependent permittivity and the frequency dependent conductivity are included in the method of moments analysis.

Top