Hybrid spread spectrum radio system
Smith, Stephen F [London, TN; Dress, William B [Camas, WA
2010-02-09
Systems and methods are described for hybrid spread spectrum radio systems. A method, includes receiving a hybrid spread spectrum signal including: fast frequency hopping demodulating and direct sequence demodulating a direct sequence spread spectrum signal, wherein multiple frequency hops occur within a single data-bit time and each bit is represented by chip transmissions at multiple frequencies.
Hybrid spread spectrum radio system
Smith, Stephen F.; Dress, William B.
2010-02-02
Systems and methods are described for hybrid spread spectrum radio systems. A method includes modulating a signal by utilizing a subset of bits from a pseudo-random code generator to control an amplification circuit that provides a gain to the signal. Another method includes: modulating a signal by utilizing a subset of bits from a pseudo-random code generator to control a fast hopping frequency synthesizer; and fast frequency hopping the signal with the fast hopping frequency synthesizer, wherein multiple frequency hops occur within a single data-bit time.
Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah
2014-01-01
Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084
Research on synchronization technology of frequency hopping communication system
NASA Astrophysics Data System (ADS)
Zhao, Xiangwu; Quan, Houde; Cui, Peizhang
2018-05-01
Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.
47 CFR 87.479 - Harmful interference to radionavigation land stations.
Code of Federal Regulations, 2010 CFR
2010-10-01
... to establish wide-band systems using frequency-hopping spread spectrum techniques in the 960-1215 MHz.... Transmissions will be automatically prevented if: (1) The frequency-hopping mode fails to distribute the JTIDS...
Spread spectrum communications. Volume 1, 2 & 3
NASA Technical Reports Server (NTRS)
Simon, M. K.; Levitt, B. K.; Omura, J. K.; Scholtz, R. A.
1985-01-01
The design and operation of spread-spectrum (SS) communication systems are examined in an introductory text intended for graduate engineering students and practicing engineers. Chapters are devoted to an overview of SS systems, the historical origins of SS, basic concepts and system models, antijam communication systems, pseudonoise generators, coherent direct-sequence systems, noncoherent frequency-hopped systems, coherent and differentially coherent modulation techniques, pseudonoise acquisition and tracking in direct-sequence receivers, time and frequency synchronization of frequency-hopped receivers, low-probability-of-intercept communication, and multiple-access communication. Graphs, diagrams, and photographs are provided.
Performance of cellular frequency-hopped spread-spectrum radio networks
NASA Astrophysics Data System (ADS)
Gluck, Jeffrey W.; Geraniotis, Evaggelos
1989-10-01
Multiple access interference is characterized for cellular mobile networks, in which users are assumed to be Poisson-distributed in the plane and employ frequency-hopped spread-spectrum signaling with transmitter-oriented assignment of frequency-hopping patterns. Exact expressions for the bit error probabilities are derived for binary coherently demodulated systems without coding. Approximations for the packet error probability are derived for coherent and noncoherent systems and these approximations are applied when forward-error-control coding is employed. In all cases, the effects of varying interference power are accurately taken into account according to some propagation law. Numerical results are given in terms of bit error probability for the exact case and throughput for the approximate analyses. Comparisons are made with previously derived bounds and it is shown that these tend to be very pessimistic.
2014-03-27
42 4.2.3 Number of Hops Hs . . . . . . . . . . . . . . . . . . . . . . . . . 45 4.2.4 Number of Sensors M... 45 4.5 Standard deviation vs. Ns. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 4.6 Bias...laboratory MTM multiple taper method MUSIC multiple signal classification MVDR minimum variance distortionless reposnse PSK phase shift keying QAM
2013-08-31
13.3 µs) used in the data frame. The preamble uses direct-sequence spread spectrum (DSSS) to reduce the negative impact of fading. Three bits... ifr t covers one of the allocated hops of index h i . The received reference symbol transmitted in hop 1,2,..., Hh i N is ( )h...are recovered based on the phase difference between the constellation points demodulated from the sub-band m of the information symbol ( ) ifr t
NASA Astrophysics Data System (ADS)
Hagen, William E.; Holtzman, Julian C.
The Army Terrain Integrated Interference Prediction System (ATIIPS), a CAD terrain based simulation tool for determining the degradation effects on a network on nonspread spectrum radios caused by a network of spread spectrum radios is presented. A brief overview of the program is given, with typical graphics displays shown. Typical results for both a link simulation of interference and for a network simulation, using a slow hopped FM/FSK spread spectrum interfering radio network on a narrow band FM/FSK fixed frequency digital radio are presented.
Hop limited epidemic-like information spreading in mobile social networks with selfish nodes
NASA Astrophysics Data System (ADS)
Wu, Yahui; Deng, Su; Huang, Hongbin
2013-07-01
Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.
NASA Technical Reports Server (NTRS)
Bao, H.; Kwatra, S. C.; Kim, Junghwan; Stevens, G. H.
1990-01-01
A spread spectrum system, slow frequency hopping with GMSK (Gaussian minimum shift keying) modulation (SFH-GMSK), is proposed for mobile telephone communications. The system performance is evaluated using computer simulation and is compared with an unspread system. Results show that under multipath fading conditions, when the signal-to-noise ratio (SNR) is greater than 15 dB, slow frequency hopping gives some bit error rate improvement over the unspread system. Theoretical predictions indicate that a system efficiency of 20-65 users per cell can be achieved in the cellular configuration. Joint use of SFH-GMSK and FM is also investigated. It is shown that FM interference can cause serious degradation to the SFH-GMSK performance.
Frequency effects on charge ordering in Y0.5Ca0.5MnO3 by impedance spectroscopy
NASA Astrophysics Data System (ADS)
Sarwar, Tuba; Qamar, Afzaal; Nadeem, Muhammad
2015-02-01
In this work, structural and electrical properties of Y0.5Ca0.5MnO3 are investigated by employing X-ray diffraction and impedance spectroscopy, respectively. Applied ac electric field showed the charge ordering transition temperature around 265 K and below this temperature the heteromorphic behavior of the sample is discussed in the proximity of TCO. With frequency effects the volume of robust charge orbital ordering (COO) domains diminishes due to different competing phases along with Jahn Teller distortions. Comprehensive melting and collapse of charge orbital ordering occurs below TN(125 K), where a colossal drop in the value of impedance is observed. The change in profile of modulus plane plots determines the spreading of relaxation time of intermingled phases. Hopping mechanism is elaborated in terms of strong electron phonon coupling. Variable range hopping model and Arrhenius model are used to discuss the short and long range hopping between Mn3+ and Mn4+ channels assessing the activation energy Ea.
47 CFR 87.479 - Harmful interference to radionavigation land stations.
Code of Federal Regulations, 2012 CFR
2012-10-01
... to establish wide-band systems using frequency-hopping spread spectrum techniques in the 960-1215 MHz... spectrum uniformly across the band; (2) The radiated pulse varies from the specified width of 6.4... peak of the JTIDS spectrum as measured in a 300 kHz bandwidth. The JTIDS will be prohibited from...
47 CFR 87.479 - Harmful interference to radionavigation land stations.
Code of Federal Regulations, 2013 CFR
2013-10-01
... to establish wide-band systems using frequency-hopping spread spectrum techniques in the 960-1215 MHz... spectrum uniformly across the band; (2) The radiated pulse varies from the specified width of 6.4... peak of the JTIDS spectrum as measured in a 300 kHz bandwidth. The JTIDS will be prohibited from...
47 CFR 87.479 - Harmful interference to radionavigation land stations.
Code of Federal Regulations, 2014 CFR
2014-10-01
... to establish wide-band systems using frequency-hopping spread spectrum techniques in the 960-1215 MHz... spectrum uniformly across the band; (2) The radiated pulse varies from the specified width of 6.4... peak of the JTIDS spectrum as measured in a 300 kHz bandwidth. The JTIDS will be prohibited from...
Precise Ionosphere Monitoring via a DSFH Satellite TT&C Link
NASA Astrophysics Data System (ADS)
Chen, Xiao; Li, Guangxia; Li, Zhiqiang; Yue, Chao
2014-11-01
A phase-coherent and frequency-hopped PN ranging system was developed, originally for the purpose of anti-jamming TT&C (tracking, telemetry and telecommand) of military satellites of China, including the Beidou-2 navigation satellites. The key innovation in the synchronization of this system is the unambiguous phase recovery of direct sequence and frequency hopping (DSFH) spread spectrum signal and the correction of frequency-dependent phase rotation caused by ionosphere. With synchronization achieved, a TEC monitoring algorithm based on maximum likelihood (ML) principle is proposed and its measuring precision is analyzed through ground simulation, onboard confirmation tests will be performed when transionosphere DSFH links are established in 2014. The measuring precision of TEC exceeds that obtained from GPS receiver data because the measurement is derived from unambiguous carrier phase estimates, not pseudorange estimates. The observation results from TT&C stations can provide real time regional ionosphere TEC estimation.
NASA Astrophysics Data System (ADS)
Younger, Michael; Budulas, Peter P.; Young, Stuart H.
2002-08-01
Spread spectrum communication techniques have been recognized as a viable method to gain an advantage in interference environments. Many military-oriented systems have been initiated, and some civil systems have been attempted. Spread spectrum allows the ability to hide the signal of interest below or in the noise floor, so as not to be detected. A spread spectrum system is one in which the transmitted signal is spread over a wide frequency band, much wider, in fact, than the minimum bandwidth required to transmit the information being sent. We at Army Research Lab (ARL) are proposing using the same technique on the Internet with port hopping. The information would be transmitted in data packets over multiple ports. The port used would vary per packet or per session basis. This port hopping gives you and the recipients the ability to take datagram's and spread them out over a multitude of ports. This will hide information among the Internet noise. This will allow trusted communications between the transmitter and receiver because of the port coding sequence. There are 64K possible ports to span datagram. Jamming of transmission would be limiting the ability of the sniffer/listener. Also, the listener will find it difficult to use a man in the middle attach, since the data will be spread over multiple ports and only the receiver and transmitter will know the specific port sequencing for the datagram.
A Random Access Algorithm for Frequency Hopped Spread Spectrum Packet Radio Networks
1986-03-01
in section 4.3, the probability p is given by the following expression. N rj 1-p - N1 (NR7-1). f -• (20)~ j=o j. F,=ji < N We now present a...Algorithms," Univ. of Connecticut, EECS Dept. Technical Report UCT/ DEECS /TR-86-1, January 1986. Also, submitted for publication. 119] W. Peterson and E
Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C
2017-07-01
Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.
A new method of hybrid frequency hopping signals selection and blind parameter estimation
NASA Astrophysics Data System (ADS)
Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian
2018-04-01
Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.
2007-03-01
Quadrature QPSK Quadrature Phase-Shift Keying RV Random Variable SHAC Single-Hop-Observation Auto- Correlation SINR Signal-to-Interference...The fast Fourier transform ( FFT ) accumulation method and the strip spectral correlation algorithm subdivide the support region in the bi-frequency...diamond shapes, while the strip spectral correlation algorithm subdivides the region into strips. Each strip covers a number of the FFT accumulation
Time synchronization of a frequency-hopped MFSK communication system
NASA Technical Reports Server (NTRS)
Simon, M. K.; Polydoros, A.; Huth, G. K.
1981-01-01
In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.
NASA Astrophysics Data System (ADS)
Kandouci, Chahinaz; Djebbari, Ali
2018-04-01
A new family of two-dimensional optical hybrid code which employs zero cross-correlation (ZCC) codes, constructed by the balanced incomplete block design BIBD, as both time-spreading and wavelength hopping patterns are used in this paper. The obtained codes have both off-peak autocorrelation and cross-correlation values respectively equal to zero and unity. The work in this paper is a computer experiment performed using Optisystem 9.0 software program as a simulator to determine the wavelength hopping/time spreading (WH/TS) OCDMA system performances limitations. Five system parameters were considered in this work: the optical fiber length (transmission distance), the bitrate, the chip spacing and the transmitted power. This paper shows for what sufficient system performance parameters (BER≤10-9, Q≥6) the system can stand for.
NASA Astrophysics Data System (ADS)
Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun
2018-04-01
For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.
NASA Astrophysics Data System (ADS)
Li, Hanyu; Syed, Mubashir; Yao, Yu-Dong; Kamakaris, Theodoros
2009-12-01
This paper investigates spectrum sharing issues in the unlicensed industrial, scientific, and medical (ISM) bands. It presents a radio frequency measurement setup and measurement results in 2.4 GHz. It then develops an analytical model to characterize the coexistence interference in the ISM bands, based on radio frequency measurement results in the 2.4 GHz. Outage performance using the interference model is examined for a hybrid direct-sequence frequency-hopping spread spectrum system. The utilization of beamforming techniques in the system is also investigated, and a simplified beamforming model is proposed to analyze the system performance using beamforming. Numerical results show that beamforming significantly improves the system outage performance. The work presented in this paper provides a quantitative evaluation of signal outages in a spectrum sharing environment. It can be used as a tool in the development process for future dynamic spectrum access models as well as engineering designs for applications in unlicensed bands.
Optimum Detection Of Slow-Frequency-Hopping Signals
NASA Technical Reports Server (NTRS)
Levitt, Barry K.; Cheng, Unjeng
1994-01-01
Two papers present theoretical analyses of various schemes for coherent and noncoherent detection of M-ary-frequency-shift-keyed (MFSK) signals with slow frequency hopping. Special attention focused on continuous-phase-modulation (CPM) subset of SFH/MFSK signals, for which frequency modulation such carrier phase remains continuous (albeit unknown) during each hop.
Bounds on the cross-correlation functions of state m-sequences
NASA Astrophysics Data System (ADS)
Woodcock, C. F.; Davies, Phillip A.; Shaar, Ahmed A.
1987-03-01
Lower and upper bounds on the peaks of the periodic Hamming cross-correlation function for state m-sequences, which are often used in frequency-hopped spread-spectrum systems, are derived. The state position mapped (SPM) sequences of the state m-sequences are described. The use of SPM sequences for OR-channel code division multiplexing is studied. The relation between the Hamming cross-correlation function and the correlation function of SPM sequence is examined. Numerical results which support the theoretical data are presented.
Granata, K P; Padua, D A; Wilson, S E
2002-04-01
Leg stiffness was compared between age-matched males and females during hopping at preferred and controlled frequencies. Stiffness was defined as the linear regression slope between the vertical center of mass (COM) displacement and ground-reaction forces recorded from a force plate during the stance phase of the hopping task. Results demonstrate that subjects modulated the vertical displacement of the COM during ground contact in relation to the square of hopping frequency. This supports the accuracy of the spring-mass oscillator as a representative model of hopping. It also maintained peak vertical ground-reaction load at approximately three times body weight. Leg stiffness values in males (33.9+/-8.7 kN/m) were significantly (p<0.01) greater than in females (26.3+/-6.5 kN/m) at each of three hopping frequencies, 3.0, 2.5 Hz, and a preferred hopping rate. In the spring-mass oscillator model leg stiffness and body mass are related to the frequency of motion. Thus male subjects necessarily recruited greater leg stiffness to drive their heavier body mass at the same frequency as the lighter female subjects during the controlled frequency trials. However, in the preferred hopping condition the stiffness was not constrained by the task because frequency was self-selected. Nonetheless, both male and female subjects hopped at statistically similar preferred frequencies (2.34+/-0.22 Hz), therefore, the females continued to demonstrate less leg stiffness. Recognizing the active muscle stiffness contributes to biomechanical stability as well as leg stiffness, these results may provide insight into the gender bias in risk of musculoskeletal knee injury.
Olama, Mohammed M.; Ma, Xiao; Killough, Stephen M.; ...
2015-03-12
In recent years, there has been great interest in using hybrid spread-spectrum (HSS) techniques for commercial applications, particularly in the Smart Grid, in addition to their inherent uses in military communications. This is because HSS can accommodate high data rates with high link integrity, even in the presence of significant multipath effects and interfering signals. A highly useful form of this transmission technique for many types of command, control, and sensing applications is the specific code-related combination of standard direct sequence modulation with fast frequency hopping, denoted hybrid DS/FFH, wherein multiple frequency hops occur within a single data-bit time. Inmore » this paper, error-probability analyses are performed for a hybrid DS/FFH system over standard Gaussian and fading-type channels, progressively including the effects from wide- and partial-band jamming, multi-user interference, and varying degrees of Rayleigh and Rician fading. In addition, an optimization approach is formulated that minimizes the bit-error performance of a hybrid DS/FFH communication system and solves for the resulting system design parameters. The optimization objective function is non-convex and can be solved by applying the Karush-Kuhn-Tucker conditions. We also present our efforts toward exploring the design, implementation, and evaluation of a hybrid DS/FFH radio transceiver using a single FPGA. Numerical and experimental results are presented under widely varying design parameters to demonstrate the adaptability of the waveform for varied harsh smart grid RF signal environments.« less
NASA Technical Reports Server (NTRS)
Simon, M. K.; Polydoros, A.
1981-01-01
This paper examines the performance of coherent QPSK and QASK systems combined with FH or FH/PN spread spectrum techniques in the presence of partial-band multitone or noise jamming. The worst-case jammer and worst-case performance are determined as functions of the signal-to-background noise ratio (SNR) and signal-to-jammer power ratio (SJR). Asymptotic results for high SNR are shown to have a linear dependence between the jammer's optimal power allocation and the system error probability performance.
Spread Spectrum Receiver Electromagnetic Interference (EMI) Test Guide
NASA Technical Reports Server (NTRS)
Wheeler, M. L.
1998-01-01
The objective of this test guide is to document appropriate unit level test methods and techniques for the performance of EMI testing of Direct Sequence (DS) spread spectrum receivers. Consideration of EMI test methods tailored for spread spectrum receivers utilizing frequency spreading, techniques other than direct sequence (such as frequency hopping, frequency chirping, and various hybrid methods) is beyond the scope of this test guide development program and is not addressed as part of this document EMI test requirements for NASA programs are primarily developed based on the requirements contained in MIL-STD-46 1 D (or earlier revisions of MIL-STD-46 1). The corresponding test method guidelines for the MIL-STD-461 D tests are provided in MIL-STD-462D. These test methods are well documented with the exception of the receiver antenna port susceptibility tests (intermodulation, cross modulation, and rejection of undesired signals) which must be tailored to the specific type of receiver that is being tested. Thus, test methods addressed in this guide consist only of antenna port tests designed to evaluate receiver susceptibility characteristics. MIL-STD-462D should be referred for guidance pertaining to test methods for EMI tests other than the antenna port tests. The scope of this test guide includes: (1) a discussion of generic DS receiver performance characteristics; (2) a summary of S-band TDRSS receiver operation; (3) a discussion of DS receiver EMI susceptibility mechanisms and characteristics; (4) a summary of military standard test guidelines; (5) recommended test approach and methods; and (6) general conclusions and recommendations for future studies in the area of spread spectrum receiver testing.
Dielectric and AC conductivity studies on SrBi4Ti4O15
NASA Astrophysics Data System (ADS)
Jose, Roshan; Saravanan, K. Venkata
2018-05-01
The four layered SrBi4Ti4O15 ceramics which belong to the aurivillius family of oxide was prepared by conventional solid state reaction technique. Analysis of the dielectric data as a function of temperature and frequency revealed normal phase transition. The frequency dependent ac conductivity follows Jonscher's universal power law. Frequency exponent (n), pre-exponential factor (A), bulk dc conductivity (σdc), and hopping frequency (ωp) were determined from the fitting curves. The variation of frequency exponent with temperature indicates that large polaron hopping mechanism up to curie-temperature, then its changes to small polaron hopping. The activation energies were calculated from ac conductivity, bulk dc conductivity and hopping frequency. The activation energies revealed that conductivity had contributions from migrations of oxygen vacancies, bismuth ion vacancies and strontium ion vacancies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.
The frequency noise spectrum of a magnetic tunnel junction (MTJ) based spin torque oscillator (STO) is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. Here, we find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layermore » is aligned away from the anti-parallel orientation w.r.t the reference layer. Lastly, these results indicate that the origin of 1/f frequency noise is related to mode-hopping which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.
The frequency noise spectrum of a magnetic tunnel junction based spin torque oscillator is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. We find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layer is aligned awaymore » from the anti-parallel orientation w.r.t the reference layer. These results indicate that the origin of 1/f frequency noise is related to mode-hopping, which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.« less
Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.; ...
2014-09-29
The frequency noise spectrum of a magnetic tunnel junction (MTJ) based spin torque oscillator (STO) is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. Here, we find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layermore » is aligned away from the anti-parallel orientation w.r.t the reference layer. Lastly, these results indicate that the origin of 1/f frequency noise is related to mode-hopping which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.« less
Simulation of Downlink Synchronization for a Frequency-Hopped Satellite Communication System
1992-04-01
naflonie SIMULATION OF DOWNLINK SYNCHRONIZATION FOR A FREQUENCY-HOPPED SATELLITE COMMUNICATION SYSTEM (U) by Lyle Waper_Communicadion and Xa elo Elkaoftron...is offset by an increase in complexity while establishing the communication link, termed synchronization . This document describes a downlink... synchronization process that involves the transmission of synchronization hops by the satellite and a two-step ground terminal synchonization procedure. In
Dynamics of the one-dimensional Anderson insulator coupled to various bosonic baths
NASA Astrophysics Data System (ADS)
Bonča, Janez; Trugman, Stuart A.; Mierzejewski, Marcin
2018-05-01
We study a particle which propagates in a one-dimensional strong random potential and is coupled to a bosonic bath. We independently test various properties of bosons (hopping term, hard-core effects, and generic boson-boson interaction) and show that bosonic itineracy is the essential ingredient governing the dynamics of the particle. Coupling of the particle to itinerant phonons or hard-core bosons alike leads to delocalization of the particle by virtue of a subdiffusive (or diffusive) spread from the initially localized state. Delocalization remains in effect even when the boson frequency and the bandwidth of itinerant bosons remain an order of magnitude smaller than the magnitude of the random potential. When the particle is coupled to localized bosons, its spread remains logarithmic or even sublogarithmic. The latter result together with the survival probability shows that the particle remains localized despite being coupled to bosons.
Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors
NASA Astrophysics Data System (ADS)
Marple, M. A. T.; Avila-Paredes, H.; Kim, S.; Sen, S.
2018-05-01
A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.
Marple, M A T; Avila-Paredes, H; Kim, S; Sen, S
2018-05-28
A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.
AC and DC conductivity due to hopping mechanism in double ion doped ceramics
NASA Astrophysics Data System (ADS)
Rizwana, Mahboob, Syed; Sarah, P.
2018-04-01
Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.
47 CFR 15.247 - Operation within the bands 902-928 MHz, 2400-2483.5 MHz, and 5725-5850 MHz.
Code of Federal Regulations, 2011 CFR
2011-10-01
... channel carrier frequencies separated by a minimum of 25 kHz or the 20 dB bandwidth of the hopping channel... have hopping channel carrier frequencies that are separated by 25 kHz or two-thirds of the 20 dB...: if the 20 dB bandwidth of the hopping channel is less than 250 kHz, the system shall use at least 50...
47 CFR 15.247 - Operation within the bands 902-928 MHz, 2400-2483.5 MHz, and 5725-5850 MHz.
Code of Federal Regulations, 2014 CFR
2014-10-01
... channel carrier frequencies separated by a minimum of 25 kHz or the 20 dB bandwidth of the hopping channel... have hopping channel carrier frequencies that are separated by 25 kHz or two-thirds of the 20 dB...: if the 20 dB bandwidth of the hopping channel is less than 250 kHz, the system shall use at least 50...
47 CFR 15.247 - Operation within the bands 902-928 MHz, 2400-2483.5 MHz, and 5725-5850 MHz.
Code of Federal Regulations, 2010 CFR
2010-10-01
... channel carrier frequencies separated by a minimum of 25 kHz or the 20 dB bandwidth of the hopping channel... have hopping channel carrier frequencies that are separated by 25 kHz or two-thirds of the 20 dB...: if the 20 dB bandwidth of the hopping channel is less than 250 kHz, the system shall use at least 50...
47 CFR 15.247 - Operation within the bands 902-928 MHz, 2400-2483.5 MHz, and 5725-5850 MHz.
Code of Federal Regulations, 2013 CFR
2013-10-01
... channel carrier frequencies separated by a minimum of 25 kHz or the 20 dB bandwidth of the hopping channel... have hopping channel carrier frequencies that are separated by 25 kHz or two-thirds of the 20 dB...: if the 20 dB bandwidth of the hopping channel is less than 250 kHz, the system shall use at least 50...
47 CFR 15.247 - Operation within the bands 902-928 MHz, 2400-2483.5 MHz, and 5725-5850 MHz.
Code of Federal Regulations, 2012 CFR
2012-10-01
... channel carrier frequencies separated by a minimum of 25 kHz or the 20 dB bandwidth of the hopping channel... have hopping channel carrier frequencies that are separated by 25 kHz or two-thirds of the 20 dB...: if the 20 dB bandwidth of the hopping channel is less than 250 kHz, the system shall use at least 50...
Frequency synchronization of a frequency-hopped MFSK communication system
NASA Technical Reports Server (NTRS)
Huth, G. K.; Polydoros, A.; Simon, M. K.
1981-01-01
This paper presents the performance of fine-frequency synchronization. The performance degradation due to imperfect frequency synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of frequency hops used in the estimator. The effect of imperfect fine-time synchronization is also included in the calculation of fine-frequency synchronization performance to obtain the overall performance degradation due to synchronization errors.
NASA Astrophysics Data System (ADS)
Ivo, Penn
2004-04-01
Bluetooth is the new emerging technology for wireless communication. It can be used to connect almost any device to another device. The traditional example is to link a Personal Digital Assistant (PDA) or a laptop to a mobile phone. That way you can easily take remote connections with your PDA or laptop without getting your mobile phone from your pocket or messing around with cables. A Class 3 Bluetooth device has range of 0,1 - 10 meters. The architecture of Bluetooth is formed by the radio, the base frequency part and the Link Manager. Bluetooth uses the radio range of 2.45 GHz. The theoretical maximum bandwidth is 1 Mb/s, which is slowed down a bit by Forward Error Correction (FEC). Bluetooth specification designates the frequency hopping to be implemented with Gaussian Frequency Shift Keying (GFSK). The base frequency part of the Bluetooth architecture uses a combination of circuit and packet switching technologies. Bluetooth can support either one asynchronous data channel and up to three simultaneous synchronous speech channels, or one channel that transfers asynchronous data and synchronous speech simultaneously. The Link Manager is an essential part of the Bluetooth architecture. It uses Link Manager Protocol (LMP) to configure, authenticate and handle the connections between Bluetooth devices. Several Bluetooth devices can form an ad hoc network. In these piconets, one of the Bluetooth devices will act as a master and the others are slaves. The master sets the frequency-hopping behavior of the piconet. It is also possible to connect up to 10 piconets to each other to form so-called scatternets. Bluetooth has been designed to operate in noisy radio frequency environments, and uses a fast acknowledgement and frequency-hopping scheme to make the link robust, communication-wise. Bluetooth radio modules avoid interference from other signals by hopping to a new frequency after transmitting or receiving a packet. Compared with other systems operating in the same frequency band, the Bluetooth radio typically hops faster and uses shorter packets. This is because short packages and fast hopping limit the impact of microwave ovens and other sources of disturbances. Use of Forward Error Correction (FEC) limits the impact of random noise on long-distance links. Bluetooth transmissions are secure in a business and home environment. Bluetooth has built in sufficient encryption and authentication and is thus very secure in any environment. In addition to this, a frequency-hopping scheme with 1600 hops/sec. is employed. This is far quicker than any other competing system. This, together with an automatic output power adaption to reduce the range exactly to requirement, makes the system extremely difficult to eavesdrop. Information Integrity in Bluetooth has these components: Random Number Generation, Encryption, Encryption Key Management and Authentication.
User manual of the CATSS system (version 1.0) communication analysis tool for space station
NASA Technical Reports Server (NTRS)
Tsang, C. S.; Su, Y. T.; Lindsey, W. C.
1983-01-01
The Communication Analysis Tool for the Space Station (CATSS) is a FORTRAN language software package capable of predicting the communications links performance for the Space Station (SS) communication and tracking (C & T) system. An interactive software package was currently developed to run on the DEC/VAX computers. The CATSS models and evaluates the various C & T links of the SS, which includes the modulation schemes such as Binary-Phase-Shift-Keying (BPSK), BPSK with Direct Sequence Spread Spectrum (PN/BPSK), and M-ary Frequency-Shift-Keying with Frequency Hopping (FH/MFSK). Optical Space Communication link is also included. CATSS is a C & T system engineering tool used to predict and analyze the system performance for different link environment. Identification of system weaknesses is achieved through evaluation of performance with varying system parameters. System tradeoff for different values of system parameters are made based on the performance prediction.
NASA Astrophysics Data System (ADS)
Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc
2018-03-01
We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.
Kwon, Kun-Sup; Yoon, Won-Sang
2010-01-01
In this paper we propose a method of removing from synthesizer output spurious signals due to quasi-amplitude modulation and superposition effect in a frequency-hopping synthesizer with direct digital frequency synthesizer (DDFS)-driven phase-locked loop (PLL) architecture, which has the advantages of high frequency resolution, fast transition time, and small size. There are spurious signals that depend on normalized frequency of DDFS. They can be dominant if they occur within the PLL loop bandwidth. We suggest that such signals can be eliminated by purposefully creating frequency errors in the developed synthesizer.
Lamm, Christian E.; Kraner, Max. E.; Hofmann, Jörg; Börnke, Frederik; Mock, Hans-Peter; Sonnewald, Uwe
2017-01-01
Perception of pathogens by host pattern recognition receptors (PRRs) or R proteins is a prerequisite to promote successful immune responses. The Hsp70/Hsp90 organizing protein Hop/Sti1, a multifunctional cochaperone, has been implicated in the maturation of a receptor-like kinase (RLK) necessary for chitin sensing. However, it remains unknown whether Hop/Sti1 is generally participating in PRR genesis. Using RNA-interference (RNAi), we silenced Hop/Sti1 expression in Nicotiana tabacum to gain further insight into the role of the cochaperone in plant defense responses. As expected, transgenic plants do not respond to chitin treatment anymore. In contrast to this, trafficking and functionality of the flagellin PRR FLS2 were unaltered, suggesting a selective involvement of Hop/Sti1 during PRR maturation. Furthermore, Hop/Sti1 was identified as a cellular determinant of Potato virus Y (PVY) symptom development in tobacco, since PVY was able to accumulate to near wild-type level without provoking the usual veinal necrosis phenotype. In addition, typical antiviral host defense responses were suppressed in the transgenic plants. These data suggest that perception of PVY is dependent on Hop/Sti1-mediated receptor maturation, while viral symptoms represent a failing attempt to restrict PVY spread. In addition, Hop/Sti1 colocalized with virus-induced membrane aggregates in wild-type plants. The retention of Hop/Sti1 in potential viral replication complexes suggests a role during viral translation/replication, explaining why RNAi-lines do not exhibit increased susceptibility to PVY. This study provides evidence for a dual role of Hop/Sti1 in PRR maturation and pathogen perception as well as in promoting viral proliferation. PMID:29075278
Adaptive Transmission and Channel Modeling for Frequency Hopping Communications
2009-09-21
proposed adaptive transmission method has much greater system capacity than conventional non-adaptive MC direct- sequence ( DS )- CDMA system. • We...several mobile radio systems. First, a new improved allocation algorithm was proposed for multicarrier code-division multiple access (MC- CDMA ) system...Multicarrier code-division multiple access (MC- CDMA ) system with adaptive frequency hopping (AFH) has attracted attention of researchers due to its
Anti-jamming communication for body area network using chaotic frequency hopping.
Gopalakrishnan, Balamurugan; Bhagyaveni, Marcharla Anjaneyulu
2017-12-01
The healthcare industries research trends focus on patient reliable communication and security is a paramount requirement of healthcare applications. Jamming in wireless communication medium has become a major research issue due to the ease of blocking communication in wireless networks and throughput degradation. The most commonly used technique to overcome jamming is frequency hopping (FH). However, in traditional FH pre-sharing of key for channel selection and a high-throughput overhead is required. So to overcome this pre-sharing of key and to increase the security chaotic frequency hopping (CFH) has been proposed. The design of chaos-based hop selection is a new development that offers improved performance in transmission of information without pre-shared key and also increases the security. The authors analysed the performance of proposed CFH system under different reactive jamming durations. The percentage of error reduction by the reactive jamming for jamming duration 0.01 and 0.05 s for FH and CFH is 55.03 and 84.24%, respectively. The obtained result shows that CFH is more secure and difficult to jam by the reactive jammer.
Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy
2017-01-01
Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284
Fernández de Gorostiza, Erlantz; Mabe, Jon
2018-01-01
Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method. PMID:29473910
Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto
2018-02-23
Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.
2013-11-25
previously considered this proactive approach to combat unintentional, persistent (non- reactive) interference . In this project, we plan on extending our...channel” (or code ) by chance, through public knowledge of the underlying protocol semantics , or by compromising one of the network devices. An alternative...AFRL-RV-PS- AFRL-RV-PS- TR-2013-0142 TR-2013-0142 RENDEZVOUS PROTOCOLS AND DYNAMIC FREQUENCY HOPPING INTERFERENCE DESIGN FOR ANTI-JAMMING
Dielectric Measurements on Sol-Gel Derived Titania Films
NASA Astrophysics Data System (ADS)
Capan, Rifat; Ray, Asim K.
2017-11-01
Alternating current (AC) impedance measurements were performed on 37 nm thick nanostructured sol-gel derived anatase titania films on ultrasonically cleaned (100) p-silicon substrates at temperatures T ranging from 100 K to 300 K over a frequency range between 20 Hz and 1 MHz. The frequency-dependent behavior of the AC conductivity σ ac( f, T) obeys the universal power law, and the values of the effective hopping barrier and hopping distance were found to be 0.79 eV and 6.7 × 10-11 m from an analysis due to the correlated barrier-hopping model. The dielectric relaxation was identified as a thermally activated non-Debye process involving an activation energy of 41.5 meV.
NASA Astrophysics Data System (ADS)
Asmus, John F.
Laser divestment entered the field of art conservation through a nonlinear sequence of positive accidental events (serendipity) that involved the cinema industry, the invention of spread-spectrum and frequency-hopping communications, nuclear space propulsion, and oceanography. The unlikely chain of events began with the invention of a secure military communications system by a Viennese motion picture actress (1942). A first evaluation of the novel communications concept took place during a high-altitude nuclear test (TEAK) over the Pacific Ocean in 1958. The secure radio link proved to be a failure; however, analyses of the backscattered electromagnetic radiation contributed to the realization that nuclear-explosion plasmas need not be spherically symmetrical. Nobel Laureate Freeman Dyson exploited this nuclear option to guide in the design and prototype development of the ORION spaceship that was to rendezvous with the planet Saturn in 1970.
Maximum group velocity in a one-dimensional model with a sinusoidally varying staggered potential
NASA Astrophysics Data System (ADS)
Nag, Tanay; Sen, Diptiman; Dutta, Amit
2015-06-01
We use Floquet theory to study the maximum value of the stroboscopic group velocity in a one-dimensional tight-binding model subjected to an on-site staggered potential varying sinusoidally in time. The results obtained by numerically diagonalizing the Floquet operator are analyzed using a variety of analytical schemes. In the low-frequency limit we use adiabatic theory, while in the high-frequency limit the Magnus expansion of the Floquet Hamiltonian turns out to be appropriate. When the magnitude of the staggered potential is much greater or much less than the hopping, we use degenerate Floquet perturbation theory; we find that dynamical localization occurs in the former case when the maximum group velocity vanishes. Finally, starting from an "engineered" initial state where the particles (taken to be hard-core bosons) are localized in one part of the chain, we demonstrate that the existence of a maximum stroboscopic group velocity manifests in a light-cone-like spreading of the particles in real space.
Research on the frequency hopping bistatic sonar system
NASA Astrophysics Data System (ADS)
Liang, Guo-long; Zhang, Yao; Zhang, Guang-pu; Liu, Kai
2011-10-01
A new model for bistatic sonar system is established, in which frequency hopping (FH) signals are used for targets detection according to some rules. This model can decrease the time between adjacent signals and obtain more information in a unit time. The receiving system will receive and process the signals of different frequency respectively, according the FH pattern, for detecting and locating targets. This method can helps yield more stable and accurate outputs, using the characteristic of the FH signals, increase the ability of anti-detection and anti partial-band jamming.
The epidemic spreading model and the direction of information flow in brain networks.
Meier, J; Zhou, X; Hillebrand, A; Tewarie, P; Stam, C J; Van Mieghem, P
2017-05-15
The interplay between structural connections and emerging information flow in the human brain remains an open research problem. A recent study observed global patterns of directional information flow in empirical data using the measure of transfer entropy. For higher frequency bands, the overall direction of information flow was from posterior to anterior regions whereas an anterior-to-posterior pattern was observed in lower frequency bands. In this study, we applied a simple Susceptible-Infected-Susceptible (SIS) epidemic spreading model on the human connectome with the aim to reveal the topological properties of the structural network that give rise to these global patterns. We found that direct structural connections induced higher transfer entropy between two brain regions and that transfer entropy decreased with increasing distance between nodes (in terms of hops in the structural network). Applying the SIS model, we were able to confirm the empirically observed opposite information flow patterns and posterior hubs in the structural network seem to play a dominant role in the network dynamics. For small time scales, when these hubs acted as strong receivers of information, the global pattern of information flow was in the posterior-to-anterior direction and in the opposite direction when they were strong senders. Our analysis suggests that these global patterns of directional information flow are the result of an unequal spatial distribution of the structural degree between posterior and anterior regions and their directions seem to be linked to different time scales of the spreading process. Copyright © 2017 Elsevier Inc. All rights reserved.
Bi-orthogonal Symbol Mapping and Detection in Optical CDMA Communication System
NASA Astrophysics Data System (ADS)
Liu, Maw-Yang
2017-12-01
In this paper, the bi-orthogonal symbol mapping and detection scheme is investigated in time-spreading wavelength-hopping optical CDMA communication system. The carrier-hopping prime code is exploited as signature sequence, whose put-of-phase autocorrelation is zero. Based on the orthogonality of carrier-hopping prime code, the equal weight orthogonal signaling scheme can be constructed, and the proposed scheme using bi-orthogonal symbol mapping and detection can be developed. The transmitted binary data bits are mapped into corresponding bi-orthogonal symbols, where the orthogonal matrix code and its complement are utilized. In the receiver, the received bi-orthogonal data symbol is fed into the maximum likelihood decoder for detection. Under such symbol mapping and detection, the proposed scheme can greatly enlarge the Euclidean distance; hence, the system performance can be drastically improved.
Conduction mechanism in bismuth silicate glasses containing titanium
NASA Astrophysics Data System (ADS)
Dult, Meenakshi; Kundu, R. S.; Murugavel, S.; Punia, R.; Kishore, N.
2014-11-01
Bismuth silicate glasses mixed with different concentrations of titanium dioxide having compositions xTiO2-(60-x)Bi2O3-40SiO2 with x=0, 5, 10, 15 and 20 were prepared by the normal melt quench technique. The frequency dependence of the ac electrical conductivity of different compositions of titanium bismuth silicate glasses has been studied in the frequency range 10-1 Hz to 10 MHz and in the temperature range 623-703 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of titanium bismuth silicate glass system. The dc conductivity (σdc), so called crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. The conductivity data have been analyzed in terms of different theoretical models to determine the possible conduction mechanism. Analysis of the conductivity data and the frequency exponent shows that the correlated barrier hopping of electrons between Ti3+ and Ti4+ ions in the glasses is the most favorable mechanism for ac conduction. The temperature dependent dc conductivity has been analyzed in the framework of theoretical variable range hopping model (VRH) proposed by Mott which describe the hopping conduction in disordered semiconducting systems. The various polaron hopping parameters have also been deduced. Mott's VRH model is found to be in good agreement with experimental data and the values of inverse localization length of s-like wave function (α) obtained by this model with modifications suggested by Punia et al. are close to the ones reported for a number of oxide glasses.
Modular Multi-Function Multi-Band Airborne Radio System (MFBARS). Volume II. Detailed Report.
1981-06-01
Three Platforms in a Field of Hyperbolic LOP’s.......................... 187 76 Comparison, MFBARS Versus Baseline .......... 190 77 Program Flow Chart...configure, from a set of common modules, a given total CNI capability on specific platforms for a given mission " the ability to take advantage of...X Comm/Nav GPS L-Band; Spread Spectrum Nay X X SEEK TALK UHF Spread; Spectrum Comm X X SINCGARS VHF; Freq. Hop Comm (some platforms ) AFSATCOM UHF
NASA Astrophysics Data System (ADS)
Lunkenheimer, P.; Mayr, F.; Loidl, A.
2006-07-01
We report the frequency-dependent conductivity of the manganite system La1-xSrxMnO3 (x0.2) when approaching the metal-insulator transition from the insulating side. Results from low-frequency dielectric measurements are combined with spectra in the infrared region. For low doping levels the behavior is dominated by hopping transport of localized charge carriers at low frequencies and by phononic and electronic excitations in the infrared region. For the higher Sr contents the approach of the metallic state is accompanied by the successive suppression of the hopping contribution at low frequencies and by the development of polaronic excitations in the infrared region, which finally become superimposed by a strong Drude contribution in the fully metallic state.
Frequency hopping signal detection based on wavelet decomposition and Hilbert-Huang transform
NASA Astrophysics Data System (ADS)
Zheng, Yang; Chen, Xihao; Zhu, Rui
2017-07-01
Frequency hopping (FH) signal is widely adopted by military communications as a kind of low probability interception signal. Therefore, it is very important to research the FH signal detection algorithm. The existing detection algorithm of FH signals based on the time-frequency analysis cannot satisfy the time and frequency resolution requirement at the same time due to the influence of window function. In order to solve this problem, an algorithm based on wavelet decomposition and Hilbert-Huang transform (HHT) was proposed. The proposed algorithm removes the noise of the received signals by wavelet decomposition and detects the FH signals by Hilbert-Huang transform. Simulation results show the proposed algorithm takes into account both the time resolution and the frequency resolution. Correspondingly, the accuracy of FH signals detection can be improved.
1THz synchronous tuning of two optical synthesizers
NASA Astrophysics Data System (ADS)
Neuhaus, Rudolf; Rohde, Felix; Benkler, Erik; Puppe, Thomas; Raab, Christoph; Unterreitmayer, Reinhard; Zach, Armin; Telle, Harald R.; Stuhler, Jürgen
2016-04-01
Single-frequency optical synthesizers (SFOS) provide an optical field with arbitrarily adjustable frequency and phase which is phase-coherently linked to a reference signal. Ideally, they combine the spectral resolution of narrow linewidth frequency stabilized lasers with the broad spectral coverage of frequency combs in a tunable fashion. In state-of-the-art SFOSs tuning across comb lines requires comb line order switching,1, 2 which imposes technical overhead with problems like forbidden frequency gaps or strong phase glitches. Conventional tunable lasers often tune over only tens of GHz before mode-hops occur. Here, we present a novel type of SFOSs, which relies on a serrodyne technique with conditional flyback,3 shifting the carrier frequency of the employed frequency comb without an intrusion into the comb generator. It utilizes a new continuously tunable diode laser that tunes mode-hop-free across the full gain spectrum of the integrated laser diode. We investigate the tuning behavior of two identical SFOSs that share a common reference, by comparing the phases of their output signals. Previously, we achieved phase-stable and cycle-slip free frequency tuning over 28.1 GHz with a maximum zero-to-peak phase deviation of 62 mrad4 when sharing a common comb generator. With the new continuously tunable lasers, the SFOSs tune synchronously across nearly 17800 comb lines (1 THz). The tuning range in this approach can be extended to the full bandwidth of the frequency comb and the 110 nm mode-hop-free tuning range of the diode laser.
USDA-ARS?s Scientific Manuscript database
Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics ...
High-Speed On-Board Data Processing for Science Instruments: HOPS
NASA Technical Reports Server (NTRS)
Beyon, Jeffrey
2015-01-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Electrical conduction mechanism and dielectric characterization of MnTPPCl thin films
NASA Astrophysics Data System (ADS)
Meikhail, M. S.; Oraby, A. H.; El-Nahass, M. M.; Zeyada, H. M.; Al-Muntaser, A. A.
2018-06-01
The AC conductivity and dielectric properties of MnTPPCl sandwich structure as Au/MnTPPCl/Au were studied. The conductivity of the MnTPPCl thin films have been interpreted by the correlated barrier hopping (CBH) model. The dominant conduction process have found to be the single polaron hopping conduction. The values of the hopping distance, Rω, barrier height, W, and the localized-state density, N, are estimated at different frequencies. The behavior of dielectric constant and dielectric loss was discussed as a function of temperature and frequency. The dielectric constant was described in terms of polarization mechanism in materials. The spectral behavior of dielectric loss is interpreted on the basis of the Giuntini et al. model [1]. The value of WM is obtained as 0.32 eV. A non-Debye relaxation phenomenon was observed from the dielectric relaxation mechanism.
USDA-ARS?s Scientific Manuscript database
Viroids are small, infectious, single-stranded RNA molecules that cause several important citrus diseases. Viroids are transmitted primarily in budwood, however, spread can also occur mechanically on pruning equipment, budding knives, hedging and topping equipment. Exocortis and cachexia are two we...
Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.
2013-12-01
Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.
Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John
2015-06-01
In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.
NASA Astrophysics Data System (ADS)
Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif
2007-08-01
We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.
High-Speed On-Board Data Processing Platform for LIDAR Projects at NASA Langley Research Center
NASA Astrophysics Data System (ADS)
Beyon, J.; Ng, T. K.; Davis, M. J.; Adams, J. K.; Lin, B.
2015-12-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 - April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.
Condom use and hip hop culture: the case of urban young men in New York City.
Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G
2008-06-01
We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.
NASA Astrophysics Data System (ADS)
Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.
2018-05-01
In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.
Cavagna, G A; Franzetti, P; Heglund, N C; Willems, P
1988-01-01
1. During each step of running, trotting or hopping part of the gravitational and kinetic energy of the body is absorbed and successively restored by the muscles as in an elastic rebound. In this study we analysed the vertical motion of the centre of gravity of the body during this rebound and defined the relationship between the apparent natural frequency of the bouncing system and the step frequency at the different speeds. 2. The step period and the vertical oscillation of the centre of gravity during the step were divided into two parts: a part taking place when the vertical force exerted on the ground is greater than body weight (lower part of the oscillation) and a part taking place when this force is smaller than body weight (upper part of the oscillation). This analysis was made on running humans and birds; trotting dogs, monkeys and rams; and hopping kangaroos and springhares. 3. During trotting and low-speed running the rebound is symmetric, i.e. the duration and the amplitude of the lower part of the vertical oscillation of the centre of gravity are about equal to those of the upper part. In this case, the step frequency equals the frequency of the bouncing system. 4. At high speeds of running and in hopping the rebound is asymmetric, i.e. the duration and the amplitude of the upper part of the oscillation are greater than those of the lower part, and the step frequency is lower than the frequency of the system. 5. The asymmetry is due to a relative increase in the vertical push. At a given speed, the asymmetric bounce requires a greater power to maintain the motion of the centre of gravity of the body, Wext, than the symmetric bounce. A reduction of the push would decrease Wext but the resulting greater step frequency would increase the power required to accelerate the limbs relative to the centre of gravity, Wint. It is concluded that the asymmetric rebound is adopted in order to minimize the total power, Wext + Wint. PMID:3404473
Cavagna, G A; Franzetti, P; Heglund, N C; Willems, P
1988-05-01
1. During each step of running, trotting or hopping part of the gravitational and kinetic energy of the body is absorbed and successively restored by the muscles as in an elastic rebound. In this study we analysed the vertical motion of the centre of gravity of the body during this rebound and defined the relationship between the apparent natural frequency of the bouncing system and the step frequency at the different speeds. 2. The step period and the vertical oscillation of the centre of gravity during the step were divided into two parts: a part taking place when the vertical force exerted on the ground is greater than body weight (lower part of the oscillation) and a part taking place when this force is smaller than body weight (upper part of the oscillation). This analysis was made on running humans and birds; trotting dogs, monkeys and rams; and hopping kangaroos and springhares. 3. During trotting and low-speed running the rebound is symmetric, i.e. the duration and the amplitude of the lower part of the vertical oscillation of the centre of gravity are about equal to those of the upper part. In this case, the step frequency equals the frequency of the bouncing system. 4. At high speeds of running and in hopping the rebound is asymmetric, i.e. the duration and the amplitude of the upper part of the oscillation are greater than those of the lower part, and the step frequency is lower than the frequency of the system. 5. The asymmetry is due to a relative increase in the vertical push. At a given speed, the asymmetric bounce requires a greater power to maintain the motion of the centre of gravity of the body, Wext, than the symmetric bounce. A reduction of the push would decrease Wext but the resulting greater step frequency would increase the power required to accelerate the limbs relative to the centre of gravity, Wint. It is concluded that the asymmetric rebound is adopted in order to minimize the total power, Wext + Wint.
Vantage Theory, Statistics and the Mental Worldview
ERIC Educational Resources Information Center
Niewiara, Aleksandra
2010-01-01
The paper investigates Polish punk and hip hop (rap) song lyrics broken down into frequency lists. In an analysis inspired by MacLaury's view of categorization, the construals of punk and hip hop worldviews are shown to vary in the distance of the observer from the world, the width of the viewing frame, as well as the granularity and density of…
Analysis and Testing of Mobile Wireless Networks
NASA Technical Reports Server (NTRS)
Alena, Richard; Evenson, Darin; Rundquist, Victor; Clancy, Daniel (Technical Monitor)
2002-01-01
Wireless networks are being used to connect mobile computing elements in more applications as the technology matures. There are now many products (such as 802.11 and 802.11b) which ran in the ISM frequency band and comply with wireless network standards. They are being used increasingly to link mobile Intranet into Wired networks. Standard methods of analyzing and testing their performance and compatibility are needed to determine the limits of the technology. This paper presents analytical and experimental methods of determining network throughput, range and coverage, and interference sources. Both radio frequency (BE) domain and network domain analysis have been applied to determine wireless network throughput and range in the outdoor environment- Comparison of field test data taken under optimal conditions, with performance predicted from RF analysis, yielded quantitative results applicable to future designs. Layering multiple wireless network- sooners can increase performance. Wireless network components can be set to different radio frequency-hopping sequences or spreading functions, allowing more than one sooner to coexist. Therefore, we ran multiple 802.11-compliant systems concurrently in the same geographical area to determine interference effects and scalability, The results can be used to design of more robust networks which have multiple layers of wireless data communication paths and provide increased throughput overall.
Purely hopping conduction in c-axis oriented LiNbO3 thin films
NASA Astrophysics Data System (ADS)
Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay
2009-05-01
Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khaldi, O.; Kassmi, M.; El Manar University, LMOP, 2092 Tunis
2014-08-28
Capacitance nonlinearities were studied in atomic layer deposited HfO{sub 2} films using two types of signals: a pure ac voltage of large magnitude (ac nonlinearities) and a small ac voltage superimposed to a large dc voltage (dc nonlinearities). In theory, ac and dc nonlinearities should be of the same order of magnitude. However, in practice, ac nonlinearities are found to be an order of magnitude higher than dc nonlinearities. Besides capacitance nonlinearities, hopping conduction is studied using low-frequency impedance measurements and is discussed through the correlated barrier hopping model. The link between hopping and nonlinearity is established. The ac nonlinearitiesmore » are ascribed to the polarization of isolated defect pairs, while dc nonlinearities are attributed to electrode polarization which originates from defect percolation paths. Both the ac and dc capacitance nonlinearities display an exponential variation with voltage, which results from field-induced lowering of the hopping barrier energy.« less
Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City
Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.
2008-01-01
Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799
Polaron hopping in olivine phosphates studied by nuclear resonant scattering
NASA Astrophysics Data System (ADS)
Tracy, Sally June
Valence fluctuations of Fe2+ and Fe3+ were studied in a solid solution of LixFePO4 by nuclear resonant forward scattering of synchrotron x rays while the sample was heated in a diamond-anvil pressure cell. The spectra acquired at different temperatures and pressures were analyzed for the frequencies of valence changes using the Blume-Tjon model of a system with a fluctuating Hamiltonian. These frequencies were analyzed to obtain activation energies and an activation volume for polaron hopping. There was a large suppression of hopping frequency with pressure, giving an anomalously large activation volume. This large, positive value is typical of ion diffusion, which indicates correlated motions of polarons, and Li+ ions that alter the dynamics of both. In a parallel study of NaxFePO4, the interplay between sodium ordering and electron mobility was investigated using a combination of synchrotron x-ray diffraction and nuclear resonant scattering. Conventional Mossbauer spectra were collected while the sample was heated in a resistive furnace. An analysis of the temperature evolution of the spectral shapes was used to identify the onset of fast electron hopping and determine the polaron hopping rate. Synchrotron x-ray diffraction measurements were carried out in the same temperature range. Reitveld analysis of the diffraction patterns was used to determine the temperature of sodium redistribution on the lattice. The diffraction analysis also provides new information about the phase stability of the system. The temperature evolution of the iron site occupancies from the Mossbauer measurements, combined with the synchrotron diffraction results give strong evidence for a relationship between the onset of fast electron dynamics and the redistribution of sodium in the lattice. Measurements of activation barriers for polaron hopping gave fundamental insights about the correlation between electronic carriers and mobile ions. This work established that polaron-ion interactions can alter the local dynamics of electron and ion transport. These types of coupled processes may be common in many materials used for battery electrodes, and new details concerning the influence of polaron-ion interactions on the charge dynamics are relevant to optimizing their electrochemical performance.
Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).
Stannard, Hayley J; Tulk, Melissa L; Old, Julie M
2017-03-01
Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine procedures, close montoring and quick action in response to signs of illness will ensure Tyzzer's disease outbreaks do not occur. Copyright © 2017 Elsevier B.V. All rights reserved.
DOW-PR DOlphin and Whale Pods Routing Protocol for Underwater Wireless Sensor Networks (UWSNs).
Wadud, Zahid; Ullah, Khadem; Hussain, Sajjad; Yang, Xiaodong; Qazi, Abdul Baseer
2018-05-12
Underwater Wireless Sensor Networks (UWSNs) have intrinsic challenges that include long propagation delays, high mobility of sensor nodes due to water currents, Doppler spread, delay variance, multipath, attenuation and geometric spreading. The existing Weighting Depth and Forwarding Area Division Depth Based Routing (WDFAD-DBR) protocol considers the weighting depth of the two hops in order to select the next Potential Forwarding Node (PFN). To improve the performance of WDFAD-DBR, we propose DOlphin and Whale Pod Routing protocol (DOW-PR). In this scheme, we divide the transmission range into a number of transmission power levels and at the same time select the next PFNs from forwarding and suppressed zones. In contrast to WDFAD-DBR, our scheme not only considers the packet upward advancement, but also takes into account the number of suppressed nodes and number of PFNs at the first and second hops. Consequently, reasonable energy reduction is observed while receiving and transmitting packets. Moreover, our scheme also considers the hops count of the PFNs from the sink. In the absence of PFNs, the proposed scheme will select the node from the suppressed region for broadcasting and thus ensures minimum loss of data. Besides this, we also propose another routing scheme (whale pod) in which multiple sinks are placed at water surface, but one sink is embedded inside the water and is physically connected with the surface sink through high bandwidth connection. Simulation results show that the proposed scheme has high Packet Delivery Ratio (PDR), low energy tax, reduced Accumulated Propagation Distance (APD) and increased the network lifetime.
DOW-PR DOlphin and Whale Pods Routing Protocol for Underwater Wireless Sensor Networks (UWSNs)
Wadud, Zahid; Ullah, Khadem; Hussain, Sajjad; Yang, Xiaodong; Qazi, Abdul Baseer
2018-01-01
Underwater Wireless Sensor Networks (UWSNs) have intrinsic challenges that include long propagation delays, high mobility of sensor nodes due to water currents, Doppler spread, delay variance, multipath, attenuation and geometric spreading. The existing Weighting Depth and Forwarding Area Division Depth Based Routing (WDFAD-DBR) protocol considers the weighting depth of the two hops in order to select the next Potential Forwarding Node (PFN). To improve the performance of WDFAD-DBR, we propose DOlphin and Whale Pod Routing protocol (DOW-PR). In this scheme, we divide the transmission range into a number of transmission power levels and at the same time select the next PFNs from forwarding and suppressed zones. In contrast to WDFAD-DBR, our scheme not only considers the packet upward advancement, but also takes into account the number of suppressed nodes and number of PFNs at the first and second hops. Consequently, reasonable energy reduction is observed while receiving and transmitting packets. Moreover, our scheme also considers the hops count of the PFNs from the sink. In the absence of PFNs, the proposed scheme will select the node from the suppressed region for broadcasting and thus ensures minimum loss of data. Besides this, we also propose another routing scheme (whale pod) in which multiple sinks are placed at water surface, but one sink is embedded inside the water and is physically connected with the surface sink through high bandwidth connection. Simulation results show that the proposed scheme has high Packet Delivery Ratio (PDR), low energy tax, reduced Accumulated Propagation Distance (APD) and increased the network lifetime. PMID:29757208
Leg exoskeleton reduces the metabolic cost of human hopping.
Grabowski, Alena M; Herr, Hugh M
2009-09-01
During bouncing gaits such as hopping and running, leg muscles generate force to enable elastic energy storage and return primarily from tendons and, thus, demand metabolic energy. In an effort to reduce metabolic demand, we designed two elastic leg exoskeletons that act in parallel with the wearer's legs; one exoskeleton consisted of a multiple leaf (MLE) and the other of a single leaf (SLE) set of fiberglass springs. We hypothesized that hoppers, hopping on both legs, would adjust their leg stiffness while wearing an exoskeleton so that the combination of the hopper and exoskeleton would behave as a linear spring-mass system with the same total stiffness as during normal hopping. We also hypothesized that decreased leg force generation while wearing an exoskeleton would reduce the metabolic power required for hopping. Nine subjects hopped in place at 2.0, 2.2, 2.4, and 2.6 Hz with and without an exoskeleton while we measured ground reaction forces, exoskeletal compression, and metabolic rates. While wearing an exoskeleton, hoppers adjusted their leg stiffness to maintain linear spring-mass mechanics and a total stiffness similar to normal hopping. Without accounting for the added weight of each exoskeleton, wearing the MLE reduced net metabolic power by an average of 6% and wearing the SLE reduced net metabolic power by an average of 24% compared with hopping normally at frequencies between 2.0 and 2.6 Hz. Thus, when hoppers used external parallel springs, they likely decreased the mechanical work performed by the legs and substantially reduced metabolic demand compared with hopping without wearing an exoskeleton.
NASA Astrophysics Data System (ADS)
Shi, Guang; Wang, Wen; Zhang, Fumin
2018-03-01
The measurement precision of frequency-modulated continuous-wave (FMCW) laser distance measurement should be proportional to the scanning range of the tunable laser. However, the commercial external cavity diode laser (ECDL) is not an ideal tunable laser source in practical applications. Due to the unavoidable mode hopping and scanning nonlinearity of the ECDL, the measurement precision of FMCW laser distance measurements can be substantially affected. Therefore, an FMCW laser ranging system with two auxiliary interferometers is proposed in this paper. Moreover, to eliminate the effects of ECDL, the frequency-sampling method and mode hopping influence suppression method are employed. Compared with a fringe counting interferometer, this FMCW laser ranging system has a measuring error of ± 20 μm at the distance of 5.8 m.
47 CFR 15.215 - Additional provisions to the general radiated emission limitations.
Code of Federal Regulations, 2010 CFR
2010-10-01
... hopping and other modulation techniques that may be employed as well as the frequency stability of the... RADIO FREQUENCY DEVICES Intentional Radiators Radiated Emission Limits, Additional Provisions § 15.215... operating in specified frequency bands. Unless otherwise stated, there are no restrictions as to the types...
NASA Astrophysics Data System (ADS)
M, Dongol; M, M. El-Nahass; A, El-Denglawey; A, A. Abuelwafa; T, Soga
2016-06-01
Alternating current (AC) conductivity and dielectric properties of thermally evaporated Au/PtOEP/Au thin films are investigated each as a function of temperature (303 K-473 K) and frequency (50 Hz-5 MHz). The frequency dependence of AC conductivity follows the Jonscher universal dynamic law. The AC-activation energies are determined at different frequencies. It is found that the correlated barrier hopping (CBH) model is the dominant conduction mechanism. The variation of the frequency exponent s with temperature is analyzed in terms of the CBH model. Coulombic barrier height W m , hopping distance R ω , and the density of localized states N(E F) are valued at different frequencies. Dielectric constant ɛ 1(ω,T) and dielectric loss ɛ 2(ω,T) are discussed in terms of the dielectric polarization process. The dielectric modulus shows the non-Debye relaxation in the material. The extracted relaxation time by using the imaginary part of modulus (M″) is found to follow the Arrhenius law.
Opportunistic Access in Frequency Hopping Cognitive Radio Networks
2014-03-27
thresholding MA multiple access MFSK M-ary frequency shift keying MIMO multiple-input/multiple-output OFDM orthogonal frequency-division multiplexing x...adaptive BER performance as a function of ISR with orthogonal frequency-division multiplexing ( OFDM ) interference present. . . . . . . . . . 41 4.15 Non...adaptive BER performance as a function of EB/N0 with OFDM interfer- ence present
Efficient and stable transformation of hop (Humulus lupulus L.) var. Eroica by particle bombardment.
Batista, Dora; Fonseca, Sandra; Serrazina, Susana; Figueiredo, Andreia; Pais, Maria Salomé
2008-07-01
To the best of our knowledge, this is the first accurate and reliable protocol for hop (Humulus lupulus L.) genetic transformation using particle bombardment. Based on the highly productive regeneration system previously developed by us for hop var. Eroica, two efficient transformation protocols were established using petioles and green organogenic nodular clusters (GONCs) bombarded with gusA reporter and hpt selectable genes. A total of 36 hygromycin B-resistant (hyg(r)) plants obtained upon continuous selection were successfully transferred to the greenhouse, and a first generation group of transplanted plants was followed after spending a complete vegetative cycle. PCR analysis showed the presence of one of both transgenes in 25 plants, corresponding to an integration frequency of 69.4% and an overall transformation efficiency of 7.5%. Although all final transformants were GUS negative, the integration frequency of gusA gene was higher than that of hpt gene. Petiole-derived transgenic plants showed a higher co-integration rate of 76.9%. Real-time PCR analysis confirmed co-integration in 86% of the plants tested and its stability until the first generation, and identified positive plants amongst those previously assessed as hpt (+) only by conventional PCR. Our results suggest that the integration frequencies presented here, as well as those of others, may have been underestimated, and that PCR results should be taken with precaution not only for false positives, but also for false negatives. The protocols here described could be very useful for future introduction of metabolic or resistance traits in hop cultivars even if slight modifications for other genotypes are needed.
Hopping Conduction and Bacteria: Transport Properties of Disordered Reaction-Diffusion Systems
NASA Astrophysics Data System (ADS)
Missel, Andrew; Dahmen, Karin
2008-03-01
Reaction-diffusion (RD) systems are used to model everything from the formation of animal coat patterns to the spread of genes in a population to the seasonal variation of plankton density in the ocean. In all of these problems, disorder plays a large role, but determining its effects on transport properties in RD systems has been a challenge. We present here both analytical and numerical studies of a particular disordered RD system consisting of particles which are allowed to diffuse and compete for resources (2A->A) with spatially homogeneous rates, reproduce (A->2A) in certain areas (``oases''), and die (A->0) everywhere else (the ``desert''). In the low oasis density regime, transport is mediated through rare ``hopping events'' in which a small number of particles diffuse through the desert from one oasis to another; the situation is mathematically analogous to hopping conduction in doped semiconductors, and this analogy, along with some ideas from first passage percolation theory, allows us to make some quantitative predictions about the transport properties of the system on a large scale.
Design and Processing of a Novel Chaos-Based Stepped Frequency Synthesized Wideband Radar Signal.
Zeng, Tao; Chang, Shaoqiang; Fan, Huayu; Liu, Quanhua
2018-03-26
The linear stepped frequency and linear frequency shift keying (FSK) signal has been widely used in radar systems. However, such linear modulation signals suffer from the range-Doppler coupling that degrades radar multi-target resolution. Moreover, the fixed frequency-hopping or frequency-coded sequence can be easily predicted by the interception receiver in the electronic countermeasures (ECM) environments, which limits radar anti-jamming performance. In addition, the single FSK modulation reduces the radar low probability of intercept (LPI) performance, for it cannot achieve a large time-bandwidth product. To solve such problems, we propose a novel chaos-based stepped frequency (CSF) synthesized wideband signal in this paper. The signal introduces chaotic frequency hopping between the coherent stepped frequency pulses, and adopts a chaotic frequency shift keying (CFSK) and phase shift keying (PSK) composited coded modulation in a subpulse, called CSF-CFSK/PSK. Correspondingly, the processing method for the signal has been proposed. According to our theoretical analyses and the simulations, the proposed signal and processing method achieve better multi-target resolution and LPI performance. Furthermore, flexible modulation is able to increase the robustness against identification of the interception receiver and improve the anti-jamming performance of the radar.
PARALLEL HOP: A SCALABLE HALO FINDER FOR MASSIVE COSMOLOGICAL DATA SETS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Skory, Stephen; Turk, Matthew J.; Norman, Michael L.
2010-11-15
Modern N-body cosmological simulations contain billions (10{sup 9}) of dark matter particles. These simulations require hundreds to thousands of gigabytes of memory and employ hundreds to tens of thousands of processing cores on many compute nodes. In order to study the distribution of dark matter in a cosmological simulation, the dark matter halos must be identified using a halo finder, which establishes the halo membership of every particle in the simulation. The resources required for halo finding are similar to the requirements for the simulation itself. In particular, simulations have become too extensive to use commonly employed halo finders, suchmore » that the computational requirements to identify halos must now be spread across multiple nodes and cores. Here, we present a scalable-parallel halo finding method called Parallel HOP for large-scale cosmological simulation data. Based on the halo finder HOP, it utilizes message passing interface and domain decomposition to distribute the halo finding workload across multiple compute nodes, enabling analysis of much larger data sets than is possible with the strictly serial or previous parallel implementations of HOP. We provide a reference implementation of this method as a part of the toolkit {sup yt}, an analysis toolkit for adaptive mesh refinement data that include complementary analysis modules. Additionally, we discuss a suite of benchmarks that demonstrate that this method scales well up to several hundred tasks and data sets in excess of 2000{sup 3} particles. The Parallel HOP method and our implementation can be readily applied to any kind of N-body simulation data and is therefore widely applicable.« less
Millimeter Wave Alternate Route Study.
1981-04-01
processing gains are based upon the assumption that the jammer equally distributes his available power over all the hopping frequencies. If this is true...Examples Assumptions 0 25 GHz hopping range (e.g., 20 GHz to 45 GHz) 0 10 ms settling time * 0.1 second dwell time - implies 11% increase in channel data...of the architectures presented previously. The assumption that each link has equal probability p of being disrupted (i.e., successfully jammed) seems
2013-03-01
intermediate frequency LFM linear frequency modulation MAP maximum a posteriori MATLAB® matrix laboratory ML maximun likelihood OFDM orthogonal frequency...spectrum, frequency hopping, and orthogonal frequency division multiplexing ( OFDM ) modulations. Feature analysis would be a good research thrust to...determine feature relevance and decide if removing any features improves performance. Also, extending the system for simulations using a MIMO receiver or
Frequency hopping due to acousto-electric interaction in ZnO based surface acoustic wave oscillator
NASA Astrophysics Data System (ADS)
Dasgupta, Daipayan; Sreenivas, K.
2011-08-01
A 36 MHz surface acoustic wave delay line based oscillator has been used to study the effect of acousto-electric interaction due to photo generated charge carriers in rf sputtered ZnO film under UV illumination (λ = 365 nm, 20-100 μW/cm2). Design aspects for developing a delay line based SAW oscillator are specified. The observed linear downshift in frequency (2.2 to 19.0 kHz) with varying UV intensity (20-100 μW/cm2) is related to the fractional velocity change due to acousto-electric interaction. UV illumination level of 100 μW/cm2 leads to a characteristic frequency hopping behavior arising due to a change in the oscillation criteria, and is attributed to the complex interplay between the increased attenuation and velocity shift.
contain the low level desired frequency components that are passed through an inverse transform device for producing a frequency domain signal of the desired signal uncorrupted by unwanted signals. Patent applications. (RRH)
NASA Astrophysics Data System (ADS)
Ditta, Allah; Khan, Muhammad Azhar; Junaid, Muhammad; Khalil, R. M. Arif; Warsi, Muhammad Farooq
2017-02-01
Gadolinium (Gd) and Dysprosium (Dy) co-doped Ni-Co (Ni0.4Co0.6Fe2O4) ferrites were prepared by micro-emulsion route. X-ray diffraction (XRD) analysis indicated the development of cubic spinel structure. The lattice parameter and X-ray density were found to increase from 8.24 to 8.31 Å and 5.57 to 5.91 (gm/cm3) respectively as the Gd-Dy contents increased in nickel-cobalt ferrites. The crystallite size calculated from the Scherrer's formula exhibited the formation of nanocrystalline ferrites (13-26 nm). Two foremost absorption bands observed in FTIR spectra within 400 cm-1 (υ2) to 600 cm-1 (υ1) which correspond to stretching vibrations of tetrahedral and octahedral complexes respectively. The dielectric constant (ε) and dielectric loss (tanδ) were decreased by the optimization of frequency and abrupt decrease in the low frequency region and higher values in the high frequency region were observed. The dielectric dispersion was due to rapid decrease of dielectric constant in the low frequency region. This variation of dielectric dispersion was explicated in the light of space charge polarization model of Maxwell-Wagner. The dielectric loss occurs in these ferrites due to electron hopping and defects in the dipoles. The electron hopping was possible at low frequency range but at higher frequency the dielectric loss was decreased with the decrease of electron hopping. Magnetic properties were observed by measuring M-H loops. Due to low dielectric loss and dielectric constant these materials were appropriate in the fabrication of switching and memory storage devices.
NASA Astrophysics Data System (ADS)
Kitauchi, H.; Nozaki, K.; Ito, H.; Kondo, T.; Tsuchiya, S.; Imamura, K.; Nagatsuma, T.; Ishii, M.
2014-12-01
We present our recent efforts on an evaluation of the numerical prediction method of electric field strength for ionospheric propagation of low frequency (LF) radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012), "Prediction of field strength at frequencies below about 150 kHz," made by International Telecommunication Union Radiocommunication Sector (ITU-R). As part of the Japanese Antarctic Research Expedition (JARE), we conduct on-board measurements of the electric field strengths and phases of LF 40 kHz and 60 kHz of radio signals (call sign JJY) continuously along both the ways between Tokyo, Japan and Syowa Station, the Japanese Antarctic station, at 69° 00' S, 39° 35' E on East Ongul Island, Lützow-Holm Bay, East Antarctica. The measurements are made by a newly developed, highly sensitive receiving system installed on board the Japanese Antarctic research vessel (RV) Shirase. We obtained new data sets of the electric field strength up to approximately 13,000-14,000 km propagation of LF JJY 40 kHz and 60 kHz radio waves by utilizing a newly developed, highly sensitive receiving system, comprised of an orthogonally crossed double-loop antenna and digital-signal-processing lock-in amplifiers, on board RV Shirase during the 55th JARE from November 2013 to April 2014. We have made comparisons between those on-board measurements and the numerical predictions of field strength for long-range propagation of low frequency radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012) to show that our results qualitatively support the recommended wave-hop theory for the great-circle paths approximately 7,000-8,000 km and 13,000-14,000 km propagations.
Spin diffusion in disordered organic semiconductors
NASA Astrophysics Data System (ADS)
Li, Ling; Gao, Nan; Lu, Nianduan; Liu, Ming; Bässler, Heinz
2015-12-01
An analytical theory for spin diffusion in disordered organic semiconductors is derived. It is based on percolation theory and variable range hopping in a disordered energy landscape with a Gaussian density of states. It describes universally the dependence of the spin diffusion on temperature, carrier density, material disorder, magnetic field, and electric field at the arbitrary magnitude of the Hubbard energy of charge pairs. It is found that, compared to the spin transport carried by carriers hopping, the spin exchange will hinder the spin diffusion process at low carrier density, even under the condition of a weak electric field. Importantly, under the influence of a bias voltage, anomalous spreading of the spin packet will lead to an abnormal temperature dependence of the spin diffusion coefficient and diffusion length. This explains the recent experimental data for spin diffusion length observed in Alq3.
Study of hopping type conduction from AC conductivity in multiferroic composite
NASA Astrophysics Data System (ADS)
Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan
2018-05-01
0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).
Talpalar, Adolfo E.; Rybak, Ilya A.
2015-01-01
The locomotor gait in limbed animals is defined by the left-right leg coordination and locomotor speed. Coordination between left and right neural activities in the spinal cord controlling left and right legs is provided by commissural interneurons (CINs). Several CIN types have been genetically identified, including the excitatory V3 and excitatory and inhibitory V0 types. Recent studies demonstrated that genetic elimination of all V0 CINs caused switching from a normal left-right alternating activity to a left-right synchronized “hopping” pattern. Furthermore, ablation of only the inhibitory V0 CINs (V0D subtype) resulted in a lack of left-right alternation at low locomotor frequencies and retaining this alternation at high frequencies, whereas selective ablation of the excitatory V0 neurons (V0V subtype) maintained the left–right alternation at low frequencies and switched to a hopping pattern at high frequencies. To analyze these findings, we developed a simplified mathematical model of neural circuits consisting of four pacemaker neurons representing left and right, flexor and extensor rhythm-generating centers interacting via commissural pathways representing V3, V0D, and V0V CINs. The locomotor frequency was controlled by a parameter defining the excitation of neurons and commissural pathways mimicking the effects of N-methyl-D-aspartate on locomotor frequency in isolated rodent spinal cord preparations. The model demonstrated a typical left-right alternating pattern under control conditions, switching to a hopping activity at any frequency after removing both V0 connections, a synchronized pattern at low frequencies with alternation at high frequencies after removing only V0D connections, and an alternating pattern at low frequencies with hopping at high frequencies after removing only V0V connections. We used bifurcation theory and fast-slow decomposition methods to analyze network behavior in the above regimes and transitions between them. The model reproduced, and suggested explanation for, a series of experimental phenomena and generated predictions available for experimental testing. PMID:25970489
Wang, Xuping; Yang, Lei; Yang, Xiaolan; Tian, Yanhua
2014-06-01
Hops (Humulus lupulus L.) contain 40-140 mg g(-1) polyphenols. The objective of this study was to determine the phenolic composition of a high-purity (total phenolic content = 887 mg g(-1) ) hop polyphenol extract (HPE) and evaluate its antioxidant activities in vivo and in vitro and its antimutagenic activity. The antioxidant activity of HPE was compared with the activity of green tea polyphenols. The phenolic compositions of HPE were more than 55% proanthocyanidins and more than 28% flavonoid glycosides. In vitro, HPE effectively scavenged α,α-diphenyl-β-picrylhydrazyl, hydroxyl and superoxide anion radicals, and inhibited DNA oxidative damage. In vivo, oral HPE at a polyphenol dose of 200-800 mg kg(-1) body weight significantly prevented a bromobenzene-induced decrease in liver superoxide dismutase and glutathione peroxidase activity, and decreased levels of liver thiobarbituric acid reactive substances in bromobenzene-treated mice. An oral dose of 20-80 mg kg(-1) body weight HPE significantly reduced the frequency of bone marrow micronuclei induced by cyclophosphamide. The antioxidant activities of hop polyphenols in vitro and in vivo were higher than green tea polyphenols at the same concentration. Hop polyphenols had the same or higher antioxidant activity than tea polyphenols. Hop polyphenols might be useful as natural antioxidants and antimutagens. © 2013 Society of Chemical Industry.
A zero power harmonic transponder sensor for ubiquitous wireless μL liquid-volume monitoring
NASA Astrophysics Data System (ADS)
Huang, Haiyu; Chen, Pai-Yen; Hung, Cheng-Hsien; Gharpurey, Ranjit; Akinwande, Deji
2016-01-01
Autonomous liquid-volume monitoring is crucial in ubiquitous healthcare. However, conventional approach is based on either human visual observation or expensive detectors, which are costly for future pervasive monitoring. Here we introduce a novel approach based on passive harmonic transponder antenna sensor and frequency hopping spread spectrum (FHSS) pattern analysis, to provide a very low cost wireless μL-resolution liquid-volume monitoring without battery or digital circuits. In our conceptual demonstration, the harmonic transponder comprises of a passive nonlinear frequency multiplier connected to a metamaterial-inspired 3-D antenna designed to be highly sensitive to the liquid-volume within a confined region. The transponder first receives some FHSS signal from an interrogator, then converts such signal to its harmonic band and re-radiates through the antenna sensor. The harmonic signal is picked up by a sniffer receiver and decoded through pattern analysis of the high dimensional FHSS signal strength data. A robust, zero power, absolute accuracy wireless liquid-volume monitoring is realized in the presence of strong direct coupling, background scatters, distance variance as well as near-field human-body interference. The concepts of passive harmonic transponder sensor, metamaterial-inspired antenna sensor, and FHSS pattern analysis based sensor decoding may help establishing cost-effective, energy-efficient and intelligent wireless pervasive healthcare monitoring platforms.
A zero power harmonic transponder sensor for ubiquitous wireless μL liquid-volume monitoring.
Huang, Haiyu; Chen, Pai-Yen; Hung, Cheng-Hsien; Gharpurey, Ranjit; Akinwande, Deji
2016-01-06
Autonomous liquid-volume monitoring is crucial in ubiquitous healthcare. However, conventional approach is based on either human visual observation or expensive detectors, which are costly for future pervasive monitoring. Here we introduce a novel approach based on passive harmonic transponder antenna sensor and frequency hopping spread spectrum (FHSS) pattern analysis, to provide a very low cost wireless μL-resolution liquid-volume monitoring without battery or digital circuits. In our conceptual demonstration, the harmonic transponder comprises of a passive nonlinear frequency multiplier connected to a metamaterial-inspired 3-D antenna designed to be highly sensitive to the liquid-volume within a confined region. The transponder first receives some FHSS signal from an interrogator, then converts such signal to its harmonic band and re-radiates through the antenna sensor. The harmonic signal is picked up by a sniffer receiver and decoded through pattern analysis of the high dimensional FHSS signal strength data. A robust, zero power, absolute accuracy wireless liquid-volume monitoring is realized in the presence of strong direct coupling, background scatters, distance variance as well as near-field human-body interference. The concepts of passive harmonic transponder sensor, metamaterial-inspired antenna sensor, and FHSS pattern analysis based sensor decoding may help establishing cost-effective, energy-efficient and intelligent wireless pervasive healthcare monitoring platforms.
A zero power harmonic transponder sensor for ubiquitous wireless μL liquid-volume monitoring
Huang, Haiyu; Chen, Pai-Yen; Hung, Cheng-Hsien; Gharpurey, Ranjit; Akinwande, Deji
2016-01-01
Autonomous liquid-volume monitoring is crucial in ubiquitous healthcare. However, conventional approach is based on either human visual observation or expensive detectors, which are costly for future pervasive monitoring. Here we introduce a novel approach based on passive harmonic transponder antenna sensor and frequency hopping spread spectrum (FHSS) pattern analysis, to provide a very low cost wireless μL-resolution liquid-volume monitoring without battery or digital circuits. In our conceptual demonstration, the harmonic transponder comprises of a passive nonlinear frequency multiplier connected to a metamaterial-inspired 3-D antenna designed to be highly sensitive to the liquid-volume within a confined region. The transponder first receives some FHSS signal from an interrogator, then converts such signal to its harmonic band and re-radiates through the antenna sensor. The harmonic signal is picked up by a sniffer receiver and decoded through pattern analysis of the high dimensional FHSS signal strength data. A robust, zero power, absolute accuracy wireless liquid-volume monitoring is realized in the presence of strong direct coupling, background scatters, distance variance as well as near-field human-body interference. The concepts of passive harmonic transponder sensor, metamaterial-inspired antenna sensor, and FHSS pattern analysis based sensor decoding may help establishing cost-effective, energy-efficient and intelligent wireless pervasive healthcare monitoring platforms. PMID:26732251
The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.
Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W
2009-07-01
The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.
A Middleware Solution for Wireless IoT Applications in Sparse Smart Cities
Lanzone, Stefano; Riberto, Giulio; Stefanelli, Cesare; Tortonesi, Mauro
2017-01-01
The spread of off-the-shelf mobile devices equipped with multiple wireless interfaces together with sophisticated sensors is paving the way to novel wireless Internet of Things (IoT) environments, characterized by multi-hop infrastructure-less wireless networks where devices carried by users act as sensors/actuators as well as network nodes. In particular, the paper presents Real Ad-hoc Multi-hop Peer-to peer-Wireless IoT Application (RAMP-WIA), a novel solution that facilitates the development, deployment, and management of applications in sparse Smart City environments, characterized by users willing to collaborate by allowing new applications to be deployed on their smartphones to remotely monitor and control fixed/mobile devices. RAMP-WIA allows users to dynamically configure single-hop wireless links, to manage opportunistically multi-hop packet dispatching considering that the network topology (together with the availability of sensors and actuators) may abruptly change, to actuate reliably sensor nodes specifically considering that only part of them could be actually reachable in a timely manner, and to upgrade dynamically the nodes through over-the-air distribution of new software components. The paper also reports the performance of RAMP-WIA on simple but realistic cases of small-scale deployment scenarios with off-the-shelf Android smartphones and Raspberry Pi devices; these results show not only the feasibility and soundness of the proposed approach, but also the efficiency of the middleware implemented when deployed on real testbeds. PMID:29099745
A Middleware Solution for Wireless IoT Applications in Sparse Smart Cities.
Bellavista, Paolo; Giannelli, Carlo; Lanzone, Stefano; Riberto, Giulio; Stefanelli, Cesare; Tortonesi, Mauro
2017-11-03
The spread of off-the-shelf mobile devices equipped with multiple wireless interfaces together with sophisticated sensors is paving the way to novel wireless Internet of Things (IoT) environments, characterized by multi-hop infrastructure-less wireless networks where devices carried by users act as sensors/actuators as well as network nodes. In particular, the paper presents Real Ad-hoc Multi-hop Peer-to peer-Wireless IoT Application (RAMP-WIA), a novel solution that facilitates the development, deployment, and management of applications in sparse Smart City environments, characterized by users willing to collaborate by allowing new applications to be deployed on their smartphones to remotely monitor and control fixed/mobile devices. RAMP-WIA allows users to dynamically configure single-hop wireless links, to manage opportunistically multi-hop packet dispatching considering that the network topology (together with the availability of sensors and actuators) may abruptly change, to actuate reliably sensor nodes specifically considering that only part of them could be actually reachable in a timely manner, and to upgrade dynamically the nodes through over-the-air distribution of new software components. The paper also reports the performance of RAMP-WIA on simple but realistic cases of small-scale deployment scenarios with off-the-shelf Android smartphones and Raspberry Pi devices; these results show not only the feasibility and soundness of the proposed approach, but also the efficiency of the middleware implemented when deployed on real testbeds.
NASA Astrophysics Data System (ADS)
Zhu, Guo-Zhu; Huang, Dao-Ling; Wang, Lai-Sheng
2017-07-01
We report a photoelectron imaging and photodetachment study of cryogenically cooled 3-hydroxyphenoxide (3HOP) anions, m-HO(C6H4)O-. In a previous preliminary study, two conformations of the cold 3HOP anions with different dipole bound states were observed [D. L. Huang et al., J. Phys. Chem. Lett. 6, 2153 (2015)]. Five near-threshold vibrational resonances were revealed in the photodetachment spectrum from the dipole-bound excited states of the two conformations. Here, we report a more extensive investigation of the two conformers with observation of thirty above-threshold vibrational resonances in a wide spectral range between 18 850 and 19 920 cm-1 (˜1000 cm-1 above the detachment thresholds). By tuning the detachment laser to the vibrational resonances in the photodetachment spectrum, high-resolution conformation-selective resonant photoelectron images are obtained. Using information of the autodetachment channels and theoretical vibrational frequencies, we are able to assign the resonant peaks in the photodetachment spectrum: seventeen are assigned to vibrational levels of anti-3HOP, eight to syn-3HOP, and five to overlapping vibrational levels of both conformers. From the photodetachment spectrum and the conformation-selective resonant photoelectron spectra, we have obtained fourteen fundamental vibrational frequencies for the neutral syn- and anti-m-HO(C6H4)Oṡ radicals. The possibility to produce conformation-selected neutral beams using resonant photodetachment via dipole-bound excited states of anions is discussed.
Comments on Landau damping due to synchrotron frequency spread
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ng, K.Y.; /Fermilab
2005-01-01
An inductive/space-charge impedance shifts the synchrotron frequency downwards above/below transition, but it is often said that the coherent synchrotron frequency of the bunch is not shifted in the rigid-dipole mode. On the other hand, the incoherent synchrotron frequency due to the sinusoidal rf always spreads in the downward direction. This spread will therefore not be able to cover the coherent synchrotron frequency, implying that there will not be any Landau damping no matter how large the frequency spread is. By studying the dispersion relation, it is shown that the above argument is incorrect, and there will be Landau damping ifmore » there is sufficient frequency spread. The main reason is that the coherent frequency of the rigid-dipole mode will no longer remain unshifted in the presence of a synchrotron frequency spread.« less
NASA Astrophysics Data System (ADS)
Wang, Liping; Ji, Yusheng; Liu, Fuqiang
The integration of multihop relays with orthogonal frequency-division multiple access (OFDMA) cellular infrastructures can meet the growing demands for better coverage and higher throughput. Resource allocation in the OFDMA two-hop relay system is more complex than that in the conventional single-hop OFDMA system. With time division between transmissions from the base station (BS) and those from relay stations (RSs), fixed partitioning of the BS subframe and RS subframes can not adapt to various traffic demands. Moreover, single-hop scheduling algorithms can not be used directly in the two-hop system. Therefore, we propose a semi-distributed algorithm called ASP to adjust the length of every subframe adaptively, and suggest two ways to extend single-hop scheduling algorithms into multihop scenarios: link-based and end-to-end approaches. Simulation results indicate that the ASP algorithm increases system utilization and fairness. The max carrier-to-interference ratio (Max C/I) and proportional fairness (PF) scheduling algorithms extended using the end-to-end approach obtain higher throughput than those using the link-based approach, but at the expense of more overhead for information exchange between the BS and RSs. The resource allocation scheme using ASP and end-to-end PF scheduling achieves a tradeoff between system throughput maximization and fairness.
Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A
2017-03-28
Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO 2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.
Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures
NASA Astrophysics Data System (ADS)
Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter
2018-05-01
The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.
Effects of channel tap spacing on delay-lock tracking
NASA Astrophysics Data System (ADS)
Dana, Roger A.; Milner, Brian R.; Bogusch, Robert L.
1995-12-01
High fidelity simulations of communication links operating through frequency selective fading channels require both accurate channel models and faithful reproduction of the received signal. In modern radio receivers, processing beyond the analog-to-digital converter (A/D) is done digitally, so a high fidelity simulation is actually an emulation of this digital signal processing. The 'simulation' occurs in constructing the output of the A/D. One approach to constructing the A/D output is to convolve the channel impulse response function with the combined impulse response of the transmitted modulation and the A/D. For both link simulations and hardware channel simulators, the channel impulse response function is then generated with a finite number of samples per chip, and the convolution is implemented in a tapped delay line. In this paper we discuss the effects of the channel model tap spacing on the performance of delay locked loops (DLLs) in both direct sequence and frequency hopped spread spectrum systems. A frequency selective fading channel is considered, and the channel impulse response function is constructed with an integer number of taps per modulation symbol or chip. The tracking loop time delay is computed theoretically for this tapped delay line channel model and is compared to the results of high fidelity simulations of actual DLLs. A surprising result is obtained. The performance of the DLL depends strongly on the number of taps per chip. As this number increases the DLL delay approaches the theoretical limit.
AC conduction of Ba1-xCaxTiO3 and BZT-BCTx
NASA Astrophysics Data System (ADS)
Khien, Nguyen Van; Huy, Than Trong; Hong, Le Van
2018-03-01
Ba1-xCaxTiO3 (BCTx), (x =0.0-0.3) and Ba0.8Zr0.2TiO3-Ba1-xCaxTiO3 (BZT-BCTx), (x=0.15-0.35) were fabricated by the solid state reaction method. Phase structure of the material samples was identified by X-ray diffraction. The impedance versus frequency in a range of 100 Hz to 2.5 MHz was measured for all the samples at room temperature. AC conductivity versus frequency of the BCTx and BZT-BCTx was evaluated and fitted by using the extended Universal Dielectric Response (UDR) equations. The fitting results were discussed in detail and shown that the localized reorientation polarization-based mechanism is most contributed in BCTx matrial samples. Basically both two the hopping polaron and polarization mechanisms play roles in BZT-BCTx material samples. In contrary the short-range polaron hopping is dominated in ac conductivity of BZT-BCTx material samples in low frequency range.
Variable-Range Hopping through Marginally Localized Phonons
NASA Astrophysics Data System (ADS)
Banerjee, Sumilan; Altman, Ehud
2016-03-01
We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.
NASA Astrophysics Data System (ADS)
Sapori, Daniel; Kepenekian, Mikaël; Pedesseau, Laurent; Katan, Claudine; Even, Jacky
2016-03-01
Quantum confinement as well as high frequency ε∞ and static εs dielectric profiles are described for nanoplatelets of halide inorganic perovskites CsPbX3 (X = I, Br, Cl) and hybrid organic-inorganic perovskites (HOP) in two-dimensional (2D) and three-dimensional (3D) structures. 3D HOP are currently being sought for their impressive photovoltaic ability. Prior to this sudden popularity, 2D HOP materials were driving intense activity in the field of optoelectronics. Such developments have been enriched by the recent ability to synthesize colloidal nanostructures of controlled sizes of 2D and 3D HOP. This raises the need to achieve a thorough description of the electronic structure and dielectric properties of these systems. In this work, we go beyond the abrupt dielectric interface model and reach the atomic scale description. We examine the influence of the nature of the halogen and of the cation on the band structure and dielectric constants. Similarly, we survey the effect of dimensionality and shape of the perovskite. In agreement with recent experimental results, we show an increase of the band gap and a decrease of ε∞ when the size of a nanoplatelet reduces. By inspecting 2D HOP, we find that it cannot be described as a simple superposition of independent inorganic and organic layers. Finally, the dramatic impact of ionic contributions on the dielectric constant εs is analysed.Quantum confinement as well as high frequency ε∞ and static εs dielectric profiles are described for nanoplatelets of halide inorganic perovskites CsPbX3 (X = I, Br, Cl) and hybrid organic-inorganic perovskites (HOP) in two-dimensional (2D) and three-dimensional (3D) structures. 3D HOP are currently being sought for their impressive photovoltaic ability. Prior to this sudden popularity, 2D HOP materials were driving intense activity in the field of optoelectronics. Such developments have been enriched by the recent ability to synthesize colloidal nanostructures of controlled sizes of 2D and 3D HOP. This raises the need to achieve a thorough description of the electronic structure and dielectric properties of these systems. In this work, we go beyond the abrupt dielectric interface model and reach the atomic scale description. We examine the influence of the nature of the halogen and of the cation on the band structure and dielectric constants. Similarly, we survey the effect of dimensionality and shape of the perovskite. In agreement with recent experimental results, we show an increase of the band gap and a decrease of ε∞ when the size of a nanoplatelet reduces. By inspecting 2D HOP, we find that it cannot be described as a simple superposition of independent inorganic and organic layers. Finally, the dramatic impact of ionic contributions on the dielectric constant εs is analysed. Electronic supplementary information (ESI) available: Complementary results on the electronic structure and dielectric constants of CsPbX3 and CH3NH3PbX3 (X = I, Br, Cl). See DOI: 10.1039/c5nr07175e
Employing the Intelligence Cycle Process Model Within the Homeland Security Enterprise
2013-12-01
the Iraq anti-war movement, a former U.S. Congresswoman, the U.S. Treasury Department and hip hop bands to spread Sharia law in the U.S. A Virginia...challenges remain with threat notification, access to information, and database management of information that may have contributed the 2013 Boston...The FBI said it took a number of investigative steps to check on the request, including looking at his travel history, checking databases for
Kirkland, Megan C; Chen, Alice; Downer, Matthew B; Holloway, Brett J; Wallack, Elizabeth M; Lockyer, Evan J; Buckle, Natasha C M; Abbott, Courtney L; Ploughman, Michelle
2018-06-01
People with mild multiple sclerosis (MS) often report subtle deficits in balance and cognition but display no measurable impairment on clinical assessments. We examined whether hopping to a metronome beat had the potential to detect anticipatory motor control deficits among people with mild MS (Expanded Disability Status Scale ≤ 3.5). Participants with MS (n = 13), matched controls (n = 9), and elderly subjects (n = 13) completed tests of cognition (Montreal Cognitive Assessment (MoCA)) and motor performance (Timed 25 Foot Walk Test (T25FWT)). Participants performed two bipedal hopping tasks: at 40 beats/min (bpm) and 60-bpm in random order. Hop characteristics (length, symmetry, variability) and delay from the metronome beat were extracted from an instrumented walkway and compared between groups. The MS group became more delayed from the metronome beat over time whereas elderly subjects tended to hop closer to the beat (F = 4.52, p = 0.02). Delay of the first hop during 60-bpm predicted cognition in people with MS (R = 0.55, β = 4.64 (SD 4.63), F = 4.85, p = 0.05) but not among control (R = 0.07, p = 0.86) or elderly subjects (R = 0.17, p = 0.57). In terms of hopping characteristics, at 60-bpm, people with MS and matched controls were significantly different from the elderly group. However, at 40-bpm, the MS group was no longer significantly different from the elderly group, even though matched controls and elderly still differed significantly. This new timed hopping test may be able to detect both physical ability, and feed-forward anticipatory control impairments in people with mild MS. Hopping at a frequency of 40-bpm seemed more challenging. Several aspects of anticipatory motor control can be measured: including reaction time to the first metronome cue and the ability to adapt and anticipate the beat over time. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.
Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung
2017-01-01
Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p < 0.05). Significant side differences (p = 0.02) were identified in the entire population for the medial triple hop test, such that participants jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally, the medial triple hop for distance test may be effective at identifying side‐to‐side asymmetries Level of Evidence 3 PMID:28515972
NASA Astrophysics Data System (ADS)
Velayutham, T. S.; Ng, B. K.; Gan, W. C.; Majid, W. H. Abd.; Hashim, R.; Zahid, N. I.; Chaiprapa, Jitrin
2014-08-01
Glycolipid, found commonly in membranes, is also a liquid crystal material which can self-assemble without the presence of a solvent. Here, the dielectric and conductivity properties of three synthetic glycolipid thin films in different thermotropic liquid crystal phases were investigated over a frequency and temperature range of (10-2-106 Hz) and (303-463 K), respectively. The observed relaxation processes distinguish between the different phases (smectic A, columnar/hexagonal, and bicontinuous cubic Q) and the glycolipid molecular structures. Large dielectric responses were observed in the columnar and bicontinuous cubic phases of the longer branched alkyl chain glycolipids. Glycolipids with the shortest branched alkyl chain experience the most restricted self-assembly dynamic process over the broad temperature range studied compared to the longer ones. A high frequency dielectric absorption (Process I) was observed in all samples. This is related to the dynamics of the hydrogen bond network from the sugar group. An additional low-frequency mechanism (Process II) with a large dielectric strength was observed due to the internal dynamics of the self-assembly organization. Phase sensitive domain heterogeneity in the bicontinuous cubic phase was related to the diffusion of charge carriers. The microscopic features of charge hopping were modelled using the random walk scheme, and two charge carrier hopping lengths were estimated for two glycolipid systems. For Process I, the hopping length is comparable to the hydrogen bond and is related to the dynamics of the hydrogen bond network. Additionally, that for Process II is comparable to the bilayer spacing, hence confirming that this low-frequency mechanism is associated with the internal dynamics within the phase.
NASA Astrophysics Data System (ADS)
El-Shabaan, M. M.
2018-02-01
Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.
Multicarrier orthogonal spread-spectrum (MOSS) data communications
Smith, Stephen F [London, TN; Dress, William B [Camas, WA
2008-01-01
Systems and methods are described for multicarrier orthogonal spread-spectrum (MOSS) data communication. A method includes individually spread-spectrum modulating at least two of a set of orthogonal frequency division multiplexed carriers, wherein the resulting individually spread-spectrum modulated at least two of a set of orthogonal frequency division multiplexed carriers are substantially mutually orthogonal with respect to both frequency division multiplexing and spread-spectrum modulation.
1994-03-01
FSK 16. PmCI coot 17. SECURITY CLASSWsAI1OW IL SICUURW CLA$SIICATION SECURITY CLASSIICATION 20. LIMIATION Of ABSTRACT CW REPOW ? OF TiNS PAU OF ...hop k of a symbol when partial-band interference is present is obtained from (11) and the linear transformation of random variables given by (3) as...from (13) and the transformation of random variables indicated by (9) as [16] fzwjm(zwik) = f cTak!X. (Xmk, = ZmkOkI17) f~(0,kdo . -- (,.U(zk’ )fE2
Spreading activation in nonverbal memory networks.
Foster, Paul S; Wakefield, Candias; Pryjmak, Scott; Roosa, Katelyn M; Branch, Kaylei K; Drago, Valeria; Harrison, David W; Ruff, Ronald
2017-09-01
Theories of spreading activation primarily involve semantic memory networks. However, the existence of separate verbal and visuospatial memory networks suggests that spreading activation may also occur in visuospatial memory networks. The purpose of the present investigation was to explore this possibility. Specifically, this study sought to create and describe the design frequency corpus and to determine whether this measure of visuospatial spreading activation was related to right hemisphere functioning and spreading activation in verbal memory networks. We used word frequencies taken from the Controlled Oral Word Association Test and design frequencies taken from the Ruff Figural Fluency Test as measures of verbal and visuospatial spreading activation, respectively. Average word and design frequencies were then correlated with measures of left and right cerebral functioning. The results indicated that a significant relationship exists between performance on a test of right posterior functioning (Block Design) and design frequency. A significant negative relationship also exists between spreading activation in semantic memory networks and design frequency. Based on our findings, the hypotheses were supported. Further research will need to be conducted to examine whether spreading activation exists in visuospatial memory networks as well as the parameters that might modulate this spreading activation, such as the influence of neurotransmitters.
Temperature-dependent ac conductivity and dielectric response of vanadium doped CaCu3Ti4O12 ceramic
NASA Astrophysics Data System (ADS)
Sen, A.; Maiti, U. N.; Thapa, R.; Chattopadhyay, K. K.
2011-09-01
Successful incorporation of vanadium dopant within the giant dielectric material CaCu 3Ti 4O12 (CCTO) through a conventional solid-state sintering process is achieved and its influence on the dielectric as well as electrical properties as a function of temperature and frequency is reported here. Proper crystalline phase formation together with dopant induced lattice constant shrinkage was confirmed through X-ray diffraction. The temperature dependence of the dielectric constant at different constant frequencies was investigated. We infer that the correlated barrier hopping (CBH) model is dominant in the conduction mechanism of the ceramic as per the temperature-dependent ac conductivity measurements. The electronic parameters such as density of the states at the Fermi level, N( E f) and hopping distance, R ω of the ceramic were also calculated using this model.
Search behavior of arboreal insectivorous migrants at gulf coast stopover sites in spring
Chen, Chao-Chieh; Barrow, W.C.; Ouchley, K.; Hamilton, R.B.
2011-01-01
Search behavior of arboreal insectivorous migrants was studied at three stopover sites along the northern coast of the Gulf of Mexico during spring migrations, 1993–1995. We examined if search behavior was affected by phylogeny, or by environmental factors. A sequence of search movements (hop, flutter, or flight) in a foraging bout was recorded for each migrant encountered. Search rate, frequency, and distance of movements were calculated for each species. Search rate was positively correlated with proportion of hop, but negatively correlated to flight distance. Hop distance was positively correlated to tarsus length, as was flight distance to wing length for the 31 species of migrants. Cluster analysis indicated closely related species generally have similar foraging modes, which range from “sit-and-wait” of flycatchers to “widely foraging” of warblers. Migrants tended to use more hops in dense vegetation, but more flights in areas with sparse vegetation. Migrants also used more flights when foraging in mixed-species flocks and during periods of high migrant density. Logistic models indicated warblers were more influenced by environmental factors than vireos, possibly because warblers are near-perch searchers and more affected by these factors.
Dynamic Task Allocation in Multi-Hop Multimedia Wireless Sensor Networks with Low Mobility
Jin, Yichao; Vural, Serdar; Gluhak, Alexander; Moessner, Klaus
2013-01-01
This paper presents a task allocation-oriented framework to enable efficient in-network processing and cost-effective multi-hop resource sharing for dynamic multi-hop multimedia wireless sensor networks with low node mobility, e.g., pedestrian speeds. The proposed system incorporates a fast task reallocation algorithm to quickly recover from possible network service disruptions, such as node or link failures. An evolutional self-learning mechanism based on a genetic algorithm continuously adapts the system parameters in order to meet the desired application delay requirements, while also achieving a sufficiently long network lifetime. Since the algorithm runtime incurs considerable time delay while updating task assignments, we introduce an adaptive window size to limit the delay periods and ensure an up-to-date solution based on node mobility patterns and device processing capabilities. To the best of our knowledge, this is the first study that yields multi-objective task allocation in a mobile multi-hop wireless environment under dynamic conditions. Simulations are performed in various settings, and the results show considerable performance improvement in extending network lifetime compared to heuristic mechanisms. Furthermore, the proposed framework provides noticeable reduction in the frequency of missing application deadlines. PMID:24135992
Webster, K N; Dawson, T J
2003-09-01
The locomotory characteristics of kangaroos and wallabies are unusual, with both energetic costs and gait parameters differing from those of quadrupedal running mammals. The kangaroos and wallabies have an evolutionary history of only around 5 million years; their closest relatives, the rat-kangaroos, have a fossil record of more than 26 million years. We examined the locomotory characteristics of a rat-kangaroo, Bettongia penicillata. Locomotory energetics and gait parameters were obtained from animals exercising on a motorised treadmill at speeds from 0.6 m s(-1) to 6.2 m s(-1). Aerobic metabolic costs increased as hopping speed increased, but were significantly different from the costs for a running quadruped; at the fastest speed, the cost of hopping was 50% of the cost of running. Therefore B. penicillata can travel much faster than quadrupedal runners at similar levels of aerobic output. The maximum aerobic output of B. penicillata was 17 times its basal metabolism. Increases in speed during hopping were achieved through increases in stride length, with stride frequency remaining constant. We suggest that these unusual locomotory characteristics are a conservative feature among the hopping marsupials, with an evolutionary history of 20-30 million years.
NASA Astrophysics Data System (ADS)
Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.
2016-02-01
This is the first of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low-coverage, single-tracer limit). The present report focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials. For diffusion in two dimensions, a number of formulas are presented for complex combinations of the different hops in systems with triangular, rectangular, and square symmetry. The formulas provide values in excellent agreement with kinetic Monte Carlo simulations, concluding that the diffusion coefficient can be directly determined from the proposed expressions without performing the simulations. Based on the diffusion barriers obtained from first-principles calculations and a physically meaningful estimate of the attempt frequencies, the proposed formulas are used to analyze the diffusion of Cu, Ag, and Rb adatoms on the surface and within the van der Waals (vdW) gap of a model topological insulator, Bi2Se3 . Considering the possibility of adsorbate intercalation from the terraces to the vdW gaps at morphological steps, we infer that, at low coverage and room temperature, (i) a majority of the Rb atoms bounce back at the steps and remain on the terraces, (ii) Cu atoms mostly intercalate into the vdW gap, the remaining fraction staying at the steps, and (iii) Ag atoms essentially accumulate at the steps and gradually intercalate into the vdW gap. These conclusions are in good qualitative agreement with previous experiments. The companion report (M. A. Gosálvez et al., Phys. Rev. B, submitted] extends the present study to the description of systems that contain asymmetric hops.
NASA Astrophysics Data System (ADS)
Hu, Lilei; Mandelis, Andreas; Melnikov, Alexander; Lan, Xinzheng; Hoogland, Sjoerd; Sargent, Edward H.
2017-01-01
Solution-processed colloidal quantum dots (CQDs) are promising materials for realizing low-cost, large-area, and flexible photovoltaic devices. The study of charge carrier transport in quantum dot solids is essential for understanding energy conversion mechanisms. Recently, solution-processed two-layer oleic-acid-capped PbS CQD solar cells with one layer treated with tetrabutylammonium iodide (TBAI) serving as the main light-absorbing layer and the other treated with 1,2-ethanedithiol (EDT) acting as an electron-blocking/hole-extraction layer were reported. These solar cells demonstrated a significant improvement in power conversion efficiency of 8.55% and long-term air stability. Coupled with photocarrier radiometry measurements, this work used a new trap-state mediated exciton hopping transport model, specifically for CQD thin films, to unveil and quantify exciton transport mechanisms through the extraction of hopping transport parameters including exciton lifetimes, hopping diffusivity, exciton detrapping time, and trap-state density. It is shown that PbS-TBAI has higher trap-state density than PbS-EDT that results in higher PbS-EDT exciton lifetimes. Hopping diffusivities of both CQD thin film types show similar temperature dependence, particularly higher temperatures yield higher hopping diffusivity. The higher diffusivity of PbS-TBAI compared with PbS-EDT indicates that PbS-TBAI is a much better photovoltaic material than PbS-EDT. Furthermore, PCR temperature spectra and deep-level photothermal spectroscopy provided additional insights to CQD surface trap states: PbS-TBAI thin films exhibit a single dominant trap level, while PbS-EDT films with lower trap-state densities show multiple trap levels.
Keefe, Douglas H
2012-11-01
A click-evoked otoacoustic emission (CEOAE) has group delay and spread as first- and second-order temporal moments varying over frequency, and instantaneous frequency and bandwidth as first- and second-order spectral moments varying over time. Energy-smoothed moments were calculated from a CEOAE database over 0.5-15 kHz bandwidth and 0.25-20 ms duration. Group delay and instantaneous frequency were calculated without phase unwrapping using a coherence synchrony measure that accurately classified ears with hearing loss. CEOAE moment measurements were repeatable in individual ears. Group delays were similar for CEOAEs and stimulus-frequency OAEs. Group spread is a frequency-specific measure of temporal spread in an emission, related to spatial spread across tonotopic generation sites along the cochlea. In normal ears, group delay and spread increased with frequency and decreased with level. A direct measure of cochlear tuning above 4 kHz was analyzed using instantaneous frequency and bandwidth. Synchronized spontaneous OAEs were present in most ears below 4 kHz, and confounded interpretation of moments. In ears with sensorineural hearing loss, group delay and spread varied with audiometric classification and amount of hearing loss; group delay differed between older males and females. CEOAE moments reveal clinically relevant information on cochlear tuning in ears with normal and impaired hearing.
Implementation and Testing of the JANUS Standard with SSC Pacific’s Software-Defined Acoustic Modem
2017-12-01
Communications Outpost (FDECO) Innovative Naval Prototype (INP) Program by the Advanced Photonic Technologies Branch (Code 55360), Space and Naval Warfare... Communications and Networks Division iii EXECUTIVE SUMMARY This report presents Space and Naval Warfare (SPAWAR) Systems Center Pacific’s (SSC... Frequency -Hopped Binary Frequency Shift Keying Office of Naval Research Innovative Naval Prototype Forward Deployed Energy and Communications Outpost
Frequency Hopping, Multiple Frequency-Shift Keying, Coding, and Optimal Partial-Band Jamming.
1982-08-01
receivers appropriate for these two strategies. Each receiver is noncoherent (a coherent receiver is generally impractical) and implements hard...Advances in Coding and Modulation for Noncoherent Channels Affected by Fading, Partial Band, and Multiple- . Access Interference, in A. J. Viterbi...Modulation for Noncoherent Channels Affected by Fading, Partial Band, and Multiple-Access interference, in A. J. Viterbi, ed., Advances in Coumunication
Action at a Distance in the Cell's Nucleus
NASA Astrophysics Data System (ADS)
Kondev, Jane
Various functions performed by chromosomes involve long-range communication between DNA sequences that are tens of thousands of bases apart along the genome, and microns apart in the nucleus. In this talk I will discuss experiments and theory relating to two distinct modes of long-range communication in the nucleus, chromosome looping and protein hopping along the chromosome, both in the context of DNA-break repair in yeast. Yeast is an excellent model system for studies that link chromosome conformations to their function as there is ample experimental evidence that yeast chromosome conformations are well described by a simple, random-walk polymer model. Using a combination of polymer physics theory and experiments on yeast cells, I will demonstrate that loss of polymer entropy due to chromosome looping is the driving force for homology search during repair of broken DNA by homologous recombination. I will also discuss the spread of histone modifications along the chromosome and away from the DNA break point in the context of simple physics models based on chromosome looping and kinase hopping, and show how combining physics theory and cell-biology experiment can be used to dissect the molecular mechanism of the spreading process. These examples demonstrate how combined theoretical and experimental studies can reveal physical principles of long-range communication in the nucleus, which play important roles in regulation of gene expression, DNA recombination, and chromatin modification. This work was supported by the NSF DMR-1206146.
A numerical study of Coulomb interaction effects on 2D hopping transport.
Kinkhabwala, Yusuf A; Sverdlov, Viktor A; Likharev, Konstantin K
2006-02-15
We have extended our supercomputer-enabled Monte Carlo simulations of hopping transport in completely disordered 2D conductors to the case of substantial electron-electron Coulomb interaction. Such interaction may not only suppress the average value of hopping current, but also affect its fluctuations rather substantially. In particular, the spectral density S(I)(f) of current fluctuations exhibits, at sufficiently low frequencies, a 1/f-like increase which approximately follows the Hooge scaling, even at vanishing temperature. At higher f, there is a crossover to a broad range of frequencies in which S(I)(f) is nearly constant, hence allowing characterization of the current noise by the effective Fano factor [Formula: see text]. For sufficiently large conductor samples and low temperatures, the Fano factor is suppressed below the Schottky value (F = 1), scaling with the length L of the conductor as F = (L(c)/L)(α). The exponent α is significantly affected by the Coulomb interaction effects, changing from α = 0.76 ± 0.08 when such effects are negligible to virtually unity when they are substantial. The scaling parameter L(c), interpreted as the average percolation cluster length along the electric field direction, scales as [Formula: see text] when Coulomb interaction effects are negligible and [Formula: see text] when such effects are substantial, in good agreement with estimates based on the theory of directed percolation.
Mechanics of inter-modal tunneling in nonlinear waveguides
NASA Astrophysics Data System (ADS)
Jiao, Weijian; Gonella, Stefano
2018-02-01
In this article, we investigate the mechanics of nonlinearly induced inter-modal energy tunneling between flexurally-dominated and axially-dominated modes in phononic waveguides. Special attention is devoted to elucidating the role played by the coupling between axial and flexural degrees of freedom in the determination of the available mode hopping conditions and the associated mechanisms of deformation. Waveguides offer an ideal test bed to investigate the mechanics of nonlinear energy tunneling, due to the fact that they naturally feature, even at low frequencies, families of modes (flexural and axial) that are intrinsically characterized by extreme complementarity. Moreover, thanks to their geometric simplicity, their behavior can be explained by resorting to intuitive structural mechanics models that effectively capture the dichotomy and interplay between flexural and axial mechanisms. After having delineated the fundamental mechanics of flexural-to-axial hopping using the benchmark example of a homogeneous structure, we adapt the analysis to the case of periodic waveguides, in which the complex dispersive behavior due to periodicity results in additional richness of mode hopping mechanisms. We finally extend the analysis to periodic waveguides with internal resonators, in which the availability of locally-resonant bandgaps implies the possibility to activate the resonators even at relatively low frequencies, thus increasing the degree of modal complementarity that is available in the acoustic range. In this context, inter-modal tunneling provides an unprecedented mechanism to transfer conspicuous packets of energy to the resonating microstructure.
Device and method for generating a beam of acoustic energy from a borehole, and applications thereof
Vu, Cung Khac; Sinha, Dipen N; Pantea, Cristian; Nihei, Kurt T; Schmitt, Denis P; Skelt, Christopher
2013-10-01
In some aspects of the invention, a method of generating a beam of acoustic energy in a borehole is disclosed. The method includes generating a first broad-band acoustic pulse at a first broad-band frequency range having a first central frequency and a first bandwidth spread; generating a second broad-band acoustic pulse at a second broad-band frequency range different than the first frequency range having a second central frequency and a second bandwidth spread, wherein the first acoustic pulse and second acoustic pulse are generated by at least one transducer arranged on a tool located within the borehole; and transmitting the first and the second broad-band acoustic pulses into an acoustically non-linear medium, wherein the composition of the non-linear medium produces a collimated pulse by a non-linear mixing of the first and second acoustic pulses, wherein the collimated pulse has a frequency equal to the difference in frequencies between the first central frequency and the second central frequency and a bandwidth spread equal to the sum of the first bandwidth spread and the second bandwidth spread.
NASA Technical Reports Server (NTRS)
Tittel, Frank K. (Inventor); Curl, Robert F. (Inventor); Wysocki, Gerard (Inventor)
2010-01-01
A widely tunable, mode-hop-free semiconductor laser operating in the mid-IR comprises a QCL laser chip having an effective QCL cavity length, a diffraction grating defining a grating angle and an external cavity length with respect to said chip, and means for controlling the QCL cavity length, the external cavity length, and the grating angle. The laser of claim 1 wherein said chip may be tuned over a range of frequencies even in the absence of an anti-reflective coating. The diffraction grating is controllably pivotable and translatable relative to said chip and the effective QCL cavity length can be adjusted by varying the injection current to the chip. The laser can be used for high resolution spectroscopic applications and multi species trace-gas detection. Mode-hopping is avoided by controlling the effective QCL cavity length, the external cavity length, and the grating angle so as to replicate a virtual pivot point.
DoS detection in IEEE 802.11 with the presence of hidden nodes
Soryal, Joseph; Liu, Xijie; Saadawi, Tarek
2013-01-01
The paper presents a novel technique to detect Denial of Service (DoS) attacks applied by misbehaving nodes in wireless networks with the presence of hidden nodes employing the widely used IEEE 802.11 Distributed Coordination Function (DCF) protocols described in the IEEE standard [1]. Attacker nodes alter the IEEE 802.11 DCF firmware to illicitly capture the channel via elevating the probability of the average number of packets transmitted successfully using up the bandwidth share of the innocent nodes that follow the protocol standards. We obtained the theoretical network throughput by solving two-dimensional Markov Chain model as described by Bianchi [2], and Liu and Saadawi [3] to determine the channel capacity. We validated the results obtained via the theoretical computations with the results obtained by OPNET simulator [4] to define the baseline for the average attainable throughput in the channel under standard conditions where all nodes follow the standards. The main goal of the DoS attacker is to prevent the innocent nodes from accessing the channel and by capturing the channel’s bandwidth. In addition, the attacker strives to appear as an innocent node that follows the standards. The protocol resides in every node to enable each node to police other nodes in its immediate wireless coverage area. All innocent nodes are able to detect and identify the DoS attacker in its wireless coverage area. We applied the protocol to two Physical Layer technologies: Direct Sequence Spread Spectrum (DSSS) and Frequency Hopping Spread Spectrum (FHSS) and the results are presented to validate the algorithm. PMID:25685510
DoS detection in IEEE 802.11 with the presence of hidden nodes.
Soryal, Joseph; Liu, Xijie; Saadawi, Tarek
2014-07-01
The paper presents a novel technique to detect Denial of Service (DoS) attacks applied by misbehaving nodes in wireless networks with the presence of hidden nodes employing the widely used IEEE 802.11 Distributed Coordination Function (DCF) protocols described in the IEEE standard [1]. Attacker nodes alter the IEEE 802.11 DCF firmware to illicitly capture the channel via elevating the probability of the average number of packets transmitted successfully using up the bandwidth share of the innocent nodes that follow the protocol standards. We obtained the theoretical network throughput by solving two-dimensional Markov Chain model as described by Bianchi [2], and Liu and Saadawi [3] to determine the channel capacity. We validated the results obtained via the theoretical computations with the results obtained by OPNET simulator [4] to define the baseline for the average attainable throughput in the channel under standard conditions where all nodes follow the standards. The main goal of the DoS attacker is to prevent the innocent nodes from accessing the channel and by capturing the channel's bandwidth. In addition, the attacker strives to appear as an innocent node that follows the standards. The protocol resides in every node to enable each node to police other nodes in its immediate wireless coverage area. All innocent nodes are able to detect and identify the DoS attacker in its wireless coverage area. We applied the protocol to two Physical Layer technologies: Direct Sequence Spread Spectrum (DSSS) and Frequency Hopping Spread Spectrum (FHSS) and the results are presented to validate the algorithm.
Optimum Boundaries of Signal-to-Noise Ratio for Adaptive Code Modulations
2017-11-14
1510–1521, Feb. 2015. [2]. Pursley, M. B. and Royster, T. C., “Adaptive-rate nonbinary LDPC coding for frequency - hop communications ,” IEEE...and this can cause a very narrowband noise near the center frequency during USRP signal acquisition and generation. This can cause a high BER...Final Report APPROVED FOR PUBLIC RELEASE; DISTRIBUTION IS UNLIMITED. AIR FORCE RESEARCH LABORATORY Space Vehicles Directorate 3550 Aberdeen Ave
Space-Time Processing for Tactical Mobile Ad Hoc Networks
2010-05-01
Spatial Diversity and Imperfect Channel Estimation on Wideband MC- DS - CDMA and MC- CDMA " IEEE Transactions on Communications, Vol. 57, No. 10, pp. 2988...include direct sequence code division multiple access ( DS - CDMA ), Frequency Hopped (FH) CDMA and Orthogonal Frequency Division Multiple Access (OFDMA...capability, LPD/LPI, and operability in non-continuous spectrum. In addition, FH- CDMA is robust to the near-far problem, while DS - CDMA requires
NASA Technical Reports Server (NTRS)
Numata, Kenji; Camp, Jordan
2012-01-01
We have developed a linearly polarized Ytterbium-doped fiber ring laser with a single longitudinal mode output at 1064 run. A fiber-coupled intracavity phase modulator ensured mode-hop free operation and allowed fast frequency tuning. The fiber laser was locked with high stability to an iodine-stabilized laser, showing a frequency noise suppression of a factor approx 10 (exp 5) at 1 mHz
Electrical conductivity and dielectric properties of TlInS2 single crystals
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.; Hassan, A.
2011-07-01
TlInS2 single crystals were grown by using Bridgman-Stockbauer technique. Measurements of DC conductivity were carried out in parallel (σ//) and perpendicular (σ⊥) directions to the c-axis over a temperature range from 303 to 463 K. The anisotropic behaviour of the electrical conductivity was also detected. AC conductivity and dielectric measurements were studied as a function of both frequency (102-106 Hz) and temperature (297-375 K). The frequency dependence of the AC conductivity revealed that σac(ω) obeys the universal law: σac(ω) = Aωs. The mechanism of the ac charge transport across the layers of TlInS2 single crystals was referred to the hopping over localized states near the Fermi level in the frequency range >3.5 × 103 Hz. The temperature dependence of σac(ω) for TlInS2 showed that σac is thermally activated process. Both of ɛ1 and ɛ2 decrease by increasing frequency and increase by increasing temperature. Some parameters were calculated as: the density of localized states near the Fermi level NF = 1.5 × 1020 eV-1 cm-3, the average time of charge carrier hoping between localized states τ = 3.79 μs and the average hopping distance R = 6.07 nm.
Temperature gating and competing temperature-dependent effects in DNA molecular wires
NASA Astrophysics Data System (ADS)
Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam
2017-02-01
While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.
Fujiwara, Takahiro K.; Iwasawa, Kokoro; Kalay, Ziya; Tsunoyama, Taka A.; Watanabe, Yusuke; Umemura, Yasuhiro M.; Murakoshi, Hideji; Suzuki, Kenichi G. N.; Nemoto, Yuri L.; Morone, Nobuhiro; Kusumi, Akihiro
2016-01-01
The mechanisms by which the diffusion rate in the plasma membrane (PM) is regulated remain unresolved, despite their importance in spatially regulating the reaction rates in the PM. Proposed models include entrapment in nanoscale noncontiguous domains found in PtK2 cells, slow diffusion due to crowding, and actin-induced compartmentalization. Here, by applying single-particle tracking at high time resolutions, mainly to the PtK2-cell PM, we found confined diffusion plus hop movements (termed “hop diffusion”) for both a nonraft phospholipid and a transmembrane protein, transferrin receptor, and equal compartment sizes for these two molecules in all five of the cell lines used here (actual sizes were cell dependent), even after treatment with actin-modulating drugs. The cross-section size and the cytoplasmic domain size both affected the hop frequency. Electron tomography identified the actin-based membrane skeleton (MSK) located within 8.8 nm from the PM cytoplasmic surface of PtK2 cells and demonstrated that the MSK mesh size was the same as the compartment size for PM molecular diffusion. The extracellular matrix and extracellular domains of membrane proteins were not involved in hop diffusion. These results support a model of anchored TM-protein pickets lining actin-based MSK as a major mechanism for regulating diffusion. PMID:26864625
Liboff, A R; Poggi, C; Pratesi, P
2017-01-01
A helitetrahedral model has been proposed to help explain reports of low-frequency oscillations in pure water following electromagnetic excitation at the hydronium ion cyclotron resonance frequency. The Lorentz force and the intrinsic structure constrain the motion of the H 3 O + ion so that it enjoys a unique form of proton-hopping, one whose path is helical. This model may also explain the numerous previously observed cyclotron resonance (ICR) biological couplings for cations other than hydronium by merely substituting hydrogen-bonded versions of these for hydronium in the tetrahedral structure. Thus the effectiveness of resonance stimulation in biological systems is explained in terms of the enhanced conductivity and reduced scattering associated with proton-hopping. It is further shown that the addition of charge-balancing hydroxyl ions act to enable oscillatory electric dipole moments that propagate along the helical axis, giving rise to weak power (≈ femtoWatts) radiation patterns. It is conceivable that the radiation associated with this process may play a role in the interactions at the interface between water and living matter.
Optimization of a matched-filter receiver for frequency hopping code acquisition in jamming
NASA Astrophysics Data System (ADS)
Pawlowski, P. R.; Polydoros, A.
A matched-filter receiver for frequency hopping (FH) code acquisition is optimized when either partial-band tone jamming or partial-band Gaussian noise jamming is present. The receiver is matched to a segment of the FH code sequence, sums hard per-channel decisions to form a test, and uses multiple tests to verify acquisition. The length of the matched filter and the number of verification tests are fixed. Optimization is then choosing thresholds to maximize performance based upon the receiver's degree of knowledge about the jammer ('side-information'). Four levels of side-information are considered, ranging from none to complete. The latter level results in a constant-false-alarm-rate (CFAR) design. At each level, performance sensitivity to threshold choice is analyzed. Robust thresholds are chosen to maximize performance as the jammer varies its power distribution, resulting in simple design rules which aid threshold selection. Performance results, which show that optimum distributions for the jammer power over the total FH bandwidth exist, are presented.
Electrical modulus and dielectric behavior of Cr3+ substituted Mg-Zn nanoferrites
NASA Astrophysics Data System (ADS)
Mansour, S. F.; Abdo, M. A.
2017-04-01
The dielectric parameters and ac electrical conductivity of Mg0.8Zn0.2CrxFe2-xO4; (0≤x≤0.025) nanoferrites synthesized citrate-nitrate auto-combustion method were studied using the complex impedance technique in the frequency and temperature ranges 4 Hz-5 MHz and 303-873 K respectively. Hopping of charge carriers plus interfacial polarization could interpret the behaviors of dielectric constant (ε‧), dielectric loss tangent (tanδ) and ac electrical conductivity (σac) with frequency, temperatures and composition. The up-normal behavior observed in tanδ trend with temperatures confirms the presence of relaxation loss (dipoles losses). Correlated barrier hopping (CBH) of electron is the conduction mechanism of the investigated nanoferrites. Cole-Cole plots at different temperatures emphasize the main role of grain and grain boundaries in the properties of the investigated nanoferrites. Cr3+ substitution can control the dielectric parameters and ac electrical conductivity of Mg-Zn nanoferrites making it candidates for versatile applications.
Polaron formation in normal state optical conductivity of iron-based superconductor
NASA Astrophysics Data System (ADS)
Choudhary, K. K.; Lodhi, Pavitra Devi; Kaurav, Netram
2018-05-01
Normal state Optical conductivity σ(ω) of Iron-Based superconductor LaFeAsO have been investigated using polaron formation mechanism. The coherent Drude free carrier excitations as well as the incoherent motion of carriers leading to a polaron formation, originated from inter and intra layer transitions of charge carriers are incorporated in the present model. Coherent motion of Drude carriers obtained from an effective interaction potential leads to a peak at zero frequency regime which is an indication of metallic conduction in superconducting materials and also produces a long tail at higher frequencies infrared region. Whereas, the incoherent motion i.e. hopping of carriers from Fe to Fe in the FeAs layer and from FeAs layer to LaO layer produces two different peaks at around 100 cm-1 and 430 cm-1 respectively. Two contributions, Drude and hopping carriers successfully explain the anomalies observed in the optical conductivity of metallic state of the iron-based superconductors.
AC and DC conductivity study on Ca substituted bismuth ferrite
NASA Astrophysics Data System (ADS)
Pandey, Rabichandra; Pradhan, Lagen Kumar; Kumar, Sunil; Kar, Manoranjan
2018-05-01
Bi0.95Ca0.05FeO3 multiferroic compound was synthesized by the citric acid modified sol-gel method. Crystal structure of Bi0.95Ca0.05FeO3 is studied by the X-ray diffraction (XRD) technique. The ac impedance analysis of the compound has been carried out in a wide range of frequency (100 Hz - 1MHz) as well as temperature (40-2500C). Frequency variation of dielectric constant at different temperatures can be understood by the modified Debye formula. The activation energy was found to be 0.48eV, which was obtained by employing Arrhenius equation. The AC conductivity of the sample follows the Johnscher's power law which indicates the presence of hopping type conduction in localized charged states. To understand the conduction mechanism with localized charge states, the DC resistivity data were analyzed by Mott's variable range hopping (VRH) model. The activation energy calculated from Debye relaxation time, AC conductivity and DC resistivity are comparable to each other.
Curchod, Basile F E; Penfold, Thomas J; Rothlisberger, Ursula; Tavernelli, Ivano
2013-01-01
The implementation of local control theory using nonadiabatic molecular dynamics within the framework of linear-response time-dependent density functional theory is discussed. The method is applied to study the photoexcitation of lithium fluoride, for which we demonstrate that this approach can efficiently generate a pulse, on-the-fly, able to control the population transfer between two selected electronic states. Analysis of the computed control pulse yields insights into the photophysics of the process identifying the relevant frequencies associated to the curvature of the initial and final state potential energy curves and their energy differences. The limitations inherent to the use of the trajectory surface hopping approach are also discussed.
Small polaronic hole hopping mechanism and Maxwell-Wagner relaxation in NdFeO3
NASA Astrophysics Data System (ADS)
Ahmad, I.; Akhtar, M. J.; Younas, M.; Siddique, M.; Hasan, M. M.
2012-10-01
In the modern micro-electronics, transition metal oxides due to their colossal values of dielectric permittivity possess huge potential for the development of capacitive energy storage devices. In the present work, the dielectric permittivity and the effects of temperature and frequency on the electrical transport properties of polycrystalline NdFeO3, prepared by solid state reaction method, are discussed. Room temperature Mossbauer spectrum confirms the phase purity, octahedral environment for Fe ion, and high spin state of Fe3+ ion. From the impedance spectroscopic measurements, three relaxation processes are observed, which are related to grains, grain boundaries (gbs), and electrode-semiconductor contact in the measured temperature and frequency ranges. Decrease in resistances and relaxation times of the grains and grain boundaries with temperature confirms the involvement of thermally activated conduction mechanisms. Same type of charge carriers (i.e., small polaron hole hopping) have been found responsible for conduction and relaxation processes through the grain and grain boundaries. The huge value of the dielectric constant (˜8 × 103) at high temperature and low frequency is correlated to the Maxwell-Wagner relaxation due to electrode-sample contact.
ac conductivity in Gd doped Pb(Zr0.53Ti0.47)O3 ceramics
NASA Astrophysics Data System (ADS)
Portelles, J.; Almodovar, N. S.; Fuentes, J.; Raymond, O.; Heiras, J.; Siqueiros, J. M.
2008-10-01
This study is focused in the conduction processes taking place in 0.6 wt % Gd doped lead zirconate titanate samples PbZr0.53Ti0.47O3:Gd (PZT53/47:Gd) in the vicinity of the morphotropic phase boundary. Doped samples show very large dielectric permittivity with respect to that of undoped ones near the transition temperature. The frequency dependent ac conductivity of PZT53/47:Gd ceramics was studied in the 30-450 °C temperature range. X-ray diffraction analyses indicate the incorporation of Gd atoms to the structure. The changes in the dielectric properties as functions of temperature of the doped samples are taken as additional evidence of the incorporation of Gd into the crystal structure. Gd acts as donor center promoting extrinsic n-type conduction. The ac conductivity behavior obeys Jonscher universal relation in the 100 Hz-1 MHz frequency range for temperatures between 30 and 300 °C. The measured conductivity values for Gd doped PZT53/47 are higher than those of pure PZT53/47. According to the correlated barrier hopping model, the preponderant conduction mechanism in the frequency-temperature response was recognized as small polarons hopping mechanism.
NASA Astrophysics Data System (ADS)
Dutta, Rituraj; Kumar, A.
2017-10-01
Dielectric relaxation dynamics and AC conductivity scaling of a metal-organic framework (MOF-5) based poly (vinylidene fluoride-co-hexafluoropropylene) (PVdf-HFP) incorporated with 1-Butyl-3-methylimidazolium hexafluorophosphate have been studied over a frequency range of 40 Hz-5 MHz and in the temperature range of 300 K-380 K. High values of dielectric permittivity (~{{\\varepsilon }\\prime} ) having strong dispersion are obtained at low frequency because of interfacial polarization. The real part of the dielectric modulus spectra (M‧) shows no prominent peak, whereas the imaginary part (M″) shows certain peaks, with a reduction in relaxation time (τ) that can be attributed to a non-Debye relaxation mechanism. The spectra also depict both concentration- and temperature-independent scaling behavior. The power law dependent variation of AC conductivity follows the jump relaxation model and reveals activated ion hopping over diffusion barriers. The value of the frequency exponent is observed to decrease with increasing concentration of ionic liquid, indicating the forward hopping of ions in the relaxation process. The AC conductivity scaling curves at different temperatures also depict the temperature-independent relaxation dynamics.
Clinician-Friendly Physical Performance Tests for the Hip, Ankle, and Foot.
Vogler, Joseph H; Csiernik, Alexander J; Yorgey, Marissa K; Harrison, Jerrod J; Games, Kenneth E
2017-09-01
Reference: Hegedus EJ, McDonough SM, Bleakley C, Baxter D, Cook CE. Clinician-friendly lower extremity physical performance tests in athletes: a systematic review of measurement properties and correlation with injury. Part 2: the tests for the hip, thigh, foot, and ankle including the Star Excursion Balance Test. Br J Sports Med. 2015;49(10):649-656. Do individual physical performance tests (PPTs) for the lower extremity have any relation to injury in athletes 12 years of age and older? The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed to locate articles. Three databases were searched from inception to January 13, 2014: PubMed, CINAHL, and SPORTDiscus. Search phrases were sport, athletics, athletes, and injuries combined with strength, power, endurance, agility, and function. Reference lists of all remaining articles and personal collections of the authors were then reviewed for any missing articles. Studies were included according to the following criteria: (1) published in English, (2) presented as complete articles (ie, no abstracts or posters), and (3) involved human participants. Studies were excluded on the following criteria: (1) a combination of PPTs was examined, (2) the results were measured using equipment that was expensive or not readily available to the average clinician, (3) the PPTs examined impairment-level data, (4) the PPTs examined tasks not relevant to the lower extremity, or (5) the participants scored 4 or less on the Tegner Activity Scale. The final analysis involved 31 studies. The name of the PPT and methods were extracted. Each PPT was then critiqued using the Consensus-Based Standards for the Selection of Health Measurement Instruments, a 4-point Likert scale. Data were also summarized using a score of unknown, strong, moderate, limited, or conflicting for the best evidence synthesis. A total of 14 PPTs were examined; however, names and methods of the PPTs were inconsistent throughout the literature. In descending order, based on frequency of appearance in the literature, the PPTs were (1) 1-legged hop for distance, (2) vertical jump, (3) Star Excursion Balance Test, (4) shuttle run, (5) 6-m timed hop, (6) triple hop, (7) 40-yd sprint, (8) triple crossover hop for distance, (9) 6-m timed crossover hop, (10) T-agility, (11) hexagon hop, (12) medial hop, (13) lateral hop, and (14) multi-stage fitness (beep test). The Star Excursion Balance Test in the anterior, posteromedial, and posterolateral directions was the only test that could help identify injury risk. The 1-legged hop for distance and hexagon hop showed a moderate ability to differentiate between normal and unstable ankles. In dancers, the medial hop in dancers differentiated between painful and normal hips with moderate evidence. Very little evidence supports the use of PPTs for athletes with lower extremity injuries. A panel of experts needs to standardize the names and methods of widely accepted tests.
2014-03-27
Technology (AFIT). Research at AFIT investigates the use of DSA for both civilian and military applications while advancing technology in the area of radio...other military platforms is vital for successful operations. Twelve core functions comprise the US Air Force: Nuclear Deterrence Operations, Special...problems. This Air Force report discusses “Frequency Agile Spectrum Utilization”, a sub-topic of DSA, as a potential capability area [3]. Military
Weak low-frequency electromagnetic oscillations in water.
Liboff, A R; Poggi, Claudio; Pratesi, Piero
2017-01-01
Recent observations of low-frequency electromagnetic oscillations in water suggest an inductive structural component. Accordingly, we assume a helical basis enabling us to model water as an LC tuned oscillator. A proposed tetrahedral structure consisting of three water molecules and one hydronium ion is incorporated into the Boerdijk-Coxeter tetrahelix to form long water chains that are shown to have resonance frequencies consistent with observation. This model also serves to explain separately reported claims of ion cyclotron resonance of hydronium ions, in that the tetrahelix provides a built-in path for helical proton-hopping.
Defect inspection using a time-domain mode decomposition technique
NASA Astrophysics Data System (ADS)
Zhu, Jinlong; Goddard, Lynford L.
2018-03-01
In this paper, we propose a technique called time-varying frequency scanning (TVFS) to meet the challenges in killer defect inspection. The proposed technique enables the dynamic monitoring of defects by checking the hopping in the instantaneous frequency data and the classification of defect types by comparing the difference in frequencies. The TVFS technique utilizes the bidimensional empirical mode decomposition (BEMD) method to separate the defect information from the sea of system errors. This significantly improve the signal-to-noise ratio (SNR) and moreover, it potentially enables reference-free defect inspection.
Identifying the most influential spreaders in complex networks by an Extended Local K-Shell Sum
NASA Astrophysics Data System (ADS)
Yang, Fan; Zhang, Ruisheng; Yang, Zhao; Hu, Rongjing; Li, Mengtian; Yuan, Yongna; Li, Keqin
Identifying influential spreaders is crucial for developing strategies to control the spreading process on complex networks. Following the well-known K-Shell (KS) decomposition, several improved measures are proposed. However, these measures cannot identify the most influential spreaders accurately. In this paper, we define a Local K-Shell Sum (LKSS) by calculating the sum of the K-Shell indices of the neighbors within 2-hops of a given node. Based on the LKSS, we propose an Extended Local K-Shell Sum (ELKSS) centrality to rank spreaders. The ELKSS is defined as the sum of the LKSS of the nearest neighbors of a given node. By assuming that the spreading process on networks follows the Susceptible-Infectious-Recovered (SIR) model, we perform extensive simulations on a series of real networks to compare the performance between the ELKSS centrality and other six measures. The results show that the ELKSS centrality has a better performance than the six measures to distinguish the spreading ability of nodes and to identify the most influential spreaders accurately.
Unified tensor model for space-frequency spreading-multiplexing (SFSM) MIMO communication systems
NASA Astrophysics Data System (ADS)
de Almeida, André LF; Favier, Gérard
2013-12-01
This paper presents a unified tensor model for space-frequency spreading-multiplexing (SFSM) multiple-input multiple-output (MIMO) wireless communication systems that combine space- and frequency-domain spreadings, followed by a space-frequency multiplexing. Spreading across space (transmit antennas) and frequency (subcarriers) adds resilience against deep channel fades and provides space and frequency diversities, while orthogonal space-frequency multiplexing enables multi-stream transmission. We adopt a tensor-based formulation for the proposed SFSM MIMO system that incorporates space, frequency, time, and code dimensions by means of the parallel factor model. The developed SFSM tensor model unifies the tensorial formulation of some existing multiple-access/multicarrier MIMO signaling schemes as special cases, while revealing interesting tradeoffs due to combined space, frequency, and time diversities which are of practical relevance for joint symbol-channel-code estimation. The performance of the proposed SFSM MIMO system using either a zero forcing receiver or a semi-blind tensor-based receiver is illustrated by means of computer simulation results under realistic channel and system parameters.
Methods and apparatuses using filter banks for multi-carrier spread-spectrum signals
Moradi, Hussein; Farhang, Behrouz; Kutsche, Carl A
2014-10-14
A transmitter includes a synthesis filter bank to spread a data symbol to a plurality of frequencies by encoding the data symbol on each frequency, apply a common pulse-shaping filter, and apply gains to the frequencies such that a power level of each frequency is less than a noise level of other communication signals within the spectrum. Each frequency is modulated onto a different evenly spaced subcarrier. A demodulator in a receiver converts a radio frequency input to a spread-spectrum signal in a baseband. A matched filter filters the spread-spectrum signal with a common filter having characteristics matched to the synthesis filter bank in the transmitter by filtering each frequency to generate a sequence of narrow pulses. A carrier recovery unit generates control signals responsive to the sequence of narrow pulses suitable for generating a phase-locked loop between the demodulator, the matched filter, and the carrier recovery unit.
Methods and apparatuses using filter banks for multi-carrier spread-spectrum signals
Moradi, Hussein; Farhang, Behrouz; Kutsche, Carl A
2014-05-20
A transmitter includes a synthesis filter bank to spread a data symbol to a plurality of frequencies by encoding the data symbol on each frequency, apply a common pulse-shaping filter, and apply gains to the frequencies such that a power level of each frequency is less than a noise level of other communication signals within the spectrum. Each frequency is modulated onto a different evenly spaced subcarrier. A demodulator in a receiver converts a radio frequency input to a spread-spectrum signal in a baseband. A matched filter filters the spread-spectrum signal with a common filter having characteristics matched to the synthesis filter bank in the transmitter by filtering each frequency to generate a sequence of narrow pulses. A carrier recovery unit generates control signals responsive to the sequence of narrow pulses suitable for generating a phase-locked loop between the demodulator, the matched filter, and the carrier recovery unit.
2018-03-01
ER D C/ CR RE L TR -1 8- 3 ERDC 6.1 Basic Research Measuring the Non-Line-of-Sight Ultra- High - Frequency Channel in Mountainous Terrain... High - Frequency Channel in Mountainous Terrain A Spread-Spectrum, Portable Channel Sounder Samuel S. Streeter and Daniel J. Breton U.S. Army...spread-spectrum, portable channel sounder specifically designed to meas- ure the non-line-of-sight, ultra- high -frequency channel in mountainous terrain
NASA Astrophysics Data System (ADS)
H, M. Zeyada; F, M. El-Taweel; M, M. El-Nahass; M, M. El-Shabaan
2016-07-01
The AC electrical conductivity and dielectrical properties of 2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3, 2-c]quinoline-3-carbonitrile (Ph-HPQ) and 2-amino-4-(2-chlorophenyl)-6-ethyl-5-oxo-5,6-dihydro-4H-pyrano [3, 2-c] quinoline-3-carbonitrile (Ch-HPQ) thin films were determined in the frequency range of 0.5 kHz-5 MHz and the temperature range of 290-443 K. The AC electrical conduction of both compounds in thin film form is governed by the correlated barrier hopping (CBH) mechanism. Some parameters such as the barrier height, the maximum barrier height, the density of charges, and the hopping distance were determined as functions of temperature and frequency. The phenoxyphenyl group has a greater influence on those parameters than the chlorophenyl group. The AC activation energies were determined at different frequencies and temperatures. The dielectric behaviors of Ph-HPQ and Ch-HPQ were investigated using the impedance spectroscopy technique. The impedance data are presented in Nyquist diagrams for different temperatures. The Ch-HPQ films have higher impedance than the Ph-HPQ films. The real dielectric constant and dielectric loss show a remarkable dependence on the frequency and temperature. The Ph-HPQ has higher dielectric constants than the Ch-HPQ.
NASA Astrophysics Data System (ADS)
Sinha, Subhojyoti; Kumar Chatterjee, Sanat; Ghosh, Jiten; Kumar Meikap, Ajit
2013-03-01
We have used Rietveld refinement technique to extract the microstructural parameters of thioglycolic acid capped CdSe quantum dots. The quantum dot formation and its efficient capping are further confirmed by HR-TEM, UV-visible and FT-IR spectroscopy. Comparative study of the variation of dc conductivity with temperature (298 K ≤ T ≤ 460 K) is given considering Arrhenius formalism, small polaron hopping and Schnakenberg model. We observe that only Schnakenberg model provides good fit to the non-linear region of the variation of dc conductivity with temperature. Experimental variation of ac conductivity and dielectric parameters with temperature (298 K ≤ T ≤ 460 K) and frequency (80 Hz ≤ f ≤ 2 MHz) are discussed in the light of hopping theory and quantum confinement effect. We have elucidated the observed non-linearity in the I-V curves (measured within ±50 V), at dark and at ambient light, in view of tunneling mechanism. Tunnel exponents and non-linearity weight factors have also been evaluated in this regard.
Reconfigurable microwave photonic in-phase and quadrature detector for frequency agile radar.
Emami, Hossein; Sarkhosh, Niusha
2014-06-01
A microwave photonic in-phase and quadrature detector is conceived and practically demonstrated. The detector has the ability to become electronically reconfigured to operate at any frequency over a wide range. This makes it an excellent candidate for frequency agile radars and other electronic warfare systems based on frequency hopping. The detector exhibits a very low amplitude and phase imbalance, which removes the need for any imbalance compensation technique. The system is designed based on the transversal filtering concept and reconfigurability is achieved via wavelength control in a dispersive fiber. The system operation was demonstrated over a frequency range of 3.5-35 GHz, with a maximum of -32 dB amplitude imbalance.
Direct link of a mid-infrared QCL to a frequency comb by optical injection.
Borri, S; Galli, I; Cappelli, F; Bismuto, A; Bartalini, S; Cancio, P; Giusfredi, G; Mazzotti, D; Faist, J; De Natale, P
2012-03-15
A narrow-linewidth comb-linked nonlinear source is used as master radiation to injection lock a room-temperature mid-infrared quantum cascade laser (QCL). This process leads to a direct lock of the QCL to the optical frequency comb, providing the unique features of narrow linewidth, absolute frequency, higher output power, and wide mode-hop-free tunability. The QCL reproduces the injected radiation within more than 94%, with a reduction of the frequency-noise spectral density by 3 to 4 orders of magnitude up to about 100 kHz, and a linewidth narrowing from a few MHz to 20 kHz.
Methods and apparatuses using filter banks for multi-carrier spread spectrum signals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moradi, Hussein; Farhang, Behrouz; Kutsche, Carl A
2017-01-31
A transmitter includes a synthesis filter bank to spread a data symbol to a plurality of frequencies by encoding the data symbol on each frequency, apply a common pulse-shaping filter, and apply gains to the frequencies such that a power level of each frequency is less than a noise level of other communication signals within the spectrum. Each frequency is modulated onto a different evenly spaced subcarrier. A demodulator in a receiver converts a radio frequency input to a spread-spectrum signal in a baseband. A matched filter filters the spread-spectrum signal with a common filter having characteristics matched to themore » synthesis filter bank in the transmitter by filtering each frequency to generate a sequence of narrow pulses. A carrier recovery unit generates control signals responsive to the sequence of narrow pulses suitable for generating a phase-locked loop between the demodulator, the matched filter, and the carrier recovery unit.« less
Methods and apparatuses using filter banks for multi-carrier spread spectrum signals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moradi, Hussein; Farhang, Behrouz; Kutsche, Carl A.
2016-06-14
A transmitter includes a synthesis filter bank to spread a data symbol to a plurality of frequencies by encoding the data symbol on each frequency, apply a common pulse-shaping filter, and apply gains to the frequencies such that a power level of each frequency is less than a noise level of other communication signals within the spectrum. Each frequency is modulated onto a different evenly spaced subcarrier. A demodulator in a receiver converts a radio frequency input to a spread-spectrum signal in a baseband. A matched filter filters the spread-spectrum signal with a common filter having characteristics matched to themore » synthesis filter bank in the transmitter by filtering each frequency to generate a sequence of narrow pulses. A carrier recovery unit generates control signals responsive to the sequence of narrow pulses suitable for generating a phase-locked loop between the demodulator, the matched filter, and the carrier recovery unit.« less
Radar network communication through sensing of frequency hopping
Dowla, Farid; Nekoogar, Faranak
2013-05-28
In one embodiment, a radar communication system includes a plurality of radars having a communication range and being capable of operating at a sensing frequency and a reporting frequency, wherein the reporting frequency is different than the sensing frequency, each radar is adapted for operating at the sensing frequency until an event is detected, each radar in the plurality of radars has an identification/location frequency for reporting information different from the sensing frequency, a first radar of the radars which senses the event sends a reporting frequency corresponding to its identification/location frequency when the event is detected, and all other radars in the plurality of radars switch their reporting frequencies to match the reporting frequency of the first radar upon detecting the reporting frequency switch of a radar within the communication range. In another embodiment, a method is presented for communicating information in a radar system.
Mode selection and tuning of single-frequency short-cavity VECSELs
Serkland, Darwin K.; So, Haley M.; Peake, Gregory M.; ...
2018-03-05
Here, we report on mode selection and tuning properties of vertical-external-cavity surface-emitting lasers (VECSELs) containing coupled semiconductor and external cavities of total length less than 1 mm. Our goal is to create narrowlinewidth (<1MHz) single-frequency VECSELs that operate near 850 nm on a single longitudinal cavity resonance and tune versus temperature without mode hops. We have designed, fabricated, and measured VECSELs with external-cavity lengths ranging from 25 to 800 μm. Lastly, we compare simulated and measured coupled-cavity mode frequencies and discuss criteria for single mode selection.
NASA Astrophysics Data System (ADS)
Yen, J. L.; Kremer, P.; Amin, N.; Fung, J.
1989-05-01
The Department of National Defence (Canada) has been conducting studies into multi-beam adaptive arrays for extremely high frequency (EHF) frequency hopped signals. A three-beam 43 GHz adaptive antenna and a beam control processor is under development. An interactive software package for the operation of the array, capable of applying different control algorithms is being written. A maximum signal to jammer plus noise ratio (SJNR) was found to provide superior performance in preventing degradation of user signals in the presence of nearby jammers. A new fast algorithm using a modified conjugate gradient approach was found to be a very efficient way to implement anti-jamming arrays based on maximum SJNR criterion. The present study was intended to refine and simplify this algorithm and to implement the algorithm on an experimental array for real-time evaluation of anti-jamming performance. A three-beam adaptive array was used. A simulation package was used in the evaluation of multi-beam systems using more than three beams and different user-jammer scenarios. An attempt to further reduce the computation burden through continued analysis of maximum SJNR met with limited success. A method to acquire and track an incoming laser beam is proposed.
NASA Astrophysics Data System (ADS)
Yen, J. L.; Kremer, P.; Fung, J.
1990-05-01
The Department of National Defence (Canada) has been conducting studies into multi-beam adaptive arrays for extremely high frequency (EHF) frequency hopped signals. A three-beam 43 GHz adaptive antenna and a beam control processor is under development. An interactive software package for the operation of the array, capable of applying different control algorithms is being written. A maximum signal to jammer plus noise ratio (SJNR) has been found to provide superior performance in preventing degradation of user signals in the presence of nearby jammers. A new fast algorithm using a modified conjugate gradient approach has been found to be a very efficient way to implement anti-jamming arrays based on maximum SJNR criterion. The present study was intended to refine and simplify this algorithm and to implement the algorithm on an experimental array for real-time evaluation of anti-jamming performance. A three-beam adaptive array was used. A simulation package was used in the evaluation of multi-beam systems using more than three beams and different user-jammer scenarios. An attempt to further reduce the computation burden through further analysis of maximum SJNR met with limited success. The investigation of a new angle detector for spatial tracking in heterodyne laser space communications was completed.
Intelligent cognitive radio jamming - a game-theoretical approach
NASA Astrophysics Data System (ADS)
Dabcevic, Kresimir; Betancourt, Alejandro; Marcenaro, Lucio; Regazzoni, Carlo S.
2014-12-01
Cognitive radio (CR) promises to be a solution for the spectrum underutilization problems. However, security issues pertaining to cognitive radio technology are still an understudied topic. One of the prevailing such issues are intelligent radio frequency (RF) jamming attacks, where adversaries are able to exploit on-the-fly reconfigurability potentials and learning mechanisms of cognitive radios in order to devise and deploy advanced jamming tactics. In this paper, we use a game-theoretical approach to analyze jamming/anti-jamming behavior between cognitive radio systems. A non-zero-sum game with incomplete information on an opponent's strategy and payoff is modelled as an extension of Markov decision process (MDP). Learning algorithms based on adaptive payoff play and fictitious play are considered. A combination of frequency hopping and power alteration is deployed as an anti-jamming scheme. A real-life software-defined radio (SDR) platform is used in order to perform measurements useful for quantifying the jamming impacts, as well as to infer relevant hardware-related properties. Results of these measurements are then used as parameters for the modelled jamming/anti-jamming game and are compared to the Nash equilibrium of the game. Simulation results indicate, among other, the benefit provided to the jammer when it is employed with the spectrum sensing algorithm in proactive frequency hopping and power alteration schemes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Derr, Kurt W.; Richardson, John G.
Monitoring devices and systems comprise a plurality of data channel modules coupled to processing circuitry. Each data channel module of the plurality of data channel modules is configured to capture wireless communications for a selected frequency channel. The processing circuitry is configured to receive captured wireless communications from the plurality of data channel modules and to organize received wireless communications according to at least one parameter. Related methods of monitoring wireless communications are also disclosed.
2008-08-29
resulting in much larger system capacity than for a non-adaptive MC direct-sequence ( DS )- CDMA system. This conclusion is confirmed for realistic fading...system capacity than for a non-adaptive MC direct-sequence ( DS )- CDMA system. This conclusion is confirmed for realistic fading channels with correlated...transmission method exploits both frequency and multiuser diversity and improves on non-adaptive MC DS - CDMA sys- tems in [6]. In this paper, we focus on the
Frequency Hopping Transceiver Multiplexer
1983-03-01
l~o ngth ( method 211) Ile If 19 nose (m Wace em. t amem 0 311c fte s Saa Spray (meto 101. cond. U) nom t 7 o m011 V $h dIVN5k~ WaftIS OCIV16111 ATC...the resonators together to reduce adverse loading is also critical. Figure 5-12 shows two methods of obtaining the desired selectivity. Part A of...this large frequency range required. E.7 CONCLUSIONS It appears that the Helical Resonator with the capacitance bus is the best method available to
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serkland, Darwin K.; So, Haley M.; Peake, Gregory M.
Here, we report on mode selection and tuning properties of vertical-external-cavity surface-emitting lasers (VECSELs) containing coupled semiconductor and external cavities of total length less than 1 mm. Our goal is to create narrowlinewidth (<1MHz) single-frequency VECSELs that operate near 850 nm on a single longitudinal cavity resonance and tune versus temperature without mode hops. We have designed, fabricated, and measured VECSELs with external-cavity lengths ranging from 25 to 800 μm. Lastly, we compare simulated and measured coupled-cavity mode frequencies and discuss criteria for single mode selection.
Maximum Likelihood Detection of Low Rate Repeat Codes in Frequency Hopped Systems
2013-04-01
Communications, vol. 33, pp. 385 – 393, May 1985. [4] W. Sweldens, “Fast block noncoherent decoding,” IEEE Commun. Lett., vol. 5, pp. 132–134, Apr...2001. [5] I. Motedayen-Aval and A. Anastasopoulos, “Polynomial- complexity noncoherent symbol-by-symbol detection with application to adaptive
Universal Disorder in Organic Semiconductors Due to Fluctuations in Space Charge
NASA Astrophysics Data System (ADS)
Wu, Tzu-Cheng
This thesis concerns the study of charge transport in organic semiconductors. These materials are widely used as thin-film photoconductors in copiers and laser printers, and for their electroluminescent properties in organic light-emitting diodes. Much contemporary research is directed towards improving the efficiency of organic photovoltaic devices, which is limited to a large extent by the spatial and energetic disorder that hinders the charge mobility. One contribution to energetic disorder arises from the strong Coulomb interactions between injected charges with one another, but to date this has been largely ignored. We present a mean-field model for the effect of mutual interactions between injected charges hopping from site to site in an organic semiconductor. Our starting point is a modified Fröhlich Hamiltonian in which the charge is linearly coupled to the amplitudes of a wide band of dispersionless plasma modes having a Lorentzian distribution of frequencies. We show that in most applications of interest the hopping rates are fast enough while the plasma frequencies are low enough that random thermal fluctuations in the plasma density give rise to an energetically disordered landscape that is effectively stationary for many thousands of hops. Moreover, the distribution of site energies is Gaussian, and the energy-energy correlation function decays inversely with distance; as such, it can be argued that this disorder contributes to the Poole-Frenkel field dependence seen in a wide variety of experiments. Remarkably, the energetic disorder is universal; although it is caused by the fluctuations in the charge density, it is independent of the charge concentration.
Coupled catastrophes: sudden shifts cascade and hop among interdependent systems
Barnett, George; D'Souza, Raissa M.
2015-01-01
An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast–slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to ‘hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. PMID:26559684
Methods and apparatuses for self-generating fault-tolerant keys in spread-spectrum systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moradi, Hussein; Farhang, Behrouz; Subramanian, Vijayarangam
Self-generating fault-tolerant keys for use in spread-spectrum systems are disclosed. At a communication device, beacon signals are received from another communication device and impulse responses are determined from the beacon signals. The impulse responses are circularly shifted to place a largest sample at a predefined position. The impulse responses are converted to a set of frequency responses in a frequency domain. The frequency responses are shuffled with a predetermined shuffle scheme to develop a set of shuffled frequency responses. A set of phase differences is determined as a difference between an angle of the frequency response and an angle ofmore » the shuffled frequency response at each element of the corresponding sets. Each phase difference is quantized to develop a set of secret-key quantized phases and a set of spreading codes is developed wherein each spreading code includes a corresponding phase of the set of secret-key quantized phases.« less
AC conductivity and dielectric behavior of bulk Furfurylidenemalononitrile
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.
2012-06-01
AC conductivity and dielectric behavior for bulk Furfurylidenemalononitrile have been studied over a temperature range (293-333 K) and frequency range (50-5×106 Hz). The frequency dependence of ac conductivity, σac, has been investigated by the universal power law, σac(ω)=Aωs. The variation of the frequency exponent (s) with temperature was analyzed in terms of different conduction mechanisms, and it was found that the correlated barrier hopping (CBH) model is the predominant conduction mechanism. The temperature dependence of σac(ω) showed a linear increase with the increase in temperature at different frequencies. The ac activation energy was determined at different frequencies. Dielectric data were analyzed using complex permittivity and complex electric modulus for bulk Furfurylidenemalononitrile at various temperatures.
An OKQPSK modem incorporating numerically controlled carrier synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetken, R.E.
1988-04-04
The feasibility of incorporating numerically controlled oscillators (NCO) in communication related applications is evaluated. NCO generation of sinusoids may prove useful in systems requiring precise frequency control, tuning linearity, and orthogonality versus frequency. An OKQPSK modem operating at a data rate of 200 kb/s was fabricated. The modem operates in a back to back hardwired channel and thus does not incorporate carrier or symbol timing recovery. Spectra of the NCO generated sinusoids are presented along with waveforms from the modulation and demodulation process. Generation of sinusoids in the digital domain is a viable alternative to analog oscillators. Implementation of anmore » NCO should be considered when frequency allocation, tuning bandwidth, or frequency hopped transmission requires precise frequency synthesis. 24 figs.« less
Magnetic, electronic, dielectric and optical properties of Pr(Ca:Sr)MnO 3
NASA Astrophysics Data System (ADS)
Sichelschmidt, J.; Paraskevopoulos, M.; Brando, M.; Wehn, R.; Ivannikov, D.; Mayr, F.; Pucher, K.; Hemberger, J.; Pimenov, A.; Krug von Nidda, H.-A.; Lunkenheimer, P.; Ivanov, V. Yu.; Mukhin, A. A.; Balbashov, A. M.; Loidl, A.
2001-03-01
The charge-ordered perovskite Pr0.65Ca0.28Sr0.07MnO3 was investigated by means of magnetic susceptibility, specific heat, dielectric and optical spectroscopy and electron-spin resonance techniques. Under moderate magnetic fields, the charge order melts yielding colossal magnetoresistance effects with changes of the resistivity over eleven orders of magnitude. The optical conductivity is studied from audio frequencies far into the visible spectral regime. Below the phonon modes hopping conductivity is detected. Beyond the phonon modes the optical conductivity is explained by polaronic excitations out of a bound state. ESR techniques yield detailed informations on the (H,T ) phase diagram and reveal a broadening of the linewidth which can be modeled in terms of activated polaron hopping.
Microhard MHX2420 Orbital Performance Evaluation Using RT Logic T400CS
NASA Technical Reports Server (NTRS)
TintoreGazulla, Oriol; Lombardi, Mark
2012-01-01
RT Logic allows simulation of Ground Station - satellite communications: Static tests have been successful. Dynamic tests have been performed for simple passes. Future dynamic tests are needed to simulate real orbit communications. Satellite attitude changes antenna gain. Atmospheric and rain losses need to be added. STK Plug-in will be the next step to improve the dynamic tests. There is a possibility of running longer simulations. Simulation of different losses available in the STK Plug-in. Microhard optimization: Effect of Microhard settings on the data throughput have been understood. Optimized settings improve data throughput for LEO communications. Longer hop intervals make transfer of larger packets more efficient (more time between hops in frequency). Use of FEC (Reed-Solomon) reduces the number of retransmissions for long-range or noisy communications.
Prehn, Alexander; Glöckner, Rosa; Rempe, Gerhard; Zeppenfeld, Martin
2017-03-01
Optical frequency combs (OFCs) provide a convenient reference for the frequency stabilization of continuous-wave lasers. We demonstrate a frequency control method relying on tracking over a wide range and stabilizing the beat note between the laser and the OFC. The approach combines fast frequency ramps on a millisecond timescale in the entire mode-hop free tuning range of the laser and precise stabilization to single frequencies. We apply it to a commercially available optical parametric oscillator (OPO) and demonstrate tuning over more than 60 GHz with a ramping speed up to 3 GHz/ms. Frequency ramps spanning 15 GHz are performed in less than 10 ms, with the OPO instantly relocked to the OFC after the ramp at any desired frequency. The developed control hardware and software are able to stabilize the OPO to sub-MHz precision and to perform sequences of fast frequency ramps automatically.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Verma, Seema; Gupta, Rashmi; Bamzai, K.K., E-mail: kkbamz@yahoo.com
2016-09-15
Highlights: • CeV, NdV and mixed CeNdV nanoparticle prepared by chemical co precipitation method. • With mixing of Ce{sup 3+} and Nd{sup 3+} morphology is totally changed in mixed CeNdV. • Optical band energy of CeV, NdV and CeNdV shows good photocatalyst under UV light. • Conduction mechanism in CeV due to large polaron and small polaron in CeNdV. - Abstract: Cerium orthovanadate, neodymium orthovanadate and mixed cerium neodymium orthovanadate nanoparticles was prepared by co-precipitation method. Powder X-ray diffraction reveals tetragonal zircon structure. Slight increase in lattice parameter, volume and decrease in X-ray density inferred that Ce{sup 3+} and Nd{supmore » 3+} ion replaces each other. Transmission electron microscopy suggests change in morphology with the effect of mixing and validates formation of nanocrystalline material. The infrared transmittance spectrum confirmed the presence of various functional groups. Dielectric properties as function of frequency show dielectric constant and loss tangent decreases with increase in frequency which is due to Maxwell–Wagner type interfacial polarization. The variation of AC conductivity measurement with frequency suggests conduction mechanism due to large polaron hopping in CeV whereas small polaron in mixed CeNdV. The activation energy decreases with rising frequency indicates the conduction mechanism is based on polaron hopping between localized states in disordered manner.« less
NASA Astrophysics Data System (ADS)
Ncube, Siphephile; Chimowa, George; Chiguvare, Zivayi; Bhattacharyya, Somnath
2014-07-01
The superiority of the electronic transport properties of single-walled carbon nanotube (SWNT) ropes over SWNT mats is verified from low temperature and frequency-dependent transport. The overall change of resistance versus in nanotube mats shows that 3D variable range hopping is the dominant conduction mechanism within the 2-300 K range. The magneto-resistance (MR) is found to be predominantly negative with a parabolic nature, which can also be described by the hopping model. Although the positive upturn of the MR at low temperatures establishes the contribution from quantum interference, the inherent quantum transport in individual tubes is suppressed at elevated temperatures. Therefore, to minimize multi-channel effects from inter-tube interactions and other defects, two-terminal devices were fabricated from aligned SWNT (extracted from a mat) for low temperature transport as well as high-frequency measurements. In contrast to the mat, the aligned ropes exhibit step-like features in the differential conductance within the 80-300 K temperature range. The effects of plasmon propagation, unique to one dimension, were identified in electronic transport as a non-universal power-law dependence of the differential conductance on temperature and source-drain voltage. The complex impedance showed high power transmission capabilities up to 65 GHz as well as oscillations in the frequency range up to 30 GHz. The measurements suggest that aligned SWNT ropes have a realistic potential for high-speed device applications.
HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.
Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar
2018-05-08
HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.
Multidimensional signal modulation and/or demodulation for data communications
Smith, Stephen F [London, TN; Dress, William B [Camas, WA
2008-03-04
Systems and methods are described for multidimensional signal modulation and/or demodulation for data communications. A method includes modulating a carrier signal in a first domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; modulating the carrier signal in a second domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; and modulating the carrier signal in a third domain selected from the group consisting of phase, frequency, amplitude, polarization and spread.
Multi-Hop Teleportation of an Unknown Qubit State Based on W States
NASA Astrophysics Data System (ADS)
Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen
2018-04-01
Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.
Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.
Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David
2017-09-01
The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.
From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education
NASA Astrophysics Data System (ADS)
Dolberry, Maurice E.
Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.
Coherent or hopping like energy transfer in the chlorosome ?
NASA Astrophysics Data System (ADS)
Nalbach, Peter
2014-08-01
Chlorosomes, as part of the light-harvesting system of green bacteria, are the largest and most efficient antennae systems in nature. We have studied energy transfer dynamics in the chlorosome in a simplified toy model employing a master equation. Dephasing and relaxation due to environmental fluctuations are included by Lindblad dephasing and Redfield thermalization rates. We find at room temperature three separate time scales, i.e. 25 fs, 250 fs and 2.5 ps and determine the according energy pathways through the hierarchical structure in the chlorosome. Quantum coherence lives up to 150 fs at which time the energy is spread over roughly 12 pigments in our model.
Twomey, Megan C.; Wolfenbarger, Sierra N.; Woods, Joanna L.; Gent, David H.
2015-01-01
Knowledge of processes leading to crop damage is central to devising rational approaches to disease management. Multiple experiments established that infection of hop cones by Podosphaera macularis was most severe if inoculation occurred within 15 to 21 days after bloom. This period of infection was associated with the most pronounced reductions in alpha acids, cone color, and accelerated maturation of cones. Susceptibility of cones to powdery mildew decreased progressively after the transition from bloom to cone development, although complete immunity to the disease failed to develop. Maturation of cone tissues was associated with multiple significant affects on the pathogen manifested as reduced germination of conidia, diminished frequency of penetration of bracts, lengthening of the latent period, and decreased sporulation. Cones challenged with P. macularis in juvenile developmental stages also led to greater frequency of colonization by a complex of saprophytic, secondary fungi. Since no developmental stage of cones was immune to powdery mildew, the incidence of powdery mildew continued to increase over time and exceeded 86% by late summer. In field experiments with a moderately susceptible cultivar, the incidence of cones with powdery mildew was statistically similar when fungicide applications were made season-long or targeted only to the juvenile stages of cone development. These studies establish that partial ontogenic resistance develops in hop cones and may influence multiple phases of the infection process and pathogen reproduction. The results further reinforce the concept that the efficacy of a fungicide program may depend largely on timing of a small number of sprays during a relatively brief period of cone development. However in practice, targeting fungicide and other management tactics to periods of enhanced juvenile susceptibility may be complicated by a high degree of asynchrony in cone development and other factors that are situation-dependent. PMID:25811173
Malmir, Kazem; Olyaei, Gholam Reza; Talebian, Saeed; Jamshidi, Ali Ashraf
2015-08-01
Cyclic movements and muscle fatigue may result in musculoskeletal injuries by inducing changes in neuromuscular control. Ankle frontal-plane neuromuscular control has rarely been studied in spite of its importance. To compare the effects of peroneal muscle fatigue and a cyclic passive-inversion (CPI) protocol on ankle neuromuscular control during a lateral hop. Quasi-experimental, repeated measures. University laboratory. 22 recreationally active, healthy men with no history of ankle sprain or giving way. Participants performed a lateral hop before and after 2 interventions on a Biodex dynamometer. They were randomly assigned to intervention order and interventions were 1 wk apart. A passive intervention included 40 CPIs at 5°/s through 80% of maximum range of motion, and a fatigue intervention involved an isometric eversion at 40% of the maximal voluntary isometric contraction until the torque decreased to 50% of its initial value. Median frequency of the peroneus longus during the fatigue protocol, energy absorption by the viscoelastic tissues during the CPI protocol, and feedforward onset and reaction time of the peroneus longus during landing. A significant fall in median frequency (P < .05) and a significant decrease in energy absorption (P < .05) confirmed fatigue and a change in viscoelastic behavior, respectively. There was a significant main effect of condition on feedforward onset and reaction time (P < .05). No significant main effect of intervention or intervention × condition interaction was noted (P > .05). There was a significant difference between pre- and postintervention measures (P < .0125), but no significant difference was found between postintervention measures (P > .0125). Both fatigue and the CPI may similarly impair ankle neuromuscular control. Thus, in prolonged sports competitions and exercises, the ankle may be injured due to either fatigue or changes in the biomechanical properties of the viscoelastic tissues.
Precorrection concepts for mobile terminals with processing satellites
NASA Astrophysics Data System (ADS)
Nakamoto, F. S.; Oreilly, M. P.; Wolfson, C. R.
It is pointed out that when the spacecraft must process a large number of users simultaneously, it becomes impractical for it to acquire and track each uplink signal. A solution is for the terminals to precorrect their uplink transmissions so that they reach the spacecraft in time and frequency synchronism with the spacecraft receiver. Two dimensions of precorrection, namely time and frequency, are addressed. Precorrection approaches are classified as open loop, pseudo-open loop, or pseudo-closed loop. Performance relationships are established, and the applicability, requirements, advantages, and disadvantages of each class are discussed. It is found that since time and frequency precorrection have opposite sensitivities to the frequency hopping rate, different classes will often be adopted for the two dimensions.
Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.
Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F
2006-10-01
Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.
Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates
Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro
2010-01-01
AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477
Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten
2012-01-01
While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.
Multi-hop teleportation based on W state and EPR pairs
NASA Astrophysics Data System (ADS)
Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang
2016-05-01
Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).
2016-01-22
basic mechanism of link-based routing schemes is the broadcasting of a control message (called a “ hello ”) to all of its neighbors. If a response is...to a destination by using the set of ex- changed hello messages between users of the network. With suciently high frequency, hello messages are suc
Singh, Swati; Gupta, Sanchita; Mani, Ashutosh; Chaturvedi, Anoop
2012-01-01
Humulus lupulus is commonly known as hops, a member of the family moraceae. Currently many projects are underway leading to the accumulation of voluminous genomic and expressed sequence tag sequences in public databases. The genetically characterized domains in these databases are limited due to non-availability of reliable molecular markers. The large data of EST sequences are available in hops. The simple sequence repeat markers extracted from EST data are used as molecular markers for genetic characterization, in the present study. 25,495 EST sequences were examined and assembled to get full-length sequences. Maximum frequency distribution was shown by mononucleotide SSR motifs i.e. 60.44% in contig and 62.16% in singleton where as minimum frequency are observed for hexanucleotide SSR in contig (0.09%) and pentanucleotide SSR in singletons (0.12%). Maximum trinucleotide motifs code for Glutamic acid (GAA) while AT/TA were the most frequent repeat of dinucleotide SSRs. Flanking primer pairs were designed in-silico for the SSR containing sequences. Functional categorization of SSRs containing sequences was done through gene ontology terms like biological process, cellular component and molecular function. PMID:22368382
NASA Astrophysics Data System (ADS)
Martinez, Isidoro; Cascales, Juan Pedro; Hong, Jhen-Yong; Lin, Minn-Tsong; Prezioso, Mirko; Riminucci, Alberto; Dediu, Valentin A.; Aliev, Farkhad G.
2016-10-01
The possible influence of internal barrier dynamics on spin, charge transport and their fluctuations in organic spintronics remains poorly understood. Here we present investigation of the electron transport and low frequency noise at temperatures down to 0.3K in magnetic tunnel junctions with an organic PTCDA barriers with thickness up to 5 nm in the tunneling regime and with 200 nm thick Alq3 barrier in the hopping regime. We observed high tunneling magneto-resistance at low temperatures (15-40%) and spin dependent super-poissonian shot noise in organic magnetic tunnel junctions (OMTJs) with PTCDA. The Fano factor exceeds 1.5-2 values which could be caused by interfacial states controlled by spin dependent bunching in the tunneling events through the molecules.1 The bias dependence of the low frequency noise in OMTJs with PTCDA barriers which includes both 1/f and random telegraph noise activated at specific biases will also be discussed. On the other hand, the organic junctions with ferromagnetic electrodes and thick Alq3 barriers present sub-poissonian shot noise which depends on the temperature, indicative of variable range hopping.
Dynamics of colloidal particles in electrohydrodynamic convection of nematic liquid crystal.
Takahashi, Kentaro; Kimura, Yasuyuki
2014-07-01
We have studied the dynamics of micrometer-sized colloidal particles in electrohydrodynamic convection of nematic liquid crystal. Above the onset voltage of electroconvection, the parallel array of convection rolls appears to be perpendicular to the nematic field at first. The particles are forced to rotate by convection flow and are trapped within a single roll in this voltage regime. A slow glide motion along the roll axis is also observed. The frequency of rotational motion and the glide velocity increase with the applied voltage. Under a much larger voltage where the roll axis temporally fluctuates, the particles occasionally hop to the neighbor rolls. In this voltage regime, the motion of the particles becomes two-dimensional. The motion perpendicular to the roll axis exhibits diffusion behavior at a long time period. The effective diffusion constant is 10(3)-10(4) times larger than the molecular one. The observed behavior is compared with the result obtained by a simple stochastic model for the transport of the particles in convection. The enhancement of diffusion can be quantitatively described well by the rotation frequency in a roll, the width of the roll, and the hopping probability to the neighbor rolls.
Allen, Benjamin L; Leung, Luke K-P
2012-01-01
The prevalence of threatened species in predator scats has often been used to gauge the risks that predators pose to threatened species, with the infrequent occurrence of a given species often considered indicative of negligible predation risks. In this study, data from 4087 dingo (Canis lupus dingo and hybrids) scats were assessed alongside additional information on predator and prey distribution, dingo control effort and predation rates to evaluate whether or not the observed frequency of threatened species in dingo scats warrants more detailed investigation of dingo predation risks to them. Three small rodents (dusky hopping-mice Notomys fuscus; fawn hopping-mice Notomys cervinus; plains mice Pseudomys australis) were the only threatened species detected in <8% of dingo scats from any given site, suggesting that dingoes might not threaten them. However, consideration of dingo control effort revealed that plains mice distribution has largely retracted to the area where dingoes have been most heavily subjected to lethal control. Assessing the hypothetical predation rates of dingoes on dusky hopping-mice revealed that dingo predation alone has the potential to depopulate local hopping-mice populations within a few months. It was concluded that the occurrence of a given prey species in predator scats may be indicative of what the predator ate under the prevailing conditions, but in isolation, such data can have a poor ability to inform predation risk assessments. Some populations of threatened fauna assumed to derive a benefit from the presence of dingoes may instead be susceptible to dingo-induced declines under certain conditions.
Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom
ERIC Educational Resources Information Center
Adjapong, Edmund S.; Emdin, Christopher
2015-01-01
A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…
NASA Astrophysics Data System (ADS)
Kerley, Dan; Smith, Malcolm; Dunn, Jennifer; Herriot, Glen; Véran, Jean-Pierre; Boyer, Corinne; Ellerbroek, Brent; Gilles, Luc; Wang, Lianqi
2016-08-01
The Narrow Field Infrared Adaptive Optics System (NFIRAOS) is the first light Adaptive Optics (AO) system for the Thirty Meter Telescope (TMT). A critical component of NFIRAOS is the Real-Time Controller (RTC) subsystem which provides real-time wavefront correction by processing wavefront information to compute Deformable Mirror (DM) and Tip/Tilt Stage (TTS) commands. The National Research Council of Canada - Herzberg (NRC-H), in conjunction with TMT, has developed a preliminary design for the NFIRAOS RTC. The preliminary architecture for the RTC is comprised of several Linux-based servers. These servers are assigned various roles including: the High-Order Processing (HOP) servers, the Wavefront Corrector Controller (WCC) server, the Telemetry Engineering Display (TED) server, the Persistent Telemetry Storage (PTS) server, and additional testing and spare servers. There are up to six HOP servers that accept high-order wavefront pixels, and perform parallelized pixel processing and wavefront reconstruction to produce wavefront corrector error vectors. The WCC server performs low-order mode processing, and synchronizes and aggregates the high-order wavefront corrector error vectors from the HOP servers to generate wavefront corrector commands. The Telemetry Engineering Display (TED) server is the RTC interface to TMT and other subsystems. The TED server receives all external commands and dispatches them to the rest of the RTC servers and is responsible for aggregating several offloading and telemetry values that are reported to other subsystems within NFIRAOS and TMT. The TED server also provides the engineering GUIs and real-time displays. The Persistent Telemetry Storage (PTS) server contains fault tolerant data storage that receives and stores telemetry data, including data for Point-Spread Function Reconstruction (PSFR).
Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia
2017-01-01
The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516
Reeb-Whitaker, Carolyn K; Bonauto, David K
2014-11-01
There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Absolute frequency atlas from 915 nm to 985 nm based on laser absorption spectroscopy of iodine
NASA Astrophysics Data System (ADS)
Nölleke, Christian; Raab, Christoph; Neuhaus, Rudolf; Falke, Stephan
2018-04-01
This article reports on laser absorption spectroscopy of iodine gas between 915 nm and 985 nm. This wavelength range is scanned utilizing a narrow linewidth and mode-hop-free tunable diode-laser whose frequency is actively controlled using a calibrated wavelength meter. This allows us to provide an iodine atlas that contains almost 10,000 experimentally observed reference lines with an uncertainty of 50 MHz. For common lines, good agreement is found with a publication by Gerstenkorn and Luc (1978). The new rich dataset allows existing models of the iodine molecule to be refined and can serve as a reference for laser frequency calibration and stabilization.
NASA Astrophysics Data System (ADS)
Upadhya, Abhijeet; Dwivedi, Vivek K.; Singh, G.
2018-06-01
In this paper, we have analyzed the performance of dual hop radio frequency (RF)/free-space optical (FSO) fixed gain relay environment confined by atmospheric turbulence induced fading channel over FSO link and modeled using α - μ distribution. The RF hop of the amplify-and-forward scheme undergoes the Rayleigh fading and the proposed system model also considers the pointing error effect on the FSO link. A novel and accurate mathematical expression of the probability density function for a FSO link experiencing α - μ distributed atmospheric turbulence in the presence of pointing error is derived. Further, we have presented analytical expressions of outage probability and bit error rate in terms of Meijer-G function. In addition to this, a useful and mathematically tractable closed-form expression for the end-to-end ergodic capacity of the dual hop scheme in terms of bivariate Fox's H function is derived. The atmospheric turbulence, misalignment errors and various binary modulation schemes for intensity modulation on optical wireless link are considered to yield the results. Finally, we have analyzed each of the three performance metrics for high SNR in order to represent them in terms of elementary functions and the achieved analytical results are supported by computer-based simulations.
A biomechanical analysis of common lunge tasks in badminton.
Kuntze, Gregor; Mansfield, Neil; Sellers, William
2010-01-01
The lunge is regularly used in badminton and is recognized for the high physical demands it places on the lower limbs. Despite its common occurrence, little information is available on the biomechanics of lunging in the singles game. A video-based pilot study confirmed the relatively high frequency of lunging, approximately 15% of all movements, in competitive singles games. The biomechanics and performance characteristics of three badminton-specific lunge tasks (kick, step-in, and hop lunge) were investigated in the laboratory with nine experienced male badminton players. Ground reaction forces and kinematic data were collected and lower limb joint kinetics calculated using an inverse dynamics approach. The step-in lunge was characterized by significantly lower mean horizontal reaction force at drive-off and lower mean peak hip joint power than the kick lunge. The hop lunge resulted in significantly larger mean reaction forces during loading and drive-off phases, as well as significantly larger mean peak ankle joint moments and knee and ankle joint powers than the kick or step-in lunges. These findings indicate that, within the setting of this investigation, the step-in lunge may be beneficial for reducing the muscular demands of lunge recovery and that the hop lunge allows for higher positive power output, thereby presenting an efficient lunging method.
Role of carrier density and disorder on anisotropic charge transport in polypyrrole
NASA Astrophysics Data System (ADS)
Varade, Vaibhav; Anjaneyulu, P.; Suchand Sangeeth, C. S.; Ramesh, K. P.; Menon, Reghu
2013-01-01
Polypyrrole (PPy) has been synthesized electrochemically on platinum substrate by varying synthesis temperature and dopant concentration. The charge transport in PPy has been investigated as a function of temperature for both in-plane and out-of-plane geometry in a wide temperature range of 5 K-300 K. The charge transport showed strong anisotropy and various mechanisms were used to explain the transport. The conductivity ratio, σr = σ(300 K)/σ(5 K) is calculated for each sample to quantify the relative disorder. At all the temperatures, the conductivity values for in-plane transport are found to be more for PPy synthesized at lower temperature, while the behavior is found to be different for out-of-plane transport. The carrier density is found to play a crucial role in case of in-plane transport. An effort has been made to correlate charge transport to morphology by analyzing temperature and frequency dependence of conductivity. Charge transport in lateral direction is found to be dominated by hopping whereas tunneling mechanisms are dominated in vertical direction. Parameters such as density of states at the Fermi level [N(EF)], average hopping distance (R), and average hopping energy (W) have been estimated for each samples in both geometry.
A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.
Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea
2018-05-08
With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.
Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.
Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc
2016-09-12
In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).
Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program
Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc
2016-01-01
Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968
Potential Standards and Methods for the National Guard’s Homeland Response Force
2011-09-01
rapidly determine a missile launch and probable impact area ( Opall -Rome, 2009). Since 2006, Color Red coverage has expanded throughout the country...Manportable Air Defense (MANPAD) systems, land mines , advanced communication systems, mortars, unmanned air systems (UAS), frequency-hopping...Consequence Management Response Force (CCMRF). Internal document. Opall -Rome, B. (2009, January19). In Israel: Anti-sniper gear spots rockets
The Security Aspects of Wireless Local Area Network (WLAN)
2003-09-01
by wireless links to enable devices to communicate. In a Bluetooth network, mobile routers control the changing network topologies of these... Bluetooth Bluetooth is a simple peer-to-peer protocol created to connect multiple consumer mobile information devices (cellular phones, laptops...technology [Ref 2]. Bluetooth enables mobile devices to avoid interference from other signals by hopping to a new frequency after transmitting or
Unified conduction mechanism in unconventional VZnCaFeO glasses
NASA Astrophysics Data System (ADS)
Ahmed, E. M.; Abdel-Wahab, F.
2014-09-01
Unconventional glasses with (70-x)%V2O5 - x%ZnO-10%CaO-20%FeO compositions (where x=0, 2.5, 5, 7.5, 10, 12.5 and 15 mol %) were prepared by a normal melt-quench technique. We investigated the DC and AC conductivities of these glasses as functions of temperature and frequency. We have noted that activation energy and pre-exponential factor of the DC conductivity both vary with composition and satisfy Meyer-Neldel rule (MNR). The AC conductivity exhibited a universal dynamic response: σAC=Aωs. The obtained results of the DC, AC and exponent factor S were discussed in terms of the modified correlated barrier hopping model, which assumes that the relaxation time should contain a Meyer-Neldel rule term. An agreement between experimental and theoretical results suggests that the conduction mechanism could be hopping of polarons over barriers.
Origin of colossal permittivity in BaTiO3 via broadband dielectric spectroscopy
NASA Astrophysics Data System (ADS)
Han, Hyuksu; Voisin, Christophe; Guillemet-Fritsch, Sophie; Dufour, Pascal; Tenailleau, Christophe; Turner, Christopher; Nino, Juan C.
2013-01-01
Barium titanate (BT) ceramics with Ba/Ti ratios of 0.95 and 1.00 were synthesized using spark plasma sintering (SPS) technique. Dielectric spectroscopy (frequency range from 40 Hz to 1 MHz and temperature range from 300 K to 30 K) was performed on those ceramics (SPS BT). SPS BT showed extremely high permittivity up to ˜105, which can be referred to as colossal permittivity, with relatively low dielectric loss of ˜0.05. Data analyses following Debye relaxation and universal dielectric response models indicate that the origin of colossal permittivity in BT ceramics is the result of a hopping polaron within semiconducting grains in combination with interfacial polarization at the insulating grain boundary. Furthermore, the contributions of each polarization mechanism to the colossal permittivity in SPS BT, such as a hopping polarization, internal barrier layer capacitance effect, and electrode effect, were estimated.
Colossal permittivity and the polarization mechanism of (Mg, Mn) co-doped LaGaO3 ceramics
NASA Astrophysics Data System (ADS)
Luo, Tingting; Liu, Zhifu; Zhang, Faqiang; Li, Yongxiang
2018-03-01
Mg and Mn co-doped LaGa0.7-xMgxMn0.3O3 (x = 0, 0.05, 0.10, 0.15) ceramics were prepared by a solid-state reaction method. The electrical properties of the LaGa0.7-xMgxMn0.3O3 ceramics were studied in detail by dielectric spectra, impedance spectra, and I-V characteristic analysis. Colossal permittivity up to 104 could be obtained across the frequency range up to 104 Hz. The impedance analysis of the co-doped LaGaO3 ceramics indicated that the Mott's variable range hopping (VRH) polarization should be the main origin of colossal permittivity. Mg and Mn co-doping suppressed the formation of Mn3+ and enhanced the VRH polarization, resulting in increased permittivity. Partial localization of electrons by Mg reduced the long-range electron hopping and led to the decrease in dielectric loss.
Interference Information Based Power Control for Cognitive Radio with Multi-Hop Cooperative Sensing
NASA Astrophysics Data System (ADS)
Yu, Youngjin; Murata, Hidekazu; Yamamoto, Koji; Yoshida, Susumu
Reliable detection of other radio systems is crucial for systems that share the same frequency band. In wireless communication channels, there is uncertainty in the received signal level due to multipath fading and shadowing. Cooperative sensing techniques in which radio stations share their sensing information can improve the detection probability of other systems. In this paper, a new cooperative sensing scheme that reduces the false detection probability while maintaining the outage probability of other systems is investigated. In the proposed system, sensing information is collected using multi-hop transmission from all sensing stations that detect other systems, and transmission decisions are based on the received sensing information. The proposed system also controls the transmit power based on the received CINRs from the sensing stations. Simulation results reveal that the proposed system can reduce the outage probability of other systems, or improve its link success probability.
Forman, Michael A; Young, Derek
2012-09-18
Examples of methods for generating data based on a communications channel are described. In one such example, a processing unit may generate a first vector representation based in part on at least two characteristics of a communications channel. A constellation having at least two dimensions may be addressed with the first vector representation to identify a first symbol associated with the first vector representation. The constellation represents a plurality of regions, each region associated with a respective symbol. The symbol may be used to generate data, which may stored in an electronic storage medium and used as a cryptographic key or a spreading code or hopping sequence in a modulation technique.
HopBase: a unified resource for Humulus genomics
Hill, Steven T.; Sudarsanam, Ramcharan
2017-01-01
Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075
Engineering calculations for communications systems planning
NASA Technical Reports Server (NTRS)
Levis, C. A.; Martin, C. H.; Wang, C. W.; Gonsalvez, D.
1982-01-01
The single entry interference problem is treated for frequency sharing between the broadcasting satellite and intersatellite services near 23 GHz. It is recommended that very long (more than 120 longitude difference) intersatellite hops be relegated to the unshared portion of the band. When this is done, it is found that suitable orbit assignments can be determined easily with the aid of a set of universal curves. An attempt to develop synthesis procedures for optimally assigning frequencies and orbital slots for the broadcasting satellite service in region 2 was initiated. Several discrete programming and continuous optimization techniques are discussed.
Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis
ERIC Educational Resources Information Center
Lindsey, Treva B.
2015-01-01
This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…
Variable range hopping in ZnO films
NASA Astrophysics Data System (ADS)
Ali, Nasir; Ghosh, Subhasis
2018-04-01
We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kassmi, M.; LMOP, El Manar University, Tunis 2092; Pointet, J.
2016-06-28
Dielectric spectroscopy is carried out for intrinsic and aluminum-doped TiO{sub 2} rutile films which are deposited on RuO{sub 2} by the atomic layer deposition technique. Capacitance and conductance are measured in the 0.1 Hz–100 kHz range, for ac electric fields up to 1 MV{sub rms}/cm. Intrinsic films have a much lower dielectric constant than rutile crystals. This is ascribed to the presence of oxygen vacancies which depress polarizability. When Al is substituted for Ti, the dielectric constant further decreases. By considering Al-induced modification of polarizability, a theoretical relationship between the dielectric constant and the Al concentration is proposed. Al doping drastically decreasesmore » the loss in the very low frequency part of the spectrum. However, Al doping has almost no effect on the loss at high frequencies. The effect of Al doping on loss is discussed through models of hopping transport implying intrinsic oxygen vacancies and Al related centers. When increasing the ac electric field in the MV{sub rms}/cm range, strong voltage non-linearities are evidenced in undoped films. The conductance increases exponentially with the ac field and the capacitance displays negative values (inductive behavior). Hopping barrier lowering is proposed to explain high-field effects. Finally, it is shown that Al doping strongly improves the high-field dielectric behavior.« less
Fujiwara, Takahiro K; Iwasawa, Kokoro; Kalay, Ziya; Tsunoyama, Taka A; Watanabe, Yusuke; Umemura, Yasuhiro M; Murakoshi, Hideji; Suzuki, Kenichi G N; Nemoto, Yuri L; Morone, Nobuhiro; Kusumi, Akihiro
2016-04-01
The mechanisms by which the diffusion rate in the plasma membrane (PM) is regulated remain unresolved, despite their importance in spatially regulating the reaction rates in the PM. Proposed models include entrapment in nanoscale noncontiguous domains found in PtK2 cells, slow diffusion due to crowding, and actin-induced compartmentalization. Here, by applying single-particle tracking at high time resolutions, mainly to the PtK2-cell PM, we found confined diffusion plus hop movements (termed "hop diffusion") for both a nonraft phospholipid and a transmembrane protein, transferrin receptor, and equal compartment sizes for these two molecules in all five of the cell lines used here (actual sizes were cell dependent), even after treatment with actin-modulating drugs. The cross-section size and the cytoplasmic domain size both affected the hop frequency. Electron tomography identified the actin-based membrane skeleton (MSK) located within 8.8 nm from the PM cytoplasmic surface of PtK2 cells and demonstrated that the MSK mesh size was the same as the compartment size for PM molecular diffusion. The extracellular matrix and extracellular domains of membrane proteins were not involved in hop diffusion. These results support a model of anchored TM-protein pickets lining actin-based MSK as a major mechanism for regulating diffusion. © 2016 Fujiwara et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Marine asset security and tracking (MAST) system
Hanson, Gregory Richard [Clinton, TN; Smith, Stephen Fulton [Loudon, TN; Moore, Michael Roy [Corryton, TN; Dobson, Eric Lesley [Charleston, SC; Blair, Jeffrey Scott [Charleston, SC; Duncan, Christopher Allen [Marietta, GA; Lenarduzzi, Roberto [Knoxville, TN
2008-07-01
Methods and apparatus are described for marine asset security and tracking (MAST). A method includes transmitting identification data, location data and environmental state sensor data from a radio frequency tag. An apparatus includes a radio frequency tag that transmits identification data, location data and environmental state sensor data. Another method includes transmitting identification data and location data from a radio frequency tag using hybrid spread-spectrum modulation. Another apparatus includes a radio frequency tag that transmits both identification data and location data using hybrid spread-spectrum modulation.
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…
The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop
ERIC Educational Resources Information Center
Soderman, Johan
2013-01-01
Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…
NASA Technical Reports Server (NTRS)
Ha, Tri T.; Pratt, Timothy
1989-01-01
The feasibility of using spread spectrum techniques to provide a low-cost multiple access system for a very large number of low data terminals was investigated. Two applications of spread spectrum technology to very small aperture terminal (VSAT) satellite communication networks are presented. Two spread spectrum multiple access systems which use a form of noncoherent M-ary FSK (MFSK) as the primary modulation are described and the throughput analyzed. The analysis considers such factors as satellite power constraints and adjacent satellite interference. Also considered is the effect of on-board processing on the multiple access efficiency and the feasibility of overlaying low data rate spread spectrum signals on existing satellite traffic as a form of frequency reuse is investigated. The use of chirp is examined for spread spectrum communications. In a chirp communication system, each data bit is converted into one or more up or down sweeps of frequency, which spread the RF energy across a broad range of frequencies. Several different forms of chirp communication systems are considered, and a multiple-chirp coded system is proposed for overlay service. The mutual interference problem is examined in detail and a performance analysis undertaken for the case of a chirp data channel overlaid on a video channel.
Hip-hop as a resource for understanding the urban context
NASA Astrophysics Data System (ADS)
Brown, Bryan
2010-06-01
This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.
NASA Technical Reports Server (NTRS)
Woodring, D. G.; Nichols, S. A.; Swanson, R.
1979-01-01
During 1978 and 1979, an Air Force C-135 test aircraft was flown to various locations in the North and South Atlantic and Pacific Oceans for satellite communications experiments. A part of the equipment tested on the aircraft was the SEACOM spread spectrum modem. The SEACOM modem operated at X band frequency from the aircraft via the DSCS II satellite to a ground station. For data to be phased successfully, it was necessary to maintain independent time and frequency accuracy over relatively long periods of time (up to two weeks) on the aircraft and at the ground station. To achieve this goal, two Efratom atomic frequency standards were used. The performance of these frequency standards as used in the spread spectrum modem is discussed, including the effects of high relative velocity, synchronization and the effects of the frequency standards on data performance is discussed. The aircraft environment, which includes extremes of temperature, as well as long periods of shutdown followed by rapid warmup requirements, is also discussed.
Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿
Behr, Jürgen; Vogel, Rudi F.
2010-01-01
In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of hop inhibition, these investigations provide general insight on the role of electrophysiology and ion homeostasis in bacterial stress responses to membrane-active drugs. PMID:19880646
Modelling of information diffusion on social networks with applications to WeChat
NASA Astrophysics Data System (ADS)
Liu, Liang; Qu, Bo; Chen, Bin; Hanjalic, Alan; Wang, Huijuan
2018-04-01
Traces of user activities recorded in online social networks open new possibilities to systematically understand the information diffusion process on social networks. From the online social network WeChat, we collected a large number of information cascade trees, each of which tells the spreading trajectory of a message/information such as which user creates the information and which users view or forward the information shared by which neighbours. In this work, we propose two heterogeneous non-linear models, one for the topologies of the information cascade trees and the other for the stochastic process of information diffusion on a social network. Both models are validated by the WeChat data in reproducing and explaining key features of cascade trees. Specifically, we apply the Random Recursive Tree (RRT) to model the growth of cascade trees. The RRT model could capture key features, i.e. the average path length and degree variance of a cascade tree in relation to the number of nodes (size) of the tree. Its single identified parameter quantifies the relative depth or broadness of the cascade trees and indicates that information propagates via a star-like broadcasting or viral-like hop by hop spreading. The RRT model explains the appearance of hubs, thus a possibly smaller average path length as the cascade size increases, as observed in WeChat. We further propose the stochastic Susceptible View Forward Removed (SVFR) model to depict the dynamic user behaviour including creating, viewing, forwarding and ignoring a message on a given social network. Beside the average path length and degree variance of the cascade trees in relation to their sizes, the SVFR model could further explain the power-law cascade size distribution in WeChat and unravel that a user with a large number of friends may actually have a smaller probability to read a message (s)he receives due to limited attention.
Dimpfel, Wilfried
2013-09-16
Herbal extracts targeting at the brain remain a continuous challenge to pharmacology. Usually, a number of different animal tests have to be performed in order to find a potential clinical use. Due to manifold possibly active ingredients biochemical approaches are difficult. A more holistic approach using a neurophysiological technique has been developed earlier in order to characterise synthetic drugs. Stereotactic implantation of four semi-microelectrodes into frontal cortex, hippocampus, striatum and reticular formation of rats allowed continuous wireless monitoring of field potentials (EEG) before and after drug intake. After frequency analysis (Fast Fourier Transformation) electric power was calculated for 6 ranges (delta, theta, alpha1, alpha2, beta1 and beta2). Data from 14 synthetic drugs - tested earlier and representative for different clinical indications - were taken for construction of discriminant functions showing the projection of the frequency patterns in a six-dimensional graph. Quantitative analysis of the EEG frequency pattern from the depth of the brain succeeded in discrimination of drug effects according to their known clinical indication (Dimpfel and Schober, 2003). Extracts from Valerian root, Ginkgo leaves, Paullinia seed, Hop strobile, Rhodiola rosea root and Sideritis scardica herb were tested now under identical conditions. Classification of these extracts based on the matrix from synthetic drugs revealed that Valerian root and hop induced a pattern reminiscent of physiological sleep. Ginkgo and Paullinia appeared in close neighbourhood of stimulatory drugs like caffeine or to an analgesic profile (tramadol). Rhodiola and Sideritis developed similar frequency patterns comparable to a psychostimulant drug (methylphenidate) as well to an antidepressive drug (paroxetine). © 2013 The Author. Published by Elsevier Ireland Ltd. All rights reserved.
Robertson, Benjamin D; Sawicki, Gregory S
2014-07-21
We present a simplified Hill-type model of the human triceps surae-Achilles tendon complex working on a gravitational-inertial load during cyclic contractions (i.e. vertical hopping). Our goal was to determine the role that neural control plays in governing muscle, or contractile element (CE), and tendon, or series elastic element (SEE), mechanics and energetics within a compliant muscle-tendon unit (MTU). We constructed a 2D parameter space consisting of many combinations of stimulation frequency and magnitude (i.e. neural control strategies). We compared the performance of each control strategy by evaluating peak force and average positive mechanical power output for the system (MTU) and its respective components (CE, SEE), force-length (F-L) and -velocity (F-V) operating point of the CE during active force production, average metabolic rate for the CE, and both MTU and CE apparent efficiency. Our results suggest that frequency of stimulation plays a primary role in governing whole-MTU mechanics. These include the phasing of both activation and peak force relative to minimum MTU length, average positive power, and apparent efficiency. Stimulation amplitude was primarily responsible for governing average metabolic rate and within MTU mechanics, including peak force generation and elastic energy storage and return in the SEE. Frequency and amplitude of stimulation both played integral roles in determining CE F-L operating point, with both higher frequency and amplitude generally corresponding to lower CE strains, reduced injury risk, and elimination of the need for passive force generation in the CE parallel elastic element (PEE). Copyright © 2014 Elsevier Ltd. All rights reserved.
Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice
ERIC Educational Resources Information Center
Petchauer, Emery
2015-01-01
One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…
Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.
2011-01-01
Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128
AC conductivity and dielectric properties of bulk tungsten trioxide (WO3)
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.; Saadeldin, M.; Zaghllol, M.
2012-11-01
AC conductivity and dielectric properties of tungsten trioxide (WO3) in a pellet form were studied in the frequency range from 42 Hz to 5 MHz with a variation of temperature in the range from 303 K to 463 K. AC conductivity, σac(ω) was found to be a function of ωs where ω is the angular frequency and s is the frequency exponent. The values of s were found to be less than unity and decrease with increasing temperature, which supports the correlated barrier hopping mechanism (CBH) as the dominant mechanism for the conduction in WO3. The dielectric constant (ε‧) and dielectric loss (ε″) were measured. The Cole-Cole diagram determined complex impedance for different temperatures.
Solid-state-based laser system as a replacement for Ar+ lasers.
Beck, Tobias; Rein, Benjamin; Sörensen, Fabian; Walther, Thomas
2016-09-15
We report on a solid-state-based laser system at 1028 nm. The light is generated by a diode laser seeded ytterbium fiber amplifier. In two build-up cavities, its frequency is doubled and quadrupled to 514 nm and 257 nm, respectively. At 514 nm, the system delivers up to 4.7 W of optical power. In the fourth harmonic, up to 173 mW are available limited by the nonlinear crystal. The frequency of the laser is mode-hop-free tunable by 16 GHz in 10 ms in the UV. Therefore, the system is suitable as a low maintenance, efficient, and tunable narrowband replacement for frequency doubled Ar+ laser systems.
Study of the thermal-induced intensity balanced Nd:GdVO4 microchip dual-frequency laser
NASA Astrophysics Data System (ADS)
Cai, Meiling; Hu, Miao; Zhou, Xuefang; Lu, Yang; Zeng, Ran; Li, Qiliang; Wei, Yizhen
2018-01-01
The intensity balance ratio (IBR) tuning mechanism of Nd:GdVO4 monolithic microchip dual-frequency laser (DFL) is presented. The intensity balanced DFL signals are obtained by precisely controlling the heat sink temperature of the Nd:GdVO4 crystal. In experiments, the DFL signal with frequency separation at 64 GHz and IBR above 0.99 is realized with the temperature at 47.6 °C. The other balanced intensity distribution can be reached at -0.9 °C before mode hopping. Moreover, utilizing the fluorescence spectrum and the intensity balance points of Nd:GdVO4 DFL, we obtain the temperature difference between internal and external of Nd:GdVO4 crystal ΔT = 24.0 °C.
Electromagnetic Counter-Counter Measure (ECCM) Techniques of the Digital Microwave Radio.
1982-05-01
Frequency hopping requires special synthesizers and filter banks. Large bandwidth expansion in a microwave radio relay application can best be achieved with...34 processing gain " performance as a function of jammer modulation type " pulse jammer performance • emission bandwidth and spectral shaping 0... spectral efficiency, implementation complexity, and suitability for ECCK techniques will be considered. A sumary of the requirements and characteristics of
Jointly Optimal Design for MIMO Radar Frequency-Hopping Waveforms Using Game Theory
2016-04-01
Washington University in St . Louis St . Louis, MO, USA Using a colocated multiple input/multiple output (MIMO) radar system, we consider the problem of...Authors’ address: Preston M. Green Department of Electrical and Systems Engineering, Washington University in St . Louis, St . Louis, MO, 63130...engineering from Washington University in St . Louis, under the guidance of Dr. Arye Nehorai, in 2012 and 2015, respectively. His research interests
Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde
2013-01-01
During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313
Effect of pH on the electrical properties and conducting mechanism of SnO2 nanoparticles
NASA Astrophysics Data System (ADS)
Periathai, R. Sudha; Abarna, S.; Hirankumar, G.; Jeyakumaran, N.; Prithivikumaran, N.
2017-03-01
Semiconductor nanoparticles have attracted more interests because of their size-dependent optical and electrical properties.SnO2 is an oxygen-deficient n-type semiconductor with a wide band gap of 3.6 eV (300 K). It has many remarkable applications as sensors, catalysts, transparent conducting electrodes, anode material for rechargeable Li- ion batteries and optoelectronic devices. In the present work, the role of pH in determining the electrical and dielectric properties of SnO2 nanoparticles has been studied as a function of temperature ranging from Room temperature (RT) to 114 °C in the frequency range of 7 MHz to 50 mHz using impedance spectroscopic technique. The non linear behavior observed in the thermal dependence of the conductance of SnO2 nanoparticles is explained by means of the surface property of SnO2 nanoparticles where proton hopping mechanism is dealt with. Jonscher's power law has been fitted for the conductance spectra and the frequency exponent ("s" value) gives an insight about the ac conducting mechanism. The temperature dependence of electrical relaxation phenomenon in the material has been observed. The complex electric modulus analysis indicates the possibility of hopping conduction mechanism in the system with non-exponential type of conductivity relaxation.
NASA Astrophysics Data System (ADS)
Sorokin, N. I.
2018-04-01
The frequency (ν = 10-1-107 Hz) dependences of electrical conductivity σ(ν) of single crystals of superionic conductor Pb0.9Sc0.1F2.1 (10 mol % ScF3) with fluorite type structure (CaF2) in the temperature range 153-410 K have been investigated. The static bulk conductivity σ dc =1.5 × 10-4 S/cm and average hopping frequency ν h = 1.5 × 107 Hz of charge carriers (mobile ions F-) at room temperature (293 K) have been defined from the σ dc (ν) experimental curves. Enthalpies of thermoactivated processes of ionic conductivity σ dc ( T) (Δ H σ = 0.393 ± 0.005 eV) and dielectric relaxation ν h ( T) (Δ H h = 0.37 ± 0.03 eV) coincide within their errors. A crystal-physical model of fluorine-ion transport in a Pb0.9Sc0.1F2.1 crystal lattice has been proposed. The characteristic parameters of charge carriers have been calculated: concentration n mob = 2.0 × 1021 cm-3, the distance of the hopping d ≈ 0.5 nm and mobility μmob = 4.5 × 10-7 cm2/s V (293 K).
Temperature and frequency response of conductivity in Ag2S doped chalcogenide glassy semiconductor
NASA Astrophysics Data System (ADS)
Ojha, Swarupa; Das, Anindya Sundar; Roy, Madhab; Bhattacharya, Sanjib
2018-06-01
The electric conductivity of chalcogenide glassy semiconductor xAg2S-(1-x)(0.5S-0.5Te) has been presented here as a function of temperature and frequency. Formation of different nanocrystallites has been confirmed from X-ray diffraction study. It is also noteworthy that average size of nanocrystallites decreases with the increase of dislocation density. Dc conductivity data have been interpreted using Mott's model and Greaves's model in low and high temperature regions respectively. Ac conductivity above the room temperature has been analyzed using Meyer-Neldel (MN) conduction rule. It is interestingly noted that Correlated Barrier Hopping (CBH) model is the most appropriate conduction mechanism for x = 0.35, where pairs of charge carrier are considered to hop over the potential barrier between the sites via thermal activation. To interpret experimental data for x = 0.45, modified non-overlapping small polaron tunnelling (NSPT) model is supposed to be appropriate model due to tunnelling through grain boundary. The conductivity spectra at various temperatures have been analyzed using Almond-West Formalism (power law model). Scaling of conductivity spectra reveals that electrical relaxation process of charge carriers (polaron) is temperature independent but depends upon the composition of the present chalcogenide glassy system.
Dielectric and impedance spectral characteristics of bulk ZnIn2Se4
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Attia, A. A.; Salem, G. F.; Ali, H. A. M.; Ismail, M. I.
2014-02-01
The frequency and temperature dependence of ac conductivity, dielectric constant and dielectric loss of ZnIn2Se4 in a pellet form were investigated in the frequency range of 102-106 Hz and temperature range of 293-356 K. The behavior of ac conductivity was interpreted by the correlated barrier hopping (CBH) model. Temperature dependence of ac conductivity indicates that ac conduction is a thermally activated process. The density of localized states N(EF) and ac activation energy were estimated for various frequencies. Dielectric constant and dielectric loss showed a decrease with increasing frequency and an increase with increasing in temperature. The frequency dependence of real and imaginary parts of the complex impedance was investigated. The relaxation time decreases with the increase in temperature. The impedance spectrum exhibits the appearance of the single semicircular arc. The radius of semicircular arcs decreases with increasing temperature which suggests a mechanism of temperature-dependent on relaxation.
NASA Technical Reports Server (NTRS)
Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve
2003-01-01
A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.
NASA Astrophysics Data System (ADS)
Lee, C. C.; Chen, W. S.
2015-06-01
This study is to know how the characteristics of sporadic E-layer (Es-layer) affect the generation of spread-F in the nighttime ionosphere near the crest of equatorial ionization anomaly during solar minimum. The data of Es-layer parameters and spread-F are obtained from the Chungli ionograms of 1996. The Es-layer parameters include foEs (critical frequency of Es-layer), fbEs (blanketing frequency of Es-layer), and Δf (≡foEs-fbEs). Results show that the nighttime variations of foEs and fbEs medians (Δf medians) are different from (similar to) that of the occurrence probabilities of spread-F. Because the total number of Es-layer events is greater than that of spread-F events, the comparison between the medians of Es-layer parameters and the occurrence probabilities of spread-F might have a shortfall. Further, we categorize the Es-layer and spread-F events into each frequency interval of Es-layer parameters. For the occurrence probabilities of spread-F versus foEs, an increasing trend is found in post-midnight of all three seasons. The increasing trend also exists in pre-midnight of the J-months and in post-midnight of all seasons, for the occurrence probabilities of spread-F versus Δf. These demonstrate that the spread-F occurrence increases with increasing foEs and/or Δf. Moreover, the increasing trends indicate that polarization electric fields generated in Es-layer assist to produce spread-F, through the electrodynamical coupling of Es-layer and F-region. Regarding the occurrence probabilities of spread-F versus fbEs, the significant trend only appears in post-midnight of the E-months. This implies that fbEs might not be a major factor for the spread-F formation.
NASA Astrophysics Data System (ADS)
Grabowski, A.; Rosińska, M.
2012-07-01
On the basis of experimental data on interactions between humans we have investigated the process of epidemic spreading in a social network. We found that the distribution of the number of contacts maintained in one day is exponential. Data on frequency and duration of interpersonal interactions are presented. They allow us to simulate the spread of droplet-/-air-borne infections and to investigate the influence of human dynamics on the epidemic spread. Specifically, we investigated the influence of the distribution of frequency and duration of those contacts on magnitude, epidemic threshold and peak timing of epidemics propagating in respective networks. It turns out that a large increase in the magnitude of an epidemic and a decrease in epidemic threshold are visible if and only if both are taken into account. We have found that correlation between contact frequency and duration strongly influences the effectiveness of control measures like mass immunization campaigns.
Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R
2015-06-01
Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.
Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L
2016-12-01
Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD 0-200ms , and the knee extension moment was positively associated with RTD 0-200ms . At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD 0-200ms , and RTD 0-peak torque . Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance.
Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.
2016-01-01
Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD0-200ms, and the knee extension moment was positively associated with RTD0-200ms. At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD0-200ms, and RTD0–peak torque. Conclusion: Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Clinical Relevance: Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance. PMID:28210647
NASA Astrophysics Data System (ADS)
Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu
2017-08-01
Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.
Dynamics of liquid films exposed to high-frequency surface vibration
NASA Astrophysics Data System (ADS)
Manor, Ofer; Rezk, Amgad R.; Friend, James R.; Yeo, Leslie Y.
2015-05-01
We derive a generalized equation that governs the spreading of liquid films under high-frequency (MHz-order) substrate vibration in the form of propagating surface waves and show that this single relationship is universally sufficient to collectively describe the rich and diverse dynamic phenomena recently observed for the transport of oil films under such substrate excitation, in particular, Rayleigh surface acoustic waves. In contrast to low-frequency (Hz- to kHz-order) vibration-induced wetting phenomena, film spreading at such high frequencies arises from convective drift generated by the viscous periodic flow localized in a region characterized by the viscous penetration depth β-1≡(2μ /ρ ω ) 1 /2 adjacent to the substrate that is invoked directly by its vibration; μ and ρ are the viscosity and the density of the liquid, respectively, and ω is the excitation frequency. This convective drift is responsible for driving the spreading of thin films of thickness h ≪kl-1 , which spread self-similarly as t1 /4 along the direction of the drift corresponding to the propagation direction of the surface wave, kl being the wave number of the compressional acoustic wave that forms in the liquid due to leakage of the surface wave energy from the substrate into the liquid and t the time. Films of greater thicknesses h ˜kl-1≫β-1 , in contrast, are observed to spread with constant velocity but in a direction that opposes the drift and surface wave propagation due to the attenuation of the acoustic wave in the liquid. The universal equation derived allows for the collective prediction of the spreading of these thin and thick films in opposing directions.
Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network
NASA Astrophysics Data System (ADS)
Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue
2006-09-01
In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.
NASA Astrophysics Data System (ADS)
Dimova, Dilyana; Bajorath, Jürgen
2017-07-01
Computational scaffold hopping aims to identify core structure replacements in active compounds. To evaluate scaffold hopping potential from a principal point of view, regardless of the computational methods that are applied, a global analysis of conventional scaffolds in analog series from compound activity classes was carried out. The majority of analog series was found to contain multiple scaffolds, thus enabling the detection of intra-series scaffold hops among closely related compounds. More than 1000 activity classes were found to contain increasing proportions of multi-scaffold analog series. Thus, using such activity classes for scaffold hopping analysis is likely to overestimate the scaffold hopping (core structure replacement) potential of computational methods, due to an abundance of artificial scaffold hops that are possible within analog series.
Turelli, Michael; Barton, Nicholas H
2017-06-01
A novel strategy for controlling the spread of arboviral diseases such as dengue, Zika and chikungunya is to transform mosquito populations with virus-suppressing Wolbachia. In general, Wolbachia transinfected into mosquitoes induce fitness costs through lower viability or fecundity. These maternally inherited bacteria also produce a frequency-dependent advantage for infected females by inducing cytoplasmic incompatibility (CI), which kills the embryos produced by uninfected females mated to infected males. These competing effects, a frequency-dependent advantage and frequency-independent costs, produce bistable Wolbachia frequency dynamics. Above a threshold frequency, denoted pˆ, CI drives fitness-decreasing Wolbachia transinfections through local populations; but below pˆ, infection frequencies tend to decline to zero. If pˆ is not too high, CI also drives spatial spread once infections become established over sufficiently large areas. We illustrate how simple models provide testable predictions concerning the spatial and temporal dynamics of Wolbachia introductions, focusing on rate of spatial spread, the shape of spreading waves, and the conditions for initiating spread from local introductions. First, we consider the robustness of diffusion-based predictions to incorporating two important features of wMel-Aedes aegypti biology that may be inconsistent with the diffusion approximations, namely fast local dynamics induced by complete CI (i.e., all embryos produced from incompatible crosses die) and long-tailed, non-Gaussian dispersal. With complete CI, our numerical analyses show that long-tailed dispersal changes wave-width predictions only slightly; but it can significantly reduce wave speed relative to the diffusion prediction; it also allows smaller local introductions to initiate spatial spread. Second, we use approximations for pˆ and dispersal distances to predict the outcome of 2013 releases of wMel-infected Aedes aegypti in Cairns, Australia, Third, we describe new data from Ae. aegypti populations near Cairns, Australia that demonstrate long-distance dispersal and provide an approximate lower bound on pˆ for wMel in northeastern Australia. Finally, we apply our analyses to produce operational guidelines for efficient transformation of vector populations over large areas. We demonstrate that even very slow spatial spread, on the order of 10-20 m/month (as predicted), can produce area-wide population transformation within a few years following initial releases covering about 20-30% of the target area. Copyright © 2017 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...
NASA Astrophysics Data System (ADS)
Miyazaki, Jun
2013-10-01
We present an analytical method for quantifying exciton hopping in an energetically disordered system with quenching sites. The method is subsequently used to provide a quantitative understanding of exciton hopping in a quantum dot (QD) array. Several statistical quantities that characterize the dynamics (survival probability, average number of distinct sites visited, average hopping distance, and average hopping rate in the initial stage) are obtained experimentally by measuring time-resolved fluorescence intensities at various temperatures. The time evolution of these quantities suggests in a quantitative way that at low temperature an exciton tends to be trapped at a local low-energy site, while at room temperature, exciton hopping occurs repeatedly, leading to a large hopping distance. This method will serve to facilitate highly efficient optoelectronic devices using QDs such as photovoltaic cells and light-emitting diodes, since exciton hopping is considered to strongly influence their operational parameters. The presence of a dark QD (quenching site) that exhibits fast decay is also quantified.
The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.
Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David
2016-08-15
Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.
Xu, Pengbai; Dong, Yongkang; Zhou, Dengwang; Fu, Cheng; Zhang, Juwang; Zhang, Hongying; Lu, Zhiwei; Chen, Liang; Bao, Xiaoyi
2016-07-20
In this paper, up to 1100°C and 1200°C high-temperature distributed Brillouin sensing based on a GeO2-doped single-mode fiber (SMF) and a pure silica photonic crystal fiber (PCF) are demonstrated, respectively. The Brillouin frequency shift's (BFS) dependence on temperatures of the SMF and PCF agrees with a nonlinear function instead of a linear function, which is mainly due to the change of the acoustic velocity in a silica fiber. BFS hopping is observed in both kinds of fibers between 800°C-900°C in the first annealing process, and after that, the BFS exhibits stability and repeatability with a measurement accuracy as high as ±2.4°C for the SMF and ±3.6°C for the PCF. The BFS hopping is a highly temperature-dependent behavior, which means that a high temperature (>800°C) would accelerate this process to reach a stable state. After BFS hopping, both the SMF and PCF show good repeatability for temperatures higher than 1000°C without annealing. The process of coating burning of a silica fiber not only introduces a loss induced by micro-bending, but also imposes a compressive stress on the bare fiber, which contributes to an additional BFS variation at the temperature period of the coating burning (∼300°C-500°C).
FH/MFSK performance in multitone jamming
NASA Technical Reports Server (NTRS)
Levitt, B. K.
1985-01-01
The performance of frequency-hopped (FH) M-ary frequency-shift keyed (MFSK) signals in partial-band noise was analyzed in the open literature. The previous research is extended to the usually more effective class of multitone jamming. Some objectives researched are: (1) To categorize several different multitone jamming strategies; (2) To analyze the performance of FH/MSFK signaling, both uncoded with diversity, assuming a noncoherent energy detection metric with linear combining and perfect jamming state side information, in the presence of worst case interference for each of these multitone categories; and (3) To compare the effectiveness of the various multitone jamming techniques, and contrast the results with the partial band noise jamming case.
Simple, low-noise piezo driver with feed-forward for broad tuning of external cavity diode lasers.
Doret, S Charles
2018-02-01
We present an inexpensive, low-noise (<260 μV rms , 0.1 Hz-100 kHz) design for a piezo driver suitable for frequency tuning of external-cavity diode lasers. This simple driver improves upon many commercially available drivers by incorporating circuitry to produce a "feed-forward" signal appropriate for making simultaneous adjustments to the piezo voltage and laser current, enabling dramatic improvements in a mode-hop-free laser frequency tuning range. We present the theory behind our driver's operation, characterize its output noise, and demonstrate its use in absorption spectroscopy on the rubidium D 1 line.
Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.
Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less
Varietal discrimination of hop pellets by near and mid infrared spectroscopy.
Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A
2018-04-01
Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.
The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.
ERIC Educational Resources Information Center
Rice, Jeff
2003-01-01
Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…
NASA Astrophysics Data System (ADS)
Sikder, Somali; Ghosh, Shila
2018-02-01
This paper presents the construction of unipolar transposed modified Walsh code (TMWC) and analysis of its performance in optical code-division multiple-access (OCDMA) systems. Specifically, the signal-to-noise ratio, bit error rate (BER), cardinality, and spectral efficiency were investigated. The theoretical analysis demonstrated that the wavelength-hopping time-spreading system using TMWC was robust against multiple-access interference and more spectrally efficient than systems using other existing OCDMA codes. In particular, the spectral efficiency was calculated to be 1.0370 when TMWC of weight 3 was employed. The BER and eye pattern for the designed TMWC were also successfully obtained using OptiSystem simulation software. The results indicate that the proposed code design is promising for enhancing network capacity.
ERIC Educational Resources Information Center
Brown, Bryan
2010-01-01
This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…
Steenackers, Bart; De Cooman, Luc; De Vos, Dirk
2015-04-01
The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.
Structural, electrical and magnetic characteristics of improper multiferroic: GdFeO3
NASA Astrophysics Data System (ADS)
Sahoo, Sushrisangita; Mahapatra, P. K.; Choudhary, R. N. P.; Nandagoswami, M. L.; Kumar, Ashok
2016-06-01
Studies of dielectric, impedance, conductivity, magnetic and magneto-electric (ME) properties of GdFeO3 ceramics fabricated by chemical method are reported here. The synthesized powder is phase-pure and crystallizes in the orthorhombic crystal structure. Below 50 °C, the impedance has only grain contribution, while at higher temperatures, it has both grain and grain boundary contributions. Based on the depression angle of the Nyquist plot, the inhomogeneity of the sample is estimated. The capacitance data reveal that at low temperatures, the sample behaves as a leaky capacitor while at higher temperatures the sample shows the effect of the diffusion of thermally excited charge carriers across a barrier. In the low-frequency domain, the dielectric characteristics were explained on the basis of the Maxwell-Wagner mechanism, while in the high-frequency range those were correlated to the grain effect. The frequency dependent characteristic of the tangent loss is explained as a combined contribution from the Debye-like relaxation and dc conductivity related mechanism at higher temperatures. The temperature dependence of the dielectric characteristic and data are found to fit with two Gaussian peaks centered at 148 °C and 169 °C. While the first peak is explained on the basis of the Maxwell-Wagner mechanism, the second has its origin in magnetic reordering and the shifting of Gd3+ ions along the c-axis. The magnetic reordering also results in a sharp decrease of conductivity between 169 °C and 243 °C. The frequency dependent ac conductivity is explained on the basis of the correlated barrier hopping model and the quantum mechanical hopping model for the different frequency domain. The existence of P-E and M-H loops support its improper ferroelectric behavior and canted anti-ferromagnetism respectively. The ME coefficient of the sample is found to be 1.78 mV cm-1 Oe-1.
Ischemia-induced spreading depolarization in the retina
Srienc, Anja I; Biesecker, Kyle R; Shimoda, Angela M; Kur, Joanna
2016-01-01
Cortical spreading depolarization is a metabolically costly phenomenon that affects the brain in both health and disease. Following severe stroke, subarachnoid hemorrhage, or traumatic brain injury, cortical spreading depolarization exacerbates tissue damage and enlarges infarct volumes. It is not known, however, whether spreading depolarization also occurs in the retina in vivo. We report now that spreading depolarization episodes are generated in the in vivo rat retina following retinal vessel occlusion produced by photothrombosis. The properties of retinal spreading depolarization are similar to those of cortical spreading depolarization. Retinal spreading depolarization waves propagate at a velocity of 3.0 ± 0.1 mm/min and are associated with a negative shift in direct current potential, a transient cessation of neuronal spiking, arteriole constriction, and a decrease in tissue O2 tension. The frequency of retinal spreading depolarization generation in vivo is reduced by administration of the NMDA antagonist MK-801 and the 5-HT(1D) agonist sumatriptan. Branch retinal vein occlusion is a leading cause of vision loss from vascular disease. Our results suggest that retinal spreading depolarization could contribute to retinal damage in acute retinal ischemia and demonstrate that pharmacological agents can reduce retinal spreading depolarization frequency after retinal vessel occlusion. Blocking retinal spreading depolarization generation may represent a therapeutic strategy for preserving vision in branch retinal vein occlusion patients. PMID:27389181
Hip-Hopping across China: Intercultural Formulations of Local Identities
ERIC Educational Resources Information Center
Barrett, Catrice
2012-01-01
The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…
Revolutionizing Environmental Education through Indigenous Hip Hop Culture
ERIC Educational Resources Information Center
Gorlewski, Julie; Porfilio, Brad J.
2012-01-01
Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…
Supporting Secure, AD HOC Joins for Tactical Networks
2002-05-07
ftp.isi.edu/in-notes/ rfc2501.txt (20SEP01). [4] Deitel , Harvery M. and Paul J. Deitel . Java: How to Program 3rd Edition. (Prentice Hall: New...produce a complete product, to include the construction of TTNT hardware. The TTNT program is concerned with frequency hopping schemes, error correcting...Configuration To create the digital certificates needed for the client authentication, we modified a hybrid file encryption program that used a Rivest-Shamir
Rogers, Geoffrey
2018-06-01
The Yule-Nielsen effect is an influence on halftone color caused by the diffusion of light within the paper upon which the halftone ink is printed. The diffusion can be characterized by a point spread function. In this paper, a point spread function for paper is derived using the multiple-path model of reflection. This model treats the interaction of light with turbid media as a random walk. Using the multiple-path point spread function, a general expression is derived for the average reflectance of light from a frequency-modulated halftone, in which dot size is constant and the number of dots is varied, with the arrangement of dots random. It is also shown that the line spread function derived from the multiple-path model has the form of a Lorentzian function.
ELF whistler events with a reduced intensity observed by the DEMETER spacecraft
NASA Astrophysics Data System (ADS)
Zahlava, J.; Nemec, F.; Santolik, O.; Kolmasova, I.; Parrot, M.
2017-12-01
A survey of VLF frequency-time spectrograms obtained by the DEMETER spacecraft (2004-2010, altitude about 700 km) revealed that the intensity of fractional hop whistlers is sometimes significantly reduced at specific frequencies. These frequencies are typically above about 3.4 kHz (second cutoff frequency of the Earth-ionosphere waveguide), and they vary smoothly in time. The events were explained by the wave propagation in the Earth-ionosphere waveguide, and a resulting interference of the first few waveguide modes. We analyze the events whose frequency-time structure is rather similar, but at frequencies below 1 kHz. Altogether, 284 events are identified during the periods with active Burst mode, when high resolution data are measured by DEMETER. The vast majority of events (93%) occurs during the nighttime. All six electromagnetic field components are available, which allows us to perform a detailed wave analysis. An overview of the properties of these events is presented, and their possible origin is discussed.
Classification of Scaffold Hopping Approaches
Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders
2012-01-01
The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715
NASA Astrophysics Data System (ADS)
Niu, Yuekun; Sun, Jian; Ni, Yu; Song, Yun
2018-06-01
The dynamical mean-field theory is employed to study the orbital-selective Mott transition (OSMT) of the two-orbital Hubbard model with nearest neighbor hopping and next-nearest neighbor (NNN) hopping. The NNN hopping breaks the particle-hole symmetry at half filling and gives rise to an asymmetric density of states (DOS). Our calculations show that the broken symmetry of DOS benefits the OSMT, where the region of the orbital-selective Mott phase significantly extends with the increasing NNN hopping integral. We also find that Hund's rule coupling promotes OSMT by blocking the orbital fluctuations, but the influence of NNN hopping is more remarkable.
Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State
NASA Astrophysics Data System (ADS)
Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen
2017-10-01
Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.
Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3
ERIC Educational Resources Information Center
Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.
2012-01-01
"Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…
Precision QTL mapping of downy mildew resistance in Hop (Humulus lupulus L.)
USDA-ARS?s Scientific Manuscript database
Hop Downy mildew (DM) is an obligate parasite causing severe losses in hop if not controlled. Resistance to this pathogen is a primary goal for hop breeding programs. The objective of this study was to identify QTLs linked to DM resistance. Next-generation-sequencing was performed on a mapping po...
Genomics of the hop psuedo-autosomal regions
USDA-ARS?s Scientific Manuscript database
Hop is one of the few crop species with female and male plants with sex being determined by either XX or XY chromosomes. Hop cones are only produced in female hops with or without fertilization. This has lead to most genomic research being directed toward female plants. Very little work has been don...
Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace
ERIC Educational Resources Information Center
Durham, Aisha S.
2009-01-01
The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…
Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education
ERIC Educational Resources Information Center
Tobias, Evan S.
2014-01-01
Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…
Kankolongo Cibaka, Marie-Lucie; Decourrière, Laura; Lorenzo-Alonso, Celso-José; Bodart, Etienne; Robiette, Raphaël; Collin, Sonia
2016-11-16
Monovarietal dry-hopped beers were produced with the dual-purpose hop cultivars Amarillo, Hallertau Blanc, and Mosaic. The grapefruit-like 3-sulfanyl-4-methylpentan-1-ol was found in all three beers at concentrations much higher than expected on the basis of the free thiol content in hop. Even cysteinylated precursors proved unable to explain our results. As observed in wine, the occurrence of S-glutathione precursors was therefore suspected in hop. The analytical standards of S-3-(4-methyl-1-hydroxypentyl)glutathione, never described before, and of S-3-(1-hydroxyhexyl)glutathione, previously evidenced in grapes, were chemically synthesized. An optimized extraction of glutathionylated precursors was then applied to Amarillo, Hallertau Blanc, and Mosaic hop samples. HPLC-ESI(+)MS/MS revealed, for the first time, the occurrence of S-3-(1-hydroxyhexyl)glutathione and S-3-(4-methyl-1-hydroxypentyl)glutathione in hop, at levels well above those reported for their cysteinylated counterparts. S-3-(1-Hydroxyhexyl)glutathione emerged in all cases as the major adduct in hop. Yet, although 3-sulfanylhexan-1-ol seems relatively ubiquitous in free, cysteinylated, and glutathionylated forms, the glutathione adduct of 3-sulfanyl-4-methylpentan-1-ol, never evidenced in other plants up to now, was found only in the Hallertau Blanc variety.
Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc
2010-01-01
The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041
Universal Frequency Domain Baseband Receiver Structure for Future Military Software Defined Radios
2010-09-01
selective channels, i.e., it may have a poor performance at good conditions [4]. Military systems may require a direct sequence ( DS ) component for...frequency bins using a spreading code. This is called the MC- CDMA signal. Note that spreading does not need to cover all the subcarriers but just a few, like...preambles with appropriate frequency domain properties. A DS component can be added as usually. The FDP block then includes this code as a reference
A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.
Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia
2018-06-01
African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.
Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.
2009-01-01
Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557
Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.
2013-01-01
Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484
The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.
Harakeh, Zeena; Bogt, Tom F M Ter
2018-02-16
Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.
Hip Hop Stroke: Study Protocol for a Randomized Controlled Trial to Address Stroke Literacy
Williams, Olajide; Leighton-Herrmann, Ellyn; DeSorbo, Alexandra; Hecht, Mindy; Hedmann, Monique; Huq, Saima; Gerin, William; Chinchilli, Vernon; Ogedegbe, Gbenga; Noble, James
2015-01-01
Objective Stroke is the fifth leading cause of death and the leading cause of serious long-term adult disability in the US. Acute stroke treatments with intravenous thrombolysis and endovascular therapy are proven to reduce disability, however a critical limitation on their effectiveness is the narrow time window for administration, which is 4.5 hours and 6 hours respectively from the onset of symptoms. Our overarching goal is to reduce pre-hospital delays to acute stroke treatments in economically disadvantaged minority communities where the greatest delays exist, using Hip Hop Stroke. Methods Hip Hop Stroke (HHS) is a school-based, child-mediated, culturally-tailored stroke communication multimedia intervention developed using validated models of behavior change and designed to improve stroke literacy (knowledge of stroke symptoms, the urgent need to call 911, and prevention measures) of 4th, 5th and 6th grade students and their parents residing in poor urban communities. Children in the intervention arm will receive the HHS intervention, while those in the attentional control arm will receive standardized nutrition education based on the USDA's MyPyramid program. Children will be trained and motivated to share stroke information with their parents or other adult caregiver. Both children and parents will complete a stroke knowledge assessment at baseline, immediately following the program, and at 3-months post-program. The primary outcome is the effect of the child mediation on parental stroke literacy. Conclusion Stroke literate children, a captive audience in school systems, may represent a viable channel for spreading stroke information into households of poor urban communities where mass media stroke campaigns have shown the lowest penetration. These children may also call 911 when witnessing a stroke in their homes or communities. The HHS program may highlight the potential role of children in the chain of stroke recovery as a strategy for reducing prehospital delays to acute stroke treatment. PMID:26779395
Hip Hop Stroke: Study Protocol for a Randomized Controlled Trial to Address Stroke Literacy.
Williams, Olajide; Leighton-Herrmann, Ellyn; DeSorbo, Alexandra; Hecht, Mindy; Hedmann, Monique; Huq, Saima; Gerin, William; Chinchilli, Vernon; Ogedegbe, Gbenga; Noble, James
2015-10-01
Stroke is the fifth leading cause of death and the leading cause of serious long-term adult disability in the US. Acute stroke treatments with intravenous thrombolysis and endovascular therapy are proven to reduce disability, however a critical limitation on their effectiveness is the narrow time window for administration, which is 4.5 hours and 6 hours respectively from the onset of symptoms. Our overarching goal is to reduce pre-hospital delays to acute stroke treatments in economically disadvantaged minority communities where the greatest delays exist, using Hip Hop Stroke. Hip Hop Stroke (HHS) is a school-based, child-mediated, culturally-tailored stroke communication multimedia intervention developed using validated models of behavior change and designed to improve stroke literacy (knowledge of stroke symptoms, the urgent need to call 911, and prevention measures) of 4 th , 5 th and 6 th grade students and their parents residing in poor urban communities. Children in the intervention arm will receive the HHS intervention, while those in the attentional control arm will receive standardized nutrition education based on the USDA's MyPyramid program. Children will be trained and motivated to share stroke information with their parents or other adult caregiver. Both children and parents will complete a stroke knowledge assessment at baseline, immediately following the program, and at 3-months post-program. The primary outcome is the effect of the child mediation on parental stroke literacy. Stroke literate children, a captive audience in school systems, may represent a viable channel for spreading stroke information into households of poor urban communities where mass media stroke campaigns have shown the lowest penetration. These children may also call 911 when witnessing a stroke in their homes or communities. The HHS program may highlight the potential role of children in the chain of stroke recovery as a strategy for reducing prehospital delays to acute stroke treatment.
Origin of colossal permittivity in (In1/2Nb1/2)TiO2via broadband dielectric spectroscopy.
Zhao, Xiao-gang; Liu, Peng; Song, Yue-Chan; Zhang, An-ping; Chen, Xiao-ming; Zhou, Jian-ping
2015-09-21
(In1/2Nb1/2)TiO2 (IN-T) ceramics were prepared via a solid-state reaction route. X-ray diffraction (XRD) and Raman spectroscopy were used for the structural and compositional characterization of the synthesized compounds. The results indicated that the sintered ceramics have a single phase of rutile TiO2. Dielectric spectroscopy (frequency range from 20 Hz to 1 MHz and temperature range from 10 K to 270 K) was performed on these ceramics. The IN-T ceramics showed extremely high permittivities of up to ∼10(3), which can be referred to as colossal permittivity, with relatively low dielectric losses of ∼0.05. Most importantly, detailed impedance data analyses of IN-T demonstrated that electron-pinned defect-dipoles, interfacial polarization and polaron hopping polarization contribute to the colossal permittivity at high temperatures (270 K); however, only the complexes (pinned electron) and polaron hopping polarization are active at low temperatures (below 180 K), which is consistent with UDR analysis.
NASA Astrophysics Data System (ADS)
Akhtar, W.; Schnegg, A.; Veber, S.; Meier, C.; Fehr, M.; Lips, K.
2015-08-01
Here we describe a new high frequency/high field continuous wave and pulsed electrically detected magnetic resonance (CW EDMR and pEDMR) setup, operating at 263 GHz and resonance fields between 0 and 12 T. Spin dependent transport in illuminated hydrogenated amorphous silicon p-i-n solar cells at 5 K and 90 K was studied by in operando 263 GHz CW and pEDMR alongside complementary X-band CW EDMR. Benefiting from the superior resolution at 263 GHz, we were able to better resolve EDMR signals originating from spin dependent hopping and recombination processes. 5 K EDMR spectra were found to be dominated by conduction and valence band tail states involved in spin dependent hopping, with additional contributions from triplet exciton states. 90 K EDMR spectra could be assigned to spin pair recombination involving conduction band tail states and dangling bonds as the dominating spin dependent transport process, with additional contributions from valence band tail and triplet exciton states.
Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian
2018-04-01
Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p < 0.01), triple hop (417 ± 106 vs 519 ± 102% limb length, p < 0.01), timed hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p < 0.01), and crossover hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the operative limb compared to the control and non-operative limbs, even after starting sport-specific drills. Importantly, HER strength independently predicted hop performance. Based on these findings, to resolve between-limb deficits in strength and hop performance clinicians should include HER strengthening exercises in post-operative rehabilitation. Prognostic Study, Level II.
Chen, Huifang; Fan, Guangyu; Xie, Lei; Cui, Jun-Hong
2013-01-01
Due to the characteristics of underwater acoustic channel, media access control (MAC) protocols designed for underwater acoustic sensor networks (UWASNs) are quite different from those for terrestrial wireless sensor networks. Moreover, in a sink-oriented network with event information generation in a sensor field and message forwarding to the sink hop-by-hop, the sensors near the sink have to transmit more packets than those far from the sink, and then a funneling effect occurs, which leads to packet congestion, collisions and losses, especially in UWASNs with long propagation delays. An improved CDMA-based MAC protocol, named path-oriented code assignment (POCA) CDMA MAC (POCA-CDMA-MAC), is proposed for UWASNs in this paper. In the proposed MAC protocol, both the round-robin method and CDMA technology are adopted to make the sink receive packets from multiple paths simultaneously. Since the number of paths for information gathering is much less than that of nodes, the length of the spreading code used in the POCA-CDMA-MAC protocol is shorter greatly than that used in the CDMA-based protocols with transmitter-oriented code assignment (TOCA) or receiver-oriented code assignment (ROCA). Simulation results show that the proposed POCA-CDMA-MAC protocol achieves a higher network throughput and a lower end-to-end delay compared to other CDMA-based MAC protocols. PMID:24193100
Chen, Huifang; Fan, Guangyu; Xie, Lei; Cui, Jun-Hong
2013-11-04
Due to the characteristics of underwater acoustic channel, media access control (MAC) protocols designed for underwater acoustic sensor networks (UWASNs) are quite different from those for terrestrial wireless sensor networks. Moreover, in a sink-oriented network with event information generation in a sensor field and message forwarding to the sink hop-by-hop, the sensors near the sink have to transmit more packets than those far from the sink, and then a funneling effect occurs, which leads to packet congestion, collisions and losses, especially in UWASNs with long propagation delays. An improved CDMA-based MAC protocol, named path-oriented code assignment (POCA) CDMA MAC (POCA-CDMA-MAC), is proposed for UWASNs in this paper. In the proposed MAC protocol, both the round-robin method and CDMA technology are adopted to make the sink receive packets from multiple paths simultaneously. Since the number of paths for information gathering is much less than that of nodes, the length of the spreading code used in the POCA-CDMA-MAC protocol is shorter greatly than that used in the CDMA-based protocols with transmitter-oriented code assignment (TOCA) or receiver-oriented code assignment (ROCA). Simulation results show that the proposed POCA-CDMA-MAC protocol achieves a higher network throughput and a lower end-to-end delay compared to other CDMA-based MAC protocols.
High power VCSEL devices for atomic clock applications
NASA Astrophysics Data System (ADS)
Watkins, L. S.; Ghosh, C.; Seurin, J.-F.; Zhou, D.; Xu, G.; Xu, B.; Miglo, A.
2015-09-01
We are developing VCSEL technology producing >100mW in single frequency at wavelengths 780nm, 795nm and 850nm. Small aperture VCSELs with few mW output have found major applications in atomic clock experiments. Using an external cavity three-mirror configuration we have been able to operate larger aperture VCSELs and obtain >70mW power in single frequency operation. The VCSEL has been mounted in a fiber pigtailed package with the external mirror mounted on a shear piezo. The package incorporates a miniature Rb cell locker to lock the VCSEL wavelength. This VCSEL operates in single frequency and is tuned by a combination of piezo actuator, temperature and current. Mode-hop free tuning over >30GHz frequency span is obtained. The VCSEL has been locked to the Rb D2 line and feedback control used to obtain line-widths of <100kHz.
Spectrophotometric and electrical properties of imperatorin: an organic molecule
NASA Astrophysics Data System (ADS)
Mir, Feroz A.
2015-09-01
Imperatorin (molecular formula = C16H14O4, molecular mass = 270) an organic molecule was isolated from ethyl acetate extract of the root parts of the plant Prangos pabularia. The optical study was carried out by ultraviolet-visible spectroscopy, and this compound showed an indirect allowed transition. The optical band gap ( E g ) was found around 3.75 eV. Photoluminescence shows various good emission bands. The frequency-dependent real part of the complex ac conductivity was found to follow the universal dielectric response: σ ac ( ω) α ω s [where σ ac ( ω) is the frequency-dependent total conductivity, ω is the frequency, and s is the frequency exponent]. From ac conductivity data analysis, correlated barrier hopping charge-transport mechanism is the dominant electrical transport process shown by this compound. The good emission, less absorption, wide band gap and good electrical properties shown by this compound project them as a bright choice for organic electronic devices.
Intra-pulse modulation recognition using short-time ramanujan Fourier transform spectrogram
NASA Astrophysics Data System (ADS)
Ma, Xiurong; Liu, Dan; Shan, Yunlong
2017-12-01
Intra-pulse modulation recognition under negative signal-to-noise ratio (SNR) environment is a research challenge. This article presents a robust algorithm for the recognition of 5 types of radar signals with large variation range in the signal parameters in low SNR using the combination of the Short-time Ramanujan Fourier transform (ST-RFT) and pseudo-Zernike moments invariant features. The ST-RFT provides the time-frequency distribution features for 5 modulations. The pseudo-Zernike moments provide invariance properties that are able to recognize different modulation schemes on different parameter variation conditions from the ST-RFT spectrograms. Simulation results demonstrate that the proposed algorithm achieves the probability of successful recognition (PSR) of over 90% when SNR is above -5 dB with large variation range in the signal parameters: carrier frequency (CF) for all considered signals, hop size (HS) for frequency shift keying (FSK) signals, and the time-bandwidth product for Linear Frequency Modulation (LFM) signals.
Distance measurement using frequency scanning interferometry with mode-hoped laser
NASA Astrophysics Data System (ADS)
Medhat, M.; Sobee, M.; Hussein, H. M.; Terra, O.
2016-06-01
In this paper, frequency scanning interferometry is implemented to measure distances up to 5 m absolutely. The setup consists of a Michelson interferometer, an external cavity tunable diode laser, and an ultra-low expansion (ULE) Fabry-Pérot (FP) cavity to measure the frequency scanning range. The distance is measured by acquiring simultaneously the interference fringes from, the Michelson and the FP interferometers, while scanning the laser frequency. An online fringe processing technique is developed to calculate the distance from the fringe ratio while removing the parts result from the laser mode-hops without significantly affecting the measurement accuracy. This fringe processing method enables accurate distance measurements up to 5 m with measurements repeatability ±3.9×10-6 L. An accurate translation stage is used to find the FP cavity free-spectral-range and therefore allow accurate measurement. Finally, the setup is applied for the short distance calibration of a laser distance meter (LDM).
USDA-ARS?s Scientific Manuscript database
Increasing labor costs and reduced labor pools for hop production have resulted in the necessity to develop strategies to improve efficiency and automate hop production and harvest. One solution for reducing labor inputs is the use and production of “low-trellis” hop varieties optimized for mechani...
First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China
USDA-ARS?s Scientific Manuscript database
Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...
ERIC Educational Resources Information Center
Porfilio, Brad J., Ed.; Viola, Michael J., Ed.
2012-01-01
Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…
Hip-Hop and the Academic Canon
ERIC Educational Resources Information Center
Abe, Daudi
2009-01-01
Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…
Code of Federal Regulations, 2010 CFR
2010-04-01
..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...
Code of Federal Regulations, 2011 CFR
2011-04-01
..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...
Time Domain and Frequency Domain Deterministic Channel Modeling for Tunnel/Mining Environments.
Zhou, Chenming; Jacksha, Ronald; Yan, Lincan; Reyes, Miguel; Kovalchik, Peter
2017-01-01
Understanding wireless channels in complex mining environments is critical for designing optimized wireless systems operated in these environments. In this paper, we propose two physics-based, deterministic ultra-wideband (UWB) channel models for characterizing wireless channels in mining/tunnel environments - one in the time domain and the other in the frequency domain. For the time domain model, a general Channel Impulse Response (CIR) is derived and the result is expressed in the classic UWB tapped delay line model. The derived time domain channel model takes into account major propagation controlling factors including tunnel or entry dimensions, frequency, polarization, electrical properties of the four tunnel walls, and transmitter and receiver locations. For the frequency domain model, a complex channel transfer function is derived analytically. Based on the proposed physics-based deterministic channel models, channel parameters such as delay spread, multipath component number, and angular spread are analyzed. It is found that, despite the presence of heavy multipath, both channel delay spread and angular spread for tunnel environments are relatively smaller compared to that of typical indoor environments. The results and findings in this paper have application in the design and deployment of wireless systems in underground mining environments.
Time Domain and Frequency Domain Deterministic Channel Modeling for Tunnel/Mining Environments
Zhou, Chenming; Jacksha, Ronald; Yan, Lincan; Reyes, Miguel; Kovalchik, Peter
2018-01-01
Understanding wireless channels in complex mining environments is critical for designing optimized wireless systems operated in these environments. In this paper, we propose two physics-based, deterministic ultra-wideband (UWB) channel models for characterizing wireless channels in mining/tunnel environments — one in the time domain and the other in the frequency domain. For the time domain model, a general Channel Impulse Response (CIR) is derived and the result is expressed in the classic UWB tapped delay line model. The derived time domain channel model takes into account major propagation controlling factors including tunnel or entry dimensions, frequency, polarization, electrical properties of the four tunnel walls, and transmitter and receiver locations. For the frequency domain model, a complex channel transfer function is derived analytically. Based on the proposed physics-based deterministic channel models, channel parameters such as delay spread, multipath component number, and angular spread are analyzed. It is found that, despite the presence of heavy multipath, both channel delay spread and angular spread for tunnel environments are relatively smaller compared to that of typical indoor environments. The results and findings in this paper have application in the design and deployment of wireless systems in underground mining environments.† PMID:29457801
NASA Astrophysics Data System (ADS)
Tulunay, E.; Senalp, E. T.; Tulunay, Y.; Warrington, E. M.; Sari, M. O.
2009-04-01
A small group at METU has been developing data driven models in order to forecast some critical parameters, which affect the communication and navigation systems, since 1990. The background on the subjects supports new achievements in terms of theoretical and experimental basis contributing the COST 296 WG2 activities. This work mentions the representative contributions. (i) A method has been proposed for the assessment of HF Channel Availability under ionospheric disturbances. Signal to Noise Ratio (SNR), Doppler Spread and Modified Power Delay Spread were considered. The study relates the modem performance to ionospheric disturbances. Ionospheric disturbance was characterised by Disturbance Storm Type (DST) index. Radar data including Effective Multipath Spread, Composite Doppler Spread and SNR values were obtained from the experiment conducted between Leicester UK (52.63° N; 1.08° W) and Uppsala, Sweden (59.92° N; 17.63° E) in the year 2001. First, joint probability density function (PDF) of SNR, Doppler Spread, and Effective Multipath Spread versus DST were considered. It was demonstrated by determining the conditional PDFs, and by using Bayes' Theorem, that there were dependencies between DST and the above mentioned parameters [Sari, 2006]. Thus, it is concluded that the availability of the HF channel is a function of DST. As examples of modem characterizations, Military Standards were considered. Given a magnetic condition, the modem availability was calculated. The model developed represents the ionospheric HF channel, and it is based on a stochastic approach. Depending on the new experimental data, the conditional PDFs could be updated continuously. The HF channel availability under various ionospheric Space Weather (SW) conditions can be determined using the model. The proposed method is general and can include other indices as well. The method can also be applied to a variety of other processes. (ii) The effects of space weather conditions on the variation of group range and line-of-sight Doppler velocity of the HF Radar echo signal were investigated. HF radar system under ionospheric disturbances has been identified globally and some operational suggestions have been presented. It is possible for the HF radar operator to estimate the possible skip distance and possible single hop group ranges for the given frequencies of 11 MHz and 14 MHz [Buyukpabuscu, 2007]. (iii) The measurements over the HF band during the 29 March 2006 total solar eclipse in Antalya (36° N; 30° E) Turkey was conducted from the channel occupancy and atmospheric noise points of view. The whole HF band ranging from 1 to 30 MHz has been swept using 10 kHz peak and 200 Hz average detectors of a certified EMI receiver equipped with a calibrated active monopole antenna. The changes in the atmospheric noise during the eclipse were reported [Tulunay, 2006]. The model based, theoretical and experimental works mentioned are promising and have potential for future research and developments. References Buyukpabuscu S.O. (2007), System Identification with Particular Interest On The High Frequency Radar Under Ionospheric Disturbances, MS Thesis, Electrical and Electronics Eng., Middle East Technical Univ., Ankara, Turkey, February 2007. Sari M.O. (2006), A New Approach For The Assessment Of Hf Channel Availability Under Ionospheric Disturbances, MS Thesis, Electrical and Electronics Eng., Middle East Technical Univ., Ankara, Turkey, September 2006. Tulunay E., E. M. Warrington, Y. Tulunay, Y. Bahadırlar, A.S. Türk, R. Çaputçu, T. Yapıcı , E.T. Şenalp (2006), Propagation Related Measurements during Three Solar Eclipses in Turkey, IET 10th International Conference on Ionospheric Radio Systems & Techniques, IRST 2006, 18-21 July 2006, London, UK.
NASA Technical Reports Server (NTRS)
Simon, M. K.
1981-01-01
This paper considers the performance of quadrature partial response (QPR) in the presence of jamming. Although a QPR system employs a single sample detector in its receiver, while quadrature amplitude shift keying (or quadrature phase shift keying) requires a matched-filter type of receiver, it is shown that the coherent detection performances of the two in the presence of the intentional jammer have definite similarities.
Device Discovery in Frequency Hopping Wireless Ad Hoc Networks
2004-09-01
10.1. Benchmark scatternet configuration used for outreach compar- ison. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203 10.2. Average...Slave - Slave A B C DE Figure 10.1: Benchmark scatternet configuration used for outreach comparison. Additionally: • All nodes are within range of one...MSTSs ISOM mean = 6.97 MSTSs NISOM mean = 7.21 MSTSs Exponential distribution MSTSs P ic on et A -D p ac ke t g en er at io n ti m e pr ob ab il it y
Scaffold hopping in drug discovery using inductive logic programming.
Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H
2008-05-01
In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.
Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang
2009-02-28
To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. H pylori reference strain 26695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-(3)H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression.
Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea
Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun
2016-01-01
Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293
Schroeder, Krista; Jia, Haomiao; Wang, Y Claire; Smaldone, Arlene
The Healthy Options and Physical Activity Program (HOP) is a school nurse-led intervention for children with severe obesity. HOP was developed by experts at the New York City Department of Health and Mental Hygiene and implemented in New York City schools beginning in 2012. The purpose of this study was to evaluate HOP implementation with the goal of informing HOP refinement and potential future HOP dissemination. This study entailed a retrospective analysis of secondary data. Analytic methods included descriptive statistics, Wilcoxon rank sum and Chi square tests, and multivariate logistic regression. During the 2012-2013 school year, 20,518 children were eligible for HOP. Of these, 1054 (5.1%) were enrolled in the program. On average, enrolled children attended one HOP session during the school year. Parent participation was low (3.2% of HOP sessions). Low nurse workload, low school poverty, higher grade level, higher BMI percentile, and chronic illness diagnosis were associated with student enrollment in HOP. As currently delivered, HOP is not likely to be efficacious. Lessons learned from this evaluation are applicable to future nurse-led obesity interventions. Prior to implementing a school nurse-led obesity intervention, nursing workload and available support must be carefully considered. Interventions should be designed to facilitate (and possibly require) parent involvement. Nurses who deliver obesity interventions may require additional training in obesity treatment. With attention to these lessons learned, evidence-based school nurse-led obesity interventions can be developed. Copyright © 2017 Elsevier Inc. All rights reserved.
Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander
2018-03-17
Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.
Colossal dielectric behavior of semiconducting Sr2TiMnO6 ceramics
NASA Astrophysics Data System (ADS)
Meher, K. R. S. Preethi; Varma, K. B. R.
2009-02-01
Manganitelike double perovskite Sr2TiMnO6 (STMO) ceramics fabricated from the powders synthesized via the solid-state reaction route, exhibited dielectric constants as high as ˜105 in the low frequency range (100 Hz-10 kHz) at room temperature. The Maxwell-Wagner type of relaxation mechanism was found to be more appropriate to rationalize such high dielectric constant values akin to that observed in materials such as KxTiyNi(1-x-y)O and CaCu3Ti4O12. The dielectric measurements carried out on the samples with different thicknesses and electrode materials reflected the influence of extrinsic effects. The impedance studies (100 Hz-10 MHz) in the 180-300 K temperature range revealed the presence of two dielectric relaxations corresponding to the grain boundary and the electrode. The dielectric response of the grain boundary was found to be weakly dependent on the dc bias field (up to 11 V/cm). However, owing to the electrode polarization, the applied ac/dc field had significant effect on the low frequency dielectric response. At low temperatures (100-180 K), the dc conductivity of STMO followed a variable range hopping behavior. Above 180 K, it followed the Arrhenius behavior because of the thermally activated conduction process. The bulk conductivity relaxation owing to the localized hopping of charge carriers obeyed the typical universal dielectric response.
Architecture and design of optical path networks utilizing waveband virtual links
NASA Astrophysics Data System (ADS)
Ito, Yusaku; Mori, Yojiro; Hasegawa, Hiroshi; Sato, Ken-ichi
2016-02-01
We propose a novel optical network architecture that uses waveband virtual links, each of which can carry several optical paths, to directly bridge distant node pairs. Future photonic networks should not only transparently cover extended areas but also expand fiber capacity. However, the traversal of many ROADM nodes impairs the optical signal due to spectrum narrowing. To suppress the degradation, the bandwidth of guard bands needs to be increased, which degrades fiber frequency utilization. Waveband granular switching allows us to apply broader pass-band filtering at ROADMs and to insert sufficient guard bands between wavebands with minimum frequency utilization offset. The scheme resolves the severe spectrum narrowing effect. Moreover, the guard band between optical channels in a waveband can be minimized, which increases the number of paths that can be accommodated per fiber. In the network, wavelength path granular routing is done without utilizing waveband virtual links, and it still suffers from spectrum narrowing. A novel network design algorithm that can bound the spectrum narrowing effect by limiting the number of hops (traversed nodes that need wavelength path level routing) is proposed in this paper. This algorithm dynamically changes the waveband virtual link configuration according to the traffic distribution variation, where optical paths that need many node hops are effectively carried by virtual links. Numerical experiments demonstrate that the number of necessary fibers is reduced by 23% compared with conventional optical path networks.
Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs
Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor
2017-01-01
Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014
Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.
Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor
2017-08-01
Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.
Lürick, Anna; Kuhlee, Anne; Bröcker, Cornelia; Kümmel, Daniel; Raunser, Stefan; Ungermann, Christian
2015-01-01
Membrane fusion at vacuoles requires a consecutive action of the HOPS tethering complex, which is recruited by the Rab GTPase Ypt7, and vacuolar SNAREs to drive membrane fusion. It is assumed that the Sec1/Munc18-like Vps33 within the HOPS complex is largely responsible for SNARE chaperoning. Here, we present direct evidence for HOPS binding to SNAREs and the Habc domain of the Vam3 SNARE protein, which may explain its function during fusion. We show that HOPS interacts strongly with the Vam3 Habc domain, assembled Q-SNAREs, and the R-SNARE Ykt6, but not the Q-SNARE Vti1 or the Vam3 SNARE domain. Electron microscopy combined with Nanogold labeling reveals that the binding sites for vacuolar SNAREs and the Habc domain are located in the large head of the HOPS complex, where Vps16 and Vps33 have been identified before. Competition experiments suggest that HOPS bound to the Habc domain can still interact with assembled Q-SNAREs, whereas Q-SNARE binding prevents recognition of the Habc domain. In agreement, membranes carrying Vam3ΔHabc fuse poorly unless an excess of HOPS is provided. These data suggest that the Habc domain of Vam3 facilitates the assembly of the HOPS/SNARE machinery at fusion sites and thus supports efficient membrane fusion. PMID:25564619
ERIC Educational Resources Information Center
Horton, Akesha Monique
2013-01-01
Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…
"Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture
ERIC Educational Resources Information Center
Callahan, J. Sean; Grantham, Tarek C.
2012-01-01
One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…
HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops
ERIC Educational Resources Information Center
Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.
2008-01-01
Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…
ERIC Educational Resources Information Center
Love, Bettina L.
2016-01-01
Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…
HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention
ERIC Educational Resources Information Center
Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.
2014-01-01
The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…
Advances and Promises of Layered Halide Hybrid Perovskite Semiconductors.
Pedesseau, Laurent; Sapori, Daniel; Traore, Boubacar; Robles, Roberto; Fang, Hong-Hua; Loi, Maria Antonietta; Tsai, Hsinhan; Nie, Wanyi; Blancon, Jean-Christophe; Neukirch, Amanda; Tretiak, Sergei; Mohite, Aditya D; Katan, Claudine; Even, Jacky; Kepenekian, Mikaël
2016-11-22
Layered halide hybrid organic-inorganic perovskites (HOP) have been the subject of intense investigation before the rise of three-dimensional (3D) HOP and their impressive performance in solar cells. Recently, layered HOP have also been proposed as attractive alternatives for photostable solar cells and revisited for light-emitting devices. In this review, we combine classical solid-state physics concepts with simulation tools based on density functional theory to overview the main features of the optoelectronic properties of layered HOP. A detailed comparison between layered and 3D HOP is performed to highlight differences and similarities. In the same way as the cubic phase was established for 3D HOP, here we introduce the tetragonal phase with D 4h symmetry as the reference phase for 2D monolayered HOP. It allows for detailed analysis of the spin-orbit coupling effects and structural transitions with corresponding electronic band folding. We further investigate the effects of octahedral tilting on the band gap, loss of inversion symmetry and possible Rashba effect, quantum confinement, and dielectric confinement related to the organic barrier, up to excitonic properties. Altogether, this paper aims to provide an interpretive and predictive framework for 3D and 2D layered HOP optoelectronic properties.
Technology considerations in EHF Satcom systems
NASA Astrophysics Data System (ADS)
Cuccia, C. L.
The history of mm-wave communications is reviewed briefly and technological requirements for future implementation of mm-wave communications satellites for military and commercial applications are surveyed. The driving force for expanding mm-wave usage is an impending saturation of the GEO arc over North America with C- and Ku-band Satcoms. For military purposes, 44 GHz operations would provide antijamming capabilities and on-board processing. Necessary developments for the mm-wave Satcoms include scanning and multiple beam antennas, low-noise amplifiers, filters which channelize the frequency band, frequency hopping synthesizers, QPSK and MSK modulation systems and improvements in GaAs and indium phosphide ICs. Finally, digital systems are being explored for commercial integrated global data, voice and video systems.
Polaronic conductivity and scaling behavior of lithium iron phosphate glass
NASA Astrophysics Data System (ADS)
Banday, Azeem; Murugavel, Sevi
2018-05-01
Charge transport properties of the Lithium Iron Phosphate (LFP) glass has been investigated in a wide frequency and temperature range by means of broadband dielectric spectroscopy. The conductivity spectra has been studied on the basis of Jonscher power law for characterizing the hopping dynamics of charge carriers. The ac conductivity and scaling behavior of the LFP glass has been studied in the temperature range from 333K to 573K and frequency range from 100 mHz to 1 MHz. The conductivity isotherms of LFP glass do not superimpose upon each other by using Summerfield scaling. The structural peculiarities in the material could result in different conduction pathways giving rise to the deviation from Summerfield scaling.
Dielectric study of chalcogenide (Se80Te20)94Ge6 glass
NASA Astrophysics Data System (ADS)
Sharma, Neha; Patial, Balbir Singh; Thakur, Nagesh
2018-04-01
In the present study, dielectric characteristics specifically dielectric constant (ɛ'), dielectric loss (ɛ″) and AC conductivity (σAC) have been investigated for chalcogenide (Se80Te20)94Ge6 glass in the frequency range from 1Hz to 1MHz and within the temperature range from 300 K to 380 K. ɛ'(ω) and ɛ″(ω) are found to be frequency and temperature dependent. This behaviour is interpreted on the basis of Guintini's theory of dielectric dispersion. The investigated glass obeys the power law ωs (s<1) and decreases as temperature rises. The obtained results are discussed in terms of the correlation barrier hopping (CBH) model proposed by Elliot.
Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E
2015-08-01
Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.
NASA Astrophysics Data System (ADS)
El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.
2014-03-01
The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.
Effect of Impedance Relaxation in Conductance Mechanisms in TiO2/ITO/ZnO:Al/p-Si Heterostructure
NASA Astrophysics Data System (ADS)
Nouiri, M.; El Mir, L.
2018-03-01
The electrical conduction of a TiO2/ITO/ZnO:Al/p-Si structure under alternating-current excitation was investigated in the temperature range of 80 K to 300 K. The frequency dependence of the capacitance and conductance revealed the response of a thermally activated trap characterized by activation energy of about 140 meV. The frequency dependence of the conductance obeyed the universal dynamic response according to the common relation G = Aωs . The temperature dependence of the frequency exponent s illustrates that, in the low frequency range, conduction is governed by the correlated barrier hopping (CBH) mechanism involving two distinct energy levels for all investigated temperatures. For the high frequency region, conduction takes place according to the overlapping large-polaron tunneling mechanism at low temperatures but the CBH mechanism becomes dominant in the high temperature region. This difference in electrical behavior between low and high temperatures can be attributed to the dominance of dielectric relaxation at low compared with high temperatures.
NASA Astrophysics Data System (ADS)
Phelan, Brian R.; Gallagher, Kyle A.; Sherbondy, Kelly D.; Ranney, Kenneth I.; Narayanan, Ram M.
2014-11-01
Under support from the Army Research Laboratory's Partnerships in Research Transition program, a stepped-frequency radar (SFR) is currently under development, which allows for manipulation of the radiated spectrum while still maintaining an effective ultra-wide bandwidth. The SFR is a vehicle-mounted forward-looking ground-penetrating radar designed for high-resolution detection of buried landmines and improvised explosive devices. The SFR can be configured to precisely excise prohibited or interfering frequency bands and also possesses frequency-hopping capabilities. This paper discusses the expected performance features of the SFR as derived from laboratory testing and characterization. Ghosts and artifacts appearing in the range profile arise from gaps in the operating band when the system is configured to omit specific frequencies. An analysis of these effects is discussed and our current solution is presented. Future prospects for the SFR are also discussed, including data collection campaigns at the Army's Adelphi Laboratory Center and the Countermine Test Site.
Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki
2017-01-01
Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types. Conclusion: The single-leg hop tests and isokinetic strength measurements were both useful for a bilateral comparison of knee functional performance and strength. Knee flexion strength deficits and flexion-to-extension ratios seemed to be correlated with single-leg hop test performance. There was no difference in postoperative hop test performance or knee strength according to graft type. PMID:29164167
Romero, Andrea J
2012-01-01
The primary purpose of the current study was to develop, implement, and evaluate a hip hop dance intervention, Latin Active, among low-income Mexican-American adolescents. Mexican-descent adolescents tend to have disproportionate rates of low physical activity, overweight status, and obesity. A 5-week intervention design with pretest and post-test self-report measures. Charter middle school (grades 6-9) health/science classes in a low-income neighborhood were the setting for the Latin Active intervention. Overall, 81 participants were recruited; 73 (n = 41, female; n = 32, male) provided active parental consent to complete pretest/post-test surveys. Intervention . The Latin Active program included 10 interactive 50-minute lessons that were delivered twice a week during science/health classes. The curriculum was created on the basis of Social Cognitive Theory, Critical Hip Hop Pedagogy, and feedback from key stakeholders. The lessons focused on increasing physical activity as well as neighborhood barriers. The self-report pretest (n = 73) and post-test (n = 56) surveys included measures for frequency of vigorous physical activity, self-efficacy, and neighborhood barriers. Analysis . Paired-sample t-test analyses were conducted to assess mean differences from pretest to post-test results for intervention outcomes by gender. The Latin Active program (with 77% retention at post-test) significantly increased vigorous physical activity and dance (p < .05) and increased self-efficacy (p < .05) among girls, and it decreased perception of neighborhood barriers (p < .05) among boys. CONCLUSION . A hip hop physical activity program, Latin Active demonstrated preliminary efficacy to increase girl's vigorous physical activity and boy's perception of neighborhood barriers to physical activity. Future research will need to use a randomized, controlled design and investigate the effect of the program on measures of body mass index.
Steerable Hopping Six-Legged Robot
NASA Technical Reports Server (NTRS)
Younse, Paulo; Aghazarian, Hrand
2010-01-01
The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that indicates the amount by which the spool has been turned. When the robot is ready to hop, the electromagnetic clutch disengages the motor from the spool, thus releasing the cable restraints on the springs and allowing the springs to extend all six legs simultaneously.
Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.
Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J
2006-04-01
A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.
ERIC Educational Resources Information Center
Buchanan, Ian P.
2013-01-01
Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…
Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity
ERIC Educational Resources Information Center
Hill, Marc Lamont
2009-01-01
For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…
Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop
ERIC Educational Resources Information Center
Irby, Decoteau J.; Petchauer, Emery; Kirkland, David
2013-01-01
Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…
ERIC Educational Resources Information Center
Hill, Marc Lamont
2009-01-01
This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…
Redirected charge transport arising from diazonium grafting of carbon coated LiFePO4.
Madec, L; Seid, K A; Badot, J-C; Humbert, B; Moreau, P; Dubrunfaut, O; Lestriez, B; Guyomard, D; Gaubicher, J
2014-11-07
The morphological and the electrical properties of carbon coated LiFePO4 (LFPC) active material functionalized by 4-ethynylbenzene tetrafluoroboratediazonium salt were investigated. For this purpose, FTIR, Raman, XPS, High Resolution Transmission Electron Microscopy (HRTEM) and Broadband Dielectric Spectroscopy (BDS) were considered. Electronic conductivities of LFPC samples at room temperature were found to decrease in a large frequency range upon simple immersion in polar solvents and to decrease further upon functionalization. Due to their high dipole moment, strongly physisorbed molecules detected by XPS likely add barriers to electron hopping. Significant alteration of the carbon coating conductivity was only observed, however, upon functionalization. This effect is most presumably associated with an increase in the sp(3) content determined by Raman spectroscopy, which is a strong indication of the formation of a covalent bond between the organic layer and the carbon coating. In this case, the electron flux appears to be redirected and relayed by short-range (intra chain) and long-range (inter chain) electron transport through molecular oligomers anchored at the LFPC surface. The latter are controlled by tunnelling and slightly activated hopping, which enable higher conductivity at low temperature (T < 250 K). Alteration of the electron transport within the carbon coating also allows detection of a relaxation phenomenon that corresponds to small polaron hopping in bulk LiFePO4. XPS and HRTEM images allow a clear correlation of these findings with the island type oligomeric structure of grafted molecules.
NASA Astrophysics Data System (ADS)
Tahir-Kheli, R. A.
1983-09-01
Vacancy-assisted tracer diffusion in a multicomponent kinetic alloy consisting of xλ N atoms with hopping rate Jλ (where λ≡A, B, C, etc.) and υN vacancies (where υ=1-λxλ) distributed randomly over a regular d-dimensional (where d>=2) hypercubic, or close-packed, lattice of N sites is analyzed through a self-consistent renormalization of a recent theory of Tahir-Kheli and Elliott combined with a generalization of concepts introduced by Manning. The result for the tracer-diffusion correlation factor is the following: ftr=H''(tr)[H''(tr)+2J0], where J0 is the tracer-hopping rate, H''(tr) is a generalized effective vacancy escape frequency, H''(tr)=[M(1-υ)[J0υftr+Jeff], where Jeff is an effective hopping rate of the background atoms averaged with a weighting factor proportional to xλ and fλ, i.e., Jeff=λ(Jλxλfλ)λ(xλfλ) and M=-(1+<θ>)<θ>. For a single-component alloy, with particle concentration x, Jλ=J, and vacancy concentration υ=1-x our theory provides an excellent overall description of the correlation factor as long as JJ0>~z-2. Indeed, even for J-->0, the calculated results agree with the Monte Carlo estimates, except in the immediate vicinity of the percolation threshold, υp, which is located self-consistently to an accuracy of the order 1z.
Variability metrics in Josephson Junction fabrication for Quantum Computing circuits
NASA Astrophysics Data System (ADS)
Rosenblatt, Sami; Hertzberg, Jared; Brink, Markus; Chow, Jerry; Gambetta, Jay; Leng, Zhaoqi; Houck, Andrew; Nelson, J. J.; Plourde, Britton; Wu, Xian; Lake, Russell; Shainline, Jeff; Pappas, David; Patel, Umeshkumar; McDermott, Robert
Multi-qubit gates depend on the relative frequencies of the qubits. To reliably build multi-qubit devices therefore requires careful fabrication of Josephson junctions in order to precisely set their critical currents. The Ambegaokar-Baratoff relation between tunnel conductance and critical current implies a correlation between qubit frequency spread and tunnel junction resistance spread. Here we discuss measurement of large numbers of tunnel junctions to assess these resistance spreads, which can exceed 5% of mean resistance. With the goal of minimizing these spreads, we investigate process parameters such as lithographic junction area, evaporation and masking scheme, oxidation conditions, and substrate choice, as well as test environment, design and setup. In addition, trends of junction resistance with temperature are compared with theoretical models for further insights into process and test variability.
Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L
2018-03-30
Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.
Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang
2009-01-01
AIM: To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. METHODS: H pylori reference strain 26 695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-3H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26 695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. RESULTS: The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. CONCLUSION: Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression. PMID:19248190
Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip
Nelson, Gregory M.; Huffman, Holly; Smith, David F.
2003-01-01
Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function. PMID:14627198
Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.
Nelson, Gregory M; Huffman, Holly; Smith, David F
2003-01-01
Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.
Suzuki, Takahiro; Fujibayashi, Misato; Hataya, Tatsuji; Taneda, Akito; He, Ying-Hong; Tsushima, Taro; Duraisamy, Ganesh Selvaraj; Siglová, Kristyna; Matoušek, Jaroslav; Sano, Teruo
2017-03-01
Apple fruit crinkle viroid (AFCVd) is a tentative member of the genus Apscaviroid, family Pospiviroidae. AFCVd has a narrow host range and is known to infect apple, hop and persimmon as natural hosts. In this study, tomato, cucumber and wild hop have been identified as new experimental herbaceous hosts. Foliar symptoms were very mild or virtually undetectable, but fruits of infected tomato were small, cracked and distorted. These symptoms resemble those observed on some AFCVd-sensitive apple cultivars. After transfer to tomato, cucumber and wild hop, sequence changes were detected in a natural AFCVd isolate from hop, and major variants in tomato, cucumber and wild hop differed in 10, 8 or 2 nucleotides, respectively, from the predominant one in the inoculum. The major variants in tomato and cucumber were almost identical, and the one in wild hop was very similar to the one in cultivated hop. Detailed analyses of the host-dependent sequence changes that appear in a naturally occurring AFCVd isolate from hop after transfer to tomato using small RNA deep sequence data and infectivity studies with dimeric RNA transcripts followed by progeny analysis indicate that the major AFCVd variant in tomato emerged by selection of a minor variant present in the inoculum (i.e. hop) followed by one to two host-dependent de novo mutations. Comparison of the secondary structures of major variants in hop, tomato and persimmon after transfer to tomato suggested that maintenance of stem-loop structures in the left-hand half of the molecule is critical for infection.
Orthogonal Multi-Carrier DS-CDMA with Frequency-Domain Equalization
NASA Astrophysics Data System (ADS)
Tanaka, Ken; Tomeba, Hiromichi; Adachi, Fumiyuki
Orthogonal multi-carrier direct sequence code division multiple access (orthogonal MC DS-CDMA) is a combination of orthogonal frequency division multiplexing (OFDM) and time-domain spreading, while multi-carrier code division multiple access (MC-CDMA) is a combination of OFDM and frequency-domain spreading. In MC-CDMA, a good bit error rate (BER) performance can be achieved by using frequency-domain equalization (FDE), since the frequency diversity gain is obtained. On the other hand, the conventional orthogonal MC DS-CDMA fails to achieve any frequency diversity gain. In this paper, we propose a new orthogonal MC DS-CDMA that can obtain the frequency diversity gain by applying FDE. The conditional BER analysis is presented. The theoretical average BER performance in a frequency-selective Rayleigh fading channel is evaluated by the Monte-Carlo numerical computation method using the derived conditional BER and is confirmed by computer simulation of the orthogonal MC DS-CDMA signal transmission.
Longitudinal spread of mechanical excitation through tectorial membrane traveling waves
Sellon, Jonathan B.; Farrahi, Shirin; Ghaffari, Roozbeh; Freeman, Dennis M.
2015-01-01
The mammalian inner ear separates sounds by their frequency content, and this separation underlies important properties of human hearing, including our ability to understand speech in noisy environments. Studies of genetic disorders of hearing have demonstrated a link between frequency selectivity and wave properties of the tectorial membrane (TM). To understand these wave properties better, we developed chemical manipulations that systematically and reversibly alter TM stiffness and viscosity. Using microfabricated shear probes, we show that (i) reducing pH reduces TM stiffness with little change in TM viscosity and (ii) adding PEG increases TM viscosity with little change in TM stiffness. By applying these manipulations in measurements of TM waves, we show that TM wave speed is determined primarily by stiffness at low frequencies and by viscosity at high frequencies. Both TM viscosity and stiffness affect the longitudinal spread of mechanical excitation through the TM over a broad range of frequencies. Increasing TM viscosity or decreasing stiffness reduces longitudinal spread of mechanical excitation, thereby coupling a smaller range of best frequencies and sharpening tuning. In contrast, increasing viscous loss or decreasing stiffness would tend to broaden tuning in resonance-based TM models. Thus, TM wave and resonance mechanisms are fundamentally different in the way they control frequency selectivity. PMID:26438861
Hopper on wheels: evolving the hopping robot concept
NASA Technical Reports Server (NTRS)
Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.
2001-01-01
This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.
2018-01-01
As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation. PMID:29329248
van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques
2015-01-01
Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail in yeast where their sequential membrane targeting and assembly is well understood. Mammalian CORVET and HOPS subunits significantly differ from their yeast homologues, and novel proteins with high homology to CORVET/HOPS subunits have evolved. However, an analysis of the molecular interactions between these subunits in mammals is lacking. Here, we provide a detailed analysis of interactions within the mammalian CORVET and HOPS as well as an additional endosomal-targeting complex (VIPAS39-VPS33B) that does not exist in yeast. We show that core interactions within CORVET and HOPS are largely conserved but that the membrane-targeting module in HOPS has significantly changed to accommodate binding to mammalian-specific RAB7 interacting lysosomal protein (RILP). Arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome-associated mutations in VPS33B selectively disrupt recruitment to late endosomes by RILP or binding to its partner VIPAS39. Within the shared core of CORVET/HOPS, we find that VPS11 acts as a molecular switch that binds either CORVET-specific TGFBRAP1 or HOPS-specific VPS39/RILP thereby allowing selective targeting of these tethering complexes to early or late endosomes to time fusion events in the endo/lysosomal pathway. PMID:26463206
Jung, Haejoon; Lee, In-Ho
2018-01-12
As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.
Interaction of alcoholic extracts of hops with cocaine and paracetamol in mice.
Horvat, Olga; Raskovic, Aleksandar; Jakovljevic, Vida; Sabo, Jan; Berenji, Janos
2007-01-01
This work describes a study of the interaction in the mouse model of alcoholic extracts of hops of Magnum, Aroma and wild genotypes with drugs that have excitatory effect on the cerebral cortex (cocaine) and analgesic action (paracetamol). Hop drying and preparation of the extracts were carried out according to standard pharmacological procedures for preparing total alcoholic extracts of dry herbs, consisting of one part of dry drug and two parts of 70% alcohol. The mice received four doses i.p. of 0.5% aqueous solutions of the above-mentioned extracts (10 ml/kg) 24, 16, 4 and 0.5 h prior to receiving cocaine (25 mg/kg) or paracetamol (80 mg/kg). The parameter investigated was the change in spontaneous motility of mice after combined treatment with the extracts and cocaine/paracetamol compared to control animals that received the same dose of the drug after treatment with physiological solution. Only the ethanolic extract of Magnum hops increased the spontaneous motility of mice, while none of the extracts showed analgesic action as measured by the hot-plate method. In the interaction with cocaine, the extract of Magnum hops suppressed almost completely the action of cocaine compared to controls. Extracts of the other hops also decreased the cocaine-induced locomotor activity of mice, but to a lesser extent. Hop extracts exhibited a significant pharmacological interaction with paracetamol, with the most pronounced increase in analgesic action being found for the ethanolic extract of Aroma hops and the tert-butanolic extract of wild hops.
Dielectric and relaxation properties of poly(o-anisidine)/graphene nanocomposite
NASA Astrophysics Data System (ADS)
Sangamithirai, D.; Narayanan, V.; Stephen, A.
2016-05-01
Poly(o-anisidine)/graphene (POA/GR) nanocomposite was synthesized via chemical oxidative polymerization of o-anisidine in the presence of graphene sheets in acidic medium. The electrical properties of the nanocomposite are studied using AC impedance spectroscopic technique. It has been found that the room temperature electrical conductivity value enhanced from 1.28 × 10-6 S cm-1 to 4.47 × 10-4 S cm-1 on addition of 10 wt % of graphene into the polymer. An analysis of real and imaginary parts of dielectric permittivity reveals that both ɛ` and ɛ״ increases with the decrease of frequency at all temperature levels. Frequency dependence of dielectric loss (tan δ) spectrum indicates that hopping frequency increases with temperature and the relaxation time decreases from 2.67 × 10-5 to 7.28 × 10-6 sec.
ERIC Educational Resources Information Center
Söderman, Johan; Sernhede, Ove
2016-01-01
Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…
Fischer, Gary J [Albuquerque, NM
2010-08-17
The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.
Liu, Zechang; Wang, Liping; Liu, Yumei
2018-01-18
Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
NASA Technical Reports Server (NTRS)
Beyon, Jeffrey Y.; Ng, Tak-Kwong; Davis, Mitchell J.; Adams, James K.; Bowen, Stephen C.; Fay, James J.; Hutchinson, Mark A.
2015-01-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program since April, 2012. The HOPS team recently completed two flight campaigns during the summer of 2014 on two different aircrafts with two different science instruments. The first flight campaign was in July, 2014 based at NASA Langley Research Center (LaRC) in Hampton, VA on the NASA's HU-25 aircraft. The science instrument that flew with HOPS was Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) CarbonHawk Experiment Simulator (ACES) funded by NASA's Instrument Incubator Program (IIP). The second campaign was in August, 2014 based at NASA Armstrong Flight Research Center (AFRC) in Palmdale, CA on the NASA's DC-8 aircraft. HOPS flew with the Multifunctional Fiber Laser Lidar (MFLL) instrument developed by Excelis Inc. The goal of the campaigns was to perform an end-to-end demonstration of the capabilities of the HOPS prototype system (HOPS COTS) while running the most computationally intensive part of the ASCENDS algorithm real-time on-board. The comparison of the two flight campaigns and the results of the functionality tests of the HOPS COTS are presented in this paper.
Karam, Joseph A; Parikh, Rasesh Y; Nayak, Dhananjaya; Rosenkranz, David; Gangaraju, Vamsi K
2017-04-14
Piwi-interacting RNAs (piRNAs) are 26-30-nucleotide germ line-specific small non-coding RNAs that have evolutionarily conserved function in mobile genetic element (transposons) silencing and maintenance of genome integrity. Drosophila Hsp70/90-organizing protein homolog (Hop), a co-chaperone, interacts with piRNA-binding protein Piwi and mediates silencing of phenotypic variations. However, it is not known whether Hop has a direct role in piRNA biogenesis and transposon silencing. Here, we show that knockdown of Hop in the germ line nurse cells (GLKD) of Drosophila ovaries leads to activation of transposons. Hop GLKD females can lay eggs at the same rate as wild-type counterparts, but the eggs do not hatch into larvae. Hop GLKD leads to the accumulation of γ-H2Av foci in the germ line, indicating increased DNA damage in the ovary. We also show that Hop GLKD-induced transposon up-regulation is due to inefficient piRNA biogenesis. Based on these results, we conclude that Hop is a critical component of the piRNA pathway and that it maintains genome integrity by silencing transposons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Tripathi, Pankaj; Anuradha, S; Ghosal, Gargi; Muniyappa, K
2006-12-08
Saccharomyces cerevisiae HOP1, which encodes a component of synaptonemal complex (SC), plays an important role in both gene conversion and crossing over between homologs, as well as enforces meiotic recombination checkpoint control over the progression of recombination intermediates. In hop1Delta mutants, meiosis-specific double-strand breaks (DSBs) are reduced to 10% of the wild-type level, and at aberrantly late times, these DSBs are processed into inter-sister recombination intermediates. However, the underlying mechanism by which Hop1 protein regulates these nuclear events remains obscure. Here we show that Hop1 protein interacts selectively with the Holliday junction, changes its global conformation and blocks the dissolution of the junction by a RecQ helicase. The Holliday junction-Hop1 protein complexes are significantly more stable at higher ionic strengths and molar excess of unlabeled competitor DNA than complexes containing other recombination intermediates. Structural analysis of the Holliday junction using 2-aminopurine fluorescence emission, DNase I footprinting and KMnO4 probing provide compelling evidence that Hop1 protein binding induces significant distortion at the center of the Holliday junction. We propose that Hop1 protein might coordinate the physical monitoring of meiotic recombination intermediates with the process of branch migration of Holliday junction.
He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny
2005-01-01
Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xavier, Patrick Gordon; Feddema, John Todd; Little, Charles Quentin
2010-03-01
Hopping robots provide the possibility of breaking the link between the size of a ground vehicle and the largest obstacle that it can overcome. For more than a decade, DARPA and Sandia National Laboratories have been developing small-scale hopping robot technology, first as part of purely hopping platforms and, more recently, as part of platforms that are capable of both wheeled and hopping locomotion. In this paper we introduce the Urban Hopper robot and summarize its capabilities. The advantages of hopping for overcoming certain obstacles are discussed. Several configurations of the Urban Hopper are described, as are intelligent capabilities ofmore » the system. Key challenges are discussed.« less
NASA Technical Reports Server (NTRS)
Venosa, Elettra; Vermeire, Bert; Alakija, Cameron; Harris, Fred; Strobel, David; Sheehe, Charles J.; Krunz, Marwan
2017-01-01
In the last few years, radio technologies for unmanned aircraft vehicle (UAV) have advanced very rapidly. The increasing need to fly unmanned aircraft systems (UAS) in the national airspace system (NAS) to perform missions of vital importance to national security, defense, and science has pushed ahead the design and implementation of new radio platforms. However, a lot still has to be done to improve those radios in terms of performance and capabilities. In addition, an important aspect to account for is hardware cost and the feasibility to implement these radios using commercial off-the-shelf (COTS) components. UAV radios come with numerous technical challenges and their development involves contributions at different levels of the design. Cognitive algorithms need to be developed in order to perform agile communications using appropriate frequency allocation while maintaining safe and efficient operations in the NAS and, digital reconfigurable architectures have to be designed in order to ensure a prompt response to environmental changes. Command and control (C2) communications have to be preserved during "standard" operations while crew operations have to be minimized. It is clear that UAV radios have to be software-defined systems, where size, weight and power consumption (SWaP) are critical parameters. This paper provides preliminary results of the efforts performed to design a fully digital radio architecture as part of a NASA Phase I STTR. In this paper, we will explain the basic idea and technical principles behind our dynamic/adaptive frequency hopping radio for UAVs. We will present our Simulink model of the dynamic FH radio transmitter design for UAV communications and show simulation results and FPGA system analysis.
An Efficient Next Hop Selection Algorithm for Multi-Hop Body Area Networks
Ayatollahitafti, Vahid; Ngadi, Md Asri; Mohamad Sharif, Johan bin; Abdullahi, Mohammed
2016-01-01
Body Area Networks (BANs) consist of various sensors which gather patient’s vital signs and deliver them to doctors. One of the most significant challenges faced, is the design of an energy-efficient next hop selection algorithm to satisfy Quality of Service (QoS) requirements for different healthcare applications. In this paper, a novel efficient next hop selection algorithm is proposed in multi-hop BANs. This algorithm uses the minimum hop count and a link cost function jointly in each node to choose the best next hop node. The link cost function includes the residual energy, free buffer size, and the link reliability of the neighboring nodes, which is used to balance the energy consumption and to satisfy QoS requirements in terms of end to end delay and reliability. Extensive simulation experiments were performed to evaluate the efficiency of the proposed algorithm using the NS-2 simulator. Simulation results show that our proposed algorithm provides significant improvement in terms of energy consumption, number of packets forwarded, end to end delay and packet delivery ratio compared to the existing routing protocol. PMID:26771586
Signaling induced by hop/STI-1 depends on endocytosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael
The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP{sup C}), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP{sup C} and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling inducedmore » by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP{sup C} by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases.« less
FDMA/TDM satellite communication systems for domestic/business services
NASA Astrophysics Data System (ADS)
Perrotta, G.; Losquadro, G.; Giubilei, R.
A design concept is presented for a Ka-band satellite communication system for domestic business applications, based on FDMA uplinks and time-domain-multiplexed (TDM) downlinks. The single-hop modular-design regenerative/processing repeaters employed are capable of handling up to 16 2-Mb/s uplink carriers each. The internal (short-block) and external (Reed-Solomon) coding techniques, frequency relations and symbol synchronization, and optional mini-TDMA implementation are explained, and the results of numerical simulations of subcomponent performance are presented graphically.
The Diversity ECCM Performance of Frequency-Hopping CPFSK in Partial- Band Noise Jamming
1988-05-25
TELEPHONE (Inc€ude Art Code) 22c. OFFICE SYMBOL 1 ar .anoer (919) 549-0641 ARO: EL-S D FORM 1473.6 4 MAR 83 APR edition may be used until exhausted...ASSOCIATES, INC. TABLE OF CONTENTS Page 1.0 INTRODUCTION ...... .... ......................... 1 1.1 BACKGROUND ...... ......................... I 1.2...andJ/or Dit Special t -. V 1 atI J. S. LEE ASSOCIATES, INC. -S TABLE OF CONTENTS (Cont.) . - Page 2.2 ERROR PROBA3ILITY FORMULATION .5
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gallego-Marcos, Fernando; Sánchez, Rafael; Platero, Gloria
We analyze long-range transport through an ac driven triple quantum dot with a single electron. Resonant transitions between separated and detuned dots are mediated by the exchange of n photons with the time-dependent field. An effective model is proposed in terms of second order (cotunneling) processes which dominate the long-range transport between the edge quantum dots. The ac field renormalizes the inter dot hopping, modifying the level hybridization. It results in a non-trivial behavior of the current with the frequency and amplitude of the external ac field.
2009-10-09
trains the coefficients c of a finite impulse response (FIR) filter by gradient descent. The coefficients at iteration k + 1 are computed with the update... absorption . Figure 9 shows the reflection loss as a function of grazing angle for this bottom model. Note that below 30◦ this bottom model predicts...less than 1 dB loss per ray bounce. 11 Figure 9: Jackson bottom reflection loss for sand at 15 kHz Absorption Loss The absorption loss in the medium was
NASA Astrophysics Data System (ADS)
Wu, Jheng-Syong; Chung, Yung-Chin; Chien, Jun-Jei; Chou, Chien
2018-01-01
A two-frequency laser scanning confocal fluorescence microscope (TF-LSCFM) based on intensity modulated fluorescence signal detection was proposed. The specimen-induced spherical aberration and scattering effect were suppressed intrinsically, and high image contrast was presented due to heterodyne interference. An improved axial point spread function in a TF-LSCFM compared with a conventional laser scanning confocal fluorescence microscope was demonstrated and discussed.
Asynchronous glimpsing of speech: Spread of masking and task set-size
Ozmeral, Erol J.; Buss, Emily; Hall, Joseph W.
2012-01-01
Howard-Jones and Rosen [(1993). J. Acoust. Soc. Am. 93, 2915–2922] investigated the ability to integrate glimpses of speech that are separated in time and frequency using a “checkerboard” masker, with asynchronous amplitude modulation (AM) across frequency. Asynchronous glimpsing was demonstrated only for spectrally wide frequency bands. It is possible that the reduced evidence of spectro-temporal integration with narrower bands was due to spread of masking at the periphery. The present study tested this hypothesis with a dichotic condition, in which the even- and odd-numbered bands of the target speech and asynchronous AM masker were presented to opposite ears, minimizing the deleterious effects of masking spread. For closed-set consonant recognition, thresholds were 5.1–8.5 dB better for dichotic than for monotic asynchronous AM conditions. Results were similar for closed-set word recognition, but for open-set word recognition the benefit of dichotic presentation was more modest and level dependent, consistent with the effects of spread of masking being level dependent. There was greater evidence of asynchronous glimpsing in the open-set than closed-set tasks. Presenting stimuli dichotically supported asynchronous glimpsing with narrower frequency bands than previously shown, though the magnitude of glimpsing was reduced for narrower bandwidths even in some dichotic conditions. PMID:22894234
Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn
2012-01-01
Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749
Influence of Ag, Cd or Pb Addition on Electrical and Dielectric Properties of Bulk Glassy Se-Ge
NASA Astrophysics Data System (ADS)
El-Metwally, E. G.; Shakra, A. M.
2018-05-01
Bulk glassy samples of Se0.7Ge0.3 and Se0.7Ge0.25 X 0.05 (X = Ag, Cd or Pb) chalcogenide glass have been prepared by melt-quenching method. The studied compositions were examined in powder form by x-ray diffraction analysis. The direct-current (dc) conductivity σ_{{dc}} was measured for bulk samples in the temperature range from 303 K to 433 K, revealing enhancement with temperature for all samples. The results indicate two values of activation energy ( Δ E_{{σ1 }} and Δ E_{{σ2 }} ) due to two conduction mechanisms. Measurements of the alternating-current (ac) conductivity σ_{{ac}} ( ω ) and dielectric properties for bulk samples were carried out in the temperature range from 303 K to 433 K and frequency range from 1 kHz to 1 MHz. The ac conductivity σ_{{ac}} ( ω ) was temperature dependent and proportional to ωS , where S is the frequency exponent, which reduced with rising temperature, and ω is the angular frequency. These results are discussed based on a correlated barrier hopping model. The calculated values of the maximum height of the barrier W_{{M}} for each composition are consistent with carrier hopping over a potential barrier. The density of localized states N( {E_{{F}} } ) at the Fermi level lay in the range from 1019 eV-1 cm-3 to 1020 eV-1 cm-3, and increased with temperature. The dielectric constant ɛ1 ( ω ) and loss ɛ2 ( ω ) increased with temperature but decreased with frequency. The values of σ_{{dc}} , σ_{{ac}} ( ω ) , ɛ1 ( ω ) , and ɛ2 ( ω ) increased with temperature and with addition of Ag, Cd or Pb. The observed increase was greater for Se0.7Ge0.25Pb0.05 than for Se0.7Ge0.25Cd0.05, which was greater than for Se0.7Ge0.25Ag0.05.
Homothallism in Pseudoperonospora humuli
USDA-ARS?s Scientific Manuscript database
The hop downy mildew pathogen, Pseudoperonospora humuli, forms oospores abundantly in diseased hop tissue. Diverse monosporangial isolates of P. humuli collected from Japan, Germany, and five states in the USA readily formed oospores within hop leaves when inoculated singly, suggesting homothallism....
ERIC Educational Resources Information Center
Craig, Todd
2015-01-01
Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…
ERIC Educational Resources Information Center
Gangloff-Bailey, Felicia
2017-01-01
The influence of hip hop culture and music on African-American youth is profound and can be used as a tool to shape positive outcomes in education. Hip hop has been used effectively in the classroom to engage students and enhance their critical thinking (Gangloff-Bailey & Freeman, 2014). In addition, hip hop has been described as a socializer…
NASA Astrophysics Data System (ADS)
Calderon, Francisco M.
1993-03-01
One hundred twenty-two workers (sixteen from a coke production plant and 106 from a graphite electrode manufacturing plant) agreed to participate in this study evaluating the relationship between exposure to polycyclic aromatic hydrocarbons (PAHs) and urinary excretion of 1-hydroxypyrene (1-HOP), the main metabolite of pyrene. The results show that the concentration of pyrene in air is highly correlated with total PAHs (r equals 0.83, P < 0.0001). The correlation coefficient between pyrene in air and 1-HOP is (r equals 0.69, P < 0.0001) and between 1-HOP and total PAHs is (r equals 0.77, P < 0.0001). The biological half life of the 1-HOP was determined (18 hrs) and the noninterference of smoking habits in relation to 1-HOP urinary excretion was established, concluding that 1-HOP is a suitable bioindicator of the occupational exposure to PAHs.
Vortex variable range hopping in a conventional superconducting film
NASA Astrophysics Data System (ADS)
Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.
2017-12-01
The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.
Structural studies on the co-chaperone Hop and its complexes with Hsp90.
Onuoha, S C; Coulstock, E T; Grossmann, J G; Jackson, S E
2008-06-13
The tetratricopeptide repeat domain (TPR)-containing co-chaperone Hsp-organising protein (Hop) plays a critical role in mediating interactions between Heat Shock Protein (Hsp)70 and Hsp90 as part of the cellular assembly machine. It also modulates the ATPase activity of both Hsp70 and Hsp90, thus facilitating client protein transfer between the two. Despite structural work on the individual domains of Hop, no structure for the full-length protein exists, nor is it clear exactly how Hop interacts with Hsp90, although it is known that its primary binding site is the C-terminal MEEVD motif. Here, we have undertaken a biophysical analysis of the structure and binding of Hop to Hsp90 using a variety of truncation mutants of both Hop and Hsp90, in addition to mutants of Hsp90 that are thought to modulate the conformation, in particular the N-terminal dimerisation of the chaperone. The results establish that whilst the primary binding site of Hop is the C-terminal MEEVD peptide of Hsp90, binding also occurs at additional sites in the C-terminal and middle domain. In contrast, we show that another TPR-containing co-chaperone, CyP40, binds solely to the C-terminus of Hsp90. Truncation mutants of Hop were generated and used to investigate the dimerisation interface of the protein. In good agreement with recently published data, we find that the TPR2a domain that contains the Hsp90-binding site is also the primary site for dimerisation. However, our results suggest that residues within the TPR2b may play a role. Together, these data along with shape reconstruction analysis from small-angle X-ray scattering measurements are used to generate a solution structure for full-length Hop, which we show has an overall butterfly-like quaternary structure. Studies on the nucleotide dependence of Hop binding to Hsp90 establish that Hop binds to the nucleotide-free, 'open' state of Hsp90. However, the Hsp90-Hop complex is weakened by the conformational changes that occur in Hsp90 upon ATP binding. Together, the data are used to propose a detailed model of how Hop may help present the client protein to Hsp90 by aligning the bound client on Hsp70 with the middle domain of Hsp90. It is likely that Hop binds to both monomers of Hsp90 in the form of a clamp, interacting with residues in the middle domain of Hsp90, thus preventing ATP hydrolysis, possibly by the prevention of association of N-terminal and middle domains in individual Hsp90 monomers.
Ho, Ruoya; Stroupe, Christopher
2016-10-01
Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Knee Joint Loading during Single-Leg Forward Hopping.
Krupenevich, Rebecca L; Pruziner, Alison L; Miller, Ross H
2017-02-01
Increased or abnormal loading on the intact limb is thought to contribute to the relatively high risk of knee osteoarthritis in this limb for individuals with unilateral lower limb loss. This theory has been assessed previously by studying walking, but knee joint loading during walking is often similar between individuals with and without limb loss, prompting assessment of other movements that may place unusual loads on the knee. One such movement, hopping, is a form of locomotion that individuals with unilateral lower limb loss may situationally use instead of walking, but the mechanical effects of hopping on the intact limb are unknown. Compare knee joint kinetics of healthy adults during single-leg forward hopping compared to walking, a more traditional form of locomotion. Twenty-four healthy adults walked and hopped at self-selected speeds of 1.5 and 2.3 m·s, respectively. Joint moments were calculated using inverse dynamics. A paired Student's t-test was utilized to compare peak, impulse, and loading rate (LR) of knee adduction moment (KAM), and peak knee flexion moment (KFM) between walking and hopping. Peak KFM and KAM LR were greater during hopping compared to walking (peak KFM: 20.73% vs 5.51% body weight (BW) × height (Ht), P < 0.001; KAM LR: 0.47 vs. 0.33 BW·Ht·s, P = 0.01). Kinetic measures affecting knee joint loading are greater in hopping compared to walking. It may be advisable to limit single-leg forward hopping in the limb loss population until it is known if these loads increase knee osteoarthritis risk.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biddle, J.; Priour, D. J. Jr.; Wang, B.
We study the quantum localization phenomena of noninteracting particles in one-dimensional lattices based on tight-binding models with various forms of hopping terms beyond the nearest neighbor, which are generalizations of the famous Aubry-Andre and noninteracting Anderson models. For the case with deterministic disordered potential induced by a secondary incommensurate lattice (i.e., the Aubry-Andre model), we identify a class of self-dual models, for which the boundary between localized and extended eigenstates are determined analytically by employing a generalized Aubry-Andre transformation. We also numerically investigate the localization properties of nondual models with next-nearest-neighbor hopping, Gaussian, and power-law decay hopping terms. We findmore » that even for these nondual models, the numerically obtained mobility edges can be well approximated by the analytically obtained condition for localization transition in the self-dual models, as long as the decay of the hopping rate with respect to distance is sufficiently fast. For the disordered potential with genuinely random character, we examine scenarios with next-nearest-neighbor hopping, exponential, Gaussian, and power-law decay hopping terms numerically. We find that the higher-order hopping terms can remove the symmetry in the localization length about the energy band center compared to the Anderson model. Furthermore, our results demonstrate that for the power-law decay case, there exists a critical exponent below which mobility edges can be found. Our theoretical results could, in principle, be directly tested in shallow atomic optical lattice systems enabling non-nearest-neighbor hopping.« less
Mid-latitude spread- F structure
NASA Astrophysics Data System (ADS)
From, W. R.; Meehan, D. H.
1988-07-01
Spread- F has been observed at frequencies of 1.98, 3.84 and 5.80 MHz and multiple angles of arrival have been resolved using an HF radar near Brisbane (27°S, 153°E). The spreading of the ionogram trace has been shown to be due to a spread in angles of arrival of echoes, rather than any 'vertical' spreading. The reflection process appears to involve total specular reflection rather than scattering. The previously reported very strong bias for angles of arrival from the north-west at Brisbane is supported. The direction of movement of the reflection points is not radial and therefore, the structure cannot be purely frontal with purely linear movement, as is often supposed. The velocities are much less than for coexisting travelling ionospheric disturbances. The variations of angle of arrival, range and rate of change of range with frequency do not fit previously proposed ideas of the plasma distribution and an alternative is suggested in which the distortions of the isoionic surfaces resemble small, elongated, asymmetrical 'hills' or 'dips'.
Widely Tunable Mode-Hop-Free External-Cavity Quantum Cascade Laser
NASA Technical Reports Server (NTRS)
Wysocki, Gerard; Curl, Robert F.; Tittel, Frank K.
2010-01-01
The external-cavity quantum cascade laser (EC-QCL) system is based on an optical configuration of the Littrow type. It is a room-temperature, continuous wave, widely tunable, mode-hop-free, mid-infrared, EC-QCL spectroscopic source. It has a single-mode tuning range of 155 cm(exp -1) (approximately equal to 8% of the center wavelength) with a maximum power of 11.1 mW and 182 cm(exp -1) (approximately equal to 15% of the center wavelength), and a maximum power of 50 mW as demonstrated for 5.3 micron and 8.4 micron EC-QCLs, respectively. This technology is particularly suitable for high-resolution spectroscopic applications, multi-species tracegas detection, and spectroscopic measurements of broadband absorbers. Wavelength tuning of EC-QCL spectroscopic source can be implemented by varying three independent parameters of the laser: (1) the optical length of the gain medium (which, in this case, is equivalent to QCL injection current modulation), (2) the length of the EC (which can be independently varied in the Rice EC-QCL setup), and (3) the angle of beam incidence at the diffraction grating (frequency tuning related directly to angular dispersion of the grating). All three mechanisms of frequency tuning have been demonstrated and are required to obtain a true mode-hop-free laser frequency tuning. The precise frequency tuning characteristics of the EC-QCL output have been characterized using a variety of diagnostic tools available at Rice University (e.g., a monochromator, FTIR spectrometer, and a Fabry-Perot spectrometer). Spectroscopic results were compared with available databases (such as HITRAN, PNNL, EPA, and NIST). These enable precision verification of complete spectral parameters of the EC-QCL, such as wavelength, tuning range, tuning characteristics, and line width. The output power of the EC-QCL is determined by the performance of the QC laser chip, its operating conditions, and parameters of the QC laser cavity such as mirror reflectivity or intracavity losses. In order to maximize the output power, an analysis and optimization of the EC laser parameters has been performed. The parameters of the beam emitted from the gain medium, such as divergence angle, beam profile, and astigmatism, have been investigated. The gain medium has been fully characterized before and after each stage of modification. The main modification steps are coating one facet of the gain chip with a high reflectivity mirror and the other facet with an anti-reflection layer. Then the chip is mounted in the EC-QCL. The optomechanical design has been reviewed and improved to provide for precise collimation of the strongly divergent beam of the QCL and the tuning diffraction grating.
Beer spoilage bacteria and hop resistance.
Sakamoto, Kanta; Konings, Wil N
2003-12-31
For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However, some potential hop-resistant strains cannot grow in beer unless they have first been exposed to subinhibitory concentration of hop compounds. The beer spoilage ability of Pectinatus spp. and M. cerevisiae has been poorly studied. Since all the strains have been reported to be capable of beer spoiling, species identification is sufficient for the breweries. However, with the current trend of beer flavor (lower alcohol and bitterness), there is the potential risk that not yet reported bacteria will contribute to beer spoilage. Investigation of the beer spoilage ability of especially Gram-negative bacteria may be useful to reduce this risk.
Electrical stimulation of the midbrain excites the auditory cortex asymmetrically.
Quass, Gunnar Lennart; Kurt, Simone; Hildebrandt, Jannis; Kral, Andrej
2018-05-17
Auditory midbrain implant users cannot achieve open speech perception and have limited frequency resolution. It remains unclear whether the spread of excitation contributes to this issue and how much it can be compensated by current-focusing, which is an effective approach in cochlear implants. The present study examined the spread of excitation in the cortex elicited by electric midbrain stimulation. We further tested whether current-focusing via bipolar and tripolar stimulation is effective with electric midbrain stimulation and whether these modes hold any advantage over monopolar stimulation also in conditions when the stimulation electrodes are in direct contact with the target tissue. Using penetrating multielectrode arrays, we recorded cortical population responses to single pulse electric midbrain stimulation in 10 ketamine/xylazine anesthetized mice. We compared monopolar, bipolar, and tripolar stimulation configurations with regard to the spread of excitation and the characteristic frequency difference between the stimulation/recording electrodes. The cortical responses were distributed asymmetrically around the characteristic frequency of the stimulated midbrain region with a strong activation in regions tuned up to one octave higher. We found no significant differences between monopolar, bipolar, and tripolar stimulation in threshold, evoked firing rate, or dynamic range. The cortical responses to electric midbrain stimulation are biased towards higher tonotopic frequencies. Current-focusing is not effective in direct contact electrical stimulation. Electrode maps should account for the asymmetrical spread of excitation when fitting auditory midbrain implants by shifting the frequency-bands downward and stimulating as dorsally as possible. Copyright © 2018 Elsevier Inc. All rights reserved.
Widely tunable laser frequency offset lock with 30 GHz range and 5 THz offset.
Biesheuvel, J; Noom, D W E; Salumbides, E J; Sheridan, K T; Ubachs, W; Koelemeij, J C J
2013-06-17
We demonstrate a simple and versatile method to greatly extend the tuning range of optical frequency shifting devices, such as acousto-optic modulators (AOMs). We use this method to stabilize the frequency of a tunable narrow-band continuous-wave (CW) laser to a transmission maximum of an external Fabry-Perot interferometer (FPI) with a tunable frequency offset. This is achieved through a servo loop which contains an in-loop AOM for simple radiofrequency (RF) tuning of the optical frequency over the full 30 GHz mode-hop-free tuning range of the CW laser. By stabilizing the length of the FPI to a stabilized helium-neon (HeNe) laser (at 5 THz offset from the tunable laser) we simultaneously transfer the ~ 1 MHz absolute frequency stability of the HeNe laser to the entire 30 GHz range of the tunable laser. Thus, our method allows simple, wide-range, fast and reproducible optical frequency tuning and absolute optical frequency measurements through RF electronics, which is here demonstrated by repeatedly recording a 27-GHz-wide molecular iodine spectrum at scan rates up to 500 MHz/s. General technical aspects that determine the performance of the method are discussed in detail.
ERIC Educational Resources Information Center
Roach, Ronald
2004-01-01
As a cultural movement, hip-hop manages to get billed as both a positive and negative influence on young people, especially on Black and Latino youth. On one hand, there are African American activists, artists and entrepreneurs, such as Russell Simmons, who seek to build a progressive political movement among young hip-hop fans and who have had…
Nerve Conduction Through Dendrites via Proton Hopping.
Kier, Lemont B
2017-01-01
In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.
Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C
2015-03-01
The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation. Antimicrobial hop extracts could be used as natural preservatives in food applications to extend the shelf life and to increase the safety of fresh products. © 2014 The Society for Applied Microbiology.
Experiments and theory on parametric instabilities excited in HF heating experiments at HAARP
NASA Astrophysics Data System (ADS)
Kuo, Spencer; Snyder, Arnold; Lee, M. C.
2014-06-01
Parametric instabilities excited by O-mode HF heater and the induced ionospheric modification were explored via HAARP digisonde operated in a fast mode. The impact of excited Langmuir waves and upper hybrid waves on the ionosphere are manifested by bumps in the virtual spread, which expand the ionogram echoes upward as much as 140 km and the downward range spread of the sounding echoes, which exceeds 50 km over a significant frequency range. The theory of parametric instabilities is presented. The theory identifies the ionogram bump located between the 3.2 MHz heater frequency and the upper hybrid resonance frequency and the bump below the upper hybrid resonance frequency to be associated with the Langmuir and upper hybrid instabilities, respectively. The Langmuir bump is located close to the upper hybrid resonance frequency, rather than to the heater frequency, consistent with the theory. Each bump in the virtual height spread of the ionogram is similar to the cusp occurring in daytime ionograms at the E-F2 layer transition, indicating that there is a small ledge in the density profile similar to E-F2 layer transitions. The experimental results also show that the strong impact of the upper hybrid instability on the ionosphere can suppress the Langmuir instability.
Experiments and theory on parametric instabilities excited in HF heating experiments at HAARP
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuo, Spencer; Snyder, Arnold; Lee, M. C.
2014-06-15
Parametric instabilities excited by O-mode HF heater and the induced ionospheric modification were explored via HAARP digisonde operated in a fast mode. The impact of excited Langmuir waves and upper hybrid waves on the ionosphere are manifested by bumps in the virtual spread, which expand the ionogram echoes upward as much as 140 km and the downward range spread of the sounding echoes, which exceeds 50 km over a significant frequency range. The theory of parametric instabilities is presented. The theory identifies the ionogram bump located between the 3.2 MHz heater frequency and the upper hybrid resonance frequency and the bump below themore » upper hybrid resonance frequency to be associated with the Langmuir and upper hybrid instabilities, respectively. The Langmuir bump is located close to the upper hybrid resonance frequency, rather than to the heater frequency, consistent with the theory. Each bump in the virtual height spread of the ionogram is similar to the cusp occurring in daytime ionograms at the E-F2 layer transition, indicating that there is a small ledge in the density profile similar to E-F2 layer transitions. The experimental results also show that the strong impact of the upper hybrid instability on the ionosphere can suppress the Langmuir instability.« less
Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S
2006-01-01
The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219
Energetics and biomechanics of locomotion by red kangaroos (Macropus rufus).
Kram, R; Dawson, T J
1998-05-01
As red kangaroos hop faster over level ground, their rate of oxygen consumption (indicating metabolic energy consumption) remains nearly the same. This phenomenon has been attributed to exceptional elastic energy storage and recovery via long compliant tendons in the legs. Alternatively, red kangaroos may have exceptionally efficient muscles. To estimate efficiency, we measured the metabolic cost of uphill hopping, where muscle fibers must perform mechanical work against gravity. We found that uphill hopping was much more expensive than level hopping. The maximal rate of oxygen consumption measured (3 ml O2 kg-1 s-1) exceeds all but a few vertebrate species. However, efficiency values were normal, approximately 30%. At faster level hopping speeds the effective mechanical advantage of the extensor muscles of the ankle joint remained the same. Thus, kangaroos generate the same muscular force at all speeds but do so more rapidly at faster hopping speeds. This contradicts a recent hypothesis for what sets the cost of locomotion. The cost of transport (J kg-1 m-1) decreases at faster hopping speeds, yet red kangaroos prefer to use relatively slow speeds that avoid high levels of tendon stress.
Low Power Multi-Hop Networking Analysis in Intelligent Environments.
Etxaniz, Josu; Aranguren, Gerardo
2017-05-19
Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.
Low Power Multi-Hop Networking Analysis in Intelligent Environments
Etxaniz, Josu; Aranguren, Gerardo
2017-01-01
Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847
Gold Binding by Native and Chemically Modified Hops Biomasses
López, M. Laura; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.
2005-01-01
Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass (Humulus lupulus) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively. PMID:18365087
O'Connor, Annalouise; Konda, Veera; Reed, Ralph L; Christensen, J Mark; Stevens, Jan F; Contractor, Nikhat
2018-03-01
Xanthohumol (XN), a prenylated flavonoid found in hops, exhibits anti-inflammatory and antioxidant properties. However, poor bioavailability may limit therapeutic applications. As food components are known to modulate polyphenol absorption, the objective is to determine whether a protein matrix could enhance the bioavailability of XN post oral consumption in humans. This is a randomized, double-blind, crossover study in healthy participants (n = 6) evaluating XN and its major metabolites (isoxanthohumol [IX], 6- and 8-prenylnaringenin [6-PN, 8-PN]) for 6 h following consumption of 12.4 mg of XN delivered via a spent hops-rice protein matrix preparation or a control spent hops preparation. Plasma XN and metabolites are measured by LC-MS/MS. C max , T max , and area-under-the-curve (AUC) values were determined. Circulating XN and metabolite response to each treatment was not bioequivalent. Plasma concentrations of XN and XN + metabolites (AUC) are greater with consumption of the spent hops-rice protein matrix preparation. Compared to a standard spent hops powder, a protein-rich spent hops matrix demonstrates enhanced plasma levels of XN and metabolites following acute oral intake. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques
2009-05-01
The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.
Spaceborne Imaging Radar-C instrument
NASA Technical Reports Server (NTRS)
Huneycutt, Bryan L.
1993-01-01
The Spaceborne Imaging Radar-C is the next radar in the series of spaceborne radar experiments, which began with Seasat and continued with SIR-A and SIR-B. The SIR-C instrument has been designed to obtain simultaneous multifrequency and simultaneous multipolarization radar images from a low earth orbit. It is a multiparameter imaging radar that will be flown during at least two different seasons. The instrument operates in the squint alignment mode, the extended aperture mode, the scansar mode, and the interferometry mode. The instrument uses engineering techniques such as beam nulling for echo tracking, pulse repetition frequency hopping for Doppler centroid tracking, generating the frequency step chirp for radar parameter flexibility, block floating-point quantizing for data rate compression, and elevation beamwidth broadening for increasing the swath illumination.
A computer simulation of an adaptive noise canceler with a single input
NASA Astrophysics Data System (ADS)
Albert, Stuart D.
1991-06-01
A description of an adaptive noise canceler using Widrows' LMS algorithm is presented. A computer simulation of canceler performance (adaptive convergence time and frequency transfer function) was written for use as a design tool. The simulations, assumptions, and input parameters are described in detail. The simulation is used in a design example to predict the performance of an adaptive noise canceler in the simultaneous presence of both strong and weak narrow-band signals (a cosited frequency hopping radio scenario). On the basis of the simulation results, it is concluded that the simulation is suitable for use as an adaptive noise canceler design tool; i.e., it can be used to evaluate the effect of design parameter changes on canceler performance.
Energy landscape in frustrated systems: Cation hopping in pyrochlores
NASA Astrophysics Data System (ADS)
Brooks Hinojosa, Beverly; Asthagiri, Aravind; Nino, Juan C.
2013-07-01
We investigate the dynamics of the local environment and electronic structure in inherently dipolar frustrated pyrochlore compounds to help identify the fundamental nature of dipolar disorder in pyrochlore systems and determine the necessary and sufficient conditions for dielectric relaxation. We map out the energy landscape associated with cation hopping events in three compounds and correlate the hopping pathway with experimental dielectric response. Comprehensive analysis of the calculations allows us to postulate rules to predict the occurrence of relaxation and cation hopping pathways.
Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.
2001-01-01
The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.
NASA Astrophysics Data System (ADS)
Honerkamp, Carsten
2017-12-01
We study the Hubbard model on the AB-stacked bilayer honeycomb lattice with a repulsive on-site interaction U in second-order perturbation theory and in self-consistent random phase approximation. We determine the changes in the antiferromagnetic magnetic ordering tendencies due to the real and imaginary parts of the self-energy at the band crossing points. In particular, we present an estimate for the threshold value U* below which the magnetic order is endangered by the splitting of the quadratic band touching points into four Dirac points by an interaction-induced interlayer skew hopping. For most of the parameter space, however, the quasiparticle degradation by the frequency-dependence of the sublattice-diagonal self-energies and the Dirac-cone steepening are more essential for suppressing the AF ordering tendencies considerably. Our results might help to understand the energy scales obtained in renormalization group treatments of the same model and shed light on recent quantum Monte Carlo investigations about the fate of the magnetic ordering down to lower U .
NASA Astrophysics Data System (ADS)
Jaffari, G. Hassnain; Rehman, Atiq ur; Iqbal, Asad M.; Awan, M. S.; Saleemi, Mohsin
2017-11-01
Post sintering studies of BaTiO3 (BTO) nanoparticles are presented in detail. Bulk nanostructures were prepared via three different compaction processes, namely, uniaxial cold pressing (UCP), Cold Isostatic Pressing (CIP) and Spark Plasma Sintering (SPS). Effect of compaction technique on microstructures have been investigated and correlated with electrical response for each sample. In addition to the transport properties, temperature and frequency dependent dielectric response of variously sintered samples and bulk counterpart was recorded. Several aspects have been identified that are essential to be taken into account in order to completely understand physical processes. Drastically distinct features were observed in paraelectric (PE) regime well above ferroelectric (FE)-PE transition temperature. These features include intra grain conduction with a reduction in the magnitude of PE to FE peak dielectric constant magnitude. Role of strain, grain boundary conduction associated with observation of Maxwell Wagner relaxation and hopping conduction in dielectric and ferroelectric response have been observed and discussed. Densification with presence of oxygen vacancies, significantly enhances conductivity associated with the hopping of the carriers, in turn deteriorated ferroelectric response.
[Abnormal growth of spine in patients with adolescent idiopathic thoracic scoliosis].
Bao, Hongda; Liu, Zhen; Qiu, Yong; Zhu, Feng; Zhu, Zezhang; Zhang, Wen
2014-05-01
To investigate if the growth patterns of the spine and pelvis are consistent in adolescent idiopathic scoliosis (AIS) patients with single thoracic curves. Forty-eight thoracic adolescent idiopathic scoliosis (T-AIS) female patients and 48 healthy age-matched adolescents were recruited consecutively between December 2011 and October 2012. Radiographic parameters including height of spine (HOS), length of spine (LOS), height of thoracic spine (HOT), length of thoracic spine (LOT), height of pelvis (HOP), width of pelvis (WOP) and width of thorax (WOT) were measured on the long-cassette posteroanterior standing radiographs. In addition, ratios including HOS/HOP, LOS/HOP, HOT/HOP, LOT/HOP, LOS/LOT, WOT/WOP were also calculated. Independent t-test was performed to compare the radiographic parameters and ratios between the two groups. Compared to the age-matched healthy adolescents, T-AIS patients had a significantly higher LOS and LOT (t = -2.364 and -1.495, P = 0.020 and 0.043) and smaller HOS and HOT (t = 2.060 and 3.359, P = 0.042 and 0.001). Yet, all of HOP, WOP and WOT showed no significant difference between T-AIS patients and healthy adolescents. Similarly, LOS/HOP and LOT/HOP were significantly higher in T-AIS patients as may be expected with an average LOS/HOP of 2.26 ± 0.14 in normal controls.In addition, LOS/LOT in normal controls had a trend of increase with age which was different from the stable LOS/LOT in T-AIS patients, indicating an increased growth of thoracic vertebra compared to lumbar vertebra. Compared to the age-matched healthy adolescents, T-AIS patients have an abnormal growth characteristics with longer spine. The growth of pelvis and thorax show no significant differences between T-AIS patients and healthy adolescents.
Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica
2018-06-01
Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.
Willigenburg, Nienke; Hewett, Timothy E.
2016-01-01
Objective To define the relationship between FMS™ scores and hop performance, hip strength, and knee strength in collegiate football players. Design Cross-sectional cohort. Participants Freshmen of a division I collegiate American football team (n=59). Main Outcome Measures The athletes performed the FMS™, as well as a variety of hop tests, isokinetic knee strength and isometric hip strength tasks. We recorded total FMS™ score, peak strength and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman’s correlation coefficients quantified the relationships these measures, and chi-square analyses compared the number of athletes with asymmetries on the different tasks. Results We observed significant correlations (r=0.38–0.56, p≤0.02) between FMS™ scores and hop distance, but not between FMS™ scores and hip or knee strength (all p≥0.21). The amount of asymmetry on the FMS™ test was significantly correlated to the amount of asymmetry on the timed 6m hop (r=0.44, p<0.01), but not to hip or knee strength asymmetries between limbs (all p≥0.34). Conclusions FMS™ score was positively correlated to hop distance, and limb asymmetry in FMS™ tasks was correlated to limb asymmetry in 6m hop time in football players. No significant correlations were observed between FMS™ score and hip and knee strength, or between FMS™ asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time and cost efficient alternative to FMS™ testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries. PMID:26886801
Willigenburg, Nienke; Hewett, Timothy E
2017-03-01
To define the relationship between Functional Movement Screen (FMS) scores and hop performance, hip strength, and knee strength in collegiate football players. Cross-sectional cohort. Freshmen of a Division I collegiate American football team (n = 59). The athletes performed the FMS, and also a variety of hop tests, isokinetic knee strength, and isometric hip strength tasks. We recorded total FMS score, peak strength, and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman correlation coefficients quantified the relationships between these measures, and χ analyses compared the number of athletes with asymmetries on the different tasks. We observed significant correlations (r = 0.38-0.56, P ≤ 0.02) between FMS scores and hop distance but not between FMS scores and hip or knee strength (all P ≥ 0.21). The amount of asymmetry on the FMS test was significantly correlated to the amount of asymmetry on the timed 6-m hop (r = 0.44, P < 0.01) but not to hip or knee strength asymmetries between limbs (all P ≥ 0.34). Functional Movement Screen score was positively correlated to hop distance, and limb asymmetry in FMS tasks was correlated to limb asymmetry in 6-m hop time in football players. No significant correlations were observed between FMS score and hip and knee strength or between FMS asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time-efficient and cost-efficient alternative to FMS testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries.
Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore
2015-01-01
Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.
Mode Hopping in Semiconductor Lasers
NASA Astrophysics Data System (ADS)
Heumier, Timothy Alan
Semiconductor lasers have found widespread use in fiberoptic communications, merchandising (bar-code scanners), entertainment (videodisc and compact disc players), and in scientific inquiry (spectroscopy, laser cooling). Some uses require a minimum degree of stability of wavelength which is not met by these lasers: Under some conditions, semiconductor lasers can discontinuously switch wavelengths in a back-and-forth manner. This is called mode hopping. We show that mode hopping is directly correlated to noise in the total intensity, and that this noise is easily detected by a photodiode. We also show that there are combinations of laser case temperature and injection current which lead to mode hopping. Conversely, there are other combinations for which the laser is stable. These results are shown to have implications for controlling mode hopping.
The Effects of Angular Orientation on Flame Spread over Thin Materials
1999-12-01
Notation 7 5 Upward Spread With Burnout 8 6a Observed Flame Lengths on Napkins, Increments 2.5 cm 9 6b Observed Flame Lengths on Pet Film, Increments...Frequency of Extinguishment During Flame Spread 21 15 Flame Spread Velocity 21 VI 16 Flame Length Measured Parallel to the Surface 22 17 Comparison of... flame length (Lf) were measured from a video recording of the test. Despite erratic burn fronts with discontinuous flaming regions, the maximum
Study of dielectric relaxation and AC conductivity of InP:S single crystal
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.; El-Shazly, E. A.
2012-07-01
The dielectric relaxation and AC conductivity of InP:S single crystal were studied in the frequency range from 100 to 5.25 × 105 Hz and in the temperature range from 296 to 455 K. The dependence of the dielectric constant (ɛ1) and the dielectric loss (ɛ2) on both frequency and temperature was investigated. Since no peak was observed on the dielectric loss, we used a method based on the electric modulus to evaluate the activation energy of the dielectric relaxation. Scaling of the electric modulus spectra showed that the charge transport dynamics is independent of temperature. The AC conductivity (σAC) was found to obey the power law: Aωs. Analysis of the AC conductivity data and the frequency exponent showed that the correlated barrier hopping (CBH) model is the dominant mechanism for the AC conduction. The variation of AC conductivity with temperature at different frequencies showed that σAC is a thermally activated process.
NASA Astrophysics Data System (ADS)
Ali, H. A. M.
2016-03-01
The structure for the powder of N,N', N"-tris(4-methylphenyl)phosphoric triamide, TMP-TA, was characterized using X-ray diffraction (XRD) and differential thermal analysis (DTA) techniques. The ac conductivity and dielectric properties were measured in the frequency range of 42-105 Hz for the bulk TMP-TA in a pellet form at different temperatures. The frequency dependence of ac conductivity was expressed by a Jonscher's universal power law. The frequency exponent (s) was determined from the fitting of experimental data of ac conductivity. The correlated barrier hopping (CBH) model was found to be responsible for the ac conduction mechanism in TMP-TA. The activation energy was calculated from the temperature dependence of ac conductivity. The values of the density of states at the Fermi level were determined for different frequencies. The components of the electric modulus (M' and M") were calculated and used to estimate the relaxation time.
Alternating current transport and dielectric relaxation of nanocrystalline graphene oxide
NASA Astrophysics Data System (ADS)
Zedan, I. T.; El-Menyawy, E. M.
2018-07-01
Graphene oxide (GO) has been synthesized from natural graphite using modified Hummer's method and is subjected to sonication for 1 h. X-ray diffraction (XRD) showed that the prepared GO has nanocrystalline structure with particle size of about 5 nm and high-resolution transmission electron microscope showed that it had a layered structure. The nanocrystalline GO powder was pressed as a disk and the alternating current (AC) electrical conductivity, σAC, and dielectric properties have been investigated in the frequency range 50Hz-5 MHz and temperature range 298-523K using parallel plate spectroscopic technique. Analysis of σ AC as a function of frequency shows that the relation follows Jonscher's universal law with frequency exponent decreases with increasing temperature in which the correlated barrier hopping model is applicable to describe the behavior. The dielectric constant and dielectric loss are studied as functions of frequency and temperature. The dielectric modulus formalism is used for describing the relaxation process in which the relaxation time and its activation energy were evaluated.
NASA Astrophysics Data System (ADS)
Tewari, S.; Ghosh, A.; Bhattacharjee, A.
2016-11-01
Sintered pellets of zinc oxide (ZnO), both undoped and Al-doped are prepared through a chemical process. Dopant concentration of Aluminium in ZnO [Al/Zn in weight percentage (wt%)] is varied from 0 to 3 wt%. After synthesis structural characterisation of the samples are performed with XRD and SEM-EDAX which confirm that all the samples are of ZnO having polycrystalline nature with particle size from 108.6 to 116 nm. Frequency dependent properties like a.c. conductivity, capacitance, impedance and phase angle are measured in the frequency range 10 Hz to 100 kHz as a function of temperature (in the range 25-150 °C). Nature of a.c. conductivity in these samples indicates hopping type of conduction arising from localised defect states. The frequency and temperature dependent properties under study are found to be as per correlated barrier hoping model. Dielectric and impedance properties studied in the samples indicate distributed relaxation, showing decrease of relaxation time with temperature.
Electrical conductivity and dielectric behavior in sodium zinc divanadates
NASA Astrophysics Data System (ADS)
Sallemi, F.; Louati, B.; Guidara, K.
2014-11-01
The Na2ZnV2O7 compound was obtained by the conventional solid-state reaction. The sample was characterized by X-ray powder diffraction, Raman and impedance spectroscopy. The ac electrical conductivity and dielectric properties have been investigated in the frequency and temperature range of 200 Hz-1 MHz and 513 K-729 K, respectively. The direct current conductivity process is thermally activated. The frequency dependence of the conductivity is interpreted using the power law. The close values of activation energies obtained from the analysis of hopping frequency and dc conductivity implies that the transport is due to Na+ cation displacement parallel to (0 0 1) plane located between ZnO4 and VO4 tetrahedra. The evolution of the complex permittivity as a function of angular frequency was investigated. Several important parameters such as charge carrier concentration, ionic mobility and diffusion coefficient were determined. Thermodynamic parameters such as the free energy of activation ∆F, the enthalpy ∆H, and the change in entropy ∆S have been calculated.
NASA Astrophysics Data System (ADS)
Turik, A. V.; Bogatin, A. S.
2015-01-01
Experimental data on dielectric spectra of calcium copper titanate, CaCu3Ti4O12 (CCTO) family functional ceramics have been studied and analyzed. It is shown that there are both non-Debye relaxation and resonance regions in their spectra. An occurrence of a retardation of complex permittivity and a relaxation of electric modulus is established. An average relaxation frequency of the electric modulus is considerably (in some cases several orders of magnitude) larger than the retardation frequency of the permittivity. A parallel connection of the capacity and complex conductivity is used to model and interpret experimental data on a negative permittivity in the infralow frequency range. Computer simulation enables us to reveal that the hopping conductivity, characteristic for disordered heterogeneous systems, is to be taken into account to describe adequately experimental data on passing the real part of the capacity (or permittivity) through zero. We have found a critical frequency at which the parallel resonance would take place.
Continuous-wave single-frequency laser with dual wavelength at 1064 and 532 nm.
Zhang, Chenwei; Lu, Huadong; Yin, Qiwei; Su, Jing
2014-10-01
A continuous-wave high-power single-frequency laser with dual-wavelength output at 1064 and 532 nm is presented. The dependencies of the output power on the transmission of the output coupler and the phase-matching temperature of the LiB(3)O(5) (LBO) crystal are studied. An output coupler with transmission of 19% is used, and the temperature of LBO is controlled to the optimal phase-matching temperature of 422 K; measured maximal output powers of 33.7 W at 1064 nm and of 1.13 W at 532 nm are obtained with optical-optical conversion efficiency of 45.6%. The laser can be single-frequency operated stably and mode-hop-free, and the measured frequency drift is less than 15 MHz in 1 min. The measured Mx2 and My2 for the 1064 nm laser are 1.06 and 1.09, respectively. The measured Mx2 and My2 for the 532 nm laser are 1.12 and 1.11, respectively.
Hop powdery mildew control through alteration of spring pruning practices
USDA-ARS?s Scientific Manuscript database
Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...
Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika
2007-01-01
The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.
Nicaise, Valerie; Joe, Anna; Jeong, Byeong-ryool; Korneli, Christin; Boutrot, Freddy; Westedt, Isa; Staiger, Dorothee; Alfano, James R; Zipfel, Cyril
2013-03-06
Pathogens target important components of host immunity to cause disease. The Pseudomonas syringae type III-secreted effector HopU1 is a mono-ADP-ribosyltransferase required for full virulence on Arabidopsis thaliana. HopU1 targets several RNA-binding proteins including GRP7, whose role in immunity is still unclear. Here, we show that GRP7 associates with translational components, as well as with the pattern recognition receptors FLS2 and EFR. Moreover, GRP7 binds specifically FLS2 and EFR transcripts in vivo through its RNA recognition motif. HopU1 does not affect the protein-protein associations between GRP7, FLS2 and translational components. Instead, HopU1 blocks the interaction between GRP7 and FLS2 and EFR transcripts in vivo. This inhibition correlates with reduced FLS2 protein levels upon Pseudomonas infection in a HopU1-dependent manner. Our results reveal a novel virulence strategy used by a microbial effector to interfere with host immunity.
HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis.
Kang, Yongsung; Jelenska, Joanna; Cecchini, Nicolas M; Li, Yujie; Lee, Min Woo; Kovar, David R; Greenberg, Jean T
2014-06-01
A central mechanism of virulence of extracellular bacterial pathogens is the injection into host cells of effector proteins that modify host cellular functions. HopW1 is an effector injected by the type III secretion system that increases the growth of the plant pathogen Pseudomonas syringae on the Columbia accession of Arabidopsis. When delivered by P. syringae into plant cells, HopW1 causes a reduction in the filamentous actin (F-actin) network and the inhibition of endocytosis, a known actin-dependent process. When directly produced in plants, HopW1 forms complexes with actin, disrupts the actin cytoskeleton and inhibits endocytosis as well as the trafficking of certain proteins to vacuoles. The C-terminal region of HopW1 can reduce the length of actin filaments and therefore solubilize F-actin in vitro. Thus, HopW1 acts by disrupting the actin cytoskeleton and the cell biological processes that depend on actin, which in turn are needed for restricting P. syringae growth in Arabidopsis.
Hop Optimization and Relay Node Selection in Multi-hop Wireless Ad-Hoc Networks
NASA Astrophysics Data System (ADS)
Li, Xiaohua(Edward)
In this paper we propose an efficient approach to determine the optimal hops for multi-hop ad hoc wireless networks. Based on the assumption that nodes use successive interference cancellation (SIC) and maximal ratio combining (MRC) to deal with mutual interference and to utilize all the received signal energy, we show that the signal-to-interference-plus-noise ratio (SINR) of a node is determined only by the nodes before it, not the nodes after it, along a packet forwarding path. Based on this observation, we propose an iterative procedure to select the relay nodes and to calculate the path SINR as well as capacity of an arbitrary multi-hop packet forwarding path. The complexity of the algorithm is extremely low, and scaling well with network size. The algorithm is applicable in arbitrarily large networks. Its performance is demonstrated as desirable by simulations. The algorithm can be helpful in analyzing the performance of multi-hop wireless networks.
Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.
Neiens, Silva D; Steinhaus, Martin
2018-02-14
The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.
VLF and HF Plasma Waves Associated with Spread-F Plasma Depletions Observed on the C/NOFS Satellite
NASA Technical Reports Server (NTRS)
Pfaff, Robert; Freudenreich, H.; Schuck, P.; Klenzing, J.
2011-01-01
The C/NOFS spacecraft frequently encounters structured plasma depletions associated with equatorial spread-F along its trajectory that varies between 401 km perigee and 867 km apogee in the low latitude ionosphere. We report two classes of plasma waves detected with the Vector Electric Field Investigation (VEFI) that appear when the plasma frequency is less than the electron gyro frequency, as is common in spread-F depletions where the plasma number density typically decreases below 10(exp 4)/cu cm. In these conditions, both broadband VLF waves with a clear cutoff at the lower hybrid frequency and broadband HF waves with a clear cutoff at the plasma frequency are observed. We interpret these waves as "hiss-type" emissions possibly associated with the flow of suprathermal electrons within the inter-hemispherical magnetic flux tubes. We also report evidence of enhanced wave "transients" sometimes embedded in the broader band emissions that are associated with lightning sferics detected within the depleted plasma regions that appear in both the VLF and HF data. Theoretical implications of these observations are discussed.
Nyland, John; Wera, Jeff; Klein, Scott; Caborn, David N M
2014-12-01
This study compared lower extremity EMG activation and sagittal plane kinematics of subjects at a minimum of 2 years post-successful ACL reconstruction and rehabilitation during instrumented single leg hop testing. Comparisons were made based on subject responses to the following question, "compared to prior to your knee injury how capable are you now in performing sports activities"? Group 1=very capable, Group 2=capable, and Group 3=not capable. In addition to EMG (1000 Hz) and kinematic (60 Hz) data, subjective knee function, internal health locus of control, sports activity characteristics (intensity, frequency) pre-knee injury, and at follow-up were also compared. Group 3 had lower perceived knee function, decreased perceived sports intensity, and more subjects with decreased sports activity intensity by two levels compared to pre-injury values. Perceived function scores, anterior laxity measurements and grades were similar between groups. During single leg hop propulsion and landing Group 1 (very capable) had greater involved lower extremity gluteus maximus and medial hamstring activation amplitudes than Group 3 (not capable). Perceived sports capability was related to better subjective knee function, and higher perceived sports activity intensity. Neuromuscular compensations suggesting a hip bias with increased gluteus maximus and medial hamstring activation were identified at the involved lower extremity among most subjects who perceived high perceived sports capability compared to pre-injury status. These compensations may be related to a permanent neurosensory deficit, and its influence on afferent pathway changes that influence CNS sensorimotor re-organization. Copyright © 2014 Elsevier B.V. All rights reserved.
Livingston, Jennifer I; Deprey, Sara M; Hensley, Craig P
2015-10-01
differential diagnosis and clinical decision making. Young adults with lateral hip pain are often referred to physical therapy (PT). A thorough examination is required to obtain a diagnosis and guide management. The purpose of this case report is to describe the physical therapist's differential diagnostic process and clinical decision making for a subject with the referring diagnosis of trochanteric bursitis. A 29-year-old female presented to PT with limited sitting and running tolerance secondary to right lateral hip pain. Her symptoms began three months prior when she abruptly changed her running intensity and frequency of weight bearing activities, including running and low impact plyometrics for the lower extremity. Physical examination revealed a positive Trendelenburg sign, manual muscle test that was weak and painless of the right hip abductors, and pain elicited when performing a vertical hop on a concrete surface (+single leg hop test), but pain-free when performing the same single leg hop on a foam surface. Examination findings warranted discussion with the referring physician for further diagnostic imaging. Magnetic resonance imaging revealed a focus of edema in the posterior acetabulum, suspicious for an acetabular stress fracture. The subject was subsequently diagnosed with an acetabular stress fracture and restricted from running and plyometrics for four weeks. Thorough examination and appropriate clinical decision making by the physical therapist at the initial examination led to the diagnosis of an acetabular stress fracture in this subject. Clinicians must be aware of symptoms and signs which place the subject at risk for stress fracture for timely referral and management. 4.
High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT).
Howard, E L; Whittock, S P; Jakše, J; Carling, J; Matthews, P D; Probasco, G; Henning, J A; Darby, P; Cerenak, A; Javornik, B; Kilian, A; Koutoulis, A
2011-05-01
Implementation of molecular methods in hop (Humulus lupulus L.) breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. However, use of molecular marker technology is limited due to expense, time inefficiency, laborious methodology and dependence on DNA sequence information. Diversity arrays technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of quality polymorphic markers without reliance on DNA sequence information. This study is the first to utilise DArT for hop genotyping, identifying 730 polymorphic markers from 92 hop accessions. The marker quality was high and similar to the quality of DArT markers previously generated for other species; although percentage polymorphism and polymorphism information content (PIC) were lower than in previous studies deploying other marker systems in hop. Genetic relationships in hop illustrated by DArT in this study coincide with knowledge generated using alternate methods. Several statistical analyses separated the hop accessions into genetically differentiated North American and European groupings, with hybrids between the two groups clearly distinguishable. Levels of genetic diversity were similar in the North American and European groups, but higher in the hybrid group. The markers produced from this time and cost-efficient genotyping tool will be a valuable resource for numerous applications in hop breeding and genetics studies, such as mapping, marker-assisted selection, genetic identity testing, guidance in the maintenance of genetic diversity and the directed breeding of superior cultivars.
Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen
2015-07-01
Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Lee, C. C.; Chen, W. S.
2018-04-01
The aim of this study is to examine the effects of Es-layer characteristics on spread-F generation in the nighttime midlatitude ionosphere. The Es-layer parameters and spread-F appearance of the 23rd solar cycle (1996-2008) are recorded by the Kokubunji ionosonde. The Es-layer parameters are foEs (critical frequency of Es-layer), fbEs (blanketing frequency of Es-layer), and Δf (≡foEs-fbEs). In order to completely explore the effects, the pre-midnight and post-midnight data are classified by seasons, solar activities, and geomagnetic conditions. Results show that the spread-F occurs more frequently in post-midnight and in summer. And, the occurrence probabilities of spread-F are greater, when the solar activity is lower. For the occurrence probabilities of spread-F versus foEs and Δf under geomagnetic quiet-conditions, the trend is increasing, when the associated probabilities are significant. These indicate that the spread-F occurrence increases with increasing foEs and/or Δf. Further, the increasing trends demonstrate that polarization electric fields generated in Es-layer would be helpful to generate spread-F, through the electrodynamical coupling of Es-layer and F-region. Moreover, this electrodynamical coupling is efficient not only under quiet-conditions but under disturbed-conditions, since the significant increasing trend can also be found under disturbed-conditions. Regarding the occurrence probabilities of spread-F versus fbEs, the evident trends are not in the majority. This implies that fbEs might not be a major factor for the spread-F formation.
Spread F in the Midlatitude Ionosphere According to DPS-4 Ionosonde Data
NASA Astrophysics Data System (ADS)
Panchenko, V. A.; Telegin, V. A.; Vorob'ev, V. G.; Zhbankov, G. A.; Yagodkina, O. I.; Rozhdestvenskaya, V. I.
2018-03-01
The results of studying spread F obtained from the DPS-4 ionosonde data at the observatory of the Pushkov Institute of Terrestrial Magnetism, Ionosphere, and Radio Wave Propagation (Moscow) are presented. The methodical questions that arise during the study of a spread F phenomenon in the ionosphere are considered; the current results of terrestrial observations are compared with previously published data and the results of sounding onboard an Earth-satellite vehicle. The automated algorithm for estimation of the intensity of frequency spread F, which was developed by the authors and was successfully verified via comparison of the data of the digisonde DPS-4 and the results of manual processing, is described. The algorithm makes it possible to quantify the intensity of spread F in megahertz (the dFs parameter) and in the number of points (0, 1, 2, 3). The strongest spread (3 points) is shown to be most likely around midnight, while the weakest spread (0 points) is highly likely to occur during the daytime. The diurnal distribution of a 1-2 point spread F in the winter indicates the presence of additional maxima at 0300-0600 UT and 1400-1700 UT, which may appear due to the terminator. Despite the large volume of processed data, we can not definitively state that the appearance of spread F depends on the magnetic activity indices Kp, Dst, and AL, although the values of the dFs frequency spread interval strongly increased both at day and night during the magnetic storm of March 17-22, 2015, especially in the phase of storm recovery on March 20-22.
Dielectric Properties of PANI/CuO Nanocomposites
NASA Astrophysics Data System (ADS)
Ambalagi, Sharanabasamma M.; Devendrappa, Mahalesh; Nagaraja, Sannakki; Sannakki, Basavaraja
2018-02-01
The combustion method is used to prepare the Copper Oxide (CuO) nanoparticles. The nanocomposites of Polyaniline (PANI) by doping with copper oxide nanoparticles have synthesized at 10, 20, 30, 40 and 50 different weight percentages during the in-situ polymerization. The samples of nanocomposite of PANI-CuO were characterized by using X-Ray diffraction (XRD) technique. The physical properties such as dielectric constant, dielectric loss and A C conductivity of the nanocomposites are studied as a function of frequency in the range 5Hz-35MHz at room temperature. It is found that the dielectric constant decreases as the frequency increases. The dielectric constant it remains constant at higher frequencies and it is also observed that in particular frequency both the dielectric constant and dielectric loss are decreased as a weight percentage of CuO increased. In case of AC conductivity it is found that as the frequency increases the AC conductivity remains constant up to 3.56MHz and afterwards it increases as frequency increases. This is due to the increase in charge carriers through the hopping mechanism in the polymer nanocomposites. It is also observed that as a weight percentage of CuO increased the AC conductivity is also increasing at a particular frequency.
Villegas, Fernanda; Tilly, Nina; Ahnesjö, Anders
2013-09-07
The stochastic nature of ionizing radiation interactions causes a microdosimetric spread in energy depositions for cell or cell nucleus-sized volumes. The magnitude of the spread may be a confounding factor in dose response analysis. The aim of this work is to give values for the microdosimetric spread for a range of doses imparted by (125)I and (192)Ir brachytherapy radionuclides, and for a (60)Co source. An upgraded version of the Monte Carlo code PENELOPE was used to obtain frequency distributions of specific energy for each of these radiation qualities and for four different cell nucleus-sized volumes. The results demonstrate that the magnitude of the microdosimetric spread increases when the target size decreases or when the energy of the radiation quality is reduced. Frequency distributions calculated according to the formalism of Kellerer and Chmelevsky using full convolution of the Monte Carlo calculated single track frequency distributions confirm that at doses exceeding 0.08 Gy for (125)I, 0.1 Gy for (192)Ir, and 0.2 Gy for (60)Co, the resulting distribution can be accurately approximated with a normal distribution. A parameterization of the width of the distribution as a function of dose and target volume of interest is presented as a convenient form for the use in response modelling or similar contexts.
Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth
USDA-ARS?s Scientific Manuscript database
Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...
HopBase: A unified resource for Humulus genomics
USDA-ARS?s Scientific Manuscript database
Hop (Humulus lupulus L. var lupulus) is a plant of worldwide significance, used primarily for its’ bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop has led to additional interest from pharmacy and healthcare industries as well a...
Single frequency stable VCSEL as a compact source for interferometry and vibrometry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dudzik, Grzegorz; Rzepka, Janusz
2010-05-28
Developing an innovative PS-DAVLL (Polarization Switching DAVLL) method of frequency stabilization, which used a ferroelectric liquid crystal cell as quarter wave plate, rubidium cell and developed ultra-stable current source, allowed to obtain a frequency stability of 10{sup -9}(frequency reproducibility of 1,2centre dot10{sup -8}) and reductions in external dimensions of laser source. The total power consumption is only 1,5 Watt. Because stabilization method used in the frequency standard is insensitive to vibration, the semiconductor laser interferometer was built for measuring range over one meter, which can also be used in industry for the accurate measurement of displacements with an accuracy ofmore » 1[mum/m]. Measurements of the VCSEL laser parameters are important from the standpoint of its use in laser interferometry or vibrometry, like narrow emission line DELTAnu{sub FWHM} = 70[MHz] equivalent of this laser type and stability of linear polarization of VCSEL laser. The undoubted advantage of the constructed laser source is the lack of mode-hopping effect during continuous work of VCSEL.« less
High temperature dielectric studies of indium-substituted NiCuZn nanoferrites
NASA Astrophysics Data System (ADS)
Hashim, Mohd.; Raghasudha, M.; Shah, Jyoti; Shirsath, Sagar E.; Ravinder, D.; Kumar, Shalendra; Meena, Sher Singh; Bhatt, Pramod; Alimuddin; Kumar, Ravi; Kotnala, R. K.
2018-01-01
In this study, indium (In3+)-substituted NiCuZn nanostructured ceramic ferrites with a chemical composition of Ni0.5Cu0.25Zn0.25Fe2-xInxO4 (0.0 ≤ x ≤ 0.5) were prepared by chemical synthesis involving sol-gel chemistry. Single phased cubic spinel structure materials were prepared successfully according to X-ray diffraction and transmission electron microscopy analyses. The dielectric properties of the prepared ferrites were measured using an LCR HiTester at temperatures ranging from room temperature to 300 °C at different frequencies from 102 Hz to 5 × 106 Hz. The variations in the dielectric parameters ε‧ and (tanδ) with temperature demonstrated the frequency- and temperature-dependent characteristics due to electron hopping between the ions. The materials had low dielectric loss values in the high frequency range at all temperatures, which makes them suitable for high frequency microwave applications. A qualitative explanation is provided for the dependences of the dielectric constant and dielectric loss tangent on the frequency, temperature, and composition. Mӧssbauer spectroscopy was employed at room temperature to characterize the magnetic behavior.
Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture
ERIC Educational Resources Information Center
Beachum, Floyd D.
2013-01-01
Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…
Toward Hip-Hop Pedagogies for Music Education
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2010 CFR
2010-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2013 CFR
2013-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2012 CFR
2012-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2011 CFR
2011-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
Framing and Reviewing Hip-Hop Educational Research
ERIC Educational Resources Information Center
Petchauer, Emery
2009-01-01
Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…
ERIC Educational Resources Information Center
Hall, Marcella Runell
2009-01-01
Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…
Gold Binding by Native and Chemically Modified Hops Biomasses
López, M. Laura; Gardea-Torresdey, J. L.; Peralta-Videa, J. R.; ...
2005-01-01
Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass ( Humulus lupulus ) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding atmore » pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively.« less
Papandreou, Nikolaos; Chomilier, Jacques
2008-01-01
The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR–DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR–DP domains. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0083-8) contains supplementary material, which is available to authorized users. PMID:18987995
Extreme Kinematics in Selected Hip Hop Dance Sequences.
Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen
2015-09-01
Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.
Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao
2017-10-24
The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.
Sbardella, Maicon; Racanicci, Aline Mc; Gois, Franz D; de Lima, Cristiane B; Migotto, Dannielle L; Costa, Leandro B; Miyada, Valdomiro S
2018-04-01
The effects of dietary levels of hop β-acids on physical attributes, lipid oxidation and chemical composition of pork meat were evaluated. Thirty-two castrated male pigs obtained from a complete block design feeding experiment (6.23 ± 0.42 kg initial body weight (BW) to 20.45 ± 0.95 kg final BW) and fed diets supplemented with 0, 120, 240 or 360 mg kg -1 hop β-acids during 35 days were slaughtered to sample longissimus dorsi muscle for meat analysis. No effects (P > 0.05) of dietary hop β-acids were observed on meat physical attributes. Quadratic effects (P < 0.05) of hop β-acids were observed on lipid and protein contents and on thiobarbituric acid-reactive substance (TBARS) values of meatballs, whose equations allowed the estimation of dietary hop β-acid levels of 176, 169 and 181 mg kg -1 to provide up to 16.20% lipid reduction, 1.95% protein accretion and 23.31% TBARS reduction respectively. Dietary hop β-acids fed to pigs might reduce lipid, increase protein and reduce lipid oxidation without affecting physical attributes of the pork meat. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
The Hip-Hop club scene: Gender, grinding and sex.
Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard
2007-01-01
Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.
100 Gbps Wireless System and Circuit Design Using Parallel Spread-Spectrum Sequencing
NASA Astrophysics Data System (ADS)
Scheytt, J. Christoph; Javed, Abdul Rehman; Bammidi, Eswara Rao; KrishneGowda, Karthik; Kallfass, Ingmar; Kraemer, Rolf
2017-09-01
In this article mixed analog/digital signal processing techniques based on parallel spread-spectrum sequencing (PSSS) and radio frequency (RF) carrier synchronization for ultra-broadband wireless communication are investigated on system and circuit level.
Al-Samman, A. M.; Rahman, T. A.; Azmi, M. H.; Hindia, M. N.; Khan, I.; Hanafi, E.
2016-01-01
This paper presents an experimental characterization of millimeter-wave (mm-wave) channels in the 6.5 GHz, 10.5 GHz, 15 GHz, 19 GHz, 28 GHz and 38 GHz frequency bands in an indoor corridor environment. More than 4,000 power delay profiles were measured across the bands using an omnidirectional transmitter antenna and a highly directional horn receiver antenna for both co- and cross-polarized antenna configurations. This paper develops a new path-loss model to account for the frequency attenuation with distance, which we term the frequency attenuation (FA) path-loss model and introduce a frequency-dependent attenuation factor. The large-scale path loss was characterized based on both new and well-known path-loss models. A general and less complex method is also proposed to estimate the cross-polarization discrimination (XPD) factor of close-in reference distance with the XPD (CIX) and ABG with the XPD (ABGX) path-loss models to avoid the computational complexity of minimum mean square error (MMSE) approach. Moreover, small-scale parameters such as root mean square (RMS) delay spread, mean excess (MN-EX) delay, dispersion factors and maximum excess (MAX-EX) delay parameters were used to characterize the multipath channel dispersion. Multiple statistical distributions for RMS delay spread were also investigated. The results show that our proposed models are simpler and more physically-based than other well-known models. The path-loss exponents for all studied models are smaller than that of the free-space model by values in the range of 0.1 to 1.4 for all measured frequencies. The RMS delay spread values varied between 0.2 ns and 13.8 ns, and the dispersion factor values were less than 1 for all measured frequencies. The exponential and Weibull probability distribution models best fit the RMS delay spread empirical distribution for all of the measured frequencies in all scenarios. PMID:27654703
Al-Samman, A M; Rahman, T A; Azmi, M H; Hindia, M N; Khan, I; Hanafi, E
This paper presents an experimental characterization of millimeter-wave (mm-wave) channels in the 6.5 GHz, 10.5 GHz, 15 GHz, 19 GHz, 28 GHz and 38 GHz frequency bands in an indoor corridor environment. More than 4,000 power delay profiles were measured across the bands using an omnidirectional transmitter antenna and a highly directional horn receiver antenna for both co- and cross-polarized antenna configurations. This paper develops a new path-loss model to account for the frequency attenuation with distance, which we term the frequency attenuation (FA) path-loss model and introduce a frequency-dependent attenuation factor. The large-scale path loss was characterized based on both new and well-known path-loss models. A general and less complex method is also proposed to estimate the cross-polarization discrimination (XPD) factor of close-in reference distance with the XPD (CIX) and ABG with the XPD (ABGX) path-loss models to avoid the computational complexity of minimum mean square error (MMSE) approach. Moreover, small-scale parameters such as root mean square (RMS) delay spread, mean excess (MN-EX) delay, dispersion factors and maximum excess (MAX-EX) delay parameters were used to characterize the multipath channel dispersion. Multiple statistical distributions for RMS delay spread were also investigated. The results show that our proposed models are simpler and more physically-based than other well-known models. The path-loss exponents for all studied models are smaller than that of the free-space model by values in the range of 0.1 to 1.4 for all measured frequencies. The RMS delay spread values varied between 0.2 ns and 13.8 ns, and the dispersion factor values were less than 1 for all measured frequencies. The exponential and Weibull probability distribution models best fit the RMS delay spread empirical distribution for all of the measured frequencies in all scenarios.
An Architecture for Coexistence with Multiple Users in Frequency Hopping Cognitive Radio Networks
2013-03-01
the base WARP system, a custom IP core written in VHDL , and the Virtex IV’s embedded PowerPC core with C code to implement the radio and hopset...shown in Appendix C as Figure C.2. All VHDL code necessary to implement this IP core is included in Appendix G. 69 Figure 3.19: FPGA bus structure...subsystem functionality. A total of 1,430 lines of VHDL code were implemented for this research. 1 library ieee; 2 use ieee.std logic 1164.all; 3 use
2015-11-11
reliable data message delivery. The basic mechanism of link-based routing schemes is the broadcasting of a control message (called a “ hello ”) to all of its...short- est path route to a destination by using the set of ex- changed hello messages between users of the network. With sufficiently high frequency... hello messages are suc- cessfully exchanged across a high error link, and since this link is of longer distance, it gets used to build a shortest path
2015-09-07
reliable data message delivery. The basic mechanism of link-based routing schemes is the broadcasting of a control message (called a “ hello ”) to all of its...short- est path route to a destination by using the set of ex- changed hello messages between users of the network. With sufficiently high frequency... hello messages are suc- cessfully exchanged across a high error link, and since this link is of longer distance, it gets used to build a shortest path
Effect of Floquet engineering on the p-wave superconductor with second-neighbor couplings
NASA Astrophysics Data System (ADS)
Li, X. P.; Li, C. F.; Wang, L. C.; Zhou, L.
2018-06-01
The influence of the Floquet engineering on a particular one-dimensional p-wave superconductor, Kitaev model, with second-neighbor couplings is investigated in this paper. The effective Hamiltonians in the rotated reference frames have been obtained, and the convergent regions of the approximated Hamiltonian as well as the topological phase diagrams have been analyzed and discussed. We show that by modulating the external driving field amplitude, frequency as well as the second-neighbor hopping amplitude, the rich phase diagrams and transitions between different topological phases can be obtained.
Polaron conductivity mechanism in oxalic acid dihydrate: ac conductivity experiment
NASA Astrophysics Data System (ADS)
Levstik, Adrijan; Filipič, Cene; Bobnar, Vid; Levstik, Iva; Hadži, Dušan
2006-10-01
The ac electrical conductivity of the oxalic acid dihydrate ( α -POX) was investigated as a function of the frequency and temperature. The real part of the complex ac electrical conductivity was found to follow the universal dielectric response σ'∝νs , indicating that hopping or tunneling of localized charge carriers governs the electrical transport. A detailed analysis of the temperature dependence of the exponent s revealed that in a broad temperature range 50-200K the tunneling of polarons is the dominating charge transport mechanism.
Blanks, Deidra A.; Buss, Emily; Grose, John H.; Fitzpatrick, Douglas C.; Hall, Joseph W.
2009-01-01
Objectives The present study investigated interaural time discrimination for binaurally mismatched carrier frequencies in listeners with normal hearing. One goal of the investigation was to gain insights into binaural hearing in patients with bilateral cochlear implants, where the coding of interaural time differences may be limited by mismatches in the neural populations receiving stimulation on each side. Design Temporal envelopes were manipulated to present low frequency timing cues to high frequency auditory channels. Carrier frequencies near 4 kHz were amplitude modulated at 128 Hz via multiplication with a half-wave rectified sinusoid, and that modulation was either in-phase across ears or delayed to one ear. Detection thresholds for non-zero interaural time differences were measured for a range of stimulus levels and a range of carrier frequency mismatches. Data were also collected under conditions designed to limit cues based on stimulus spectral spread, including masking and truncation of sidebands associated with modulation. Results Listeners with normal hearing can detect interaural time differences in the face of substantial mismatches in carrier frequency across ears. Conclusions The processing of interaural time differences in listeners with normal hearing is likely based on spread of excitation into binaurally matched auditory channels. Sensitivity to interaural time differences in listeners with cochlear implants may depend upon spread of current that results in the stimulation of neural populations that share common tonotopic space bilaterally. PMID:18596646
Ultra-wideband communication system prototype using orthogonal frequency coded SAW correlators.
Gallagher, Daniel R; Kozlovski, Nikolai Y; Malocha, Donald C
2013-03-01
This paper presents preliminary ultra-wideband (UWB) communication system results utilizing orthogonal frequency coded SAW correlators. Orthogonal frequency coding (OFC) and pseudo-noise (PN) coding provides a means for spread-spectrum UWB. The use of OFC spectrally spreads a PN sequence beyond that of CDMA; allowing for improved correlation gain. The transceiver approach is still very similar to that of the CDMA approach, but provides greater code diversity. Use of SAW correlators eliminates many of the costly components that are typically needed in the intermediate frequency (IF) section in the transmitter and receiver, and greatly reduces the signal processing requirements. Development and results of an experimental prototype system with center frequency of 250 MHz are presented. The prototype system is configured using modular RF components and benchtop pulse generator and frequency source. The SAW correlation filters used in the test setup were designed using 7 chip frequencies within the transducer. The fractional bandwidth of approximately 29% was implemented to exceed the defined UWB specification. Discussion of the filter design and results are presented and are compared with packaged device measurements. A prototype UWB system using OFC SAW correlators is demonstrated in wired and wireless configurations. OFC-coded SAW filters are used for generation of a transmitted spread-spectrum UWB and matched filter correlated reception. Autocorrelation and cross-correlation system outputs are compared. The results demonstrate the feasibility of UWB SAW correlators for use in UWB communication transceivers.
A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops
ERIC Educational Resources Information Center
Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.
2012-01-01
A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…
USDA-ARS?s Scientific Manuscript database
The temporal development of biological control of arthropod pests in perennial cropping systems is largely unreported. In this study, the development of biological control of twospotted spider mite, Tetranychus urticae Koch and hop aphid, Phorodon humuli (Schrank) in a new planting of hop in Oregon...
Hip-Hop and a Hybrid Text in a Postsecondary English Class
ERIC Educational Resources Information Center
Sanchez, Deborah M.
2010-01-01
This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…
QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)
USDA-ARS?s Scientific Manuscript database
Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...
Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy
ERIC Educational Resources Information Center
Cermak, Michael J.
2012-01-01
This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…
Teaching Controversal Topics in Contemporary German Culture through Hip-Hop
ERIC Educational Resources Information Center
Putnam, Michael
2006-01-01
This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."
Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play
ERIC Educational Resources Information Center
Broughton, Anthony
2017-01-01
Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-27
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. ER10-2658-000] HOP Energy, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes Request for Blanket Section... of HOP Energy, LLC's application for market-based rate authority, with an accompanying rate tariff...
Framing Hip Hop: New Methodologies for New Times
ERIC Educational Resources Information Center
Dimitriadis, Greg
2015-01-01
This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…
Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience
ERIC Educational Resources Information Center
Wessel, Roger D.; Wallaert, Kerry A.
2011-01-01
This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…
Hip Hop Is Now: An Evolving Youth Culture
ERIC Educational Resources Information Center
Taylor, Carl; Taylor, Virgil
2007-01-01
Emerging from Rap music, Hip Hop has become a lifestyle to many modern youth around the world. Embodying both creativity and controversy, Hip Hop mirrors the values, violence, and hypocrisy of modern culture. The authors dispel some of the simplistic views that surround this evolving youth movement embraced by millions of young people who are…
Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education
ERIC Educational Resources Information Center
Emdin, Christopher
2010-01-01
The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…
Factors of Intensification in the Hops Cluster of Chuvashia
ERIC Educational Resources Information Center
Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.
2016-01-01
The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…
Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).
Hartmann, Richard; Strunz, Walter T
2017-12-12
We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.
A study on a wheel-based stair-climbing robot with a hopping mechanism
NASA Astrophysics Data System (ADS)
Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji
2008-08-01
In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.