Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

PubMed

Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

2018-06-15

Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

Variation of p53 mutational spectra between carcinoma of the upper and lower respiratory tract.

PubMed

Law, J C; Whiteside, T L; Gollin, S M; Weissfeld, J; El-Ashmawy, L; Srivastava, S; Landreneau, R J; Johnson, J T; Ferrell, R E

1995-07-01

Mutations of the p53 tumor suppressor gene are the most common genetic alterations associated with human cancer. Tumor-associated p53 mutations often show characteristic tissue-specific profiles which may infer environmentally induced mutational mechanisms. The p53 mutational frequency and spectrum were determined for 95 carcinomas of the upper and lower respiratory tract (32 lung and 63 upper respiratory tract). Mutations were identified at a frequency of 30% in upper respiratory tract (URT) tumors and 31% in lung tumors. All 29 identified mutations were single-base substitutions. Comparison of the frequency of specific base substitutions between lung and URT showed a striking difference. Transitions occurred at a frequency of 68% in URT, but only 30% in lung. Mutations involving G:C-->A:T transitions, which are commonly reported in gastric and esophageal tumors, were the most frequently identified alteration in URT (11/19). Mutations involving G:C-->T:A transversions, which were relatively common in lung tumors (3/10) and are representative of tobacco smoke-induced mutations were rare in URT tumors (1/19). Interestingly, G:C-->A:T mutations at CpG sites, which are characteristic of endogenous processes, were observed frequently in URT tumors (9/19) but only rarely in lung tumors (1/10), suggesting that both endogenous and exogenous factors are responsible for the observed differences in mutational spectra between the upper and lower respiratory systems.

Deep Sequencing Reveals Spatially Distributed Distinct Hot Spot Mutations in DICER1-Related Multinodular Goiter.

PubMed

de Kock, Leanne; Bah, Ismaël; Revil, Timothée; Bérubé, Pierre; Wu, Mona K; Sabbaghian, Nelly; Priest, John R; Ragoussis, Jiannis; Foulkes, William D

2016-10-01

Nontoxic multinodular goiter (MNG) occurs frequently, but its genetic etiology is not well established. Familial MNG and MNG occurring with ovarian Sertoli-Leydig cell tumor are associated with germline DICER1 mutations. We recently identified second somatic DICER1 ribonuclease (RNase) IIIb mutations in two MNGs. The objective of the study was to investigate the occurrence of somatic DICER1 mutations and mutational clonality in MNG. MNGs from 15 patients (10 with and five without germline DICER1 mutations) were selected based on tissue availability. Core biopsies/scrapings (n = 70) were obtained, sampling areas of follicular hyperplasia, hyperplasia within colloid pools, unremarkable thyroid parenchyma, and areas of thyroid parenchyma, not classified. After capture with a Fluidigm access array, the coding sequence of DICER1 was deep sequenced using DNA from each core/scraping. All germline DICER1-mutated cases were found to harbor at least one RNase III mutation. Specifically, we identified 12 individually distinct DICER1 RNase IIIb hot spot mutations in 32 of the follicular hyperplasia or hyperplasia within colloid pools cores/scrapings. These mutations are predicted to affect the metal-ion binding residues at positions p.Glu1705, p.Asp1709, p.Gly1809, p.Asp1810, and p.Glu1813. Somatic RNase IIIb mutations were identified in the 10 DICER1 germline mutated MNGs as follows: two cases contained one somatic mutation, five cases contained two mutations, and three cases contained three distinct somatic hot spot mutations. No RNase IIIb mutations were identified in the MNGs from individuals without germline DICER1 mutations. This study demonstrates that nodules within MNG occurring in DICER1 syndrome are associated with spatially distributed somatic DICER1 RNase IIIb mutations.

APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation.

PubMed

Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano

2014-05-01

Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.

Nucleotide selectivity defect and mutator phenotype conferred by a colon cancer-associated DNA polymerase δ mutation in human cells

PubMed Central

Mertz, Tony M.; Baranovskiy, Andrey G.; Wang, Jing; Tahirov, Tahir H.; Shcherbakova, Polina V.

2017-01-01

Mutations in the POLD1 and POLE genes encoding DNA polymerases δ (Polδ) and ε (Polε) cause hereditary colorectal cancer (CRC) and have been found in many sporadic colorectal and endometrial tumors. Much attention has been focused on POLE exonuclease domain mutations, which occur frequently in hypermutated DNA mismatch repair (MMR)-proficient tumors and appear to be responsible for the bulk of genomic instability in these tumors. In contrast, somatic POLD1 mutations are seen less frequently and typically occur in MMR-deficient tumors. Their functional significance is often unclear. Here we demonstrate that expression of the cancer-associated POLD1-R689W allele is strongly mutagenic in human cells. The mutation rate increased synergistically when the POLD1-R689W expression was combined with a MMR defect, indicating that the mutator effect of POLD1-R689W results from a high rate of replication errors. Purified human Polδ-R689W has normal exonuclease activity, but the nucleotide selectivity of the enzyme is severely impaired, providing a mechanistic explanation for the increased mutation rate in the POLD1-R689W-expressing cells. The vast majority of mutations induced by the POLD1-R689W are GC→TA transversions and GC→AT transitions, with transversions showing a strong strand bias and a remarkable preference for polypurine/polypyrimidine sequences. The mutational specificity of the Polδ variant matches that of the hypermutated CRC cell line, HCT15, in which this variant was first identified. The results provide compelling evidence for the pathogenic role of the POLD1-R689W mutation in the development of the human tumor and emphasize the need to experimentally determine the significance of Polδ variants present in sporadic tumors. PMID:28368425

Detection of isocitrate dehydrogenase 1 mutation R132H in myelodysplastic syndrome by mutation-specific antibody and direct sequencing.

PubMed

Andrulis, Mindaugas; Capper, David; Luft, Thomas; Hartmann, Christian; Zentgraf, Hanswalter; von Deimling, Andreas

2010-08-01

Sequencing of the acute myeloid leukemia genome revealed somatic mutations in isocitrate dehydrogenase-1. Acute myeloid leukemia frequently develops from myelodysplastic syndrome. In order to test whether myelodysplastic syndrome also carries isocitrate dehydrogenase-1 mutations, we stained a series of bone marrow samples from patients with myelodysplastic syndrome using an antibody specific for the R132H mutation. Three out of 71 patients exhibited antibody binding to myeloid precursor cells. The presence of the R132H mutation was confirmed by DNA sequencing. We demonstrated that isocitrate dehydrogenase-1 mutations occur in myelodysplasia preceding acute myeloid leukemia and that the R132H alteration can be detected by immunohistochemistry. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Functional Versatility of AGY Serine Codons in Immunoglobulin Variable Region Genes

PubMed Central

Detanico, Thiago; Phillips, Matthew; Wysocki, Lawrence J.

2016-01-01

In systemic autoimmunity, autoantibodies directed against nuclear antigens (Ags) often arise by somatic hypermutation (SHM) that converts AGT and AGC (AGY) Ser codons into Arg codons. This can occur by three different single-base changes. Curiously, AGY Ser codons are far more abundant in complementarity-determining regions (CDRs) of IgV-region genes than expected for random codon use or from species-specific codon frequency data. CDR AGY codons are also more abundant than TCN Ser codons. We show that these trends hold even in cartilaginous fishes. Because AGC is a preferred target for SHM by activation-induced cytidine deaminase, we asked whether the AGY abundance was solely due to a selection pressure to conserve high mutability in CDRs regardless of codon context but found that this was not the case. Instead, AGY triplets were selectively enriched in the Ser codon reading frame. Motivated by reports implicating a functional role for poly/autoreactive specificities in antiviral antibodies, we also analyzed mutations at AGY in antibodies directed against a number of different viruses and found that mutations producing Arg codons in antiviral antibodies were indeed frequent. Unexpectedly, however, we also found that AGY codons mutated often to encode nearly all of the amino acids that are reported to provide the most frequent contacts with Ag. In many cases, mutations producing codons for these alternative amino acids in antiviral antibodies were more frequent than those producing Arg codons. Mutations producing each of these key amino acids required only single-base changes in AGY. AGY is the only codon group in which two-thirds of random mutations generate codons for these key residues. Finally, by directly analyzing X-ray structures of immune complexes from the RCSB protein database, we found that Ag-contact residues generated via SHM occurred more often at AGY than at any other codon group. Thus, preservation of AGY codons in antibody genes appears to have been driven by their exceptional functional versatility, despite potential autoreactive consequences. PMID:27920779

Retinoma: spontaneous regression of retinoblastoma or benign manifestation of the mutation?

PubMed Central

Gallie, B. L.; Ellsworth, R. M.; Abramson, D. H.; Phillips, R. A.

1982-01-01

Non-progressive retinal lesions, observed in patients known to carry the gene for retinoblastoma, have in the past been called "spontaneous regression" of retinoblastoma. This term suggests shrinkage of a malignant growth, perhaps in response to some host defence mechanism. On the basis of observations on 30 patients, we propose that the term "retinoma" would be less presumptive and more suitable. Retinoma is clinically defined as a translucent, grey, elevated mass extending into the vitreous from the retina, frequently associated with calcified foci and pigment-epithelium hyperplasia. The diagnosis of retinoma strongly suggests the presence of the retinoblastoma gene, necessitating genetic counselling and frequent observation of the retinas in the individual and his offspring. We suggest that the same mutations can cause either retinoma or retinoblastoma: benign hyperplastic nodules or retinoma when the mutations occur in relatively mature retinoblasts; and malignant retinoblastoma when the same mutations arise in immature retinoblasts. Images Fig. 1 Fig. 2 PMID:7073943

A Review of Bacteria-Animal Lateral Gene Transfer May Inform Our Understanding of Diseases like Cancer

PubMed Central

Robinson, Kelly M.; Sieber, Karsten B.; Dunning Hotopp, Julie C.

2013-01-01

Lateral gene transfer (LGT) from bacteria to animals occurs more frequently than was appreciated prior to the advent of genome sequencing. In 2007, LGT from bacterial Wolbachia endosymbionts was detected in ∼33% of the sequenced arthropod genomes using a bioinformatic approach. Today, Wolbachia/host LGT is thought to be widespread and many other cases of bacteria-animal LGT have been described. In insects, LGT may be more frequently associated with endosymbionts that colonize germ cells and germ stem cells, like Wolbachia endosymbionts. We speculate that LGT may occur from bacteria to a wide variety of eukaryotes, but only becomes vertically inherited when it occurs in germ cells. As such, LGT may happen routinely in somatic cells but never become inherited or fixed in the population. Lack of inheritance of such mutations greatly decreases our ability to detect them. In this review, we propose that such noninherited bacterial DNA integration into chromosomes in human somatic cells could induce mutations leading to cancer or autoimmune diseases in a manner analogous to mobile elements and viral integrations. PMID:24146634

How Large Asexual Populations Adapt

NASA Astrophysics Data System (ADS)

Desai, Michael

2007-03-01

We often think of beneficial mutations as being rare, and of adaptation as a sequence of selected substitutions: a beneficial mutation occurs, spreads through a population in a selective sweep, then later another beneficial mutation occurs, and so on. This simple picture is the basis for much of our intuition about adaptive evolution, and underlies a number of practical techniques for analyzing sequence data. Yet many large and mostly asexual populations -- including a wide variety of unicellular organisms and viruses -- live in a very different world. In these populations, beneficial mutations are common, and frequently interfere or cooperate with one another as they all attempt to sweep simultaneously. This radically changes the way these populations adapt: rather than an orderly sequence of selective sweeps, evolution is a constant swarm of competing and interfering mutations. I will describe some aspects of these dynamics, including why large asexual populations cannot evolve very quickly and the character of the diversity they maintain. I will explain how this changes our expectations of sequence data, how sex can help a population adapt, and the potential role of ``mutator'' phenotypes with abnormally high mutation rates. Finally, I will discuss comparisons of these predictions with evolution experiments in laboratory yeast populations.

GNAQ and GNA11 mutations occur in 9.5% of mucosal melanoma and are associated with poor prognosis.

PubMed

Sheng, Xinan; Kong, Yan; Li, Yiqian; Zhang, Qiannan; Si, Lu; Cui, Chuanliang; Chi, Zhihong; Tang, Bixia; Mao, Lili; Lian, Bin; Wang, Xuan; Yan, Xieqiao; Li, Siming; Dai, Jie; Guo, Jun

2016-09-01

Mucosal melanoma (MM) is a rare subtype of melanoma in Caucasians with extremely poor prognosis, and therapy strategy has not been clearly established for MM. We aimed to investigate the genetic aberrations possibly applicable in targeted therapy of MM. We examined the somatic mutations of GNAQ and GNA11 (GNAQ/11, encoding the guanine nucleotide-binding alpha subunits) in MM and evaluated their correlation to clinicopathologic features of MM. This study collected samples from primary lesions of 284 MM patients. Tissue samples were analysed for mutations in exons 4 and 5 of GNAQ/11 in genomic DNA by polymerase chain reaction amplification and Sanger sequencing. Correlations of GNAQ/11 mutations to clinicopathologic features and prognosis of MM were evaluated. The overall mutation frequency of GNAQ/11 in MM was 9.5% (27 in 284), with a frequency of 4.6% and 4.9% for GNAQ and GNA11 mutations, respectively. The mutations in exon 5 of GNAQ/11 occurred exclusively in codon 209. GNAQ(Q209L) was the most prevalent variation (92.3% of missense GNAQ mutations). GNAQ/11 mutations were not significantly associated with age, gender, ulceration, and primary anatomic site. The median overall survival for MM patients with GNAQ mutations (16.0 versus 26.0 months, P = 0.031) or GNA11 mutations (15.0 versus 26.0 months, P = 0.039) were significantly shorter than those for patients with wild-type GNAQ and GNA11, respectively. Our study suggests that GNAQ and GNA11 mutations occur frequently in MM and may be a prognostic factor for MM. Our data implicate that GNAQ/11 may be potential targets for targeted therapy of MM. Copyright © 2016 Elsevier Ltd. All rights reserved.

Locus-Specific Mutation Databases for Neurodegenerative Brain Diseases

PubMed Central

Cruts, Marc; Theuns, Jessie; Van Broeckhoven, Christine

2012-01-01

The Alzheimer disease and frontotemporal dementia (AD&FTLD) and Parkinson disease (PD) Mutation Databases make available curated information of sequence variations in genes causing Mendelian forms of the most common neurodegenerative brain disease AD, frontotemporal lobar degeneration (FTLD), and PD. They are established resources for clinical geneticists, neurologists, and researchers in need of comprehensive, referenced genetic, epidemiologic, clinical, neuropathological, and/or cell biological information of specific gene mutations in these diseases. In addition, the aggregate analysis of all information available in the databases provides unique opportunities to extract mutation characteristics and genotype–phenotype correlations, which would be otherwise unnoticed and unexplored. Such analyses revealed that 61.4% of mutations are private to one single family, while only 5.7% of mutations occur in 10 or more families. The five mutations with most frequent independent observations occur in 21% of AD, 43% of FTLD, and 48% of PD families recorded in the Mutation Databases, respectively. Although these figures are inevitably biased by a publishing policy favoring novel mutations, they probably also reflect the occurrence of multiple rare and few relatively common mutations in the inherited forms of these diseases. Finally, with the exception of the PD genes PARK2 and PINK1, all other genes are associated with more than one clinical diagnosis or characteristics thereof. Hum Mutat 33:1340–1344, 2012. © 2012 Wiley Periodicals, Inc. PMID:22581678

Management of hyperparathyroidism (PHP) in MEN2 syndromes in Europe.

PubMed

Alevizaki, Maria

2013-03-14

Hyperparathyroidism occurs in 20-30% of MEN2A syndrome patients. It is usually associated with mild disease and is frequently asymptomatic, especially in younger age. There is genotype/phenotype association and PHP is usually associated with codon 634 mutations; however association with more "rare" mutations has also been reported. The pathology of the parathyroid glands includes hyperplasia, adenoma or a combination of the two. The optimal surgical management of this entity has not been defined yet.

Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth.

PubMed

Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, Jörn

2017-05-23

Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell cultures from nine UL from 40-50 year old Caucasian patients with at least one UL. Cultured UL cells were investigated for loss of MED12-mutated cells. Genetic characterization of native tumor samples and adjacent myometrium was done by array analysis. "Aged" primary cultures without passaging were compared to cells of three subsequent passages. Comparative analyses of the mutated/non-mutated ratios between native tissue, primary cells, and cultured tumor cells revealed a clear decrease of MED12-mutated cells. None of the tumors showed gross alterations of the array profiles, excluding the presence of gross genomic imbalances besides the MED12 mutations as a reason for the intertumoral variation in the loss of MED12-mutated cells. Albeit at a lesser rate, loss of MED12-mutated cells from cell cultures of UL occurs even without passaging thus indicating the requirement of soluble factors or matrix components lacking in vitro. Identification of these factors can help to understand the mechanisms of the growth of the most frequent type of uterine leiomyomas and to decipher novel drug targets.

The somatic POLE P286R mutation defines a unique subclass of colorectal cancer featuring hypermutation, representing a potential genomic biomarker for immunotherapy

PubMed Central

Kim, Jihun; Kim, Deokhoon; Chun, Sung-Min; Kim, Jiyun; Kim, Tae Won; Park, Inja; Yu, Chang-Sik; Jang, Se Jin

2016-01-01

Early-onset colorectal cancers (EOCRCs) may have biological or genomic features distinct from late-onset CRCs (LOCRCs). Previous studies have mostly focused on the germline predisposition conditions of EOCRCs, but we hypothesized that EOCRCs may have distinct somatic aberrations that accelerate cancer development. To identify the somatic aberrations that accelerate cancer development at an early age, we conducted whole exome sequencing for 28 polyposis-unrelated, microsatellite stable (MSS) EOCRCs with no known germline predisposition conditions. Surprisingly, we found two distinct groups in the context of mutational burden: 6 hypermutated cases with 2325 to 10973 mutations and 22 nonhypermutated cases with 47 to 154 mutations. Further analysis revealed that four of the six hypermutated cases had the same POLE P286R mutation. We validated this finding in 83 MSS EOCRCs and 27 MSS LOCRCs, which revealed that 7.2% of EOCRCs (6/83) had the POLE P286R mutation, which was not found in LOCRCs. Clinicopathologically, EOCRCs with POLE mutations occurred far more frequently in the right colon than in the left colon, affecting men more frequently than women. In summary, we have identified a unique subclass of colon cancer characterized by a hypermutation associated with the POLE mutation. The acquisition of the POLE mutation leading to hypermutation can accelerate cancer development. Clinically, this subset with hypermutation may be susceptible to immune checkpoint blockade. PMID:27612425

Activation of the MAPK pathway is a common event in uveal melanomas although it rarely occurs through mutation of BRAF or RAS.

PubMed

Zuidervaart, W; van Nieuwpoort, F; Stark, M; Dijkman, R; Packer, L; Borgstein, A-M; Pavey, S; van der Velden, P; Out, C; Jager, M J; Hayward, N K; Gruis, N A

2005-06-06

In contrast to cutaneous melanoma, there is no evidence that BRAF mutations are involved in the activation of the mitogen-activated protein kinase (MAPK) pathway in uveal melanoma, although there is increasing evidence that this pathway is activated frequently in the latter tumours. In this study, we performed mutation analysis of the RAS and BRAF genes in a panel of 11 uveal melanoma cell lines and 19 primary uveal melanoma tumours. In addition, Western blot and immunohistochemical analyses were performed on downstream members of the MAPK pathway in order to assess the contribution of each of these components. No mutations were found in any of the three RAS gene family members and only one cell line carried a BRAF mutation (V599E). Despite this, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK), ERK and ELK were constitutively activated in all samples. These data suggest that activation of the MAPK pathway is commonly involved in the development of uveal melanoma, but occurs through a mechanism different to that of cutaneous melanoma.

Activation of the MAPK pathway is a common event in uveal melanomas although it rarely occurs through mutation of BRAF or RAS

PubMed Central

Zuidervaart, W; van Nieuwpoort, F; Stark, M; Dijkman, R; Packer, L; Borgstein, A-M; Pavey, S; van der Velden, P; Out, C; Jager, M J; Hayward, N K; Gruis, N A

2005-01-01

In contrast to cutaneous melanoma, there is no evidence that BRAF mutations are involved in the activation of the mitogen-activated protein kinase (MAPK) pathway in uveal melanoma, although there is increasing evidence that this pathway is activated frequently in the latter tumours. In this study, we performed mutation analysis of the RAS and BRAF genes in a panel of 11 uveal melanoma cell lines and 19 primary uveal melanoma tumours. In addition, Western blot and immunohistochemical analyses were performed on downstream members of the MAPK pathway in order to assess the contribution of each of these components. No mutations were found in any of the three RAS gene family members and only one cell line carried a BRAF mutation (V599E). Despite this, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK), ERK and ELK were constitutively activated in all samples. These data suggest that activation of the MAPK pathway is commonly involved in the development of uveal melanoma, but occurs through a mechanism different to that of cutaneous melanoma. PMID:15928660

Relationship between driver gene mutations, their relative protein expressions and survival in non-small cell lung carcinoma in Macao.

PubMed

Chan, Kin Iong; Vong, Hong Ting; Sin, Lai Fong; Yip, Yuk Ching; Zhong, Xue Yun; Wen, Jian Ming

2018-04-01

We report the status of most common gene mutations in non-small cell lung carcinoma (NSCLC) in Macao, and explore the relationship between each gene mutation and clinicopathologic features and survival. EGFR, KRAS and BRAF mutations were detected by PCR in 122 cases of NSCLC. ALK translocation and MET amplification were detected by fluorescence in situ hybridization (FISH). MET and thyroid transcription factor (TTF-1) were investigated by immunohistochemistry. Clinical data were collected for analyzing their correlation with the gene mutations. The mutation of EGFR, KRAS and BRAF was detected in 48 (39.3%), 13 (10.7%) and 3 (2.5%) of 122 cases of NSCLC, respectively. ALK translocation and MET amplification were detected in 7 (5.7%) and 3 cases (2.5%). The rate of EGFR mutation was significantly higher in female and non-smoker patients. In TTF-1 positive cases EGFR mutation was more frequent. Age of the patients over 62-year old was correlated with KRAS mutations. The concordance between ALK IHC and FISH was 58.3%. The MET protein in the cases with MET amplification was 100% positive. The survival was lower in the patients with positive MET protein than those with negative. MET protein was an independent prognostic factor for NSCLC. EGFR mutation occurred frequently in the female never smoke patients with NSCLC. KRAS mutation was more common in old patients. Negative MET protein expression could be used as a negative predictive marker of MET amplification. MET protein expression was an independent prognostic factor for NSCLC. © 2017 John Wiley & Sons Ltd.

Association mining of mutated cancer genes in different clinical stages across 11 cancer types.

PubMed

Hu, Wangxiong; Li, Xiaofen; Wang, Tingzhang; Zheng, Shu

2016-10-18

Many studies have demonstrated that some genes (e.g. APC, BRAF, KRAS, PTEN, TP53) are frequently mutated in cancer, however, underlying mechanism that contributes to their high mutation frequency remains unclear. Here we used Apriori algorithm to find the frequent mutational gene sets (FMGSs) from 4,904 tumors across 11 cancer types as part of the TCGA Pan-Cancer effort and then mined the hidden association rules (ARs) within these FMGSs. Intriguingly, we found that well-known cancer driver genes such as BRAF, KRAS, PTEN, and TP53 were often co-occurred with other driver genes and FMGSs size peaked at an itemset size of 3~4 genes. Besides, the number and constitution of FMGS and ARs differed greatly among different cancers and stages. In addition, FMGS and ARs were rare in endocrine-related cancers such as breast carcinoma, ovarian cystadenocarcinoma, and thyroid carcinoma, but abundant in cancers contact directly with external environments such as skin melanoma and stomach adenocarcinoma. Furthermore, we observed more rules in stage IV than in other stages, indicating that distant metastasis needed more sophisticated gene regulatory network.

Mutational landscape of antibody variable domains reveals a switch modulating the interdomain conformational dynamics and antigen binding

PubMed Central

Koenig, Patrick; Lee, Chingwei V.; Walters, Benjamin T.; Janakiraman, Vasantharajan; Stinson, Jeremy; Patapoff, Thomas W.; Fuh, Germaine

2017-01-01

Somatic mutations within the antibody variable domains are critical to the immense capacity of the immune repertoire. Here, via a deep mutational scan, we dissect how mutations at all positions of the variable domains of a high-affinity anti-VEGF antibody G6.31 impact its antigen-binding function. The resulting mutational landscape demonstrates that large portions of antibody variable domain positions are open to mutation, and that beneficial mutations can be found throughout the variable domains. We determine the role of one antigen-distal light chain position 83, demonstrating that mutation at this site optimizes both antigen affinity and thermostability by modulating the interdomain conformational dynamics of the antigen-binding fragment. Furthermore, by analyzing a large number of human antibody sequences and structures, we demonstrate that somatic mutations occur frequently at position 83, with corresponding domain conformations observed for G6.31. Therefore, the modulation of interdomain dynamics represents an important mechanism during antibody maturation in vivo. PMID:28057863

SETD2 is recurrently mutated in whole-exome sequenced canine osteosarcoma.

PubMed

Sakthikumar, Sharadha; Elvers, Ingegerd; Kim, Jaegil; Arendt, Maja L; Thomas, Rachael; Turner-Maier, Jason; Swofford, Ross; Johnson, Jeremy; Schumacher, Steven E; Alföldi, Jessica; Axelsson, Erik; Couto, Guillermo; Kisseberth, William; Pettersson, Mats E; Getz, Gad; Meadows, Jennifer R S; Modiano, Jaime F; Breen, Matthew; Kierczak, Marcin; Forsberg-Nilsson, Karin; Marinescu, Voichita D; Lindblad-Toh, Kerstin

2018-05-03

Osteosarcoma (OSA) is a debilitating bone cancer that affects humans, especially children and adolescents. A homologous form of OSA spontaneously occurs in dogs, and its differential incidence observed across breeds allows for the investigation of tumor mutations in the context of multiple genetic backgrounds. Using whole-exome sequencing and dogs from three susceptible breeds (22 golden retrievers, 21 Rottweilers, and 23 greyhounds), we found that OSA tumors show a high frequency of somatic copy number alterations (SCNA) affecting key oncogenes and tumor suppressor genes. The across-breed results are similar to what has been observed for human OSA, but the disease frequency and somatic mutation counts vary in the three breeds. For all breeds, three mutational signatures (one of which has not been previously reported), and eleven significantly mutated genes were identified. TP53 was the most frequently altered gene (83% of dogs have either mutations or SCNA in TP53), recapitulating observations in human OSA. The second most frequently mutated gene, histone methyltransferase SETD2, has known roles in multiple cancers, but has not previously been strongly implicated in OSA. This study points to the likely importance of histone modifications in OSA and highlights the strong genetic similarities between human and dog OSA, suggesting that canine OSA may serve as an excellent model for developing treatment strategies in both species. Copyright ©2018, American Association for Cancer Research.

Characterization of potential driver mutations involved in human breast cancer by computational approaches

PubMed Central

Rajendran, Barani Kumar; Deng, Chu-Xia

2017-01-01

Breast cancer is the second most frequently occurring form of cancer and is also the second most lethal cancer in women worldwide. A genetic mutation is one of the key factors that alter multiple cellular regulatory pathways and drive breast cancer initiation and progression yet nature of these cancer drivers remains elusive. In this article, we have reviewed various computational perspectives and algorithms for exploring breast cancer driver mutation genes. Using both frequency based and mutational exclusivity based approaches, we identified 195 driver genes and shortlisted 63 of them as candidate drivers for breast cancer using various computational approaches. Finally, we conducted network and pathway analysis to explore their functions in breast tumorigenesis including tumor initiation, progression, and metastasis. PMID:28477017

HIV subtype, epidemiological and mutational correlations in patients from Paraná, Brazil.

PubMed

Silva, Monica Maria Gomes da; Telles, Flavio Queiroz; da Cunha, Clovis Arns; Rhame, Frank S

2010-01-01

Analyze patients with HIV infection from Curitiba, Paraná, their epidemiological characteristics and HIV RAM. Patients regularly followed in an ID Clinic had their medical data evaluated and cases of virological failure were analyzed with genotypic report. Patients with complete medical charts were selected (n = 191). Demographic and clinical characteristics were compared. One hundred thirty two patients presented with subtype B infection (69.1%), 41 subtype C (21.5%), 10 subtype F (5.2%), 7 BF (3.7%) and 1 CF (0.5%). Patients with subtype B infection had been diagnosed earlier than patients with subtype non-B. Also, subtype B infection was more frequent in men who have sex with men, while non-B subtypes occurred more frequently in heterosexuals and women. Patients with previous history of three classes of ARVs (n = 161) intake were selected to evaluate resistance. For RT inhibitors, 41L and 210W were more frequently observed in subtype B than in non-B strains. No differences between subtypes and mutations were observed to NNTRIs. Mutations at 10, 32 and 63 position of protease were more observed in subtype B viruses than non-B, while positions 20 and 36 of showed more amino acid substitutions in subtype non-B viruses. Patients with history of NFV intake were evaluated to resistance pathway. The 90M pathway was more frequent in subtypes B and non-B. Mutations previously reported as common in non-B viruses, such as 65R and 106M, were uncommon in our study. Mutations 63P and 36I, previously reported as common in HIV-1 subtypes B and C from Brazil, respectively, were common. There is a significant frequency of HIV-1 non-B infections in Paraná state, with isolates classified as subtypes C, F, BF and BC. Patients with subtype C infection were more frequently female, heterosexual and had a longer average time of HIV diagnosis.

Monogenic autoinflammatory diseases: General concepts and presentation in adult patients.

PubMed

Hernández-Rodríguez, José; Ruiz-Ortiz, Estíbaliz; Yagüe, Jordi

2018-01-23

Monogenic autoinflammatory diseases (AIFD) are rare disorders characterized by an uncontrolled increase of the systemic inflammatory response, which is caused by mutations in genes involved in inflammatory pathways. Over the last few years, new genes and proteins responsible for new monogenic AIFD have been identified and a substantial improvement in their treatment has been achieved. Monogenic AIFD manifestations typically begin during childhood, but they can also occur in adults. Compared to pediatric patients, adults usually present with a less severe disease and fewer long-term complications. In addition, patients with adult-onset disease carry low-penetrance mutations more often than pathogenic variants. A late-onset of AIFD may be occasionally associated with the presence of somatic mutations. In this study, we review the most frequent monogenic AIFD, and others recently described, which may occur during adulthood. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Spliceosomal gene aberrations are rare, coexist with oncogenic mutations, and are unlikely to exert a driver effect in childhood MDS and JMML.

PubMed

Hirabayashi, Shinsuke; Flotho, Christian; Moetter, Jessica; Heuser, Michael; Hasle, Henrik; Gruhn, Bernd; Klingebiel, Thomas; Thol, Felicitas; Schlegelberger, Brigitte; Baumann, Irith; Strahm, Brigitte; Stary, Jan; Locatelli, Franco; Zecca, Marco; Bergstraesser, Eva; Dworzak, Michael; van den Heuvel-Eibrink, Marry M; De Moerloose, Barbara; Ogawa, Seishi; Niemeyer, Charlotte M; Wlodarski, Marcin W

2012-03-15

Somatic mutations of the spliceosomal machinery occur frequently in adult patients with myelodysplastic syndrome (MDS). We resequenced SF3B1, U2AF35, and SRSF2 in 371 children with MDS or juvenile myelomonocytic leukemia. We found missense mutations in 2 juvenile myelomonocytic leukemia cases and in 1 child with systemic mastocytosis with MDS. In 1 juvenile myelomonocytic leukemia patient, the SRSF2 mutation that initially coexisted with an oncogenic NRAS mutation was absent at relapse, whereas the NRAS mutation persisted and a second, concomitant NRAS mutation later emerged. The patient with systemic mastocytosis and MDS carried both mutated U2AF35 and KIT in a single clone as confirmed by clonal sequencing. In the adult MDS patients sequenced for control purposes, we detected previously reported mutations in 7/30 and a novel SRSF2 deletion (c.284_307del) in 3 of 30 patients. These findings implicate that spliceosome mutations are rare in pediatric MDS and juvenile myelomonocytic leukemia and are unlikely to operate as driver mutations.

Exploring the common molecular basis for the universal DNA mutation bias: Revival of Loewdin mutation model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Liang-Yu; Center for Bioinformatics, Huazhong Agricultural University, Wuhan 430070; Wang, Guang-Zhong

2011-06-10

Highlights: {yields} There exists a universal G:C {yields} A:T mutation bias in three domains of life. {yields} This universal mutation bias has not been sufficiently explained. {yields} A DNA mutation model proposed by Loewdin 40 years ago offers a common explanation. -- Abstract: Recently, numerous genome analyses revealed the existence of a universal G:C {yields} A:T mutation bias in bacteria, fungi, plants and animals. To explore the molecular basis for this mutation bias, we examined the three well-known DNA mutation models, i.e., oxidative damage model, UV-radiation damage model and CpG hypermutation model. It was revealed that these models cannot providemore » a sufficient explanation to the universal mutation bias. Therefore, we resorted to a DNA mutation model proposed by Loewdin 40 years ago, which was based on inter-base double proton transfers (DPT). Since DPT is a fundamental and spontaneous chemical process and occurs much more frequently within GC pairs than AT pairs, Loewdin model offers a common explanation for the observed universal mutation bias and thus has broad biological implications.« less

Mutations in ALDH1A3 represent a frequent cause of microphthalmia/anophthalmia in consanguineous families.

PubMed

Abouzeid, Hana; Favez, Tatiana; Schmid, Angélique; Agosti, Céline; Youssef, Mohammed; Marzouk, Iman; El Shakankiry, Nihal; Bayoumi, Nader; Munier, Francis L; Schorderet, Daniel F

2014-08-01

Anophthalmia or microphthalmia (A/M), characterized by absent or small eye, can be unilateral or bilateral and represent developmental anomalies due to the mutations in several genes. Recently, mutations in aldehyde dehydrogenase family 1, member A3 (ALDH1A3) also known as retinaldehyde dehydrogenase 3, have been reported to cause A/M. Here, we screened a cohort of 75 patients with A/M and showed that mutations in ALDH1A3 occurred in six families. Based on this series, we estimate that mutations in ALDH1A3 represent a major cause of A/M in consanguineous families, and may be responsible for approximately 10% of the cases. Screening of this gene should be performed in a first line of investigation, together with SOX2. © 2014 WILEY PERIODICALS, INC.

High frequency of GATA2 mutations in patients with mild chronic neutropenia evolving to MonoMac syndrome, myelodysplasia, and acute myeloid leukemia.

PubMed

Pasquet, Marlène; Bellanné-Chantelot, Christine; Tavitian, Suzanne; Prade, Naïs; Beaupain, Blandine; Larochelle, Olivier; Petit, Arnaud; Rohrlich, Pierre; Ferrand, Christophe; Van Den Neste, Eric; Poirel, Hélène A; Lamy, Thierry; Ouachée-Chardin, Marie; Mansat-De Mas, Véronique; Corre, Jill; Récher, Christian; Plat, Geneviève; Bachelerie, Françoise; Donadieu, Jean; Delabesse, Eric

2013-01-31

Congenital neutropenia is a group of genetic disorders that involve chronic neutropenia and susceptibility to infections. These neutropenias may be isolated or associated with immunologic defects or extra-hematopoietic manifestations. Complications may occur as infectious diseases, but also less frequently as myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML). Recently, the transcription factor GATA2 has been identified as a new predisposing gene for familial AML/MDS. In the present study, we describe the initial identification by exome sequencing of a GATA2 R396Q mutation in a family with a history of chronic mild neutropenia evolving to AML and/or MDS. The subsequent analysis of the French Severe Chronic Neutropenia Registry allowed the identification of 6 additional pedigrees and 10 patients with 6 different and not previously reportedGATA2 mutations (R204X, E224X, R330X, A372T, M388V, and a complete deletion of the GATA2 locus). The frequent evolution to MDS and AML in these patients reveals the importance of screening GATA2 in chronic neutropenia associated with monocytopenia because of the frequent hematopoietic transformation, variable clinical expression at onset, and the need for aggressive therapy in patients with poor clinical outcome. Mutations of key transcription factor in myeloid malignancies.

The role of LKB1 in lung cancer.

PubMed

Sanchez-Cespedes, Montse

2011-09-01

In humans, the LKB1 gene is located on the short arm of chromosome 19, which is frequently deleted in lung tumors. Unlike most cancers of sporadic origin, in non-small cell lung cancer (NSCLC) nearly half of the tumors harbor somatic and homozygous inactivating mutations in LKB1. In NSCLC, LKB1 inactivation strongly predominates in adenocarcinomas from smokers and coexists with mutations at other important cancer genes, including KRAS and TP53. Remarkably, LKB1 alterations frequently occur simultaneously with inactivation at another important tumor suppressor gene, BRG1 (also called SMARCA4), which is also located on chromosome 19p. The present review considers the frequency and pattern of LKB1 mutations in lung cancer and the distinct biological pathways in which the LKB1 protein is involved in the development of this type of cancer. Finally, the possible clinical applications in cancer management, especially in lung cancer treatment, associated with the presence of absence of LKB1 are discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi

Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivationmore » of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.« less

The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe.

PubMed

Maugeri, Alessandra; Flothmann, Kris; Hemmrich, Nadine; Ingvast, Sofie; Jorge, Paula; Paloma, Eva; Patel, Reshma; Rozet, Jean-Michel; Tammur, Jaana; Testa, Francesco; Balcells, Susana; Bird, Alan C; Brunner, Han G; Hoyng, Carel B; Metspalu, Andres; Simonelli, Francesca; Allikmets, Rando; Bhattacharya, Shomi S; D'Urso, Michele; Gonzàlez-Duarte, Roser; Kaplan, Josseline; te Meerman, Gerard J; Santos, Rosário; Schwartz, Marianne; Van Camp, Guy; Wadelius, Claes; Weber, Bernhard H F; Cremers, Frans P M

2002-03-01

Inherited retinal dystrophies represent the most important cause of vision impairment in adolescence, affecting approximately 1 out of 3000 individuals. Mutations of the photoreceptor-specific gene ABCA4 (ABCR) are a common cause of retinal dystrophy. A number of mutations have been repeatedly reported for this gene, notably the 2588G>C mutation which is frequent in both patients and controls. Here we ascertained the frequency of the 2588G>C mutation in a total of 2343 unrelated random control individuals from 11 European countries and 241 control individuals from the US, as well as in 614 patients with STGD both from Europe and the US. We found an overall carrier frequency of 1 out of 54 in Europe, compared with 1 out of 121 in the US, confirming that the 2588G>C ABCA4 mutation is one of the most frequent autosomal recessive mutations in the European population. Carrier frequencies show an increasing gradient in Europe from South-West to North-East. The lowest carrier frequency, 0 out of 199 (0%), was found in Portugal; the highest, 11 out of 197 (5.5%), was found in Sweden. Haplotype analysis in 16 families segregating the 2588G>C mutation showed four intragenic polymorphisms invariably present in all 16 disease chromosomes and sharing of the same allele for several markers flanking the ABCA4 locus in most of the disease chromosomes. These results indicate a single origin of the 2588G>C mutation which, to our best estimate, occurred between 2400 and 3000 years ago.

Investigation of mutation distribution in DNA gyrase and topoisomerase IV genes in ciprofloxacin-non-susceptible Enterobacteriaceae isolated from blood cultures in a tertiary care university hospital in South Korea, 2005-2010.

PubMed

Nam, You Sun; Cho, Sun Young; Yang, Hee Young; Park, Kyung Sun; Jang, Ji-Hyun; Kim, Yun-Tae; Jeong, Joo-Won; Suh, Jin-Tae; Lee, Hee Joo

2013-02-01

This study investigated the distribution of mutations in DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE) genes and compared the distribution of these mutations with the distribution of plasmid-mediated quinolone resistance (PMQR) genes and extended-spectrum β-lactamase (ESBL) production in 101 ciprofloxacin-non-susceptible Enterobacteriaceae from blood culture isolates (80 Escherichia coli and 21 Klebsiella pneumoniae) isolated in Kyung Hee University Hospital, a tertiary care university hospital in Seoul, South Korea. Among the 101 isolates, 80 (79.2%) contained PMQR genes and 28 (27.7%) produced ESBL. Mutations in the gyrA and parC genes were observed more frequently than in the gyrB and parE genes as well as more frequently in E. coli than in K. pneumoniae isolates, even in the same ciprofloxacin minimum inhibitory concentration (MIC) range of the two species. In E. coli isolates, the distribution of the codon 529 mutation (Ile→Leu) in parE was increased with an increase in the ciprofloxacin MIC. An increase in high-level resistance to quinolones may occur with double mutations compared with a single mutation in gyrA as well as with additional mutations in parC. However, this finding could not be applied to ciprofloxacin-resistant K. pneumoniae. A higher level of quinolone resistance may be correlated with an additional mutation in parE, especially Ile529→Leu. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

PubMed

Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

2011-06-01

Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for the possible influence of non-HFE iron homeostasis regulators and their modulation on the course of chronic liver disease and liver cirrhosis.

Angioimmunoblastic T-cell lymphoma: more than a disease of T follicular helper cells.

PubMed

Lemonnier, François; Mak, Tak W

2017-08-01

Angioimmunoblastic T-cell lymphoma (AITL) is one of the most frequent entities of peripheral T-cell lymphoma. An AITL has two components: the AITL tumour cells, which have a T follicular helper (TFH) cell phenotype, and a surrounding and extensive tumour microenvironment that is populated with various reactive cell types, including B cells. Recurrent TET2 mutations have been described in 50-80% of AITLs, possibly occurring in a haematopoietic progenitor cell. An article published recently in the Journal of Pathology describes the use of microdissection to isolate PD1 + AITL tumour cells and CD20 + B cells from the AITL microenvironment, and to show that TET2 mutations are actually more frequent in these diseases than previously thought. Whereas TET2 mutations were detected in only six of 13 AITLs, 12 of 13 samples of microdissected PD1 + AITL tumour cells possessed this mutation. Moreover, TET2 mutations were detected in CD20 + B cells from the AITL microenvironment in six of nine informative cases. These results confirm that TET2 mutation is an early event in the majority of AITL cases, and that the driving molecular anomalies are not restricted to the T lineage tumour cells. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Impact of mutational profiles on response of primary oestrogen receptor-positive breast cancers to oestrogen deprivation.

PubMed

Gellert, Pascal; Segal, Corrinne V; Gao, Qiong; López-Knowles, Elena; Martin, Lesley-Ann; Dodson, Andrew; Li, Tiandao; Miller, Christopher A; Lu, Charles; Mardis, Elaine R; Gillman, Alexa; Morden, James; Graf, Manuela; Sidhu, Kally; Evans, Abigail; Shere, Michael; Holcombe, Christopher; McIntosh, Stuart A; Bundred, Nigel; Skene, Anthony; Maxwell, William; Robertson, John; Bliss, Judith M; Smith, Ian; Dowsett, Mitch

2016-11-09

Pre-surgical studies allow study of the relationship between mutations and response of oestrogen receptor-positive (ER+) breast cancer to aromatase inhibitors (AIs) but have been limited to small biopsies. Here in phase I of this study, we perform exome sequencing on baseline, surgical core-cuts and blood from 60 patients (40 AI treated, 20 controls). In poor responders (based on Ki67 change), we find significantly more somatic mutations than good responders. Subclones exclusive to baseline or surgical cores occur in ∼30% of tumours. In phase II, we combine targeted sequencing on another 28 treated patients with phase I. We find six genes frequently mutated: PIK3CA, TP53, CDH1, MLL3, ABCA13 and FLG with 71% concordance between paired cores. TP53 mutations are associated with poor response. We conclude that multiple biopsies are essential for confident mutational profiling of ER+ breast cancer and TP53 mutations are associated with resistance to oestrogen deprivation therapy.

Mutalisk: a web-based somatic MUTation AnaLyIS toolKit for genomic, transcriptional and epigenomic signatures.

PubMed

Lee, Jongkeun; Lee, Andy Jinseok; Lee, June-Koo; Park, Jongkeun; Kwon, Youngoh; Park, Seongyeol; Chun, Hyonho; Ju, Young Seok; Hong, Dongwan

2018-05-22

Somatic genome mutations occur due to combinations of various intrinsic/extrinsic mutational processes and DNA repair mechanisms. Different molecular processes frequently generate different signatures of somatic mutations in their own favored contexts. As a result, the regional somatic mutation rate is dependent on the local DNA sequence, the DNA replication/RNA transcription dynamics and epigenomic chromatin organization landscape in the genome. Here, we propose an online computational framework, termed Mutalisk, which correlates somatic mutations with various genomic, transcriptional and epigenomic features in order to understand mutational processes that contribute to the generation of the mutations. This user-friendly tool explores the presence of localized hypermutations (kataegis), dissects the spectrum of mutations into the maximum likelihood combination of known mutational signatures and associates the mutation density with numerous regulatory elements in the genome. As a result, global patterns of somatic mutations in any query sample can be efficiently screened, thus enabling a deeper understanding of various mutagenic factors. This tool will facilitate more effective downstream analyses of cancer genome sequences to elucidate the diversity of mutational processes underlying the development and clonal evolution of cancer cells. Mutalisk is freely available at http://mutalisk.org.

CTCF genetic alterations in endometrial carcinoma are pro-tumorigenic

PubMed Central

Marshall, A D; Bailey, C G; Champ, K; Vellozzi, M; O'Young, P; Metierre, C; Feng, Y; Thoeng, A; Richards, A M; Schmitz, U; Biro, M; Jayasinghe, R; Ding, L; Anderson, L; Mardis, E R; Rasko, J E J

2017-01-01

CTCF is a haploinsufficient tumour suppressor gene with diverse normal functions in genome structure and gene regulation. However the mechanism by which CTCF haploinsufficiency contributes to cancer development is not well understood. CTCF is frequently mutated in endometrial cancer. Here we show that most CTCF mutations effectively result in CTCF haploinsufficiency through nonsense-mediated decay of mutant transcripts, or loss-of-function missense mutation. Conversely, we identified a recurrent CTCF mutation K365T, which alters a DNA binding residue, and acts as a gain-of-function mutation enhancing cell survival. CTCF genetic deletion occurs predominantly in poor prognosis serous subtype tumours, and this genetic deletion is associated with poor overall survival. In addition, we have shown that CTCF haploinsufficiency also occurs in poor prognosis endometrial clear cell carcinomas and has some association with endometrial cancer relapse and metastasis. Using shRNA targeting CTCF to recapitulate CTCF haploinsufficiency, we have identified a novel role for CTCF in the regulation of cellular polarity of endometrial glandular epithelium. Overall, we have identified two novel pro-tumorigenic roles (promoting cell survival and altering cell polarity) for genetic alterations of CTCF in endometrial cancer. PMID:28319062

Chromosome 12p deletions in TEL-AML1 childhood acute lymphoblastic leukemia are associated with retrotransposon elements and occur postnatally

PubMed Central

Hofmann, Jerry; Kang, Michelle; Selzer, Rebecca; Green, Roland; Zhou, Mi; Zhong, Sheng; Zhang, Luoping; Smith, Martyn T.; Marsit, Carmen; Loh, Mignon; Buffler, Patricia; Yeh, Ru-Fang

2008-01-01

TEL-AML1 (ETV6-RUNX1) is the most common translocation in the childhood leukemias, and is a prenatal mutation in most children. This translocation has been detected at a high rate among newborns (∼1%); therefore the rate-limiting event for leukemia appears to be secondary mutations. A frequent such mutation in this subtype is partial deletion of chromosome 12p, trans from the translocation. Nine del(12p) breakpoints within six leukemia cases were sequenced to explore the etiology of this genetic event, and most involved cryptic sterile translocations. Twelve of 18 del(12p) parent sequences involved in these breakpoints were located in repeat regions (8 of these in Long Interspersed Nuclear Elements, or LINEs). This stands in contrast to TEL-AML1, in which only 21 of 110 previously assessed breakpoints (19%) occur in DNA repeats (P = 0.0001). An exploratory assessment of archived neonatal blood cards (ANB cards) revealed significantly more LINE CpG methylation in individuals at birth who were later diagnosed with TEL-AML1 leukemia, compared to individuals who did not contract leukemia (P = 0.01). Nontemplate nucleotides were also more frequent in del(12p) than in TEL-AML1 junctions (P = 0.004) suggesting formation by terminal deoxynucleotidyl transferase. Assessment of six ANB cards indicated that no del(12p) rearrangements backtracked to birth, although two of these patients were previously positive for TEL-AML1 using the same assay with comparable sensitivity. These data are compatible with the a two-stage natural history: TEL-AML1 occurs prenatally, and del(12p) occurs postnatally in more mature cells with a structure that suggests the involvement of retrotransposon instability. PMID:19047175

Concurrent Oncogene Mutation Profile in Chinese Patients With Stage Ib Lung Adenocarcinoma

PubMed Central

Wen, Ying-Sheng; Cai, Ling; Zhang, Xue-wen; Zhu, Jian-fei; Zhang, Zi-chen; Shao, Jian-yong; Zhang, Lan-Jun

2014-01-01

Abstract Molecular characteristics in lung cancer are associated with carcinogenesis, response to targeted therapies, and prognosis. With concurrent oncogene mutations being reported more often, the adjustment of treatment based on the driver gene mutations would improve therapy. We proposed to investigate the distribution of concurrent oncogene mutations in stage Ib lung adenocarcinoma in a Chinese population and find out the correlation between survival outcome and the most frequently mutated genes in EGFR and KRAS in Chinese population. Simultaneously, we tried to validate the Sequenom method by real time fluoresce qualification reverse transcription polymerase chain reaction (RT-PCR) in oncogene detection. One hundred fifty-six patients who underwent complete surgical resection in our hospital between 1999 and 2007 were retrospectively investigated. Using time-of-flight mass spectrometry, 238 mutation hotspots in 19 oncogenes were examined. Genetic mutations occurred in 86 of 156 patients (55.13%). EGFR was most frequently gene contained driver mutations, with a rate of 44.23%, followed by KRAS (8.33%), PIK3CA (3.84%), KIT (3.20%), BRAF (2.56%), AKT (1.28%), MET (0.64%), NRAS (0.64%), HRAS (0.64%), and ERBB2 (0.64%). No mutations were found in the RET, PDGFRA, FGFR1, FGFR3, FLT3, ABL, CDK, or JAK2 oncogenes. Thirteen patients (8.3%) were detected in multiple gene mutations. Six patients had PIK3CA mutations in addition to mutations in EGFR and KRAS. EGFR mutations can coexist with mutations in NRAS, KIT, ERBB2, and BRAF. Only one case was found to have a KRAS mutation coexisting with the EGFR T790M mutation. Otherwise, mutations in EGFR and KRAS seem to be mutually exclusive. There is no survival benefit in favor of EGFR/KRAS mutation. Several concomitant driver gene mutations were observed in our study. None of EFGR/KRAS mutation was demonstrated as a prognostic factor. Polygenic mutation testing by time-of-flight mass spectrometry was validated by RT-PCR, which can be an alternative option to test for multiple mutations and can be widely applied to clinical practice and help to guide treatment. PMID:25546673

KRAS mutations: variable incidences in a Brazilian cohort of 8,234 metastatic colorectal cancer patients

PubMed Central

2014-01-01

Background KRAS mutations are frequently found in colorectal cancer (CRC) indicating the importance of its genotyping in the study of the molecular mechanisms behind this disease. Although major advances have occurred over the past decade, there are still important gaps in our understanding of CRC carcinogenesis, particularly whether sex-linked factors play any role. Methods The profile of KRAS mutations in the Brazilian population was analyzed by conducting direct sequencing of KRAS codons 12 and 13 belonging to 8,234 metastatic CRC patient samples. DNA was extracted from paraffin-embedded tissue, exon 1 was amplified by PCR and submitted to direct sequencing. The data obtained was analysed comparing different geographical regions, gender and age. Results The median age was 59 years and the overall percentage of wild-type and mutated KRAS was 62.8% and 31.9%, respectively. Interestingly, different percentages of mutated KRAS patients were observed between male and female patients (32.5% versus 34.8%, respectively; p = 0.03). KRAS Gly12Asp mutation was the most prevalent for both genders and for most regions, with the exception of the North where Gly12Val was the most frequent mutation found. Conclusions To the best of our knowledge this is one of the largest cohorts of KRAS genotyping in CRC patients and the largest to indicate a higher incidence of KRAS mutation in females compared to males in Brazil. Nevertheless, further research is required to better address the impact of gender differences in colorectal cancer. PMID:24720724

Targeted next generation sequencing of parotid gland cancer uncovers genetic heterogeneity.

PubMed

Grünewald, Inga; Vollbrecht, Claudia; Meinrath, Jeannine; Meyer, Moritz F; Heukamp, Lukas C; Drebber, Uta; Quaas, Alexander; Beutner, Dirk; Hüttenbrink, Karl-Bernd; Wardelmann, Eva; Hartmann, Wolfgang; Büttner, Reinhard; Odenthal, Margarete; Stenner, Markus

2015-07-20

Salivary gland cancer represents a heterogeneous group of malignant tumors. Due to their low incidence and the existence of multiple morphologically defined subtypes, these tumors are still poorly understood with regard to their molecular pathogenesis and therapeutically relevant genetic alterations.Performing a systematic and comprehensive study covering 13 subtypes of salivary gland cancer, next generation sequencing was done on 84 tissue samples of parotid gland cancer using multiplex PCR for enrichment of cancer related gene loci covering hotspots of 46 cancer genes.Mutations were identified in 22 different genes. The most frequent alterations affected TP53, followed by RAS genes, PIK3CA, SMAD4 and members of the ERB family. HRAS mutations accounted for more than 90% of RAS mutations, occurring especially in epithelial-myoepithelial carcinomas and salivary duct carcinomas. Additional mutations in PIK3CA also affected particularly epithelial-myoepithelial carcinomas and salivary duct carcinomas, occurring simultaneously with HRAS mutations in almost all cases, pointing to an unknown and therapeutically relevant molecular constellation. Interestingly, 14% of tumors revealed mutations in surface growth factor receptor genes including ALK, HER2, ERBB4, FGFR, cMET and RET, which might prove to be targetable by new therapeutic agents. 6% of tumors revealed mutations in SMAD4.In summary, our data provide novel insight into the fundamental molecular heterogeneity of salivary gland cancer, relevant in terms of tumor classification and the establishment of targeted therapeutic concepts.

Recurrent and founder mutations in the PMS2 gene

PubMed Central

Tomsic, Jerneja; Senter, Leigha; Liyanarachchi, Sandya; Clendenning, Mark; Vaughn, Cecily P.; Jenkins, Mark A.; Hopper, John L.; Young, Joanne; Samowitz, Wade; de la Chapelle, Albert

2012-01-01

Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However some mutations are observed repeatedly, across individuals not known to be related, due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations, one (c.903G>T) a probable founder, and one (c.1A>G) where founder mutation status could not be evaluated. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. PMID:22577899

Recurrent and founder mutations in the PMS2 gene.

PubMed

Tomsic, J; Senter, L; Liyanarachchi, S; Clendenning, M; Vaughn, C P; Jenkins, M A; Hopper, J L; Young, J; Samowitz, W; de la Chapelle, A

2013-03-01

Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However, some mutations are observed repeatedly across individuals not known to be related due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here, we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations and one (c.903G>T) a probable founder. One (c.1A>G) could not be evaluated for founder mutation status. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. © 2012 John Wiley & Sons A/S.

Microarray-based mutation detection and phenotypic characterization in Korean patients with retinitis pigmentosa

PubMed Central

Kim, Cinoo; Kim, Kwang Joong; Bok, Jeong; Lee, Eun-Ju; Kim, Dong-Joon; Oh, Ji Hee; Park, Sung Pyo; Shin, Joo Young; Lee, Jong-Young

2012-01-01

Purpose To evaluate microarray-based genotyping technology for the detection of mutations responsible for retinitis pigmentosa (RP) and to perform phenotypic characterization of patients with pathogenic mutations. Methods DNA from 336 patients with RP and 360 controls was analyzed using the GoldenGate assay with microbeads containing 95 previously reported disease-associated mutations from 28 RP genes. Mutations identified by microarray-based genotyping were confirmed by direct sequencing. Segregation analysis and phenotypic characterization were performed in patients with mutations. The disease severity was assessed by visual acuity, electroretinography, optical coherence tomography, and kinetic perimetry. Results Ten RP-related mutations of five RP genes (PRP3 pre-mRNA processing factor 3 homolog [PRPF3], rhodopsin [RHO], phosphodiesterase 6B [PDE6B], peripherin 2 [PRPH2], and retinitis pigmentosa 1 [RP1]) were identified in 26 of the 336 patients (7.7%) and in six of the 360 controls (1.7%). The p.H557Y mutation in PDE6B, which was homozygous in four patients and heterozygous in nine patients, was the most frequent mutation (2.5%). Mutation segregation was assessed in four families. Among the patients with missense mutations, the most severe phenotype occurred in patients with p.D984G in RP1; less severe phenotypes occurred in patients with p.R135W in RHO; a relatively moderate phenotype occurred in patients with p.T494M in PRPF3, p.H557Y in PDE6B, or p.W316G in PRPH2; and a mild phenotype was seen in a patient with p.D190N in RHO. Conclusions The results reveal that the GoldenGate assay may not be an efficient method for molecular diagnosis in RP patients with rare mutations, although it has proven to be reliable and efficient for high-throughput genotyping of single-nucleotide polymorphisms. The clinical features varied according to the mutations. Continuous effort to identify novel RP genes and mutations in a population is needed to improve the efficiency and accuracy of the genetic diagnosis of RP. PMID:23049240

The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

PubMed Central

Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

2017-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

Predominant RET Germline Mutations in Exons 10, 11, and 16 in Iranian Patients with Hereditary Medullary Thyroid Carcinoma

PubMed Central

Hedayati, Mehdi; Zarif Yeganeh, Marjan; Sheikhol Eslami, Sara; Rezghi Barez, Shekoofe; Hoghooghi Rad, Laleh; Azizi, Fereidoun

2011-01-01

Medullary thyroid carcinoma occurs in both sporadic (75%) and hereditary (25%) forms. The missense mutations of RET proto-oncogene in MTC development have been well demonstrated. To investigate the spectrum of predominant RET germline mutations in exons 10, 11, and 16 in hereditary MTC in Iranian population, 217 participants were included. Genomic DNAs were extracted from the leukocytes using the standard Salting Out/Proteinase K method. Mutation detection was performed through PCR-RFLP and DNA sequencing. In 217 participants, 43 missense mutations were identified in exons 10 (6%), 11 (13%), and 16 (0.9%). Moreover, a novel germline mutation was detected in exon 11 (S686N). Also four different polymorphisms were found in intron 16 in eight patients. The obtained data showed the frequency profile of RET mutations in Iranian individuals with MTC (19.8%). The most frequent mutation in our population was C634G whereas in most population it was C634R. Altogether, these results underline the importance of the genetic background of family members of any patient with MTC. PMID:21765987

High frequency of GATA2 mutations in patients with mild chronic neutropenia evolving to MonoMac syndrome, myelodysplasia, and acute myeloid leukemia

PubMed Central

Pasquet, Marlène; Bellanné-Chantelot, Christine; Tavitian, Suzanne; Prade, Naïs; Beaupain, Blandine; LaRochelle, Olivier; Petit, Arnaud; Rohrlich, Pierre; Ferrand, Christophe; Van Den Neste, Eric; Poirel, Hélène A.; Lamy, Thierry; Ouachée-Chardin, Marie; Mansat-De Mas, Véronique; Corre, Jill; Récher, Christian; Plat, Geneviève; Bachelerie, Françoise; Donadieu, Jean

2013-01-01

Congenital neutropenia is a group of genetic disorders that involve chronic neutropenia and susceptibility to infections. These neutropenias may be isolated or associated with immunologic defects or extra-hematopoietic manifestations. Complications may occur as infectious diseases, but also less frequently as myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML). Recently, the transcription factor GATA2 has been identified as a new predisposing gene for familial AML/MDS. In the present study, we describe the initial identification by exome sequencing of a GATA2 R396Q mutation in a family with a history of chronic mild neutropenia evolving to AML and/or MDS. The subsequent analysis of the French Severe Chronic Neutropenia Registry allowed the identification of 6 additional pedigrees and 10 patients with 6 different and not previously reported GATA2 mutations (R204X, E224X, R330X, A372T, M388V, and a complete deletion of the GATA2 locus). The frequent evolution to MDS and AML in these patients reveals the importance of screening GATA2 in chronic neutropenia associated with monocytopenia because of the frequent hematopoietic transformation, variable clinical expression at onset, and the need for aggressive therapy in patients with poor clinical outcome. PMID:23223431

Familial Isolated Pituitary Adenomas (FIPA) and the Pituitary Adenoma Predisposition due to Mutations in the Aryl Hydrocarbon Receptor Interacting Protein (AIP) Gene

PubMed Central

Aaltonen, Lauri A.; Daly, Adrian F.

2013-01-01

Pituitary adenomas are one of the most frequent intracranial tumors and occur with a prevalence of approximately 1:1000 in the developed world. Pituitary adenomas have a serious disease burden, and their management involves neurosurgery, biological therapies, and radiotherapy. Early diagnosis of pituitary tumors while they are smaller may help increase cure rates. Few genetic predictors of pituitary adenoma development exist. Recent years have seen two separate, complimentary advances in inherited pituitary tumor research. The clinical condition of familial isolated pituitary adenomas (FIPA) has been described, which encompasses the familial occurrence of isolated pituitary adenomas outside of the setting of syndromic conditions like multiple endocrine neoplasia type 1 and Carney complex. FIPA families comprise approximately 2% of pituitary adenomas and represent a clinical entity with homogeneous or heterogeneous pituitary adenoma types occurring within the same kindred. The aryl hydrocarbon receptor interacting protein (AIP) gene has been identified as causing a pituitary adenoma predisposition of variable penetrance that accounts for 20% of FIPA families. Germline AIP mutations have been shown to associate with the occurrence of large pituitary adenomas that occur at a young age, predominantly in children/adolescents and young adults. AIP mutations are usually associated with somatotropinomas, but prolactinomas, nonfunctioning pituitary adenomas, Cushing disease, and other infrequent clinical adenoma types can also occur. Gigantism is a particular feature of AIP mutations and occurs in more than one third of affected somatotropinoma patients. Study of pituitary adenoma patients with AIP mutations has demonstrated that these cases raise clinical challenges to successful treatment. Extensive research on the biology of AIP and new advances in mouse Aip knockout models demonstrate multiple pathways by which AIP may contribute to tumorigenesis. This review assesses the current clinical and therapeutic characteristics of more than 200 FIPA families and addresses research findings among AIP mutation-bearing patients in different populations with pituitary adenomas. PMID:23371967

Molecular mechanisms of epigenetic variation in plants.

PubMed

Fujimoto, Ryo; Sasaki, Taku; Ishikawa, Ryo; Osabe, Kenji; Kawanabe, Takahiro; Dennis, Elizabeth S

2012-01-01

Natural variation is defined as the phenotypic variation caused by spontaneous mutations. In general, mutations are associated with changes of nucleotide sequence, and many mutations in genes that can cause changes in plant development have been identified. Epigenetic change, which does not involve alteration to the nucleotide sequence, can also cause changes in gene activity by changing the structure of chromatin through DNA methylation or histone modifications. Now there is evidence based on induced or spontaneous mutants that epigenetic changes can cause altering plant phenotypes. Epigenetic changes have occurred frequently in plants, and some are heritable or metastable causing variation in epigenetic status within or between species. Therefore, heritable epigenetic variation as well as genetic variation has the potential to drive natural variation.

Pyruvate Kinase Deficiency in Sub-Saharan Africa: Identification of a Highly Frequent Missense Mutation (G829A;Glu277Lys) and Association with Malaria

PubMed Central

Machado, Patrícia; Manco, Licínio; Gomes, Cláudia; Mendes, Cristina; Fernandes, Natércia; Salomé, Graça; Sitoe, Luis; Chibute, Sérgio; Langa, José; Ribeiro, Letícia; Miranda, Juliana; Cano, Jorge; Pinto, João; Amorim, António; do Rosário, Virgílio E.; Arez, Ana Paula

2012-01-01

Background Pyruvate kinase (PK) deficiency, causing hemolytic anemia, has been associated to malaria protection and its prevalence in sub-Saharan Africa is not known so far. This work shows the results of a study undertaken to determine PK deficiency occurrence in some sub-Saharan African countries, as well as finding a prevalent PK variant underlying this deficiency. Materials and Methods Blood samples of individuals from four malaria endemic countries (Mozambique, Angola, Equatorial Guinea and Sao Tome and Principe) were analyzed in order to determine PK deficiency occurrence and detect any possible high frequent PK variant mutation. The association between this mutation and malaria was ascertained through association studies involving sample groups from individuals showing different malaria infection and outcome status. Results The percentage of individuals showing a reduced PK activity in Maputo was 4.1% and the missense mutation G829A (Glu277Lys) in the PKLR gene (only identified in three individuals worldwide to date) was identified in a high frequency. Heterozygous carrier frequency was between 6.7% and 2.6%. A significant association was not detected between either PK reduced activity or allele 829A frequency and malaria infection and outcome, although the variant was more frequent among individuals with uncomplicated malaria. Conclusions This was the first study on the occurrence of PK deficiency in several areas of Africa. A common PKLR mutation G829A (Glu277Lys) was identified. A global geographical co-distribution between malaria and high frequency of PK deficiency seems to occur suggesting that malaria may be a selective force raising the frequency of this 277Lys variant. PMID:23082140

The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas.

PubMed

Sunaoshi, Masaaki; Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J; Morioka, Takamitsu; Kaminishi, Mutsumi; Shang, Yi; Nishimura, Mayumi; Shimada, Yoshiya; Tachibana, Akira; Kakinuma, Shizuko

2015-09-01

Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2a and Ikaros are a prominent feature of young adult irradiation-induced T-cell lymphoma, tumors arising after irradiation from infancy suffer a second hit in Pten by mis-segregation or recombination. This is the first report showing an influence of age-at-exposure on genomic alterations of tumor suppressor genes and their relative involvement in radiation-induced T-cell lymphoma. These data are important for considering the risks associated with childhood exposure to radiation. Copyright © 2015 Elsevier B.V. All rights reserved.

SMARCA4-inactivating mutations increase sensitivity to Aurora kinase A inhibitor VX-680 in non-small cell lung cancers. | Office of Cancer Genomics

Cancer.gov

Mutations in the SMARCA4/BRG1 gene resulting in complete loss of its protein (BRG1) occur frequently in non-small cell lung cancer (NSCLC) cells. Currently, no single therapeutic agent has been identified as synthetically lethal with SMARCA4/BRG1 loss. We identify AURKA activity as essential in NSCLC cells lacking SMARCA4/BRG1. In these cells, RNAi-mediated depletion or chemical inhibition of AURKA induces apoptosis and cell death in vitro and in xenograft mouse models.

ESR1 Mutations Affect Anti-proliferative Responses to Tamoxifen through Enhanced Cross-Talk with IGF Signaling

PubMed Central

Gelsomino, Luca; Gu, Guowei; Rechoum, Yassine; Beyer, Amanda R; Pejerrey, Sasha M; Tsimelzon, Anna; Wang, Tao; Huffman, Kenneth; Ludlow, Andrew; Ando’, Sebastiano; Fuqua, Suzanne AW

2017-01-01

It is now generally accepted that estrogen receptor (ESR1) mutations occur frequently in metastatic breast cancers, however we do not yet know how to best treat these patients. We have modeled the three most frequent hormone binding ESR1 (HBD-ESR1) mutations (Y537N, Y537S, and D538G) using stable lentiviral transduction in human breast cancer cell lines. Effects on growth were examined in response to hormonal and targeted agents, and mutation-specific changes were studied using microarray and western blot analysis. We determined that the HBD-ESR1 mutations alter anti-proliferative effects to tamoxifen (Tam), due to cell-intrinsic changes in activation of the insulin-like growth factor receptor (IGF1R) signaling pathway and levels of PIK3R1/PIK3R3. The selective estrogen receptor degrader, fulvestrant, significantly reduced the anchorage-independent growth of ESR1 mutant-expressing cells, while combination treatments with the mTOR inhibitor everolimus, or an inhibitor blocking IGF1R and the insulin receptor significantly enhanced anti-proliferative responses. Using digital drop (dd) PCR we identified mutations at high frequencies ranging from 12% for Y537N, 5% for Y537S, and 2% for D538G in archived primary breast tumors from women treated with adjuvant mono-tamoxifen therapy. The HBD-ESR1 mutations were not associated with recurrence-free or overall survival in response in this patient cohort, and suggest that knowledge of other cell-intrinsic factors in combination with ESR1 mutation status will be needed determine anti-proliferative responses to Tam. PMID:27178332

Protease Inhibitors Drug Resistance Mutations in Turkish Patients with Chronic Hepatitis C.

PubMed

Sargin Altunok, Elif; Sayan, Murat; Akhan, Sila; Aygen, Bilgehan; Yildiz, Orhan; Tekin Koruk, Suda; Mistik, Resit; Demirturk, Nese; Ural, Onur; Kose, Şükran; Aynioglu, Aynur; Korkmaz, Fatime; Ersoz, Gülden; Tuna, Nazan; Ayaz, Celal; Karakecili, Faruk; Keten, Derya; Inan, Dilara; Yazici, Saadet; Koculu, Safiye; Yildirmak, Taner

2016-09-01

Drug resistance development is an expected problem during treatment with protease inhibitors (PIs), this is largely due to the fact that Pls are low-genetic barrier drugs. Resistance-associated variants (RAVs) however may also occur naturally, and prior to treatment with Pls, the clinical impact of this basal resistance remains unknown. In Turkey, there is yet to be an investigation into the hepatitis C (HCV) drug associated resistance to oral antivirals. 178 antiviral-naïve patients infected with HCV genotype 1 were selected from 27 clinical centers of various geographical regions in Turkey and included in the current study. The basal NS3 Pls resistance mutations of these patients were analyzed. In 33 (18.5%) of the patients included in the study, at least one mutation pattern that can cause drug resistance was identified. The most frequently detected mutation pattern was T54S while R109K was the second most frequently detected. Following a more general examination of the patients studied, telaprevir (TVR) resistance in 27 patients (15.2%), boceprevir (BOC) resistance in 26 (14.6%) patients, simeprevir (SMV) resistance in 11 (6.2%) patients and faldaprevir resistance in 13 (7.3%) patients were detected. Our investigation also revealed that rebound developed in the presence of a Q80K mutation and amongst two V55A mutations following treatment with TVR, while no response to treatment was detected in a patient with a R55K mutation. We are of the opinion that drug resistance analyses can be beneficial and necessary in revealing which variants are responsible for pre-treatment natural resistance and which mutations are responsible for the viral breakthrough that may develop during the treatment. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Analysis of the neurofibromatosis 2 gene reveals molecular variants of meningioma.

PubMed Central

Wellenreuther, R.; Kraus, J. A.; Lenartz, D.; Menon, A. G.; Schramm, J.; Louis, D. N.; Ramesh, V.; Gusella, J. F.; Wiestler, O. D.; von Deimling, A.

1995-01-01

There is evidence from cytogenetic and loss of heterozygosity studies for the involvement of a tumor suppressor gene on chromosome 22 in the formation of meningiomas. Recently, the NF2 gene, which causes neurofibromatosis type 2 and which is located in the affected region on chromosome 22, has been identified. A previous study on 8 of the 17 exons of the NF2 gene described mutations in 16% of meningiomas. We have analyzed the entire coding region of the NF2 gene in 70 sporadic meningiomas and identified 43 mutations in 41 patients. These resulted predominantly in immediate truncation, splicing abnormalities, or an altered reading frame of the predicted protein product. Although there was no evidence for distinct hotspots, all mutations occurred in the first 13 exons, the region of homology with the filopodial proteins moesin, ezrin, and radixin. The association of loss of heterozygosity on chromosome 22 with mutations in the NF2 gene was significant. These data suggest that NF2 represents the meningioma locus on chromosome 22. NF2 mutations occurred significantly more frequently in fibroblastic meningioma (70%) and transitional meningioma (83%) than in meningiothelial meningioma (25%), thus indicating a differential molecular pathogenesis of these meningioma variants. Images Figure 1 PMID:7717450

Genetic mutations in human rectal cancers detected by targeted sequencing.

PubMed

Bai, Jun; Gao, Jinglong; Mao, Zhijun; Wang, Jianhua; Li, Jianhui; Li, Wensheng; Lei, Yu; Li, Shuaishuai; Wu, Zhuo; Tang, Chuanning; Jones, Lindsey; Ye, Hua; Lou, Feng; Liu, Zhiyuan; Dong, Zhishou; Guo, Baishuai; Huang, Xue F; Chen, Si-Yi; Zhang, Enke

2015-10-01

Colorectal cancer (CRC) is widespread with significant mortality. Both inherited and sporadic mutations in various signaling pathways influence the development and progression of the cancer. Identifying genetic mutations in CRC is important for optimal patient treatment and many approaches currently exist to uncover these mutations, including next-generation sequencing (NGS) and commercially available kits. In the present study, we used a semiconductor-based targeted DNA-sequencing approach to sequence and identify genetic mutations in 91 human rectal cancer samples. Analysis revealed frequent mutations in KRAS (58.2%), TP53 (28.6%), APC (16.5%), FBXW7 (9.9%) and PIK3CA (9.9%), and additional mutations in BRAF, CTNNB1, ERBB2 and SMAD4 were also detected at lesser frequencies. Thirty-eight samples (41.8%) also contained two or more mutations, with common combination mutations occurring between KRAS and TP53 (42.1%), and KRAS and APC (31.6%). DNA sequencing for individual cancers is of clinical importance for targeted drug therapy and the advantages of such targeted gene sequencing over other NGS platforms or commercially available kits in sensitivity, cost and time effectiveness may aid clinicians in treating CRC patients in the near future.

Summary of mutations underlying autosomal recessive congenital ichthyoses (ARCI) in Arabs with four novel mutations in ARCI-related genes from the United Arab Emirates.

PubMed

Bastaki, Fatma; Mohamed, Madiha; Nair, Pratibha; Saif, Fatima; Mustafa, Ethar M; Bizzari, Sami; Al-Ali, Mahmoud T; Hamzeh, Abdul Rezzak

2017-05-01

Clinical and molecular heterogeneity is a prominent characteristic of congenital ichthyoses, with the involvement of numerous causative loci. Mutations in these loci feature in autosomal recessive congenital ichthyoses (ARCIs) quite variably, with certain genes/mutations being more frequently uncovered in particular populations. In this study, we used whole exome sequencing as well as direct Sanger sequencing to uncover four novel mutations in ARCI-related genes, which were found in families from the United Arab Emirates. In silico tools such as CADD and SIFT Indel were used to predict the functional consequences of these mutations. The here-presented mutations occurred in three genes (ALOX12B, TGM1, ABCA12), and these are a mixture of missense and indel variants with damaging functional consequences on their encoded proteins. This study presents an overview of the mutations that were found in ARCI-related genes in Arabs and discusses molecular and clinical details pertaining to the above-mentioned Emirati cases and their novel mutations with special emphasis on the resulting protein changes. © 2017 The International Society of Dermatology.

[Genotyping of BRCA1, BRCA2 and CHEK2 germline mutations in Russian breast cancer patients using diagnostic biochips].

PubMed

Nasedkina, T V; Gromyko, O E; Emel'ianova, M A; Ignatova, E O; Kazubskaia, T P; Portnoĭ, S M; Zasedatelev, A S; Liubchenko, L N

2014-01-01

Germline mutations of BRCA1/2 genes cause the predisposition of their carriers to breast or/and ovary cancers (BC or/and OC) during the lifetime. Identification of these mutations is a basis of molecular diagnosis for BC susceptibility. Rapid genotyping technique using microarrays for identification of BRCA1 185delAG, 300T>G, 4153delA, 5382insC mutations and 4158 A>G sequence variant; BRCA2 695insT and 6174delT mutations; 1100delC mutation in CHEK2 gene was applied for 412 randomly collected breast cancer samples from the central region of European area of Russia. In 25 (6.0%) patients (6.0%) BC was associated with other tumours: OC, cervical cancer, colorectal cancer etc. BRCA1/2 and CHEK2 mutations were found in 33 (8.0%) BC patients. The most frequent mutation was BRCA1 5382insC, occurred in 16 (3.9%) BC patients, and CHEK2 1100delC, revealed in 7 (1.7%) BC patients. An application of diagnostic BC-microarray for genetic testing of BRCA1/2 and CHEK2 founder mutations has been discussed.

Evolutionary Action Score of TP53 Identifies High-Risk Mutations Associated with Decreased Survival and Increased Distant Metastases in Head and Neck Cancer.

PubMed

Neskey, David M; Osman, Abdullah A; Ow, Thomas J; Katsonis, Panagiotis; McDonald, Thomas; Hicks, Stephanie C; Hsu, Teng-Kuei; Pickering, Curtis R; Ward, Alexandra; Patel, Ameeta; Yordy, John S; Skinner, Heath D; Giri, Uma; Sano, Daisuke; Story, Michael D; Beadle, Beth M; El-Naggar, Adel K; Kies, Merrill S; William, William N; Caulin, Carlos; Frederick, Mitchell; Kimmel, Marek; Myers, Jeffrey N; Lichtarge, Olivier

2015-04-01

TP53 is the most frequently altered gene in head and neck squamous cell carcinoma, with mutations occurring in over two-thirds of cases, but the prognostic significance of these mutations remains elusive. In the current study, we evaluated a novel computational approach termed evolutionary action (EAp53) to stratify patients with tumors harboring TP53 mutations as high or low risk, and validated this system in both in vivo and in vitro models. Patients with high-risk TP53 mutations had the poorest survival outcomes and the shortest time to the development of distant metastases. Tumor cells expressing high-risk TP53 mutations were more invasive and tumorigenic and they exhibited a higher incidence of lung metastases. We also documented an association between the presence of high-risk mutations and decreased expression of TP53 target genes, highlighting key cellular pathways that are likely to be dysregulated by this subset of p53 mutations that confer particularly aggressive tumor behavior. Overall, our work validated EAp53 as a novel computational tool that may be useful in clinical prognosis of tumors harboring p53 mutations. ©2015 American Association for Cancer Research.

Evolutionary Action score of TP53 (EAp53) identifies high risk mutations associated with decreased survival and increased distant metastases in head and neck cancer

PubMed Central

Neskey, David M.; Osman, Abdullah A.; Ow, Thomas J.; Katsonis, Panagiotis; McDonald, Thomas; Hicks, Stephanie C.; Hsu, Teng-Kuei; Pickering, Curtis R.; Ward, Alexandra; Patel, Ameeta; Yordy, John S.; Skinner, Heath D.; Giri, Uma; Sano, Daisuke; Story, Michael D.; Beadle, Beth M.; El-Naggar, Adel K.; Kies, Merrill S.; William, William N.; Caulin, Carlos; Frederick, Mitchell; Kimmel, Marek; Myers, Jeffrey N.; Lichtarge, Olivier

2015-01-01

TP53 is the most frequently altered gene in head and neck squamous cell carcinoma (HNSCC) with mutations occurring in over two third of cases, but the prognostic significance of these mutations remains elusive. In the current study, we evaluated a novel computational approach termed Evolutionary Action (EAp53) to stratify patients with tumors harboring TP53 mutations as high or low risk, and validated this system in both in vivo and in vitro models. Patients with high risk TP53 mutations had the poorest survival outcomes and the shortest time to the development of distant metastases. Tumor cells expressing high risk TP53 mutations were more invasive and tumorigenic and they exhibited a higher incidence of lung metastases. We also documented an association between the presence of high risk mutations and decreased expression of TP53 target genes, highlighting key cellular pathways that are likely to be dysregulated by this subset of p53 mutations which confer particularly aggressive tumor behavior. Overall, our work validated EAp53 as a novel computational tool that may be useful in clinical prognosis of tumors harboring p53 mutations. PMID:25634208

The Rate of Beneficial Mutations Surfing on the Wave of a Range Expansion

PubMed Central

Lehe, Rémi; Hallatschek, Oskar; Peliti, Luca

2012-01-01

Many theoretical and experimental studies suggest that range expansions can have severe consequences for the gene pool of the expanding population. Due to strongly enhanced genetic drift at the advancing frontier, neutral and weakly deleterious mutations can reach large frequencies in the newly colonized regions, as if they were surfing the front of the range expansion. These findings raise the question of how frequently beneficial mutations successfully surf at shifting range margins, thereby promoting adaptation towards a range-expansion phenotype. Here, we use individual-based simulations to study the surfing statistics of recurrent beneficial mutations on wave-like range expansions in linear habitats. We show that the rate of surfing depends on two strongly antagonistic factors, the probability of surfing given the spatial location of a novel mutation and the rate of occurrence of mutations at that location. The surfing probability strongly increases towards the tip of the wave. Novel mutations are unlikely to surf unless they enjoy a spatial head start compared to the bulk of the population. The needed head start is shown to be proportional to the inverse fitness of the mutant type, and only weakly dependent on the carrying capacity. The precise location dependence of surfing probabilities is derived from the non-extinction probability of a branching process within a moving field of growth rates. The second factor is the mutation occurrence which strongly decreases towards the tip of the wave. Thus, most successful mutations arise at an intermediate position in the front of the wave. We present an analytic theory for the tradeoff between these factors that allows to predict how frequently substitutions by beneficial mutations occur at invasion fronts. We find that small amounts of genetic drift increase the fixation rate of beneficial mutations at the advancing front, and thus could be important for adaptation during species invasions. PMID:22479175

Clustering of Caucasian Leber hereditary optic neuropathy patients containing the 11778 or 14484 mutations on an mtDNA lineage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, M.D.; Sun, F.; Wallace, D.C.

1997-02-01

Leber hereditary optic neuropathy (LHON) is a type of blindness caused by mtDNA mutations. Three LHON mtDNA mutations at nucleotide positions 3460, 11778, and 14484 are specific for LHON and account for 90% of worldwide cases and are thus designated as {open_quotes}primary{close_quotes} LHON mutations. Fifteen other {open_quotes}secondary{close_quotes} LHON mtDNA mutations have been identified, but their pathogenicity is unclear. mtDNA haplotype and phylogenetic analysis of the primary LHON mutations in North American Caucasian patients and controls has shown that, unlike the 3460 and 11778 mutations, which are distributed throughout the European-derived (Caucasian) mtDNA phylogeny, patients containing the 14484 mutation tended tomore » be associated with European mtDNA haplotype J. To investigate this apparent clustering, we performed {chi}{sup 2}-based statistical analyses to compare the distribution of LHON patients on the Caucasian phylogenetic tree. Our results indicate that, unlike the 3460 and 11778 mutations, the 14484 mutation was not distributed on the phylogeny in proportion to the frequencies of the major Caucasian mtDNA haplogroups found in North America. The 14484 mutation was next shown to occur on the haplogroup J background more frequently that expected, consistent with the observation that {approximately}75% of worldwide 14484-positive LHON patients occur in association with haplogroup J. The 11778 mutation also exhibited a moderate clustering on haplogroup J. These observations were supported by statistical analysis using all available mutation frequencies reported in the literature. This paper thus illustrates the potential importance of genetic background in certain mtDNA-based diseases, speculates on a pathogenic role for a subset of LHON secondary mutations and their interaction with primary mutations, and provides support for a polygenic model for LHON expression in some cases. 18 refs., 3 tabs.« less

Mutant p53-Expressing Cells Undergo Necroptosis via Cell Competition with the Neighboring Normal Epithelial Cells.

PubMed

Watanabe, Hirotaka; Ishibashi, Kojiro; Mano, Hiroki; Kitamoto, Sho; Sato, Nanami; Hoshiba, Kazuya; Kato, Mugihiko; Matsuzawa, Fumihiko; Takeuchi, Yasuto; Shirai, Takanobu; Ishikawa, Susumu; Morioka, Yuka; Imagawa, Toshiaki; Sakaguchi, Kazuyasu; Yonezawa, Suguru; Kon, Shunsuke; Fujita, Yasuyuki

2018-06-26

p53 is a tumor suppressor protein, and its missense mutations are frequently found in human cancers. During the multi-step progression of cancer, p53 mutations generally accumulate at the mid or late stage, but not in the early stage, and the underlying mechanism is still unclear. In this study, using mammalian cell culture and mouse ex vivo systems, we demonstrate that when p53R273H- or p53R175H-expressing cells are surrounded by normal epithelial cells, mutant p53 cells undergo necroptosis and are basally extruded from the epithelial monolayer. When mutant p53 cells alone are present, cell death does not occur, indicating that necroptosis results from cell competition with the surrounding normal cells. Furthermore, when p53R273H mutation occurs within RasV12-transformed epithelia, cell death is strongly suppressed and most of the p53R273H-expressing cells remain intact. These results suggest that the order of oncogenic mutations in cancer development could be dictated by cell competition. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Sleep Disorders in Parkinsonian and Nonparkinsonian LRRK2 Mutation Carriers

PubMed Central

Pont-Sunyer, Claustre; Iranzo, Alex; Gaig, Carles; Fernández-Arcos, Ana; Vilas, Dolores; Valldeoriola, Francesc; Compta, Yaroslau; Fernández-Santiago, Ruben; Fernández, Manel; Bayés, Angels; Calopa, Matilde; Casquero, Pilar; de Fàbregues, Oriol; Jaumà, Serge; Puente, Victor; Salamero, Manel; José Martí, Maria; Santamaría, Joan; Tolosa, Eduard

2015-01-01

Objective In idiopathic Parkinson disease (IPD) sleep disorders are common and may antedate the onset of parkinsonism. Based on the clinical similarities between IPD and Parkinson disease associated with LRRK2 gene mutations (LRRK2-PD), we aimed to characterize sleep in parkinsonian and nonmanifesting LRRK2 mutation carriers (NMC). Methods A comprehensive interview conducted by sleep specialists, validated sleep scales and questionnaires, and video-polysomnography followed by multiple sleep latency test (MSLT) assessed sleep in 18 LRRK2-PD (17 carrying G2019S and one R1441G mutations), 17 NMC (11 G2019S, three R1441G, three R1441C), 14 non-manifesting non-carriers (NMNC) and 19 unrelated IPD. Results Sleep complaints were frequent in LRRK2-PD patients; 78% reported poor sleep quality, 33% sleep onset insomnia, 56% sleep fragmentation and 39% early awakening. Sleep onset insomnia correlated with depressive symptoms and poor sleep quality. In LRRK2-PD, excessive daytime sleepiness (EDS) was a complaint in 33% patients and short sleep latencies on the MSLT, which are indicative of objective EDS, were found in 71%. Sleep attacks occurred in three LRRK2-PD patients and a narcoleptic phenotype was not observed. REM sleep behavior disorder (RBD) was diagnosed in three LRRK2-PD. EDS and RBD were always reported to start after the onset of parkinsonism in LRRK2-PD. In NMC, EDS was rarely reported and RBD was absent. When compared to IPD, sleep onset insomnia was more significantly frequent, EDS was similar, and RBD was less significantly frequent and less severe in LRRK2-PD. In NMC, RBD was not detected and sleep complaints were much less frequent than in LRRK2-PD. No differences were observed in sleep between NMC and NMNC. Conclusions Sleep complaints are frequent in LRRK2-PDand show a pattern that when compared to IPD is characterized by more frequent sleep onset insomnia, similar EDS and less prominent RBD. Unlike in IPD, RBD and EDS seem to be not markers of the prodromal stage of LRRK2-PD. PMID:26177462

Loss of the tumor suppressor BAP1 causes myeloid transformation

PubMed Central

Dey, Anwesha; Seshasayee, Dhaya; Noubade, Rajkumar; French, Dorothy M.; Liu, Jinfeng; Chaurushiya, Mira S.; Kirkpatrick, Donald S.; Pham, Victoria C.; Lill, Jennie R.; Bakalarski, Corey E.; Wu, Jiansheng; Phu, Lilian; Katavolos, Paula; Saunders, Lindsay M.; Abdel-Wahab, Omar; Modrusan, Zora; Seshagiri, Somasekar; Dong, Ken; Lin, Zhonghua; Balazs, Mercedesz; Suriben, Rowena; Newton, Kim; Hymowitz, Sarah; Garcia-Manero, Guillermo; Martin, Flavius; Levine, Ross L.; Dixit, Vishva M.

2016-01-01

Deubiquitinating enzyme BAP1 is mutated in a hereditary cancer syndrome with increased risk of mesothelioma and uveal melanoma. Somatic BAP1 mutations occur in various malignancies. We show that mouse Bap1 gene deletion is lethal during embryogenesis, but systemic or hematopoietic-restricted deletion in adults recapitulates features of human myelodysplastic syndrome (MDS). Knock-in mice expressing BAP1 with a 3xFlag tag revealed that BAP1 interacts with HCF-1, OGT, and the polycomb group proteins ASXL1 and ASXL2 in vivo. OGT and HCF-1 levels were decreased by Bap1 deletion, indicating a critical role for BAP1 in stabilizing these epigenetic regulators. Human ASXL1 is mutated frequently in chronic myelomonocytic leukemia (CMML) so an ASXL/BAP1 complex may suppress CMML. A novel BAP1 catalytic mutation found in a MDS patient implies that BAP1 loss of function has similar consequences in mouse and man. PMID:22878500

Genotype and Outcome After Kidney Transplantation in Alport Syndrome.

PubMed

Gillion, Valentine; Dahan, Karin; Cosyns, Jean-Pierre; Hilbert, Pascale; Jadoul, Michel; Goffin, Eric; Godefroid, Nathalie; De Meyer, Martine; Mourad, Michel; Pirson, Yves; Kanaan, Nada

2018-05-01

Alport syndrome (AS) is caused by mutations in α3/α4/α5 (IV) collagen genes, the severity of which determine the progression of AS. Posttransplantation outcome is good, although anti-glomerular basement membrane (anti-GBM) glomerulonephritis occurs in 3% to 5% of recipients, clustering in patients with a severe mutation. We assessed whether the severity of the underlying AS mutation affects graft and patients outcome after transplantation, including the occurrence of anti-GBM nephritis. We included 73 AS patients with an identified mutation (COL4A5, 57 patients; COL4A3, 9 patients; COL4A4, 6 patients; heterozygous composite COL4A3 and A4, 1 patient) who underwent transplantation between 1971 and 2014 and who had received a total of 93 kidney grafts. In all, 41 patients had a severe mutation (COL4A5, 30 patients; COL4A3, 6 patients; COL4A4, 5 patients), and 32 had a nonsevere mutation (COL4A5, 27 patients; COL4A3, 4 patients; COL4A4, 1 patient). Patient survival was similar in patients with severe and nonsevere mutations (89% vs. 84% at 5 years, 83% vs. 75% at 10, 15, and 20 years; P  = 0.46). Graft survival was not affected by the severity of mutation (77% vs. 63% at 5 years, 60% vs. 55% at 10 years, 55% vs. 55% at 15 years, and 55% vs. 50% at 20 years; P  = 0.65). Clinically significant anti-GBM glomerulonephritis occurred in 1 male patient with severe COL4A5 mutation 6 years after transplantation recurred in a subsequent graft, leading twice to graft loss. Although severe mutations affect the severity of AS, they do not have an impact on patient and graft survival after transplantation. De novo anti-GBM nephritis after transplantation was less frequent than previously reported, occurring in only 1.4% of AS patients, and in 2% of males with COL4A5 mutation.

The "SWOT" of BRAF inhibition in melanoma: RAF inhibitors, MEK inhibitors or both?

PubMed

Nissan, Moriah H; Solit, David B

2011-12-01

Activating mutations in the BRAF gene are among the most prevalent kinase mutations in human cancer. BRAF mutations are most frequent in patients with melanoma where they occur in approximately 50% of patients with advanced disease. Remarkable clinical activity has recently been reported with highly selective RAF inhibitors in melanoma patients whose tumors harbor V600E BRAF mutations. The response rates of RAF inhibitors in patients with BRAF-mutant melanomas far exceed the activity level of any prior therapy studied in this disease. The results suggest that we have entered an era of personalized therapy for patients with metastatic melanoma in which treatment selection will be guided by BRAF mutational status. This review will discuss the strengths, weaknesses, opportunities and threats ("SWOT") of developing RAF and MEK selective inhibitors as anti-cancer therapies, recent insights into the mechanisms of intrinsic and acquired resistance to these agents, and current efforts to develop mechanism-based combination therapies.

GTF2I mutation frequently occurs in more indolent thymic epithelial tumors and predicts better prognosis.

PubMed

Feng, Yanfen; Lei, Yiyan; Wu, Xiaoyan; Huang, Yuhua; Rao, Huilan; Zhang, Yu; Wang, Fang

2017-08-01

A missense mutation in GTF2I was previously identified in thymic epithelioid tumor (TET). However, the clinicopathological relevance of GTF2I mutation has not been illustrated. We studied the prognostic importance of GTF2I mutation as well as its relation to histological subtypes in a large number of TETs. TET samples from 296 patients with clinical and follow-up data were collected, and histological subtypes were classified. Analysis of the GTF2I (chromosome 7 c.74146970T>A) mutation was undertaken by using quantitative real time polymerase chain reaction (qPCR) and direct sequencing. The association of GTF2I mutation with clinicopathological features as well as prognosis was analyzed. One hundred twenty-four out of 296 (41.9%) patients harbored the GTF2I mutation (chromosome 7 c.74146970T>A). GTF2I mutation was observed in 20 (87.0%) cases of type A thymoma, 70 (78.7%) of type AB thymoma, and the frequency decreased with the degree of histological subtype aggressiveness, with the lowest rate in thymic carcinoma (7.7%). The difference of GTF2I mutation distribution in histological subtypes was statistically significant (p<0.001). The GTF2I mutation was found more frequently in patients with early Masaoka stage (I-II, n=112, 90.3%) than in those with advanced stage (III-IV) disease (n=12, 9.6%, p<0.001). However, only histological subtype significantly predicted the presence of the GTF2I mutation in patients with TETs. The presence of the GTF2I mutation correlated with better prognosis (90.0% compared to 72.0% 5-year survival, and 86% compared to 56% 10-year survival, respectively; log-rank p=0.001). Moreover, it was an independent prognostic factor [hazard ratio (HR), 0.35; 95% confidential interval (CI), 0.15-0.81; p=0.014)]. The frequency of the GTF2I mutation is higher in more indolent TETs, and correlates with better prognosis. Further studies are required to elucidate the role of the GTF2I mutation in TETs and its clinical application. Copyright © 2017 Elsevier B.V. All rights reserved.

A vaccine targeting mutant IDH1 induces antitumour immunity.

PubMed

Schumacher, Theresa; Bunse, Lukas; Pusch, Stefan; Sahm, Felix; Wiestler, Benedikt; Quandt, Jasmin; Menn, Oliver; Osswald, Matthias; Oezen, Iris; Ott, Martina; Keil, Melanie; Balß, Jörg; Rauschenbach, Katharina; Grabowska, Agnieszka K; Vogler, Isabel; Diekmann, Jan; Trautwein, Nico; Eichmüller, Stefan B; Okun, Jürgen; Stevanović, Stefan; Riemer, Angelika B; Sahin, Ugur; Friese, Manuel A; Beckhove, Philipp; von Deimling, Andreas; Wick, Wolfgang; Platten, Michael

2014-08-21

Monoallelic point mutations of isocitrate dehydrogenase type 1 (IDH1) are an early and defining event in the development of a subgroup of gliomas and other types of tumour. They almost uniformly occur in the critical arginine residue (Arg 132) in the catalytic pocket, resulting in a neomorphic enzymatic function, production of the oncometabolite 2-hydroxyglutarate (2-HG), genomic hypermethylation, genetic instability and malignant transformation. More than 70% of diffuse grade II and grade III gliomas carry the most frequent mutation, IDH1(R132H) (ref. 3). From an immunological perspective, IDH1(R132H) represents a potential target for immunotherapy as it is a tumour-specific potential neoantigen with high uniformity and penetrance expressed in all tumour cells. Here we demonstrate that IDH1(R132H) contains an immunogenic epitope suitable for mutation-specific vaccination. Peptides encompassing the mutated region are presented on major histocompatibility complexes (MHC) class II and induce mutation-specific CD4(+) T-helper-1 (TH1) responses. CD4(+) TH1 cells and antibodies spontaneously occurring in patients with IDH1(R132H)-mutated gliomas specifically recognize IDH1(R132H). Peptide vaccination of mice devoid of mouse MHC and transgenic for human MHC class I and II with IDH1(R132H) p123-142 results in an effective MHC class II-restricted mutation-specific antitumour immune response and control of pre-established syngeneic IDH1(R132H)-expressing tumours in a CD4(+) T-cell-dependent manner. As IDH1(R132H) is present in all tumour cells of these slow-growing gliomas, a mutation-specific anti-IDH1(R132H) vaccine may represent a viable novel therapeutic strategy for IDH1(R132H)-mutated tumours.

DNA mutation motifs in the genes associated with inherited diseases.

PubMed

Růžička, Michal; Kulhánek, Petr; Radová, Lenka; Čechová, Andrea; Špačková, Naďa; Fajkusová, Lenka; Réblová, Kamila

2017-01-01

Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs) rarely associated with mutations (coldspots) and frequently associated with mutations (hotspots) exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

Pre-operative role of BRAF in the guidance of the surgical approach and prognosis of differentiated thyroid carcinoma.

PubMed

Danilovic, Debora L S; Lima, Erika U; Domingues, Regina B; Brandão, Lenine G; Hoff, Ana O; Marui, Suemi

2014-04-01

The p.V600E BRAF and RAS mutations are found in 30-80% of differentiated thyroid carcinoma (DTC). BRAF mutation has been associated with poor prognosis. This study investigated the role of molecular studies in preoperative diagnosis of DTC and the association of p.V600E mutation with prognostic factors. Prospective study. A total of 202 patients with cytological diagnosis of Bethesda III-VI underwent preoperative molecular studies and subsequent thyroidectomy. p.V600E and RAS mutations were studied in the cytology smears, using real-time PCR genotyping technique. The BRAF mutation (BRAF(+) or BRAF(-)) was correlated with histological and clinical findings. Molecular study of 172 nodules with Bethesda III-V cytology improved negative predictive value and accuracy of Bethesda III and IV diagnosis. BRAF mutation was present in 65% of 94 DTC and p.Q61R NRAS in one. Except for age, BRAF(+) and BRAF(-) did not differ in sex, tumor size, histological subtype, multifocality, vascular invasion, extrathyroidal extension, or prognostic staging. Among papillary carcinomas, lymph node (LN) metastasis was diagnosed in 23% BRAF(+) and 37% BRAF(-). Distant metastasis occurred in four BRAF(-). Recurrent or persistent disease was more frequent in BRAF(-) (26.7 vs 3.3% BRAF(+), P=0.002) along follow-up of 29.8±10 months. BRAF(+) patients without LN metastasis by pre-operative evaluation submitted to thyroidectomy with central neck dissection (CND) had more frequent LN metastasis (45 vs 5% no CND, P=0.002), but no difference in clinical outcome was observed. Pre-operative identification of BRAF mutation improved cytological diagnosis of DTC, but it was not associated with poor prognostic factors. Prophylactic CND did not guarantee better outcome in BRAF(+) patients.

Mutational spectrum of myeloid malignancies with inv(3)/t(3;3) reveals a predominant involvement of RAS/RTK signaling pathways

PubMed Central

Gröschel, Stefan; Sanders, Mathijs A.; Hoogenboezem, Remco; Zeilemaker, Annelieke; Havermans, Marije; Erpelinck, Claudia; Bindels, Eric M. J.; Beverloo, H. Berna; Döhner, Hartmut; Löwenberg, Bob; Döhner, Konstanze; Delwel, Ruud

2015-01-01

Myeloid malignancies bearing chromosomal inv(3)/t(3;3) abnormalities are among the most therapy-resistant leukemias. Deregulated expression of EVI1 is the molecular hallmark of this disease; however, the genome-wide spectrum of cooperating mutations in this disease subset has not been systematically elucidated. Here, we show that 98% of inv(3)/t(3;3) myeloid malignancies harbor mutations in genes activating RAS/receptor tyrosine kinase (RTK) signaling pathways. In addition, hemizygous mutations in GATA2, as well as heterozygous alterations in RUNX1, SF3B1, and genes encoding epigenetic modifiers, frequently co-occur with the inv(3)/t(3;3) aberration. Notably, neither mutational patterns nor gene expression profiles differ across inv(3)/t(3;3) acute myeloid leukemia, chronic myeloid leukemia, and myelodysplastic syndrome cases, suggesting recognition of inv(3)/t(3;3) myeloid malignancies as a single disease entity irrespective of blast count. The high incidence of activating RAS/RTK signaling mutations may provide a target for a rational treatment strategy in this high-risk patient group. PMID:25381062

Holoprosencephaly: ZIC2 mutation in a case with panhypopituitarism.

PubMed

Tasdemir, Sener; Sahin, Ibrahim; Cayır, Atilla; Doneray, Hakan; Solomon, Benjamin D; Muenke, Maximilian; Yuce, Ihsan; Tatar, Abdulgani

2014-07-01

Holoprosencephaly (HPE), the most common malformation of the brain, results from failed or incomplete separation of the embryonic forebrain (prosencephalon). HPE occurs in approximately 1 in 250 embryos and in about 1 in 10,000 births. It is etiologically heterogeneous, and may be caused by cytogenetic anomalies and teratogenic influences; it occurs as part of a syndrome, or due to heterozygous mutations in 1 of over 10 HPE-associated genes. ZIC2 mutations are the second-most common cause of non-syndromic non-chromosomal HPE (after sonic hedgehog) and occur de novo in 74% of the affected probands. The objective of the study was to describe the first case of ZIC2-related HPE with both anterior and posterior pituitary insufficiencies. We report about a 2-year-8-month-old boy who was born as a second child in a non-consanguineous healthy Turkish family. He has the characteristic ZIC2 phenotype: bitemporal narrowing, upslanting palpebral fissures, large ears, short nose with anteverted nares and broad and deep philtrum. Magnetic resonance imaging revealed alobar HPE. During laboratory investigation, his blood sodium level was 158 mmol/L and the specific gravity of his urine was 1.002. Serum osmolarity was 336 mOsm/L and urine osmolality was 135 mOsm/kg. His FT4 was 0.8 ng/dL and TSH was 0.79 mLU/mL. Response to vasopressin confirmed the diagnosis of central diabetes insipidus and TRH-stimulating test supported the central hypothyroidism. A frameshift mutation (NM_007129.2:c1091_1092 del, p.Gln364Leufs*2) in the ZIC2 gene was detected. Pituitary insufficiency other than isolated diabetes insipidus is a rare finding of HPE, and occurs most frequently in patients with GLI2 mutations (the phenotype of which typically does not include frank neuroanatomic anomalies such as HPE); ours is the only described patient with a ZIC2 mutation and both anterior and posterior pituitary dysfunction.

Mutations in the LKB1 tumour suppressor are frequently detected in tumours from Caucasian but not Asian lung cancer patients

PubMed Central

Koivunen, J P; Kim, J; Lee, J; Rogers, A M; Park, J O; Zhao, X; Naoki, K; Okamoto, I; Nakagawa, K; Yeap, B Y; Meyerson, M; Wong, K-K; Richards, W G; Sugarbaker, D J; Johnson, B E; Jänne, P A

2008-01-01

Somatic mutations of LKB1 tumour suppressor gene have been detected in human cancers including non-small cell lung cancer (NSCLC). The relationship between LKB1 mutations and clinicopathological characteristics and other common oncogene mutations in NSCLC is inadequately described. In this study we evaluated tumour specimens from 310 patients with NSCLC including those with adenocarcinoma, adenosquamous carcinoma, and squamous cell carcinoma histologies. Tumours were obtained from patients of US (n=143) and Korean (n=167) origin and screened for LKB1, KRAS, BRAF, and EGFR mutations using RT—PCR-based SURVEYOR-WAVE method followed by Sanger sequencing. We detected mutations in the LKB1 gene in 34 tumours (11%). LKB1 mutation frequency was higher in NSCLC tumours of US origin (17%) compared with 5% in NSCLCs of Korean origin (P=0.001). They tended to occur more commonly in adenocarcinomas (13%) than in squamous cell carcinomas (5%) (P=0.066). LKB1 mutations associated with smoking history (P=0.007) and KRAS mutations (P=0.042) were almost mutually exclusive with EGFR mutations (P=0.002). The outcome of stages I and II NSCLC patients treated with surgery alone did not significantly differ based on LKB1 mutation status. Our study provides clinical and molecular characteristics of NSCLC, which harbour LKB1 mutations. PMID:18594528

Mutations in the LKB1 tumour suppressor are frequently detected in tumours from Caucasian but not Asian lung cancer patients.

PubMed

Koivunen, J P; Kim, J; Lee, J; Rogers, A M; Park, J O; Zhao, X; Naoki, K; Okamoto, I; Nakagawa, K; Yeap, B Y; Meyerson, M; Wong, K-K; Richards, W G; Sugarbaker, D J; Johnson, B E; Jänne, P A

2008-07-22

Somatic mutations of LKB1 tumour suppressor gene have been detected in human cancers including non-small cell lung cancer (NSCLC). The relationship between LKB1 mutations and clinicopathological characteristics and other common oncogene mutations in NSCLC is inadequately described. In this study we evaluated tumour specimens from 310 patients with NSCLC including those with adenocarcinoma, adenosquamous carcinoma, and squamous cell carcinoma histologies. Tumours were obtained from patients of US (n=143) and Korean (n=167) origin and screened for LKB1, KRAS, BRAF, and EGFR mutations using RT-PCR-based SURVEYOR-WAVE method followed by Sanger sequencing. We detected mutations in the LKB1 gene in 34 tumours (11%). LKB1 mutation frequency was higher in NSCLC tumours of US origin (17%) compared with 5% in NSCLCs of Korean origin (P=0.001). They tended to occur more commonly in adenocarcinomas (13%) than in squamous cell carcinomas (5%) (P=0.066). LKB1 mutations associated with smoking history (P=0.007) and KRAS mutations (P=0.042) were almost mutually exclusive with EGFR mutations (P=0.002). The outcome of stages I and II NSCLC patients treated with surgery alone did not significantly differ based on LKB1 mutation status. Our study provides clinical and molecular characteristics of NSCLC, which harbour LKB1 mutations.

Vascular events in Korean patients with myeloproliferative neoplasms and their relationship to JAK2 mutation.

PubMed

Bang, Soo-Mee; Lee, Jong-Seok; Ahn, Jeong Yeal; Lee, Jae Hoon; Hyun, Myung Soo; Kim, Bong Seog; Park, Moo Rim; Chi, Hyun-Sook; Kim, Ho Young; Kim, Hyo Jung; Lee, Moon Hee; Kim, Hwak; Won, Jong Ho; Yoon, Hwi Joong; Oh, Do-Yeun; Nam, Eun-Mi; Bae, Sung Hwa; Kim, Byoung-Kook

2009-03-01

Evaluation of the Janus kinase 2 (JAK2) V617F mutation has been widely used for the diagnosis of myeloproliferative neoplasms (MPN). However, its prognostic relevance to clinical outcome is not completely understood. We investigated the association of JAK2 V617F with vascular events in Korean patients with myeloproliferative neoplasms (MPN). We studied 283 patients from 15 centers, who were diagnosed with MPN. The JAK2 V617F status was evaluated by allele-specific polymerase chain reaction (PCR) and sequencing. The patients' diagnoses were essential thrombocythemia (ET n = 146), polycythemia vera (PV n = 120), primary myelofibrosis (n = 12), and unclassifiable MPN (MPNu n = 5). JAK2 V617F was detected in 89 (61%) patients with ET, 103 (86%) with PV, four (33%) with myelofibrosis, and four (80%) with MPNu. A higher number of leukocytes, haemoglobin levels and BM cellularity as well as an older age, lower platelet counts, and diagnosis of PV were significantly correlated with JAK2 V617F. Eighty-three and 43 episodes of thrombosis and bleeding occurred in 100 patients each before and after the diagnosis. Vascular events more frequently occurred in 37% of patients with JAK2 V617F than in 29% of those without the mutation (p = 0.045). Among 175 patients whose samples were available for sequencing, 28 patients with homozygous JAK2 V617F had vascular events more frequently (57%) than those who were heterozygotes (39%) or had the wild type (27%) (p = 0.03). The multivariate analysis showed that a JAK2 homozygous mutation, hypercholesterolemia and older age were independent risk factors for a vascular event. The results of this study showed that Korean patients with MPN had a similar JAK2 mutation rate and frequency of vascular events when compared to Western patients. The presence of V617F was significantly related to vascular events. Therefore, initial evaluation for the JAK2 mutation and careful monitoring for vascular events should be performed in MPN patients.

ESR1 mutations affect anti-proliferative responses to tamoxifen through enhanced cross-talk with IGF signaling.

PubMed

Gelsomino, Luca; Gu, Guowei; Rechoum, Yassine; Beyer, Amanda R; Pejerrey, Sasha M; Tsimelzon, Anna; Wang, Tao; Huffman, Kenneth; Ludlow, Andrew; Andò, Sebastiano; Fuqua, Suzanne A W

2016-06-01

The purpose of this study was to address the role of ESR1 hormone-binding mutations in breast cancer. Soft agar anchorage-independent growth assay, Western blot, ERE reporter transactivation assay, proximity ligation assay (PLA), coimmunoprecipitation assay, silencing assay, digital droplet PCR (ddPCR), Kaplan-Meier analysis, and statistical analysis. It is now generally accepted that estrogen receptor (ESR1) mutations occur frequently in metastatic breast cancers; however, we do not yet know how to best treat these patients. We have modeled the three most frequent hormone-binding ESR1 (HBD-ESR1) mutations (Y537N, Y537S, and D538G) using stable lentiviral transduction in human breast cancer cell lines. Effects on growth were examined in response to hormonal and targeted agents, and mutation-specific changes were studied using microarray and Western blot analysis. We determined that the HBD-ESR1 mutations alter anti-proliferative effects to tamoxifen (Tam), due to cell-intrinsic changes in activation of the insulin-like growth factor receptor (IGF1R) signaling pathway and levels of PIK3R1/PIK3R3. The selective estrogen receptor degrader, fulvestrant, significantly reduced the anchorage-independent growth of ESR1 mutant-expressing cells, while combination treatments with the mTOR inhibitor everolimus, or an inhibitor blocking IGF1R, and the insulin receptor significantly enhanced anti-proliferative responses. Using digital drop (dd) PCR, we identified mutations at high frequencies ranging from 12 % for Y537N, 5 % for Y537S, and 2 % for D538G in archived primary breast tumors from women treated with adjuvant mono-tamoxifen therapy. The HBD-ESR1 mutations were not associated with recurrence-free or overall survival in response in this patient cohort and suggest that knowledge of other cell-intrinsic factors in combination with ESR1 mutation status will be needed determine anti-proliferative responses to Tam.

Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

PubMed

Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

2017-12-15

TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

Atypical multifocal Dravet syndrome lacks generalized seizures and may show later cognitive decline.

PubMed

Kim, Young Ok; Bellows, Susannah; McMahon, Jacinta M; Iona, Xenia; Damiano, John; Dibbens, Leanne; Kelley, Kent; Gill, Deepak; Cross, J Helen; Berkovic, Samuel F; Scheffer, Ingrid E

2014-01-01

To show that atypical multifocal Dravet syndrome is a recognizable, electroclinical syndrome associated with sodium channel gene (SCN1A) mutations that readily escapes diagnosis owing to later cognitive decline and tonic seizures. Eight patients underwent electroclinical characterization. SCN1A was sequenced and copy number variations sought by multiplex ligation-dependent probe amplification. All patients were female (age range at assessment 5-26y) with median seizure onset at 6.5 months (range 4-19mo). The initial seizure was brief in seven and status epilepticus only occurred in one; three were febrile. Focal seizures occurred in four patients and bilateral convulsion in the other four. All patients developed multiple focal seizure types and bilateral convulsions, with seizure clusters in six. The most common focal seizure semiology (six out of eight) comprised unilateral clonic activity. Five also had focal or asymmetric tonic seizures. Rare or transient myoclonic seizures occurred in six individuals, often triggered by specific antiepileptic drugs. Developmental slowing occurred in all: six between 3 years and 8 years, and two around 1 year 6 months. Cognitive outcome varied from severe to mild intellectual disability. Multifocal epileptiform discharges were seen on electroencephalography. Seven out of eight patients had SCN1A mutations. Atypical, multifocal Dravet syndrome with SCN1A mutations may not be recognized because of later cognitive decline and frequent tonic seizures. © 2013 Mac Keith Press.

A Specific Mutational Signature Associated with DNA 8-Oxoguanine Persistence in MUTYH-defective Colorectal Cancer

DOE PAGES

Viel, Alessandra; Bruselles, Alessandro; Meccia, Ettore; ...

2017-04-13

8-Oxoguanine, a common mutagenic DNA lesion, generates G:C > T:A transversions via mispairing with adenine during DNA replication. When operating normally, the MUTYH DNA glycosylase prevents 8-oxoguanine-related mutagenesis by excising the incorporated adenine. Biallelic MUTYH mutations impair this enzymatic function and are associated with colorectal cancer (CRC) in MUTYH-Associated Polyposis (MAP) syndrome. Here in this paper, we perform whole-exome sequencing that reveals a modest mutator phenotype in MAP CRCs compared to sporadic CRC stem cell lines or bulk tumours. The excess G:C > T:A transversion mutations in MAP CRCs exhibits a novel mutational signature, termed Signature 36, with a strongmore » sequence dependence. The MUTYH mutational signature reflecting persistent 8-oxoG:A mismatches occurs frequently in the APC, KRAS, PIK3CA, FAT4, TP53, FAT1, AMER1, KDM6A, SMAD4 and SMAD2 genes that are associated with CRC. In conclusion, the occurrence of Signature 36 in other types of human cancer indicates that DNA 8-oxoguanine-related mutations might contribute to the development of cancer in other organs.« less

A Specific Mutational Signature Associated with DNA 8-Oxoguanine Persistence in MUTYH-defective Colorectal Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Viel, Alessandra; Bruselles, Alessandro; Meccia, Ettore

8-Oxoguanine, a common mutagenic DNA lesion, generates G:C > T:A transversions via mispairing with adenine during DNA replication. When operating normally, the MUTYH DNA glycosylase prevents 8-oxoguanine-related mutagenesis by excising the incorporated adenine. Biallelic MUTYH mutations impair this enzymatic function and are associated with colorectal cancer (CRC) in MUTYH-Associated Polyposis (MAP) syndrome. Here in this paper, we perform whole-exome sequencing that reveals a modest mutator phenotype in MAP CRCs compared to sporadic CRC stem cell lines or bulk tumours. The excess G:C > T:A transversion mutations in MAP CRCs exhibits a novel mutational signature, termed Signature 36, with a strongmore » sequence dependence. The MUTYH mutational signature reflecting persistent 8-oxoG:A mismatches occurs frequently in the APC, KRAS, PIK3CA, FAT4, TP53, FAT1, AMER1, KDM6A, SMAD4 and SMAD2 genes that are associated with CRC. In conclusion, the occurrence of Signature 36 in other types of human cancer indicates that DNA 8-oxoguanine-related mutations might contribute to the development of cancer in other organs.« less

CDKN2A/p16 inactivation mechanisms and their relationship to smoke exposure and molecular features in non-small cell lung cancer

PubMed Central

Tam, Kit W.; Zhang, Wei; Soh, Junichi; Stastny, Victor; Chen, Min; Sun, Han; Thu, Kelsie; Rios, Jonathan J.; Yang, Chenchen; Marconett, Crystal N.; Selamat, Suhaida A.; Laird-Offringa, Ite A; Taguchi, Ayumu; Hanash, Samir; Shames, David; Ma, Xiaotu; Zhang, Michael Q; Lam, Wan L.; Gazdar, Adi

2013-01-01

Introduction CDKN2A(p16) inactivation is common in lung cancer and occurs via homozygous deletions (HD), methylation of promoter region, or point mutations. While p16 promoter methylation has been linked to KRAS mutation and smoking, the associations between p16 inactivation mechanisms and other common genetic mutations and smoking status are still controversial or unknown. Methods We determined all three p16 inactivation mechanisms using multiple methodologies for genomic status, methylation, RNA and protein expression, and correlated them with EGFR, KRAS, STK11 mutations and smoking status in 40 cell lines and 45 tumor samples of primary NSCLC. We also performed meta-analyses to investigate the impact of smoke exposure on p16 inactivation. Results p16 inactivation was the major mechanism of RB pathway perturbation in NSCLC, with HD being the most frequent method, followed by methylation and the rarer point mutations. Inactivating mechanisms were tightly correlated with loss of mRNA and protein expression. p16 inactivation occurred at comparable frequencies regardless of mutational status of EGFR, KRAS and STK11, however, the major inactivation mechanism of p16 varied. p16 methylation was linked to KRAS mutation but was mutually exclusive with EGFR mutation. Cell lines and tumor samples demonstrated similar results. Our meta-analyses confirmed a modest positive association between p16 promoter methylation and smoking. Conclusions Our results confirm that all of the inactivation mechanisms are truly associated with loss of gene product and identify specific associations between p16 inactivation mechanisms and other genetic changes and smoking status. PMID:24077454

Paragangliomas and paraganglioma syndromes

PubMed Central

Boedeker, Carsten Christof

2012-01-01

Paragangliomas are rare tumors of neural crest origin. They are benign in the majority of cases and are characterized by a strong vascularisation. In the head and neck region they most commonly occur as carotid body tumors. Jugulotympanic and especially vagal paragangliomas are seen less frequently. Complete surgical resection represents the only curative treatment option even though resection of locally advanced tumors regularly results in lesions of the lower cranial nerves and major vessels. Appoximately 30% of all head and neck paragangliomas (HNPs) are hereditary and associated with different tumor syndromes. The paraganglioma syndromes 1, 3 and 4 (PGL 1, 3 and 4) make up the majority of those familial cases. PGL 1 is associated with mutations of the succinate dehydrogenase subunit D (SDHD) gene, PGL 3 is caused by SDHC and PGL 4 by SDHB gene mutations. Multiple HNPs and the occurance of HNPs together with pheochromocytomas are seen in SDHD as well as SDHB mutation carriers. In patients with SDHB mutations the risk for the development of malignant paraganglial tumors is significantly higher compared to SDHC and SDHD patients as well as patients with sporadic tumors. SDHC mutation carriers almost exclusively present with benign HNP that are unifocal in the majority of cases. The role of transmission is autosomal dominant for all three symptoms. Interestingly, there is a “parent-of-origin-dependent-inheritance” in subjects with SDHD gene mutations. This means that the disease phenotype may only become present if the mutation is inherited through the paternal line. We recommend screening for mutations of the genes SDHB, SDHC and SDHD in patients with HNPs. Certain clinical parameters can help to set up the order in which the three genes should be tested. PMID:22558053

A mutation analysis of the phenylalanine hydroxylase (PAH) gene in the Israeli population.

PubMed

Bercovich, D; Elimelech, A; Yardeni, T; Korem, S; Zlotogora, J; Gal, N; Goldstein, N; Vilensky, B; Segev, R; Avraham, S; Loewenthal, R; Schwartz, G; Anikster, Y

2008-05-01

Hyperphenylalaninemia (HPA) is a group of diseases characterized by a persistent elevation of phenylalanine levels in tissues and biological fluids. The most frequent form is phenylalanine hydroxylase deficiency, causing phenylketonuria (PKU). Among 159 Israeli patients (Jews, Muslim and Christian Arabs and Druze) with HPA, in whom at least one of the mutations was characterized, a total of 43 different mutations were detected, including seven novel ones. PKU was very rare among Ashkenazi Jews and relatively frequent among Jews from Yemen, the Caucasian Mountains, Bukhara and Tunisia. The mutations responsible for the high frequency were: exon3del (Yemenite Jews), L48S (Tunisian Jews) and E178G, P281L and L48S (Jews from the Caucasian Mountains and Bukhara). Among the non-Jewish Israeli citizens, the disease was relatively frequent in the Negev and in the Nazareth vicinity, and in many localities a unique mutation was detected, often in a single family. While marked genetic heterogeneity was observed in the Arab and Jewish populations, only one mutation A300S, was frequent in all of the communities. Several of the other frequent mutations were shared by the non-Ashkenazi Jews and Arabs; none were mutual to Ashkenazi Jews and Arabs.

Compensatory Evolution of Intrinsic Transcription Terminators in Bacillus Cereus

PubMed Central

Safina, Ksenia R.; Mironov, Andrey A.

2017-01-01

Many RNA molecules possess complicated secondary structure critical to their function. Mutations in double-helical regions of RNA may disrupt Watson–Crick (WC) interactions causing structure destabilization or even complete loss of function. Such disruption can be compensated by another mutation restoring base pairing, as has been shown for mRNA, rRNA and tRNA. Here, we investigate the evolution of intrinsic transcription terminators between closely related strains of Bacillus cereus. While the terminator structure is maintained by strong natural selection, as evidenced by the low frequency of disrupting mutations, we observe multiple instances of pairs of disrupting-compensating mutations in RNA structure stems. Such two-step switches between different WC pairs occur very fast, consistent with the low fitness conferred by the intermediate non-WC variant. Still, they are not instantaneous, and probably involve transient fixation of the intermediate variant. The GU wobble pair is the most frequent intermediate, and remains fixed longer than other intermediates, consistent with its less disruptive effect on the RNA structure. Double switches involving non-GU intermediates are more frequent at the ends of RNA stems, probably because they are associated with smaller fitness loss. Together, these results show that the fitness landscape of bacterial transcription terminators is rather rugged, but that the fitness valleys associated with unpaired stem nucleotides are rather shallow, facilitating evolution. PMID:28201729

High-resolution melting analysis (HRM) for mutational screening of Dnajc17 gene in patients affected by thyroid dysgenesis.

PubMed

Nettore, I C; Desiderio, S; De Nisco, E; Cacace, V; Albano, L; Improda, N; Ungaro, P; Salerno, M; Colao, A; Macchia, P E

2018-06-01

Congenital hypothyroidism is a frequent disease occurring with an incidence of about 1/1500 newborns/year. In about 75% of the cases, CH is caused by alterations in thyroid morphogenesis, defined "thyroid dysgenesis" (TD). TD is generally a sporadic disease but in about 5% of the cases a genetic origin has been demonstrated. Previous studies indicate that Dnajc17 as a candidate modifier gene for hypothyroidism, since it is expressed in the thyroid bud, interacts with NKX2.1 and PAX8 and it has been associated to the hypothyroid phenotype in mice carrying a single Nkx2.1 and Pax8 genes (double heterozygous knock-out). The work evaluates the possible involvement of DNAJC17 in the pathogenesis of TD. High-resolution DNA melting analysis (HRM) and direct sequencing have been used to screen for mutations in the DNAJC17 coding sequence in 89 patients with TD. Two mutations have been identified in the coding sequence of DNAJC17 gene, one in exon 5 (c.350A>C; rs79709714) and one in exon 9 (c.610G>C; rs117485355). The last one is a rare variant, while the rs79709714 is a polymorphism. Both are present in databases and the frequency of the alleles is not different between TD patients and controls. DNAJC17 mutations are not frequently present in patients with TD.

Bone Metastasis in Prostate Cancer: Recurring Mitochondrial DNA Mutation Reveals Selective Pressure Exerted by the Bone Microenvironment

PubMed Central

Arnold, Rebecca S.; Fedewa, Stacey A.; Goodman, Michael; Osunkoya, Adeboye O.; Kissick, Haydn T.; Morrissey, Colm; True, Lawrence D.; Petros, John A.

2015-01-01

Background Cancer progression and metastasis occurs such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell’s description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. Methods We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Results Somatic mutations were significantly more numerous in bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (np) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at np 10436 and a tRNA Thr mutation at np 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to bone and also occurred in three patients. Conclusions Mitochondrial genomic variation was greater in metastatic sites than the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational “hot-spot” was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific “survival of the fittest” as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. PMID:25952970

Bone metastasis in prostate cancer: Recurring mitochondrial DNA mutation reveals selective pressure exerted by the bone microenvironment.

PubMed

Arnold, Rebecca S; Fedewa, Stacey A; Goodman, Michael; Osunkoya, Adeboye O; Kissick, Haydn T; Morrissey, Colm; True, Lawrence D; Petros, John A

2015-09-01

Cancer progression and metastasis occur such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell's description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary tumor and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Somatic mutations were significantly more numerous in the bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (n.p.) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in the bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at n.p. 10436 and a tRNA Thr mutation at n.p. 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to the bone and also occurred in three patients. Mitochondrial genomic variation was greater in metastatic sites than in the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational "hot-spot" was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific "survival of the fittest" as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. Published by Elsevier Inc.

Carcinogenesis of PIK3CA

PubMed Central

2013-01-01

PIK3CA is the most frequently mutated oncogene in human cancers. PIK3CA is phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha. It controls cell growth, proliferation, motility, survival, differentiation and intracellular trafficking. In most of human cancer alteration occurred frequently in the alpha isoform of phosphatidylinositol 3 kinase. PIK3CA mutations were most frequent in endometrial, ovarian, colorectal, breast, cervical, squamous cell cancer of the head and neck, chondroma, thyroid carcinoma and in cancer family syndrome. Inhibition of PI3K signaling can diminish cell proliferation, and in some circumstances, promote cell death. Consequently, components of this pathway present attractive targets for cancer therapeutics. A number of PI3K pathway inhibitors have been developed and used. PI3K inhibitors (both pan-PI3K and isoform-specific PI3K inhibitors), dual PI3K-mTOR inhibitors that are catalytic site inhibitors of the p110 isoforms and mTOR (the kinase component of both mTORC1 and mTORC2), mTOR catalytic site inhibitors, and AKT inhibitors are the most advanced in the clinic. They are approved for the treatment of several carcinomas. PMID:23768168

De novo mutations in histone modifying genes in congenital heart disease

PubMed Central

Zaidi, Samir; Choi, Murim; Wakimoto, Hiroko; Ma, Lijiang; Jiang, Jianming; Overton, John D.; Romano-Adesman, Angela; Bjornson, Robert D.; Breitbart, Roger E.; Brown, Kerry K.; Carriero, Nicholas J.; Cheung, Yee Him; Deanfield, John; DePalma, Steve; Fakhro, Khalid A.; Glessner, Joseph; Hakonarson, Hakon; Italia, Michael; Kaltman, Jonathan R.; Kaski, Juan; Kim, Richard; Kline, Jennie K.; Lee, Teresa; Leipzig, Jeremy; Lopez, Alexander; Mane, Shrikant M.; Mitchell, Laura E.; Newburger, Jane W.; Parfenov, Michael; Pe'er, Itsik; Porter, George; Roberts, Amy; Sachidanandam, Ravi; Sanders, Stephan J.; Seiden, Howard S.; State, Mathew W.; Subramanian, Sailakshmi; Tikhonova, Irina R.; Wang, Wei; Warburton, Dorothy; White, Peter S.; Williams, Ismee A.; Zhao, Hongyu; Seidman, Jonathan G.; Brueckner, Martina; Chung, Wendy K.; Gelb, Bruce D.; Goldmuntz, Elizabeth; Seidman, Christine E.; Lifton, Richard P.

2013-01-01

Congenital heart disease (CHD) is the most frequent birth defect, affecting 0.8% of live births1. Many cases occur sporadically and impair reproductive fitness, suggesting a role for de novo mutations. By analysis of exome sequencing of parent-offspring trios, we compared the incidence of de novo mutations in 362 severe CHD cases and 264 controls. CHD cases showed a significant excess of protein-altering de novo mutations in genes expressed in the developing heart, with an odds ratio of 7.5 for damaging mutations. Similar odds ratios were seen across major classes of severe CHD. We found a marked excess of de novo mutations in genes involved in production, removal or reading of H3K4 methylation (H3K4me), or ubiquitination of H2BK120, which is required for H3K4 methylation2–4. There were also two de novo mutations in SMAD2; SMAD2 signaling in the embryonic left-right organizer induces demethylation of H3K27me5. H3K4me and H3K27me mark `poised' promoters and enhancers that regulate expression of key developmental genes6. These findings implicate de novo point mutations in several hundred genes that collectively contribute to ~10% of severe CHD. PMID:23665959

Serum antibodies against frameshift peptides in microsatellite unstable colorectal cancer patients with Lynch syndrome

PubMed Central

Reuschenbach, Miriam; Kloor, Matthias; Morak, Monika; Wentzensen, Nicolas; Germann, Anja; Garbe, Yvette; Tariverdian, Mirjam; Findeisen, Peter; Neumaier, Michael; Holinski-Feder, Elke; Doeberitz, Magnus von Knebel

2014-01-01

High level microsatellite instability (MSI-H) occurs in about 15% of colorectal cancer (CRCs), either as sporadic cancers or in the context of hereditary non-polyposis cancer (HNPCC) or Lynch syndrome. In MSI-H CRC, mismatch repair deficiency leads to insertion/deletion mutations at coding microsatellites (cMS) and thus to the translation of frameshift peptides (FSPs). FSPs are potent inductors of T cell responses in vitro and in vivo. The present study aims at the identification of FSP-specific humoral immune responses in MSI-H CRC and Lynch syndrome. Sera from patients with history of MSI-H CRC (n=69), healthy Lynch syndrome mutation carriers (n=31) and healthy controls (n=52) were analyzed for antibodies against FSPs using peptide ELISA. Reactivities were measured against FSPs derived from genes frequently mutated in MSI-H CRCs, AIM2, TGFBR2, CASP5, TAF1B, ZNF294, and MARCKS. Antibody reactivity against FSPs was significantly higher in MSI-H CRC patients than in healthy controls (p=0.036, Mann-Whitney) and highest in patients with shortest interval between tumor resection and serum sampling. Humoral immune responses in patients were most frequently directed against FSPs derived from mutated TAF1B (11.6%, 8/69) and TGFBR2 (10.1%, 7/69). Low level FSP-specific antibodies were also detected in healthy mutation carriers. Our results show that antibody responses against FSPs are detectable in MSI-H CRC patients and healthy Lynch syndrome mutation carriers. Based on the high number of defined FSP antigens, measuring FSP-specific humoral immune responses is a highly promising tool for future diagnostic application in MSI-H cancer patients. PMID:19957108

Serum antibodies against frameshift peptides in microsatellite unstable colorectal cancer patients with Lynch syndrome.

PubMed

Reuschenbach, Miriam; Kloor, Matthias; Morak, Monika; Wentzensen, Nicolas; Germann, Anja; Garbe, Yvette; Tariverdian, Mirjam; Findeisen, Peter; Neumaier, Michael; Holinski-Feder, Elke; von Knebel Doeberitz, Magnus

2010-06-01

High level microsatellite instability (MSI-H) occurs in about 15% of colorectal cancer (CRCs), either as sporadic cancers or in the context of hereditary non-polyposis cancer or Lynch syndrome. In MSI-H CRC, mismatch repair deficiency leads to insertion/deletion mutations at coding microsatellites and thus to the translation of frameshift peptides (FSPs). FSPs are potent inductors of T cell responses in vitro and in vivo. The present study aims at the identification of FSP-specific humoral immune responses in MSI-H CRC and Lynch syndrome. Sera from patients with history of MSI-H CRC (n = 69), healthy Lynch syndrome mutation carriers (n = 31) and healthy controls (n = 52) were analyzed for antibodies against FSPs using peptide ELISA. Reactivities were measured against FSPs derived from genes frequently mutated in MSI-H CRCs, AIM2, TGFBR2, CASP5, TAF1B, ZNF294, and MARCKS. Antibody reactivity against FSPs was significantly higher in MSI-H CRC patients than in healthy controls (P = 0.036, Mann-Whitney) and highest in patients with shortest interval between tumor resection and serum sampling. Humoral immune responses in patients were most frequently directed against FSPs derived from mutated TAF1B (11.6%, 8/69) and TGFBR2 (10.1%, 7/69). Low level FSP-specific antibodies were also detected in healthy mutation carriers. Our results show that antibody responses against FSPs are detectable in MSI-H CRC patients and healthy Lynch syndrome mutation carriers. Based on the high number of defined FSP antigens, measuring FSP-specific humoral immune responses is a highly promising tool for future diagnostic application in MSI-H cancer patients.

Chromatin remodelling and DNA repair genes are frequently mutated in endometrioid endometrial carcinoma.

PubMed

García-Sanz, Pablo; Triviño, Juan Carlos; Mota, Alba; Pérez López, María; Colás, Eva; Rojo-Sebastián, Alejandro; García, Ángel; Gatius, Sonia; Ruiz, María; Prat, Jaime; López-López, Rafael; Abal, Miguel; Gil-Moreno, Antonio; Reventós, Jaume; Matias-Guiu, Xavier; Moreno-Bueno, Gema

2017-04-01

In developed countries, endometrial carcinoma is the most common cancer that affects the female genital tract. Endometrial carcinoma is divided into two main histological types, type I or endometrioid and type II or non-endometrioid, each of which have characteristic, although not exclusive, molecular alterations and mutational profiles. Nevertheless, information about the implication and relevance of some of these genes in this disease is lacking. We sought here to identify new recurrently mutated genes in endometrioid cancers that play a role in tumourigenesis and that influence the clinical outcome. We focused on low-grade, non-ultramutated tumours as these tumours have a worse prognosis than the ultramutated POLE-positive endometrioid endometrial carcinomas (EECs). We performed exome-sequencing of 11 EECs with matched normal tissue and subsequently validated 15 candidate genes in 76 samples. For the first time, we show that mutations in chromatin remodelling-related genes (KMT2D, KMT2C, SETD1B and BCOR) and in DNA-repair-related genes (BRCA1, BRCA2, RAD50 and CHD4) are frequent in this subtype of endometrial cancer. The alterations to these genes occurred with frequencies ranging from 35.5% for KMT2D to 10.5% for BRCA1 and BCOR, with some showing a tendency toward co-occurrence (RAD50-KMT2D and RAD50-SETD1B). All these genes harboured specific mutational hotspots. In addition, the mutational status of KMT2C, KMT2D and SETD1B helps to predict the degree of myometrial invasion, a critical prognostic feature. These results highlight the possible implication of these genes in this disease, creating opportunities for new therapeutic approaches. © 2016 UICC.

Background sequence characteristics influence the occurrence and severity of disease-causing mtDNA mutations

PubMed Central

Wei, Wei; Hudson, Gavin

2017-01-01

Inherited mitochondrial DNA (mtDNA) mutations have emerged as a common cause of human disease, with mutations occurring multiple times in the world population. The clinical presentation of three pathogenic mtDNA mutations is strongly associated with a background mtDNA haplogroup, but it is not clear whether this is limited to a handful of examples or is a more general phenomenon. To address this, we determined the characteristics of 30,506 mtDNA sequences sampled globally. After performing several quality control steps, we ascribed an established pathogenicity score to the major alleles for each sequence. The mean pathogenicity score for known disease-causing mutations was significantly different between mtDNA macro-haplogroups. Several mutations were observed across all haplogroup backgrounds, whereas others were only observed on specific clades. In some instances this reflected a founder effect, but in others, the mutation recurred but only within the same phylogenetic cluster. Sequence diversity estimates showed that disease-causing mutations were more frequent on young sequences, and genomes with two or more disease-causing mutations were more common than expected by chance. These findings implicate the mtDNA background more generally in recurrent mutation events that have been purified through natural selection in older populations. This provides an explanation for the low frequency of mtDNA disease reported in specific ethnic groups. PMID:29253894

The investigation of genetic and clinical features in Chinese patients with juvenile amyotrophic lateral sclerosis.

PubMed

Liu, Z-J; Lin, H-X; Liu, G-L; Tao, Q-Q; Ni, W; Xiao, B-G; Wu, Z-Y

2017-09-01

Juvenile amyotrophic lateral sclerosis (JALS) occurs at an age of onset below 25 years with a heterogeneous disease onset location, variable progression and survival time. To investigate whether an ALS gene profile could resolve any aspects of clinical symptom heterogeneity, we have used targeted sequencing technology in a cohort of 12 JALS patients of Chinese descent. We detected 5 likely pathogenic mutations, 2 in familial probands and 3 in sporadic patients. One was a known TARDBP mutation (p.G348V) and 4 were FUS frameshift mutations including a known p.Gln519Ilefs*9 mutation and 3 novel mutations, p.Gly515Valfs*14, p.Gly486Profs*30, and p.Arg498Alafs*32. Of the 4 FUS mutations, 2 were able to be confirmed as de novo mutations. The TARDBP mutation carrier showed a classic ALS phenotype. All patients with FUS mutations experienced limb weakness at an early age and developed bulbar symptoms during the disease course. FUS mutations have previously been associated with increased JALS disease progression, however, we found a large range 12 to 84 months in disease survival (mean 58.2 months). Our results justify future screening for variants in FUS as it remains the most frequent genetic determinant of early onset, JALS (found in 30% of our patients). © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Oncogenic and RASopathy-associated K-RAS mutations relieve membrane-dependent occlusion of the effector-binding site.

PubMed

Mazhab-Jafari, Mohammad T; Marshall, Christopher B; Smith, Matthew J; Gasmi-Seabrook, Geneviève M C; Stathopulos, Peter B; Inagaki, Fuyuhiko; Kay, Lewis E; Neel, Benjamin G; Ikura, Mitsuhiko

2015-05-26

K-RAS4B (Kirsten rat sarcoma viral oncogene homolog 4B) is a prenylated, membrane-associated GTPase protein that is a critical switch for the propagation of growth factor signaling pathways to diverse effector proteins, including rapidly accelerated fibrosarcoma (RAF) kinases and RAS-related protein guanine nucleotide dissociation stimulator (RALGDS) proteins. Gain-of-function KRAS mutations occur frequently in human cancers and predict poor clinical outcome, whereas germ-line mutations are associated with developmental syndromes. However, it is not known how these mutations affect K-RAS association with biological membranes or whether this impacts signal transduction. Here, we used solution NMR studies of K-RAS4B tethered to nanodiscs to investigate lipid bilayer-anchored K-RAS4B and its interactions with effector protein RAS-binding domains (RBDs). Unexpectedly, we found that the effector-binding region of activated K-RAS4B is occluded by interaction with the membrane in one of the NMR-observable, and thus highly populated, conformational states. Binding of the RAF isoform ARAF and RALGDS RBDs induced marked reorientation of K-RAS4B from the occluded state to RBD-specific effector-bound states. Importantly, we found that two Noonan syndrome-associated mutations, K5N and D153V, which do not affect the GTPase cycle, relieve the occluded orientation by directly altering the electrostatics of two membrane interaction surfaces. Similarly, the most frequent KRAS oncogenic mutation G12D also drives K-RAS4B toward an exposed configuration. Further, the D153V and G12D mutations increase the rate of association of ARAF-RBD with lipid bilayer-tethered K-RAS4B. We revealed a mechanism of K-RAS4B autoinhibition by membrane sequestration of its effector-binding site, which can be disrupted by disease-associated mutations. Stabilizing the autoinhibitory interactions between K-RAS4B and the membrane could be an attractive target for anticancer drug discovery.

The role of APC in WNT pathway activation in serrated neoplasia.

PubMed

Borowsky, Jennifer; Dumenil, Troy; Bettington, Mark; Pearson, Sally-Ann; Bond, Catherine; Fennell, Lochlan; Liu, Cheng; McKeone, Diane; Rosty, Christophe; Brown, Ian; Walker, Neal; Leggett, Barbara; Whitehall, Vicki

2018-03-01

Conventional adenomas are initiated by APC gene mutation that activates the WNT signal. Serrated neoplasia is commonly initiated by BRAF or KRAS mutation. WNT pathway activation may also occur, however, to what extent this is owing to APC mutation is unknown. We examined aberrant nuclear β-catenin immunolocalization as a surrogate for WNT pathway activation and analyzed the entire APC gene coding sequence in serrated and conventional pathway polyps and cancers. WNT pathway activation was a common event in conventional pathway lesions with aberrant nuclear immunolocalization of β-catenin and truncating APC mutations in 90% and 89% of conventional adenomas and 82% and 70% of BRAF wild-type cancers, respectively. WNT pathway activation was seen to a lesser extent in serrated pathway lesions. It occurred at the transition to dysplasia in serrated polyps with a significant increase in nuclear β-catenin labeling from sessile serrated adenomas (10%) to sessile serrated adenomas with dysplasia (55%) and traditional serrated adenomas (9%) to traditional serrated adenomas with dysplasia (39%) (P=0.0001). However, unlike the conventional pathway, truncating APC mutations were rare in the serrated pathway lesions especially sessile serrated adenomas even when dysplastic (15%) and in the BRAF mutant cancers with microsatellite instability that arise from them (8%). In contrast, APC missense mutations that were rare in conventional pathway adenomas and cancers (3% in BRAF wild-type cancers) were more frequent in BRAF mutant cancers with microsatellite instability (32%). We conclude that increased WNT signaling is important in the transition to malignancy in the serrated pathway but that APC mutation is less common and the spectrum of mutations is different than in conventional colorectal carcinogenesis. Moderate impact APC mutations and non-APC-related causes of increased WNT signaling may have a more important role in serrated neoplasia than the truncating APC mutations common in conventional adenomas.

Ancient genes establish stress-induced mutation as a hallmark of cancer.

PubMed

Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching "protected" genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer.

Ancient genes establish stress-induced mutation as a hallmark of cancer

PubMed Central

Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching “protected” genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer. PMID:28441401

Weaver syndrome and EZH2 mutations: Clarifying the clinical phenotype.

PubMed

Tatton-Brown, Katrina; Murray, Anne; Hanks, Sandra; Douglas, Jenny; Armstrong, Ruth; Banka, Siddharth; Bird, Lynne M; Clericuzio, Carol L; Cormier-Daire, Valerie; Cushing, Tom; Flinter, Frances; Jacquemont, Marie-Line; Joss, Shelagh; Kinning, Esther; Lynch, Sally Ann; Magee, Alex; McConnell, Vivienne; Medeira, Ana; Ozono, Keiichi; Patton, Michael; Rankin, Julia; Shears, Debbie; Simon, Marleen; Splitt, Miranda; Strenger, Volker; Stuurman, Kyra; Taylor, Clare; Titheradge, Hannah; Van Maldergem, Lionel; Temple, I Karen; Cole, Trevor; Seal, Sheila; Rahman, Nazneen

2013-12-01

Weaver syndrome, first described in 1974, is characterized by tall stature, a typical facial appearance, and variable intellectual disability. In 2011, mutations in the histone methyltransferase, EZH2, were shown to cause Weaver syndrome. To date, we have identified 48 individuals with EZH2 mutations. The mutations were primarily missense mutations occurring throughout the gene, with some clustering in the SET domain (12/48). Truncating mutations were uncommon (4/48) and only identified in the final exon, after the SET domain. Through analyses of clinical data and facial photographs of EZH2 mutation-positive individuals, we have shown that the facial features can be subtle and the clinical diagnosis of Weaver syndrome is thus challenging, especially in older individuals. However, tall stature is very common, reported in >90% of affected individuals. Intellectual disability is also common, present in ~80%, but is highly variable and frequently mild. Additional clinical features which may help in stratifying individuals to EZH2 mutation testing include camptodactyly, soft, doughy skin, umbilical hernia, and a low, hoarse cry. Considerable phenotypic overlap between Sotos and Weaver syndromes is also evident. The identification of an EZH2 mutation can therefore provide an objective means of confirming a subtle presentation of Weaver syndrome and/or distinguishing Weaver and Sotos syndromes. As mutation testing becomes increasingly accessible and larger numbers of EZH2 mutation-positive individuals are identified, knowledge of the clinical spectrum and prognostic implications of EZH2 mutations should improve. © 2013 Wiley Periodicals, Inc.

Mutational analysis of genes coding for cell surface proteins in colorectal cancer cell lines reveal novel altered pathways, druggable mutations and mutated epitopes for targeted therapy

PubMed Central

Correa, Bruna R.; Bettoni, Fabiana; Koyama, Fernanda C.; Navarro, Fabio C.P.; Perez, Rodrigo O.; Mariadason, John; Sieber, Oliver M.; Strausberg, Robert L.; Simpson, Andrew J.G.; Jardim, Denis L.F.; Reis, Luiz Fernando L.; Parmigiani, Raphael B.; Galante, Pedro A.F.; Camargo, Anamaria A.

2014-01-01

We carried out a mutational analysis of 3,594 genes coding for cell surface proteins (Surfaceome) in 23 colorectal cancer cell lines, searching for new altered pathways, druggable mutations and mutated epitopes for targeted therapy in colorectal cancer. A total of 3,944 somatic non-synonymous substitutions and 595 InDels, occurring in 2,061 (57%) Surfaceome genes were catalogued. We identified 48 genes not previously described as mutated in colorectal tumors in the TCGA database, including genes that are mutated and expressed in >10% of the cell lines (SEMA4C, FGFRL1, PKD1, FAM38A, WDR81, TMEM136, SLC36A1, SLC26A6, IGFLR1). Analysis of these genes uncovered important roles for FGF and SEMA4 signaling in colorectal cancer with possible therapeutic implications. We also found that cell lines express on average 11 druggable mutations, including frequent mutations (>20%) in the receptor tyrosine kinases AXL and EPHA2, which have not been previously considered as potential targets for colorectal cancer. Finally, we identified 82 cell surface mutated epitopes, however expression of only 30% of these epitopes was detected in our cell lines. Notwithstanding, 92% of these epitopes were expressed in cell lines with the mutator phenotype, opening new venues for the use of “general” immune checkpoint drugs in this subset of patients. PMID:25193853

Nonoverlapping Clinical and Mutational Patterns in Melanomas from the Female Genital Tract and Atypical Genital Nevi.

PubMed

Yélamos, Oriol; Merkel, Emily A; Sholl, Lauren Meldi; Zhang, Bin; Amin, Sapna M; Lee, Christina Y; Guitart, Gerta E; Yang, Jingyi; Wenzel, Alexander T; Bunick, Christopher G; Yazdan, Pedram; Choi, Jaehyuk; Gerami, Pedram

2016-09-01

Genital melanomas (GM) are the second most common cancer of the female external genitalia and may be confused with atypical genital nevi (AGN), which exhibit atypical histological features but have benign behavior. In this study, we compared the clinical, histological, and molecular features of 19 GM and 25 AGN. We described chromosomal copy number aberrations and the mutational status of 50 oncogenes and tumor suppressor genes in both groups. Our study showed that a pigmented lesion occurring in mucosal tissue, particularly in postmenopausal women, was more likely to be a melanoma than a nevus. GM had high levels of chromosomal instability, with many copy number aberrations. Furthermore, we found a completely nonoverlapping pattern of oncogenic mutations when comparing GM and AGN. In GM, we report somatic mutations in KIT and TP53. Conversely, AGN had frequent BRAF V600E mutations, which were not seen in any of the GM. Our results show that GM and AGN have distinct clinical and molecular changes and that GM have a different mutational pattern compared with AGN. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Metabolic interactions between cysteamine and epigallocatechin gallate.

PubMed

Izzo, Valentina; Pietrocola, Federico; Sica, Valentina; Durand, Sylvère; Lachkar, Sylvie; Enot, David; Bravo-San Pedro, José Manuel; Chery, Alexis; Esposito, Speranza; Raia, Valeria; Maiuri, Luigi; Maiuri, Maria Chiara; Kroemer, Guido

2017-02-01

Phase II clinical trials indicate that the combination of cysteamine plus epigallocatechin gallate (EGCG) is effective against cystic fibrosis in patients bearing the most frequent etiological mutation (CFTRΔF508). Here, we investigated the interaction between both agents on cultured respiratory epithelia cells from normal and CFTRΔF508-mutated donors. We observed that the combination of both agents affected metabolic circuits (and in particular the tricarboxylic acid cycle) in a unique way and that cysteamine plus EGCG reduced cytoplasmic protein acetylation more than each of the 2 components alone. In a cell-free system, protein cross-linking activity of EGCG was suppressed by cysteamine. Finally, EGCG was able to enhance the conversion of cysteamine into taurine in metabolic flux experiments. Altogether, these results indicate that multiple pharmacological interactions occur between cysteamine and EGCG, suggesting that they contribute to the unique synergy of both agents in restoring the function of mutated CFTRΔF508.

Metabolic interactions between cysteamine and epigallocatechin gallate

PubMed Central

Izzo, Valentina; Pietrocola, Federico; Sica, Valentina; Durand, Sylvère; Lachkar, Sylvie; Enot, David; Bravo-San Pedro, José Manuel; Chery, Alexis; Esposito, Speranza; Raia, Valeria; Maiuri, Luigi; Maiuri, Maria Chiara; Kroemer, Guido

2017-01-01

ABSTRACT Phase II clinical trials indicate that the combination of cysteamine plus epigallocatechin gallate (EGCG) is effective against cystic fibrosis in patients bearing the most frequent etiological mutation (CFTRΔF508). Here, we investigated the interaction between both agents on cultured respiratory epithelia cells from normal and CFTRΔF508-mutated donors. We observed that the combination of both agents affected metabolic circuits (and in particular the tricarboxylic acid cycle) in a unique way and that cysteamine plus EGCG reduced cytoplasmic protein acetylation more than each of the 2 components alone. In a cell-free system, protein cross-linking activity of EGCG was suppressed by cysteamine. Finally, EGCG was able to enhance the conversion of cysteamine into taurine in metabolic flux experiments. Altogether, these results indicate that multiple pharmacological interactions occur between cysteamine and EGCG, suggesting that they contribute to the unique synergy of both agents in restoring the function of mutated CFTRΔF508. PMID:28059601

Undifferentiated and Dedifferentiated Endometrial Carcinomas With POLE Exonuclease Domain Mutations Have a Favorable Prognosis.

PubMed

Espinosa, Iñigo; Lee, Cheng-Han; D'Angelo, Emanuela; Palacios, José; Prat, Jaime

2017-08-01

POLE exonuclease domain mutations have recently been described in undifferentiated endometrial carcinoma but, because of the rarity of this aggressive type of endometrial cancer, their prognostic significance is unknown. We have analyzed the immunophenotype (ARID1A, MLH1, PMS2, MSH2, MSH6, p53, β-catenin, and SMARCB1) and mutational status (POLE, PIK3CA, and PTEN) of 21 undifferentiated carcinomas (8 undifferentiated and 13 dedifferentiated carcinomas). Loss of ARID1A expression was observed in 9 of 19 cases (47%), loss of expression of at least 1 DNA mismatch repair protein in 7 (7/21; 33%), and p53 immunoreaction was aberrant (mutated/inactivated) in 11 cases (11/21; 52%). All tumors were negative for β-catenin. Normal nuclear SMARCB1 (INI1) staining was found in all but 1 dedifferentiated case. Two undifferentiated and 7 dedifferentiated carcinomas showed POLE exonuclease domain mutations (9/21; 42%). PIK3CA mutations occurred in six tumors (6/21; 28%) (2 undifferentiated and 4 dedifferentiated carcinomas). PTEN mutations were found in 7 of 15 cases (47%) (4 undifferentiated and 3 dedifferentiated carcinomas). POLE-mutated undifferentiated and dedifferentiated endometrial carcinomas were more frequently stage I tumors than similar carcinomas lacking exonuclease domain mutations (7/9; 78% vs. 3/12; 25%; P=0.023) and patients had significantly better outcome (disease-specific survival) than those without POLE exonuclease domain mutations (P=0.02). Determination of the POLE mutation status is important for the management of these patients.

PAX5 mutations occur frequently in adult B-cell progenitor acute lymphoblastic leukemia and PAX5 haploinsufficiency is associated with BCR-ABL1 and TCF3-PBX1 fusion genes: a GRAALL study.

PubMed

Familiades, J; Bousquet, M; Lafage-Pochitaloff, M; Béné, M-C; Beldjord, K; De Vos, J; Dastugue, N; Coyaud, E; Struski, S; Quelen, C; Prade-Houdellier, N; Dobbelstein, S; Cayuela, J-M; Soulier, J; Grardel, N; Preudhomme, C; Cavé, H; Blanchet, O; Lhéritier, V; Delannoy, A; Chalandon, Y; Ifrah, N; Pigneux, A; Brousset, P; Macintyre, E A; Huguet, F; Dombret, H; Broccardo, C; Delabesse, E

2009-11-01

Adult and child B-cell progenitor acute lymphoblastic leukemia (BCP-ALL) differ in terms of incidence and prognosis. These disparities are mainly due to the molecular abnormalities associated with these two clinical entities. A genome-wide analysis using oligo SNP arrays recently demonstrated that PAX5 (paired-box domain 5) is the main target of somatic mutations in childhood BCP-ALL being altered in 38.9% of the cases. We report here the most extensive analysis of alterations of PAX5 coding sequence in 117 adult BCP-ALL patients in the unique clinical protocol GRAALL-2003/GRAAPH-2003. Our study demonstrates that PAX5 is mutated in 34% of adult BCP-ALL, mutations being partial or complete deletion, partial or complete amplification, point mutation or fusion gene. PAX5 alterations are heterogeneous consisting in complete loss in 17%, focal deletions in 10%, point mutations in 7% and translocations in 1% of the cases. PAX5 complete loss and PAX5 point mutations differ. PAX5 complete loss seems to be a secondary event and is significantly associated with BCR-ABL1 or TCF3-PBX1 fusion genes and a lower white blood cell count.

Short stature in genetic syndromes: Selected issues.

PubMed

Łaczmańska, Izabela; Kuliczkowska-Płaksej, Justyna; Stembalska, Agnieszka

2018-03-14

Short stature, which is defined as height below 2 standard deviations of the mean height for the age and sex, is one of the most frequent reasons for medical consultations in children. Short stature may occur due to a constitutional delay in growth, familial short stature or chronic diseases, including many genetic syndromes, metabolic and endocrine disorders. In this article the authors provide a mini-review of the most frequent genetic syndromes associated with short stature that should be taken into account in the differential diagnosis process. Syndromes caused by chromosomal aberrations and gene mutations were divided into 2 main groups: syndromes that are associated with intrauterine growth retardation (IUGR) and those in which IUGR does not occur in the natural history of the patient. The authors described the most important anomalies in each syndrome. Metabolic diseases and skeletal dysplasias were omitted, as they are major separate groups of diseases involving growth delay.

Recombination Is Responsible for the Increased Recovery of Drug-Resistant Mutants with Hypermutated Genomes in Resting Yeast Diploids Expressing APOBEC Deaminases

PubMed Central

Lada, Artem G.; Stepchenkova, Elena I.; Zhuk, Anna S.; Kliver, Sergei F.; Rogozin, Igor B.; Polev, Dmitrii E.; Dhar, Alok; Pavlov, Youri I.

2017-01-01

DNA editing deaminases (APOBECs) are implicated in generation of mutations in somatic cells during tumorigenesis. APOBEC-dependent mutagenesis is thought to occur during transient exposure of unprotected single-stranded DNA. Mutations frequently occur in clusters (kataegis). We investigated mechanisms of mutant generation in growing and resting diploid yeast expressing APOBEC from sea lamprey, PmCDA1, whose kataegistic effect was previously shown to be associated with transcription. We have found that the frequency of canavanine-resistant mutants kept raising after growth cessation, while the profile of transcription remained unchanged. Surprisingly, the overall number of mutations in the genomes did not elevate in resting cells. Thus, mutations were accumulated during vigorous growth stage with both intense replication and transcription. We found that the elevated recovery of can1 mutant clones in non-growing cells is the result of loss of heterozygosity (LOH) leading to clusters of homozygous mutations in the chromosomal regions distal to the reporter gene. We confirmed that recombination frequency in resting cells was elevated by orders of magnitude, suggesting that cells were transiently committed to meiotic levels of recombination, a process referred to in yeast genetics as return-to-growth. In its extreme, on day 6 of starvation, a few mutant clones were haploid, likely resulting from completed meiosis. Distribution of mutations along chromosomes indicated that PmCDA1 was active during ongoing recombination events and sometimes produced characteristic kataegis near initial breakpoints. AID and APOBEC1 behaved similar to PmCDA1. We conclude that replication, transcription, and mitotic recombination contribute to the recovered APOBEC-induced mutations in resting diploids. The mechanism is relevant to the initial stages of oncogenic transformation in terminally differentiated cells, when recombination may lead to the LOH exposing recessive mutations induced by APOBECs in cell’s history and to acquisition of new mutations near original break. PMID:29312434

Recombination Is Responsible for the Increased Recovery of Drug-Resistant Mutants with Hypermutated Genomes in Resting Yeast Diploids Expressing APOBEC Deaminases.

PubMed

Lada, Artem G; Stepchenkova, Elena I; Zhuk, Anna S; Kliver, Sergei F; Rogozin, Igor B; Polev, Dmitrii E; Dhar, Alok; Pavlov, Youri I

2017-01-01

DNA editing deaminases (APOBECs) are implicated in generation of mutations in somatic cells during tumorigenesis. APOBEC-dependent mutagenesis is thought to occur during transient exposure of unprotected single-stranded DNA. Mutations frequently occur in clusters ( kataegis ). We investigated mechanisms of mutant generation in growing and resting diploid yeast expressing APOBEC from sea lamprey, PmCDA1, whose kataegistic effect was previously shown to be associated with transcription. We have found that the frequency of canavanine-resistant mutants kept raising after growth cessation, while the profile of transcription remained unchanged. Surprisingly, the overall number of mutations in the genomes did not elevate in resting cells. Thus, mutations were accumulated during vigorous growth stage with both intense replication and transcription. We found that the elevated recovery of can1 mutant clones in non-growing cells is the result of loss of heterozygosity (LOH) leading to clusters of homozygous mutations in the chromosomal regions distal to the reporter gene. We confirmed that recombination frequency in resting cells was elevated by orders of magnitude, suggesting that cells were transiently committed to meiotic levels of recombination, a process referred to in yeast genetics as return-to-growth. In its extreme, on day 6 of starvation, a few mutant clones were haploid, likely resulting from completed meiosis. Distribution of mutations along chromosomes indicated that PmCDA1 was active during ongoing recombination events and sometimes produced characteristic kataegis near initial breakpoints. AID and APOBEC1 behaved similar to PmCDA1. We conclude that replication, transcription, and mitotic recombination contribute to the recovered APOBEC-induced mutations in resting diploids. The mechanism is relevant to the initial stages of oncogenic transformation in terminally differentiated cells, when recombination may lead to the LOH exposing recessive mutations induced by APOBECs in cell's history and to acquisition of new mutations near original break.

Colorectal Carcinomas With CpG Island Methylator Phenotype 1 Frequently Contain Mutations in Chromatin Regulators

PubMed Central

Tahara, Tomomitsu; Yamamoto, Eiichiro; Madireddi, Priyanka; Suzuki, Hiromu; Maruyama, Reo; Chung, Woonbok; Garriga, Judith; Jelinek, Jaroslav; Yamano, Hiro-o; Sugai, Tamotsu; Kondo, Yutaka; Toyota, Minoru; Issa, Jean-Pierre J.; Estécio, Marcos R. H.

2014-01-01

BACKGROUND & AIMS Subgroups of colorectal carcinomas (CRCs) characterized by DNA methylation anomalies are termed CpG island methylator phenotype (CIMP)1, CIMP2, or CIMP-negative. The pathogenesis of CIMP1 colorectal carcinomas, and their effects on patients’ prognoses and responses to treatment, differ from those of other CRCs. We sought to identify genetic somatic alterations associated with CIMP1 CRCs. METHODS We examined genomic DNA samples from 100 primary CRCs, 10 adenomas, and adjacent normal-appearing mucosae from patients undergoing surgery or colonoscopy at 3 tertiary medical centers. We performed exome sequencing of 16 colorectal tumors and their adjacent normal tissues. Extensive comparison with known somatic alterations in CRCs allowed segregation of CIMP1-exclusive alterations. The prevalence of mutations in selected genes was determined from an independent cohort. RESULTS We found that genes that regulate chromatin were mutated in CIMP1 CRCs; the highest rates of mutation were observed in CHD7 and CHD8, which encode members of the chromodomain helicase/adenosine triphosphate—dependent chromatin remodeling family. Somaticmutations in these 2 genes were detected in 5 of 9 CIMP1 CRCs. A prevalence screen showed that nonsilencing mutations in CHD7 and CHD8 occurred significantly more frequently in CIMP1 tumors (18 of 42 [43%]) than in CIMP2 (3 of 34 [9%]; P < .01) or CIMP-negative tumors (2 of 34 [6%]; P < .001). CIMP1 markers had increased binding by CHD7, compared with all genes. Genes altered in patients with CHARGE syndrome (congenital malformations involving the central nervous system, eye, ear, nose, and mediastinal organs) who had CHD7 mutations were also altered in CRCs with mutations in CHD7. CONCLUSIONS Aberrations in chromatin remodeling could contribute to the development of CIMP1 CRCs. A better understanding of the biological determinants of CRCs can be achieved when these tumors are categorized according to their epigenetic status. PMID:24211491

Clinical Characterization of the Pheochromocytoma and Paraganglioma Susceptibility Genes SDHA, TMEM127, MAX, and SDHAF2 for Gene-Informed Prevention

PubMed Central

Schiavi, Francesca; Ni, Ying; Welander, Jenny; Patocs, Attila; Ngeow, Joanne; Wellner, Ulrich; Malinoc, Angelica; Taschin, Elisa; Barbon, Giovanni; Lanza, Virginia; Söderkvist, Peter; Stenman, Adam; Larsson, Catharina; Svahn, Fredrika; Chen, Jin-Lian; Marquard, Jessica; Fraenkel, Merav; Walter, Martin A.; Peczkowska, Mariola; Prejbisz, Aleksander; Jarzab, Barbara; Hasse-Lazar, Kornelia; Petersenn, Stephan; Moeller, Lars C.; Meyer, Almuth; Reisch, Nicole; Trupka, Arnold; Brase, Christoph; Galiano, Matthias; Preuss, Simon F.; Kwok, Pingling; Lendvai, Nikoletta; Berisha, Gani; Makay, Özer; Boedeker, Carsten C.; Weryha, Georges; Racz, Karoly; Januszewicz, Andrzej; Walz, Martin K.; Gimm, Oliver; Opocher, Giuseppe; Eng, Charis; Neumann, Hartmut P. H.

2017-01-01

Importance Effective cancer prevention is based on accurate molecular diagnosis and results of genetic family screening, genotype-informed risk assessment, and tailored strategies for early diagnosis. The expanding etiology for hereditary pheochromocytomas and paragangliomas has recently included SDHA, TMEM127, MAX, and SDHAF2 as susceptibility genes. Clinical management guidelines for patients with germline mutations in these 4 newly included genes are lacking. Objective To study the clinical spectra and age-related penetrance of individuals with mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes. Design, Setting, and Patients This study analyzed the prospective, longitudinally followed up European-American-Asian Pheochromocytoma-Paraganglioma Registry for prevalence of SDHA, TMEM127, MAX, and SDHAF2 germline mutation carriers from 1993 to 2016. Genetic predictive testing and clinical investigation by imaging from neck to pelvis was offered to mutation-positive registrants and their relatives to clinically characterize the pheochromocytoma/paraganglioma diseases associated with mutations of the 4 new genes. Main Outcomes and Measures Prevalence and spectra of germline mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes were assessed. The clinical features of SDHA, TMEM127, MAX, and SDHAF2 disease were characterized. Results Of 972 unrelated registrants without mutations in the classic pheochromocytoma- and paraganglioma-associated genes (632 female [65.0%] and 340 male [35.0%]; age range, 8-80; mean [SD] age, 41.0 [13.3] years), 58 (6.0%) carried germline mutations of interest, including 29 SDHA, 20 TMEM127, 8 MAX, and 1 SDHAF2. Fifty-three of 58 patients (91%) had familial, multiple, extra-adrenal, and/or malignant tumors and/or were younger than 40 years. Newly uncovered are 7 of 63 (11%) malignant pheochromocytomas and paragangliomas in SDHA and TMEM127 disease. SDHA disease occurred as early as 8 years of age. Extra-adrenal tumors occurred in 28 mutation carriers (48%) and in 23 of 29 SDHA mutation carriers (79%), particularly with head and neck paraganglioma. MAX disease occurred almost exclusively in the adrenal glands with frequently bilateral tumors. Penetrance in the largest subset, SDHA carriers, was 39% at 40 years of age and is statistically different in index patients (45%) vs mutation-carrying relatives (13%; P < .001). Conclusions and Relevance The SDHA, TMEM127, MAX, and SDHAF2 genes may contribute to hereditary pheochromocytoma and paraganglioma. Genetic testing is recommended in patients at clinically high risk if the classic genes are mutation negative. Gene-specific prevention and/or early detection requires regular, systematic whole-body investigation. PMID:28384794

Clinical Characterization of the Pheochromocytoma and Paraganglioma Susceptibility Genes SDHA, TMEM127, MAX, and SDHAF2 for Gene-Informed Prevention.

PubMed

Bausch, Birke; Schiavi, Francesca; Ni, Ying; Welander, Jenny; Patocs, Attila; Ngeow, Joanne; Wellner, Ulrich; Malinoc, Angelica; Taschin, Elisa; Barbon, Giovanni; Lanza, Virginia; Söderkvist, Peter; Stenman, Adam; Larsson, Catharina; Svahn, Fredrika; Chen, Jin-Lian; Marquard, Jessica; Fraenkel, Merav; Walter, Martin A; Peczkowska, Mariola; Prejbisz, Aleksander; Jarzab, Barbara; Hasse-Lazar, Kornelia; Petersenn, Stephan; Moeller, Lars C; Meyer, Almuth; Reisch, Nicole; Trupka, Arnold; Brase, Christoph; Galiano, Matthias; Preuss, Simon F; Kwok, Pingling; Lendvai, Nikoletta; Berisha, Gani; Makay, Özer; Boedeker, Carsten C; Weryha, Georges; Racz, Karoly; Januszewicz, Andrzej; Walz, Martin K; Gimm, Oliver; Opocher, Giuseppe; Eng, Charis; Neumann, Hartmut P H

2017-09-01

Effective cancer prevention is based on accurate molecular diagnosis and results of genetic family screening, genotype-informed risk assessment, and tailored strategies for early diagnosis. The expanding etiology for hereditary pheochromocytomas and paragangliomas has recently included SDHA, TMEM127, MAX, and SDHAF2 as susceptibility genes. Clinical management guidelines for patients with germline mutations in these 4 newly included genes are lacking. To study the clinical spectra and age-related penetrance of individuals with mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes. This study analyzed the prospective, longitudinally followed up European-American-Asian Pheochromocytoma-Paraganglioma Registry for prevalence of SDHA, TMEM127, MAX, and SDHAF2 germline mutation carriers from 1993 to 2016. Genetic predictive testing and clinical investigation by imaging from neck to pelvis was offered to mutation-positive registrants and their relatives to clinically characterize the pheochromocytoma/paraganglioma diseases associated with mutations of the 4 new genes. Prevalence and spectra of germline mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes were assessed. The clinical features of SDHA, TMEM127, MAX, and SDHAF2 disease were characterized. Of 972 unrelated registrants without mutations in the classic pheochromocytoma- and paraganglioma-associated genes (632 female [65.0%] and 340 male [35.0%]; age range, 8-80; mean [SD] age, 41.0 [13.3] years), 58 (6.0%) carried germline mutations of interest, including 29 SDHA, 20 TMEM127, 8 MAX, and 1 SDHAF2. Fifty-three of 58 patients (91%) had familial, multiple, extra-adrenal, and/or malignant tumors and/or were younger than 40 years. Newly uncovered are 7 of 63 (11%) malignant pheochromocytomas and paragangliomas in SDHA and TMEM127 disease. SDHA disease occurred as early as 8 years of age. Extra-adrenal tumors occurred in 28 mutation carriers (48%) and in 23 of 29 SDHA mutation carriers (79%), particularly with head and neck paraganglioma. MAX disease occurred almost exclusively in the adrenal glands with frequently bilateral tumors. Penetrance in the largest subset, SDHA carriers, was 39% at 40 years of age and is statistically different in index patients (45%) vs mutation-carrying relatives (13%; P < .001). The SDHA, TMEM127, MAX, and SDHAF2 genes may contribute to hereditary pheochromocytoma and paraganglioma. Genetic testing is recommended in patients at clinically high risk if the classic genes are mutation negative. Gene-specific prevention and/or early detection requires regular, systematic whole-body investigation.

[Colorectal oncogenesis].

PubMed

Laurent-Puig, P; Agostini, J; Maley, K

2010-11-01

Recent progress in the field of molecular biology has allowed us to identify at least two different molecular mechanisms implicated in colorectal carcinogenesis (CRC): chromosomal instability (CIN) and genetic instability. Even though the two molecular mechanisms differ, their signalling pathways, implicated in malignant transformation of colonic epithelial cells, appear to be similar. The most frequent group of CRC, which represents 80% of sporadic CRC, is characterized by allelic losses on the short arm of chromosome 17 and 8 and on the long arm of chromosome 5, 18 and 22. These allelic losses are associated with mutations in TP53, APC, SMAD2 and SMAD4 genes. All of these alterations are grouped under the phenotype CIN. A genetic instability termed MSI (microsatellite instability), which results from a mismatch repair (MMR) deficiency, appears in 12-15% of CRC cases. The presence of MMR deficiency leads to the accumulation of mutations in genes controlling cell cycle and apoptosis (TGFBRII, BAX or CASPASE5). More recently, the existence of a third phenotype was suggested. The main alteration associated with this group of tumors is the hypermethylation of the promoter region of numerous genes, leading to their inactivation. An activating mutation of BRAF is frequently associated with this phenotype. As described above, CRC shows genetic heterogeneity, however the consequences in terms of signalling pathway alterations are similar. For example, the activation of Wnt signalling pathways can result from the inactivation of the APC gene in the CIN phenotype or from an activating mutation in the β-catenin gene in MSI tumors. The inactivation of TGFβ pathways is also present in both tumor types and is driven by SMAD4, and more rarely by a SMAD2 inactivating mutation in CIN tumors, or by the existence of a frame-shift mutation occurring in a polyG coding track of the TGFβ (transforming growth factor) receptor type II in MSI tumors. The RAS-MAP kinase pathway is activated by KRAS mutations in CIN tumors or by BRAF mutations in MSI tumors. The p53 pathway is inactivated by TP53 inactivation in CIN tumors or by BAX inactivating mutations in MSI tumors.

Molecular Epidemiology of EGFR and KRAS Mutations in 3026 Lung Adenocarcinomas: Higher Susceptibility of Women to Smoking-related KRAS-mutant Cancers

PubMed Central

Dogan, Snjezana; Shen, Ronglai; Ang, Daphne C; Johnson, Melissa L; D’Angelo, Sandra P; Paik, Paul K; Brzostowski, Edyta B; Riely, Gregory J; Kris, Mark G; Zakowski, Maureen F; Ladanyi, Marc

2012-01-01

Purpose The molecular epidemiology of most EGFR and KRAS mutations in lung cancer remains unclear. Experimental Design We genotyped 3026 lung adenocarcinomas for the major EGFR (exon 19 deletions and L858R) and KRAS (G12, G13) mutations and examined correlations with demographic, clinical and smoking history data. Results EGFR mutations were found in 43% of never smokers (NS) and in 11% of smokers. KRAS mutations occurred in 34% of smokers and in 6% of NS. In patients with smoking histories up to 10 pack-years, EGFR predominated over KRAS. Among former smokers with lung cancer, multivariate analysis showed that, independent of pack-years, increasing smoking-free years raise the likelihood of EGFR mutation. NS were more likely than smokers to have KRAS G>A transition mutation (mostly G12D) (58% vs. 20%, p=0.0001). KRAS G12C, the most common G>T transversion mutation in smokers, was more frequent in women (p=0.007) and these women were younger than men with the same mutation (median 65 vs. 69, p=0.0008) and had smoked less. Conclusions The distinct types of KRAS mutations in smokers vs. NS suggest that most KRAS-mutant lung cancers in NS are not due to secondhand smoke exposure. The higher frequency of KRAS G12C in women, their younger age, and lesser smoking history together support a heightened susceptibility to tobacco carcinogens. PMID:23014527

Deep targeted sequencing in pediatric acute lymphoblastic leukemia unveils distinct mutational patterns between genetic subtypes and novel relapse-associated genes.

PubMed

Lindqvist, C Mårten; Lundmark, Anders; Nordlund, Jessica; Freyhult, Eva; Ekman, Diana; Carlsson Almlöf, Jonas; Raine, Amanda; Övernäs, Elin; Abrahamsson, Jonas; Frost, Britt-Marie; Grandér, Dan; Heyman, Mats; Palle, Josefine; Forestier, Erik; Lönnerholm, Gudmar; Berglund, Eva C; Syvänen, Ann-Christine

2016-09-27

To characterize the mutational patterns of acute lymphoblastic leukemia (ALL) we performed deep next generation sequencing of 872 cancer genes in 172 diagnostic and 24 relapse samples from 172 pediatric ALL patients. We found an overall greater mutational burden and more driver mutations in T-cell ALL (T-ALL) patients compared to B-cell precursor ALL (BCP-ALL) patients. In addition, the majority of the mutations in T-ALL had occurred in the original leukemic clone, while most of the mutations in BCP-ALL were subclonal. BCP-ALL patients carrying any of the recurrent translocations ETV6-RUNX1, BCR-ABL or TCF3-PBX1 harbored few mutations in driver genes compared to other BCP-ALL patients. Specifically in BCP-ALL, we identified ATRX as a novel putative driver gene and uncovered an association between somatic mutations in the Notch signaling pathway at ALL diagnosis and increased risk of relapse. Furthermore, we identified EP300, ARID1A and SH2B3 as relapse-associated genes. The genes highlighted in our study were frequently involved in epigenetic regulation, associated with germline susceptibility to ALL, and present in minor subclones at diagnosis that became dominant at relapse. We observed a high degree of clonal heterogeneity and evolution between diagnosis and relapse in both BCP-ALL and T-ALL, which could have implications for the treatment efficiency.

Analysis of MSH3 in endometrial cancers with defective DNA mismatch repair.

PubMed

Swisher, E M; Mutch, D G; Herzog, T J; Rader, J S; Kowalski, L D; Elbendary, A; Goodfellow, P J

1998-01-01

To clarify the origin of defective mismatch repair (MMR) in sporadic endometrial cancers with microsatellite instability (MSI), a thorough mutation analysis was performed on the human mismatch repair gene MSH3. Twenty-eight MSI-positive endometrial cancers were investigated for mutations in the human mismatch repair gene MSH3 using single-strand conformation variant (SSCV) analysis of all 24 exons. All variants were sequenced. Loss of heterozygosity was investigated at all MSH3 polymorphisms discovered. A subset of tumors were investigated for methylation of the 5' promoter region of MSH3 using Southern blot hybridization. An identical single-base deletion (delta A) predicted to result in a truncated proteins was discovered in six tumors (21.4%). This deletion occurs in a string of eight consecutive adenosine residues (A8). Because simple repeat sequences are unstable in cells with defective MMR, the observed mutation may be an effect, rather than a cause, of MSI. Evidence of inactivation of the second MSH3 allele in tumors with the delta A mutation would strongly support a causal role for these MSH3 mutations. However, there was no evidence of a second mutation, loss of sequences, or methylation of the promoter region in any of the tumors with the delta A mutation. Although the delta A mutation is a frequent event in sporadic MSI-positive endometrial cancers, it may not be causally associated with defective DNA MMR.

A novel truncating AIP mutation, p.W279*, in a familial isolated pituitary adenoma (FIPA) kindred.

PubMed

Cansu, Güven Barış; Taşkıran, Bengür; Trivellin, Giampaolo; Faucz, Fabio R; Stratakis, Constantine A

2016-07-01

Familial isolated pituitary adenomas (FIPA) constitute 2-3% of pituitary tumours. AIP is the most commonly mutated gene in FIPA. We herein report a novel germline mutation of the AIP gene in a family with FIPA. We present two patients, a father and his 12-year-old daughter, diagnosed clinically and using laboratory measures with acromegaly-gigantism. Both underwent transsphenoidal hypophyseal surgery for macroadenomas. We initially detected a novel heterozygous germline AIP mutation, c.836G>A (p.W279*), in the father's DNA. We then found the same mutation in his affected daughter. Pituitary adenomas associated with AIP mutations mostly present as FIPA (68%) at an early age (78% occur at <30 years old). They are often growth hormone (GH) - or prolactin - secreting macroadenomas (88%) that have already extended beyond the sella at the time of diagnosis. Acromegalic cases are resistant to somatostatin analogues and multimodal management is frequently essential to control the disease. Our patients had normalized GH/IGF-1 values soon after surgery, although enough time may not have elapsed to reach final cure. While penetrance of the disease can be as low as 10% in FIPA, especially children and young patients with somatotropinoma and prolactinoma should be surveyed for inactivating mutations or deletions in AIP. Determining the causative mutations may be of assistance in early diagnosis, treatment success, and genetic counseling.

Correlates of Protective Cellular Immunity Revealed by Analysis of Population-Level Immune Escape Pathways in HIV-1

PubMed Central

Brumme, Chanson J.; Martin, Eric; Listgarten, Jennifer; Brockman, Mark A.; Le, Anh Q.; Chui, Celia K. S.; Cotton, Laura A.; Knapp, David J. H. F.; Riddler, Sharon A.; Haubrich, Richard; Nelson, George; Pfeifer, Nico; DeZiel, Charles E.; Heckerman, David; Apps, Richard; Carrington, Mary; Mallal, Simon; Harrigan, P. Richard; John, Mina

2012-01-01

HLA class I-associated polymorphisms identified at the population level mark viral sites under immune pressure by individual HLA alleles. As such, analysis of their distribution, frequency, location, statistical strength, sequence conservation, and other properties offers a unique perspective from which to identify correlates of protective cellular immunity. We analyzed HLA-associated HIV-1 subtype B polymorphisms in 1,888 treatment-naïve, chronically infected individuals using phylogenetically informed methods and identified characteristics of HLA-associated immune pressures that differentiate protective and nonprotective alleles. Over 2,100 HLA-associated HIV-1 polymorphisms were identified, approximately one-third of which occurred inside or within 3 residues of an optimally defined cytotoxic T-lymphocyte (CTL) epitope. Differential CTL escape patterns between closely related HLA alleles were common and increased with greater evolutionary distance between allele group members. Among 9-mer epitopes, mutations at HLA-specific anchor residues represented the most frequently detected escape type: these occurred nearly 2-fold more frequently than expected by chance and were computationally predicted to reduce peptide-HLA binding nearly 10-fold on average. Characteristics associated with protective HLA alleles (defined using hazard ratios for progression to AIDS from natural history cohorts) included the potential to mount broad immune selection pressures across all HIV-1 proteins except Nef, the tendency to drive multisite and/or anchor residue escape mutations within known CTL epitopes, and the ability to strongly select mutations in conserved regions within HIV's structural and functional proteins. Thus, the factors defining protective cellular immune responses may be more complex than simply targeting conserved viral regions. The results provide new information to guide vaccine design and immunogenicity studies. PMID:23055555

Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

PubMed Central

McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C.; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

2015-01-01

Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal “actionable” mutations, including BRAF(V600E), IDH1(R132H), PIK3CA(E545K), EGFR(L858R), and KRAS(G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K(phosphatidylinositol 3-kinase)–AKT–mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS–MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTORsignaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. PMID:25877892

High mutation rates limit evolutionary adaptation in Escherichia coli

PubMed Central

Wagner, Andreas

2018-01-01

Mutation is fundamental to evolution, because it generates the genetic variation on which selection can act. In nature, genetic changes often increase the mutation rate in systems that range from viruses and bacteria to human tumors. Such an increase promotes the accumulation of frequent deleterious or neutral alleles, but it can also increase the chances that a population acquires rare beneficial alleles. Here, we study how up to 100-fold increases in Escherichia coli’s genomic mutation rate affect adaptive evolution. To do so, we evolved multiple replicate populations of asexual E. coli strains engineered to have four different mutation rates for 3000 generations in the laboratory. We measured the ability of evolved populations to grow in their original environment and in more than 90 novel chemical environments. In addition, we subjected the populations to whole genome population sequencing. Although populations with higher mutation rates accumulated greater genetic diversity, this diversity conveyed benefits only for modestly increased mutation rates, where populations adapted faster and also thrived better than their ancestors in some novel environments. In contrast, some populations at the highest mutation rates showed reduced adaptation during evolution, and failed to thrive in all of the 90 alternative environments. In addition, they experienced a dramatic decrease in mutation rate. Our work demonstrates that the mutation rate changes the global balance between deleterious and beneficial mutational effects on fitness. In contrast to most theoretical models, our experiments suggest that this tipping point already occurs at the modest mutation rates that are found in the wild. PMID:29702649

A frame-shift mutation of PMS2 is a widespread cause of Lynch syndrome.

PubMed

Clendenning, M; Senter, L; Hampel, H; Robinson, K Lagerstedt; Sun, S; Buchanan, D; Walsh, M D; Nilbert, M; Green, J; Potter, J; Lindblom, A; de la Chapelle, A

2008-06-01

When compared to the other mismatch repair genes involved in Lynch syndrome, the identification of mutations within PMS2 has been limited (<2% of all identified mutations), yet the immunohistochemical analysis of tumour samples indicates that approximately 5% of Lynch syndrome cases are caused by PMS2. This disparity is primarily due to complications in the study of this gene caused by interference from pseudogene sequences. Using a recently developed method for detecting PMS2 specific mutations, we have screened 99 patients who are likely candidates for PMS2 mutations based on immunohistochemical analysis. We have identified a frequently occurring frame-shift mutation (c.736_741del6ins11) in 12 ostensibly unrelated Lynch syndrome patients (20% of patients we have identified with a deleterious mutation in PMS2, n = 61). These individuals all display the rare allele (population frequency <0.05) at a single nucleotide polymorphism (SNP) in exon 11, and have been shown to possess a short common haplotype, allowing us to calculate that the mutation arose around 1625 years ago (65 generations; 95% confidence interval 22 to 120). Ancestral analysis indicates that this mutation is enriched in individuals with British and Swedish ancestry. We estimate that there are >10 000 carriers of this mutation in the USA alone. The identification of both the mutation and the common haplotype in one Swedish control sample (n = 225), along with evidence that Lynch syndrome associated cancers are rarer than expected in the probands' families, would suggest that this is a prevalent mutation with reduced penetrance.

A mutation spectrum that includes GNAS, KRAS and TP53 may be shared by mucinous neoplasms of the appendix.

PubMed

Hara, Kieko; Saito, Tsuyoshi; Hayashi, Takuo; Yimit, Alkam; Takahashi, Michiko; Mitani, Keiko; Takahashi, Makoto; Yao, Takashi

2015-09-01

Appendiceal mucinous tumors (AMTs) are classified as low-grade appendiceal mucinous neoplasms (LAMNs) or mucinous adenocarcinomas (MACs), although their carcinogenesis is not well understood. As somatic activating mutations of GNAS are considered to be characteristic of LAMNs while TP53 mutations have been shown to be specific to MACs, MACs are unlikely to result from transformation of LAMNs. However, emerging evidence also shows the presence of GNAS mutations in MACs. We examined 16 AMTs (11 LAMNs and 5 MACs) for genetic alterations of GNAS, KRAS, BRAF, TP53, CTNNB1, and TERT promoter in order to elucidate the possibility of a shared genetic background in the two tumor types. Extensive histological examination revealed the presence of a low-grade component in all cases of MAC. GNAS mutations were detected in two LAMNs and in one MAC, although the GNAS mutation in this MAC was a nonsense mutation (Q227X) expected not to be activating mutation. TP53 mutations were detected in three LAMNs; they were frequently detected in MACs. KRAS mutations were detected in three LAMNs and three MACs, and CTNNB1 mutations were detected in two LAMNs. KRAS mutation and activating mutation of GNAS occurred exclusively in AMTs. BRAF and TERT mutations were not detected. Overexpression of p53 was observed in only two MACs, and p53 immunostaining clearly discriminated the high-grade lesion from a low-grade component in one. These findings suggest that p53 overexpression plays an important role in the carcinogenesis of AMTs and that, in addition to mutations of GNAS, KRAS and TP53 alterations might be shared by AMTs, thus providing evidence for the possible progression of LAMNs to MAC. Copyright © 2015 Elsevier GmbH. All rights reserved.

Population variability of the FimH type 1 fimbrial adhesin in Klebsiella pneumoniae.

PubMed

Stahlhut, Steen G; Chattopadhyay, Sujay; Struve, Carsten; Weissman, Scott J; Aprikian, Pavel; Libby, Stephen J; Fang, Ferric C; Krogfelt, Karen Angeliki; Sokurenko, Evgeni V

2009-03-01

FimH is an adhesive subunit of type 1 fimbriae expressed by different enterobacterial species. The enteric bacterium Klebsiella pneumoniae is an environmental organism that is also a frequent cause of sepsis, urinary tract infection (UTI), and liver abscess. Type 1 fimbriae have been shown to be critical for the ability of K. pneumoniae to cause UTI in a murine model. We show here that the K. pneumoniae fimH gene is found in 90% of strains from various environmental and clinical sources. The fimH alleles exhibit relatively low nucleotide and structural diversity but are prone to frequent horizontal-transfer events between different bacterial clones. Addition of the fimH locus to multiple-locus sequence typing significantly improved the resolution of the clonal structure of pathogenic strains, including the K1 encapsulated liver isolates. In addition, the K. pneumoniae FimH protein is targeted by adaptive point mutations, though not to the same extent as FimH from uropathogenic Escherichia coli or TonB from the same K. pneumoniae strains. Such adaptive mutations include a single amino acid deletion from the signal peptide that might affect the length of the fimbrial rod by affecting FimH translocation into the periplasm. Another FimH mutation (S62A) occurred in the course of endemic circulation of a nosocomial uropathogenic clone of K. pneumoniae. This mutation is identical to one found in a highly virulent uropathogenic strain of E. coli, suggesting that the FimH mutations are pathoadaptive in nature. Considering the abundance of type 1 fimbriae in Enterobacteriaceae, our present finding that fimH genes are subject to adaptive microevolution substantiates the importance of type 1 fimbria-mediated adhesion in K. pneumoniae.

Genetic and biochemical findings in Chinese children with Leigh syndrome.

PubMed

Ma, Yan-Yan; Wu, Tong-Fei; Liu, Yu-Peng; Wang, Qiao; Song, Jin-Qing; Li, Xi-Yuan; Shi, Xiu-Yu; Zhang, Wei-Na; Zhao, Meng; Hu, Lin-Yan; Yang, Yan-Ling; Zou, Li-Ping

2013-11-01

This study investigated the genetic and enzymological features of Leigh syndrome due to respiratory chain complex deficiency in Chinese patients. The clinical features of 75 patients were recorded. Mitochondrial respiratory chain enzyme activities were determined via spectrophotometry. Mitochondrial gene sequence analysis was performed in 23 patients. Five core pedigrees were investigated via restriction fragment length polymorphism and gene sequencing. Psychomotor retardation (55%), motor regression (20%), weakness (29%), and epilepsy (25%) were the most frequent manifestations. Sixty-four patients (85.3%) had isolated respiratory complex deficiencies: complex I was seen in 28 patients (37.3%); complex II, seven (9.3%); complex III, six (8%); complex IV, ten (13.3%); and complex V, 13 patients (17.3%). Eleven patients (14.7%) had combined complex deficiencies. Mitochondrial DNA mutations were detected in 10 patients. Eight point mutations were found in mitochondrial structural genes: m.4833A>G in ND2, m.10191T>C in ND3, m.12338T>C and m.13513G>A in ND5, m.14502T>C and m.14487T>C in ND6, m.8108A>G in COXII, and m.8993T>G in ATPase6. Three mutations were found in tRNA genes: m.4395A>G in tRNA-Gln, m.10454T>C in tRNA-Arg, and m.5587T>C in tRNA-Ala. One patient and their mother both had the m.12338T>C and m.8993T>C mutations. In conclusion, mitochondrial respiratory chain complex I deficiency and structural gene mutations frequently occur in Chinese Leigh syndrome patients. Copyright © 2013 Elsevier Ltd. All rights reserved.

Rates of loss of heterozygosity and mitotic recombination in NF2 schwannomas, sporadic vestibular schwannomas and schwannomatosis schwannomas.

PubMed

Hadfield, K D; Smith, M J; Urquhart, J E; Wallace, A J; Bowers, N L; King, A T; Rutherford, S A; Trump, D; Newman, W G; Evans, D G

2010-11-25

Biallelic inactivation of the NF2 gene occurs in the majority of schwannomas. This usually involves a combination of a point mutation or multiexon deletion, in conjunction with either a second point mutation or loss of heterozygosity (LOH). We have performed DNA sequence and dosage analysis of the NF2 gene in a panel of 239 schwannoma tumours: 97 neurofibromatosis type 2 (NF2)-related schwannomas, 104 sporadic vestibular schwannomas (VS) and 38 schwannomatosis-related schwannomas. In total, we identified germline NF2 mutations in 86 out of 97 (89%) NF2 patients and a second mutational event in 77 out of 97 (79%). LOH was by far the most common form of second hit. A combination of microsatellite analysis with either conventional comparative genomic hybridization (CGH) or multiplex ligation-dependent probe amplification (MLPA) identified mitotic recombination (MR) as the cause of LOH in 14 out of 72 (19%) total evaluable tumours. Among sporadic VS, at least one NF2 mutation was identified by sequence analysis or MLPA in 65 out of 98 (66%) tumours. LOH occurred in 54 out of 96 (56%) evaluable tumours, but MR only accounted for 5 out of 77 (6%) tested. LOH was present in 28 out of 34 (82%) schwannomatosis-related schwannomas. In all eight patients who had previously tested positive for a germline SMARCB1 mutation, this involved loss of the whole, or part of the long arm, of chromosome 22. In contrast, 5 out of 22 (23%) tumours from patients with no germline SMARCB1 mutation exhibited MR. High-resolution Affymetrix SNP6 genotyping and copy number (CN) analysis (Affymetrix, Santa Clara, CA, USA) were used to determine the chromosomal breakpoint locations in tumours with MR. A range of unique recombination sites, spanning approximately 11.4 Mb, were identified. This study shows that MR is a mechanism of LOH in NF2 and SMARCB1-negative schwannomatosis-related schwannomas, occurring less frequently in sporadic VS. We found no evidence of MR in SMARCB1-positive schwannomatosis, suggesting that susceptibility to MR varies according to the disease context.

PROTEIN KINASE C δ IS A THERAPEUTIC TARGET IN MALIGNANT MELANOMA WITH NRAS MUTATION

PubMed Central

Takashima, Asami; English, Brandon; Chen, Zhihong; Cao, Juxiang; Cui, Rutao; Williams, Robert M.; Faller, Douglas V.

2014-01-01

NRAS is the second most frequently mutated gene in melanoma. Previous reports have demonstrated the sensitivity of cancer cell lines carrying KRAS mutations to apoptosis initiated by inhibition of protein kinase C delta (PKCδ). Here, we report that PKCδ inhibition is cytotoxic in melanomas with primary NRAS mutations. Novel small-molecule inhibitors of PKCδ were designed as chimeric hybrids of two naturally-occurring PKCδ inhibitors, staurosporine and rottlerin. The specific hypothesis interrogated and validated is that combining two domains of two naturally-occurring PKCδ inhibitors into a chimeric or hybrid structure retains biochemical and biological activity, and improves PKCδ isozyme selectivity. We have devised a potentially general synthetic protocol to make these chimeric species using Molander trifluorborate coupling chemistry. Inhibition of PKCδ, by siRNA or small molecule inhibitors, suppressed the growth of multiple melanoma cell lines carrying NRAS mutations, mediated via caspase-dependent apoptosis. Following PKCδ inhibition, the stress-responsive JNK pathway was activated, leading to the activation of H2AX. Consistent with recent reports on the apoptotic role of phospho-H2AX, knockdown of H2AX prior to PKCδ inhibition mitigated the induction of caspase-dependent apoptosis. Furthermore, PKCδ inhibition effectively induced cytotoxicity in BRAF-mutant melanoma cell lines that had evolved resistance to a BRAF inhibitor, suggesting the potential clinical application of targeting PKCδ in patients who have relapsed following treatment with BRAF inhibitors. Taken together, the present work demonstrates that inhibition of PKCδ by novel small molecule inhibitors causes caspase-dependent apoptosis mediated via the JNK-H2AX pathway in melanomas with NRAS mutations or BRAF inhibitor-resistance. PMID:24506253

Clinical utility of TERT promoter mutations and ALK rearrangement in thyroid cancer patients with a high prevalence of the BRAF V600E mutation.

PubMed

Bae, Ja Seong; Kim, Yourha; Jeon, Sora; Kim, Se Hee; Kim, Tae Jung; Lee, Sohee; Kim, Min-Hee; Lim, Dong Jun; Lee, Youn Soo; Jung, Chan Kwon

2016-02-09

Mutations in the TERT promoter, ALK rearrangement, and the BRAF V600E mutation are associated with aggressive clinicopathologic features in thyroid cancers. However, little is known about the impact of TERT promoter mutations and ALK rearrangement in thyroid cancer patients with a high prevalence of BRAF mutations. We performed Sanger sequencing to detect BRAF V600E and TERT promoter mutations and both immunohistochemistry and fluorescence in situ hybridization to identify ALK rearrangement on 243 thyroid cancers. TERT promoter mutations were not present in 192 well-differentiated thyroid carcinomas (WDTC) without distant metastasis or in 9 medullary carcinomas. However, the mutations did occur in 40 % (12/30) of WDTC with distant metastasis, 29 % (2/7) of poorly differentiated carcinomas and 60 % (3/5) of anaplastic carcinomas. ALK rearrangement was not present in all thyroid cancers. The BRAF V600E mutation was more frequently found in WDTC without distant metastasis than in WDTC with distant metastasis (p = 0.007). In the cohort of WDTC with distant metastasis, patients with wild-type BRAF and TERT promoter had a significantly higher response rate after radioiodine therapy (p = 0.024), whereas the BRAF V600E mutation was significantly correlated with progressive disease (p = 0.025). The TERT promoter mutation is an independent predictor for distant metastasis of WDTC, but ALK testing is not useful for clinical decision-making in Korean patients with a high prevalence of the BRAF V600E mutation. Radioiodine therapy for distant metastasis of WDTC is most effective in patients without BRAF V600E and TERT promoter mutations.

PTEN/MMAC1 Mutations in Hepatocellular Carcinomas: Somatic Inactivation of Both Alleles in Tumors

PubMed Central

Kawamura, Naoki; Nagai, Hisaki; Bando, Koichi; Koyama, Masaaki; Matsumoto, Satoshi; Tajiri, Takashi; Onda, Masahiko; Fujimoto, Jiro; Ueki, Takahiro; Konishi, Noboru; Shiba, Tadayoshi

1999-01-01

Allelic loss of loci on chromosome 10q occurs frequently in hepatocellular carcinomas. Somatic mutations of the PTEN/MMAC1 gene on this chromosome at 10q23 were recently identified in sporadic cancers of the uterus, brain, prostate and breast. To investigate the potential role of PTEN/MMAC1 gene in the genesis of hepatocellular carcinomas, we examined 96 tumors for allelic loss on 10q and also for subtle mutations anywhere within the coding region of PTEN/MMAC1 gene. Allelic loss was identified in 25 of the 89 (27%) tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in five of those tumors: three frameshift mutations, a 1‐bp insertion at codon 83–84 in exon 4 and two 4‐bp deletions, both at codon 318–319 in exon 8; two C‐to‐G transversion mutation, both at ‐9 bp from the initiation codon in the 5’non‐coding region of exon 1. No missense mutation was observed in this panel of tumors. In most of the informative tumors carrying intragenic mutations of one allele, we were able to detect loss of heterozygosity as well. These findings suggest that two alleles of the PTEN/MMAC1 gene may be inactivated by a combination of intragenic point mutation on one allele and loss of chromosomal material on the other allele in some of these tumors. PMID:10363579

Stargardt disease: towards developing a model to predict phenotype.

PubMed

Heathfield, Laura; Lacerda, Miguel; Nossek, Christel; Roberts, Lisa; Ramesar, Rajkumar S

2013-10-01

Stargardt disease is an ABCA4-associated retinopathy, which generally follows an autosomal recessive inheritance pattern and is a frequent cause of macular degeneration in childhood. ABCA4 displays significant allelic heterogeneity whereby different mutations can cause retinal diseases with varying severity and age of onset. A genotype-phenotype model has been proposed linking ABCA4 mutations, purported ABCA4 functional protein activity and severity of disease, as measured by degree of visual loss and the age of onset. It has, however, been difficult to verify this model statistically in observational studies, as the number of individuals sharing any particular mutation combination is typically low. Seven founder mutations have been identified in a large number of Caucasian Afrikaner patients in South Africa, making it possible to test the genotype-phenotype model. A generalised linear model was developed to predict and assess the relative pathogenic contribution of the seven mutations to the age of onset of Stargardt disease. It is shown that the pathogenicity of an individual mutation can differ significantly depending on the genetic context in which it occurs. The results reported here may be used to identify suitable candidates for inclusion in clinical trials, as well as guide the genetic counselling of affected individuals and families.

Stargardt Disease: towards developing a model to predict phenotype

PubMed Central

Heathfield, Laura; Lacerda, Miguel; Nossek, Christel; Roberts, Lisa; Ramesar, Rajkumar S

2013-01-01

Stargardt disease is an ABCA4-associated retinopathy, which generally follows an autosomal recessive inheritance pattern and is a frequent cause of macular degeneration in childhood. ABCA4 displays significant allelic heterogeneity whereby different mutations can cause retinal diseases with varying severity and age of onset. A genotype–phenotype model has been proposed linking ABCA4 mutations, purported ABCA4 functional protein activity and severity of disease, as measured by degree of visual loss and the age of onset. It has, however, been difficult to verify this model statistically in observational studies, as the number of individuals sharing any particular mutation combination is typically low. Seven founder mutations have been identified in a large number of Caucasian Afrikaner patients in South Africa, making it possible to test the genotype–phenotype model. A generalised linear model was developed to predict and assess the relative pathogenic contribution of the seven mutations to the age of onset of Stargardt disease. It is shown that the pathogenicity of an individual mutation can differ significantly depending on the genetic context in which it occurs. The results reported here may be used to identify suitable candidates for inclusion in clinical trials, as well as guide the genetic counselling of affected individuals and families. PMID:23695285

Integrative genomic and functional analysis of human oral squamous cell carcinoma cell lines reveals synergistic effects of FAT1 and CASP8 inactivation.

PubMed

Hayes, Tyler F; Benaich, Nathan; Goldie, Stephen J; Sipilä, Kalle; Ames-Draycott, Ashley; Cai, Wenjun; Yin, Guangliang; Watt, Fiona M

2016-12-01

Oral squamous cell carcinoma (OSCC) is genetically highly heterogeneous, which contributes to the challenges of treatment. To create an in vitro model that accurately reflects this heterogeneity, we generated a panel of HPV-negative OSCC cell lines. By whole exome sequencing of the lines and matched patient blood samples, we demonstrate that the mutational spectrum of the lines is representative of primary OSCC in The Cancer Genome Atlas. We show that loss of function mutations in FAT1 (an atypical cadherin) and CASP8 (Caspase 8) frequently occur in the same tumour. OSCC cells with inactivating FAT1 mutations exhibited reduced intercellular adhesion. Knockdown of FAT1 and CASP8 individually or in combination in OSCC cells led to increased cell migration and clonal growth, resistance to Staurosporine-induced apoptosis and, in some cases, increased terminal differentiation. The OSCC lines thus represent a valuable resource for elucidating the impact of different mutations on tumour behaviour. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Association of mutations with morphological dysplasia in de novo acute myeloid leukemia without 2016 WHO Classification-defined cytogenetic abnormalities

PubMed Central

Weinberg, Olga K.; Gibson, Christopher J.; Blonquist, Traci M.; Neuberg, Donna; Pozdnyakova, Olga; Kuo, Frank; Ebert, Benjamin L.; Hasserjian, Robert P.

2018-01-01

Despite improvements in our understanding of the molecular basis of acute myeloid leukemia (AML), the association between genetic mutations with morphological dysplasia remains unclear. In this study, we evaluated and scored dysplasia in bone marrow (BM) specimens from 168 patients with de novo AML; none of these patients had cytogenetic abnormalities according to the 2016 World Health Organization Classification. We then performed targeted sequencing of diagnostic BM aspirates for recurrent mutations associated with myeloid malignancies. We found that cohesin pathway mutations [q (FDR-adjusted P)=0.046] were associated with a higher degree of megakaryocytic dysplasia and STAG2 mutations were marginally associated with greater myeloid lineage dysplasia (q=0.052). Frequent megakaryocytes with separated nuclear lobes were more commonly seen among cases with cohesin pathway mutations (q=0.010) and specifically in those with STAG2 mutations (q=0.010), as well as NPM1 mutations (q=0.022 when considering the presence of any vs. no megakaryocytes with separated nuclear lobes). RAS pathway mutations (q=0.006) and FLT3-ITD (q=0.006) were significantly more frequent in cases without evaluable erythroid cells. In univariate analysis of the 153 patients treated with induction chemotherapy, NPM1 mutations were associated with longer event-free survival (EFS) (P=0.042), while RUNX1 (P=0.042), NF1 (P=0.040), frequent micromegakaryocytes (P=0.018) and presence of a subclone (P=0.002) were associated with shorter EFS. In multivariable modeling, NPM1 was associated with longer EFS, while presence of a subclone and frequent micromegakaryocytes remained significantly associated with shorter EFS. PMID:29326119

Analysis of TSC1 mutation spectrum in mucosal melanoma.

PubMed

Ma, Meng; Dai, Jie; Xu, Tianxiao; Yu, Sifan; Yu, Huan; Tang, Huan; Yan, Junya; Wu, Xiaowen; Yu, Jiayi; Chi, Zhihong; Si, Lu; Cui, Chuanliang; Sheng, Xinan; Kong, Yan; Guo, Jun

2018-02-01

Mucosal melanoma is a relatively rare subtype of melanoma for which no clearly established therapeutic strategy exists. The genes of the mTOR signalling pathway have drawn great attention as key targets for cancer treatment, including melanoma. In this study, we aimed to investigate the mutation status of the upstream mTOR regulator TSC1 and evaluated its correlation with the clinicopathological features of mucosal melanoma. We collected 91 mucosal melanoma samples for detecting TSC1 mutations. All the coding exons of TSC1 were amplified by PCR and subjected to Sanger sequencing. Expression level of TSC1 encoding protein (hamartin) was detected by immunohistochemistry. The activation of mTOR pathway was determined by evaluating the phosphorylation status of S6RP and 4E-BP1. The overall mutation frequency of TSC1 was found to be 17.6% (16/91 patients). TSC1 mutations were more inclined to occur in advanced mucosal melanoma (stages III and IV). In the 16 patients with TSC1 mutations, 14 different mutations were detected, affecting 11 different exons. TSC1 mutations were correlated with upregulation of S6RP phosphorylation but were unrelated to 4E-BP1 phosphorylation or hamartin expression. Mucosal melanoma patients with TSC1 mutations had a worse outcome than patients without TSC1 mutations (24.0 versus 34.0 months, P = 0.007). Our findings suggest that TSC1 mutations are frequent in mucosal melanoma. TSC1 mutations can activate the mTOR pathway through phospho-S6RP and might be a poor prognostic predictor of mucosal melanoma. Our data implicate the potential significance of TSC1 mutations for effective and specific drug therapy for mucosal melanoma.

[Study of gene mutation in 62 hemophilia A children].

PubMed

Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

2017-11-02

Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense mutation; the most frequent gene mutation in medium hemophilia A is missense mutation.

Mechanistic considerations on the wavelength-dependent variations of UVR genotoxicity and mutagenesis in skin: the discrimination of UVA-signature from UV-signature mutation.

PubMed

Ikehata, Hironobu

2018-05-31

Ultraviolet radiation (UVR) predominantly induces UV-signature mutations, C → T and CC → TT base substitutions at dipyrimidine sites, in the cellular and skin genome. I observed in our in vivo mutation studies of mouse skin that these UVR-specific mutations show a wavelength-dependent variation in their sequence-context preference. The C → T mutation occurs most frequently in the 5'-TCG-3' sequence regardless of the UVR wavelength, but is recovered more preferentially there as the wavelength increases, resulting in prominent occurrences exclusively in the TCG sequence in the UVA wavelength range, which I will designate as a "UVA signature" in this review. The preference of the UVB-induced C → T mutation for the sequence contexts shows a mixed pattern of UVC- and UVA-induced mutations, and a similar pattern is also observed for natural sunlight, in which UVB is the most genotoxic component. In addition, the CC → TT mutation hardly occurs at UVA1 wavelengths, although it is detected rarely but constantly in the UVC and UVB ranges. This wavelength-dependent variation in the sequence-context preference of the UVR-specific mutations could be explained by two different photochemical mechanisms of cyclobutane pyrimidine dimer (CPD) formation. The UV-signature mutations observed in the UVC and UVB ranges are known to be caused mainly by CPDs produced through the conventional singlet/triplet excitation of pyrimidine bases after the direct absorption of the UVC/UVB photon energy in those bases. On the other hand, a novel photochemical mechanism through the direct absorption of the UVR energy to double-stranded DNA, which is called "collective excitation", has been proposed for the UVA-induced CPD formation. The UVA photons directly absorbed by DNA produce CPDs with a sequence context preference different from that observed for CPDs caused by the UVC/UVB-mediated singlet/triplet excitation, causing CPD formation preferentially at thymine-containing dipyrimidine sites and probably also preferably at methyl CpG-associated dipyrimidine sites, which include the TCG sequence. In this review, I present a mechanistic consideration on the wavelength-dependent variation of the sequence context preference of the UVR-specific mutations and rationalize the proposition of the UVA-signature mutation, in addition to the UV-signature mutation.

Coexistence of JAK2 and CALR mutations and their clinical implications in patients with essential thrombocythemia.

PubMed

Kang, Min-Gu; Choi, Hyun-Woo; Lee, Jun Hyung; Choi, Yong Jun; Choi, Hyun-Jung; Shin, Jong-Hee; Suh, Soon-Pal; Szardenings, Michael; Kim, Hye-Ran; Shin, Myung-Geun

2016-08-30

Janus kinase 2 (JAK2) and calreticulin (CALR) constitute the two most frequent mutations in essential thrombocythemia (ET), and both are reported to be mutually exclusive. Hence, we examined a cohort of 123 myeloproliferative neoplasm (MPN) patients without BCR-ABL1 rearrangement and additional ET patients (n=96) for coexistence of JAK2 and CALR mutations. The frequency of CALR mutations was 20.3% in 123 MPN patients; 31.1% in ET (n=74), 25% in primary myelofibrosis (n=4) and 2.2% in polycythemia vera (n=45). JAK2 and CALR mutations coexisted in 7 (4.2%) of 167 ET patients. Clinical characteristics, progression-free survival (PFS), and elapsed time to achieve partial remission across 4 groups (JAK2+/CALR+, JAK2+/CALR-, JAK2-/CALR+, JAK2-/CALR-) were reviewed. The JAK2+/CALR- group had higher leukocyte counts and hemoglobin levels and more frequent thrombotic events than JAK2-/CALR- group. JAK2 mutations have a greater effect on the disease phenotype and the clinical features of MPN patients rather than do CALR mutation. JAK2+ groups showed a tendency of poor PFS than JAK2- groups regardless of CALR mutation. CALR+ was a predictor of late response to the treatment. Our study also showed that thrombosis was more frequent in ET patients with type 2 CALR mutations than in those with type 1 CALR mutations.

A heterozygous IDH1R132H/WT mutation induces genome-wide alterations in DNA methylation.

PubMed

Duncan, Christopher G; Barwick, Benjamin G; Jin, Genglin; Rago, Carlo; Kapoor-Vazirani, Priya; Powell, Doris R; Chi, Jen-Tsan; Bigner, Darell D; Vertino, Paula M; Yan, Hai

2012-12-01

Monoallelic point mutations of the NADP(+)-dependent isocitrate dehydrogenases IDH1 and IDH2 occur frequently in gliomas, acute myeloid leukemias, and chondromas, and display robust association with specific DNA hypermethylation signatures. Here we show that heterozygous expression of the IDH1(R132H) allele is sufficient to induce the genome-wide alterations in DNA methylation characteristic of these tumors. Using a gene-targeting approach, we knocked-in a single copy of the most frequently observed IDH1 mutation, R132H, into a human cancer cell line and profiled changes in DNA methylation at over 27,000 CpG dinucleotides relative to wild-type parental cells. We find that IDH1(R132H/WT) mutation induces widespread alterations in DNA methylation, including hypermethylation of 2010 and hypomethylation of 842 CpG loci. We demonstrate that many of these alterations are consistent with those observed in IDH1-mutant and G-CIMP+ primary gliomas and can segregate IDH wild-type and mutated tumors as well as those exhibiting the G-CIMP phenotype in unsupervised analysis of two primary glioma cohorts. Further, we show that the direction of IDH1(R132H/WT)-mediated DNA methylation change is largely dependent upon preexisting DNA methylation levels, resulting in depletion of moderately methylated loci. Additionally, whereas the levels of multiple histone H3 and H4 methylation modifications were globally increased, consistent with broad inhibition of histone demethylation, hypermethylation at H3K9 in particular accompanied locus-specific DNA hypermethylation at several genes down-regulated in IDH1(R132H/WT) knock-in cells. These data provide insight on epigenetic alterations induced by IDH1 mutations and support a causal role for IDH1(R132H/WT) mutants in driving epigenetic instability in human cancer cells.

Molecular and Clinical Characterization of Albinism in a Large Cohort of Italian Patients

PubMed Central

Gargiulo, Annagiusi; Testa, Francesco; Rossi, Settimio; Di Iorio, Valentina; Fecarotta, Simona; de Berardinis, Teresa; Iovine, Antonello; Magli, Adriano; Signorini, Sabrina; Fazzi, Elisa; Galantuomo, Maria Silvana; Fossarello, Maurizio; Montefusco, Sandro; Ciccodicola, Alfredo; Neri, Alberto; Macaluso, Claudio; Simonelli, Francesca; Surace, Enrico Maria

2011-01-01

Purpose. The purpose of this study was to identify the molecular basis of albinism in a large cohort of Italian patients showing typical ocular landmarks of the disease and to provide a full characterization of the clinical ophthalmic manifestations. Methods. DNA samples from 45 patients with ocular manifestations of albinism were analyzed by direct sequencing analysis of five genes responsible for albinism: TYR, P, TYRP1, SLC45A2 (MATP), and OA1. All patients studied showed a variable degree of skin and hair hypopigmentation. Eighteen patients with distinct mutations in each gene associated with OCA were evaluated by detailed ophthalmic analysis, optical coherence tomography (OCT), and fundus autofluorescence. Results. Disease-causing mutations were identified in more than 95% of analyzed patients with OCA (28/45 [62.2%] cases with two or more mutations; 15/45 [33.3%] cases with one mutation). Thirty-five different mutant alleles were identified of which 15 were novel. Mutations in TYR were the most frequent (73.3%), whereas mutations in P occurred more rarely (13.3%) than previously reported. Novel mutations were also identified in rare loci such as TYRP1 and MATP. Mutations in the OA1 gene were not detected. Clinical assessment revealed that patients with iris and macular pigmentation had significantly higher visual acuity than did severe hypopigmented phenotypes. Conclusions. TYR gene mutations represent a relevant cause of oculocutaneous albinism in Italy, whereas mutations in P present a lower frequency than that found in other populations. Clinical analysis revealed that the severity of the ocular manifestations depends on the degree of retinal pigmentation. PMID:20861488

Clonal status of actionable driver events and the timing of mutational processes in cancer evolution.

PubMed

McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

2015-04-15

Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal "actionable" mutations, including BRAF (V600E), IDH1 (R132H), PIK3CA (E545K), EGFR (L858R), and KRAS (G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K (phosphatidylinositol 3-kinase)-AKT-mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS-MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTOR signaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. Copyright © 2015, American Association for the Advancement of Science.

KIT D816V-mutated bone marrow mesenchymal stem cells in indolent systemic mastocytosis are associated with disease progression.

PubMed

Garcia-Montero, Andres C; Jara-Acevedo, Maria; Alvarez-Twose, Ivan; Teodosio, Cristina; Sanchez-Muñoz, Laura; Muñiz, Carmen; Muñoz-Gonzalez, Javier I; Mayado, Andrea; Matito, Almudena; Caldas, Carolina; Morgado, Jose M; Escribano, Luis; Orfao, Alberto

2016-02-11

Multilineage involvement of bone marrow (BM) hematopoiesis by the somatic KIT D816V mutation is present in a subset of adult indolent systemic mastocytosis (ISM) patients in association with a poorer prognosis. Here, we investigated the potential involvement of BM mesenchymal stem cells (MSCs) from ISM patients by the KIT D816V mutation and its potential impact on disease progression and outcome. This mutation was investigated in highly purified BM MSCs and other BM cell populations from 83 ISM patients followed for a median of 116 months. KIT D816V-mutated MSCs were detected in 22 of 83 cases. All MSC-mutated patients had multilineage KIT mutation (100% vs 30%, P = .0001) and they more frequently showed involvement of lymphoid plus myeloid BM cells (59% vs 22%; P = .03) and a polyclonal pattern of inactivation of the X-chromosome of KIT-mutated BM mast cells (64% vs 0%; P = .01) vs other multilineage ISM cases. Moreover, presence of KIT-mutated MSCs was associated with more advanced disease features, a greater rate of disease progression (50% vs 17%; P = .04), and a shorter progression-free survival (P ≤ .003). Overall, these results support the notion that ISM patients with mutated MSCs may have acquired the KIT mutation in a common pluripotent progenitor cell, prior to differentiation into MSCs and hematopoietic precursor cells, before the X-chromosome inactivation process occurs. From a clinical point of view, acquisition of the KIT mutation in an earlier BM precursor cell confers a significantly greater risk for disease progression and a poorer outcome. © 2016 by The American Society of Hematology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagishita, Shigehiro; Horinouchi, Hidehito, E-mail: hhorinou@ncc.go.jp; Katsui Taniyama, Tomoko

Purpose: To determine the frequency and clinical significance of epidermal growth factor receptor (EGFR) mutations in patients with potentially curable stage III non–small-cell lung cancer (NSCLC) who are eligible for definitive chemoradiotherapy (CRT). Patients and Methods: Between January 2001 and December 2010, we analyzed the EGFR mutational status in consecutive NSCLC patients who were treated by CRT. The response rate, relapse-free survival, 2-year relapse-free rate, initial relapse sites, and overall survival of the patients were investigated. Results: A total of 528 patients received CRT at our hospital during the study period. Of these, 274 were diagnosed as having nonsquamous NSCLC. Sufficientmore » specimens for mutational analyses could be obtained from 198 of these patients. The proportion of patients with EGFR activating mutations was 17%. In addition to the well-known characteristics of patients carrying EGFR mutations (female, adenocarcinoma, and never/light smoker), the proportion of cases with smaller primary lesions (T1/2) was found to be higher in patients with EGFR mutations than in those with wild-type EGFR. Patients with EGFR mutations showed similar response rate, relapse-free survival, and 2-year relapse-free rates as compared to patients with wild-type EGFR. Local relapses as the site of initial relapse occurred significantly less frequently in patients with EGFR mutation (4% vs 21%; P=.045). Patients with EGFR mutations showed longer local control (adjusted hazard ratio 0.49; P=.043). After disease progression, a majority of the patients with EGFR mutations received EGFR tyrosine kinase inhibitors (62%), and these patients showed longer postprogression survival than those with wild-type EGFR. Conclusions: Our study is the first to show radiosensitive biology of EGFR-mutated tumors in definitive CRT with curative intent. This finding could serve as a credible baseline estimate of EGFR-mutated population in stage III nonsquamous NSCLC.« less

Co-occurring genomic alterations define major subsets of KRAS - mutant lung adenocarcinoma with distinct biology, immune profiles, and therapeutic vulnerabilities

PubMed Central

Skoulidis, Ferdinandos; Byers, Lauren A.; Diao, Lixia; Papadimitrakopoulou, Vassiliki A.; Tong, Pan; Izzo, Julie; Behrens, Carmen; Kadara, Humam; Parra, Edwin R.; Canales, Jaime Rodriguez; Zhang, Jianjun; Giri, Uma; Gudikote, Jayanthi; Cortez, Maria A.; Yang, Chao; Fan, You Hong; Peyton, Michael; Girard, Luc; Coombes, Kevin R.; Toniatti, Carlo; Heffernan, Timothy P.; Choi, Murim; Frampton, Garrett M.; Miller, Vincent; Weinstein, John N.; Herbst, Roy S.; Wong, Kwok-Kin; Zhang, Jianhua; Sharma, Padmanee; Mills, Gordon B.; Hong, Waun K.; Minna, John D.; Allison, James P.; Futreal, Andrew; Wang, Jing; Wistuba, Ignacio I.; Heymach, John V.

2015-01-01

The molecular underpinnings that drive the heterogeneity of KRAS-mutant lung adenocarcinoma (LUAC) are poorly characterized. We performed an integrative analysis of genomic, transcriptomic and proteomic data from early-stage and chemo-refractory LUAC and identified three robust subsets of KRAS-mutant LUAC dominated, respectively, by co-occurring genetic events in STK11/LKB1 (the KL subgroup), TP53 (KP) and CDKN2A/B inactivation coupled with low expression of the NKX2-1 (TTF1) transcription factor (KC). We further reveal biologically and therapeutically relevant differences between the subgroups. KC tumors frequently exhibited mucinous histology and suppressed mTORC1 signaling. KL tumors had high rates of KEAP1 mutational inactivation and expressed lower levels of immune markers, including PD-L1. KP tumors demonstrated higher levels of somatic mutations, inflammatory markers, immune checkpoint effector molecules and improved relapse-free survival. Differences in drug sensitivity patterns were also observed; notably, KL cells showed increased vulnerability to HSP90-inhibitor therapy. This work provides evidence that co-occurring genomic alterations identify subgroups of KRAS-mutant LUAC with distinct biology and therapeutic vulnerabilities. PMID:26069186

Novel BRCA1 mutations and more frequent intron-20 alteration found among 236 women from Western Poland.

PubMed

Sobczak, K; Kozłowski, P; Napierała, M; Czarny, J; Woźniak, M; Kapuścińska, M; Lośko, M; Koziczak, M; Jasińska, A; Powierska, J; Braczkowski, R; Breborowicz, J; Godlewski, D; Mackiewicz, A; Krzyzosiak, W

1997-10-09

Three different novel BRCA1 mutations, five independent cases of the same 12 bp insertion-duplication in intron-20 and two novel rare BRCA1 sequence variants were identified among 122 Polish women with positive, in most cases moderate family history of breast and/or ovarian cancer, 80 controls and 34 unselected breast cancer tissue specimens. All mutations and variants were germline. The 4153 delA frameshift mutation, the Tyr105Cys missense mutation and two cases of the alteration in intron-20 were found in the group of healthy women with positive family history. Two other cases of the intronic insertion were found in unselected controls. Their carriers had no family history of breast or ovarian cancer but other cancers occurred in their families. The 1782 Trp/STOP nonsense mutation and one case of the insertion in intron-20 were first found in tissue specimens of breast cancer patient and breast/ovarian cancer patient, respectively. Their carriers also had no family history of breast or ovarian cancer. The distribution of the insertion in intron-20 in analysed groups and results of RT-PCR experiments suggest a less prominent role for this variant considered earlier a splicing mutation. This study shows also, that more population-oriented research is needed, involving women with less profound or even no family history of breast and ovarian cancer, to better understand the role and significance of different BRCA1 variants and mutations.

Identification of a Gypsy SHOX mutation (p.A170P) in Léri-Weill dyschondrosteosis and Langer mesomelic dysplasia

PubMed Central

Barca-Tierno, Verónica; Aza-Carmona, Miriam; Barroso, Eva; Heine-Suner, Damia; Azmanov, Dimitar; Rosell, Jordi; Ezquieta, Begoña; Montané, Lucia Sentchordi; Vendrell, Teresa; Cruz, Jaime; Santos, Fernando; Rodríguez, José Ignacio; Pozo, Jesús; Argente, Jesús; Kalaydjieva, Luba; Gracía, Ricardo; Campos-Barros, Ángel; Benito-Sanz, Sara; Heath, Karen E

2011-01-01

We report the clinical and molecular characteristics of 12 Spanish families with multiple members affected with Léri-Weill dyschondrosteosis (LWD) or Langer mesomelic dysplasia (LMD), who present the SHOX (short stature homeobox gene) mutation p.A170P (c.508G>C) in heterozygosity or homozygosity, respectively. In all studied families, the A170P mutation co-segregated with the fully penetrant phenotype of mesomelic limb shortening and Madelung deformity. A shared haplotype around SHOX was observed by microsatellite analysis, confirming the presence of a common ancestor, probably of Gypsy origin, as 11 of the families were of this ethnic group. Mutation screening in 359 Eastern-European Gypsies failed to identify any carriers. For the first time, we have shown SHOX expression in the human growth plate of a 22-week LMD fetus, homozygous for the A170P mutation. Although the mutant SHOX protein was expressed in all zones of the growth plate, the chondrocyte columns in the proliferative zone were disorganized with the chondrocytes occurring in smaller columnal clusters. We have also identified a novel mutation at the same residue, c. 509C>A (p.A170D), in two unrelated Spanish LWD families, which similar to A170P mutation impedes nuclear localization of SHOX. In conclusion, we have identified A170P as the first frequent SHOX mutation in Gypsy LWD and LMD individuals. PMID:21712857

Identification of a Gypsy SHOX mutation (p.A170P) in Léri-Weill dyschondrosteosis and Langer mesomelic dysplasia.

PubMed

Barca-Tierno, Verónica; Aza-Carmona, Miriam; Barroso, Eva; Heine-Suner, Damia; Azmanov, Dimitar; Rosell, Jordi; Ezquieta, Begoña; Montané, Lucia Sentchordi; Vendrell, Teresa; Cruz, Jaime; Santos, Fernando; Rodríguez, José Ignacio; Pozo, Jesús; Argente, Jesús; Kalaydjieva, Luba; Gracía, Ricardo; Campos-Barros, Angel; Benito-Sanz, Sara; Heath, Karen E

2011-12-01

We report the clinical and molecular characteristics of 12 Spanish families with multiple members affected with Léri-Weill dyschondrosteosis (LWD) or Langer mesomelic dysplasia (LMD), who present the SHOX (short stature homeobox gene) mutation p.A170P (c.508G>C) in heterozygosity or homozygosity, respectively. In all studied families, the A170P mutation co-segregated with the fully penetrant phenotype of mesomelic limb shortening and Madelung deformity. A shared haplotype around SHOX was observed by microsatellite analysis, confirming the presence of a common ancestor, probably of Gypsy origin, as 11 of the families were of this ethnic group. Mutation screening in 359 Eastern-European Gypsies failed to identify any carriers. For the first time, we have shown SHOX expression in the human growth plate of a 22-week LMD fetus, homozygous for the A170P mutation. Although the mutant SHOX protein was expressed in all zones of the growth plate, the chondrocyte columns in the proliferative zone were disorganized with the chondrocytes occurring in smaller columnal clusters. We have also identified a novel mutation at the same residue, c. 509C>A (p.A170D), in two unrelated Spanish LWD families, which similar to A170P mutation impedes nuclear localization of SHOX. In conclusion, we have identified A170P as the first frequent SHOX mutation in Gypsy LWD and LMD individuals.

Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

PubMed

Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

2014-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

Isolated p.H62L Mutation in the CYP21A2 Gene in a Simple Virilizing 21-Hydroxylase Deficient Patient

PubMed Central

Fernández, Cecilia; Belli, Susana; Buzzalino, Noemi; Dain, Liliana

2013-01-01

Congenital adrenal hyperplasia due to 21-hydroxylase deficiency accounts for 90%–95% of cases. This autosomal recessive disorder has a broad spectrum of clinical forms, ranging from severe or classical, which includes the salt-wasting and simple virilizing forms, to the mild late onset or nonclassical form. Most of the disease-causing mutations described are likely to be the consequence of nonhomologous recombination or gene conversion events between the active CYP21A2 gene and its homologous CYP21A1P pseudogene. Nevertheless, an increasing number of naturally occurring mutations have been found. The change p.H62L is one of the most frequent rare mutations of the CYP21A2 gene. It was suggested that the p.H62L represents a mild mutation that may be responsible for a more severe enzymatic impairment when presented with another mild mutation on the same allele. In this report, a 20-year-old woman carrying an isolated p.H62L mutation in compound heterozygosity with c.283-13A/C>G mutation is described. Although a mildly nonclassical phenotype was expected, clinical signs and hormonal profile of the patient are consistent with a more severe simple virilizing form of 21-hydroxylase deficiency. The study of genotype-phenotype correlation in additional patients would help in defining the role of p.H62L in disease manifestation. PMID:23936690

Isolated p.H62L Mutation in the CYP21A2 Gene in a Simple Virilizing 21-Hydroxylase Deficient Patient.

PubMed

Taboas, Melisa; Fernández, Cecilia; Belli, Susana; Buzzalino, Noemi; Alba, Liliana; Dain, Liliana

2013-01-01

Congenital adrenal hyperplasia due to 21-hydroxylase deficiency accounts for 90%-95% of cases. This autosomal recessive disorder has a broad spectrum of clinical forms, ranging from severe or classical, which includes the salt-wasting and simple virilizing forms, to the mild late onset or nonclassical form. Most of the disease-causing mutations described are likely to be the consequence of nonhomologous recombination or gene conversion events between the active CYP21A2 gene and its homologous CYP21A1P pseudogene. Nevertheless, an increasing number of naturally occurring mutations have been found. The change p.H62L is one of the most frequent rare mutations of the CYP21A2 gene. It was suggested that the p.H62L represents a mild mutation that may be responsible for a more severe enzymatic impairment when presented with another mild mutation on the same allele. In this report, a 20-year-old woman carrying an isolated p.H62L mutation in compound heterozygosity with c.283-13A/C>G mutation is described. Although a mildly nonclassical phenotype was expected, clinical signs and hormonal profile of the patient are consistent with a more severe simple virilizing form of 21-hydroxylase deficiency. The study of genotype-phenotype correlation in additional patients would help in defining the role of p.H62L in disease manifestation.

Anaphylaxis as a clinical manifestation of clonal mast cell disorders.

PubMed

Matito, A; Alvarez-Twose, I; Morgado, J M; Sánchez-Muñoz, L; Orfao, A; Escribano, L

2014-08-01

Clonal mast cell disorders comprise a heterogeneous group of disorders characterized by the presence of gain of function KIT mutations and a constitutively altered activation-associated mast cell immunophenotype frequently associated with clinical manifestations related to the release of mast cells mediators. These disorders do not always fulfil the World Health Organization (WHO)-proposed criteria for mastocytosis, particularly when low-sensitive diagnostic approaches are performed. Anaphylaxis is a frequent presentation of clonal mast cell disorders, particularly in mastocytosis patients without typical skin lesions. The presence of cardiovascular symptoms, e.g., hypotension, occurring after a hymenoptera sting or spontaneously in the absence of cutaneous manifestations such as urticaria is characteristic and differs from the presentation of anaphylaxis in the general population without mastocytosis.

Simultaneous use of in silico design and a correlated mutation network as a tool to efficiently guide enzyme engineering.

PubMed

Nobili, Alberto; Tao, Yifeng; Pavlidis, Ioannis V; van den Bergh, Tom; Joosten, Henk-Jan; Tan, Tianwei; Bornscheuer, Uwe T

2015-03-23

In order to improve the efficiency of directed evolution experiments, in silico multiple-substrate clustering was combined with an analysis of the variability of natural enzymes within a protein superfamily. This was applied to a Pseudomonas fluorescens esterase (PFE I) targeting the enantioselective hydrolysis of 3-phenylbutyric acid esters. Data reported in the literature for nine substrates were used for the clustering meta-analysis of the docking conformations in wild-type PFE I, and this highlighted a tryptophan residue (W28) as an interesting target. Exploration of the most frequently, naturally occurring amino acids at this position suggested that the reduced flexibility observed in the case of the W28F variant leads to enhancement of the enantioselectivity. This mutant was subsequently combined with mutations identified in a library based on analysis of a correlated mutation network. By interrogation of <80 variants a mutant with 15-fold improved enantioselectivity was found. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transition between morule-like and solid components may occur in solid-predominant adenocarcinoma of the lung: report of 2 cases with EGFR and KRAS mutations.

PubMed

Tajima, Shogo; Koda, Kenji

2015-01-01

A limited number of pulmonary adenocarcinoma cases with morule-like components have been described to date, and the most frequent histological subtype is papillary-predominant adenocarcinoma. Occasionally, this type of adenocarcinoma is associated with solid-predominant adenocarcinoma. EGFR mutations are predominant in adenocarcinoma with morule-like components, followed by ALK rearrangements. Herein, we present 2 cases of solid-predominant adenocarcinoma with morule-like components harboring either an EGFR or KRAS mutation. This KRAS-mutant case is the first to be associated with morule-like components, to the best of our knowledge. Both cases showed transition between micropapillary and morule-like components. Transition between morule-like and solid components was also observed in both cases. Although a few cases of solid-predominant adenocarcinoma have been shown to harbor morule-like components, this type of transition has not been previously well described. We surmised that the solid components of some EGFR-mutant adenocarcinomas might be derived from morule-like components.

Elucidating the genomic architecture of Asian EGFR-mutant lung adenocarcinoma through multi-region exome sequencing.

PubMed

Nahar, Rahul; Zhai, Weiwei; Zhang, Tong; Takano, Angela; Khng, Alexis J; Lee, Yin Yeng; Liu, Xingliang; Lim, Chong Hee; Koh, Tina P T; Aung, Zaw Win; Lim, Tony Kiat Hon; Veeravalli, Lavanya; Yuan, Ju; Teo, Audrey S M; Chan, Cheryl X; Poh, Huay Mei; Chua, Ivan M L; Liew, Audrey Ann; Lau, Dawn Ping Xi; Kwang, Xue Lin; Toh, Chee Keong; Lim, Wan-Teck; Lim, Bing; Tam, Wai Leong; Tan, Eng-Huat; Hillmer, Axel M; Tan, Daniel S W

2018-01-15

EGFR-mutant lung adenocarcinomas (LUAD) display diverse clinical trajectories and are characterized by rapid but short-lived responses to EGFR tyrosine kinase inhibitors (TKIs). Through sequencing of 79 spatially distinct regions from 16 early stage tumors, we show that despite low mutation burdens, EGFR-mutant Asian LUADs unexpectedly exhibit a complex genomic landscape with frequent and early whole-genome doubling, aneuploidy, and high clonal diversity. Multiple truncal alterations, including TP53 mutations and loss of CDKN2A and RB1, converge on cell cycle dysregulation, with late sector-specific high-amplitude amplifications and deletions that potentially beget drug resistant clones. We highlight the association between genomic architecture and clinical phenotypes, such as co-occurring truncal drivers and primary TKI resistance. Through comparative analysis with published smoking-related LUAD, we postulate that the high intra-tumor heterogeneity observed in Asian EGFR-mutant LUAD may be contributed by an early dominant driver, genomic instability, and low background mutation rates.

GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico.

PubMed

Hernández-Juárez, Aideé Alejandra; Lugo-Trampe, José de Jesús; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Angel; Treviño-González, José Luis; de-la-Cruz-Ávila, Israel; Martínez-de-Villarreal, Laura Elia

2014-12-01

Mutations in the DFNB1 locus are the most common cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL) worldwide. The aim of this study was to identify the most frequent mutations in patients with ARNSHL who reside in Northeastern Mexico. We determined the nucleotide sequence the coding region of GJB2 of 78 patients with ARNSHL. Polymerase chain reaction assays were used to detect the GJB2 IVS1+1G>A mutation and deletions within GJB6. GJB2 mutations were detected in 9.6% of the alleles, and c.35delG was the most frequent. Six other less-frequent mutations were detected, including an extremely rare variant (c.645_648delTAGA), a novel mutation (c.35G>A), and one of possible Mexican origin (c.34G>T). GJB6 deletions and GJB2 IVS1+1G>A were not detected. These data suggest that mutations in the DFNB1 locus are a rare cause of ARNSHL among the population of Northeastern Mexico. This confirms the genetic heterogeneity of this condition and indicates that further research is required to determine the other mechanisms of pathogenesis of ARNSHL in Mexicans. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Mutation analysis of 272 Spanish families affected by autosomal recessive retinitis pigmentosa using a genotyping microarray.

PubMed

Ávila-Fernández, Almudena; Cantalapiedra, Diego; Aller, Elena; Vallespín, Elena; Aguirre-Lambán, Jana; Blanco-Kelly, Fiona; Corton, M; Riveiro-Álvarez, Rosa; Allikmets, Rando; Trujillo-Tiebas, María José; Millán, José M; Cremers, Frans P M; Ayuso, Carmen

2010-12-03

Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by progressive loss of vision. The aim of this study was to identify the causative mutations in 272 Spanish families using a genotyping microarray. 272 unrelated Spanish families, 107 with autosomal recessive RP (arRP) and 165 with sporadic RP (sRP), were studied using the APEX genotyping microarray. The families were also classified by clinical criteria: 86 juveniles and 186 typical RP families. Haplotype and sequence analysis were performed to identify the second mutated allele. At least one-gene variant was found in 14% and 16% of the juvenile and typical RP groups respectively. Further study identified four new mutations, providing both causative changes in 11% of the families. Retinol Dehydrogenase 12 (RDH12) was the most frequently mutated gene in the juvenile RP group, and Usher Syndrome 2A (USH2A) and Ceramide Kinase-Like (CERKL) were the most frequently mutated genes in the typical RP group. The only variant found in CERKL was p.Arg257Stop, the most frequent mutation. The genotyping microarray combined with segregation and sequence analysis allowed us to identify the causative mutations in 11% of the families. Due to the low number of characterized families, this approach should be used in tandem with other techniques.

TERT promoter mutation status as an independent prognostic factor in cutaneous melanoma.

PubMed

Griewank, Klaus G; Murali, Rajmohan; Puig-Butille, Joan Anton; Schilling, Bastian; Livingstone, Elisabeth; Potrony, Miriam; Carrera, Cristina; Schimming, Tobias; Möller, Inga; Schwamborn, Marion; Sucker, Antje; Hillen, Uwe; Badenas, Celia; Malvehy, Josep; Zimmer, Lisa; Scherag, André; Puig, Susana; Schadendorf, Dirk

2014-09-01

Recently, TERT promoter mutations were identified at high frequencies in cutaneous melanoma tumor samples and cell lines. The mutations were found to have a UV-signature and to lead to increased TERT gene expression. We analyzed a large cohort of melanoma patients for the presence and distribution of TERT promoter mutations and their association with clinico-pathological characteristics. 410 melanoma tumor samples were analyzed by Sanger sequencing for the presence of TERT promoter mutations. An analysis of associations between mutation status and various clinical and pathologic variables was performed. TERT promoter mutations were identified in 154 (43%) of 362 successfully sequenced melanomas. Mutation frequencies varied between melanoma subtype, being most frequent in melanomas arising in nonacral skin (48%) and melanomas with occult primary (50%), and less frequent in mucosal (23%), and acral (19%) melanomas. Mutations carried a UV signature (C>T or CC>TT). The presence of TERT promoter mutations was associated with factors such as BRAF or NRAS mutation (P < .001), histologic type (P = .002), and Breslow thickness (P < .001). TERT promoter mutation was independently associated with poorer overall survival in patients with nonacral cutaneous melanomas (median survival 80 months vs 291 months for wild-type; hazard ratio corrected for other covariates 2.47; 95% confidence interval [CI] = 1.29 to 4.74; P = .006). UV-induced TERT promoter mutations are one of the most frequent genetic alterations in melanoma, with frequencies varying depending on melanoma subtype. In nonacral cutaneous melanomas, presence of TERT promoter mutations is independently associated with poor prognosis. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The Etiology and Clinical Course of Chronic Pancreatitis in Children With Early Onset of the Disease.

PubMed

Wejnarska, Karolina; Kolodziejczyk, Elwira; Wertheim-Tysarowska, Katarzyna; Dadalski, Maciej; Sobczynska-Tomaszewska, Agnieszka; Kierkus, Jarosław; Bal, Jerzy; Rygiel, Agnieszka Magdalena; Oracz, Grzegorz

2016-12-01

The etiological factors of chronic pancreatitis (CP) in children differ from those in adults. To date, no study has assessed the clinical course of CP in young children. The aim of our study was to evaluate the etiology and the clinical presentation of the disease in children with disease onset before 5 years of age in comparison to later-onset of CP. A total of 276 children with CP, hospitalized from 1988 to 2015, were enrolled in the study. Data on presentation, diagnostic findings, and treatment were reviewed. Two hundred sixty patients were screened for the most frequent mutations in major pancreatitis-associated genes, such as cationic trypsinogen/serine protease gene (PRSS1), serine protease inhibitor, Kazal type 1 gene (SPINK1), and cystic fibrosis transmembrane conductance regulator gene (CFTR). The disease onset before the age of 5 years occurred in 51 patients (group 1), the later onset in 225 patients (group 2). We found no significant discrepancies in distribution of the etiological factors between groups. The youngest patients (group 1) had more pancreatitis episodes (median 5.0 vs 3.00; P < 0.05) and underwent surgeries more frequently (25.5% vs 8.9%; P < 0.05). It could be associated with significantly longer follow-up in early onset group (median 6 vs 4 years; P < 0.05). There were no differences in nutritional status or exocrine and endocrine pancreatic function. Early- and later-onset pancreatitis have similar etiological factors with predominance of gene mutations. The most frequent mutation found was p.Asn34Ser (N34S) in SPINK1 gene. The clinical presentation differed in number of pancreatitis episodes and frequency of surgeries.

Frequent PTPRK-RSPO3 fusions and RNF43 mutations in colorectal traditional serrated adenoma.

PubMed

Sekine, Shigeki; Yamashita, Satoshi; Tanabe, Taro; Hashimoto, Taiki; Yoshida, Hiroshi; Taniguchi, Hirokazu; Kojima, Motohiro; Shinmura, Kazuya; Saito, Yutaka; Hiraoka, Nobuyoshi; Ushijima, Toshikazu; Ochiai, Atsushi

2016-06-01

The molecular mechanisms underlying the serrated pathway of colorectal tumourigenesis, particularly those related to traditional serrated adenomas (TSAs), are still poorly understood. In this study, we analysed genetic alterations in 188 colorectal polyps, including hyperplastic polyps, sessile serrated adenomas/polyps (SSA/Ps), TSAs, tubular adenomas, and tubulovillous adenomas by using targeted next-generation sequencing and reverse transcription-PCR. Our analyses showed that most TSAs (71%) contained genetic alterations in WNT pathway components. In particular, PTPRK-RSPO3 fusions (31%) and RNF43 mutations (24%) were frequently and almost exclusively observed in TSAs. Consistent with the WNT pathway activation, immunohistochemical analysis showed diffuse and focal nuclear accumulation of β-catenin in 53% and 30% of TSAs, respectively. APC mutations were observed in tubular and tubulovillous adenomas and in a subset of TSAs. BRAF mutations were exclusively and frequently encountered in serrated lesions. KRAS mutations were observed in all types of polyps, but were most commonly encountered in tubulovillous adenomas and TSAs. This study has demonstrated that TSAs frequently harbour genetic alterations that lead to WNT pathway activation, in addition to BRAF and KRAS mutations. In particular, PTPRK-RSPO3 fusions and RNF43 mutations were found to be characteristic genetic features of TSAs. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

RUNX1 mutations in acute myeloid leukemia are associated with distinct clinico-pathologic and genetic features.

PubMed

Gaidzik, V I; Teleanu, V; Papaemmanuil, E; Weber, D; Paschka, P; Hahn, J; Wallrabenstein, T; Kolbinger, B; Köhne, C H; Horst, H A; Brossart, P; Held, G; Kündgen, A; Ringhoffer, M; Götze, K; Rummel, M; Gerstung, M; Campbell, P; Kraus, J M; Kestler, H A; Thol, F; Heuser, M; Schlegelberger, B; Ganser, A; Bullinger, L; Schlenk, R F; Döhner, K; Döhner, H

2016-11-01

We evaluated the frequency, genetic architecture, clinico-pathologic features and prognostic impact of RUNX1 mutations in 2439 adult patients with newly-diagnosed acute myeloid leukemia (AML). RUNX1 mutations were found in 245 of 2439 (10%) patients; were almost mutually exclusive of AML with recurrent genetic abnormalities; and they co-occurred with a complex pattern of gene mutations, frequently involving mutations in epigenetic modifiers (ASXL1, IDH2, KMT2A, EZH2), components of the spliceosome complex (SRSF2, SF3B1) and STAG2, PHF6, BCOR. RUNX1 mutations were associated with older age (16-59 years: 8.5%; ⩾60 years: 15.1%), male gender, more immature morphology and secondary AML evolving from myelodysplastic syndrome. In univariable analyses, RUNX1 mutations were associated with inferior event-free (EFS, P<0.0001), relapse-free (RFS, P=0.0007) and overall survival (OS, P<0.0001) in all patients, remaining significant when age was considered. In multivariable analysis, RUNX1 mutations predicted for inferior EFS (P=0.01). The effect of co-mutation varied by partner gene, where patients with the secondary genotypes RUNX1 mut /ASXL1 mut (OS, P=0.004), RUNX1 mut /SRSF2 mut (OS, P=0.007) and RUNX1 mut /PHF6 mut (OS, P=0.03) did significantly worse, whereas patients with the genotype RUNX1 mut /IDH2 mut (OS, P=0.04) had a better outcome. In conclusion, RUNX1-mutated AML is associated with a complex mutation cluster and is correlated with distinct clinico-pathologic features and inferior prognosis.

L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rozen, R.; Ferreira-Rajabi, L.; Robb, L.

Cystic fibrosis is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Over 400 mutations have been reported at this locus. Although severe forms of cystic fibrosis are usually associated with pancreatic insufficiency, pulmonary dysfunction, and elevated sweat chloride, there is a wide range of phenotypes, including congenital absence of the vas deferens, observed with some of the milder mutations. The L206W mutation, which was first identified in patients from South France, is relatively frequent in French Canadians from Quebec. In this report, we document the atypical form of cystic fibrosis associated with this mutation in amore » cohort of 7 French Canadian probands. 20 refs.« less

Transcriptional specificity in various p53-mutant cells.

PubMed

Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

2013-03-01

Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

Cancer-associated TERT promoter mutations abrogate telomerase silencing

PubMed Central

Chiba, Kunitoshi; Johnson, Joshua Z; Vogan, Jacob M; Wagner, Tina; Boyle, John M; Hockemeyer, Dirk

2015-01-01

Mutations in the human telomerase reverse transcriptase (TERT) promoter are the most frequent non-coding mutations in cancer, but their molecular mechanism in tumorigenesis has not been established. We used genome editing of human pluripotent stem cells with physiological telomerase expression to elucidate the mechanism by which these mutations contribute to human disease. Surprisingly, telomerase-expressing embryonic stem cells engineered to carry any of the three most frequent TERT promoter mutations showed only a modest increase in TERT transcription with no impact on telomerase activity. However, upon differentiation into somatic cells, which normally silence telomerase, cells with TERT promoter mutations failed to silence TERT expression, resulting in increased telomerase activity and aberrantly long telomeres. Thus, TERT promoter mutations are sufficient to overcome the proliferative barrier imposed by telomere shortening without additional tumor-selected mutations. These data establish that TERT promoter mutations can promote immortalization and tumorigenesis of incipient cancer cells. DOI: http://dx.doi.org/10.7554/eLife.07918.001 PMID:26194807

Long term persistence of herpes simplex virus-specific CD8+ CTL in persons with frequently recurring genital herpes.

PubMed

Posavad, C M; Huang, M L; Barcy, S; Koelle, D M; Corey, L

2000-07-15

Herpes simplex virus (HSV) establishes a lifelong infection in humans. Reactivation of latent virus occurs intermittently so that the immune system is frequently exposed to viral Ag, providing an opportunity to evaluate memory T cells to a persistent human pathogen. We studied the persistence of genital herpes lesion-derived HSV-specific CD8+ CTL from three immunocompetent individuals with frequently recurring genital HSV-2 infection. All CTL clones were HSV-2 type specific and only one to three unique clonotypes were identified from any single biopsy specimen. The TCRBV genes utilized by these clonotypes were sequenced, and clonotype-specific probes were used to longitudinally track these clonotypes in PBMC and genital lesions. CTL clonotypes were consistently detected in PBMC and lesions for at least 2 and up to 7 years, and identical clonotypes infiltrated herpes lesions spaced as long as 7.5 years apart. Moreover, these clones were functionally lytic in vivo over these time periods. Additionally, CTL clones killed target cells infected with autologous viral isolates obtained 6.5 years after CTL clones were established, suggesting that selective pressure by these CTL did not result in the mutation of CTL epitopes. Thus, HSV recurs in the face of persistent CD8+ CTL with no evidence of clonal exhaustion or mutation of CTL epitopes as mechanisms of viral persistence.

Crizotinib resistance in acute myeloid leukemia with inv(2)(p23q13)/RAN binding protein 2 (RANBP2) anaplastic lymphoma kinase (ALK) fusion and monosomy 7.

PubMed

Takeoka, Kayo; Okumura, Atsuko; Maesako, Yoshitomo; Akasaka, Takashi; Ohno, Hitoshi

2015-03-01

This is the first report on the development of a p.G1269A mutation within the kinase domain (KD) of ALK after crizotinib treatment in RANBP2-ALK acute myeloid leukemia (AML). An elderly woman with AML with an inv(2)(p23q13)/RANBP2-ALK and monosomy 7 was treated with crizotinib. After a short-term hematological response and the restoration of normal hematopoiesis, she experienced a relapse of AML. Fluorescence in situ hybridization using the ALK break-apart probe confirmed the inv(2)(p23q13), while G-banded karyotyping revealed the deletion of a segment of the short arm of chromosome 1 [del(1)(p13p22)] after crizotinib therapy. The ALK gene carried a heterozygous mutation at the nucleotide position g.716751G>C within exon 25, causing the p.G1269A amino acid substitution within the ALK-KD. Reverse transcriptase PCR revealed that the mutated ALK allele was selectively transcribed and the mutation occurred in the ALK allele rearranged with RANBP2. As both the del(1)(p13p22) at the cytogenetic level and p.G1269A at the nucleotide level newly appeared after crizotinib treatment, it is likely that they were secondarily acquired alterations involved in crizotinib resistance. Although secondary genetic abnormalities in ALK are most frequently described in non-small cell lung cancers harboring an ALK alteration, this report suggests that an ALK-KD mutation can occur independently of the tumor cell type or fusion partner after crizotinib treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

Induction of endoplasmic reticulum stress by deletion of Grp78 depletes Apc mutant intestinal epithelial stem cells.

PubMed

van Lidth de Jeude, J F; Meijer, B J; Wielenga, M C B; Spaan, C N; Baan, B; Rosekrans, S L; Meisner, S; Shen, Y H; Lee, A S; Paton, J C; Paton, A W; Muncan, V; van den Brink, G R; Heijmans, J

2017-06-15

Intestinal epithelial stem cells are highly sensitive to differentiation induced by endoplasmic reticulum (ER) stress. Colorectal cancer develops from mutated intestinal epithelial stem cells. The most frequent initiating mutation occurs in Apc, which results in hyperactivated Wnt signalling. This causes hyperproliferation and reduced sensitivity to chemotherapy, but whether these mutated stem cells are sensitive to ER stress induced differentiation remains unknown. Here we examined this by generating mice in which both Apc and ER stress repressor chaperone Grp78 can be conditionally deleted from the intestinal epithelium. For molecular studies, we used intestinal organoids derived from these mice. Homozygous loss of Apc alone resulted in crypt elongation, activation of the Wnt signature and accumulation of intestinal epithelial stem cells, as expected. This phenotype was however completely rescued on activation of ER stress by additional deletion of Grp78. In these Apc-Grp78 double mutant animals, stem cells were rapidly lost and repopulation occurred by non-mutant cells that had escaped recombination, suggesting that Apc-Grp78 double mutant stem cells had lost self-renewal capacity. Although in Apc-Grp78 double mutant mice the Wnt signature was lost, these intestines exhibited ubiquitous epithelial presence of nuclear β-catenin. This suggests that ER stress interferes with Wnt signalling downstream of nuclear β-catenin. In conclusion, our findings indicate that ER stress signalling results in loss of Apc mutated intestinal epithelial stem cells by interference with the Wnt signature. In contrast to many known inhibitors of Wnt signalling, ER stress acts downstream of β-catenin. Therefore, ER stress poses a promising target in colorectal cancers, which develop as a result of Wnt activating mutations.

Frequent somatic TERT promoter mutations and CTNNB1 mutations in hepatocellular carcinoma.

PubMed

Lee, Seung Eun; Chang, Seong-Hwan; Kim, Wook Youn; Lim, So Dug; Kim, Wan Seop; Hwang, Tea Sook; Han, Hye Seung

2016-10-25

Genetic alterations of TERT and CTNNB1 have been documented in hepatocellular carcinoma. TERT promoter mutations are the earliest genetic events in the multistep process of hepatocarcinogenesis related to cirrhosis. However, analyses of TERT promoter and CTNNB1 mutations in hepatocellular carcinoma tumor samples have not been performed in the Korean population, where hepatitis B virus-related hepatocellular carcinoma is prevalent. In order to identify the role of TERT promoter and CTNNB1 mutations in the hepatocarcinogenesis and pathogenesis of recurrent hepatocellular carcinoma, we performed the sequence analyses in 140 hepatocellular nodules (including 107 hepatocellular carcinomas), and 8 pairs of matched primary and relapsed hepatocellular carcinomas. TERT promoter and CTNNB1 mutations were only observed in hepatocellular carcinomas but not in precursor lesions. Of 109 patients with hepatocellular carcinoma, 41 (39.0%) and 15 (14.6%) harbored TERT and CTNNB1 mutations, respectively. TERT promotermutations were significantly more frequent in hepatocellular carcinomas related to hepatitis C virus infection (5/6; 83.3%) compared to tumors of other etiologies (P = 0.001). In two cases, discordance in TERT promoter mutation status was observed between the primary and the corresponding recurrent hepatocellular carcinoma. The two patients with discordant cases had early relapses. In conclusion, we identified TERT promoter and CTNNB1 mutations as the most frequent somatic genetic alterations observed in hepatocellular carcinoma, indicating its pivotal role in hepatocarcinogenesis. Furthermore, we suggest the possibility of intratumoral genetic heterogeneity of TERT promoter mutations in hepatocellular carcinoma as indicated by the discordance in TERT promoter mutations between primary and corresponding recurrent hepatocellular carcinoma.

A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

NASA Astrophysics Data System (ADS)

Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-11-01

Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

Hypomorphic Rag1 mutations alter the pre-immune repertoire at early stages of lymphoid development.

PubMed

Ott de Bruin, Lisa M; Bosticardo, Marita; Barbieri, Alessandro; Lin, Sherry G; Rowe, Jared H; Poliani, Pietro L; Ching, Kimberly; Eriksson, Daniel; Landegren, Nils; Kämpe, Olle; Manis, John P; Notarangelo, Luigi D

2018-05-09

Hypomorphic RAG1 mutations allowing residual T and B cell development have been found in patients presenting with delayed-onset combined immune deficiency with granulomas and/or autoimmunity (CID-G/AI) and abnormalities of the peripheral T and B cell repertoire. To examine how hypomorphic Rag1 mutations affect the earliest stages of lymphocyte development, we used CRISPR/Cas9 to generate mouse models with equivalent mutations found in patients with CID-G/AI. Immunological characterization showed partial development of T and B lymphocytes, with persistence of naïve cells, preserved serum immunoglobulin, but impaired antibody responses and presence of autoantibodies, thereby recapitulating the phenotype seen in patients with CID-G/AI. By using high throughput sequencing, we identified marked skewing of Igh V and Trb V gene usage in early progenitors, with a bias for productive Igh and Trb rearrangements after selection occurred and increased apoptosis of B cell progenitors. Rearrangement at the Igk locus was impaired, and polyreactive IgM antibodies were detected. This study provides novel insights in how hypomorphic Rag1 mutations alter the primary repertoire of T and B cells, setting the stage for immune dysregulation frequently seen in patients. Copyright © 2018 American Society of Hematology.

A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family.

PubMed

Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-11-06

Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

Genetic risk factors for inhibitors in haemophilia A.

PubMed

Bardi, Edit; Astermark, Jan

2015-02-01

The current most serious side effect of haemophilia treatment is inhibitor development. Significant progress has been made over the last decades to understand why this complication occurs in some patients and it seems clear that both genetic and non-genetic factors are involved. Several issues however remain to be settled. A review was undertaken to summarise some key findings regarding the current view and available data on genetic markers of potential importance within this area. The causative F8 mutation, together with the HLA class II alleles, plays a pivotal pathophysiological role in inhibitor development. The types of mutation most frequently associated with inhibitors are large deletions, nonsense mutations, inversions, small deletions/insertions without A-runs, splice-site mutations at conserved nucleotides and certain missense mutations. Regarding HLA class II allele, it has been hard to consistently identify risk alleles. Ethnicity has consistently been associated with inhibitor risk, but the causality of this has so far not been resolved. Among immune regulatory molecules, several polymorphic molecules have been suggested to be of importance. Most of these need additional studies and immune system challenges have to be fully evaluated. Inhibitor risk should be further defined, as patients in the future may be offered non-immunogenic treatments. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

High frequency of mutations in codon 98 of the peripheral myelin protein Po gene in 20 French CMT1 patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rougher, H.; LeGuern, E. Gouider, R.

1996-03-01

Charcot-Marie-Tooth disease, characterized by distal muscle weakness and amyotrophy, decreased or absent tendon reflexes, and high arched feet, is the most common inherited peripheral neuropathy, with a prevalence of 1 in 2,500. Two types of CMT have been distinguished on the basis of nerve conduction velocities. CMT type 1 is the most frequent, with markedly slowed velocities ({<=}40 m/s) associated with hypertrophic onion bulb changes on nerve biopsy. Autosomal dominant CMT1 is genetically heterogeneous: CMT1A is caused by a 1.5-Mb duplication in 17p11.2 and, more rarely, by a point mutation in tha PMP22 (peripheral myelin protein, 22 kD) gene locatedmore » in the duplicated region; CMT1B results from mutations in the Po (peripheral myelin protein zero) gene in 1q22-23. Forty-five percent (7/16) of the published mutations associated with CMT1 occur in exon 3 of Po. In order to determine the cause of CMT1 in 20 unrelated patients without 17p11.2 duplications, mutations were sought in exon 3 of Po with three techniques: nonradioactive SSCP, automated sequencing, and PCR enzymatic restriction. 18 refs., 2 figs.« less

VWF mutations and new sequence variations identified in healthy controls are more frequent in the African-American population.

PubMed

Bellissimo, Daniel B; Christopherson, Pamela A; Flood, Veronica H; Gill, Joan Cox; Friedman, Kenneth D; Haberichter, Sandra L; Shapiro, Amy D; Abshire, Thomas C; Leissinger, Cindy; Hoots, W Keith; Lusher, Jeanne M; Ragni, Margaret V; Montgomery, Robert R

2012-03-01

Diagnosis and classification of VWD is aided by molecular analysis of the VWF gene. Because VWF polymorphisms have not been fully characterized, we performed VWF laboratory testing and gene sequencing of 184 healthy controls with a negative bleeding history. The controls included 66 (35.9%) African Americans (AAs). We identified 21 new sequence variations, 13 (62%) of which occurred exclusively in AAs and 2 (G967D, T2666M) that were found in 10%-15% of the AA samples, suggesting they are polymorphisms. We identified 14 sequence variations reported previously as VWF mutations, the majority of which were type 1 mutations. These controls had VWF Ag levels within the normal range, suggesting that these sequence variations might not always reduce plasma VWF levels. Eleven mutations were found in AAs, and the frequency of M740I, H817Q, and R2185Q was 15%-18%. Ten AA controls had the 2N mutation H817Q; 1 was homozygous. The average factor VIII level in this group was 99 IU/dL, suggesting that this variation may confer little or no clinical symptoms. This study emphasizes the importance of sequencing healthy controls to understand ethnic-specific sequence variations so that asymptomatic sequence variations are not misidentified as mutations in other ethnic or racial groups.

Transcription-associated mutational pressure in the Parvovirus B19 genome: Reactivated genomes contribute to the variability of viral populations.

PubMed

Khrustalev, Vladislav Victorovich; Ermalovich, Marina Anatolyevna; Hübschen, Judith M; Khrustaleva, Tatyana Aleksandrovna

2017-12-21

In this study we used non-overlapping parts of the two long open reading frames coding for nonstructural (NS) and capsid (VP) proteins of all available sequences of the Parvovirus B19 subgenotype 1a genome and found out that the rates of A to G, C to T and A to T mutations are higher in the first long reading frame (NS) of the virus than in the second one (VP). This difference in mutational pressure directions for two parts of the same viral genome can be explained by the fact of transcription of just the first long reading frame during the lifelong latency in nonerythroid cells. Adenine deamination (producing A to G and A to T mutations) and cytosine deamination (producing C to T mutations) occur more frequently in transcriptional bubbles formed by DNA "plus" strand of the first open reading frame. These mutations can be inherited only in case of reactivation of the infectious virus due to the help of Adenovirus that allows latent Parvovirus B19 to start transcription of the second reading frame and then to replicate its genome by the rolling circle mechanism using the specific origin. Results of this study provide evidence that the genomes reactivated from latency make significant contributions to the variability of Parvovirus B19. Copyright © 2017 Elsevier Ltd. All rights reserved.

Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

PubMed Central

Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

2000-01-01

Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

The genomic landscape of mantle cell lymphoma is related to the epigenetically determined chromatin state of normal B cells

PubMed Central

Zhang, Jenny; Jima, Dereje; Moffitt, Andrea B.; Liu, Qingquan; Czader, Magdalena; Hsi, Eric D.; Fedoriw, Yuri; Dunphy, Cherie H.; Richards, Kristy L.; Gill, Javed I.; Sun, Zhen; Love, Cassandra; Scotland, Paula; Lock, Eric; Levy, Shawn; Hsu, David S.; Dunson, David; Dave, Sandeep S.

2014-01-01

In this study, we define the genetic landscape of mantle cell lymphoma (MCL) through exome sequencing of 56 cases of MCL. We identified recurrent mutations in ATM, CCND1, MLL2, and TP53. We further identified a number of novel genes recurrently mutated in patients with MCL including RB1, WHSC1, POT1, and SMARCA4. We noted that MCLs have a distinct mutational profile compared with lymphomas from other B-cell stages. The ENCODE project has defined the chromatin structure of many cell types. However, a similar characterization of primary human mature B cells has been lacking. We defined, for the first time, the chromatin structure of primary human naïve, germinal center, and memory B cells through chromatin immunoprecipitation and sequencing for H3K4me1, H3K4me3, H3Ac, H3K36me3, H3K27me3, and PolII. We found that somatic mutations that occur more frequently in either MCLs or Burkitt lymphomas were associated with open chromatin in their respective B cells of origin, naïve B cells, and germinal center B cells. Our work thus elucidates the landscape of gene-coding mutations in MCL and the critical interplay between epigenetic alterations associated with B-cell differentiation and the acquisition of somatic mutations in cancer. PMID:24682267

How the Leopard Hides Its Spots: ASIP Mutations and Melanism in Wild Cats

PubMed Central

Schneider, Alexsandra; David, Victor A.; Johnson, Warren E.; O'Brien, Stephen J.; Barsh, Gregory S.; Menotti-Raymond, Marilyn; Eizirik, Eduardo

2012-01-01

The occurrence of melanism (darkening of the background coloration) is documented in 13 felid species, in some cases reaching high frequencies at the population level. Recent analyses have indicated that it arose multiple times in the Felidae, with three different species exhibiting unique mutations associated with this trait. The causative mutations in the remaining species have so far not been identified, precluding a broader assessment of the evolutionary dynamics of melanism in the Felidae. Among these, the leopard (Panthera pardus) is a particularly important target for research, given the iconic status of the ‘black panther’ and the extremely high frequency of melanism observed in some Asian populations. Another felid species from the same region, the Asian golden cat (Pardofelis temminckii), also exhibits frequent records of melanism in some areas. We have sequenced the coding region of the Agouti Signaling Protein (ASIP) gene in multiple leopard and Asian golden cat individuals, and identified distinct mutations strongly associated with melanism in each of them. The single nucleotide polymorphism (SNP) detected among the P. pardus individuals was caused by a nonsense mutation predicted to completely ablate ASIP function. A different SNP was identified in P. temminckii, causing a predicted amino acid change that should also induce loss of function. Our results reveal two additional cases of species-specific mutations implicated in melanism in the Felidae, and indicate that ASIP mutations may play an important role in naturally-occurring coloration polymorphism. PMID:23251368

How the leopard hides its spots: ASIP mutations and melanism in wild cats.

PubMed

Schneider, Alexsandra; David, Victor A; Johnson, Warren E; O'Brien, Stephen J; Barsh, Gregory S; Menotti-Raymond, Marilyn; Eizirik, Eduardo

2012-01-01

The occurrence of melanism (darkening of the background coloration) is documented in 13 felid species, in some cases reaching high frequencies at the population level. Recent analyses have indicated that it arose multiple times in the Felidae, with three different species exhibiting unique mutations associated with this trait. The causative mutations in the remaining species have so far not been identified, precluding a broader assessment of the evolutionary dynamics of melanism in the Felidae. Among these, the leopard (Panthera pardus) is a particularly important target for research, given the iconic status of the 'black panther' and the extremely high frequency of melanism observed in some Asian populations. Another felid species from the same region, the Asian golden cat (Pardofelis temminckii), also exhibits frequent records of melanism in some areas. We have sequenced the coding region of the Agouti Signaling Protein (ASIP) gene in multiple leopard and Asian golden cat individuals, and identified distinct mutations strongly associated with melanism in each of them. The single nucleotide polymorphism (SNP) detected among the P. pardus individuals was caused by a nonsense mutation predicted to completely ablate ASIP function. A different SNP was identified in P. temminckii, causing a predicted amino acid change that should also induce loss of function. Our results reveal two additional cases of species-specific mutations implicated in melanism in the Felidae, and indicate that ASIP mutations may play an important role in naturally-occurring coloration polymorphism.

The genetic difference between Western and Chinese urothelial cell carcinomas: infrequent FGFR3 mutation in Han Chinese patients.

PubMed

Yuan, Xiaotian; Liu, Cheng; Wang, Kun; Liu, Li; Liu, Tiantian; Ge, Nan; Kong, Feng; Yang, Liu; Björkholm, Magnus; Fan, Yidong; Zhao, Shengtian; Xu, Dawei

2016-05-03

Urothelial cell carcinoma (UCC) includes urothelial bladder carcinoma (UBC), renal pelvic carcinoma (RPC) and ureter carcinoma (UC), and its incidence varies dependent on geographical areas and tumor locations, which indicates different oncogenic mechanisms and/or different genetic susceptibility/environment exposure. The activating mutations of the fibroblast growth factor receptor 3 (FGFR3) gene and telomerase reverse transcriptase (TERT) promoter are the most frequent genetic events in UCCs. These mutations have clinical utilities in UCC initial diagnostics, prognosis, recurrence monitoring and management. However, the vast majority of the results are obtained from studies of UCC patients in Western countries, and little has been known about these in Han Chinese patients. In the present study, we screened the FGFR3 gene and TERT promoter for mutations in 116 UBC, 91 RPC and 115 UC tumors from Han Chinese patients by using Sanger Sequencing. TERT promoter mutations occurred at a high frequency in these UCC patients, comparable with that seen in Western patients, however, the FGFR3 mutation was surprisingly lower, only 9.4% for UBCs, 8.8% for RPCs and 2.6% for UCs, respectively. Taken together, the FGFR3 gene is an infrequent target in the pathogenesis of Han Chinese UCCs, and its mutation detection and targeted therapy have limited clinical utility in these patients. Our results underscore the need for extensive characterization of cancer genomes from diverse patient populations, thereby contributing to precision medicine for cancer treatment and prevention.

Three molecular pathways model colorectal carcinogenesis in Lynch syndrome.

PubMed

Ahadova, Aysel; Gallon, Richard; Gebert, Johannes; Ballhausen, Alexej; Endris, Volker; Kirchner, Martina; Stenzinger, Albrecht; Burn, John; von Knebel Doeberitz, Magnus; Bläker, Hendrik; Kloor, Matthias

2018-07-01

Lynch syndrome is caused by germline mutations of DNA mismatch repair (MMR) genes. MMR deficiency has long been regarded as a secondary event in the pathogenesis of Lynch syndrome colorectal cancers. Recently, this concept has been challenged by the discovery of MMR-deficient crypt foci in the normal mucosa. We aimed to reconstruct colorectal carcinogenesis in Lynch syndrome by collecting molecular and histology evidence from Lynch syndrome adenomas and carcinomas. We determined the frequency of MMR deficiency in adenomas from Lynch syndrome mutation carriers by immunohistochemistry and by systematic literature analysis. To trace back the pathways of pathogenesis, histological growth patterns and mutational signatures were analyzed in Lynch syndrome colorectal cancers. Literature and immunohistochemistry analysis demonstrated MMR deficiency in 491 (76.7%) out of 640 adenomas (95% CI: 73.3% to 79.8%) from Lynch syndrome mutation carriers. Histologically normal MMR-deficient crypts were found directly adjacent to dysplastic adenoma tissue, proving their role as tumor precursors in Lynch syndrome. Accordingly, mutation signature analysis in Lynch colorectal cancers revealed that KRAS and APC mutations commonly occur after the onset of MMR deficiency. Tumors lacking evidence of polypous growth frequently presented with CTNNB1 and TP53 mutations. Our findings demonstrate that Lynch syndrome colorectal cancers can develop through three pathways, with MMR deficiency commonly representing an early and possibly initiating event. This underlines that targeting MMR-deficient cells by chemoprevention or vaccines against MMR deficiency-induced frameshift peptide neoantigens holds promise for tumor prevention in Lynch syndrome. © 2018 UICC.

Sequence analysis of the drug‑resistant rpoB gene in the Mycobacterium tuberculosis L‑form among patients with pneumoconiosis complicated by tuberculosis.

PubMed

Lu, Jun; Jiang, Shan; Ye, Song; Deng, Yun; Ma, Shuai; Li, Chao-Pin

2014-04-01

The aim of the present study was to investigate the mutational characteristics of the drug‑resistant Mycobacterium tuberculosis L‑form of the rpoB gene isolated from patients with pneumoconiosis complicated by tuberculosis, in order to reduce the occurrence of the drug resistance of patients and gain a more complete information on the resistance of the Mycobacterium tuberculosis L‑form. A total of 42 clinically isolated strains of Mycobacterium tuberculosis L‑form were collected, including 31 drug‑resistant strains. The genomic DNA was extracted, then the target genes were amplified by polymerase chain reaction and the hot mutational regions of the rpoB gene were analyzed by direct sequencing. The results revealed that no rpoB gene mutation was present in 11 rifampicin (RFP)‑sensitive strains, while conformational changes were identified in 31 RFP‑resistant strains. The mutation rate was 93.55% (29/31) in the resistant strains, and was frequently concentrated in codons 531 (51.61%; 16/31) and 526 (32.26%; 10/31), mainly occurring by case substitutions, including 27 unit point mutations and two two‑point mutations. The novel mutation identified in codon 516 had not been previously reported. The substitution of highly‑conserved amino acids encoded by the rpoB gene resulted in the molecular mechanism responsible for RFP resistance in the Mycobacterium tuberculosis L‑form. This also demonstrated that the rpoB gene is diversiform.

Sarcomeric hypertrophic cardiomyopathy: genetic profile in a Portuguese population.

PubMed

Brito, Dulce; Miltenberger-Miltenyi, Gabriel; Vale Pereira, Sónia; Silva, Doroteia; Diogo, António Nunes; Madeira, Hugo

2012-09-01

Sarcomeric hypertrophic cardiomyopathy has heterogeneous phenotypic expressions, of which sudden cardiac death is the most feared. A genetic diagnosis is essential to identify subjects at risk in each family. The spectrum of disease-causing mutations in the Portuguese population is unknown. Seventy-seven unrelated probands with hypertrophic cardiomyopathy were systematically screened for mutations by PCR and sequencing of five sarcomeric genes: MYBPC3, MYH7, TNNT2, TNNI3 and MYL2. Familial cosegregation analysis was performed in most patients. Thirty-four different mutations were identified in 41 (53%) index patients, 71% with familial hypertrophic cardiomyopathy. The most frequently involved gene was MYBPC3 (66%) with 22 different mutations (8 novel) in 27 patients, followed by MYH7 (22%), TNNT2 (12%) and TNNI3 (2.6%). In three patients (7%), two mutations were found in MYBPC3 and/or MYH7. Additionally, 276 relatives were screened, leading to the identification of a mean of three other affected relatives for each pedigree with the familial form of the disease. Disease-associated mutations were identified mostly in familial hypertrophic cardiomyopathy, corroborating the idea that rarely studied genes may be implicated in sporadic forms. Private mutations are the rule, MYBPC3 being the most commonly involved gene. Mutations in MYBPC3 and MYH7 accounted for most cases of sarcomere-related disease. Multiple mutations in these genes may occur, which highlights the importance of screening both. The detection of novel mutations strongly suggests that all coding regions should be systematically screened. Genotyping in hypertrophic cardiomyopathy enables a more precise diagnosis of the disease, with implications for risk stratification and genetic counseling. Copyright © 2011 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

Advances in Molecular Pathology and Treatment of Periampullary Cancers.

PubMed

Chandrasegaram, Manju D; Chen, John W; Price, Timothy J; Zalcberg, John; Sjoquist, Katrin; Merrett, Neil D

2016-01-01

Periampullary cancers (PACs) include the following 4 traditional anatomic subtypes: pancreatic, ampullary, biliary, or duodenal cancers. This review was performed to highlight recent advances in the genomic and molecular understanding of each PAC subtype and the advances in chemotherapeutic and molecular trials in these cancer subtypes. Recent advances have highlighted differences in the genomic and molecular features within each PAC subtype. Ampullary cancers can now be further defined accurately into their intestinal and pancreatobiliary subtypes using histomolecular profiling. K-ras mutation, which occurs in most pancreatic cancers, is found to occur less frequently in ampullary (42%-52%), biliary (22%-23%), and duodenal cancers (32%-35%), suggesting crucial differences in targetable mutations in these cancer subtypes.Ampullary cancers of intestinal subtype and duodenal cancers seem to share similarities with colorectal cancer, given that they respond to similar chemotherapeutic regimens. This has potential implications for clinical trials and treatment selection, where PACs are often considered together. Future trials should be designed in view of our increased understanding of the different anatomic and histomolecularly profiled subtypes of PAC cancers, which respects their individual molecular characteristics, phenotype, and response to treatment.

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia.

PubMed

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

2003-11-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure. These results are consistent with the possibility of an incidental acquisition and transmission of P. jiroveci mutant types, either by person to person transmission or from an environmental source.

Molecular features of colorectal hyperplastic polyps and sessile serrated adenoma/polyps from Korea.

PubMed

Kim, Kyoung-Mee; Lee, Eui Jin; Ha, Sangyun; Kang, So Young; Jang, Kee-Taek; Park, Cheol Keun; Kim, Jin Yong; Kim, Young Ho; Chang, Dong Kyung; Odze, Robert Daniel

2011-09-01

Abundant recent data suggest that sessile serrated adenoma/polyp (SSA/P) is an early precursor lesion in the serrated pathway of carcinogenesis. It is believed that SSA/Ps develop cancer by an SSA/P-dysplasia-carcinoma sequence. Hyperplastic polyps (HPs) share some histologic and molecular characteristics with SSA/P, but it is unclear whether SSA/Ps are derived from HPs or whether they develop by a different pathogenetic pathway. Previous studies have shown that serrated polyps from Korean patients show different prevalence rates of certain molecular abnormalities compared with similar lesions from American patients, and this suggests that lifestyle and dietary factors may influence the serrated neoplasia pathway. The purpose of this study was to evaluate the molecular features of HPs and SSA/Ps, the latter both with and without dysplasia, from Korean patients and to compare the findings with similar lesions from American patients. One hundred and eleven serrated polyps, consisting of 45 HPs (30 microvesicular, 11 goblet cell, 4 mucin depleted) and 56 SSA/Ps (36 with dysplasia, 20 without dysplasia), were retrieved from the pathology files of a large medical center in Korea and 38 SSA/P from American patients were evaluated for BRAF and KRAS mutations, microsatellite instability, and hypermethylation of O6-methylguanine-DNA methyltransferase (MGMT), hMLH1, adenomatous polyposis coli (APC), p16, methylated in tumor-1 (MINT-1), MINT2, and MINT31. Methylation of hMLH1 was performed using 2 different sets of primers. Twenty-three conventional adenomas from Korean patients were included as controls. The data were compared between polyp subtypes and between polyps in the right versus the left colon. With regard to HP, KRAS mutations were present in 31.1% of polyps and BRAF mutations in 46.7% of polyps. KRAS mutations were significantly more common in goblet cell HP and BRAF in microvesicular HP (MVHP). Methylation of MGMT, hMLH1, APC, p16, MINT1, MINT2, and MINT31 were present in 42.2%, 64.4% (and 24.4%), 37.8%, 60%, 68.9%, 51.1%, and 60% of HPs. CpG island methylator phenotype high was noted in 60% of HPs. Methylation of hMLH1, p16, MINT2, and MINT31 were more frequent in MVHPs compared with other types of HPs. In contrast, SSA/Ps showed KRAS and BRAF mutations in 12.5% and 60.7% of cases, respectively. Methylation of all tumor-related genes, except hMLH1 (23.2% using 1 type of primers) and APC (37.5%), occurred in >50% of lesions, and CpG island methylator phenotype (CIMP) high was noted in 76.8% of cases. None of the molecular findings were significantly more common in SSA/P with, versus those without, dysplasia, but only 2 of the 36 polyps with dysplasia were of the conventional adenomatous type; the remainder (34 of 36) was of the serrated type. Nevertheless, both SSA/P with conventional adenomatous dysplasia showed methylation of MGMT, APC, MINT1, and MINT31 and were CIMP high. BRAF mutations, methylation of most tumor related genes, and CIMP high occurred more frequently in HPs and SSA/Ps in the right colon, compared with the left colon. In fact, no significant differences were observed between HPs and SSPs of the right colon and HPs and SSA/Ps from the left colon. Furthermore, compared with American patients, Korean male individuals were affected more frequently than female individuals, and both BRAF mutations and hMLH1 methylation were less frequent in the latter compared with the former. We conclude that HPs and SSA/Ps in Korean patients share some, but not all, clinical and molecular characteristics to those that occur in Americans. The data support the theory that the right and left colon are biologically different with regard to susceptibility to serrated cancer, and that anatomic location (right vs. left) may be a more significant risk factor of progression than the histologic type of polyp. Our data also support the theory that right-sided MVHPs may be a precursor to SSA/P.

Targeting STATs for cancer therapy: "Undruggable" no more.

PubMed

Frank, David A

2012-10-01

We are in the midst of an exciting transition in the treatment of cancers, from the empirically developed non-specifically cytotoxic drugs to the era of rationally derived molecularly targeted therapies. Over the past 15 years, our understanding of the mutations that drive cancer pathogenesis has grown enormously, which has rapidly led to the development of drugs to target the associated gene products. Almost all of this focus has been on kinases, largely tyrosine kinases that are activated by translocations, point mutations, insertions and deletions. Although this approach will continue to bear fruit for some time, there is increasing evidence that the returns will be diminishing. First, dominant activating mutations in kinases are less frequent then initially expected particularly in common human cancers, and thus the number of patient whose tumors have suitable targets may be limited. The second cause for concern is the rapid development of resistance that often occurs, arising either from mutations in the target kinase or activation of a parallel pathway. Thus, the desire to target a common convergence point of multiple pathways that directly contributes to the oncogenic phenotype is highly desirable. This goal has led to consideration of transcription factors as therapeutic targets.

Genetics and epigenetics of liver cancer.

PubMed

Ozen, Cigdem; Yildiz, Gokhan; Dagcan, Alper Tunga; Cevik, Dilek; Ors, Aysegul; Keles, Umur; Topel, Hande; Ozturk, Mehmet

2013-05-25

Hepatocellular carcinoma (HCC) represents a major form of primary liver cancer in adults. Chronic infections with hepatitis B (HBV) and C (HCV) viruses and alcohol abuse are the major factors leading to HCC. This deadly cancer affects more than 500,000 people worldwide and it is quite resistant to conventional chemo- and radiotherapy. Genetic and epigenetic studies on HCC may help to understand better its mechanisms and provide new tools for early diagnosis and therapy. Recent literature on whole genome analysis of HCC indicated a high number of mutated genes in addition to well-known genes such as TP53, CTNNB1, AXIN1 and CDKN2A, but their frequencies are much lower. Apart from CTNNB1 mutations, most of the other mutations appear to result in loss-of-function. Thus, HCC-associated mutations cannot be easily targeted for therapy. Epigenetic aberrations that appear to occur quite frequently may serve as new targets. Global DNA hypomethylation, promoter methylation, aberrant expression of non-coding RNAs and dysregulated expression of other epigenetic regulatory genes such as EZH2 are the best-known epigenetic abnormalities. Future research in this direction may help to identify novel biomarkers and therapeutic targets for HCC. Copyright © 2013 Elsevier B.V. All rights reserved.

Erythro-megakaryocytic transcription factors associated with hereditary anemia

PubMed Central

Weiss, Mitchell J.

2014-01-01

Most heritable anemias are caused by mutations in genes encoding globins, red blood cell (RBC) membrane proteins, or enzymes in the glycolytic and hexose monophosphate shunt pathways. A less common class of genetic anemia is caused by mutations that alter the functions of erythroid transcription factors (TFs). Many TF mutations associated with heritable anemia cause truncations or amino acid substitutions, resulting in the production of functionally altered proteins. Characterization of these mutant proteins has provided insights into mechanisms of gene expression, hematopoietic development, and human disease. Mutations within promoter or enhancer regions that disrupt TF binding to essential erythroid genes also cause anemia and heritable variations in RBC traits, such as fetal hemoglobin content. Defining the latter may have important clinical implications for de-repressing fetal hemoglobin synthesis to treat sickle cell anemia and β thalassemia. Functionally important alterations in genes encoding TFs or their cognate cis elements are likely to occur more frequently than currently appreciated, a hypothesis that will soon be tested through ongoing genome-wide association studies and the rapidly expanding use of global genome sequencing for human diagnostics. Findings obtained through such studies of RBCs and associated diseases are likely generalizable to many human diseases and quantitative traits. PMID:24652993

Genetic forms of neurohypophyseal diabetes insipidus.

PubMed

Rutishauser, Jonas; Spiess, Martin; Kopp, Peter

2016-03-01

Neurohypophyseal diabetes insipidus is characterized by polyuria and polydipsia owing to partial or complete deficiency of the antidiuretic hormone, arginine vasopressin (AVP). Although in most patients non-hereditary causes underlie the disorder, genetic forms have long been recognized and studied both in vivo and in vitro. In most affected families, the disease is transmitted in an autosomal dominant manner, whereas autosomal recessive forms are much less frequent. Both phenotypes can be caused by mutations in the vasopressin-neurophysin II (AVP) gene. In transfected cells expressing dominant mutations, the mutated hormone precursor is retained in the endoplasmic reticulum, where it forms fibrillar aggregates. Autopsy studies in humans and a murine knock-in model suggest that the dominant phenotype results from toxicity to vasopressinergic neurons, but the mechanisms leading to cell death remain unclear. Recessive transmission results from AVP with reduced biologic activity or the deletion of the locus. Genetic neurohypophyseal diabetes insipidus occurring in the context of diabetes mellitus, optic atrophy, and deafness is termed DIDMOAD or Wolfram syndrome, a genetically and phenotypically heterogeneous autosomal recessive disorder caused by mutations in the wolframin (WFS 1) gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

Poly ADP-ribose polymerase-1 as a potential therapeutic target in Merkel cell carcinoma.

PubMed

Ferrarotto, Renata; Cardnell, Robert; Su, Shirley; Diao, Lixia; Eterovic, A Karina; Prieto, Victor; Morrisson, William H; Wang, Jing; Kies, Merrill S; Glisson, Bonnie S; Byers, Lauren Averett; Bell, Diana

2018-03-23

Patients with metastatic Merkel cell carcinoma are treated similarly to small cell lung cancer (SCLC). Poly ADP-ribose polymerase-1 (PARP1) is overexpressed in SCLC and response to PARP inhibitors have been reported in patients with SCLC. Our study explores PARP as a therapeutic target in Merkel cell carcinoma. We evaluated PARP1 expression and Merkel cell polyomavirus (MCPyV) in 19 patients with Merkel cell carcinoma. Target exome-sequencing was performed in 14 samples. Sensitivity to olaparib was tested in 4 Merkel cell carcinoma cell lines. Most Merkel cell carcinomas (74%) express PARP1 at high levels. Mutations in DNA-damage repair genes were identified in 9 samples (64%), occurred exclusively in head neck primaries, and correlated with TP53/RB1 mutations. The TP53/RB1 mutations were more frequent in MCPyV-negative tumors. Sensitivity to olaparib was seen in the Merkel cell carcinoma line with highest PARP1 expression. Based on PARP1 overexpression, DNA-damage repair gene mutations, platinum sensitivity, and activity of olaparib in a Merkel cell carcinoma line, clinical trials with PARP inhibitors are warranted in Merkel cell carcinoma. © 2018 Wiley Periodicals, Inc.

Application of a multi-channel microfluidic chip on the simultaneous detection of DNAs by using microbead-quantum dots.

PubMed

Le, Ngoc Tam; Kim, Jong Sung

2014-12-01

Several researches have shown that cancer is caused by genetic mutations especially in genes involved in cell growth and regulation. Ras family members are frequently found in their mutated, oncogenic forms in human tumors. Mutant RAS proteins are constitutively active, owing to reduce intrinsic GTPase activity and insensitivity to GTPase-activating protein (GAPs). In total, activating mutations in the RAS genes occur in approximately 20% of all human cancers, mainly in codon 12, 13 or 61. Activating mutations in the NRAS gene not only result in the reduction of intrinsic GTPase activity but also in the induction of resistance against molecules inducing such activity. In this paper, we reported a rapid, simple and portable method for detecting the mutant types of NRAS genes codon 12 and 61 simultaneously by using bead-quantum dots (QDs) based multi-channel microfluidic chip. Probe DNAs are conjugated to bead-QDs and packed in the pillars of channels in the microfluidic chip. After injection of target DNAs and intercalating dyes, the fluorescence quenching of QDs by intercalating dye was observed due to FRET phenomena. The platform can be effortlessly applied in other biological and clinical areas.

Disruption of PH–kinase domain interactions leads to oncogenic activation of AKT in human cancers

PubMed Central

Parikh, Chaitali; Janakiraman, Vasantharajan; Wu, Wen-I; Foo, Catherine K.; Kljavin, Noelyn M.; Chaudhuri, Subhra; Stawiski, Eric; Lee, Brian; Lin, Jie; Li, Hong; Lorenzo, Maria N.; Yuan, Wenlin; Guillory, Joseph; Jackson, Marlena; Rondon, Jesus; Franke, Yvonne; Bowman, Krista K.; Sagolla, Meredith; Stinson, Jeremy; Wu, Thomas D.; Wu, Jiansheng; Stokoe, David; Stern, Howard M.; Brandhuber, Barbara J.; Lin, Kui; Skelton, Nicholas J.; Seshagiri, Somasekar

2012-01-01

The protein kinase v-akt murine thymoma viral oncogene homolog (AKT), a key regulator of cell survival and proliferation, is frequently hyperactivated in human cancers. Intramolecular pleckstrin homology (PH) domain–kinase domain (KD) interactions are important in maintaining AKT in an inactive state. AKT activation proceeds after a conformational change that dislodges the PH from the KD. To understand these autoinhibitory interactions, we generated mutations at the PH–KD interface and found that most of them lead to constitutive activation of AKT. Such mutations are likely another mechanism by which activation may occur in human cancers and other diseases. In support of this likelihood, we found somatic mutations in AKT1 at the PH–KD interface that have not been previously described in human cancers. Furthermore, we show that the AKT1 somatic mutants are constitutively active, leading to oncogenic signaling. Additionally, our studies show that the AKT1 mutants are not effectively inhibited by allosteric AKT inhibitors, consistent with the requirement for an intact PH–KD interface for allosteric inhibition. These results have important implications for therapeutic intervention in patients with AKT mutations at the PH–KD interface. PMID:23134728

Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces.

PubMed

Engin, H Billur; Kreisberg, Jason F; Carter, Hannah

2016-01-01

Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10(-4)) and oncogenes (Odds Ratio 1.17, P-value < 10(-3)). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10(-8)). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer genes that encode proteins participating in interactions that are perturbed recurrently across tumors. In summary, mutation of specific protein interactions is an important contributor to tumor heterogeneity and may have important implications for clinical outcomes.

The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T).

PubMed

Gumus, Evren

2018-05-07

Familial Mediterranean Fever (FMF) is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV) gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January⁻December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T) mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP), do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS) analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

Variables that influence BRAF mutation probability: A next-generation sequencing, non-interventional investigation of BRAFV600 mutation status in melanoma.

PubMed

Gaiser, Maria Rita; Skorokhod, Alexander; Gransheier, Diana; Weide, Benjamin; Koch, Winfried; Schif, Birgit; Enk, Alexander; Garbe, Claus; Bauer, Jürgen

2017-01-01

The incidence of melanoma, particularly in older patients, has steadily increased over the past few decades. Activating mutations of BRAF, the majority occurring in BRAFV600, are frequently detected in melanoma; however, the prognostic significance remains unclear. This study aimed to define the probability and distribution of BRAFV600 mutations, and the clinico-pathological factors that may affect BRAF mutation status, in patients with advanced melanoma using next-generation sequencing. This was a non-interventional, retrospective study of BRAF mutation testing at two German centers, in Heidelberg and Tübingen. Archival tumor samples from patients with histologically confirmed melanoma (stage IIIB, IIIC, IV) were analyzed using PCR amplification and deep sequencing. Clinical, histological, and mutation data were collected. The statistical influence of patient- and tumor-related characteristics on BRAFV600 mutation status was assessed using multiple logistic regression (MLR) and a prediction profiler. BRAFV600 mutation status was assessed in 453 samples. Mutations were detected in 57.6% of patients (n = 261), with 48.1% (n = 102) at the Heidelberg site and 66.0% (n = 159) at the Tübingen site. The decreasing influence of increasing age on mutation probability was quantified. A main effects MLR model identified age (p = 0.0001), center (p = 0.0004), and melanoma subtype (p = 0.014) as significantly influencing BRAFV600 mutation probability; ultraviolet (UV) exposure showed a statistical trend (p = 0.1419). An interaction model of age versus other variables showed that center (p<0.0001) and melanoma subtype (p = 0.0038) significantly influenced BRAF mutation probability; age had a statistically significant effect only as part of an interaction with both UV exposure (p = 0.0110) and melanoma subtype (p = 0.0134). This exploratory study highlights that testing center, melanoma subtype, and age in combination with UV exposure and melanoma subtype significantly influence BRAFV600 mutation probability in patients with melanoma. Further validation of this model, in terms of reproducibility and broader relevance, is required.

A Genetic Survey of Pyrethroid Insecticide Resistance in Aphids in New Brunswick, Canada, with Particular Emphasis on Aphids as Vectors of Potato virus Y.

PubMed

MacKenzie, Tyler D B; Arju, Irin; Poirier, René; Singh, Mathuresh

2018-05-28

Aphids are viral vectors in potatoes, most importantly of Potato virus Y (PVY), and insecticides are frequently used to reduce viral spread during the crop season. Aphids collected from the potato belt of New Brunswick, Canada, in 2015 and 2016 were surveyed for known and novel mutations in the Na-channel (para) gene, coding for the target of synthetic pyrethroid insecticides. Specific genetic mutations known to confer resistance (kdr and skdr) were found in great abundance in Myzus persicae (Sulzer) (Hemiptera: Aphididae), which rose from 76% in 2015 to 96% in 2016. Aphids other than M. persicae showed lower frequency of resistance. In 2015, 3% of individuals contained the resistance mutation skdr, rising to 13% in 2016 (of 45 species). Several novel resistance mutations or mutations not before reported in aphids were identified in this gene target. One of these mutations, I936V, is known to confer pyrethroid resistance in another unrelated insect, and three others occur immediately adjacent and prompt similar chemical shifts in the primary protein structure, to previously characterized mutations associated with pyrethroid resistance. Most novel mutations were found in species other than M. persicae or others currently tracked individually by the provincial aphid monitoring program, which were determined by cytochrome C oxidase I (cox1) sequencing. Through our cox1 DNA barcoding survey, at least 45 species of aphids were discovered in NB potato fields in 2015 and 2016, many of which are known carriers of PVY.

A founder BRCA2 mutation in non-Afrikaner breast cancer patients of the Western Cape of South Africa.

PubMed

van der Merwe, N C; Hamel, N; Schneider, S-R; Apffelstaedt, J P; Wijnen, J T; Foulkes, W D

2012-02-01

Founder mutations in BRCA1 and BRCA2 have been reported in many different populations. We studied 105 Coloured and 16 Black Xhosa women residing in the Western Cape of South Africa diagnosed with breast cancer. We screened these patients using our standard panel of six previously reported SA Afrikaner and Ashkenazi Jewish BRCA1/2 mutations and identified only two Afrikaner mutations. Further screening by the protein truncation test (BRCA1 exon 11, and BRCA2 exons 10 and 11) revealed an additional four deleterious mutations (BRCA1 c.1504_ 1508del,p.Leu502AlafsX2, BRCA2 c.2826_2829del,p.Ile943LysfsX16, c.6447_6448dup,p.Lys2150IlefsX19 and c.5771_5774del,p.Ile1924Argfs X38). The latter, also known in Breast Cancer Information Core nomenclature as 5999del4, was identified in 4 of 105 (3.8%) Coloureds and 4 of 16 (25%) Xhosa women, which makes it a frequent founder mutation in the Western Cape Province. Although this mutation was previously reported to occur in the Netherlands, haplotype analysis indicated two distinct origins for the Dutch and South African mutations, excluding the possibility of a common Dutch ancestor and suggesting gene flow from the indigenous tribes such as the Xhosa to the Coloured population instead. Further studies to determine the carrier rate of this variant in the Xhosa and other SA populations are warranted. © 2011 John Wiley & Sons A/S.

Mutations in PIK3CA are infrequent in neuroblastoma

PubMed Central

Dam, Vincent; Morgan, Brian T; Mazanek, Pavel; Hogarty, Michael D

2006-01-01

Background Neuroblastoma is a frequently lethal pediatric cancer in which MYCN genomic amplification is highly correlated with aggressive disease. Deregulated MYC genes require co-operative lesions to foster tumourigenesis and both direct and indirect evidence support activated Ras signaling for this purpose in many cancers. Yet Ras genes and Braf, while often activated in cancer cells, are infrequent targets for activation in neuroblastoma. Recently, the Ras effector PIK3CA was shown to be activated in diverse human cancers. We therefore assessed PIK3CA for mutation in human neuroblastomas, as well as in neuroblastomas arising in transgenic mice with MYCN overexpressed in neural-crest tissues. In this murine model we additionally surveyed for Ras family and Braf mutations as these have not been previously reported. Methods Sixty-nine human neuroblastomas (42 primary tumors and 27 cell lines) were sequenced for PIK3CA activating mutations within the C2, helical and kinase domain "hot spots" where 80% of mutations cluster. Constitutional DNA was sequenced in cases with confirmed alterations to assess for germline or somatic acquisition. Additionally, Ras family members (Hras1, Kras2 and Nras) and the downstream effectors Pik3ca and Braf, were sequenced from twenty-five neuroblastomas arising in neuroblastoma-prone transgenic mice. Results We identified mutations in the PIK3CA gene in 2 of 69 human neuroblastomas (2.9%). Neither mutation (R524M and E982D) has been studied to date for effects on lipid kinase activity. Though both occurred in tumors with MYCN amplification the overall rate of PIK3CA mutations in MYCN amplified and single-copy tumors did not differ appreciably (2 of 31 versus 0 of 38, respectively). Further, no activating mutations were identified in a survey of Ras signal transduction genes (including Hras1, Kras2, Nras, Pik3ca, or Braf genes) in twenty-five neuroblastic tumors arising in the MYCN-initiated transgenic mouse model. Conclusion These data suggest that activating mutations in the Ras/Raf-MAPK/PI3K signaling cascades occur infrequently in neuroblastoma. Further, despite compelling evidence for MYC and RAS cooperation in vitro and in vivo to promote tumourigenesis, activation of RAS signal transduction does not constitute a preferred secondary pathway in neuroblastomas with MYCN deregulation in either human tumors or murine models. PMID:16822308

Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma.

PubMed

Zou, Yang; Liu, Fa-Ying; Liu, Huai; Wang, Feng; Li, Wei; Huang, Mei-Zhen; Huang, Yan; Yuan, Xiao-Qun; Xu, Xiao-Yun; Huang, Ou-Ping; He, Ming

2014-03-01

The catalytic subunit of DNA polymerase epsilon (POLE1) functions primarily in nuclear DNA replication and repair. Recently, POLE1 mutations were detected frequently in colorectal and endometrial carcinomas while with lower frequency in several other types of cancer, and the p.P286R and p.V411L mutations were the potential mutation hotspots in human cancers. Nevertheless, the mutation frequency of POLE1 in ovarian cancer still remains largely unknown. Here, we screened a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma for the presence of POLE1 hotspot mutations by direct sequencing. A heterozygous somatic POLE1 mutation, p.S297F (c.890C>T), but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was identified in 3 out of 37 (8.1%) patients with ovarian endometrioid carcinoma; this mutation was evolutionarily highly conserved from Homo sapiens to Schizosaccharomyces. Of note, the POLE1 mutation coexisted with mutation in the ovarian cancer-associated PPP2R1A (protein phosphatase 2, regulatory subunit A, α) gene in a 46-year-old patient, who was also diagnosed with ectopic endometriosis in the benign ovary. In addition, a 45-year-old POLE1-mutated ovarian endometrioid carcinoma patient was also diagnosed with uterine leiomyoma while the remaining 52-year-old POLE1-mutated patient showed no additional distinctive clinical manifestation. In contrast to high frequency of POLE1 mutations in ovarian endometrioid carcinoma, no POLE1 mutations were identified in patients with other subtypes of ovarian carcinoma. Our results showed for the first time that the POLE1 p.S297F mutation, but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was frequent in Chinese ovarian endometrioid carcinoma, but absent in other subtypes of ovarian carcinoma. These results implicated that POLE1 p.S297F mutation might be actively involved in the pathogenesis of ovarian endometrioid carcinoma, but might not be actively involved in other subtypes of ovarian carcinoma. Copyright © 2014 Elsevier B.V. All rights reserved.

Natural History of Aging in Cornelia de Lange Syndrome

PubMed Central

KLINE, ANTONIE D.; GRADOS, MARCO; SPONSELLER, PAUL; LEVY, HOWARD P.; BLAGOWIDOW, NATALIE; SCHOEDEL, CHRISTIANNE; RAMPOLLA, JONI; CLEMENS, DOUGLAS K.; KRANTZ, IAN; KIMBALL, AMY; PICHARD, CARMEN; TUCHMAN, DAVID

2016-01-01

Observations about the natural history of aging in Cornelia de Lange syndrome (CdLS) are made, based on 49 patients from a multidisciplinary clinic for adolescents and adults. The mean age was 17 years. Although most patients remain small, obesity may develop. Gastroesophageal reflux persists or worsens, and there are early long-term sequelae, including Barrett esophagus in 10%; other gastrointestinal findings include risk for volvulus, rumination, and chronic constipation. Submucous cleft palate was found in 14%, most undetected before our evaluation. Chronic sinusitis was noted in 39%, often with nasal polyps. Blepharitis improves with age; cataracts and detached retina may occur. Decreased bone density is observed, with occasional fractures. One quarter have leg length discrepancy and 39% scoliosis. Most females have delayed or irregular menses but normal gynecologic exams and pap smears. Benign prostatic hypertrophy occurred in one male prior to 40 years. The phenotype is variable, but there is a distinct pattern of facial changes with aging. Premature gray hair is frequent; two patients had cutis verticis gyrata. Behavioral issues and specific psychiatric diagnoses, including self-injury, anxiety, attention-deficit disorder, autistic features, depression, and obsessive-compulsive behavior, often worsen with age. This work presents some evidence for accelerated aging in CdLS. Of 53% with mutation analysis, 55% demonstrate a detectable mutation in NIPBL or SMC1A. Although no specific genotype–phenotype correlations have been firmly established, individuals with missense mutations in NIPBL and SMC1A appear milder than those with other mutations. Based on these observations, recommendations for clinical management of adults with CdLS are made. PMID:17640042

Persistent induction of somatic reversions of the pink-eyed unstable mutation in F1 mice born to fathers irradiated at the spermatozoa stage.

PubMed

Shiraishi, Kazunori; Shimura, Tsutomu; Taga, Masataka; Uematsu, Norio; Gondo, Yoichi; Ohtaki, Megu; Kominami, Ryo; Niwa, Ohtsura

2002-06-01

Untargeted mutation and delayed mutation are features of radiation-induced genomic instability and have been studied extensively in tissue culture cells. The mouse pink-eyed unstable (p(un)) mutation is due to an intragenic duplication of the pink-eyed dilution locus and frequently reverts back to the wild type in germ cells as well as in somatic cells. The reversion event can be detected in the retinal pigment epithelium as a cluster of pigmented cells (eye spot). We have investigated the reversion p(um) in F1 mice born to irradiated males. Spermatogonia-stage irradiation did not affect the frequency of the reversion in F1 mice. However, 6 Gy irradiation at the spermatozoa stage resulted in an approximately twofold increase in the number of eye spots in the retinal pigment epithelium of F1 mice. Somatic reversion occurred for the paternally derived p(un) alleles. In addition, the reversion also occurred for the maternally derived, unirradiated p(un) alleles at a frequency equal to that for the paternally derived allele. Detailed analyses of the number of pigmented cells per eye spot indicated that the frequency of reversion was persistently elevated during the proliferation cycle of the cells in the retinal pigment epithelium when the male parents were irradiated at the spermatozoa stage. The present study demonstrates the presence of a long-lasting memory of DNA damage and the persistent up-regulation of recombinogenic activity in the retinal pigment epithelium of the developing fetus.

Mucopolysaccharidosis IVA: Identification of a common missense mutation I113F in the N-Acetylgalactosamine-6-sulfate sulfatase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomatsu, Shunji; Fukuda, Seiji; Rezvi, Maruf

1995-09-01

Mucopolysaccharidosis IVA is an autosomal recessive lysosomal storage disorder caused by a deficiency of N-acetylgalactosamine-6-sulfate sulfatase (GALNS). The recent isolation and characterization of cDNA and genomic sequences encoding GALNS has facilitated identification of the molecular lesions that cause MPS IVA. We identified a common missense mutation among Caucasian MPS IVA patients. The mutation was originally detected by SSCP, and successive sequencing revealed an A{yields}T transversion at nt 393. This substitution altered the isoleucine at position 113 to phenylalanine (I113F) in the 622 amino acid GALNS protein and was associated with a severe phenotype in a homozygote. Compound heterogzygotes with onemore » I113F-allele mutation have a wide range of clinical phenotypes. Transfection experiments in GALNS-deficient fibroblasts revealed that the mutation drastically reduces the enzyme activity of GALNS. Allele-specific oligonucleotide or SSCP analysis indicated that this mutation accounted for 22.5% (9/40) of unrelated MPS IVA chromosomes from 23 Caucasian patients, including 6 consanguineous cases. Of interest, the I1e 113{yields}Phe substitution occurred in only Caucasian MPS IVA patients and in none of the GALNS alleles of 20 Japanese patients. These findings identify a frequent missense mutation among MPS IVA patients of Caucasian ancestry that results in severe MPS IVA when homoallelic, and will facilitate molecular diagnosis of most such patients and identification of heterozygous carriers. In addition to this common mutation, 10 different point mutations and 2 small deletions were detected, suggesting allelic heterogeneity in GALNS gene. 32 refs., 2 figs., 3 tabs.« less

Mutations in FUS are the most frequent genetic cause in juvenile sporadic ALS patients of Chinese origin.

PubMed

Zou, Zhang-Yu; Liu, Ming-Sheng; Li, Xiao-Guang; Cui, Li-Ying

2016-01-01

Juvenile onset ALS is a very rare form of motor neuron disease, with the first symptoms of motor neuron degeneration manifested before 25 years of age. Mutations in the alsin (ALS2), senataxin (SETX), and spatacsin (SPG11) genes have been associated with familial ALS with juvenile onset and slow progression, whereas the genetic architecture of sporadic juvenile ALS remains unclear. We screened mutations in C9orf72, SOD1, FUS, TARDBP, ANG, VCP and PFN1 in 16 juvenile sporadic ALS patients. Four cases (25%) carrying FUS mutations and one individual (6%) harbouring a SOD1 mutation were identified. All cases had an aggressive disease course. Our results suggest that FUS mutations are the most frequent genetic cause in early-onset sporadic ALS patients of Chinese origin. Genetic testing of FUS should be performed in early-onset ALS patients especially those with an aggressive disease course.

Detecting recurrent gene mutation in interaction network context using multi-scale graph diffusion.

PubMed

Babaei, Sepideh; Hulsman, Marc; Reinders, Marcel; de Ridder, Jeroen

2013-01-23

Delineating the molecular drivers of cancer, i.e. determining cancer genes and the pathways which they deregulate, is an important challenge in cancer research. In this study, we aim to identify pathways of frequently mutated genes by exploiting their network neighborhood encoded in the protein-protein interaction network. To this end, we introduce a multi-scale diffusion kernel and apply it to a large collection of murine retroviral insertional mutagenesis data. The diffusion strength plays the role of scale parameter, determining the size of the network neighborhood that is taken into account. As a result, in addition to detecting genes with frequent mutations in their genomic vicinity, we find genes that harbor frequent mutations in their interaction network context. We identify densely connected components of known and putatively novel cancer genes and demonstrate that they are strongly enriched for cancer related pathways across the diffusion scales. Moreover, the mutations in the clusters exhibit a significant pattern of mutual exclusion, supporting the conjecture that such genes are functionally linked. Using multi-scale diffusion kernel, various infrequently mutated genes are found to harbor significant numbers of mutations in their interaction network neighborhood. Many of them are well-known cancer genes. The results demonstrate the importance of defining recurrent mutations while taking into account the interaction network context. Importantly, the putative cancer genes and networks detected in this study are found to be significant at different diffusion scales, confirming the necessity of a multi-scale analysis.

Electroclinical presentation and genotype-phenotype relationships in patients with Unverricht-Lundborg disease carrying compound heterozygous CSTB point and indel mutations.

PubMed

Canafoglia, Laura; Gennaro, Elena; Capovilla, Giuseppe; Gobbi, Giuseppe; Boni, Antonella; Beccaria, Francesca; Viri, Maurizio; Michelucci, Roberto; Agazzi, Pamela; Assereto, Stefania; Coviello, Domenico A; Di Stefano, Maria; Rossi Sebastiano, Davide; Franceschetti, Silvana; Zara, Federico

2012-12-01

Unverricht-Lundborg disease (EPM1A) is frequently due to an unstable expansion of a dodecamer repeat in the CSTB gene, whereas other types of mutations are rare. EPM1A due to homozygous expansion has a rather stereotyped presentation with prominent action myoclonus. We describe eight patients with five different compound heterozygous CSTB point or indel mutations in order to highlight their particular phenotypical presentations and evaluate their genotype-phenotype relationships. We screened CSTB mutations by means of Southern blotting and the sequencing of the genomic DNA of each proband. CSTB messenger RNA (mRNA) aberrations were characterized by sequencing the complementary DNA (cDNA) of lymphoblastoid cells, and assessing the protein concentrations in the lymphoblasts. The patient evaluations included the use of a simplified myoclonus severity rating scale, multiple neurophysiologic tests, and electroencephalography (EEG)-polygraphic recordings. To highlight the particular clinical features and disease time-course in compound heterozygous patients, we compared some of their characteristics with those observed in a series of 40 patients carrying the common homozygous expansion mutation observed at the C. Besta Foundation, Milan, Italy. The eight compound heterozygous patients belong to six EPM1A families (out of 52; 11.5%) diagnosed at the Laboratory of Genetics of the Galliera Hospitals in Genoa, Italy. They segregated five different heterozygous point or indel mutations in association with the common dodecamer expansion. Four patients from three families had previously reported CSTB mutations (c.67-1G>C and c.168+1_18del); one had a novel nonsense mutation at the first exon (c.133C>T) leading to a premature stop codon predicting a short peptide; the other three patients from two families had a complex novel indel mutation involving the donor splice site of intron 2 (c.168+2_169+21delinsAA) and leading to an aberrant transcript with a partially retained intron. The protein dose (cystatin B/β-actin) in our heterozygous patients was 0.24 ± 0.02, which is not different from that assessed in patients bearing the homozygous dodecamer expansion. The compound heterozygous patients had a significantly earlier disease onset (7.4 ± 1.7 years) than the homozygous patients, and their disease presentations included frequent myoclonic seizures and absences, often occurring in clusters throughout the course of the disease. The seizures were resistant to the pharmacologic treatments that usually lead to complete seizure control in homozygous patients. EEG-polygraphy allowed repeated seizures to be recorded. Action myoclonus progressively worsened and all of the heterozygous patients older than 30 years were in wheelchairs. Most of the patients showed moderate to severe cognitive impairment, and six had psychiatric symptoms. EPM1A due to compound heterozygous CSTB mutations presents with variable but often markedly severe and particular phenotypes. Most of our patients presented with the electroclinical features of severe epilepsy, which is unexpected in homozygous patients, and showed frequent seizures resistant to pharmacologic treatment. The presence of variable phenotypes (even in siblings) suggests interactions with other genetic factors influencing the final disease presentation. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.

TP53, PIK3CA, FBXW7 and KRAS Mutations in Esophageal Cancer Identified by Targeted Sequencing.

PubMed

Zheng, Huili; Wang, Yan; Tang, Chuanning; Jones, Lindsey; Ye, Hua; Zhang, Guangchun; Cao, Weihai; Li, Jingwen; Liu, Lifeng; Liu, Zhencong; Zhang, Chao; Lou, Feng; Liu, Zhiyuan; Li, Yangyang; Shi, Zhenfen; Zhang, Jingbo; Zhang, Dandan; Sun, Hong; Dong, Haichao; Dong, Zhishou; Guo, Baishuai; Yan, H E; Lu, Qingyu; Huang, Xue; Chen, Si-Yi

2016-01-01

Esophageal cancer (EC) is a common malignancy with significant morbidity and mortality. As individual cancers exhibit unique mutation patterns, identifying and characterizing gene mutations in EC that may serve as biomarkers might help predict patient outcome and guide treatment. Traditionally, personalized cancer DNA sequencing was impractical and expensive. Recent technological advancements have made targeted DNA sequencing more cost- and time-effective with reliable results. This technology may be useful for clinicians to direct patient treatment. The Ion PGM and AmpliSeq Cancer Panel was used to identify mutations at 737 hotspot loci of 45 cancer-related genes in 64 EC samples from Chinese patients. Frequent mutations were found in TP53 and less frequent mutations in PIK3CA, FBXW7 and KRAS. These results demonstrate that targeted sequencing can reliably identify mutations in individual tumors that make this technology a possibility for clinical use. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

Mutations in myosin VIIA (MYO7A) and usherin (USH2A) in Spanish patients with Usher syndrome types I and II, respectively.

PubMed

Nájera, Carmen; Beneyto, Magdalena; Blanca, José; Aller, Elena; Fontcuberta, Ana; Millán, José María; Ayuso, Carmen

2002-07-01

Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment and retinitis pigmentosa. Three clinical types are known (USH1, USH2 and USH3), and there is an extensive genetic heterogeneity, with at least ten genes implicated. The most frequently mutated genes are MYO7A, which causes USH1B, and usherin, which causes USH2A. We carried out a mutation analysis of these two genes in the Spanish population. Analysis of the MYO7A gene in patients from 30 USH1 families and sporadic cases identified 32% of disease alleles, with mutation Q821X being the most frequent. Most of the remaining variants are private mutations. With regard to USH2, mutation 2299delG was detected in 25% of the Spanish patients. Altogether the mutations detected in USH2A families account for 23% of the disease alleles. Copyright 2002 Wiley-Liss, Inc.

Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

PubMed Central

Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

2001-01-01

Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

Wide spectrum of NR5A1‐related phenotypes in 46,XY and 46,XX individuals

PubMed Central

Domenice, Sorahia; Machado, Aline Zamboni; Ferreira, Frederico Moraes; Ferraz‐de‐Souza, Bruno; Lerario, Antonio Marcondes; Lin, Lin; Nishi, Mirian Yumie; Gomes, Nathalia Lisboa; da Silva, Thatiana Evelin; Silva, Rosana Barbosa; Correa, Rafaela Vieira; Montenegro, Luciana Ribeiro; Narciso, Amanda; Costa, Elaine Maria Frade; Achermann, John C

2016-01-01

Steroidogenic factor 1 (NR5A1, SF‐1, Ad4BP) is a transcriptional regulator of genes involved in adrenal and gonadal development and function. Mutations in NR5A1 have been among the most frequently identified genetic causes of gonadal development disorders and are associated with a wide phenotypic spectrum. In 46,XY individuals, NR5A1‐related phenotypes may range from disorders of sex development (DSD) to oligo/azoospermia, and in 46,XX individuals, from 46,XX ovotesticular and testicular DSD to primary ovarian insufficiency (POI). The most common 46,XY phenotype is atypical or female external genitalia with clitoromegaly, palpable gonads, and absence of Müllerian derivatives. Notably, an undervirilized external genitalia is frequently seen at birth, while spontaneous virilization may occur later, at puberty. In 46,XX individuals, NR5A1 mutations are a rare genetic cause of POI, manifesting as primary or secondary amenorrhea, infertility, hypoestrogenism, and elevated gonadotropin levels. Mothers and sisters of 46,XY DSD patients carrying heterozygous NR5A1 mutations may develop POI, and therefore require appropriate counseling. Moreover, the recurrent heterozygous p.Arg92Trp NR5A1 mutation is associated with variable degrees of testis development in 46,XX patients. A clear genotype‐phenotype correlation is not seen in patients bearing NR5A1 mutations, suggesting that genetic modifiers, such as pathogenic variants in other testis/ovarian‐determining genes, may contribute to the phenotypic expression. Here, we review the published literature on NR5A1‐related disease, and discuss our findings at a single tertiary center in Brazil, including ten novel NR5A1 mutations identified in 46,XY DSD patients. The ever‐expanding phenotypic range associated with NR5A1 variants in XY and XX individuals confirms its pivotal role in reproductive biology, and should alert clinicians to the possibility of NR5A1 defects in a variety of phenotypes presenting with gonadal dysfunction. Birth Defects Research (Part C) 108:309–320, 2016. © 2016 The Authors Birth Defects Research Part C: Embryo Today: Reviews Published by Wiley Periodicals, Inc. PMID:28033660

Autosomal Dominant Tubulointerstitial Kidney Disease: Clinical Presentation of Patients With ADTKD-UMOD and ADTKD-MUC1.

PubMed

Ayasreh, Nadia; Bullich, Gemma; Miquel, Rosa; Furlano, Mónica; Ruiz, Patricia; Lorente, Laura; Valero, Oliver; García-González, Miguel Angel; Arhda, Nisrine; Garin, Intza; Martínez, Víctor; Pérez-Gómez, Vanessa; Fulladosa, Xavier; Arroyo, David; Martínez-Vea, Alberto; Espinosa, Mario; Ballarín, Jose; Ars, Elisabet; Torra, Roser

2018-05-18

Autosomal dominant tubulointerstitial kidney disease (ADTKD) is a rare underdiagnosed cause of end-stage renal disease (ESRD). ADTKD is caused by mutations in at least 4 different genes: MUC1, UMOD, HNF1B, and REN. Retrospective cohort study. 56 families (131 affected individuals) with ADTKD referred from different Spanish hospitals. Clinical, laboratory, radiologic, and pathologic data were collected, and genetic testing for UMOD, MUC1, REN, and HNF1B was performed. Hyperuricemia, ultrasound findings, renal histology, genetic mutations. Age at ESRD, rate of decline in estimated glomerular filtration rate. ADTKD was diagnosed in 25 families (45%), 9 carried UMOD pathogenic variants (41 affected members), and 16 carried the MUC1 pathogenic mutation c.(428)dupC (90 affected members). No pathogenic variants were identified in REN or HNF1B. Among the 77 individuals who developed ESRD, median age at onset of ESRD was 51 years for those with ADTKD-MUC1 versus 56 years (P=0.1) for those with ADTKD-UMOD. Individuals with the MUC1 duplication presented higher risk for developing ESRD (HR, 2.24; P=0.03). The slope of decline in estimated glomerular filtration rate showed no significant difference between groups (-3.0mL/min/1.73m 2 per year in the ADTKD-UMOD group versus -3.9mL/min/1.73m 2 per year in the ADTKD-MUC1 group; P=0.2). The prevalence of hyperuricemia was significantly higher in individuals with ADTKD-UMOD (87% vs 54%; P=0.006). Although gout occurred more frequently in this group, the difference was not statistically significant (24% vs 7%; P=0.07). Relatively small Spanish cohort. MUC1 analysis limited to cytosine duplication. The main genetic cause of ADTKD in our Spanish cohort is the MUC1 pathogenic mutation c.(428)dupC. Renal survival may be worse in individuals with the MUC1 mutation than in those with UMOD mutations. Clinical presentation does not permit distinguishing between these variants. However, hyperuricemia and gout are more frequent in individuals with ADTKD-UMOD. Copyright © 2018 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Lynch syndrome: the influence of environmental factors on extracolonic cancer risk in hMLH1 c.C1528T mutation carriers and their mutation-negative sisters.

PubMed

Blokhuis, M M; Pietersen, G E; Goldberg, P A; Algar, U; Van der Merwe, L; Mbatani, N; Vorster, A A; Ramesar, R S

2010-09-01

Lynch Syndrome (LS) is a cancer susceptibility syndrome caused mostly by mutations in the mismatch repair genes, hMLH1, hMSH2 and hMSH6. Mutation carriers are at risk of colorectal and endometrial cancer and, less frequently, cancer of the ovaries, stomach, small bowel, hepatobiliary tract, ureter, renal pelvis and brain. The influence of environmental factors on extracolonic cancer risk in LS patients has not been investigated thus far. The aim of this study was to investigate some of these factors in South African females carrying the hMLH1 c.C1528T mutation and their mutation-negative relatives. Data were collected from 87 mutation-positive females and 121 mutation-negative female relatives regarding age, cancer history, hormonal contraceptive use, parity, duration of breast feeding, height, weight and age at first birth, last birth, menarche and menopause. Influence of these factors on cancer risk was analysed by mixed-effects generalised linear models. Extracolonic cancer occurred in 14% (12/87) of mutation-positive females versus 7% (8/121) of mutation-negative females, (P = 0.0279, adjusted for age and relatedness between women). Breast cancer was the most common extracolonic cancer. An association was found for oral contraceptive use and extracolonic cancer risk in mutation-negative females only. No association was found for any of the other risk factors investigated, when adjusted for age. This might be due to the scarcity of extracolonic cancers in our data. Future knowledge on the influence of additional environmental factors on cancer risk in LS females can lead to evidence-based lifestyle advice for mutation carriers, thereby complementing the prevention strategies available today. In addition, it can contribute to an integrated model of cancer aetiology. Therefore, this study should be taken as a thrust for further research.

De novo mutations in inhibitors of Wnt, BMP, and Ras/ERK signaling pathways in non-syndromic midline craniosynostosis.

PubMed

Timberlake, Andrew T; Furey, Charuta G; Choi, Jungmin; Nelson-Williams, Carol; Loring, Erin; Galm, Amy; Kahle, Kristopher T; Steinbacher, Derek M; Larysz, Dawid; Persing, John A; Lifton, Richard P

2017-08-29

Non-syndromic craniosynostosis (NSC) is a frequent congenital malformation in which one or more cranial sutures fuse prematurely. Mutations causing rare syndromic craniosynostoses in humans and engineered mouse models commonly increase signaling of the Wnt, bone morphogenetic protein (BMP), or Ras/ERK pathways, converging on shared nuclear targets that promote bone formation. In contrast, the genetics of NSC is largely unexplored. More than 95% of NSC is sporadic, suggesting a role for de novo mutations. Exome sequencing of 291 parent-offspring trios with midline NSC revealed 15 probands with heterozygous damaging de novo mutations in 12 negative regulators of Wnt, BMP, and Ras/ERK signaling (10.9-fold enrichment, P = 2.4 × 10 -11 ). SMAD6 had 4 de novo and 14 transmitted mutations; no other gene had more than 1. Four familial NSC kindreds had mutations in genes previously implicated in syndromic disease. Collectively, these mutations contribute to 10% of probands. Mutations are predominantly loss-of-function, implicating haploinsufficiency as a frequent mechanism. A common risk variant near BMP2 increased the penetrance of SMAD6 mutations and was overtransmitted to patients with de novo mutations in other genes in these pathways, supporting a frequent two-locus pathogenesis. These findings implicate new genes in NSC and demonstrate related pathophysiology of common non-syndromic and rare syndromic craniosynostoses. These findings have implications for diagnosis, risk of recurrence, and risk of adverse neurodevelopmental outcomes. Finally, the use of pathways identified in rare syndromic disease to find genes accounting for non-syndromic cases may prove broadly relevant to understanding other congenital disorders featuring high locus heterogeneity.

Simultaneous Occurence of an Autosomal Dominant Inherited MSX1 Mutation and an X-linked Recessive Inherited EDA Mutation in One Chinese Family with Non-syndromic Oligodontia.

PubMed

Zhang, Xiao Xia; Wong, Sing Wai; Han, Dong; Feng, Hai Lan

2015-01-01

To describe the simultaneous occurence of an autosomal dominant inherited MSX1 mutation and an X-linked recessive inherited EDA mutation in one Chinese family with nonsyndromic oligodontia. Clinical data of characteristics of tooth agenesis were collected. MSX1 and EDA gene mutations were detected in a Chinese family of non-syndromic oligodontia. Mild hypodontia in the parents and severe oligodontia in the son was recorded. A novel missense heterozygous mutation c.517C>A (p.Arg173Ser) was detected in the MSX1 gene in the boy and the father. A homozygous missense mutation c.1001G>A (p.Arg334His) was detected in the EDA gene in the boy and the same mutant occurred heterozygously in the mother. Simultaneous occurence of two different gene mutations with different inheritence patterns, which both caused oligodontia, which occurred in one subject and in one family, was reported.

Ovarian Cancers: Genetic Abnormalities, Tumor Heterogeneity and Progression, Clonal Evolution and Cancer Stem Cells.

PubMed

Testa, Ugo; Petrucci, Eleonora; Pasquini, Luca; Castelli, Germana; Pelosi, Elvira

2018-02-01

Four main histological subtypes of ovarian cancer exist: serous (the most frequent), endometrioid, mucinous and clear cell; in each subtype, low and high grade. The large majority of ovarian cancers are diagnosed as high-grade serous ovarian cancers (HGS-OvCas). TP53 is the most frequently mutated gene in HGS-OvCas; about 50% of these tumors displayed defective homologous recombination due to germline and somatic BRCA mutations, epigenetic inactivation of BRCA and abnormalities of DNA repair genes; somatic copy number alterations are frequent in these tumors and some of them are associated with prognosis; defective NOTCH, RAS/MEK, PI3K and FOXM1 pathway signaling is frequent. Other histological subtypes were characterized by a different mutational spectrum: LGS-OvCas have increased frequency of BRAF and RAS mutations; mucinous cancers have mutation in ARID1A , PIK3CA , PTEN , CTNNB1 and RAS . Intensive research was focused to characterize ovarian cancer stem cells, based on positivity for some markers, including CD133, CD44, CD117, CD24, EpCAM, LY6A, ALDH1. Ovarian cancer cells have an intrinsic plasticity, thus explaining that in a single tumor more than one cell subpopulation, may exhibit tumor-initiating capacity. The improvements in our understanding of the molecular and cellular basis of ovarian cancers should lead to more efficacious treatments.

Ovarian Cancers: Genetic Abnormalities, Tumor Heterogeneity and Progression, Clonal Evolution and Cancer Stem Cells

PubMed Central

Castelli, Germana; Pelosi, Elvira

2018-01-01

Four main histological subtypes of ovarian cancer exist: serous (the most frequent), endometrioid, mucinous and clear cell; in each subtype, low and high grade. The large majority of ovarian cancers are diagnosed as high-grade serous ovarian cancers (HGS-OvCas). TP53 is the most frequently mutated gene in HGS-OvCas; about 50% of these tumors displayed defective homologous recombination due to germline and somatic BRCA mutations, epigenetic inactivation of BRCA and abnormalities of DNA repair genes; somatic copy number alterations are frequent in these tumors and some of them are associated with prognosis; defective NOTCH, RAS/MEK, PI3K and FOXM1 pathway signaling is frequent. Other histological subtypes were characterized by a different mutational spectrum: LGS-OvCas have increased frequency of BRAF and RAS mutations; mucinous cancers have mutation in ARID1A, PIK3CA, PTEN, CTNNB1 and RAS. Intensive research was focused to characterize ovarian cancer stem cells, based on positivity for some markers, including CD133, CD44, CD117, CD24, EpCAM, LY6A, ALDH1. Ovarian cancer cells have an intrinsic plasticity, thus explaining that in a single tumor more than one cell subpopulation, may exhibit tumor-initiating capacity. The improvements in our understanding of the molecular and cellular basis of ovarian cancers should lead to more efficacious treatments. PMID:29389895

CFTR Mutations Spectrum and the Efficiency of Molecular Diagnostics in Polish Cystic Fibrosis Patients

PubMed Central

Ziętkiewicz, Ewa; Rutkiewicz, Ewa; Pogorzelski, Andrzej; Klimek, Barbara; Voelkel, Katarzyna; Witt, Michał

2014-01-01

Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers. PMID:24586523

CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.

PubMed

Ziętkiewicz, Ewa; Rutkiewicz, Ewa; Pogorzelski, Andrzej; Klimek, Barbara; Voelkel, Katarzyna; Witt, Michał

2014-01-01

Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Oncometabolite D-2-Hydroxyglutarate Inhibits ALKBH DNA Repair Enzymes and Sensitizes IDH Mutant Cells to Alkylating Agents.

PubMed

Wang, Pu; Wu, Jing; Ma, Shenghong; Zhang, Lei; Yao, Jun; Hoadley, Katherine A; Wilkerson, Matthew D; Perou, Charles M; Guan, Kun-Liang; Ye, Dan; Xiong, Yue

2015-12-22

Chemotherapy of a combination of DNA alkylating agents, procarbazine and lomustine (CCNU), and a microtubule poison, vincristine, offers a significant benefit to a subset of glioma patients. The benefit of this regimen, known as PCV, was recently linked to IDH mutation that occurs frequently in glioma and produces D-2-hydroxyglutarate (D-2-HG), a competitive inhibitor of α-ketoglutarate (α-KG). We report here that D-2-HG inhibits the α-KG-dependent alkB homolog (ALKBH) DNA repair enzymes. Cells expressing mutant IDH display reduced repair kinetics, accumulate more DNA damages, and are sensitized to alkylating agents. The observed sensitization to alkylating agents requires the catalytic activity of mutant IDH to produce D-2-HG and can be reversed by the deletion of mutant IDH allele or overexpression of ALKBH2 or AKLBH3. Our results suggest that impairment of DNA repair may contribute to tumorigenesis driven by IDH mutations and that alkylating agents may merit exploration for treating IDH-mutated cancer patients. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Mutation-Independent Activation of the Anaplastic Lymphoma Kinase in Neuroblastoma.

PubMed

Regairaz, Marie; Munier, Fabienne; Sartelet, Hervé; Castaing, Marine; Marty, Virginie; Renauleaud, Céline; Doux, Camille; Delbé, Jean; Courty, José; Fabre, Monique; Ohta, Shigeru; Vielh, Philippe; Michiels, Stefan; Valteau-Couanet, Dominique; Vassal, Gilles

2016-02-01

Activating mutations of anaplastic lymphoma kinase (ALK) have been identified as important players in neuroblastoma development. Our goal was to evaluate the significance of overall ALK activation in neuroblastoma. Expression of phosphorylated ALK, ALK, and its putative ligands, pleiotrophin and midkine, was screened in 289 neuroblastomas and 56 paired normal tissues. ALK was expressed in 99% of tumors and phosphorylated in 48% of cases. Pleiotrophin and midkine were expressed in 58% and 79% of tumors, respectively. ALK activation was significantly higher in tumors than in paired normal tissues, together with ALK and midkine expression. ALK activation was largely independent of mutations and correlated with midkine expression in tumors. ALK activation in tumors was associated with favorable features, including a younger age at diagnosis, hyperdiploidy, and detection by mass screening. Antitumor activity of the ALK inhibitor TAE684 was evaluated in wild-type or mutated ALK neuroblastoma cell lines and xenografts. TAE684 was cytotoxic in vitro in all cell lines, especially those harboring an ALK mutation. TAE684 efficiently inhibited ALK phosphorylation in vivo in both F1174I and R1275Q xenografts but demonstrated antitumor activity only against the R1275Q xenograft. In conclusion, ALK activation occurs frequently during neuroblastoma oncogenesis, mainly through mutation-independent mechanisms. However, ALK activation is not associated with a poor outcome and is not always a driver of cell proliferation and/or survival in neuroblastoma. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

The mitochondrial DNA G13513A MELAS mutation in the NADH dehydrogenase 5 gene is a frequent cause of Leigh-like syndrome with isolated complex I deficiency.

PubMed

Chol, M; Lebon, S; Bénit, P; Chretien, D; de Lonlay, P; Goldenberg, A; Odent, S; Hertz-Pannier, L; Vincent-Delorme, C; Cormier-Daire, V; Rustin, P; Rötig, A; Munnich, A

2003-03-01

Leigh syndrome is a subacute necrotising encephalomyopathy frequently ascribed to mitochondrial respiratory chain deficiency. This condition is genetically heterogeneous, as mutations in both mitochondrial (mt) and nuclear genes have been reported. Here, we report the G13513A transition in the ND5 mtDNA gene in three unrelated children with complex I deficiency and a peculiar MRI aspect distinct from typical Leigh syndrome. Brain MRI consistently showed a specific involvement of the substantia nigra and medulla oblongata sparing the basal ganglia. Variable degrees of heteroplasmy were found in all tissues tested and a high percentage of mutant mtDNA was observed in muscle. The asymptomatic mothers presented low levels of mutant mtDNA in blood leucocytes. This mutation, which affects an evolutionary conserved amino acid (D393N), has been previously reported in adult patients with MELAS or LHON/MELAS syndromes, emphasising the clinical heterogeneity of mitochondrial DNA mutations. Since the G13513A mutation was found in 21% of our patients with Leigh syndrome and complex I deficiency (3/14), it appears that this mutation represents a frequent cause of Leigh-like syndrome, which should be systematically tested for molecular diagnosis in affected children and for genetic counselling in their maternal relatives.

Deep comparative genomics among Chlamydia trachomatis lymphogranuloma venereum isolates highlights genes potentially involved in pathoadaptation.

PubMed

Borges, Vítor; Gomes, João Paulo

2015-06-01

Lymphogranuloma venereum (LGV) is a human sexually transmitted disease caused by the obligate intracellular bacterium Chlamydia trachomatis (serovars L1-L3). LGV clinical manifestations range from severe ulcerative proctitis (anorectal syndrome), primarily caused by the epidemic L2b strains, to painful inguinal lymphadenopathy (the typical LGV bubonic form). Besides potential host-related factors, the differential disease severity and tissue tropism among LGV strains is likely a function of the genetic backbone of the strains. We aimed to characterize the genetic variability among LGV strains as strain- or serovar-specific mutations may underlie phenotypic signatures, and to investigate the mutational events that occurred throughout the pathoadaptation of the epidemic L2b lineage. By analyzing 20 previously published genomes from L1, L2, L2b and L3 strains and two new genomes from L2b strains, we detected 1497 variant sites and about 100 indels, affecting 453 genes and 144 intergenic regions, with 34 genes displaying a clear overrepresentation of nonsynonymous mutations. Effectors and/or type III secretion substrates (almost all of those described in the literature) and inclusion membrane proteins showed amino acid changes that were about fivefold more frequent than silent changes. More than 120 variant sites occurred in plasmid-regulated virulence genes, and 66% yielded amino acid changes. The identified serovar-specific variant sites revealed that the L2b-specific mutations are likely associated with higher fitness and pointed out potential targets for future highly discriminatory diagnostic/typing tests. By evaluating the evolutionary pathway beyond the L2b clonal radiation, we observed that 90.2% of the intra-L2b variant sites occurring in coding regions involve nonsynonymous mutations, where CT456/tarp has been the main target. Considering the progress on C. trachomatis genetic manipulation, this study may constitute an important contribution for prioritizing study targets for functional genomics aiming to dissect the impact of the identified intra-LGV polymorphisms on virulence or tropism dissimilarities among LGV strains. Copyright © 2015 Elsevier B.V. All rights reserved.

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas

NASA Astrophysics Data System (ADS)

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K.; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69-80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene (IDH1), of which 83-90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice.

Precore and core promoter mutations of hepatitis B virus and hepatitis B e antigen-negative chronic hepatitis B in Korea.

PubMed

Yoo, Byung Chul; Park, Joong-Won; Kim, Hyung Joon; Lee, Dong Ho; Cha, Young Ju; Park, Sill Moo

2003-01-01

The aims of this study were to determine the frequency of precore/core promoter mutations and hepatitis B e antigen (HBeAg)-negative chronic hepatitis B (e-CHB) in Korea. Patients with chronic hepatitis B virus (HBV) infection were tested for HBeAg, anti-HBe, liver profile and HBV-DNA by a branched DNA (bDNA) assay. Serum HBV-DNA was amplified by a polymerase chain reaction and the precore/core promoter sequence was determined. Among the 413 consecutive HBeAg-negative patients, 19.6% were bDNA-positive. Evidence of liver disease was found in 90.1% of bDNA-positive and 41.7% of bDNA-negative patients. Overall, 17.7% of HBeAg-negative patients had e-CHB. Precore mutation (A1896) was detected in 93.7% of HBeAg-negative bDNA-positive and 93.9% of HBeAg-negative bDNA-negative patients. In 59 HBeAg-positive patients, 78% had wild-type and 22% had a mixture of wild-type and A1896 mutant. Core promoter TA mutation was detected in 89.9% of HBeAg-negative bDNA-positive patients, 89.8% of HBeAg-negative bDNA-negative patients, and 74.6% of HBeAg-positive patients. No correlation was found between the presence of precore/core promoter mutations and HBV-DNA levels or disease severity. In Korean patients infected with HBV genotype C, precore mutation occurred almost invariably along with HBeAg seroconversion and core promoter TA mutation was frequent irrespective of viral replication levels or disease severity.

BRAF mutation and anaplasia may be predictive factors of progression-free survival in adult pleomorphic xanthoastrocytoma.

PubMed

Tabouret, E; Bequet, C; Denicolaï, E; Barrié, M; Nanni, I; Metellus, P; Dufour, Henri; Chinot, O; Figarella-Branger, D

2015-12-01

Pleomorphic xanthoastrocytoma (PXA) is a rare, low-grade glioma that frequently occurs in pediatric patients. To analyze adult patients diagnosed with PXA and to search for pathological and molecular markers of diagnosis and prognosis. We retrospectively included patients older than 16 years with PXA who were referred to our institution between October 2003 and September 2013. All pathological diagnoses were reviewed by a neuropathologist. Histological characteristics and immunostaining of GFAP, OLIG2, neurofilament, CD34, Ki67, p53, p16, and IDH1 R132H were analyzed. The following molecular alterations were analyzed: mutations of IDH1/2, BRAF and the histone H3.3 and the EGFR amplification. Clinical data, treatment modalities, and patient outcome were recorded. We identified 16 adult patients with reviewed PXA diagnosis. No IDH neither histone H3.3 mutations were found; BRAF V600E mutation was recorded in six patients. Ten patients presented with anaplastic features. BRAF mutations were associated with lower Ki67, OLIG2 expression, and lack of p16 expression. Median PFS and OS were 41.5 months (95% CI: 11.4-71.6) and 71.4 months (95% CI: 15.5-127.3), respectively. BRAF mutation tended to be associated with greater PFS (p = 0.051), whereas anaplastic features were associated with minimal PFS (p = 0.042). PXA in adults PXA may present features distinct from pediatric PXA. Anaplastic features and BRAF mutation may potentially identify specific subgroups with distinct prognoses. Copyright © 2015 Elsevier Ltd. All rights reserved.

Clinicopathological Characteristics and KRAS Mutation Status of Endometrial Mucinous Metaplasia and Carcinoma.

PubMed

Sung, Ji-Youn; Jung, Yoon Yang; Kim, Hyun-Soo

2018-05-01

Mucinous metaplasia of the endometrium occurs as a spectrum of epithelial alterations ranging from the formation of simple, tubular glands to architecturally complex glandular proliferation with intraglandular papillary projection and cellular tufts. Endometrial mucinous metaplasia often presents a diagnostic challenge in endometrial curettage. We analyzed the clinicopathological characteristics and the mutation status for V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) of 11 cases of endometrial mucinous metaplasia. Electronic medical record review and histopathological examination were performed. KRAS mutation status was analyzed using a pyrosequencing technique. Cases were classified histopathologically into simple (5/11) or papillary (6/11) mucinous metaplasias. All (6/6) papillary mucinous metaplasias were associated with atypical hyperplasia/endometrioid intraepithelial neoplasia (AH/EIN; 1/6) or carcinoma (5/6), whereas in a single patient with simple mucinous metaplasia, grade 1 endometrioid carcinoma was incidentally detected. The difference in frequency of association of the metaplasia with AH/EIN or carcinoma was significant (p=0.015). KRAS mutations were identified in five out of six cases of papillary mucinous metaplasias, comprising three cases with G12D and two with G12V mutations; the frequency of KRAS mutation was significantly higher (p=0.015) than in cases of simple mucinous metaplasia (0/5). Papillary mucinous metaplasia is frequently associated with endometrial neoplastic lesions. The high incidence of KRAS mutations in papillary mucinous metaplasia suggests that papillary mucinous metaplasia may be a precancerous lesion of a certain subset of mucinous carcinomas of the endometrium. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Kinetics of mutation induction by ultraviolet light in excision-deficient yeast.

PubMed

Eckardt, F; Haynes, R H

1977-02-01

We have measured the frequency of UV-induced reversions (locus plus suppressor) for the ochre alleles ade2-1 and lys2-1 and forward mutations (ade2 adex double auxotrophs) in an excision-deficient strain of Saccharomyces cerevisiae (rad2-20). For very low UV doses, both mutational systems exhibit linear induction kinetics. However, as the dose increases, a strikingly different response is observed: in the selective reversion system a transition to higher order induction kinetics occurs near 9 ergs/mm2 (25% survival), whereas in the nonselective forward system the mutation frequency passes through a maximum near 14 ergs/mm2 (4.4% survival) and then declines. This contrast in kinetics cannot be explained in any straightforward way by current models of induced mutagenesis, which have been developed primarily on the basis of bacterial data. The bacterial models are designed to accommodate the quadratic induction kinetics that are frequently observed in these systems. We have derived a mathematical expression for mutation frequency that enables us to fit both the forward and reversion data on the assumptions that mutagenesis is basically a "single event" Poisson process, and that mutation and killing are not necessarily independent of one another. In particular, the dose-response relations are consistent with the idea that the sensitivity of the revertants is about 25% less than that of the original cell population, whereas the sensitivity of the forward mutants is about 29% greater than the population average. We argue that this relatively small differential sensitivity of mutant and nonmutant cells is associated with events that take place during mutation expression and clonal growth.

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas.

PubMed

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69-80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene ( IDH1 ), of which 83-90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice.

Identification of a PTEN mutation with reduced protein stability, phosphatase activity, and nuclear localization in Hong Kong patients with autistic features, neurodevelopmental delays, and macrocephaly.

PubMed

Wong, Chi Wai; Or, Penelope Mei Yu; Wang, Yubing; Li, Lisha; Li, Jing; Yan, Mingfei; Cao, Ye; Luk, Ho Ming; Tong, Tony Ming For; Leslie, Nick R; Lo, Ivan Fai-Man; Choy, Kwong Wai; Chan, Andrew Man Lok

2018-04-02

PTEN is a tumor suppressor gene inactivated in over 30% of human cancers. It encodes a lipid phosphatase that serves as a gatekeeper of the phosphoinositide 3-kinase signaling pathway. Germline mutation frequently occurs in this gene in patients diagnosed with PTEN Hamartoma Tumor Syndrome (PHTS). PHTS individuals are characterized by macrocephaly, benign growth of multiple tissues and increased tumor risk. In addition, autistic phenotypes are found in 10-20% of individuals carrying the germline PTEN mutation with macrocephaly. In this report, 13 suspected PHTS patients were screened for mutation in the PTEN gene. A missense variant (c. 302T > C) substituting the isoleucine at codon 101 to a threonine, a single nucleotide insertion (c. 327-328insC) causing a frame shift mutation and termination at codon 109, and a nonsense variant (c. 1003C > T) truncated the protein at codon 335 were identified. The I101T mutation significantly reduced PTEN protein expression levels by 2.5- to 4.0-fold. Mechanistically, I101T reduced the protein half-life of PTEN possibly due to enhanced polyubiquitination at Lysine 13. However, the I101T mutant retained almost 30% of the lipid phosphatase activity of the wild-type protein. Finally, the I101T mutant has reduced phosphorylation at a PTEN auto-dephosphorylation site at Threonine 366 and a lowered ratio of nuclear to cytosolic protein level. These partial losses of multiple PTEN biochemical functions may contribute to the tissue overgrowth and autistic features of this PHTS patient. Autism Res 2018. © 2018 The Authors Autism Research published by International Society for Autism Research and Wiley Periodicals, Inc. The genetics of autism spectrum disorders is highly complex with individual risk influenced by both genetic and environmental factors. Mutation in the human PTEN gene confers a high risk of developing autistic behavior. This report revealed that PTEN mutations occurred in 23% of a selected group of Hong Kong patients harboring autistic features with gross overgrowth symptoms. Detailed characterization of a PTEN mutation revealed reduced protein stability as one of the underlying mechanisms responsible for reduced PTEN activity. © 2018 The Authors Autism Research published by International Society for Autism Research and Wiley Periodicals, Inc.

Clinical Correlations With Lewy Body Pathology in LRRK2-Related Parkinson Disease

PubMed Central

Kalia, Lorraine V.; Lang, Anthony E.; Hazrati, Lili-Naz; Fujioka, Shinsuke; Wszolek, Zbigniew K.; Dickson, Dennis W.; Ross, Owen A.; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Hurtig, Howard I.; Alcalay, Roy N.; Marder, Karen S.; Clark, Lorraine N.; Gaig, Carles; Tolosa, Eduardo; Ruiz-Martínez, Javier; Marti-Masso, Jose F.; Ferrer, Isidre; de Munain, Adolfo López; Goldman, Samuel M.; Schüle, Birgitt; Langston, J. William; Aasly, Jan O.; Giordana, Maria T.; Bonifati, Vincenzo; Puschmann, Andreas; Canesi, Margherita; Pezzoli, Gianni; De Paula, Andre Maues; Hasegawa, Kazuko; Duyckaerts, Charles; Brice, Alexis; Stoessl, A. Jon; Marras, Connie

2015-01-01

IMPORTANCE Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of genetic Parkinson disease (PD) known to date. The clinical features of manifesting LRRK2 mutation carriers are generally indistinguishable from those of patients with sporadic PD. However, some PD cases associated with LRRK2 mutations lack Lewy bodies (LBs), a neuropathological hallmark of PD. We investigated whether the presence or absence of LBs correlates with different clinical features in LRRK2-related PD. OBSERVATIONS We describe genetic, clinical, and neuropathological findings of 37 cases of LRRK2-related PD including 33 published and 4 unpublished cases through October 2013. Among the different mutations, the LRRK2 p.G2019S mutation was most frequently associated with LB pathology. Nonmotor features of cognitive impairment/dementia, anxiety, and orthostatic hypotension were correlated with the presence of LBs. In contrast, a primarily motor phenotype was associated with a lack of LBs. CONCLUSIONS AND RELEVANCE To our knowledge, this is the first report of clinicopathological correlations in a series of LRRK2-related PD cases. Findings from this selected group of patients with PD demonstrated that parkinsonian motor features can occur in the absence of LBs. However, LB pathology in LRRK2-related PD may be a marker for a broader parkinsonian symptom complex including cognitive impairment. PMID:25401511

Molecular consequences of the R453C hypertrophic cardiomyopathy mutation on human β-cardiac myosin motor function.

PubMed

Sommese, Ruth F; Sung, Jongmin; Nag, Suman; Sutton, Shirley; Deacon, John C; Choe, Elizabeth; Leinwand, Leslie A; Ruppel, Kathleen; Spudich, James A

2013-07-30

Cardiovascular disorders are the leading cause of morbidity and mortality in the developed world, and hypertrophic cardiomyopathy (HCM) is among the most frequently occurring inherited cardiac disorders. HCM is caused by mutations in the genes encoding the fundamental force-generating machinery of the cardiac muscle, including β-cardiac myosin. Here, we present a biomechanical analysis of the HCM-causing mutation, R453C, in the context of human β-cardiac myosin. We found that this mutation causes a ∼30% decrease in the maximum ATPase of the human β-cardiac subfragment 1, the motor domain of myosin, and a similar percent decrease in the in vitro velocity. The major change in the R453C human β-cardiac subfragment 1 is a 50% increase in the intrinsic force of the motor compared with wild type, with no appreciable change in the stroke size, as observed with a dual-beam optical trap. These results predict that the overall force of the ensemble of myosin molecules in the muscle should be higher in the R453C mutant compared with wild type. Loaded in vitro motility assay confirms that the net force in the ensemble is indeed increased. Overall, this study suggests that the R453C mutation should result in a hypercontractile state in the heart muscle.

EGFR, ALK, RET, KRAS and BRAF alterations in never-smokers with non-small cell lung cancer.

PubMed

Dong, Y U; Ren, Weihong; Qi, Jun; Jin, B O; Li, Ying; Tao, Huiqing; Xu, Ren; Li, Yanqing; Zhang, Qinxian; Han, Baohui

2016-04-01

Non-small cell lung cancer (NSCLC), caused by various mutations in a spectrum of cancer driver genes, may have distinct pathological characteristics and drug responses. Extensive genetic screening and pathological characterization is required for the design of customized therapies to improve patient outcomes. Notably, NSCLC in never-smokers exhibits distinctive clinicopathological features, which are frequently associated with tumorigenic mutations, and thus may be treated as a unique disease entity. However, to the best of our knowledge, these mutations have not been extensively and accurately characterized in an NSCLC study with a large sample size. Therefore, the present study enrolled a large cohort of NSCLC patients, which consisted of 358 never-smokers, for the screening of genetic alterations in the epidermal growth factor receptor (EGFR), ret proto-oncogene (RET), anaplastic lymphoma kinase (ALK), Kirsten rat sarcoma viral oncogene homolog (KRAS) and B-Raf proto-oncogene serine/threonine kinase (BRAF) tumorigenic genes. It was identified that the mutation rate was 47.8, 7.5, 3.6, 1.4 and 0.3% for EGFR, ALK, KRAS, RET and BRAF, respectively. In addition, clinicopathological features associated with these mutations were characterized. EGFR mutations were more frequently observed in female and older patients. By contrast, KRAS mutations were more frequently detected in male patients, and ALK and RET translocations in younger patients. The cancer cells were frequently well-differentiated in carcinoma cases exhibiting EGFR mutations, however, were less differentiated in those with ALK translocations. In conclusion, the present study determined the frequency of oncogenic alterations and associated clinicopathological features in NSCLC exhibited by never-smokers using a large sample size. The results of the present study may enrich our knowledge of NSCLC in never-smokers and provide useful insights for improvement of the outcome of molecularly targeted therapies for the treatment of NSCLC.

Sick sinus syndrome with HCN4 mutations shows early onset and frequent association with atrial fibrillation and left ventricular noncompaction.

PubMed

Ishikawa, Taisuke; Ohno, Seiko; Murakami, Takashi; Yoshida, Kentaro; Mishima, Hiroyuki; Fukuoka, Tetsuya; Kimoto, Hiroki; Sakamoto, Risa; Ohkusa, Takafumi; Aiba, Takeshi; Nogami, Akihiko; Sumitomo, Naokata; Shimizu, Wataru; Yoshiura, Koh-Ichiro; Horigome, Hitoshi; Horie, Minoru; Makita, Naomasa

2017-05-01

Familial sick sinus syndrome (SSS) is often attributable to mutations in genes encoding the cardiac Na channel SCN5A and pacemaker channel HCN4. We previously found that SSS with SCN5A mutations shows early onset of manifestations and male predominance. Despite recent reports on the complications of atrial fibrillation (AF) and left ventricular noncompaction (LVNC) in patients with SSS caused by HCN4 mutations, their overall clinical spectrum remains unknown. The purpose of this study was to investigate the clinical and demographic features of SSS patients carrying HCN4 mutations. We genetically screened 38 unrelated SSS families and functionally analyzed the mutant SCN5A and HCN4 channels by patch clamping. We also evaluated the clinical features of familial SSS by a meta-analysis of 48 SSS probands with mutations in HCN4 (n = 16) and SCN5A (n = 32), including previously reported cases, and 538 sporadic SSS cases. We identified two HCN4 and three SCN5A loss-of-function mutations in our familial SSS cohort. Meta-analysis of HCN4 mutation carriers showed a significantly younger age at diagnosis (39.1 ± 21.7 years) than in sporadic SSS (74.3 ± 0.4 years; P <.001), but a significantly older age than in SCN5A mutation carriers (20.0 ± 17.6 years; P = .003). Moreover, HCN4 mutation carriers were more frequently associated with AF (43.8%) and LVNC (50%) and with older age at pacemaker implantation (43.5 ± 22.1 years) than were SCN5A mutation carriers (17.8 ± 16.5 years; P <.001). SSS with HCN4 mutations may form a distinct SSS subgroup characterized by early clinical manifestation after adolescence and frequent association with AF and LVNC. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Pheochromocytoma in MEN 2A syndrome. Study of 54 patients.

PubMed

Rodriguez, Jose M; Balsalobre, Maria; Ponce, Jose L; Ríos, Antonio; Torregrosa, Nuria M; Tebar, Javier; Parrilla, Pascual

2008-11-01

Pheochromocytoma occurs in nearly 50% of MEN 2A (multiple endocrine neoplasia, type 2A) cases. Many issues related to this tumor are still the subject of debate: the diagnostic management in patients who have had positive genetic study results (RET mutation), variations related to mutation, the best surgical option, and the real relapse rate during long-term follow-up. The aim of this study is to present our experience with this unusual disease, looking for answers to some of these questions. Of 169 patients belonging to 19 MEN 2A families, 54 (32%) presented with pheochromocytoma. The following variables have been studied: (1) clinical and diagnostic data [age, mutation, clinical features, results of catecholamines and catabolites in a 24-h urine sample, computerized tomography (CT) scan and iodine-131 meta-iodobenzylguanidine (MIBG) scintigraphy results, and the means of diagnostic, clinical, or genetic screening]; (2) surgical treatment; and (3) follow-up and recurrence. The mean follow-up time was 92.5 months (range: 12-120 months). The mean age of the 54 patients was 37.9 years (range: 14-71 years); 33 were women. Most (96.3%) mutations were found in exon 11. The most frequent mutations were Cys634Tyr (in 33 cases [61.1%]) and Cys634Arg (in 14 [25.9%]). The diagnosis of pheocromocytoma was made after the diagnosis of MTC in 26 cases (48.2%), simultaneously in 21 (38.9%), and prior in the 7 remaining cases (12.9%). At the time of diagnosis 28 patients (51.8%) were asymptomatic and 26 (48.2%) had clinical features related to pheochromocytoma. In 6 patients (11.1%), the values of catecholamines and catabolites in urine were normal. In the cases with high values, the most useful isolated determination was that of metanephrines (82%), followed by adrenaline (76%). The CT scan did not provide a correct diagnosis in 6 patients with bilateral lesions, and one patient with a bilateral tumor was not diagnosed by MIBG. The combination of CT scan and MIBG diagnosed 100% of cases. The pheochromocytoma was bilateral in 27 cases, with a total number of 81 pathological glands detected. A laparascopic approach was used in 30 cases and a laparotomy in 24. The mean tumor size was 4.5 cm (range: 1-18 cm). Five patients with unilateral resection relapsed (18.5%), and the mean relapse time was 43.2 months (range: 12-120 months). There was a greater frequency of pheochromocytoma in those subjects who had the Cys634Arg mutation (p < 0.03). In addition, the Cys634Arg mutation is more frequent in bilateral cases. There are no prognostic factors for recurrence. Pheochromocytoma in MEN 2A is related to the type of mutation, which can be early onset and is frequently asymptomatic. Its diagnosis requires catecholamines determinations as well as a CT scan. Correct diagnosis of bilaterality is established by CT and MIBG. Laparoscopic adrenalectomy is the treatment of choice.

Mutation Analysis of KRAS and BRAF Genes in Metastatic Colorectal Cancer: a First Large Scale Study from Iran.

PubMed

Koochak, Aghigh; Rakhshani, Nasser; Karbalaie Niya, Mohammad Hadi; Tameshkel, Fahimeh Safarnezhad; Sohrabi, Masoud Reza; Babaee, Mohammad Reza; Rezvani, Hamid; Bahar, Babak; Imanzade, Farid; Zamani, Farhad; Khonsari, Mohammad Reza; Ajdarkosh, Hossein; Hemmasi, Gholamreza

2016-01-01

The investigation of mutation patterns in oncogenes potentially can make available a reliable mechanism for management and treatment decisions for patients with colorectal cancer (CRC). This study concerns the rate of KRAS and BRAF genes mutations in Iranian metastatic colorectal cancer (mCRC) patients, as well as associations of genotypes with clinicopathological features. A total of 1,000 mCRC specimens collected from 2008 to 2012 that referred to the Mehr Hospital and Partolab center, Tehran, Iran enrolled in this cross sectional study. Using HRM, Dxs Therascreen and Pyrosequencing methods, we analyzed the mutational status of KRAS and BRAF genes in these. KRAS mutations were present in 33.6% cases (n=336). Of KRAS mutation positive cases, 85.1% were in codon 12 and 14.9% were in codon 13. The most frequent mutation at KRAS codon 12 was Gly12Asp; BRAF mutations were not found in any mCRC patients (n=242). In addition, we observed a strong correlation of KRAS mutations with some clinicopathological characteristics. KRAS mutations are frequent in mCRCs while presence of BRAF mutations in these patients is rare. Moreover, associations of KRAS genotypes with non-mucinous adenocarcinoma and depth of invasion (pT3) were remarkable.

Positive contribution of pathogenic mutations in the mitochondrial genome to the promotion of cancer by prevention from apoptosis.

PubMed

Shidara, Yujiro; Yamagata, Kumi; Kanamori, Takashi; Nakano, Kazutoshi; Kwong, Jennifer Q; Manfredi, Giovanni; Oda, Hideaki; Ohta, Shigeo

2005-03-01

The role of mitochondrial dysfunction in cancer has been a subject of great interest and much ongoing investigation. Although most cancer cells harbor somatic mutations in mitochondrial DNA (mtDNA), the question of whether such mutations contribute to the promotion of carcinomas remains unsolved. Here we used trans-mitochondrial hybrids (cybrids) containing a common HeLa nucleus and mtDNA of interest to compare the role of mtDNA against the common nuclear background. We constructed cybrids with or without a homoplasmic pathogenic point mutation at nucleotide position 8,993 or 9,176 in the mtDNA ATP synthase subunit 6 gene (MTATP6) derived from patients with mitochondrial encephalomyopathy. When the cybrids were transplanted into nude mice, the MTATP6 mutations conferred an advantage in the early stage of tumor growth. The mutant cybrids also increased faster than wild type in culture. To complement the mtDNA mutations, we transfected a wild-type nuclear version of MTATP, whose codons were converted to the universal genetic codes containing a mitochondrial target sequence, into the nucleus of cybrids carrying mutant MTATP6. The restoration of MTATP slowed down the growth of tumor in transplantation. Conversely, expression of a mutant nuclear version of MTATP6 in the wild-type cybrids declined respiration and accelerated the tumor growth. These findings showed that the advantage in tumor growth depended upon the MTATP6 function but was not due to secondary nuclear mutations caused by the mutant mitochondria. Because apoptosis occurred less frequently in the mutant versus wild-type cybrids in cultures and tumors, the pathogenic mtDNA mutations seem to promote tumors by preventing apoptosis.

FOXP2 variants in 14 individuals with developmental speech and language disorders broaden the mutational and clinical spectrum.

PubMed

Reuter, Miriam S; Riess, Angelika; Moog, Ute; Briggs, Tracy A; Chandler, Kate E; Rauch, Anita; Stampfer, Miriam; Steindl, Katharina; Gläser, Dieter; Joset, Pascal; Krumbiegel, Mandy; Rabe, Harald; Schulte-Mattler, Uta; Bauer, Peter; Beck-Wödl, Stefanie; Kohlhase, Jürgen; Reis, André; Zweier, Christiane

2017-01-01

Disruptions of the FOXP2 gene, encoding a forkhead transcription factor, are the first known monogenic cause of a speech and language disorder. So far, mainly chromosomal rearrangements such as translocations or larger deletions affecting FOXP2 have been reported. Intragenic deletions or convincingly pathogenic point mutations in FOXP2 have up to date only been reported in three families. We thus aimed at a further characterisation of the mutational and clinical spectrum. Chromosomal microarray testing, trio exome sequencing, multigene panel sequencing and targeted sequencing of FOXP2 were performed in individuals with variable developmental disorders, and speech and language deficits. We identified four different truncating mutations, two novel missense mutations within the forkhead domain and an intragenic deletion in FOXP2 in 14 individuals from eight unrelated families. Mutations occurred de novo in four families and were inherited from an affected parent in the other four. All index patients presented with various manifestations of language and speech impairment. Apart from two individuals with normal onset of speech, age of first words was between 4 and 7 years. Articulation difficulties such as slurred speech, dyspraxia, stuttering and poor pronunciation were frequently noted. Motor development was normal or only mildly delayed. Mild cognitive impairment was reported for most individuals. By identifying intragenic deletions or mutations in 14 individuals from eight unrelated families with variable developmental delay/cognitive impairment and speech and language deficits, we considerably broaden the mutational and clinical spectrum associated with aberrations in FOXP2. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Naturally Occurring Mutations in Large Surface Genes Related to Occult Infection of Hepatitis B Virus Genotype C

PubMed Central

Kim, Hong; Lee, Seoung-Ae; Kim, Dong-Won; Lee, Sueng-Hyun; Kim, Bum-Joon

2013-01-01

Molecular mechanisms related to occult hepatitis B virus (HBV) infection, particularly those based on genotype C infection, have rarely been determined thus far in the ongoing efforts to determine infection mechanisms. Therefore, we aim to elucidate the mutation patterns in the surface open reading frame (S ORF) underlying occult infections of HBV genotype C in the present study. Nested PCRs were applied to 624 HBV surface antigen (HBsAg) negative Korean subjects. Cloning and sequencing of the S ORF gene was applied to 41 occult cases and 40 control chronic carriers. Forty-one (6.6%) of the 624 Korean adults with HBsAg-negative serostatus were found to be positive for DNA according to nested PCR tests. Mutation frequencies in the three regions labeled here as preS1, preS2, and S were significantly higher in the occult subjects compared to the carriers in all cases. A total of two types of deletions, preS1 deletions in the start codon and preS2 deletions as well as nine types of point mutations were significantly implicated in the occult infection cases. Mutations within the “a” determinant region in HBsAg were found more frequently in the occult subjects than in the carriers. Mutations leading to premature termination of S ORF were found in 16 occult subjects (39.0%) but only in one subject from among the carriers (2.5%). In conclusion, our data suggest that preS deletions, the premature termination of S ORF, and “a” determinant mutations are associated with occult infections of HBV genotype C among a HBsAg-negative population. The novel mutation patterns related to occult infection introduced in the present study can help to broaden our understanding of HBV occult infections. PMID:23349904

Genetic screening of non-classic CAH females with hyperandrogenemia identifies a novel CYP11B1 gene mutation.

PubMed

Shammas, Christos; Byrou, Stefania; Phelan, Marie M; Toumba, Meropi; Stylianou, Charilaos; Skordis, Nicos; Neocleous, Vassos; Phylactou, Leonidas A

2016-04-01

Congenital adrenal hyperplasia (CAH) is an endocrine autosomal recessive disorder with various symptoms of diverse severity. Mild hyperandrogenemia is the most commonclinical feature in non-classic CAH patients and 95% of the cases are identified by mutations in the CYP21A2 gene. In the present study, the second most common cause for non-classic CAH (NC-CAH), 11β-hydroxylase deficiency due to mutations in the CYP11B1 gene, is investigated. Screening of the CYP21A2 and CYP11B1 genes by direct sequencing was carried out for the detection of possible genetic defects in patients with suspected CAH. It wasobserved that CYP11B1 variants co-exist only in rare cases along with mutations in CYP21A2 in patients clinically diagnosed with CAH. A total of 23 NC-CAH female patients out of 75 were identified with only one mutation in the CYP21A2 gene. The novel CYP11B1 gene mutation, p.Val484Asp, was identified in a patient with CAH in the heterozygous state. The structural characterization of the novel p.Val484Asp was found to likely cause distortion of the surrounding beta sheet and indirect destabilization of the cavity that occurs on the opposite face of the structural elements, leading to partial impairment of the enzymatic activity. CYP21A2 gene mutations are the most frequent genetic defects in cases of NC-CAH even when these patients are in the heterozygous state. These mutations have a diverse phenotype giving rise to a variable extent of cortisol synthesis impairment; it is also clear that CYP11B1 mutants are a rare type of defects causing CAH.

ACTION OF MUTAGENIC AGENTS ON AUXOTROPHIC STRAINS OF STREPTOMYCES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jarai, M.

1962-01-01

The mutagenic effect on Streptomyces auxotrophs of uv and x irradiation and of some chemical agerts was studied. From the observed reverse mutations it was concluded that uv and probably x irradiation have an optimal mutagenic dose. With nine auxotrophic strains it was shown that under the same conditions different gene loci reacted differently to the same mutagenic agent. With uy radiation, mutations occurred most frequently at doses falling within the range of 3500 to 4000 erg/mm/sup 2/. With such doses, the average mutation frequency for singly deficient mutants was 0.8 x 10/sup -6/, for doubly deficient mutants 8.4 xmore » 10/sup -8/. An analysis of the number of mutations as compared to the number of survivors in two biochemical mutants (N-4 and N-11) showed that with N- 4 the highest number of mutations was obtained at doses of 3500 to 4500 erg/mm/ sup 2/, namely, 12 to 15 per 10 surviving conidia, and with strain N-11, the highest frequency was obtained in the same dose range, namely, three to four mutations per 10/sup 6/ surviving conidia. The optimal dose of irradiation corresponds to 90 to 97% lethality. It was shown that, unlike the results with uv irradiation, with x rays no such definite relation existed between optimal dose and frequency of mutations. The highest mutation frequency occurred at doses of 20,000 to 25,000 r, which corresponded to 85 to 91% lethality. Of the chemical substances examined, a definite mutagenic action was exerted by acridine orange, streptomycin, hydroxylamine, phenyl, isocyannte, and 8-quinolinol. The maximum mutagenic frequency for survivors was 41.4 x 10/sup -6/ after uv irradiation (biochemical mutant arg 3-; frequency of sportaneous back mutation, 0.041 x 10/sup -6/). With x irradiation the maximum mutagenic frequency was 3.42 x 10/sup -6/ (biochemical mutant meth 1-; frequency of spontaneous back mutation, 0.28 X 10/sup -6/). With chemical agents the maximum mutation frequencies for the initial conidia number were as follows: acridine orange, 3.65 x 10/sup -6/ (biochemical mutant arg 3-); streptomycin, 2.05 x 10/sup -6/ (biochemical mutant arg 3-); hydroxylamine, 5.81 x 10/sup -6/ (biochemical mutant meth 1/sup -/); phenyl isocyanate, 6.11 x 10/sup -6/ (biochemical mutant meth 1/sup -/); 8- quinolinol, 1.02 x 10/sup -6/ (biochemical mutant meth 1/sup -/). (BBB)« less

The H3.3 K27M mutation results in a poorer prognosis in brainstem gliomas than thalamic gliomas in adults.

PubMed

Feng, Jie; Hao, Shuyu; Pan, Changcun; Wang, Yu; Wu, Zhen; Zhang, Junting; Yan, Hai; Zhang, Liwei; Wan, Hong

2015-11-01

Brainstem and thalamic gliomas are rare, and they are poorly understood in adults. Genetic aberrations that occur in these tumors are still unknown. In this study, we investigated whether thalamic gliomas have different genetic aberrations and clinical outcomes compared with brainstem gliomas in adults. Forty-three glioma samples were selected, including 28 brainstem and 15 thalamic gliomas. The frequency of the K27M mutation in adult midline gliomas was 58.1%. High-grade gliomas in the thalamus were statistically significantly more numerous than brainstem gliomas. Patients with K27M mutant brainstem gliomas had a significantly shorter overall survival than patients with wild-type tumors (P = .020) by Cox regression after adjustment for other independent risk factors. However, there was no statistical tendency toward a poorer overall survival in thalamic gliomas containing the K27M mutation compared with wild-type tumors. The presence of the K27M mutation significantly corresponded with mutations in TP53 in thalamic gliomas. Interestingly, the K27M mutation was mutually exclusive with mutations in IDH1, which was detected only in brainstem gliomas. The microarray data identified 86 differentially expressed genes between brainstem and thalamic gliomas with the K27M mutation. The cyclin-dependent kinase 6 (CDK6) gene, which plays an important role in cancer pathways, was found to be differentially expressed between brainstem and thalamic gliomas with K27M mutations. Although the K27M mutation was frequently observed in adult brainstem and thalamic gliomas, this mutation tended to be associated with a poorer prognosis in brainstem gliomas but not in thalamic gliomas. Brainstem gliomas may present different genetic aberrations from thalamic gliomas. These differences may provide guidance for therapeutic decisions for the treatment of adult brainstem and thalamic gliomas, which may have different molecular targets. Copyright © 2015. Published by Elsevier Inc.

Analysis of the surface expression of c-kit and occurrence of the c-kit Asp816Val activating mutation in T cells, B cells, and myelomonocytic cells in patients with mastocytosis.

PubMed

Akin, C; Kirshenbaum, A S; Semere, T; Worobec, A S; Scott, L M; Metcalfe, D D

2000-02-01

The Asp816Val c-kit activating mutation is detectable in the peripheral blood cells of some patients with mastocytosis and in lesional skin biopsies obtained from adult patients with urticaria pigmentosa. These observations led to the conclusion that this mutation is present in mast cells and mast cell precursors that express c-kit. However, the distribution of the Asp816Val mutation among hematopoietic lineages is unknown. To determine the distribution of the Asp816Val mutation among hematopoietic lineages and to explore its relationship to clinical disease, we examined cells bearing differentiation markers for myelomonocytic cells as well as T and B lymphocytes, in both peripheral blood and bone marrow obtained from patients with mastocytosis. The presence of Asp816Val c-kit mutation in cells magnetically sorted from peripheral blood or bone marrow according to surface differentiation markers was studied by reverse transcriptase polymerase chain reaction (RT-PCR) restriction fragment length polymorphism (RFLP) analysis. The surface expression of c-kit was determined by flow cytometry. The mutation was detectable by RT-PCR in at least one cell lineage in the bone marrow in 7 of 7 patients examined and in the peripheral blood of 11 of 11 adult patients with urticaria pigmentosa and indolent disease. The mutation was identified most frequently in B cells and myeloid cells. Flow cytometric analysis demonstrated that the differentiated cells expressing mutated c-kit were negative for surface KIT. These results are consistent with the conclusion that the c-kit Asp816Val mutation occurs in an early progenitor cell and is carried by myelomonocytic cells, T cells, and B cells in addition to mast cells. However, unlike mast cells, these myelomonocytic cells, T cells, and B cells do not concomitantly express surface c-kit and thus may be less susceptible to the effects of this mutation.

Spectrum of mutations in leiomyosarcomas identified by clinical targeted next-generation sequencing.

PubMed

Lee, Paul J; Yoo, Naomi S; Hagemann, Ian S; Pfeifer, John D; Cottrell, Catherine E; Abel, Haley J; Duncavage, Eric J

2017-02-01

Recurrent genomic mutations in uterine and non-uterine leiomyosarcomas have not been well established. Using a next generation sequencing (NGS) panel of common cancer-associated genes, 25 leiomyosarcomas arising from multiple sites were examined to explore genetic alterations, including single nucleotide variants (SNV), small insertions/deletions (indels), and copy number alterations (CNA). Sequencing showed 86 non-synonymous, coding region somatic variants within 151 gene targets in 21 cases, with a mean of 4.1 variants per case; 4 cases had no putative mutations in the panel of genes assayed. The most frequently altered genes were TP53 (36%), ATM and ATRX (16%), and EGFR and RB1 (12%). CNA were identified in 85% of cases, with the most frequent copy number losses observed in chromosomes 10 and 13 including PTEN and RB1; the most frequent gains were seen in chromosomes 7 and 17. Our data show that deletions in canonical cancer-related genes are common in leiomyosarcomas. Further, the spectrum of gene mutations observed shows that defects in DNA repair and chromosomal maintenance are central to the biology of leiomyosarcomas, and that activating mutations observed in other common cancer types are rare in leiomyosarcomas. Copyright © 2017 Elsevier Inc. All rights reserved.

Impact of tissue type and content of neoplastic cells of samples on the quality of epidermal growth factor receptor mutation analysis among patients with lung adenocarcinoma

PubMed Central

PALIOGIANNIS, PANAGIOTIS; ATTENE, FEDERICO; COSSU, ANTONIO; DEFRAIA, EFISIO; PORCU, GIUSEPPE; CARTA, ANNAMARIA; SOTGIU, MARIA IGNAZIA; PAZZOLA, ANTONIO; CORDERO, LORENZO; CAPELLI, FRANCESCA; FADDA, GIOVANNI MARIA; ORTU, SALVATORE; SOTGIU, GIOVANNI; PALOMBA, GRAZIA; SINI, MARIA CRISTINA; PALMIERI, GIUSEPPE; COLOMBINO, MARIA

2015-01-01

Assessment of the epidermal growth factor receptor (EGFR) mutational status has become crucial in recent years in the molecular classification of patients with lung cancer. The impact of the type and quantity of malignant cells of the neoplastic specimen on the quality of mutation analysis remains to be elucidated, and only empirical and sporadic data are available. The aim of the present study was to investigate the impact of tissue type and content of neoplastic cells in the specimen on the quality of EGFR mutation analysis among patients with lung adenocarcinoma. A total of 515 patients with histologically-confirmed disease were included in the present study. Formalin-fixed paraffin embedded tissue samples were used for the mutation analysis and the content of the neoplastic cells was evaluated using light microscopy. Genomic DNA was isolated using a standard protocol. The coding sequences and splice junctions of exons 18, 19 and 21 in the EGFR gene were then screened for mutations by direct automated sequencing. The mean age of the patients examined was 64.9 years and 357 (69.3%) were male. A total of 429 tissue samples (83.3%) were obtained by biopsy and the remaining samples were obtained by surgery. A total of 456 samples (88.5%) were observed from primary lung adenocarcinomas, while 59 (11.5%) were from metastatic lesions. EGFR mutations occurred in 59 cases (11.5%); exon 18 mutations were detected in one case (1.7%), whereas exon 19 and 21 mutations were detected in 30 (51%) and 28 (47.3%) cases, respectively. EGFR mutations were more frequent in females and patients that had never smoked. The distribution of the mutations among primary and metastatic tissues exhibited no significant differences in the proportions of EGFR mutations detected. However, a statistically significant difference in the number of mutations detected was found between samples with at least 50% of neoplastic cells (450 cases-57 mutations; 12.7%) and those with <50% of neoplastic cells (65 cases-2 mutations; 3.1%). PMID:25683726

Establishment of Anti-Human ATRX Monoclonal Antibody AMab-6

PubMed Central

Ogasawara, Satoshi; Fujii, Yuki; Kaneko, Mika K.; Oki, Hiroharu; Sabit, Hemragul; Nakada, Mitsutoshi; Suzuki, Hiroyoshi; Ichimura, Koichi; Komori, Takashi

2016-01-01

Gliomas are the most frequently occurring brain tumors with a heterogeneous molecular background. The molecular subgrouping of gliomas more prognostically stratifies patients into distinct groups compared with conventional histological classification. The most important molecules for the subtype diagnosis of diffuse gliomas are mutations of isocitrate dehydrogenase (IDH), TERT promoter, and α-thalassemia/mental-retardation-syndrome-X-linked (ATRX) and the codeletion of 1p/19q. Among them, IDH and ATRX mutations can be diagnosed using specific monoclonal antibodies (mAbs). We have developed many mAbs against IDH mutants, including HMab-1/HMab-2 against IDH1-R132H and multispecific mAbs MsMab-1/MsMab-2 against IDH1/2 mutations. In contrast, highly sensitive mAbs against ATRX remain to be established. In this study, we immunized mice with recombinant human ATRX and developed a novel mAb, AMab-6. The dissociation constant of AMab-6 was determined to be 9.7 × 10−10 M, indicating that the binding affinity of AMab-6 is very high. Furthermore, AMab-6 sensitively detects ATRX in Western blot and immunohistochemical analyses, indicating that AMab-6 could become the standard marker to determine the ATRX mutation status of gliomas in immunohistochemical analyses. PMID:27788029

Establishment of Anti-Human ATRX Monoclonal Antibody AMab-6.

PubMed

Ogasawara, Satoshi; Fujii, Yuki; Kaneko, Mika K; Oki, Hiroharu; Sabit, Hemragul; Nakada, Mitsutoshi; Suzuki, Hiroyoshi; Ichimura, Koichi; Komori, Takashi; Kato, Yukinari

2016-10-01

Gliomas are the most frequently occurring brain tumors with a heterogeneous molecular background. The molecular subgrouping of gliomas more prognostically stratifies patients into distinct groups compared with conventional histological classification. The most important molecules for the subtype diagnosis of diffuse gliomas are mutations of isocitrate dehydrogenase (IDH), TERT promoter, and α-thalassemia/mental-retardation-syndrome-X-linked (ATRX) and the codeletion of 1p/19q. Among them, IDH and ATRX mutations can be diagnosed using specific monoclonal antibodies (mAbs). We have developed many mAbs against IDH mutants, including HMab-1/HMab-2 against IDH1-R132H and multispecific mAbs MsMab-1/MsMab-2 against IDH1/2 mutations. In contrast, highly sensitive mAbs against ATRX remain to be established. In this study, we immunized mice with recombinant human ATRX and developed a novel mAb, AMab-6. The dissociation constant of AMab-6 was determined to be 9.7 × 10 -10 M, indicating that the binding affinity of AMab-6 is very high. Furthermore, AMab-6 sensitively detects ATRX in Western blot and immunohistochemical analyses, indicating that AMab-6 could become the standard marker to determine the ATRX mutation status of gliomas in immunohistochemical analyses.

Lack of association between the pseudo deficiency mutation in the arylsulfatase A gene on chromosome 22 with schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, P.L.; Chetty, V.; Kasch, L.

Arylsulfatase-A deficiency causes the neurodegenerative lysosomal storage disease metachromatic leukodystrophy. In the late-onset variant, schizophrenia-like psychosis is a frequent finding and sometimes given as the initial diagnosis. A mutant allele, pseudo-deficiency, causes deficient enzyme activity but no apparent clinical effect. It occurs at a high frequency and consists of two tightly-linked A{r_arrow}G transitions: one causing the loss of a glycosylation site (PDg); and one causing the loss of a polyadenylation signal (PDa). Since this gene was mapped to chromosome 22q13-qter, a region implicated in a potential linkage with schizophrenia, we hypothesized that this common mutation may be a predisposing geneticmore » factor for schizophrenia. We studied a random sample of schizophrenic patients for possible increase in frequency of the pseudo-deficiency mutations and in multiplex families to verify if the mutations are linked to schizophrenia. Among 50 Caucasian patients identified through out-patient and in-patient clinics, the frequencies for the three alleles PDg + PDa together, PDg or PDa alone were 11%, 5% and 0%, respectively. The corresponding frequencies among 100 Caucasian controls were 7.5%, 6% and 0%, respectively, the differences between the patients and controls being insignificant ({chi}{sup 2}tests: 0.10« less

Wilms tumor gene 1 (WT1), TP53, RAS/BRAF and KIT aberrations in testicular germ cell tumors.

PubMed

Boublikova, L; Bakardjieva-Mihaylova, V; Skvarova Kramarzova, K; Kuzilkova, D; Dobiasova, A; Fiser, K; Stuchly, J; Kotrova, M; Buchler, T; Dusek, P; Grega, M; Rosova, B; Vernerova, Z; Klezl, P; Pesl, M; Zachoval, R; Krolupper, M; Kubecova, M; Stahalova, V; Abrahamova, J; Babjuk, M; Kodet, R; Trka, J

2016-07-01

Wilms tumor gene 1 (WT1), a zinc-finger transcription factor essential for testis development and function, along with other genes, was investigated for their role in the pathogenesis of testicular germ cell tumors (TGCT). In total, 284 TGCT and 100 control samples were investigated, including qPCR for WT1 expression and BRAF mutation, p53 immunohistochemistry detection, and massively parallel amplicon sequencing. WT1 was significantly (p < 0.0001) under-expressed in TGCT, with an increased ratio of exon 5-lacking isoforms, reaching low levels in chemo-naïve relapsed TGCT patients vs. high levels in chemotherapy-pretreated relapsed patients. BRAF V600E mutation was identified in 1% of patients only. p53 protein was lowly expressed in TGCT metastases compared to the matched primary tumors. Of 9 selected TGCT-linked genes, RAS/BRAF and WT1 mutations were frequent while significant TP53 and KIT variants were not detected (p = 0.0003). WT1 has been identified as a novel factor involved in TGCT pathogenesis, with a potential prognostic impact. Distinct biologic nature of the two types of relapses occurring in TGCT has been demonstrated. Differential mutation rate of the key TGCT-related genes has been documented. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Erosion of functional independence early in the evolution of a microbial mutualism

PubMed Central

Hillesland, Kristina L.; Lim, Sujung; Flowers, Jason J.; Turkarslan, Serdar; Pinel, Nicolas; Zane, Grant M.; Elliott, Nicholas; Qin, Yujia; Wu, Liyou; Baliga, Nitin S.; Zhou, Jizhong; Wall, Judy D.; Stahl, David A.

2014-01-01

Many species have evolved to function as specialized mutualists, often to the detriment of their ability to survive independently. However, there are few, if any, well-controlled observations of the evolutionary processes underlying the genesis of new mutualisms. Here, we show that within the first 1,000 generations of initiating independent syntrophic interactions between a sulfate reducer (Desulfovibrio vulgaris) and a hydrogenotrophic methanogen (Methanococcus maripaludis), D. vulgaris frequently lost the capacity to grow by sulfate respiration, thus losing the primary physiological attribute of the genus. The loss of sulfate respiration was a consequence of mutations in one or more of three key genes in the pathway for sulfate respiration, required for sulfate activation (sat) and sulfate reduction to sulfite (apsA or apsB). Because loss-of-function mutations arose rapidly and independently in replicated experiments, and because these mutations were correlated with enhanced growth rate and productivity, gene loss could be attributed to natural selection, even though these mutations should significantly restrict the independence of the evolved D. vulgaris. Together, these data present an empirical demonstration that specialization for a mutualistic interaction can evolve by natural selection shortly after its origin. They also demonstrate that a sulfate-reducing bacterium can readily evolve to become a specialized syntroph, a situation that may have often occurred in nature. PMID:25267659

SOS1 and PTPN11 mutations in five cases of Noonan syndrome with multiple giant cell lesions.

PubMed

Beneteau, Claire; Cavé, Hélène; Moncla, Anne; Dorison, Nathalie; Munnich, Arnold; Verloes, Alain; Leheup, Bruno

2009-10-01

We report five cases of multiple giant cell lesions in patients with typical Noonan syndrome. Such association has frequently been referred to as Noonan-like/multiple giant cell (NL/MGCL) syndrome before the molecular definition of Noonan syndrome. Two patients show mutations in PTPN11 (p.Tyr62Asp and p.Asn308Asp) and three in SOS1 (p.Arg552Ser and p.Arg552Thr). The latter are the first SOS1 mutations reported outside PTPN11 in NL/MGCL syndrome. MGCL lesions were observed in jaws ('cherubism') and joints ('pigmented villonodular synovitis'). We show through those patients that both types of MGCL are not PTPN11-specific, but rather represent a low penetrant (or perhaps overlooked) complication of the dysregulated RAS/MAPK signaling pathway. We recommend discarding NL/MGCL syndrome from the nosology, as this presentation is neither gene-nor allele-specific of Noonan syndrome; these patients should be described as Noonan syndrome with MGCL (of the mandible, the long bone...). The term cherubism should be used only when multiple giant cell lesions occur without any other clinical and molecular evidence of Noonan syndrome, with or without mutations of the SH3BP2 gene.

The first USH2A mutation analysis of Japanese autosomal recessive retinitis pigmentosa patients: a totally different mutation profile with the lack of frequent mutations found in Caucasian patients.

PubMed

Zhao, Yang; Hosono, Katsuhiro; Suto, Kimiko; Ishigami, Chie; Arai, Yuuki; Hikoya, Akiko; Hirami, Yasuhiko; Ohtsubo, Masafumi; Ueno, Shinji; Terasaki, Hiroko; Sato, Miho; Nakanishi, Hiroshi; Endo, Shiori; Mizuta, Kunihiro; Mineta, Hiroyuki; Kondo, Mineo; Takahashi, Masayo; Minoshima, Shinsei; Hotta, Yoshihiro

2014-09-01

Retinitis pigmentosa (RP) is a highly heterogeneous genetic disease. The USH2A gene, which accounts for approximately 74-90% of Usher syndrome type 2 (USH2) cases, is also one of the major autosomal recessive RP (arRP) causative genes among Caucasian populations. To identify disease-causing USH2A gene mutations in Japanese RP patients, all 73 exons were screened for mutations by direct sequencing. In total, 100 unrelated Japanese RP patients with no systemic manifestations were identified, excluding families with obvious autosomal dominant inheritance. Of these 100 patients, 82 were included in this present study after 18 RP patients with very likely pathogenic EYS (eyes shut homolog) mutations were excluded. The mutation analysis of the USH2A revealed five very likely pathogenic mutations in four patients. A patient had only one very likely pathogenic mutation and the others had two of them. Caucasian frequent mutations p.C759F in arRP and p.E767fs in USH2 were not found. All the four patients exhibited typical clinical features of RP. The observed prevalence of USH2A gene mutations was approximately 4% among Japanese arRP patients, and the profile of the USH2A gene mutations differed largely between Japanese patients and previously reported Caucasian populations.

[Mutational frequencies in usherin(USH2A gene) in 26 Colombian individuals with Usher syndrome type II].

PubMed

López, Greizy; Gelvez, Nancy Yaneth; Tamayo, Martalucía

2011-03-01

Usher syndrome is a disorder characterized by progressive retinitis pigmentosa, prelingual sensory hearing loss and vestibular dysfunction. It is the most frequent cause of deaf-blindness in humans. Three clinical types and twelve genetic subtypes have been characterized. Type II is the most common, and among these cases, nearly 80% have mutations in the USH2A gene. The aim of the study was to establish the mutational frequencies for the short isoform of USH2A gene in Usher syndrome type II. Twenty-six Colombian individuals with Usher syndrome type II were included. SSCP analysis for 20 exons of the short isoform was performed and abnormal patterns were sequenced. Sequencing of exon 13 of the USH2A gene was performed for all the individuals because the most frequent mutation is located in this exon. The most frequent mutation was c.2299delG, identified in the 27% (n=8) of the sample. The second mutation, p.R334W, showed a frequency of 15%. A new variant identified in the 5’UTR region, g.129G>T, was present in 1 individual (4%). Four polymorphisms were identified; one of them is a new deletion in exon 20, first reported in this study. Mutations in the usherin short isoform were identified in 38% of a sample of 26 USH2 cases. Molecular diagnosis was established in 7 of the 26.

High-density array-CGH with targeted NGS unmask multiple noncontiguous minute deletions on chromosome 3p21 in mesothelioma.

PubMed

Yoshikawa, Yoshie; Emi, Mitsuru; Hashimoto-Tamaoki, Tomoko; Ohmuraya, Masaki; Sato, Ayuko; Tsujimura, Tohru; Hasegawa, Seiki; Nakano, Takashi; Nasu, Masaki; Pastorino, Sandra; Szymiczek, Agata; Bononi, Angela; Tanji, Mika; Pagano, Ian; Gaudino, Giovanni; Napolitano, Andrea; Goparaju, Chandra; Pass, Harvey I; Yang, Haining; Carbone, Michele

2016-11-22

We used a custom-made comparative genomic hybridization array (aCGH; average probe interval 254 bp) to screen 33 malignant mesothelioma (MM) biopsies for somatic copy number loss throughout the 3p21 region (10.7 Mb) that harbors 251 genes, including BRCA1 (breast cancer 1)-associated protein 1 (BAP1), the most commonly mutated gene in MM. We identified frequent minute biallelic deletions (<3 kb) in 46 of 251 genes: four were cancer-associated genes: SETD2 (SET domain-containing protein 2) (7 of 33), BAP1 (8 of 33), PBRM1 (polybromo 1) (3 of 33), and SMARCC1 (switch/sucrose nonfermentable- SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily c, member 1) (2 of 33). These four genes were further investigated by targeted next-generation sequencing (tNGS), which revealed sequence-level mutations causing biallelic inactivation. Combined high-density aCGH and tNGS revealed biallelic gene inactivation in SETD2 (9 of 33, 27%), BAP1 (16 of 33, 48%), PBRM1 (5 of 33, 15%), and SMARCC1 (2 of 33, 6%). The incidence of genetic alterations detected is much higher than reported in the literature because minute deletions are not detected by NGS or commercial aCGH. Many of these minute deletions were not contiguous, but rather alternated with segments showing oscillating copy number changes along the 3p21 region. In summary, we found that in MM: (i) multiple minute simultaneous biallelic deletions are frequent in chromosome 3p21, where they occur as distinct events involving multiple genes; (ii) in addition to BAP1, mutations of SETD2, PBRM1, and SMARCC1 are frequent in MM; and (iii) our results suggest that high-density aCGH combined with tNGS provides a more precise estimate of the frequency and types of genes inactivated in human cancer than approaches based exclusively on NGS strategy.

Chronic Obstructive Pulmonary Disease Is Not Associated with KRAS Mutations in Non-Small Cell Lung Cancer.

PubMed

Saber, Ali; van der Wekken, Anthonie J; Kerner, Gerald S M A; van den Berge, Maarten; Timens, Wim; Schuuring, Ed; ter Elst, Arja; van den Berg, Anke; Hiltermann, T Jeroen N; Groen, Harry J M

2016-01-01

Mutations in epithelial growth factor receptor (EGFR), as well as in the EGFR downstream target KRAS are frequently observed in non-small cell lung cancer (NSCLC). Chronic obstructive pulmonary disease (COPD), an independent risk factor for developing NSCLC, is associated with an increased activation of EGFR. In this study we determined presence of EGFR and KRAS hotspot mutations in 325 consecutive NSCLC patients subjected to EGFR and KRAS mutation analysis in the diagnostic setting and for whom the pulmonary function has been determined at time of NSCLC diagnosis. Information about age at diagnosis, sex, smoking status, forced vital capacity (FVC) and forced expiratory volume in 1 sec (FEV1) was collected. Chronic obstructive pulmonary disease(COPD) was defined according to 2013 GOLD criteria. Chi-Square, student t-test and multivariate logistic regression were used to analyze the data. A total of 325 NSCLC patients were included, 193 with COPD and 132 without COPD. COPD was not associated with presence of KRAS hotspot mutations, while EGFR mutations were significantly higher in non-COPD NSCLC patients. Both female gender (HR 2.61; 95% CI: 1.56-4.39; p<0.001) and smoking (HR 4.10; 95% CI: 1.14-14.79; p = 0.03) were associated with KRAS mutational status. In contrast, only smoking (HR 0.11; 95% CI: 0.04-0.32; p<0.001) was inversely associated with EGFR mutational status. Smoking related G>T and G>C transversions were significantly more frequent in females (86.2%) than in males (61.5%) (p = 0.008). The exon 19del mutation was more frequent in non-smokers (90%) compared to current or past smokers (36.8%). In conclusion, KRAS mutations are more common in females and smokers, but are not associated with COPD-status in NSCLC patients. EGFR mutations are more common in non-smoking NSCLC patients.

The risk of extra-colonic, extra-endometrial cancer in the Lynch syndrome.

PubMed

Watson, Patrice; Vasen, Hans F A; Mecklin, Jukka-Pekka; Bernstein, Inge; Aarnio, Markku; Järvinen, Heikki J; Myrhøj, Torben; Sunde, Lone; Wijnen, Juul T; Lynch, Henry T

2008-07-15

Persons with the Lynch syndrome (LS) are at high risk for cancer, including cancers of the small bowel, stomach, upper urologic tract (renal pelvis and ureter), ovary, biliary tract and brain tumors, in addition to the more commonly observed colorectal and endometrial cancers. Cancer prevention strategies for these less common cancers require accurate, age-specific risk estimation. We pooled data from 4 LS research centers in a retrospective cohort study, to produce absolute incidence estimates for these cancer types, and to evaluate several potential risk modifiers. After elimination of 135 persons missing crucial information, cohort included 6,041 members of 261 families with LS-associated MLH1 or MSH2 mutations. All were either mutation carriers by test, probable mutation carriers (endometrial/colorectal cancer-affected), or first-degree relatives of these. Among mutation carriers and probable carriers, urologic tract cancer (N = 98) had an overall lifetime risk (to age 70) of 8.4% (95% CI: 6.6-10.8); risks were higher in males (p < 0.02) and members of MSH2 families (p < 0.0001). Ovarian cancer (N = 72) had an lifetime risk of 6.7% (95% CI: 5.3-9.1); risks were higher in women born after the median year of birth (p < 0.008) and in members of MSH2 families (p < 0.006). Brain tumors and cancers of the small bowel, stomach, breast and biliary tract were less common. Urologic tract cancer and ovarian cancer occur frequently enough in some LS subgroups to justify trials to evaluate promising prevention interventions. Other cancer types studied occur too infrequently to justify strenuous cancer control interventions. (c) 2008 Wiley-Liss, Inc.

The Risk of Extra-colonic, Extra-endometrial Cancer in the Lynch Syndrome

PubMed Central

Watson, Patrice; Vasen, Hans F.A.; Mecklin, Jukka-Pekka; Bernstein, Inge; Aarnio, Markku; Järvinen, Heikki J.; Myrhøj, Torben; Sunde, Lone; Wijnen, Juul T.; Lynch, Henry T.

2009-01-01

Persons with the Lynch syndrome (LS) are at high risk for cancer, including cancers of the small bowel, stomach, upper urologic tract (renal pelvis and ureter), ovary, biliary tract, and brain tumors, in addition to the more commonly observed colorectal and endometrial cancers. Cancer prevention strategies for these less-common cancers require accurate, age-specific risk estimation. We pooled data from four LS research centers in a retrospective cohort study, to produce absolute incidence estimates for these cancer types, and to evaluate several potential risk modifiers. After elimination of 135 persons missing crucial information, cohort included 6041 members of 261 families with LS-associated MLH1 or MSH2 mutations. All were either mutation carriers by test, probable mutation carriers (endometrial/colorectal cancer-affected), or first-degree relatives of these. Among mutation carriers and probable carriers, urologic tract cancer (N=98) had an overall lifetime risk (to age 70) of 8.4% (95%CI: 6.6–10.8); risks were higher in males (p<0.02) and members of MSH2 families (p<0.0001). Ovarian cancer (N=72) had an lifetime risk of 6.7% (95%CI: 5.3–9.1); risks were higher in women born after the median year of birth (p<0.008) and in members of MSH2 families (p<0.006). Brain tumors and cancers of the small bowel, stomach, breast, and biliary tract were less common. Urologic tract cancer and ovarian cancer occur frequently enough in some LS subgroups to justify trials to evaluate promising prevention interventions. Other cancer types studied occur too infrequently to justify strenuous cancer control interventions. PMID:18398828

Population genetics of the cytoplasm and the units of selection on mitochondrial DNA in Drosophila melanogaster

PubMed Central

2011-01-01

Biological variation exists across a nested set of hierarchical levels from nucleotides within genes to populations within species to lineages within the tree of life. How selection acts across this hierarchy is a long-standing question in evolutionary biology. Recent studies have suggested that genome size is influenced largely by the balance of selection, mutation and drift in lineages with different population sizes. Here we use population cage and maternal transmission experiments to identify the relative strength of selection at an individual and cytoplasmic level. No significant trends were observed in the frequency of large (L) and small (S) mtDNAs across 14 generations in population cages. In all replicate cages, new length variants were observed in heteroplasmic states indicating that spontaneous length mutations occurred in these experimental populations. Heteroplasmic flies carrying L genomes were more frequent than those carrying S genomes suggesting an asymmetric mutation dynamic from larger to smaller mtDNAs. Mother-offspring transmission of heteroplasmy showed that the L mtDNA increased in frequency within flies both between and within generations despite sampling drift of the same intensity as occurred in population cages. These results suggest that selection for mtDNA size is stronger at the cytoplasmic than at the organismal level. The fixation of novel mtDNAs within and between species requires a transient intracellular heteroplasmic stage. The balance of population genetic forces at the cytoplasmic and individual levels governs the units of selection on mtDNA, and has implications for evolutionary inference as well as for the effects of mtDNA mutations on fitness, disease and aging. PMID:21538136

Investigating the Feasibility of Targeted Next-Generation Sequencing to Guide the Treatment of Head and Neck Squamous Cell Carcinoma.

PubMed

Lim, Sun Min; Cho, Sang Hee; Hwang, In Gyu; Choi, Jae Woo; Chang, Hyun; Ahn, Myung-Ju; Park, Keon Uk; Kim, Ji-Won; Ko, Yoon Ho; Ahn, Hee Kyung; Cho, Byoung Chul; Nam, Byung-Ho; Chun, Sang Hoon; Hong, Ji Hyung; Kwon, Jung Hye; Choi, Jong Gwon; Kang, Eun Joo; Yun, Tak; Lee, Keun-Wook; Kim, Joo-Hang; Kim, Jin Soo; Lee, Hyun Woo; Kim, Min Kyoung; Jung, Dongmin; Kim, Ji Eun; Keam, Bhumsuk; Yun, Hwan Jung; Kim, Sangwoo; Kim, Hye Ryun

2018-05-09

Head and neck squamous cell carcinoma (HNSCC) is a deadly disease in which precision medicine needs to be incorporated. We aimed to implement next-generation sequencing (NGS) in determining actionable targets to guide appropriate molecular targeted therapy in HNSCC patients. Ninety-three tumors and matched blood samples underwent targeted sequencing of 244 genes using the Illumina HiSeq 2500 platform with an average depth of coverage of greater than 1,000×. Clinicopathological data from patients were obtained from 17 centers in Korea, and were analyzed in correlation with NGS data. Ninety-two of the 93 tumors were amenable to data analysis. TP53 was the most common mutation, occurring in 47 (51%) patients, followed by CDKN2A (n=23, 25%), CCND1 (n=22, 24%) and PIK3CA (n=19, 21%). The total mutational burden was similar between human papillomavirus (HPV)-negative vs. positive tumors, although TP53, CDKN2A and CCND1 gene alterations occurred more frequently in HPV-negative tumors. HPV-positive tumors were significantly associated with immune signature-related genes compared to HPV-negative tumors. Mutations of NOTCH1 (p=0.027), CDKN2A (p<0.001) and TP53 (p=0.038) were significantly associated with poorer overall survival. FAT1 mutations were highly enriched in cisplatin responders, and potentially targetable alterations such as PIK3CA E545K and CDKN2A R58X were noted in 14 (15%) patients. We found several targetable genetic alterations, and our findings suggest that implementation of precision medicine in HNSCC is feasible. The predictive value of each targetable alteration should be assessed in a future umbrella trial using matched molecular targeted agents.

Lung cancer in never smokers--a review.

PubMed

Couraud, Sébastien; Zalcman, Gérard; Milleron, Bernard; Morin, Franck; Souquet, Pierre-Jean

2012-06-01

An estimated 10-25% of lung cancers worldwide occur in never smokers, i.e. individuals having smoked less than 100 cigarettes in their lifetime. Lung cancer in never smokers (LCINS) is more frequent in women, although large geographic variations are found. Histologically, adenocarcinomas predominate. The mere existence of LCINS suggests that risk factors other than smoking must be present. Exposure to environmental tobacco smoke (particularly in women) and exposure to workplace carcinogens (particularly in men) are the two most important alternative risk factors. However, a history of either is absent in more than a third of LCINS. The large proportion of women in LCINS suggest a hormonal element that may interact with other identified factors such as hereditary risks, a history of respiratory infections or disease, exposure to air pollution, cooking and heating fumes, or exposure to ionising radiation. The study of genomic polymorphisms finds constitutive DNA variations across subjects according to their smoking status, particularly in genes coding for enzymes that participate in the metabolism of certain carcinogens, in those coding for DNA repair enzymes, or in genes associated with tobacco addiction, or inflammatory processes. The type of molecular mutation in p53 or KRAS varies with smoking status. EGFR mutations are more frequent in never smokers, as are EML4-ALK fusions. The mutually exclusive nature of certain mutations is a strong argument in favour of separate genetic paths to cancer for ever smokers and never smokers. In the present paper we review current clinical and molecular aspects of LCINS. Copyright © 2012 Elsevier Ltd. All rights reserved.

Co-occurring genomic alterations define major subsets of KRAS-mutant lung adenocarcinoma with distinct biology, immune profiles, and therapeutic vulnerabilities.

PubMed

Skoulidis, Ferdinandos; Byers, Lauren A; Diao, Lixia; Papadimitrakopoulou, Vassiliki A; Tong, Pan; Izzo, Julie; Behrens, Carmen; Kadara, Humam; Parra, Edwin R; Canales, Jaime Rodriguez; Zhang, Jianjun; Giri, Uma; Gudikote, Jayanthi; Cortez, Maria A; Yang, Chao; Fan, Youhong; Peyton, Michael; Girard, Luc; Coombes, Kevin R; Toniatti, Carlo; Heffernan, Timothy P; Choi, Murim; Frampton, Garrett M; Miller, Vincent; Weinstein, John N; Herbst, Roy S; Wong, Kwok-Kin; Zhang, Jianhua; Sharma, Padmanee; Mills, Gordon B; Hong, Waun K; Minna, John D; Allison, James P; Futreal, Andrew; Wang, Jing; Wistuba, Ignacio I; Heymach, John V

2015-08-01

The molecular underpinnings that drive the heterogeneity of KRAS-mutant lung adenocarcinoma are poorly characterized. We performed an integrative analysis of genomic, transcriptomic, and proteomic data from early-stage and chemorefractory lung adenocarcinoma and identified three robust subsets of KRAS-mutant lung adenocarcinoma dominated, respectively, by co-occurring genetic events in STK11/LKB1 (the KL subgroup), TP53 (KP), and CDKN2A/B inactivation coupled with low expression of the NKX2-1 (TTF1) transcription factor (KC). We further revealed biologically and therapeutically relevant differences between the subgroups. KC tumors frequently exhibited mucinous histology and suppressed mTORC1 signaling. KL tumors had high rates of KEAP1 mutational inactivation and expressed lower levels of immune markers, including PD-L1. KP tumors demonstrated higher levels of somatic mutations, inflammatory markers, immune checkpoint effector molecules, and improved relapse-free survival. Differences in drug sensitivity patterns were also observed; notably, KL cells showed increased vulnerability to HSP90-inhibitor therapy. This work provides evidence that co-occurring genomic alterations identify subgroups of KRAS-mutant lung adenocarcinoma with distinct biology and therapeutic vulnerabilities. Co-occurring genetic alterations in STK11/LKB1, TP53, and CDKN2A/B-the latter coupled with low TTF1 expression-define three major subgroups of KRAS-mutant lung adenocarcinoma with distinct biology, patterns of immune-system engagement, and therapeutic vulnerabilities. ©2015 American Association for Cancer Research.

[Retrospective Analysis of the Afatinib Clinical Pathway during the 28-Day Introductory Period-The Japanese Style of Collaborative Drug Therapy Management(J-CDTM)].

PubMed

Iwata, Kaori; Ryota, Noriko; Hikita, Ami; Sando, Masumi; Suzuki, Hidekazu; Tamiya, Motohiro; Azuma, Yuichiro; Tani, Eriko; Hamaguchi, Masanari; Tanaka, Ayako; Shiroyama, Takayuki; Morishita, Naoko; Okamoto, Norio; Futagami, Sumiko; Hirashima, Tomonori

2015-08-01

Afatinib is a newly approved second-generation epidermal growth factor receptor-tyrosine kinase inhibito r(EGFR-TKI). Afatinib has been shown to prolongthe overall survival of patients with non-small cell lungcancer (NSCLC) with EGFR mutations compared with the standard chemotherapy. However, Grade 3 or 4 toxicities, includingdiarrhea, rash, paronychia, and stomatitis, have been observed more frequently in patients treated with afatinib than in those treated with first-generation EGFR-TKIs. Accordingly, our institution developed an afatinib clinical pathway (the afatinib pathway), which was designed by certified nurses, medical physicians, and certified pharmacists, with the goal of reducing the severity of diarrhea and rash that occur most frequently duringthe 28-day introductory period of afatinib treatment. Between May and October 2014, afatinib was administered accordingto the afatinib pathway to 14 patients with NSCLC and EGFR mutations. Of these patients, only one (7.1%) experienced Grade 3 diarrhea. No other patient experienced Grade 3 or 4 toxicity. The afatinib pathway was effective in reducingthe severities of the diarrhea and rash duringthe 28-day introductory period of the afatinib treatment. Our implementation of the afatinib pathway could be considered the Japanese style of collaborative drugtherapy management (J-CDTM).

Mutations in the newly identified RAX regulatory sequence are not a frequent cause of micro/anophthalmia.

PubMed

Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick

2009-06-01

Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.

Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

PubMed

Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

2013-02-15

Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Mutations of NPM1 gene in de novo acute myeloid leukaemia: determination of incidence, distribution pattern and identification of two novel mutations in Indian population.

PubMed

Ahmad, Firoz; Mandava, Swarna; Das, Bibhu Ranjan

2009-06-01

Mutations in the nucleophosmin (NPM1) gene have been recently described to occur in about one-third of acute myeloid leukaemias (AMLs) and represent the most frequent genetic alteration currently known in this subset, specially in those with normal karyotype. This study explored the prevalence and clinical profile of NPM1 mutations in a cohort of 200 Indian adult and children with AML. NPM1 mutations were observed in 19.5% of all population and 34.2% of those with normal karyotype. Adults had a significantly higher incidence of NPM1 mutations than children [38 of 161 (23.6%) vs. 1 of 39 (2.5%), p = 0.002]. NPM1 mutations were significantly associated with normal karyotype (p = 0.001), high WBC count (p = 0.034), AML-M4 subtype (p = 0.039) and a gradient increase of mutation rate with the increase in age groups. Sequence analysis of 39 mutated cases revealed typical mutations (types A, B, D, Nm and H*) as well as two novel variations (types F1 and F2). Majority of the patients had mutation type A (69.2%), followed by B (5.1%), D (15.3%), H* (2.5%) and Nm (2.5%) all involving COOH terminal of the NPM1 protein. In conclusion, this study represents the first report of NPM1 mutation from Indian population and confirms that the incidence of NPM1 mutations varies considerably globally, with slightly lower incidence in Indian population compared to western countries. The current study also served to identify two novel NPM1 mutants that add new insights into the heterogeneity of genomic insertions at exon 12. More ongoing larger studies are warranted to elucidate the molecular pathogenesis of AML that arises in this part of the world. Furthermore, we believe that in light of its high prevalence worldwide, inclusion of NPM1 mutation detection assay in diagnostic evaluations of AML may improve the efficacy of routine genetic characterization and allow assignment of patients to better-defined risk categories.

Spectrum and prevalence of FP/TMEM127 gene mutations in pheochromocytomas and paragangliomas.

PubMed

Yao, Li; Schiavi, Francesca; Cascon, Alberto; Qin, Yuejuan; Inglada-Pérez, Lucia; King, Elizabeth E; Toledo, Rodrigo A; Ercolino, Tonino; Rapizzi, Elena; Ricketts, Christopher J; Mori, Luigi; Giacchè, Mara; Mendola, Antonella; Taschin, Elisa; Boaretto, Francesca; Loli, Paola; Iacobone, Maurizio; Rossi, Gian-Paolo; Biondi, Bernadette; Lima-Junior, José Viana; Kater, Claudio E; Bex, Marie; Vikkula, Miikka; Grossman, Ashley B; Gruber, Stephen B; Barontini, Marta; Persu, Alexandre; Castellano, Maurizio; Toledo, Sergio P A; Maher, Eamonn R; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Dahia, Patricia L M

2010-12-15

Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P = 2.7 × 10(-4)) and/or with familial disease (5 of 20 samples; P = .005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P = .54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occurred in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein.

Molecular Diagnostics of Gliomas Using Next Generation Sequencing of a Glioma-Tailored Gene Panel.

PubMed

Zacher, Angela; Kaulich, Kerstin; Stepanow, Stefanie; Wolter, Marietta; Köhrer, Karl; Felsberg, Jörg; Malzkorn, Bastian; Reifenberger, Guido

2017-03-01

Current classification of gliomas is based on histological criteria according to the World Health Organization (WHO) classification of tumors of the central nervous system. Over the past years, characteristic genetic profiles have been identified in various glioma types. These can refine tumor diagnostics and provide important prognostic and predictive information. We report on the establishment and validation of gene panel next generation sequencing (NGS) for the molecular diagnostics of gliomas. We designed a glioma-tailored gene panel covering 660 amplicons derived from 20 genes frequently aberrant in different glioma types. Sensitivity and specificity of glioma gene panel NGS for detection of DNA sequence variants and copy number changes were validated by single gene analyses. NGS-based mutation detection was optimized for application on formalin-fixed paraffin-embedded tissue specimens including small stereotactic biopsy samples. NGS data obtained in a retrospective analysis of 121 gliomas allowed for their molecular classification into distinct biological groups, including (i) isocitrate dehydrogenase gene (IDH) 1 or 2 mutant astrocytic gliomas with frequent α-thalassemia/mental retardation syndrome X-linked (ATRX) and tumor protein p53 (TP53) gene mutations, (ii) IDH mutant oligodendroglial tumors with 1p/19q codeletion, telomerase reverse transcriptase (TERT) promoter mutation and frequent Drosophila homolog of capicua (CIC) gene mutation, as well as (iii) IDH wildtype glioblastomas with frequent TERT promoter mutation, phosphatase and tensin homolog (PTEN) mutation and/or epidermal growth factor receptor (EGFR) amplification. Oligoastrocytic gliomas were genetically assigned to either of these groups. Our findings implicate gene panel NGS as a promising diagnostic technique that may facilitate integrated histological and molecular glioma classification. © 2016 International Society of Neuropathology.

Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction.

PubMed

Do, Ron; Stitziel, Nathan O; Won, Hong-Hee; Jørgensen, Anders Berg; Duga, Stefano; Angelica Merlini, Pier; Kiezun, Adam; Farrall, Martin; Goel, Anuj; Zuk, Or; Guella, Illaria; Asselta, Rosanna; Lange, Leslie A; Peloso, Gina M; Auer, Paul L; Girelli, Domenico; Martinelli, Nicola; Farlow, Deborah N; DePristo, Mark A; Roberts, Robert; Stewart, Alexander F R; Saleheen, Danish; Danesh, John; Epstein, Stephen E; Sivapalaratnam, Suthesh; Hovingh, G Kees; Kastelein, John J; Samani, Nilesh J; Schunkert, Heribert; Erdmann, Jeanette; Shah, Svati H; Kraus, William E; Davies, Robert; Nikpay, Majid; Johansen, Christopher T; Wang, Jian; Hegele, Robert A; Hechter, Eliana; Marz, Winfried; Kleber, Marcus E; Huang, Jie; Johnson, Andrew D; Li, Mingyao; Burke, Greg L; Gross, Myron; Liu, Yongmei; Assimes, Themistocles L; Heiss, Gerardo; Lange, Ethan M; Folsom, Aaron R; Taylor, Herman A; Olivieri, Oliviero; Hamsten, Anders; Clarke, Robert; Reilly, Dermot F; Yin, Wu; Rivas, Manuel A; Donnelly, Peter; Rossouw, Jacques E; Psaty, Bruce M; Herrington, David M; Wilson, James G; Rich, Stephen S; Bamshad, Michael J; Tracy, Russell P; Cupples, L Adrienne; Rader, Daniel J; Reilly, Muredach P; Spertus, John A; Cresci, Sharon; Hartiala, Jaana; Tang, W H Wilson; Hazen, Stanley L; Allayee, Hooman; Reiner, Alex P; Carlson, Christopher S; Kooperberg, Charles; Jackson, Rebecca D; Boerwinkle, Eric; Lander, Eric S; Schwartz, Stephen M; Siscovick, David S; McPherson, Ruth; Tybjaerg-Hansen, Anne; Abecasis, Goncalo R; Watkins, Hugh; Nickerson, Deborah A; Ardissino, Diego; Sunyaev, Shamil R; O'Donnell, Christopher J; Altshuler, David; Gabriel, Stacey; Kathiresan, Sekar

2015-02-05

Myocardial infarction (MI), a leading cause of death around the world, displays a complex pattern of inheritance. When MI occurs early in life, genetic inheritance is a major component to risk. Previously, rare mutations in low-density lipoprotein (LDL) genes have been shown to contribute to MI risk in individual families, whereas common variants at more than 45 loci have been associated with MI risk in the population. Here we evaluate how rare mutations contribute to early-onset MI risk in the population. We sequenced the protein-coding regions of 9,793 genomes from patients with MI at an early age (≤50 years in males and ≤60 years in females) along with MI-free controls. We identified two genes in which rare coding-sequence mutations were more frequent in MI cases versus controls at exome-wide significance. At low-density lipoprotein receptor (LDLR), carriers of rare non-synonymous mutations were at 4.2-fold increased risk for MI; carriers of null alleles at LDLR were at even higher risk (13-fold difference). Approximately 2% of early MI cases harbour a rare, damaging mutation in LDLR; this estimate is similar to one made more than 40 years ago using an analysis of total cholesterol. Among controls, about 1 in 217 carried an LDLR coding-sequence mutation and had plasma LDL cholesterol > 190 mg dl(-1). At apolipoprotein A-V (APOA5), carriers of rare non-synonymous mutations were at 2.2-fold increased risk for MI. When compared with non-carriers, LDLR mutation carriers had higher plasma LDL cholesterol, whereas APOA5 mutation carriers had higher plasma triglycerides. Recent evidence has connected MI risk with coding-sequence mutations at two genes functionally related to APOA5, namely lipoprotein lipase and apolipoprotein C-III (refs 18, 19). Combined, these observations suggest that, as well as LDL cholesterol, disordered metabolism of triglyceride-rich lipoproteins contributes to MI risk.

Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozata, M.; Suzuki, Satoru; Takeda, Teiji

Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity ofmore » the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.« less

Novel USH2A mutations in Japanese Usher syndrome type 2 patients: marked differences in the mutation spectrum between the Japanese and other populations.

PubMed

Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Usami, Shin-Ichi; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

2011-07-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 2 (USH2) is the most common type of USH and is frequently caused by mutations in USH2A. In a recent mutation screening of USH2A in Japanese USH2 patients, we identified 11 novel mutations in 10 patients and found the possible frequent mutation c.8559-2A>G in 4 of 10 patients. To obtain a more precise mutation spectrum, we analyzed further nine Japanese patients in this study. We identified nine mutations, of which eight were novel. This result indicates that the mutation spectrum for USH2A among Japanese patients largely differs from Caucasian, Jewish and Palestinian patients. Meanwhile, we did not find the c.8559-2A>G in this study. Haplotype analysis of the c.8559-2G (mutated) alleles using 23 single nucleotide polymorphisms surrounding the mutation revealed an identical haplotype pattern of at least 635 kb in length, strongly suggesting that the mutation originated from a common ancestor. The fact that all patients carrying c.8559-2A>G came from western Japan suggests that the mutation is mainly distributed in that area; indeed, most of the patients involved in this study came from eastern Japan, which contributed to the absence of c.8559-2A>G.

Heterozygous Mutations Causing Partial Prohormone Convertase 1 Deficiency Contribute to Human Obesity

PubMed Central

Creemers, John W.M.; Choquet, Hélène; Stijnen, Pieter; Vatin, Vincent; Pigeyre, Marie; Beckers, Sigri; Meulemans, Sandra; Than, Manuel E.; Yengo, Loïc; Tauber, Maithé; Balkau, Beverley; Elliott, Paul; Jarvelin, Marjo-Riitta; Van Hul, Wim; Van Gaal, Luc; Horber, Fritz; Pattou, François; Froguel, Philippe; Meyre, David

2012-01-01

Null mutations in the PCSK1 gene, encoding the proprotein convertase 1/3 (PC1/3), cause recessive monogenic early onset obesity. Frequent coding variants that modestly impair PC1/3 function mildly increase the risk for common obesity. The aim of this study was to determine the contribution of rare functional PCSK1 mutations to obesity. PCSK1 exons were sequenced in 845 nonconsanguineous extremely obese Europeans. Eight novel nonsynonymous PCSK1 mutations were identified, all heterozygous. Seven mutations had a deleterious effect on either the maturation or the enzymatic activity of PC1/3 in cell lines. Of interest, five of these novel mutations, one of the previously described frequent variants (N221D), and the mutation found in an obese mouse model (N222D), affect residues at or near the structural calcium binding site Ca-1. The prevalence of the newly identified mutations was assessed in 6,233 obese and 6,274 lean European adults and children, which showed that carriers of any of these mutations causing partial PCSK1 deficiency had an 8.7-fold higher risk to be obese than wild-type carriers. These results provide the first evidence of an increased risk of obesity in heterozygous carriers of mutations in the PCSK1 gene. Furthermore, mutations causing partial PCSK1 deficiency are present in 0.83% of extreme obesity phenotypes. PMID:22210313

Heterozygous mutations causing partial prohormone convertase 1 deficiency contribute to human obesity.

PubMed

Creemers, John W M; Choquet, Hélène; Stijnen, Pieter; Vatin, Vincent; Pigeyre, Marie; Beckers, Sigri; Meulemans, Sandra; Than, Manuel E; Yengo, Loïc; Tauber, Maithé; Balkau, Beverley; Elliott, Paul; Jarvelin, Marjo-Riitta; Van Hul, Wim; Van Gaal, Luc; Horber, Fritz; Pattou, François; Froguel, Philippe; Meyre, David

2012-02-01

Null mutations in the PCSK1 gene, encoding the proprotein convertase 1/3 (PC1/3), cause recessive monogenic early onset obesity. Frequent coding variants that modestly impair PC1/3 function mildly increase the risk for common obesity. The aim of this study was to determine the contribution of rare functional PCSK1 mutations to obesity. PCSK1 exons were sequenced in 845 nonconsanguineous extremely obese Europeans. Eight novel nonsynonymous PCSK1 mutations were identified, all heterozygous. Seven mutations had a deleterious effect on either the maturation or the enzymatic activity of PC1/3 in cell lines. Of interest, five of these novel mutations, one of the previously described frequent variants (N221D), and the mutation found in an obese mouse model (N222D), affect residues at or near the structural calcium binding site Ca-1. The prevalence of the newly identified mutations was assessed in 6,233 obese and 6,274 lean European adults and children, which showed that carriers of any of these mutations causing partial PCSK1 deficiency had an 8.7-fold higher risk to be obese than wild-type carriers. These results provide the first evidence of an increased risk of obesity in heterozygous carriers of mutations in the PCSK1 gene. Furthermore, mutations causing partial PCSK1 deficiency are present in 0.83% of extreme obesity phenotypes.

[Recurrent vascular access trombosis associated with the prothrombin mutation G20210A in a adult patient in haemodialysis].

PubMed

Quintana, L F; Coll, E; Monteagudo, I; Collado, S; López-Pedret, J; Cases, A

2005-01-01

Vascular access-related complications are a frequent cause of morbidity in haemodialysis patients and generate high costs. We present the case of an adult patient with end-stage renal disease and recurrent vascular access thrombosis associated with the prothrombin mutation G20210A and renal graft intolerance. The clinical expression of this heterozygous gene mutation may have been favoured by inflammatory state, frequent in dialysis patients. In this patient, the inflammatory response associated with the renal graft intolerance would have favored the development of recurrent vascular access thrombosis in a adult heterozygous for prothrombin mutation G20210A. In the case of early dysfunction of haemodialysis vascular access and after ruling out technical problems, it is convenient to carry out a screening for thrombophilia.

Loss of MSH3 protein expression is frequent in MLH1-deficient colorectal cancer and is associated with disease progression.

PubMed

Plaschke, Jens; Krüger, Stefan; Jeske, Birgit; Theissig, Franz; Kreuz, Friedmar R; Pistorius, Steffen; Saeger, Hans D; Iaccarino, Ingram; Marra, Giancarlo; Schackert, Hans K

2004-02-01

Mononucleotide repeat sequences are particularly prone to frameshift mutations in tumors with biallelic inactivation of the mismatch repair (MMR) genes MLH1 or MSH2. In these tumors, several genes harboring mononucleotide repeats in their coding region have been proposed as targets involved in tumor progression, among which are also the MMR genes MSH3 and MSH6. We have analyzed the expression of the MSH3 and MSH6 proteins by immunohistochemistry in 31 colorectal carcinomas in which MLH1 was inactivated. Loss of MSH3 expression was identified in 15 tumors (48.5%), whereas all tumors expressed MSH6. Frameshift mutations at coding microsatellites were more frequent in MSH3 (16 of 31) than in MSH6 (3 of 31; Fisher's exact test, P < 0.001). Frameshift mutations and allelic losses of MSH3 were more frequent in MSH3-negative tumors compared with those with normal expression (22 mutations in 30 alleles versus 8 mutations in 28 alleles; chi(2), P = 0.001). Biallelic inactivation was evident or inferred for 60% of MSH3-negative tumors but none of the tumors with normal MSH3 expression. In contrast, we did not identify frameshift mutations in the (A)8 tract of MSH3 in a control group of 18 colorectal carcinomas in which the MMR deficiency was based on the inactivation of MSH2. As it has been suggested that mutations of MSH3 might play a role in tumor progression, we studied the association between MSH3 expression and disease stage assessed by lymph node and distant metastases status. Dukes stages C and D were more frequent in primary tumors with loss of MSH3 expression (9 of 13), compared with tumors with retained expression (1 of 14; Fisher's exact test, P = 0.001), suggesting that MSH3 abrogation may be a predictor of metastatic disease or even favor tumor cell spread in MLH1-deficient colorectal cancers.

Functional significance of co-occurring mutations in PIK3CA and MAP3K1 in breast cancer.

PubMed

Avivar-Valderas, Alvaro; McEwen, Robert; Taheri-Ghahfarokhi, Amir; Carnevalli, Larissa S; Hardaker, Elizabeth L; Maresca, Marcello; Hudson, Kevin; Harrington, Elizabeth A; Cruzalegui, Francisco

2018-04-20

The PI3Kα signaling pathway is frequently hyper-activated in breast cancer (BrCa), as a result of mutations/amplifications in oncogenes (e.g. HER2 ), decreased function in tumor suppressors (e.g. PTEN ) or activating mutations in key components of the pathway. In particular, activating mutations of PIK3CA (~45%) are frequently found in luminal A BrCa samples. Genomic studies have uncovered inactivating mutations in MAP3K1 (13-20%) and MAP2K4 (~8%), two upstream kinases of the JNK apoptotic pathway in luminal A BrCa samples. Further, simultaneous mutation of PIK3CA and MAP3K1 are found in ~11% of mutant PIK3CA tumors. How these two alterations may cooperate to elicit tumorigenesis and impact the sensitivity to PI3K and AKT inhibitors is currently unknown. Using CRISPR gene editing we have genetically disrupted MAP3K1 expression in mutant PIK3CA cell lines to specifically create in vitro models reflecting the mutational status of PIK3CA and MAP3K1 in BrCa patients. MAP3K1 deficient cell lines exhibited ~2.4-fold increased proliferation rate and decreased sensitivity to PI3Kα/δ(AZD8835) and AKT (AZD5363) inhibitors (~2.61 and ~5.23-fold IC 50 increases, respectively) compared with parental control cell lines. In addition, mechanistic analysis revealed that MAP3K1 disruption enhances AKT phosphorylation and downstream signaling and reduces sensitivity to AZD5363-mediated pathway inhibition. This appears to be a consequence of deficient MAP3K1-JNK signaling increasing IRS1 stability and therefore promoting IRS1 binding to p85, resulting in enhanced PI3Kα activity. Using 3D-MCF10A-PI3Kα H1047R models, we found that MAP3K1 depletion increased overall acinar volume and counteracted AZD5363-mediated reduction of acinar growth due to enhanced proliferation and reduced apoptosis. Furthermore, in vivo efficacy studies revealed that MAP3K1-deficient MCF7 tumors were less sensitive to AKT inhibitor treatment, compared with parental MCF7 tumors. Our study provides mechanistic and in vivo evidence indicating a role for MAP3K1 as a tumor suppressor gene at least in the context of PIK3CA -mutant backgrounds. Further, our work predicts that MAP3K1 mutational status may be considered as a predictive biomarker for efficacy in PI3K pathway inhibitor trials.

Frequency of TERT promoter mutations in primary tumors of the liver.

PubMed

Quaas, Alexander; Oldopp, Theresa; Tharun, Lars; Klingenfeld, Catina; Krech, Till; Sauter, Guido; Grob, Tobias J

2014-12-01

Transcriptional regulation of the TERT gene is a major cause of the cancer-specific increase in telomerase activity. Recently, frequent somatic mutations in the TERT promoter have been described in several tumor entities such as melanoma, glioblastoma, bladder cancer, and hepatocellular carcinoma. By generating a putative consensus binding site for ETS transcription factors within the TERT promoter, these mutations are predicted to increase promoter activity and TERT transcription. In order to improve the understanding of the role of TERT promoter mutation in liver tumorigenesis, the mutational status of the TERT promoter was analyzed in 78 hepatocellular carcinomas, 15 hepatocellular adenomas, and 52 intrahepatic cholangiocarciomas. The promoter region of TERT was screened for the two hotspot mutations using PCR and restriction fragment length analysis, utilizing the introduction of novel restriction sites by the somatic mutations. TERT promoter mutation was found in 37 of 78 hepatocellular carcinomas (47 %) and was restricted to the -124C>T mutation. Frequency of mutations was associated with grade of differentiation ranging from 39 % in well-differentiated tumors to 73 % in high-grade hepatocellular carcinomas. TERT promoter mutations were not found in 15 hepatocellular adenomas and 52 intrahepatic cholangiocarcinomas. These data show that TERT promoter mutation is the most frequent genetic alteration in hepatocellular carcinoma known at this time. The striking predominance of the -124C>T mutation compared with other tumor entities suggest a biological difference of the two hotspot mutations. Analysis of TERT promoter mutation might become a diagnostic tool distinguishing hepatocellular adenoma from well-differentiated hepatocellular carcinoma.

Non-cardiac manifestations of Marfan syndrome

PubMed Central

2017-01-01

Because of the widespread distribution of fibrillin 1 in the body, Marfan syndrome (MFS) affects virtually every system. The expression of this single dominantly inherited gene is variable within a family, and between families. There is some genotype-phenotype correlation which is helpful in guiding long-term prognosis, and management. In general gene mutations have been reported in clusters, with those having mainly ocular manifestations occurring in exons 1 to 15 of this 65-exon gene; those causing cardiac problems often involving cysteine replacement in a calcium binding EGF-like sequence; the most severe mutations occurring in exons 25–32, causing neonatal MFS diagnosed at birth, and severe enough to cause death frequently before the age of 2. Other correlations will certainly be found in future. This condition is progressive, and the manifestations unfold according to age. For example, if the lens is going to dislocate this usually occurs by age 10; scoliosis usually presents itself between the ages of 8 and 15; height should be monitored carefully between the onset of puberty and cessation of growth approximately age 17 or 18. Holistic care should be offered by one doctor who oversees the patient’s welfare. This should be a paediatrician, paediatric cardiologist, or general practitioner in the case of an affected child. Thereafter, the physician in charge of the most seriously affected system should be aware that other systems need to be managed through a referral network. PMID:29270372

TERT promoter mutations contribute to IDH mutations in predicting differential responses to adjuvant therapies in WHO grade II and III diffuse gliomas

PubMed Central

Ding, Xiao-Jie; Qin, Zhi-Yong; Hong, Christopher S.; Chen, Ling-Chao; Zhang, Xin; Zhao, Fang-Ping; Wang, Yin; Wang, Yang; Zhou, Liang-Fu; Zhuang, Zhengping; Ng, Ho-Keung; Yan, Hai; Yao, Yu; Mao, Ying

2015-01-01

IDH mutations frequently occur in WHO grade II and III diffuse gliomas and have favorable prognosis compared to wild-type tumors. However, whether IDH mutations in WHO grade II and II diffuse gliomas predict enhanced sensitivity to adjuvant radiation (RT) or chemotherapy (CHT) is still being debated. Recent studies have identified recurrent mutations in the promoter region of telomerase reverse transcriptase (TERT) in gliomas. We previously demonstrated that TERT promoter mutations may be promising biomarkers in glioma survival prognostication when combined with IDH mutations. This study analyzed IDH and TERT promoter mutations in 295 WHO grade II and III diffuse gliomas treated with or without adjuvant therapies to explore their impact on the sensitivity of tumors to genotoxic therapies. IDH mutations were found in 216 (73.2%) patients and TERT promoter mutations were found in 112 (38%) patients. In multivariate analysis, IDH mutations (p < 0.001) were independent prognostic factors for PFS and OS in patients receiving genotoxic therapies while TERT promoter mutations were not. In univariate analysis, IDH and TERT promoter mutations were not significant prognostic factors in patients who did not receive genotoxic therapies. Adjuvant RT and CHT were factors independently impacting PFS (RT p = 0.001, CHT p = 0.026) in IDH mutated WHO grade II and III diffuse gliomas but not in IDH wild-type group. Univariate and multivariate analyses demonstrated TERT promoter mutations further stratified IDH wild-type WHO grade II and III diffuse gliomas into two subgroups with different responses to genotoxic therapies. Adjuvant RT and CHT were significant parameters influencing PFS in the IDH wt/TERT mut subgroup (RT p = 0.015, CHT p = 0.015) but not in the IDH wt/TERT wt subgroup. Our data demonstrated that IDH mutated WHO grade II and III diffuse gliomas had better PFS and OS than their IDH wild-type counterparts when genotoxic therapies were administered after surgery. Importantly, we also found that TERT promoter mutations further stratify IDH wild-type WHO grade II and III diffuse gliomas into two subgroups with different responses to adjuvant therapies. Taken together, TERT promoter mutations may predict enhanced sensitivity to genotoxic therapies in IDH wild-type WHO grade II and III diffuse gliomas and may justify intensified treatment in this subgroup. PMID:26314843

Mutation frequency in 15 common cancer genes in high-risk head and neck squamous cell carcinoma.

PubMed

McBride, Sean M; Rothenberg, S Michael; Faquin, William C; Chan, Annie W; Clark, John R; Ellisen, Leif W; Wirth, Lori J

2014-08-01

With prior studies having looked at unselected cohorts, we sought to explore the mutational landscape in a high-risk group of head and neck squamous cell carcinoma (HNSCC) tumors. A multiplexed polymerase chain reaction (PCR) assay evaluating 68 loci in 15 genes was performed on 64 patients with high-risk HNSCC. Because of the frequent PIK3CA and AKT1 mutations in patients with oropharyngeal carcinoma, we evaluated the relationship between mutation status and both clinical/pathologic variables and tumor control in this subgroup. Seventeen of 64 patients harbored mutations in the assayed loci: 16% in PIK3CA, 9% in TP53, 2% in AKT1, and 2% in epidermal growth factor receptor (EGFR). The frequency of PIK3CA/AKT1 mutations in oropharyngeal and sinonasal primaries was increased compared to other primary sites (35% vs 6%; p = .005). There was no relationship between mutation status and overall survival (OS), disease-specific death, or progression in the oropharyngeal cohort. We identified frequent PIK3CA mutations in patients with high-risk HNSCC confined predominantly to the oropharyngeal and sinonasal subsites; for the first time, mutation in AKT1 has been identified in HNSCC. Copyright © 2014 Wiley Periodicals, Inc.

Contrasting molecular pathology of colorectal carcinoma in Egyptian and Western patients

PubMed Central

Soliman, A S; Bondy, M L; El-Badawy, S A; Mokhtar, N; Eissa, S; Bayoumy, S; Seifeldin, I A; Houlihan, P S; Lukish, J R; Watanabe, T; Chan, A On On; Zhu, D; Amos, C I; Levin, B; Hamilton, S R

2001-01-01

Colorectal carcinoma is uncommon in Egypt, but a high proportion of cases occurs before age 40 years and in the rectum. We compared the molecular pathology of 59 representative Egyptian patients aged 10–72 to Western patients with sporadic, young-onset, or hereditary non-polyposis colorectal cancer syndrome (HNPCC)-associated carcinoma and found significant differences. Most Egyptian cancers were rectal (51%) and poorly differentiated (58%). High levels of microsatellite instability (MSI-H) were frequent (37%) and attributable in some cases (36%) to methylation of the promoter of the hMLH1 mismatch repair gene, but no MSI-H cancer had loss of hMSH2 mismatch repair gene product of the type seen with germline hMSH2 mutation in HNPCC. K-ras mutation was uncommon (11%). In subset analyses, high frequencies of MSI-H in rectal carcinomas (36%) and p53 gene product overexpression in MSI-H cancers (50%) were found. MSI-H and K-ras mutation in Egyptians under age 40 were unusual (17% and 0%, respectively), and schistosomiasis was associated with MSI and K-ras mutation. Cluster analysis identified 2 groups: predominantly young men with poorly differentiated mucinous and signet-ring cell colorectal carcinoma lacking K-ras mutation; older patients who had well- or moderately differentiated adenocarcinoma often with MSI-H, K-ras mutation and schistosomiasis. Our findings show that the molecular pathology of colorectal cancer in older as well as younger Egyptians has unique differences from Western patients, and schistosomiasis influences the molecular pathogenesis of some tumours. © 2001 Cancer Research Campaignhttp://www.bjcancer.com PMID:11592777

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruening, W.; Nakagama, H.: Bardessy, N.

Wilms` tumor (WT), an embryonal malignancy of the kidney, occurs most frequently in children under the age of 5 years, affecting {approximately}1 in 10,000 individuals. The WT1 tumor suppressor gene, residing at 11p13, is structurally altered in {approximately}10-15% of WT cases. Individuals with germline mutations within the WT1 gene suffer from predisposition to WT and developmental defects of the urogenital system. Patients with heterozygous deletions of the WT1 gene, or mutations predicted to cause inactivation of one WT1 allele, suffer relatively mild genital system defects (notably hypospadias and cryptorchidism in males) and a predisposition to WT. These results suggest thatmore » developing genital system development is sensitive to the absolute concentrations of the WT1 gene products. Patients with missense mutations within the WT1 gene, however, can suffer from a much more severe disorder known as Denys-Drash syndrome (DDS). This syndrome is characterized by intersex disorders, renal nephropathy, and a predisposition to WTs. The increased severity of the developmental defects associated with DDS, compared to those individuals with mild genital system anomalies and WTs, suggests that mutations defined in patients with DDS behave in a dominant-negative fashion. We have identified a novel WT1 mutation in a patient with DDS. This mutation, predicted to produce a truncated WT1 polypeptide encompassing exons 1, 2, and 3, defines a domain capable of behaving as an antimorph. We have also demonstrated that WT1 can self-associate in vivo using yeast two-hybrid systems. Deletion analysis have mapped the interacting domains to the amino terminus of the WT1 polypeptide, within exons 1 and 2. These results provide a molecular mechanism to explain how WT1 mutations can function in a dominant-negative fashion to eliminate wild-type WT1 activity, leading to DDS.« less

Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

PubMed Central

Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

2010-01-01

Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

Frequency and patterns of protease gene resistance mutations in HIV-infected patients treated with lopinavir/ritonavir as their first protease inhibitor.

PubMed

Barber, Tristan J; Harrison, Linda; Asboe, David; Williams, Ian; Kirk, Stuart; Gilson, Richard; Bansi, Loveleen; Pillay, Deenan; Dunn, David

2012-04-01

Selection of protease mutations on antiretroviral therapy (ART) including a ritonavir-boosted protease inhibitor (PI) has been reported infrequently. Scarce data exist from long-term cohorts on resistance incidence or mutational patterns emerging to different PIs. We studied UK patients receiving lopinavir/ritonavir as their first PI, either while naive to ART or having previously received non-PI-based ART. Virological failure was defined as viral load ≥ 400 copies/mL after previous suppression <400 copies/mL, or failure to achieve <400 copies/mL during the first 6 months. pol sequences whilst failing lopinavir or within 30 days after stopping were analysed. Major and minor mutations (IAS-USA 2008-after exclusion of polymorphisms) were considered. Predicted susceptibility was determined using the Stanford HIVdb algorithm. Three thousand and fifty-six patients were followed for a median (IQR) of 14 (6-30) months, of whom 811 (27%) experienced virological failure. Of these, resistance test results were available on 291 (36%). One or more protease mutations were detected in 32 (11%) patients; the most frequent were I54V (n = 12), M46I (n = 11), V82A (n = 7) and L76V (n = 3). No association with viral subtype was evident. Many patients retained virus predicted to be susceptible to lopinavir (14, 44%), tipranavir (26, 81%) and darunavir (27, 84%). This study reflects the experience of patients in routine care. Selection of protease gene mutations by lopinavir/ritonavir occurred at a much higher rate than in clinical trials. The mutations observed showed only partial overlap with those previously identified by structural chemistry models, serial cell culture passage and genotype-phenotype analyses. There remained a low degree of predicted cross-resistance to other widely used PIs.

Identification of three subgroups of B cell chronic lymphocytic leukemia based upon mutations of BCL-6 and IgV genes.

PubMed

Capello, D; Fais, F; Vivenza, D; Migliaretti, G; Chiorazzi, N; Gaidano, G; Ferrarini, M

2000-05-01

Although B cell chronic lymphocytic leukemia (B-CLL) has been traditionally viewed as a tumor of virgin B cells, this notion has been recently questioned by data suggesting that a fraction of B-CLL derives from antigen experienced B cells. In order to further clarify the histogenetic derivation of this lymphoproliferation, we have analyzed the DNA sequences of the 5' non-coding region of BCL-6 proto-oncogene in 28 cases of B-CLL. Mutations of BCL-6 proto-oncogene, a zinc finger transcription factor implicated in lymphoma development, represent a histogenetic marker of B cell transit through the germinal center (GC) and occur frequently in B cell malignancies derived from GC or post-GC B cells. For comparison, the same tumor panel was analyzed for somatic mutations of the rearranged immunoglobulin variable (IgV) genes, which are known to be acquired at the time of B cell transit through the GC. Sequence analyses of BCL-6 and IgV genes allowed the definition of three groups of B-CLL. Group I B-CLL displayed mutations of both BCL-6 and IgV genes (10/28; 36%). Group II B-CLL displayed mutated IgV genes, but a germline BCL-6 gene (5/28; 18%). Finally, group III B-CLL included the remaining cases (13/28; 46%) that were characterized by the absence of somatic mutations of both BCL-6 and IgV genes. Overall, the distribution of BCL-6 and IgV mutations in B-CLL reinforce the notion that this leukemia is histogenetically heterogeneous and that a substantial subgroup of these lymphoproliferations derives from post-germinal center B cells.

Electrocardiogram changes and atrial arrhythmias in individuals carrying sodium channel SCN5A D1275N mutation.

PubMed

Vanninen, Sari U M; Nikus, Kjell; Aalto-Setälä, Katriina

2017-09-01

The cardiac sodium channel SCN5A regulates atrioventricular and ventricular depolarization as well as cardiac conduction. Patients with cardiac electrical abnormalities have an increased risk of sudden cardiac death (SCD) and cardio-embolic stroke. Optimal management of cardiac disease includes the understanding of association between the causative mutations and the clinical phenotype. A 12-lead electrocardiogram (ECG) is an easy and inexpensive tool for finding risk patients. A blood sample for DNA extraction was obtained in a Finnish family with 43 members; systematic 12-lead ECG analysis was performed in 13 of the family members carrying an SCN5A D1275N mutation. Conduction defects and supraventricular arrhythmias, including atrial fibrillation/flutter, atrioventricular nodal re-entry tachycardia (AVNRT) and junctional rhythm were searched for. Five (38%) mutation carriers had fascicular or bundle branch block, 10 had atrial arrhythmias; no ventricular arrhythmias were found. Notching of the R- and S waves - including initial QRS fragmentation - and prolonged S-wave upstroke were present in all the affected family members. Notably, four (31%) affected family members had a stroke before the age of 31 and two experienced premature death. A 12-lead ECG can be used to predict arrhythmias in SCN5A D1275N mutation carriers. Key messages The 12-lead ECG may reveal cardiac abnormalities even before clinical symptoms occur. Specific ECG findings - initial QRS fragmentation, prolonged S-wave upstroke as well as supraventricular arrhythmias - were frequently encountered in all SCN5A D1257N mutation carriers. ECG follow-up is recommended for all SCN5A D1275N mutation carriers.

Recurrence of carbamoyl phosphate synthetase 1 (CPS1) deficiency in Turkish patients: characterization of a founder mutation by use of recombinant CPS1 from insect cells expression.

PubMed

Hu, Liyan; Diez-Fernandez, Carmen; Rüfenacht, Véronique; Hismi, Burcu Öztürk; Ünal, Özlem; Soyucen, Erdogan; Çoker, Mahmut; Bayraktar, Bilge Tanyeri; Gunduz, Mehmet; Kiykim, Ertugrul; Olgac, Asburce; Pérez-Tur, Jordi; Rubio, Vicente; Häberle, Johannes

2014-12-01

Carbamoyl phosphate synthetase 1 (CPS1) deficiency due to CPS1 mutations is a rare autosomal-recessive urea cycle disorder causing hyperammonemia that can lead to death or severe neurological impairment. CPS1 catalyzes carbamoyl phosphate formation from ammonia, bicarbonate and two molecules of ATP, and requires the allosteric activator N-acetyl-L-glutamate. Clinical mutations occur in the entire CPS1 coding region, but mainly in single families, with little recurrence. We characterized here the only currently known recurrent CPS1 mutation, p.Val1013del, found in eleven unrelated patients of Turkish descent using recombinant His-tagged wild type or mutant CPS1 expressed in baculovirus/insect cell system. The global CPS1 reaction and the ATPase and ATP synthesis partial reactions that reflect, respectively, the bicarbonate and the carbamate phosphorylation steps, were assayed. We found that CPS1 wild type and V1013del mutant showed comparable expression levels and purity but the mutant CPS1 exhibited no significant residual activities. In the CPS1 structural model, V1013 belongs to a highly hydrophobic β-strand at the middle of the central β-sheet of the A subdomain of the carbamate phosphorylation domain and is close to the predicted carbamate tunnel that links both phosphorylation sites. Haplotype studies suggested that p.Val1013del is a founder mutation. In conclusion, the mutation p.V1013del inactivates CPS1 but does not render the enzyme grossly unstable or insoluble. Recurrence of this particular mutation in Turkish patients is likely due to a founder effect, which is consistent with the frequent consanguinity observed in the affected population. Copyright © 2014 Elsevier Inc. All rights reserved.

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas

PubMed Central

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K.; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

Abstract World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69–80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene (IDH1), of which 83–90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice. PMID:27877908

PIK3CA gene alterations in bladder cancer are frequent and associate with reduced recurrence in non-muscle invasive tumors.

PubMed

Dueñas, Marta; Martínez-Fernández, Mónica; García-Escudero, Ramón; Villacampa, Felipe; Marqués, Miriam; Saiz-Ladera, Cristina; Duarte, José; Martínez, Victor; Gómez, M José; Martín, M Luisa; Fernández, Manoli; Castellano, Daniel; Real, Francisco X; Rodriguez-Peralto, Jose L; De La Rosa, Federico; Paramio, Jesús M

2015-07-01

Bladder cancer (BC) is the fifth most common cancer in the world, being the non-muscle invasive tumors (NMIBC) the most frequent. NMIBC shows a very high frequency of recurrence and, in certain cases, tumor progression. The phosphatidylinositol 3-kinase (PI3K) pathway, which controls cell growth, tumorigenesis, cell invasion and drug response, is frequently activated in numerous human cancers, including BC, in part through alterations of PIK3CA gene. However, the significance of PIK3CA gene alterations with respect to clinicopathological characteristics, and in particular tumor recurrence and progression, remains elusive. Here, we analyzed the presence of mutations in FGFR3 and PIK3CA genes and copy number alterations of PIK3CA gene in bladder tumor and their correspondent paired normal samples from 87 patients. We observed an extremely high frequency of PIK3CA gene alterations (mutations, copy gains, or both) in tumor samples, affecting primarily T1 and T2 tumors. A significant number of normal tissues also showed mutations and copy gains, being coincident with those found in the corresponding tumor sample. In low-grade tumors PIK3CA mutations associated with FGFR3 mutations. Alterations in PIK3CA gene resulted in increased Akt activity in tumors. Interestingly, the presence of PIK3CA gene alterations, and in particular gene mutations, is significantly associated with reduced recurrence of NMIBC patients. Importantly, the presence of FGFR3 mutations may influence the clinical outcome of patients bearing alterations in PIK3CA gene, and increased recurrence was associated to FGFR3 mutated, PIK3CA wt tumors. These findings may have high relevance in terms of using PI3K-targeted therapies for BC treatment. © 2013 Wiley Periodicals, Inc.

Detection of ESR1 mutations in plasma and tumors from metastatic breast cancer patients using next-generation sequencing.

PubMed

Yanagawa, Takehiro; Kagara, Naofumi; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo

2017-06-01

Liquid biopsy using digital PCR (dPCR) has been widely used for the screening of ESR1 mutations, since they are frequently identified in the hotspot. However, dPCR is limited to the known mutations. Therefore, we aimed to analyze the utility of next-generation sequencing (NGS) to discover novel ESR1 mutations. Whole exon sequencing of the ESR1 gene using NGS was performed in 16 primary and 47 recurrent tumor samples and 38 plasma samples from hormone receptor-positive metastatic breast cancer patients. Functional analyses were then performed for the novel mutations we detected. We identified no mutations in primary tumors and six mutations in five recurrent tumors, including three types of known mutations (Y537C, Y537N, and D538G) and two novel mutations (E279V and G557R). We also identified seven mutations in five plasma samples, including three types of known mutations (S463P, Y537S, and D538G) and one mutation not reported in COSMIC database (L536H). All nine patients with ESR1 mutations were treated with aromatase inhibitors (AIs) prior to sampling, and the mutations were frequently detected in patients who received AI treatments in the metastatic setting. Among the three novel mutations (E279V, L536H, and G557R), L536H, but not E279V and G557R, showed ligand-independent activity. All three mutant proteins showed nuclear localization and had no relation with non-genomic ER pathways. Although the molecular mechanisms of the E279V and G557R mutations remain unclear, our data suggest the utility of NGS as a liquid biopsy for metastatic breast cancer patients and the potential to identify novel ESR1 mutations.

Uncommon EGFR mutations in cytological specimens of 1,874 newly diagnosed Indonesian lung cancer patients.

PubMed

Syahruddin, Elisna; Wulandari, Laksmi; Sri Muktiati, Nunuk; Rima, Ana; Soeroso, Noni; Ermayanti, Sabrina; Levi, Michael; Hidajat, Heriawaty; Widjajahakim, Grace; Utomo, Ahmad Rusdan Handoyo

2018-01-01

We aimed to evaluate the distribution of individual epidermal growth factor receptor ( EGFR ) mutation subtypes found in routine cytological specimens. A retrospective audit was performed on EGFR testing results of 1,874 consecutive cytological samples of newly diagnosed or treatment-naïve Indonesian lung cancer patients (years 2015-2016). Testing was performed by ISO15189 accredited central laboratory. Overall test failure rate was 5.1%, with the highest failure (7.1%) observed in pleural effusion and lowest (1.6%) in needle aspiration samples. EGFR mutation frequency was 44.4%. Tyrosine kinase inhibitor (TKI)-sensitive common EGFR mutations (ins/dels exon 19, L858R) and uncommon mutations (G719X, T790M, L861Q) contributed 57.1% and 29%, respectively. Approximately 13.9% of mutation-positive patients carried a mixture of common and uncommon mutations. Women had higher EGFR mutation rate (52.9%) vs men (39.1%; p <0.05). In contrast, uncommon mutations conferring either TKI responsive (G719X, L861Q) or TKI resistance (T790M, exon 20 insertions) were consistently more frequent in men than in women (67.3% vs 32.7% or 69.4% vs 30.6%; p <0.05). Up to 10% EGFR mutation-positive patients had baseline single mutation T790M, exon 20 insertion, or in coexistence with TKI-sensitive mutations. Up to 9% patients had complex or multiple EGFR mutations, whereby 48.7% patients harbored TKI-resistant mutations. One patient presented third-generation TKI-resistant mutation L792F simultaneously with T790M. Routine diagnostic cytological techniques yielded similar success rate to detect EGFR mutations. Uncommon EGFR mutations were frequent events in Indonesian lung cancer patients.

Frequent genomic imbalances suggest commonly altered tumour genes in human hepatocarcinogenesis

PubMed Central

Niketeghad, F; Decker, H J; Caselmann, W H; Lund, P; Geissler, F; Dienes, H P; Schirmacher, P

2001-01-01

Hepatocellular carcinoma (HCC) is one of the most frequent-occurring malignant tumours worldwide, but molecular changes of tumour DNA, with the exception of viral integrations and p53 mutations, are poorly understood. In order to search for common macro-imbalances of genomic tumour DNA, 21 HCCs and 3 HCC-cell lines were characterized by comparative genomic hybridization (CGH), subsequent database analyses and in selected cases by fluorescence in situ hybridization (FISH). Chromosomal subregions of 1q, 8q, 17q and 20q showed frequent gains of genomic material, while losses were most prevalent in subregions of 4q, 6q, 13q and 16q. Deleted regions encompass tumour suppressor genes, like RB-1 and the cadherin gene cluster, some of them previously identified as potential target genes in HCC development. Several potential growth- or transformation-promoting genes located in chromosomal subregions showed frequent gains of genomic material. The present study provides a basis for further genomic and expression analyses in HCCs and in addition suggests chromosome 4q to carry a so far unidentified tumour suppressor gene relevant for HCC development. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11531255

Molecular etiology and genotype-phenotype correlation of Chinese Han deaf patients with type I and type II Waardenburg Syndrome.

PubMed

Sun, Lianhua; Li, Xiaohua; Shi, Jun; Pang, Xiuhong; Hu, Yechen; Wang, Xiaowen; Wu, Hao; Yang, Tao

2016-10-19

Waardenburg syndrome (WS) characterized by sensorineural hearing loss and pigmentary abnormalities is genetically heterogeneous and phenotypically variable. This study investigated the molecular etiology and genotype-phenotype correlation of WS in 36 Chinese Han deaf probands and 16 additional family members that were clinically diagnosed with WS type I (WS1, n = 8) and type II (WS2, n = 42). Mutation screening of six WS-associated genes detected PAX3 mutations in 6 (86%) of the 7 WS1 probands. Among the 29 WS2 probands, 13 (45%) and 10 (34%) were identified with SOX10 and MITF mutations, respectively. Nineteen of the 26 detected mutations were novel. In WS2 probands whose parental DNA samples were available, de novo mutations were frequently seen for SOX10 mutations (7/8) but not for MITF mutations (0/5, P = 0.005). Excessive freckle, a common feature of WS2 in Chinese Hans, was frequent in WS2 probands with MITF mutations (7/10) but not in those with SOX10 mutations (0/13, P = 4.9 × 10 -4 ). Our results showed that mutations in SOX10 and MITF are two major causes for deafness associated with WS2. These two subtypes of WS2 can be distinguished by the high de novo rate of the SOX10 mutations and the excessive freckle phenotype exclusively associated with the MITF mutations.

Molecular etiology and genotype-phenotype correlation of Chinese Han deaf patients with type I and type II Waardenburg Syndrome

PubMed Central

Sun, Lianhua; Li, Xiaohua; Shi, Jun; Pang, Xiuhong; Hu, Yechen; Wang, Xiaowen; Wu, Hao; Yang, Tao

2016-01-01

Waardenburg syndrome (WS) characterized by sensorineural hearing loss and pigmentary abnormalities is genetically heterogeneous and phenotypically variable. This study investigated the molecular etiology and genotype-phenotype correlation of WS in 36 Chinese Han deaf probands and 16 additional family members that were clinically diagnosed with WS type I (WS1, n = 8) and type II (WS2, n = 42). Mutation screening of six WS-associated genes detected PAX3 mutations in 6 (86%) of the 7 WS1 probands. Among the 29 WS2 probands, 13 (45%) and 10 (34%) were identified with SOX10 and MITF mutations, respectively. Nineteen of the 26 detected mutations were novel. In WS2 probands whose parental DNA samples were available, de novo mutations were frequently seen for SOX10 mutations (7/8) but not for MITF mutations (0/5, P = 0.005). Excessive freckle, a common feature of WS2 in Chinese Hans, was frequent in WS2 probands with MITF mutations (7/10) but not in those with SOX10 mutations (0/13, P = 4.9 × 10−4). Our results showed that mutations in SOX10 and MITF are two major causes for deafness associated with WS2. These two subtypes of WS2 can be distinguished by the high de novo rate of the SOX10 mutations and the excessive freckle phenotype exclusively associated with the MITF mutations. PMID:27759048

Cystic fibrosis transmembrane conductance regulator regulates epithelial cell response to Aspergillus and resultant pulmonary inflammation.

PubMed

Chaudhary, Neelkamal; Datta, Kausik; Askin, Frederic B; Staab, Janet F; Marr, Kieren A

2012-02-01

Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) alter epithelial cell (EC) interactions with multiple microbes, such that dysregulated inflammation and injury occur with airway colonization in people with cystic fibrosis (CF). Aspergillus fumigatus frequently colonizes CF airways, but it has been assumed to be an innocent saprophyte; its potential role as a cause of lung disease is controversial. To study the interactions between Aspergillus and EC, and the role of the fungus in evoking inflammatory responses. A. fumigatus expressing green fluorescent protein was developed for in vitro and in vivo models, which used cell lines and mouse tracheal EC. Fungal spores (conidia) are rapidly ingested by ECs derived from bronchial cell lines and murine tracheas, supporting a role for EC in early airway clearance. Bronchial ECs harboring CFTR mutations (ΔF508) or deletion demonstrate impaired uptake and killing of conidia, and ECs with CFTR mutation undergo more conidial-induced apoptosis. Germinated (hyphal) forms of the fungus evoke secretion of inflammatory mediators, with CFTR mutation resulting in increased airway levels of macrophage inflammatory protein 2 and KC, and higher lung monocyte chemotactic protein-1. After A. fumigatus inhalation, CFTR(-/-) mice develop exaggerated lymphocytic inflammation, mucin accumulation, and lung injury. Data demonstrate a critical role for CFTR in mediating EC responses to A. fumigatus. Results suggest that the fungus elicits aberrant pulmonary inflammation in the setting of CFTR mutation, supporting the potential role of antifungals to halt progressive CF lung disease.

Mutations in SNX14 Cause a Distinctive Autosomal-Recessive Cerebellar Ataxia and Intellectual Disability Syndrome

PubMed Central

Thomas, Anna C.; Williams, Hywel; Setó-Salvia, Núria; Bacchelli, Chiara; Jenkins, Dagan; O’Sullivan, Mary; Mengrelis, Konstantinos; Ishida, Miho; Ocaka, Louise; Chanudet, Estelle; James, Chela; Lescai, Francesco; Anderson, Glenn; Morrogh, Deborah; Ryten, Mina; Duncan, Andrew J.; Pai, Yun Jin; Saraiva, Jorge M.; Ramos, Fabiana; Farren, Bernadette; Saunders, Dawn; Vernay, Bertrand; Gissen, Paul; Straatmaan-Iwanowska, Anna; Baas, Frank; Wood, Nicholas W.; Hersheson, Joshua; Houlden, Henry; Hurst, Jane; Scott, Richard; Bitner-Glindzicz, Maria; Moore, Gudrun E.; Sousa, Sérgio B.; Stanier, Philip

2014-01-01

Intellectual disability and cerebellar atrophy occur together in a large number of genetic conditions and are frequently associated with microcephaly and/or epilepsy. Here we report the identification of causal mutations in Sorting Nexin 14 (SNX14) found in seven affected individuals from three unrelated consanguineous families who presented with recessively inherited moderate-severe intellectual disability, cerebellar ataxia, early-onset cerebellar atrophy, sensorineural hearing loss, and the distinctive association of progressively coarsening facial features, relative macrocephaly, and the absence of seizures. We used homozygosity mapping and whole-exome sequencing to identify a homozygous nonsense mutation and an in-frame multiexon deletion in two families. A homozygous splice site mutation was identified by Sanger sequencing of SNX14 in a third family, selected purely by phenotypic similarity. This discovery confirms that these characteristic features represent a distinct and recognizable syndrome. SNX14 encodes a cellular protein containing Phox (PX) and regulator of G protein signaling (RGS) domains. Weighted gene coexpression network analysis predicts that SNX14 is highly coexpressed with genes involved in cellular protein metabolism and vesicle-mediated transport. All three mutations either directly affected the PX domain or diminished SNX14 levels, implicating a loss of normal cellular function. This manifested as increased cytoplasmic vacuolation as observed in cultured fibroblasts. Our findings indicate an essential role for SNX14 in neural development and function, particularly in development and maturation of the cerebellum. PMID:25439728

Mutations in SNX14 cause a distinctive autosomal-recessive cerebellar ataxia and intellectual disability syndrome.

PubMed

Thomas, Anna C; Williams, Hywel; Setó-Salvia, Núria; Bacchelli, Chiara; Jenkins, Dagan; O'Sullivan, Mary; Mengrelis, Konstantinos; Ishida, Miho; Ocaka, Louise; Chanudet, Estelle; James, Chela; Lescai, Francesco; Anderson, Glenn; Morrogh, Deborah; Ryten, Mina; Duncan, Andrew J; Pai, Yun Jin; Saraiva, Jorge M; Ramos, Fabiana; Farren, Bernadette; Saunders, Dawn; Vernay, Bertrand; Gissen, Paul; Straatmaan-Iwanowska, Anna; Baas, Frank; Wood, Nicholas W; Hersheson, Joshua; Houlden, Henry; Hurst, Jane; Scott, Richard; Bitner-Glindzicz, Maria; Moore, Gudrun E; Sousa, Sérgio B; Stanier, Philip

2014-11-06

Intellectual disability and cerebellar atrophy occur together in a large number of genetic conditions and are frequently associated with microcephaly and/or epilepsy. Here we report the identification of causal mutations in Sorting Nexin 14 (SNX14) found in seven affected individuals from three unrelated consanguineous families who presented with recessively inherited moderate-severe intellectual disability, cerebellar ataxia, early-onset cerebellar atrophy, sensorineural hearing loss, and the distinctive association of progressively coarsening facial features, relative macrocephaly, and the absence of seizures. We used homozygosity mapping and whole-exome sequencing to identify a homozygous nonsense mutation and an in-frame multiexon deletion in two families. A homozygous splice site mutation was identified by Sanger sequencing of SNX14 in a third family, selected purely by phenotypic similarity. This discovery confirms that these characteristic features represent a distinct and recognizable syndrome. SNX14 encodes a cellular protein containing Phox (PX) and regulator of G protein signaling (RGS) domains. Weighted gene coexpression network analysis predicts that SNX14 is highly coexpressed with genes involved in cellular protein metabolism and vesicle-mediated transport. All three mutations either directly affected the PX domain or diminished SNX14 levels, implicating a loss of normal cellular function. This manifested as increased cytoplasmic vacuolation as observed in cultured fibroblasts. Our findings indicate an essential role for SNX14 in neural development and function, particularly in development and maturation of the cerebellum. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Carcinoma of the colon and rectum with deregulation of insulin-like growth factor 2 signaling: clinical and molecular implications.

PubMed

Belharazem, Djeda; Magdeburg, Julia; Berton, Ann-Kristin; Beissbarth, Li; Sauer, Christian; Sticht, Carsten; Marx, Alexander; Hofheinz, Ralf; Post, Stefan; Kienle, Peter; Ströbel, Philipp

2016-10-01

Loss of imprinting (LOI) of the insulin-like growth factor 2 (IGF2) is an early event in the development of colorectal cancer (CRC). Whether LOI of IGF2 denotes a molecular or clinical cancer subgroup is currently unknown. Tumor biopsies and paired normal mucosa from 399 patients with extensive clinical annotations were analyzed for LOI and IGF2 expression. LOI status in 140 informative cases was correlated with clinicopathologic parameters and outcome. LOI was frequent in normal mucosa and tumors and occurred throughout the large intestine. LOI was unrelated to microsatellite instability, KRAS mutation status, stage, and survival. However, CRC with LOI showed increased IGF2 protein levels and activation of AKT1. Gene expression analysis of tumors with and without LOI and knockdown of IGF2 in cell lines revealed that IGF2 induced distinct sets of activated and repressed genes, including Wnt5a, CEACAM6, IGF2BP3, KPN2A, BRCA2, and CDK1. Inhibition of AKT1 in IGF2-stimulated cells showed that the downstream effects of IGF2 on cell proliferation and gene expression were strictly AKT1-dependent. LOI of IGF2 is a frequent and early event in CRC that occurs both in the adenomatous polyposis coli (APC) gene-mutated and serrated route of carcinogenesis. LOI leads to overexpression of IGF2, activates IGF1R and AKT1, and is a powerful driver of cell proliferation. Moreover, our results suggest that IGF2 via AKT1 also contributes to non-canonical wnt signaling. Although LOI had no significant impact on major clinical parameters and outcome, its potential as a target for preventive and therapeutic interventions merits further investigation.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Uncommon EGFR mutations in cytological specimens of 1,874 newly diagnosed Indonesian lung cancer patients

PubMed Central

Syahruddin, Elisna; Wulandari, Laksmi; Sri Muktiati, Nunuk; Rima, Ana; Soeroso, Noni; Ermayanti, Sabrina; Levi, Michael; Hidajat, Heriawaty; Widjajahakim, Grace; Utomo, Ahmad Rusdan Handoyo

2018-01-01

Purpose We aimed to evaluate the distribution of individual epidermal growth factor receptor (EGFR) mutation subtypes found in routine cytological specimens. Patients and methods A retrospective audit was performed on EGFR testing results of 1,874 consecutive cytological samples of newly diagnosed or treatment-naïve Indonesian lung cancer patients (years 2015–2016). Testing was performed by ISO15189 accredited central laboratory. Results Overall test failure rate was 5.1%, with the highest failure (7.1%) observed in pleural effusion and lowest (1.6%) in needle aspiration samples. EGFR mutation frequency was 44.4%. Tyrosine kinase inhibitor (TKI)-sensitive common EGFR mutations (ins/dels exon 19, L858R) and uncommon mutations (G719X, T790M, L861Q) contributed 57.1% and 29%, respectively. Approximately 13.9% of mutation-positive patients carried a mixture of common and uncommon mutations. Women had higher EGFR mutation rate (52.9%) vs men (39.1%; p<0.05). In contrast, uncommon mutations conferring either TKI responsive (G719X, L861Q) or TKI resistance (T790M, exon 20 insertions) were consistently more frequent in men than in women (67.3% vs 32.7% or 69.4% vs 30.6%; p<0.05). Up to 10% EGFR mutation–positive patients had baseline single mutation T790M, exon 20 insertion, or in coexistence with TKI-sensitive mutations. Up to 9% patients had complex or multiple EGFR mutations, whereby 48.7% patients harbored TKI-resistant mutations. One patient presented third-generation TKI-resistant mutation L792F simultaneously with T790M. Conclusion Routine diagnostic cytological techniques yielded similar success rate to detect EGFR mutations. Uncommon EGFR mutations were frequent events in Indonesian lung cancer patients. PMID:29615847

Genetic analysis of leukemic transformation of chronic myeloproliferative neoplasms

PubMed Central

Abdel-Wahab, Omar; Manshouri, Taghi; Patel, Jay; Harris, Kelly; Yao, JinJuan; Hedvat, Cyrus; Heguy, Adriana; Bueso-Ramos, Carlos; Kantarjian, Hagop; Levine, Ross L.; Verstovsek, Srdan

2009-01-01

The genetic events which contribute to transformation of myeloproliferative neoplasms (MPN) to acute myeloid leukemia (AML) are not well characterized. We investigated the role of JAK2, TET2, ASXL1, and IDH1 mutations in leukemic transformation of MPNs through mutational analysis of 63 patients with AML secondary to a preexisting MPN (sAML). We identified frequent TET2 (26.3%), ASXL1 (19.3%), IDH1 (9.5%), and JAK2 (36.8%) mutations in sAML; all possible mutational combinations of these genes were observed. Analysis of 14 patients for which paired samples from MPN and sAML were available demonstrated TET2 mutations were frequently acquired at leukemic transformation (6/14=43%). In contrast, ASXL1 mutations were almost always detected in both the MPN and AML clones from individual patients. A case was also observed where TET2 and ASXL1 mutations were found before the patient acquired a JAK2 mutation or developed clinical evidence of MPN. We conclude that mutations in TET2, ASXL1, and IDH1 are common in sAML derived from a pre-existing MPN. Although TET2/ASXL1 mutations may precede acquisition of JAK2 mutations by the MPN clone, mutations in TET2, but not ASXL1, are commonly acquired at the time of leukemic transformation. These data suggest the mutational order of events in MPN and sAML varies in different patients, and that TET2 and ASXL1 mutations have distinct roles in MPN pathogenesis and leukemic transformation. The presence of sAML with no pre-existing JAK2/TET2/ASXL1/IDH1 mutations indicates the existence of other mutations necessary for leukemic transformation. PMID:20068184

The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

PubMed

Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

2016-10-01

The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

Dural ectasia and FBN1 mutation screening of 40 patients with Marfan syndrome and related disorders: role of dural ectasia for the diagnosis.

PubMed

Attanasio, Monica; Pratelli, Elisa; Porciani, Maria Cristina; Evangelisti, Lucia; Torricelli, Elena; Pellicanò, Giannantonio; Abbate, Rosanna; Gensini, Gian Franco; Pepe, Guglielmina

2013-07-01

Marfan syndrome is an autosomal dominant disorder of connective tissue caused by mutations in the gene encoding fibrillin-1 (FBN1), a matrix component of microfibrils. Dural ectasia, i.e. enlargement of the neural canal mainly located in the lower lumbar and sacral region, frequently occurs in Marfan patients. The aim of our study was to investigate the role of dural ectasia in raising the diagnosis of Marfan syndrome and its association with FBN1 mutations. We studied 40 unrelated patients suspected for MFS, who underwent magnetic resonance imaging searching for dural ectasia. In all of them FBN1 gene analysis was also performed. Thirty-seven patients resulted affected by Marfan syndrome according to the '96 Ghent criteria; in 30 of them the diagnosis was confirmed when revaluated by the recently revised criteria (2010). Thirty-six patients resulted positive for dural ectasia. The degree of dural ectasia was grade 1 in 19 patients, grade 2 in 11 patients, and grade 3 in 6 patients. In 7 (24%) patients, the presence of dural ectasia allowed to reach a positive score for systemic feature criterion. Twenty-four patients carried an FBN1 mutation, that were represented by 13 missense (54%), and 11 (46%) mutations generating a premature termination codon (PTC, frameshifts and stop codons). No mutation was detected in the remaining 16 (6 patients with MFS and 10 with related disorders according to revised Ghent criteria). The prevalence of severe (grade 2 and grade 3) involvement of dura mater was higher in patients harbouring premature termination codon (PTC) mutations than those carrying missense-mutations (8/11 vs 2/13, P = 0.0111). Our data emphasizes the importance of dural ectasia screening to reach the diagnosis of Marfan syndrome especially when it is uncertain and indicates an association between PTC mutations and severe dural ectasia in Marfan patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Oncogenic exon 2 mutations in Mediator subunit MED12 disrupt allosteric activation of cyclin C-CDK8/19.

PubMed

Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G

2018-03-30

Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.

TP53 mutations in primary breast carcinomas from white and African-Brazilian patients.

PubMed

Nagai, Maria Aparecida; Schaer Barbosa, Helenemarie; Zago, Marco Antonio; Araújo Silva, Wilson; Nishimoto, Inês Nobuko; Salaorni, Sibeli; Guerreiro Costa, Lívia Nery Franco; Silva Araújo, Marcos; Caldas Oliveira, Ana Gabriela; Mourâo Neto, Mário; Brentani, Maria Mitzi

2003-07-01

We have attempted to determine the incidence, nature and clinical significance of TP53 mutation in a group of white (242 cases) and African-Brazilian (52 cases) patients with breast cancer. The interethnic admixture as estimated by STR markers showed that white subjects displayed 67.9+/-0.4%, 25.0+/-1.7% and 7.0%+/-1.6% and the black populations had 34.4+/-1.9%, 56.2+/-1.9 and 9.4+/-2.2% respectively of European, African and Amerindian genes. Clinical parameters such as age, lymph node status and steroid receptors were similar in both groups. African-Brazilian patients presented more advanced lesions. Mutation screening was performed using polymerase chain reaction-single strand conformation analysis followed by sequencing. Compared to whites (13.6%), a relatively high frequency of TP53 mutation was found in blacks (32.7%) (p=0.001). African-Brazilian women have a larger proportion of mutations in exons 5 and 7, whereas white women have more mutations in exon 8. Mutations within exon 4 were found only in tumors of white patients. The spectra of TP53 mutations show that A:T-->G:C nucleotide transversion and G:C-->C:G transition were more common in African-Brazilian women whereas G:C-->T:A transversion occurs very frequently in whites. A high prevalence of G:C-->A:T nucleotide transitions and deletions was detected in both groups. No association was found between p53 gene mutation and tumor or clinical parameters independently of the ethnic group. With a median follow-up of 35.6 months for whites and 43.4 months for the blacks, no differences in overall survival were found. If white patients were stratified according to the type and location of TP53 mutations, patients with mutations affecting amino acids directly involved in DNA or Zn binding displayed a poor prognosis. The pattern of mutations found in our population seems to reflect a base line pattern observed in populations with similar ethnic profile with some modifications, which might be derived from specific etiological factors.

Down syndrome and leukemia: insights into leukemogenesis and translational targets

PubMed Central

Barbaric, Draga; Byatt, Sally-Anne; Sutton, Rosemary; Marshall, Glenn M.

2015-01-01

Children with Down syndrome (DS) have a significantly increased risk of childhood leukemia, in particular acute megakaryoblastic leukemia (AMKL) and acute lymphoblastic leukemia (DS-ALL). A pre-leukemia, called transient myeloproliferative disorder (TMD), characterised by a GATA binding protein 1 (GATA1) mutation, affects up to 30% of newborns with DS. In most cases, the pre-leukemia regresses spontaneously, however one-quarter of these children will go on to develop AMKL or myelodysplastic syndrome (MDS) . AMKL and MDS occurring in young children with DS and a GATA1 somatic mutation are collectively termed myeloid leukemia of Down syndrome (ML-DS). This model represents an important multi-step process of leukemogenesis, and further study is required to identify therapeutic targets to potentially prevent development of leukemia. DS-ALL is a high-risk leukemia and mutations in the JAK-STAT pathway are frequently observed. JAK inhibitors may improve outcome for this type of leukemia. Genetic and epigenetic studies have revealed likely candidate drivers involved in development of ML-DS and DS-ALL. Overall this review aims to identify potential impacts of new research on how we manage children with DS, pre-leukemia and leukemia. PMID:26835364

Effects of hypertrophic and dilated cardiomyopathy mutations on power output by human β-cardiac myosin.

PubMed

Spudich, James A; Aksel, Tural; Bartholomew, Sadie R; Nag, Suman; Kawana, Masataka; Yu, Elizabeth Choe; Sarkar, Saswata S; Sung, Jongmin; Sommese, Ruth F; Sutton, Shirley; Cho, Carol; Adhikari, Arjun S; Taylor, Rebecca; Liu, Chao; Trivedi, Darshan; Ruppel, Kathleen M

2016-01-01

Hypertrophic cardiomyopathy is the most frequently occurring inherited cardiovascular disease, with a prevalence of more than one in 500 individuals worldwide. Genetically acquired dilated cardiomyopathy is a related disease that is less prevalent. Both are caused by mutations in the genes encoding the fundamental force-generating protein machinery of the cardiac muscle sarcomere, including human β-cardiac myosin, the motor protein that powers ventricular contraction. Despite numerous studies, most performed with non-human or non-cardiac myosin, there is no clear consensus about the mechanism of action of these mutations on the function of human β-cardiac myosin. We are using a recombinantly expressed human β-cardiac myosin motor domain along with conventional and new methodologies to characterize the forces and velocities of the mutant myosins compared with wild type. Our studies are extending beyond myosin interactions with pure actin filaments to include the interaction of myosin with regulated actin filaments containing tropomyosin and troponin, the roles of regulatory light chain phosphorylation on the functions of the system, and the possible roles of myosin binding protein-C and titin, important regulatory components of both cardiac and skeletal muscles. © 2016. Published by The Company of Biologists Ltd.

[Analysis on mutation of S gene and P gene of hepatitis B virus in two counties of Sichuan Province].

PubMed

Tong, Wen-Bin; He, Ji-Lan; Sun, Li

2009-02-01

To analyze HBV S gene/P gene mutation in 2 counties (districts) of Sichuan province. HBV DNA were extracted from sera positive both for HBsAg and HBeAg. After PCR and nucleotide sequencing, nucleotide/amino acid mutation in S and P gene were compared and analyzed. Of 47 serum samples from patients with chronic HBV infection, amino acid mutation in 'a' determinant occurred in 12 samples (25.53%,12/47), correlating with T126A, I126T/S, P127T, T131N, M133L, M133T and T140I; high proportion of mutation clustered in first loop of 'a' determinant (92.86%,13/14), rtV207I mutation in C domain of reverse transcription occured in one sample. Naturally occurring mutation in 'a' determinant clustered predominantly in the first loop and usually associated with altered antigenicity, posing a potential threat to successfully vaccinated individuals; Lamivudine-resistant mutant might occur in patient even without nucleotide analogue treatment.

Counseling patients with succinate dehydrogenase subunit defects: genetics, preventive guidelines, and dealing with uncertainty

PubMed Central

Raygada, Margarita; King, Kathryn S.; Adams, Karen T.; Stratakis, Constantine A.; Pacak, Karel

2016-01-01

The discovery that mutations in the succinate dehydrogenase (SDH) complex subunit (SDHA, B/C/D/AF2) genes predispose patients to the development of tumors has led to the identification of a large population of patients and relatives at risk for developing malignancies. The most frequent conditions associated with these mutations are the familial paraganglioma syndromes. Other tumors that are frequently associated with SDH mutations (SDHx) are gastrointestinal stromal tumors and renal cell carcinomas. A number of other rare associations have also been described. SDHx mutations are often clinically silent and metastatic, but they may also be aggressive in their presentation. The penetrance of these mutations is beginning to be understood, and the characteristics of the phenotype are being elucidated. However, the inability to accurately predict the appearance, nature, and location of tumors as well as their tendency to recur or metastasize pose challenges to those who counsel and manage patients with SDHx mutations. In this work, we present our approach for counseling these families in the context of the current uncertainties, while striving to maintain patient autonomy. PMID:24854530

Detection of ESR1 mutations in circulating cell-free DNA from patients with metastatic breast cancer treated with palbociclib and letrozole.

PubMed

Gyanchandani, Rekha; Kota, Karthik J; Jonnalagadda, Amruth R; Minteer, Tanya; Knapick, Beth A; Oesterreich, Steffi; Brufsky, Adam M; Lee, Adrian V; Puhalla, Shannon L

2017-09-15

ESR1 mutations are frequently acquired in hormone-resistant metastatic breast cancer (MBC). CDK4/6 inhibition along with endocrine therapy is a promising strategy in hormone receptor-positive MBC. However, the incidence and impact of ESR1 mutations on clinical outcome in patients treated with CDK4/6 inhibitors have not been defined. In this study, we evaluated the frequency of ESR1 mutations in cfDNA from 16 patients with MBC undergoing palbociclib and letrozole therapy. Four common ESR1 mutations (D538G, Y537C, Y537N, and Y537S) were analyzed in serial blood draws using ddPCR. Mutation rate was 31.3% (5/16) (n=3; de novo , n=2; acquired). D538G was the most frequent mutation (n=3), followed by Y537N and Y537S (n=2). One patient showed multiple ESR1 mutations. Mutations were enriched during therapy. Progression-free survival (PFS) and overall survival (OS) were similar in patients with and without mutation detected at any given time during treatment. However, PFS was significantly shorter in patients with ESR1 mutation at initial blood draw (3.3 versus 9.0 months, P-value=0.038). In conclusion, ESR1 mutation prevalence is consistent with recent studies in hormone-refractory breast cancer. Further, treatment with palbociclib and letrozole does not prevent selection of ESR1 mutations in later lines of therapy. Larger studies are warranted to validate these findings.

Detection of ESR1 mutations in circulating cell-free DNA from patients with metastatic breast cancer treated with palbociclib and letrozole

PubMed Central

Gyanchandani, Rekha; Kota, Karthik J.; Jonnalagadda, Amruth R.; Minteer, Tanya; Knapick, Beth A.; Oesterreich, Steffi; Brufsky, Adam M.; Lee, Adrian V.; Puhalla, Shannon L.

2017-01-01

ESR1 mutations are frequently acquired in hormone-resistant metastatic breast cancer (MBC). CDK4/6 inhibition along with endocrine therapy is a promising strategy in hormone receptor-positive MBC. However, the incidence and impact of ESR1 mutations on clinical outcome in patients treated with CDK4/6 inhibitors have not been defined. In this study, we evaluated the frequency of ESR1 mutations in cfDNA from 16 patients with MBC undergoing palbociclib and letrozole therapy. Four common ESR1 mutations (D538G, Y537C, Y537N, and Y537S) were analyzed in serial blood draws using ddPCR. Mutation rate was 31.3% (5/16) (n=3; de novo, n=2; acquired). D538G was the most frequent mutation (n=3), followed by Y537N and Y537S (n=2). One patient showed multiple ESR1 mutations. Mutations were enriched during therapy. Progression-free survival (PFS) and overall survival (OS) were similar in patients with and without mutation detected at any given time during treatment. However, PFS was significantly shorter in patients with ESR1 mutation at initial blood draw (3.3 versus 9.0 months, P-value=0.038). In conclusion, ESR1 mutation prevalence is consistent with recent studies in hormone-refractory breast cancer. Further, treatment with palbociclib and letrozole does not prevent selection of ESR1 mutations in later lines of therapy. Larger studies are warranted to validate these findings. PMID:28978004

Somatic mutations affect key pathways in lung adenocarcinoma

PubMed Central

Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

2009-01-01

Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

Correlation of RET somatic mutations with clinicopathological features in sporadic medullary thyroid carcinomas

PubMed Central

Moura, M M; Cavaco, B M; Pinto, A E; Domingues, R; Santos, J R; Cid, M O; Bugalho, M J; Leite, V

2009-01-01

Screening of REarranged during Transfection (RET) gene mutations has been carried out in different series of sporadic medullary thyroid carcinomas (MTC). RET-positive tumours seem to be associated to a worse clinical outcome. However, the correlation between the type of RET mutation and the patients' clinicopathological data has not been evaluated yet. We analysed RET exons 5, 8, 10–16 in fifty-one sporadic MTC, and found somatic mutations in thirty-three (64.7%) tumours. Among the RET-positive cases, exon 16 was the most frequently affected (60.6%). Two novel somatic mutations (Cys630Gly, c.1881del18) were identified. MTC patients were divided into three groups: group 1, with mutations in RET exons 15 and 16; group 2, with other RET mutations; group 3, having no RET mutations. Group 1 had higher prevalence (P=0.0051) and number of lymph node metastases (P=0.0017), and presented more often multifocal tumours (P=0.037) and persistent disease at last control (P=0.0242) than group 2. Detectable serum calcitonin levels at last screening (P=0.0119) and stage IV disease (P=0.0145) were more frequent in group 1, than in the other groups. Our results suggest that, among the sporadic MTC, cases with RET mutations in exons 15 and 16 are associated with the worst prognosis. Cases with other RET mutations have the most indolent course, and those with no RET mutations have an intermediate risk. PMID:19401695

Wide spectrum of NR5A1-related phenotypes in 46,XY and 46,XX individuals.

PubMed

Domenice, Sorahia; Machado, Aline Zamboni; Ferreira, Frederico Moraes; Ferraz-de-Souza, Bruno; Lerario, Antonio Marcondes; Lin, Lin; Nishi, Mirian Yumie; Gomes, Nathalia Lisboa; da Silva, Thatiana Evelin; Silva, Rosana Barbosa; Correa, Rafaela Vieira; Montenegro, Luciana Ribeiro; Narciso, Amanda; Costa, Elaine Maria Frade; Achermann, John C; Mendonca, Berenice Bilharinho

2016-12-01

Steroidogenic factor 1 (NR5A1, SF-1, Ad4BP) is a transcriptional regulator of genes involved in adrenal and gonadal development and function. Mutations in NR5A1 have been among the most frequently identified genetic causes of gonadal development disorders and are associated with a wide phenotypic spectrum. In 46,XY individuals, NR5A1-related phenotypes may range from disorders of sex development (DSD) to oligo/azoospermia, and in 46,XX individuals, from 46,XX ovotesticular and testicular DSD to primary ovarian insufficiency (POI). The most common 46,XY phenotype is atypical or female external genitalia with clitoromegaly, palpable gonads, and absence of Müllerian derivatives. Notably, an undervirilized external genitalia is frequently seen at birth, while spontaneous virilization may occur later, at puberty. In 46,XX individuals, NR5A1 mutations are a rare genetic cause of POI, manifesting as primary or secondary amenorrhea, infertility, hypoestrogenism, and elevated gonadotropin levels. Mothers and sisters of 46,XY DSD patients carrying heterozygous NR5A1 mutations may develop POI, and therefore require appropriate counseling. Moreover, the recurrent heterozygous p.Arg92Trp NR5A1 mutation is associated with variable degrees of testis development in 46,XX patients. A clear genotype-phenotype correlation is not seen in patients bearing NR5A1 mutations, suggesting that genetic modifiers, such as pathogenic variants in other testis/ovarian-determining genes, may contribute to the phenotypic expression. Here, we review the published literature on NR5A1-related disease, and discuss our findings at a single tertiary center in Brazil, including ten novel NR5A1 mutations identified in 46,XY DSD patients. The ever-expanding phenotypic range associated with NR5A1 variants in XY and XX individuals confirms its pivotal role in reproductive biology, and should alert clinicians to the possibility of NR5A1 defects in a variety of phenotypes presenting with gonadal dysfunction. Birth Defects Research (Part C) 108:309-320, 2016. © 2016 The Authors Birth Defects Research Part C: Embryo Today: Reviews Published by Wiley Periodicals, Inc. © 2016 The Authors Birth Defects Research Part C: Embryo Today: Reviews Published by Wiley Periodicals, Inc.

Germline mutations of KIT in gastrointestinal stromal tumor (GIST) and mastocytosis.

PubMed

Ke, Hengning; Kazi, Julhash U; Zhao, Hui; Sun, Jianmin

2016-01-01

Somatic mutations of KIT are frequently found in mastocytosis and gastrointestinal stromal tumor (GIST), while germline mutations of KIT are rare, and only found in few cases of familial GIST and mastocytosis. Although ligand-independent activation is the common feature of KIT mutations, the phenotypes mediated by various germline KIT mutations are different. Germline KIT mutations affect different tissues such as interstitial cells of Cajal (ICC), mast cells or melanocytes, and thereby lead to GIST, mastocytosis, or abnormal pigmentation. In this review, we summarize germline KIT mutations in familial mastocytosis and GIST and discuss the possible cellular context dependent transforming activity of KIT mutations.

Cell cultures in uterine leiomyomas: rapid disappearance of cells carrying MED12 mutations.

PubMed

Nadine Markowski, Dominique; Tadayyon, Mahboobeh; Bartnitzke, Sabine; Belge, Gazanfer; Maria Helmke, Burkhard; Bullerdiek, Jörn

2014-04-01

Uterine leiomyomas (UL) are the most frequent symptomatic human tumors. Nevertheless, their molecular pathogenesis is not yet fully understood. To learn more about the biology of these common neoplasms and their response to treatment, cell cultures derived from UL are a frequently used model system, but until recently appropriate genetic markers confirming their origin from the tumor cell population were lacking for most UL, i.e., those not displaying karyotypic abnormalities. The identification of MED12 mutations in the majority of UL makes it possible to trace the tumor cell population during in vitro passaging in the absence of cytogenetic abnormalities. The present study is addressing the in vitro survival of cells carrying MED12 mutations and its association with karyotypic alterations. The results challenge numerous in vitro studies into the biology and behavior of leiomyomas. Cells of one genetic subtype of UL, i.e., those with rearrangements of the high mobility AT-hook 2 protein gene (HMGA2), seem to be able to proliferate in vitro for many passages whereas tumor cells from the much more frequent MED12-mutated lesions barely survive even the first passages. Apparently, for the most frequent type of human UL no good in vitro model seems to exist because cells do not survive culturing. On the other hand, this inability may point to an Achilles' heel of this type of UL. Copyright © 2014 Wiley Periodicals, Inc.

Primary Ciliary Dyskinesia Caused by Homozygous Mutation in DNAL1, Encoding Dynein Light Chain 1

PubMed Central

Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C.; Aviram, Micha; Parvari, Ruti

2011-01-01

In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. PMID:21496787

TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.

PubMed

Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf

2017-06-01

Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

JAG1 mutations are found in approximately one third of patients presenting with only one or two clinical features of Alagille syndrome.

PubMed

Guegan, K; Stals, K; Day, M; Turnpenny, P; Ellard, S

2012-07-01

Alagille syndrome is a multisystem disorder characterized by highly variable expressivity, most frequently caused by heterozygous JAG1 gene mutations. Classic diagnostic criteria combine the presence of bile duct paucity on liver biopsy with three of five systems affected; liver, heart, skeleton, eye and dysmorphic facies. The aim of this study was to determine the prevalence and distribution of JAG1 mutations in patients referred for routine clinical diagnostic testing. Clinical data were available for 241 patients from 135 families. The index cases were grouped according to the number of systems affected (heart, liver, skeletal, eye and facies) and the mutation frequency calculated for each group. JAG1 mutations were identified in 59/135 (44%) probands. The highest mutation detection rates were observed in patients with the most frequent presenting features of Alagille syndrome; ranging from 20% (one system) to 86% (five systems). The overall mutation pick-up rate in a clinical diagnostic setting was lower than in previous research studies. Identification of a JAG1 gene mutation is particularly useful for those patients with atypical or mild Alagille syndrome who do not meet classic diagnostic criteria as it provides a definite molecular diagnosis and allows accurate genetic counselling for the family. © 2011 John Wiley & Sons A/S.

Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B

DTIC Science & Technology

2012-09-01

down Yes, A3B expression increases the steady-state level of genomic uracil Fig. 2a-2c 2) Can A3B mutate a target gene to escape drug...somatic mutation in human cancer genomes. Nature 446, 153-158 (2007). 10 2 Jones, S. et al. Frequent mutations of chromatin remodeling gene ARID1A in...processes molding the genomes of 21 breast cancers. Cell 149, 979-993 (2012). 9 Stephens, P. J. et al. The landscape of cancer genes and mutational

Loss of alleles from the distal short arm of chromosome 1 occurs late in melanoma tumor progression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dracopoli, N.C.; Harnett, P.; Bale, S.J.

The gene for familial malignant melanoma and its precursor lesion, the dysplastic nevus, has been assigned to a region of the distal short arm of chromosome 1, which is frequently involved in karyotypic abnormalities in melanoma cells. The authors have examined loci on chromosome 1p for loss-of-constitutional heterozygosity in 35 melanomas and 21 melanoma cell lines to analyze the role of these abnormalities in melanocyte transformation. Loss-of-heterozygosity at loci on chromosome 1p was identified in 15/35 (43%) melanomas and 11/21 (52%) melanoma cell lines. Analysis of multiple metastases derived from the same patient and of melanoma and lymphoblastoid samples frommore » a family with hereditary melanoma showed that the loss-of-heterozygosity at loci on distal 1p is a late event in tumor progression, rather than the second mutation that would occur if melanoma were due to a cellular recessive mechanism. Comparisons with neuroblastoma and multiple endocrine neoplasia (MEN2) suggest that the frequent 1p loss-of-heterozygosity in these malignancies is a common late event of neuroectodermal tumor progression.« less

Naturally occurring melanomas in dogs as models for non-UV pathways of human melanomas.

PubMed

Gillard, Marc; Cadieu, Edouard; De Brito, Clotilde; Abadie, Jérôme; Vergier, Béatrice; Devauchelle, Patrick; Degorce, Frédérique; Dréano, Stephane; Primot, Aline; Dorso, Laetitia; Lagadic, Marie; Galibert, Francis; Hédan, Benoit; Galibert, Marie-Dominique; André, Catherine

2014-01-01

Spontaneously occurring melanomas are frequent in dogs. They appear at the same localizations as in humans, i.e. skin, mucosal sites, nail matrix and eyes. They display variable behaviors: tumors at oral localizations are more frequent and aggressive than at other anatomical sites. Interestingly, dog melanomas are associated with strong breed predispositions and overrepresentation of black-coated dogs. Epidemiological analysis of 2350 affected dogs showed that poodles are at high risk of developing oral melanoma, while schnauzers or Beauce shepherds mostly developped cutaneous melanoma. Clinical and histopathological analyses were performed on a cohort of 153 cases with a 4-yr follow-up. Histopathological characterization showed that most canine tumors are intradermal and homologous to human rare morphological melanomas types - 'nevocytoid type' and 'animal type'-. Tumor cDNA sequencing data, obtained from 95 dogs for six genes, relevant to human melanoma classification, detected somatic mutations in oral melanoma, in NRAS and PTEN genes, at human hotspot sites, but not in BRAF. Altogether, these findings support the relevance of the dog model for comparative oncology of melanomas, especially for the elucidation of non-UV induced pathways. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Mucosal malignant melanoma - a clinical, oncological, pathological and genetic survey.

PubMed

Mikkelsen, Lauge H; Larsen, Ann-Cathrine; von Buchwald, Christian; Drzewiecki, Krzysztof T; Prause, Jan U; Heegaard, Steffen

2016-06-01

Mucosal melanomas constitute 1.3% of all melanomas and they may develop in any mucosal membrane. Conjunctival melanomas (0.5/million/year) and melanomas in the sinonasal cavity (0.5/million/year) are the most common, followed by anorectal melanomas (0.4/million/year) and melanomas in the oral cavity (0.2/million/year). Anorectal melanoma occurs slightly more often in females, whereas oral melanoma has a male predilection. Mucosal melanoma most commonly develops in a patient's sixth or seventh decade of life, and no differences between races have been found except for sinonasal melanoma and conjunctival melanoma, which are very rare in Black people. The symptoms are not tumour-specific and are related to the organ system affected, and the disease is most often diagnosed at an advanced clinical stage. The diagnosis of a primary tumour is difficult, and metastatic cutaneous melanoma and choroidal melanoma must be excluded. Mutations in KIT are frequently found, while BRAF and NRAS mutations are rarely found - except in conjunctival melanomas that carry BRAF mutations. Mutations in the TERT promotor region are also found in mucosal melanomas. Complete surgical resection with free margins is the treatment of choice. The prognosis is poor, with the 5-year survival rate ranging from 0% (gastric melanoma) to 80% (conjunctival melanoma). © 2016 APMIS. Published by John Wiley & Sons Ltd.

Genetic predisposition to peripheral nerve neoplasia: Diagnostic criteria and pathogenesis of neurofibromatoses, Carney complex, and related syndromes

PubMed Central

Rodriguez, Fausto J.; Stratakis, Constantine A.; Evans, D Gareth

2013-01-01

Neoplasms of the peripheral nerve sheath represent essential clinical manifestations of the syndromes known as the neurofibromatoses. Although involvement of multiple organ systems, including skin, central nervous system and skeleton, may also be conspicuous, peripheral nerve neoplasia is often the most important and frequent cause of morbidity in these patients. Clinical characteristics of neurofibromatosis type 1 (NF1) and neurofibromatosis type 2 (NF2) have been extensively described and studied during the last century, and the identification of mutations in the NF1 and NF2 genes by contemporary molecular techniques have created a separate multidisciplinary field in genetic medicine. In schwannomatosis, the most recent addition to the neurofibromatosis group, peripheral nervous system involvement is the exclusive (or almost exclusive) clinical manifestation. Although the majority of cases of schwannomatosis are sporadic, approximately a third occur in families and a subset of these has recently been associated with germline mutations in the tumor suppressor gene SMARCB1/INI1. Other curious syndromes that involve the peripheral nervous system are associated with predominant endocrine manifestations, and include Carney Complex and MEN2b, secondary to inactivating mutations in the PRKAR1A gene in a subset, and activating mutations in RET respectively. In this review, we provide a concise update on the diagnostic criteria, pathology and molecular pathogenesis of these enigmatic syndromes in relation to peripheral nerve sheath neoplasia. PMID:22210082

Genetic predisposition to peripheral nerve neoplasia: diagnostic criteria and pathogenesis of neurofibromatoses, Carney complex, and related syndromes.

PubMed

Rodriguez, Fausto J; Stratakis, Constantine A; Evans, D Gareth

2012-03-01

Neoplasms of the peripheral nerve sheath represent essential clinical manifestations of the syndromes known as the neurofibromatoses. Although involvement of multiple organ systems, including skin, central nervous system, and skeleton, may also be conspicuous, peripheral nerve neoplasia is often the most important and frequent cause of morbidity in these patients. Clinical characteristics of neurofibromatosis type 1 (NF1) and neurofibromatosis type 2 (NF2) have been extensively described and studied during the last century, and the identification of mutations in the NF1 and NF2 genes by contemporary molecular techniques have created a separate multidisciplinary field in genetic medicine. In schwannomatosis, the most recent addition to the neurofibromatosis group, peripheral nervous system involvement is the exclusive (or almost exclusive) clinical manifestation. Although the majority of cases of schwannomatosis are sporadic, approximately one-third occur in families and a subset of these has recently been associated with germline mutations in the tumor suppressor gene SMARCB1/INI1. Other curious syndromes that involve the peripheral nervous system are associated with predominant endocrine manifestations, and include Carney complex and MEN2b, secondary to inactivating mutations in the PRKAR1A gene in a subset, and activating mutations in RET, respectively. In this review, we provide a concise update on the diagnostic criteria, pathology and molecular pathogenesis of these enigmatic syndromes in relation to peripheral nerve sheath neoplasia.

Epistatically Interacting Substitutions Are Enriched during Adaptive Protein Evolution

PubMed Central

Gong, Lizhi Ian; Bloom, Jesse D.

2014-01-01

Most experimental studies of epistasis in evolution have focused on adaptive changes—but adaptation accounts for only a portion of total evolutionary change. Are the patterns of epistasis during adaptation representative of evolution more broadly? We address this question by examining a pair of protein homologs, of which only one is subject to a well-defined pressure for adaptive change. Specifically, we compare the nucleoproteins from human and swine influenza. Human influenza is under continual selection to evade recognition by acquired immune memory, while swine influenza experiences less such selection due to the fact that pigs are less likely to be infected with influenza repeatedly in a lifetime. Mutations in some types of immune epitopes are therefore much more strongly adaptive to human than swine influenza—here we focus on epitopes targeted by human cytotoxic T lymphocytes. The nucleoproteins of human and swine influenza possess nearly identical numbers of such epitopes. However, mutations in these epitopes are fixed significantly more frequently in human than in swine influenza, presumably because these epitope mutations are adaptive only to human influenza. Experimentally, we find that epistatically constrained mutations are fixed only in the adaptively evolving human influenza lineage, where they occur at sites that are enriched in epitopes. Overall, our results demonstrate that epistatically interacting substitutions are enriched during adaptation, suggesting that the prevalence of epistasis is dependent on the underlying evolutionary forces at play. PMID:24811236

Metastasis of colon cancer to the thyroid gland: a case diagnosed on fine-needle aspirate by a combined cytological, immunocytochemical, and molecular approach.

PubMed

Cozzolino, Immacolata; Malapelle, Umberto; Carlomagno, Chiara; Palombini, Lucio; Troncone, Giancarlo

2010-12-01

Fine-needle aspiration (FNA) with cytological evaluation reliably diagnoses primary and secondary thyroid neoplasms. However, identifying the primary origin of a metastatic process involving the thyroid gland is challenging. In particular, metastasis of colon cancer to the thyroid gland is very rare. In this case report, a right lobe solid thyroid nodule in a 66-year-old male was aspirated. FNA cytology showed necrosis and atypical tall columnar cells; since, the patient at age 60 had undergone surgery for a sigmoid-rectal cancer metastasizing to the liver and subsequently to the lung, a suspicion of metastasis from colon cancer was raised. This was corroborated by cell-block immunocytochemistry showing a cytokeratin (CK) 7 negative/CK20-positive staining pattern; thyreoglobulin and TTF-1 were both negative. Since KRAS codon 12/13 mutations frequently occur in colon cancer, whereas they are extremely uncommon in primary thyroid tumors, DNA was extracted from the aspirated cells, and KRAS mutational analysis was carried out. The codon 12 G12D mutation was found; the same mutation was evident in the primary cancer of the colon and in its liver and lung metastasis. Thus, a combined cytological, immunocytochemical and molecular approach unquestionably correlated metastatic adenocarcinoma cells aspirated from the thyroid to a colo-rectal origin. © 2010 Wiley-Liss, Inc.

Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

PubMed

Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

2017-11-01

Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

Novel genes and mutations in patients affected by recurrent pregnancy loss.

PubMed

Quintero-Ronderos, Paula; Mercier, Eric; Fukuda, Michiko; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Vaiman, Daniel; Gris, Jean-Christophe; Laissue, Paul

2017-01-01

Recurrent pregnancy loss is a frequently occurring human infertility-related disease affecting ~1% of women. It has been estimated that the cause remains unexplained in >50% cases which strongly suggests that genetic factors may contribute towards the phenotype. Concerning its molecular aetiology numerous studies have had limited success in identifying the disease's genetic causes. This might have been due to the fact that hundreds of genes are involved in each physiological step necessary for guaranteeing reproductive success in mammals. In such scenario, next generation sequencing provides a potentially interesting tool for research into recurrent pregnancy loss causative mutations. The present study involved whole-exome sequencing and an innovative bioinformatics analysis, for the first time, in 49 unrelated women affected by recurrent pregnancy loss. We identified 27 coding variants (22 genes) potentially related to the phenotype (41% of patients). The affected genes, which were enriched by potentially deleterious sequence variants, belonged to distinct molecular cascades playing key roles in implantation/pregnancy biology. Using a quantum chemical approach method we established that mutations in MMP-10 and FGA proteins led to substantial energetic modifications suggesting an impact on their functions and/or stability. The next generation sequencing and bioinformatics approaches presented here represent an efficient way to find mutations, having potentially moderate/strong functional effects, associated with recurrent pregnancy loss aetiology. We consider that some of these variants (and genes) represent probable future biomarkers for recurrent pregnancy loss.

Behavioral phenotypes of genetic mouse models of autism

PubMed Central

Kazdoba, T. M.; Leach, P. T.; Crawley, J. N.

2016-01-01

More than a hundred de novo single gene mutations and copy-number variants have been implicated in autism, each occurring in a small subset of cases. Mutant mouse models with syntenic mutations offer research tools to gain an understanding of the role of each gene in modulating biological and behavioral phenotypes relevant to autism. Knockout, knockin and transgenic mice incorporating risk gene mutations detected in autism spectrum disorder and comorbid neurodevelopmental disorders are now widely available. At present, autism spectrum disorder is diagnosed solely by behavioral criteria. We developed a constellation of mouse behavioral assays designed to maximize face validity to the types of social deficits and repetitive behaviors that are central to an autism diagnosis. Mouse behavioral assays for associated symptoms of autism, which include cognitive inflexibility, anxiety, hyperactivity, and unusual reactivity to sensory stimuli, are frequently included in the phenotypic analyses. Over the past 10 years, we and many other laboratories around the world have employed these and additional behavioral tests to phenotype a large number of mutant mouse models of autism. In this review, we highlight mouse models with mutations in genes that have been identified as risk genes for autism, which work through synaptic mechanisms and through the mTOR signaling pathway. Robust, replicated autism-relevant behavioral outcomes in a genetic mouse model lend credence to a causal role for specific gene contributions and downstream biological mechanisms in the etiology of autism. PMID:26403076

Pitfalls in the molecular genetic diagnosis of Leber hereditary optic neuropathy (LHON)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johns, D.R.; Neufeld, M.J.

1993-10-01

Pathogenetic mutations in mtDNA are found in the majority of patients with Leber hereditary optic neuropathy (LHON), and molecular genetic techniques to detect them are important for diagnosis. A false-positive molecular genetic error has adverse consequences for the diagnosis of this maternally inherited disease. The authors found a number of mtDNA polymorphisms that occur adjacent to known LHON-associated mutations and that confound their molecular genetic detection. These transition mutations occur at mtDNA nt 11779 (SfaNI site loss, 11778 mutation), nt 3459 (BsaHI site loss, 3460 mutation), nt 15258 (AccI site loss, 15257 mutation), nt 14485 (mismatch primer Sau3AI site loss,more » 14484 mutation), and nt 13707 (BstNI site loss, 13708 mutation). Molecular genetic detection of the most common pathogenetic mtDNA mutations in LHON, using a single restriction enzyme, may be confounded by adjacent polymorphisms that occur with a false-positive rate of 2%-7%. 19 refs.« less

Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

PubMed

Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

2017-07-01

Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

The Prevalence of Gap Junction Protein Beta 2 (GJB2) Mutations in Non Syndromic Sensorineural Hearing Loss in Çukurova Region.

PubMed

Bozdoğan, Sevcan Tuğ; Kuran, Gökhan; Yüregir, Özge Özalp; Aslan, Hüseyin; Haytoğlu, Süheyl; Ayaz, Akif; Arıkan, Osman Kürşat

2015-08-01

To date, studies in all populations showed that mutations in the gene of Gap junction protein beta 2 (GJB2) play an important role in non-syndromic autosomal recessive congenital hearing loss. The aim of this study was to evaluate GJB2 gene of patients with hearing loss in our region using deoxyribonucleic acid (DNA) sequencing method and to demonstrate region-specific mutation and polymorphism distribution. Patients who had bilateral severe sensorineural non-syndromic hearing loss identified by audiologic evaluation were included. Peripheral blood samples were collected and the GJB2 gene exon1 and exon 2 regions were amplified by polymerase chain reaction (PCR). Obtained PCR products were sequenced by the DNA sequence analysis method (SeqFinder Sequencing System; ABI 3130; Foster City, CA, USA) and analyzed using the SeqScape software. Of the 77 patients, 16 had homozygous or heterozygous mutation. The mutation of 35delG, which is known as the most frequent mutation of GJB2 gene, was also the most frequently seen mutation at a ratio of 5.5% in patients with hearing loss in our region; this was followed by the V27I mutation. As this is the first study conducted by sequence analysis in our region, it was worth to be presented in terms of showing the distribution of mutation.

Biological significance of TERT promoter mutation in papillary urothelial neoplasm of low malignant potential.

PubMed

Wang, Chung-Chieh; Huang, Chao-Yuan; Jhuang, Yu-Lin; Chen, Chih-Chi; Jeng, Yung-Ming

2018-04-01

Mutations in FGFR3 and the promoter region of the telomerase reverse transcriptase (TERT) gene have been found frequently in urothelial carcinoma of the urinary bladder. However, related data for papillary urothelial neoplasm of low malignant potential (PUNLMP) are limited. In this study, we investigated the mutation status of the TERT promoter, FGFR3 and HRAS in low-grade papillary urothelial neoplasms and evaluated their prognostic significance. The cases included in this study comprised 21 inverted papillomas, 30 PUNLMPs and 34 low-grade non-invasive papillary urothelial carcinomas (NIPUCs). TERT promoter mutations were observed in 10 (33%) PUNLMPs and 17 (50%) low-grade NIPUCs, but not in any inverted papilloma. FGFR3 mutations were observed more frequently in PUNLMP and low-grade NIPUC than in inverted papillomas (P = 0.009), whereas the opposite trend was noted for HRAS mutations (P < 0.001). Regarding the clinical outcome, TERT promoter mutation was associated with a higher recurrence rate in PUNLMP (P = 0.024) but not in low-grade NIPUC (P = 0.530). Notably, PUNLMP cases with TERT promoter mutations had a similar recurrence rate to that in low-grade NIPUC cases (P = 0.487). Our results suggest that the status of the TERT promoter mutation may serve as a biomarker of prognostic stratification in patients with PUNLMP. © 2017 John Wiley & Sons Ltd.

Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

PubMed

Mohamed Yusoff, Abdul Aziz; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

2016-12-01

Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. Creative Commons Attribution License

Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

PubMed Central

Yusoff, Abdul Aziz Mohamed; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

2016-01-01

Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. PMID:28125199

Estrogen receptor (ESR1) mutation in bone metastases from breast cancer.

PubMed

Bartels, Stephan; Christgen, Matthias; Luft, Angelina; Persing, Sascha; Jödecke, Kai; Lehmann, Ulrich; Kreipe, Hans

2018-01-01

Activating mutations of estrogen receptor α gene (ESR1) in breast cancer can cause endocrine resistance of metastatic tumor cells. The skeleton belongs to the metastatic sides frequently affected by breast cancer. The prevalence of ESR1 mutation in bone metastasis and the corresponding phenotype are not known. In this study bone metastases from breast cancer (n=231) were analyzed for ESR1 mutation. In 27 patients (12%) (median age 73 years, range: 55-82 years) activating mutations of ESR1 were detected. The most frequent mutation was p.D538G (53%), no mutations in exon 4 (K303) or 7 (S463) were found. Lobular breast cancer was present in 52% of mutated cases (n=14) and in 49% of all samples (n=231), respectively. Mutated cancers constantly displayed strong estrogen receptor expression. Progesterone receptor was positive in 78% of the mutated cases (n=21). From 194 estrogen receptor-positive samples, 14% had ESR1 mutated. Except for one mutated case, no concurrent HER2 overexpression was noted. Metastatic breast cancer with activating mutations of ESR1 had a higher Ki67 labeling index than primary luminal cancers (median 30%, ranging from 5 to 60% with 85% of cases revealing ≥20% Ki67-positive cells). From those patients from whom information on endocrine therapy was available (n=7), two had received tamoxifen only, 4 tamoxifen followed by aromatase inhibitors and one patient had been treated with aromatase inhibitors only. We conclude that ESR1 mutation is associated with estrogen receptor expression and high proliferative activity and affects about 14% of estrogen receptor-positive bone metastases from breast cancer.

Isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma.

PubMed

Kipp, Benjamin R; Voss, Jesse S; Kerr, Sarah E; Barr Fritcher, Emily G; Graham, Rondell P; Zhang, Lizhi; Highsmith, W Edward; Zhang, Jun; Roberts, Lewis R; Gores, Gregory J; Halling, Kevin C

2012-10-01

Somatic mutations in isocitrate dehydrogenase 1 and 2 genes are common in gliomas and help stratify patients with brain cancer into histologic and molecular subtypes. However, these mutations are considered rare in other solid tumors. The aims of this study were to determine the frequency of isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma and to assess histopathologic differences between specimens with and without an isocitrate dehydrogenase mutation. We sequenced 94 formalin-fixed, paraffin-embedded cholangiocarcinoma (67 intrahepatic and 27 extrahepatic) assessing for isocitrate dehydrogenase 1 (codon 132) and isocitrate dehydrogenase 2 (codons 140 and 172) mutations. Multiple histopathologic characteristics were also evaluated and compared with isocitrate dehydrogenase 1/2 mutation status. Of the 94 evaluated specimens, 21 (22%) had a mutation including 14 isocitrate dehydrogenase 1 and 7 isocitrate dehydrogenase 2 mutations. Isocitrate dehydrogenase mutations were more frequently observed in intrahepatic cholangiocarcinoma than in extrahepatic cholangiocarcinoma (28% versus 7%, respectively; P = .030). The 14 isocitrate dehydrogenase 1 mutations were R132C (n = 9), R132S (n = 2), R132G (n = 2), and R132L (n = 1). The 7 isocitrate dehydrogenase 2 mutations were R172K (n = 5), R172M (n = 1), and R172G (n = 1). Isocitrate dehydrogenase mutations were more frequently observed in tumors with clear cell change (P < .001) and poorly differentiated histology (P = .012). The results of this study show for the first time that isocitrate dehydrogenase 1 and 2 genes are mutated in cholangiocarcinoma. The results of this study are encouraging because it identifies a new potential target for genotype-directed therapeutic trials and may represent a potential biomarker for earlier detection of cholangiocarcinoma in a subset of cases. Copyright © 2012 Elsevier Inc. All rights reserved.

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation.

PubMed

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H; Yang, Rui; Killela, Patrick J; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Liang, Junbo; Wang, Sizhen; Jiao, Yuchen; Yan, Hai; Tao, Hou-Quan

2015-05-01

Several somatic mutation hotspots were recently identified in the telomerase reverse transcriptase (TERT) promoter region in human cancers. Large scale studies of these mutations in multiple tumour types are limited, in particular in Asian populations. This study aimed to: analyse TERT promoter mutations in multiple tumour types in a large Chinese patient cohort, investigate novel tumour types and assess the functional significance of the mutations. TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumour types and 799 tumour tissues from Chinese cancer patients. Thymic epithelial tumours, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR), telomerase activity by the telomeric repeat amplification protocol (TRAP) assay and promoter activity by the luciferase reporter assay. TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in gastrointestinal stromal tumour (GIST), thymic epithelial tumours, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumourigenesis, making them potential therapeutic targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

PubMed Central

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

2015-01-01

Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

Alpha-particle carcinogenesis in Thorotrast patients: epidemiology, dosimetry, pathology, and molecular analysis.

PubMed

Ishikawa, Y; Wada, I; Fukumoto, M

2001-01-01

We studied the alpha-radiation risks in patients who received injections of Thorotrast, an X-ray contrast medium used in Europe, Japan, and the United States from 1930 to 1955. Thorotrast was composed of thorium dioxide (ThO2) and Th-232, a naturally occurring radionuclide. Because the physical half-life of ThO2 is 14 billion years and Thorotrast is hardly eliminated from the body, tissues in which it was deposited are irradiated by alpha-radiation for the entire lifetime of the subject. The dosimetry of Thorotrast patients is very complicated, but currently its reliability is quite high compared with other irradiated populations. The major causes of the death of Thorotrast patients are liver cancer, liver cirrhosis, leukemia, and other cancers. Three histologies of liver cancer are found: cholangiocarcinoma, hepatocellular carcinoma, and angiosarcoma. Although cholangiocarcinoma is the most frequent, angiosarcoma is characteristic of alpha-radiation. Among blood neoplasms with a higher incidence of increase than the general population, erythroleukemia and myelodysplastic syndrome were remarkable. Thorotrast patients exhaled a high concentration of radon (Rn-220), a progeny of Th-232, but no excesses of lung cancer in the patients of Japan, Germany, and Denmark were reported. Mutation analyses of p53 genes and loss of heterozygosity (LOH) studies at 17p locus were performed to characterize the genetic changes in Thorotrast-induced liver tumors. Interestingly, LOH, supposedly corresponding to large deletions was not frequent; most mutations were transitions, also seen in tumors of the general population, suggesting that genetic changes of Thorotrast-induced cancers are mainly delayed mutations, and not the result of the direct effects of radiation.

Synergistic Interactions with PI3K Inhibition that Induce Apoptosis. | Office of Cancer Genomics

Cancer.gov

Activating mutations involving the PI3K pathway occur frequently in human cancers. However, PI3K inhibitors primarily induce cell cycle arrest, leaving a significant reservoir of tumor cells that may acquire or exhibit resistance. We searched for genes that are required for the survival of PI3K mutant cancer cells in the presence of PI3K inhibition by conducting a genome scale shRNA-based apoptosis screen in a PIK3CA mutant human breast cancer cell. We identified 5 genes (PIM2, ZAK, TACC1, ZFR, ZNF565) whose suppression induced cell death upon PI3K inhibition.

CMML AND aCML: NOVEL PATHOGENETIC LESIONS

PubMed Central

Muramatsu, Hideki; Makishima, Hideki; Maciejewski, Jaroslaw P.

2012-01-01

Summary Chronic myelomonocytic leukemia (CMML) and atypical chronic myeloid leukemia (aCML) are distinct, yet related, entities of myelodysplastic/myeloproliferative neoplasms (MDS/MPN) characterized by morphologic dysplasia with accumulation of monocytes or neutrophils, respectively. Our understanding of the molecular pathogenesis of CMML and aCML has advanced, mainly due to the application of novel technologies such as array-based karyotyping or next generation sequencing. In addition to previously known recurrent aberrations, somatic uniparental disomy affecting chromosomes 3, 4, 7, and 11 frequently occurs in CMML. Novel somatic mutations of genes, including those associated with proliferation signaling (CBL, RAS, RUNX1, JAK2 (V617F)) and with modification of epigenetic status (TET2, ASXL1, UTX, EZH2) have been found. Various combinations of mutations suggest a multistep pathogenesis and may account for clinical heterogeneity. The prognostic and diagnostic significance of these molecular lesions, in particular their value as biomarkers of response or resistance to specific therapies, while uncertain now is likely to be clarified as large systematic studies come to completion. PMID:22289493

[Familial hypercalcemia and hypophosphatemia: importance in differential diagnosis of disorders in calcium-phosphate metabolism].

PubMed

Zofková, I

2010-05-01

Hypercalcemia and hypophosphatemia are symptoms of two relatively rare hereditary diseases and are extraordinarily important from the standpoint of the differential diagnosis. Mutation in calcium sensing receptor gene (CaSR) clinically manifests as familial hypocalciuric hypercalcemia (FHH) or as the much more serious neonatal hyperparathyreosis. Hypercalciuric hypocalcemia is extremely rare. Prognosis for the most frequent mutations in the CaSR gene FHH is considered benign; nevertheless, if overlooked it can lead to an incorrect diagnosis of primary hyperparathyreosis, which has a fundamentally different prognosis and treatment. Familial hypophosphatemia sometimes occurs as hereditary rickets, which is a consequence of insufficient production of vitamin D-hormone or abnormal function of vitamin D receptors (VDR). The disease manifests as X-linked dominant hypophosphatemic rickets or autosomal dominant hypophosphatemic rickets. Autosomal recessive form is very rare. Oncogenic hypophosphatemia should be excluded in differential diagnosis. In this review the issues of pathogenesis, differential diagnosis and treatment of FHH and hypophosphatemic rickets are discussed.

CFTR gene mutations in isolated chronic obstructive pulmonary disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pignatti, P.F.; Bombien, C.; Marigo, C.

1994-09-01

In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

A Comparison between CHEK2*1100delC/I157T Mutation Carrier and Noncarrier Breast Cancer Patients: A Clinicopathological Analysis.

PubMed

Huszno, Joanna; Budryk, Magdalena; Kołosza, Zofia; Tęcza, Karolina; Pamuła Piłat, Jolanta; Nowara, Elżbieta; Grzybowska, Ewa

2016-01-01

The suppressor gene CHEK2 encodes a cell cycle checkpoint kinase, involved in cell cycle regulation, apoptosis and response to DNA damage. The aim of this study was to analyze the differences between CHEK2 mutation carriers (CHEK2*1100delC/I157T) and noncarriers with respect to clinicopathological factors. We reviewed the medical records of 100 early breast cancer patients (46 mutation carriers and 54 noncarriers) who were treated with chemotherapy, hormonotherapy or trastuzumab. CHEK2 mutation carriers were older (>65 years) than noncarriers (17 vs. 7%; p = 0.215). Twenty-five (54%) of them had a history of cancer in the family. Gastric cancer in the family history was detected in 11% of mutation carriers and in 2% of noncarriers (p = 0.092). There was a trend for more frequent lymph node metastases in patients without the mutation in comparison to mutation carriers (46 vs. 28%; p = 0.098). Luminal B type breast cancer was detected more often in carriers (39 vs. 20%; p = 0.048). Breast-conserving treatment was also conducted more often in mutation carriers (57 vs. 31%; p = 0.015). Histologic grades G1/G2 were detected more frequently in mutation carriers (82 vs. 70%; p = 0.212). Mutation carriers were characterized by older age, a history of gastric cancer in the family, locally advanced disease, lower histologic grade and luminal B type breast cancer. © 2016 S. Karger AG, Basel.

Plac8 links oncogenic mutations to regulation of autophagy and is critical to pancreatic cancer progression

PubMed Central

Kinsey, Conan; Balakrishnan, Vijaya; O’Dell, Michael R.; Huang, Jing Li; Newman, Laurel; Whitney-Miller, Christa L.; Hezel, Aram F.; Land, Hartmut

2014-01-01

Summary Mutations in p53 and RAS potently cooperate in oncogenic transformation and correspondingly these genetic alterations frequently coexist in pancreatic ductal adenocarcinoma (PDA) and other human cancers. Previously we identified a set of genes synergistically activated by combined RAS and p53 mutations as frequent downstream mediators of tumorigenesis. Here, we show that the synergistically activated gene Plac8 is critical for pancreatic cancer growth. Silencing of Plac8 in cell lines suppresses tumor formation by blocking autophagy, a process essential for maintaining metabolic homeostasis in PDA, and genetic inactivation in an engineered mouse model inhibits PDA progression. We show that Plac8 is a critical regulator of the autophagic machinery, localizing to the lysosomal compartment and facilitating lysosome-autophagosome fusion. Plac8 thus provides a mechanistic link between primary oncogenic mutations and the induction of autophagy, a central mechanism of metabolic reprogramming, during PDA progression. PMID:24794439

Integration of genomic, transcriptomic and proteomic data identifies two biologically distinct subtypes of invasive lobular breast cancer

PubMed Central

Michaut, Magali; Chin, Suet-Feung; Majewski, Ian; Severson, Tesa M.; Bismeijer, Tycho; de Koning, Leanne; Peeters, Justine K.; Schouten, Philip C.; Rueda, Oscar M.; Bosma, Astrid J.; Tarrant, Finbarr; Fan, Yue; He, Beilei; Xue, Zheng; Mittempergher, Lorenza; Kluin, Roelof J.C.; Heijmans, Jeroen; Snel, Mireille; Pereira, Bernard; Schlicker, Andreas; Provenzano, Elena; Ali, Hamid Raza; Gaber, Alexander; O’Hurley, Gillian; Lehn, Sophie; Muris, Jettie J.F.; Wesseling, Jelle; Kay, Elaine; Sammut, Stephen John; Bardwell, Helen A.; Barbet, Aurélie S.; Bard, Floriane; Lecerf, Caroline; O’Connor, Darran P.; Vis, Daniël J.; Benes, Cyril H.; McDermott, Ultan; Garnett, Mathew J.; Simon, Iris M.; Jirström, Karin; Dubois, Thierry; Linn, Sabine C.; Gallagher, William M.; Wessels, Lodewyk F.A.; Caldas, Carlos; Bernards, Rene

2016-01-01

Invasive lobular carcinoma (ILC) is the second most frequently occurring histological breast cancer subtype after invasive ductal carcinoma (IDC), accounting for around 10% of all breast cancers. The molecular processes that drive the development of ILC are still largely unknown. We have performed a comprehensive genomic, transcriptomic and proteomic analysis of a large ILC patient cohort and present here an integrated molecular portrait of ILC. Mutations in CDH1 and in the PI3K pathway are the most frequent molecular alterations in ILC. We identified two main subtypes of ILCs: (i) an immune related subtype with mRNA up-regulation of PD-L1, PD-1 and CTLA-4 and greater sensitivity to DNA-damaging agents in representative cell line models; (ii) a hormone related subtype, associated with Epithelial to Mesenchymal Transition (EMT), and gain of chromosomes 1q and 8q and loss of chromosome 11q. Using the somatic mutation rate and eIF4B protein level, we identified three groups with different clinical outcomes, including a group with extremely good prognosis. We provide a comprehensive overview of the molecular alterations driving ILC and have explored links with therapy response. This molecular characterization may help to tailor treatment of ILC through the application of specific targeted, chemo- and/or immune-therapies. PMID:26729235

Elevated expression of activated forms of Neu/ErbB-2 and ErbB-3 are involved in the induction of mammary tumors in transgenic mice: implications for human breast cancer.

PubMed Central

Siegel, P M; Ryan, E D; Cardiff, R D; Muller, W J

1999-01-01

To assess the importance of Neu activation during mammary tumorigenesis, altered receptors harboring in-frame deletions within the extracellular domain were expressed in transgenic mice. Females from several independent lines develop multiple mammary tumors that frequently metastasize to the lung. Tumor progression in these strains was associated with elevated levels of tyrosine-phosphorylated Neu and ErbB-3. Consistent with these observations, a survey of primary human breast tumors revealed frequent co-expression of both erbB-2 and erbB-3 transcripts. The ability of altered Neu receptors to induce mammary tumorigenesis in transgenic mice prompted us to examine whether similar mutations occurred in ErbB-2 during human breast cancer progression. Interestingly, an alternatively spliced form of erbB-2, closely resembling spontaneous activated forms of neu, was detected in human breast tumors. The ErbB-2 receptor encoded by this novel transcript harbors an in-frame deletion of 16 amino acids in the extracellular domain and can transform Rat-1 fibroblasts. Together, these observations argue that co-expression of ErbB-2 and ErbB-3 may play a critical role in the induction of human breast tumors, and raise the possibility that activating mutations in the ErbB-2 receptor may also contribute to this process. PMID:10205169

Phenotypic and genotypic studies of ALS cases in ALS-SMA families.

PubMed

Corcia, Philippe; Vourc'h, Patrick; Blasco, Helene; Couratier, Philippe; Dangoumau, Audrey; Bellance, Remi; Desnuelle, Claude; Viader, Fausto; Pautot, Vivien; Millecamps, Stephanie; Bakkouche, Salah; Salachas, FranÇois; Andres, Christian R; Meininger, Vincent; Camu, William

2018-08-01

Amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA) are the most frequent motor neuron disorders in adulthood and infancy, respectively. There is a growing literature supporting common pathophysiological patterns between those disorders. One important clinical issue for that is the co-occurrence of both diseases within a family. To collect families in which ALS and SMA patients co-exist and describe the phenotype and the genotype of ALS patients. Nine families with co-occurrence of SMA and ALS have been gathered over the last 15 years. Epidemiological, phenotype and genetic status were collected. Out of the nine families, six corresponded to the criteria of familial ALS (FALS). Clinical data were available for 11 patients out of the 15 ALS cases. Mean age of onset was 58.5 years, site of onset was lower limbs in nine cases (81.8%), median duration was 22 months. Four ALS patients carried a mutation: three mutations in SOD1 gene (G147N in two cases and one with E121G) and one repeat expansion in the C9ORF72 gene. Three patients had abnormal SMN1 copy numbers. While the high proportion of familial history of ALS cases in these ALS-SMA pedigrees could have suggested that these familial clusters of the two most frequent MND rely on a genetic background, we failed to exclude that this occurred by chance.

MOXD2, a Gene Possibly Associated with Olfaction, Is Frequently Inactivated in Birds

PubMed Central

Goh, Chul Jun; Choi, Dongjin; Park, Dong-Bin; Kim, Hyein; Hahn, Yoonsoo

2016-01-01

Vertebrate MOXD2 encodes a monooxygenase DBH-like 2 protein that could be involved in neurotransmitter metabolism, potentially during olfactory transduction. Loss of MOXD2 in apes and whales has been proposed to be associated with evolution of olfaction in these clades. We analyzed 57 bird genomes to identify MOXD2 sequences and found frequent loss of MOXD2 in 38 birds. Among the 57 birds, 19 species appeared to have an intact MOXD2 that encoded a full-length protein; 32 birds had a gene with open reading frame-disrupting point mutations and/or exon deletions; and the remaining 6 species did not show any MOXD2 sequence, suggesting a whole-gene deletion. Notably, among 10 passerine birds examined, 9 species shared a common genomic deletion that spanned several exons, implying the gene loss occurred in a common ancestor of these birds. However, 2 closely related penguin species, each of which had an inactive MOXD2, did not share any mutation, suggesting an independent loss after their divergence. Distribution of the 38 birds without an intact MOXD2 in the bird phylogenetic tree clearly indicates that MOXD2 loss is widespread and independent in bird lineages. We propose that widespread MOXD2 loss in some bird lineages may be implicated in the evolution of olfactory perception in these birds. PMID:27074048

MOXD2, a Gene Possibly Associated with Olfaction, Is Frequently Inactivated in Birds.

PubMed

Goh, Chul Jun; Choi, Dongjin; Park, Dong-Bin; Kim, Hyein; Hahn, Yoonsoo

2016-01-01

Vertebrate MOXD2 encodes a monooxygenase DBH-like 2 protein that could be involved in neurotransmitter metabolism, potentially during olfactory transduction. Loss of MOXD2 in apes and whales has been proposed to be associated with evolution of olfaction in these clades. We analyzed 57 bird genomes to identify MOXD2 sequences and found frequent loss of MOXD2 in 38 birds. Among the 57 birds, 19 species appeared to have an intact MOXD2 that encoded a full-length protein; 32 birds had a gene with open reading frame-disrupting point mutations and/or exon deletions; and the remaining 6 species did not show any MOXD2 sequence, suggesting a whole-gene deletion. Notably, among 10 passerine birds examined, 9 species shared a common genomic deletion that spanned several exons, implying the gene loss occurred in a common ancestor of these birds. However, 2 closely related penguin species, each of which had an inactive MOXD2, did not share any mutation, suggesting an independent loss after their divergence. Distribution of the 38 birds without an intact MOXD2 in the bird phylogenetic tree clearly indicates that MOXD2 loss is widespread and independent in bird lineages. We propose that widespread MOXD2 loss in some bird lineages may be implicated in the evolution of olfactory perception in these birds.

Prevalence of mutations within major hydrophilic region of hepatitis B virus and their correlation with genotypes among chronically infected patients in Egypt.

PubMed

Abu Zeid, Walaa M; Ramadan, Dalia I; Shemis, Mohamed A

2016-03-01

Mutations within the major hydrophilic region (MHR) of the hepatitis B surface antigen (HBsAg) have been reported in relation to viral persistence by evasion from vaccine and immunotherapy, severity of liver disease and lack of detection by commercial kits. The aim of this study was to elucidate the circulation of hepatitis B virus (HBV) genotypes, subgenotypes and serotypes in Egypt, with recognition of the pattern and prevalence of MHR mutations possibly occurring during the course of the disease. Eighty-eight samples from patients with chronic HBV infection were included in the study. The surface protein-encoding gene (S gene) in the HBV genome was subjected to amplification and partial sequencing. Based on phylogenetic analysis, only genotype D was found circulating among patients. The majority of isolates belonged to subgenotype D3 (86.3%), followed by D7 (8%), then D5 (3.4%) and lastly D1 (2.3%). Two subtypes were identified: ayw2 (97%) and ayw3 (2%). The 'w' sub-determinant was not defined in one isolate (1%). A significant proportion of patients (13/88, 14.8%) exhibited mutations in the MHR, 10 of whom harboured mutations in the 'a' determinant region and three outside. The first loop comprised four patients with three mutations (P127S, P127T and Y134F). The second loop contained six patients, all with one mutation, S143L, which was most frequently encountered in this study (6.8%). We conclude that genotype D, subgenotype D3 and HBsAg subtype ayw2 are the most common types circulating in Egypt, which account for 100%, 86.3% and 97% of the population, respectively, with a moderate degree of MHR mutations. Copyright © 2016 Arab Journal of Gastroenterology. Published by Elsevier B.V. All rights reserved.

Evolutionary history of two pollen self-incompatibility factors reveals alternate routes to self-compatibility within Solanum.

PubMed

Markova, Dragomira N; Petersen, Jennifer J; Yam, Sarah E; Corral, Adryanna; Valle, Matthew J; Li, Wentao; Chetelat, Roger T

2017-12-01

Self-incompatibility (SI) prevents self-fertilization and reduces inbreeding. While SI is common in plants, transitions to self-compatibility (SC) occur frequently. Little is known about the genetic changes and evolutionary steps underlying these shifts. In the Solanaceae, SI is gametophytic, with specificity determined by S-RNases in the pistil and S-locus F-box proteins (SLFs) in pollen. We examined the role of two pollen factors, Cullin1 (CUL1) and SLF-23, in SI → SC transitions in wild tomato species from the Arcanum species group ( Solanum arcanum , S. neorickii , and S. chmielewskii ). Pollen compatibility was assessed on tester lines that reject pollen lacking functional SLF-23 or CUL1. Complementation tests, gene sequencing, and phylogenetic analyses were used to characterize both functional and nonfunctional alleles. We found evidence for multiple independent SI → SC transitions. In S. arcanum and S. chmielewskii , SC is caused by loss of pistil S-RNase activity, while in S. neorickii SC is associated with expression of a functional SLF-23 that recognizes the S 9 type S-RNase expressed in its pistils. Interestingly, we found identical deletion mutations in CUL1 exon 7 of S. chmielewskii as previously seen in S. habrochaites . Mating system transitions in the Arcanum group have occurred via both pistil loss-of-function and pollen gain-of-function SC mutations. Mutations common to S. chmielewskii and S. habrochaites must have arisen in a common ancestor, possibly to the entire tomato clade, then became fixed in different lineages after loss of pistil-side SI function. © 2017 Botanical Society of America.

Botrytis pseudocinerea Is a Significant Pathogen of Several Crop Plants but Susceptible to Displacement by Fungicide-Resistant B. cinerea Strains

PubMed Central

Plesken, Cecilia; Weber, Roland W. S.; Rupp, Sabrina; Leroch, Michaela

2015-01-01

Botrytis cinerea is one of the most important pathogens worldwide, causing gray mold on a large variety of crops. Botrytis pseudocinerea has been found previously to occur together with B. cinerea in low abundance in vineyards and strawberry fields. Here, we report B. pseudocinerea to be common and sometimes dominant over B. cinerea on several fruit and vegetable crops in Germany. On apples with calyx end rot and on oilseed rape, it was the major gray mold species. Abundance of B. pseudocinerea was often negatively correlated with fungicide treatments. On cultivated strawberries, it was frequently found in spring but was largely displaced by B. cinerea following fungicide applications. Whereas B. cinerea strains with multiple-fungicide resistance were common in these fields, B. pseudocinerea almost never developed resistance to any fungicide even though resistance mutations occurred at similar frequencies in both species under laboratory conditions. The absence of resistance to quinone outside inhibitors in B. pseudocinerea was correlated with an intron in cytB preventing the major G143A resistance mutation. Our work indicates that B. pseudocinerea has a wide host range similar to that of B. cinerea and that it can become an important gray mold pathogen on cultivated plants. PMID:26231644

Central nervous system capillary haemangioblastoma: the pathologist's viewpoint

PubMed Central

Hussein, Mahmoud R

2007-01-01

Summary Haemangioblastomas are rare neoplasms of uncertain histogenesis. They represent 1.5–2.5% of intracranial tumours. While the cerebellum is by far the most frequent site, these lesions also tend to occur in the medulla and spinal cord. Most haemangioblastomas are sporadic but up to one quarter are associated with Von Hippel–Lindau disease (VHL). Although a fairly good number of haemangioblastomas were reported, a lack of side-by-side analysis of these reports has resulted in tentative conclusions that merely offer a first glimpse at their clinicopathologic diversity and histogenesis. To remedy this issue, this study presents a literature review concerning these lesions. Medline literature including both relevant monographs and clinicopathological case series. Haemangioblastomas occur either as a part of VHL disease (25–30%, inherited mutation of VHL gene on 3p25–26 chromosome) or as sporadic tumours (often with somatic mutation of VHL gene). They have diverse clinicopathologic presentations with cerebellar lesions having a better prognosis than their brainstem counterparts. Immunostaining is important for separation of haemangioblastomas from other tumours with similar histology. The rich vascularity of haemangioblastomas is due to overexpression of vascular endothelial growth factors. Moreover, ‘stromal’ cells represent the neoplastic cells of haemangioblastomas and are capable of forming blood islands with extramedullary haematopoiesis. PMID:17877533

Somatic Mutations and Clonal Hematopoiesis in Aplastic Anemia.

PubMed

Yoshizato, Tetsuichi; Dumitriu, Bogdan; Hosokawa, Kohei; Makishima, Hideki; Yoshida, Kenichi; Townsley, Danielle; Sato-Otsubo, Aiko; Sato, Yusuke; Liu, Delong; Suzuki, Hiromichi; Wu, Colin O; Shiraishi, Yuichi; Clemente, Michael J; Kataoka, Keisuke; Shiozawa, Yusuke; Okuno, Yusuke; Chiba, Kenichi; Tanaka, Hiroko; Nagata, Yasunobu; Katagiri, Takamasa; Kon, Ayana; Sanada, Masashi; Scheinberg, Phillip; Miyano, Satoru; Maciejewski, Jaroslaw P; Nakao, Shinji; Young, Neal S; Ogawa, Seishi

2015-07-02

In patients with acquired aplastic anemia, destruction of hematopoietic cells by the immune system leads to pancytopenia. Patients have a response to immunosuppressive therapy, but myelodysplastic syndromes and acute myeloid leukemia develop in about 15% of the patients, usually many months to years after the diagnosis of aplastic anemia. We performed next-generation sequencing and array-based karyotyping using 668 blood samples obtained from 439 patients with aplastic anemia. We analyzed serial samples obtained from 82 patients. Somatic mutations in myeloid cancer candidate genes were present in one third of the patients, in a limited number of genes and at low initial variant allele frequency. Clonal hematopoiesis was detected in 47% of the patients, most frequently as acquired mutations. The prevalence of the mutations increased with age, and mutations had an age-related signature. DNMT3A-mutated and ASXL1-mutated clones tended to increase in size over time; the size of BCOR- and BCORL1-mutated and PIGA-mutated clones decreased or remained stable. Mutations in PIGA and BCOR and BCORL1 correlated with a better response to immunosuppressive therapy and longer and a higher rate of overall and progression-free survival; mutations in a subgroup of genes that included DNMT3A and ASXL1 were associated with worse outcomes. However, clonal dynamics were highly variable and might not necessarily have predicted the response to therapy and long-term survival among individual patients. Clonal hematopoiesis was prevalent in aplastic anemia. Some mutations were related to clinical outcomes. A highly biased set of mutations is evidence of Darwinian selection in the failed bone marrow environment. The pattern of somatic clones in individual patients over time was variable and frequently unpredictable. (Funded by Grant-in-Aid for Scientific Research and others.).

Role and Mechanism of Structural Variation in Progression of Breast Cancer

DTIC Science & Technology

2013-09-01

mutations that occurred throughout tumor evolution, we identified 9 early nonsynonymous point mutations that occurred in cancer genes . Only five of...identified, are mutations in the TP53 gene suggesting its role as a driver mutation   5   • Our data also suggests that in the case of this one patient...generated by breakage-fusion- bridge cycles that promote repeated rounds of mutation within a chromosome arm, or from progressive amplification of genes that

Alcohol consumption and breast tumor mitochondrial DNA mutations.

PubMed

Platek, Mary E; Shields, Peter G; Tan, Duanjun; Marian, Catalin; Bonner, Matthew R; McCann, Susan E; Nie, Jing; Wilding, Gregory E; Ambrosone, Christine; Millen, Amy E; Trevisan, Maurizio; Russell, Marcia; Nochajski, Thomas H; Edge, Stephen B; Winston, Janet; Freudenheim, Jo L

2010-06-01

Mitochondrial DNA (mtDNA) mutations are frequent in breast tumors, but the etiology of these mutations is unknown. We hypothesized that these mutations are associated with exposures that affect oxidative stress such as alcohol metabolism. Using archived tumor blocks from incident breast cancer cases in a case control study, the Western New York Exposures and Breast Cancer (WEB) study, analysis of mtDNA mutations was conducted on 128 breast cancer cases selected based on extremes of alcohol intake. Temporal temperature gradient gel electrophoresis (TTGE) was used to screen the entire mtDNA genome and sequencing was completed for all TTGE positive samples. Case-case comparisons were completed using unconditional logistic regression to determine the relative prevalence of the mutations by exposures including alcohol consumption, manganese superoxide dismutase (MnSOD) genotype, nutrient intake related to oxidative stress and established breast cancer risk factors. Somatic mtDNA mutations were found in 60 of the 128 tumors examined. There were no differences in the prevalence of mtDNA mutations by alcohol consumption, MnSOD genotype or dietary intake. The likelihood of mtDNA mutations was reduced among those with a positive family history for breast cancer (OR = 0.33, CI = 0.12-0.92), among postmenopausal women who used hormone replacement therapy (OR = 0.46, CI = 0.19-1.08, P = 0.08) and was increased for ER negative tumors (OR = 2.05, CI = 0.95-4.43, P = 0.07). Consistent with previous studies, we found that mtDNA mutations are a frequent occurrence in breast tumors. An understanding of the etiology of mtDNA mutations may provide insight into breast carcinogenesis.

Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

PubMed

Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

2017-10-01

Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

Mucinous Cystic Neoplasms Lined by Abundant Mucinous Epithelium Frequently Involve KRAS Mutations and Malignant Progression.

PubMed

Shibata, Hideki; Ohike, Nobuyuki; Norose, Tomoko; Isobe, Tomohide; Suzuki, Reika; Imai, Hideyuki; Shiokawa, Akira; Aoki, Takeshi; Murakami, Masahiko; Mizukami, Hiroki; Tanaka, Jun-Ichi; Takimoto, Masafumi

2017-12-01

Pancreatic and hepatic mucinous cyst neoplasms (MCNs) have a malignant potential, but indolent MCNs are not uncommon. The pathological and genetic characteristics of resected MCNs (n=15) categorized by the amount of mucin of the lining epithelium were investigated. MCNs were divided into two groups: (i) a rich (r)-MCN group (n=6), in which more than half of the epithelium was lined by abundant mucinous epithelium; and (ii) a poor (p)-MCN group (n=9), which consisted of the remaining cases. Three patients in the r-MCN group showed invasive carcinoma or high-grade dysplasia, whereas all patients in the p-MCN group showed low-grade dysplasia. Mutations of Kirsten rat sarcoma viral oncogene homolog (KRAS) were more frequent in the r-MCN group (83%) (p-MCN; 11%, p<0.05). Mucinous MCNs more frequently have KRAS mutations and higher risk of malignant progression. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Growth Hormone Receptor Mutations Related to Individual Dwarfism

PubMed Central

Li, Charles; Zhang, Xiquan

2018-01-01

Growth hormone (GH) promotes body growth by binding with two GH receptors (GHRs) at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin-like growth factor (IGF) synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature), including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development. PMID:29748515

HMG CoA lyase deficiency: identification of five causal point mutations in codons 41 and 42, including a frequent Saudi Arabian mutation, R41Q.

PubMed Central

Mitchell, G A; Ozand, P T; Robert, M F; Ashmarina, L; Roberts, J; Gibson, K M; Wanders, R J; Wang, S; Chevalier, I; Plöchl, E; Miziorko, H

1998-01-01

The hereditary deficiency of 3-hydroxy-3-methylglutaryl (HMG) CoA lyase (HL; OMIM 246450 [http://www3.ncbi.nlm.nih. gov:80/htbin-post/Omim/dispmim?246450]) results in episodes of hypoketotic hypoglycemia and coma and is reported to be frequent and clinically severe in Saudi Arabia. We found genetic diversity among nine Saudi HL-deficient probands: six were homozygous for the missense mutation R41Q, and two were homozygous for the frameshift mutation F305fs(-2). In 32 non-Saudi HL-deficient probands, we found three R41Q alleles and also discovered four other deleterious point mutations in codons 41 and 42: R41X, D42E, D42G, and D42H. In purified mutant recombinant HL, all four missense mutations in codons 41 and 42 cause a marked decrease in HL activity. We developed a screening procedure for HL missense mutations that yields residual activity at levels comparable to those obtained using purified HL peptides. Codons 41 and 42 are important for normal HL catalysis and account for a disproportionate 21 (26%) of 82 of mutant alleles in our group of HL-deficient probands. PMID:9463337

Chromosome 17p Homodisomy Is Associated With Better Outcome in 1p19q Non-Codeleted and IDH-Mutated Gliomas

PubMed Central

Labussière, Marianne; Rahimian, Amithys; Giry, Marine; Boisselier, Blandine; Schmitt, Yohann; Polivka, Marc; Mokhtari, Karima; Delattre, Jean-Yves; Idbaih, Ahmed; Alentorn, Agusti

2016-01-01

Background. The 1p19q non-codeleted gliomas with IDH mutation, defined as “molecular astrocytomas,” display frequent TP53 mutations and have an intermediate prognosis. We investigated the prognostic impact of copy number-neutral loss of heterozygosity (CNLOH) in 17p in this population. Methods. We analyzed 793 gliomas (206 grade II, 377 grade III, and 210 grade IV) by single nucleotide polymorphism array and for TP53 mutations. Results. Homodisomy revealed by CNLOH was observed in 156 cases (19.7%). It was more frequent in astrocytomas and oligoastrocytomas (98/256, 38%) than oligodendrogliomas (28/327, 8.6%; p < .0001) or glioblastoma multiforme (30/210, 14.3%; p < .0001), tightly associated with TP53 mutation (69/71 vs. 20/79; p = 2 × 10−16), and mutually exclusive with 1p19q codeletion (1/156 vs. 249/556; p < .0001). In the group of IDH-mutated 1p19q non-codeleted gliomas, CNLOH 17p was associated with longer survival (86.3 vs. 46.2 months; p = .004), particularly in grade III gliomas (overall survival >100 vs. 37.9 months; p = .007). These data were confirmed in an independent dataset from the Cancer Genome Atlas. Conclusion. CNLOH 17p is a prognostic marker and further refines the molecular classification of gliomas. Implications for Practice: Homodisomy of chromosome 17p (CNLOH 17p) is a frequent feature in IDH-mutated 1p19q non-codeleted gliomas (group 2). It is constantly associated with TP53 mutation. It was found, within this specific molecular group of gliomas (corresponding to molecular astrocytomas), that CNLOH 17p is associated with a much better outcome and may therefore represent an additional prognostic marker to refine the prognostic classification of gliomas. PMID:27401888

The p.Thr11Met mutation in c19orf12 is frequent among adult Turkish patients with MPAN.

PubMed

Olgiati, Simone; Doğu, Okan; Tufekcioglu, Zeynep; Diler, Yunus; Saka, Esen; Gultekin, Murat; Kaleagasi, Hakan; Kuipers, Demy; Graafland, Josja; Breedveld, Guido J; Quadri, Marialuisa; Sürmeli, Reyhan; Sünter, Gülin; Doğan, Tuğrul; Yalçın, Ayşe Destina; Bilgiç, Başar; Elibol, Bülent; Emre, Murat; Hanagasi, Hasmet A; Bonifati, Vincenzo

2017-06-01

Mutations in the C19orf12 gene cause mitochondrial membrane protein associated neurodegeneration (MPAN), an autosomal recessive form of neurodegeneration with brain iron accumulation (NBIA). A limited number of patients with C19orf12 mutations, particularly those with adult onset of symptoms, have been reported. We sequenced the entire coding region of C19orf12 in 15 Turkish adult probands with idiopathic NBIA. We also performed haplotype analysis in families with a recurrent C19orf12 mutation. Clinical features were collected using a standardized form. Nine of our 15 probands (60%) carried the homozygous c.32C > T mutation in C19orf12 (predicted protein effect: p.Thr11Met). This homozygous mutation co-segregated with the disease in all affected relatives available for testing (16 homozygous subjects). Haplotypes across the C19orf12 locus were identical for a very small region, closest to the mutation, suggesting an old founder, or, two independent founders. The clinical phenotype was characterized by adult onset in most cases (mean 24.5 years, range 10-36), and broad spectrum, including prominent parkinsonism, pyramidal signs, psychiatric disturbances, cognitive decline, and motor axonal neuropathy, in various combinations. On T2- or susceptibility weighted-MRI images, all patients displayed bilateral hypointensities in globus pallidus and substantia nigra, without an eye-of-the-tiger sign; however, hyperintense streaking of the medial medullary lamina between the external and internal parts of globus pallidus was observed frequently. The C19orf12 p.Thr11Met mutation is frequent among adult Turkish patients with MPAN. These findings contribute to the characterization of this important NBIA form, and have direct implications for genetic testing of patients of Turkish origin. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mutant JAK3 phosphoproteomic profiling predicts synergism between JAK3 inhibitors and MEK/BCL2 inhibitors for the treatment of T-cell acute lymphoblastic leukemia

PubMed Central

Degryse, S; de Bock, C E; Demeyer, S; Govaerts, I; Bornschein, S; Verbeke, D; Jacobs, K; Binos, S; Skerrett-Byrne, D A; Murray, H C; Verrills, N M; Van Vlierberghe, P; Cools, J; Dun, M D

2018-01-01

Mutations in the interleukin-7 receptor (IL7R) or the Janus kinase 3 (JAK3) kinase occur frequently in T-cell acute lymphoblastic leukemia (T-ALL) and both are able to drive cellular transformation and the development of T-ALL in mouse models. However, the signal transduction pathways downstream of JAK3 mutations remain poorly characterized. Here we describe the phosphoproteome downstream of the JAK3(L857Q)/(M511I) activating mutations in transformed Ba/F3 lymphocyte cells. Signaling pathways regulated by JAK3 mutants were assessed following acute inhibition of JAK1/JAK3 using the JAK kinase inhibitors ruxolitinib or tofacitinib. Comprehensive network interrogation using the phosphoproteomic signatures identified significant changes in pathways regulating cell cycle, translation initiation, mitogen-activated protein kinase and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)/AKT signaling, RNA metabolism, as well as epigenetic and apoptotic processes. Key regulatory proteins within pathways that showed altered phosphorylation following JAK inhibition were targeted using selumetinib and trametinib (MEK), buparlisib (PI3K) and ABT-199 (BCL2), and found to be synergistic in combination with JAK kinase inhibitors in primary T-ALL samples harboring JAK3 mutations. These data provide the first detailed molecular characterization of the downstream signaling pathways regulated by JAK3 mutations and provide further understanding into the oncogenic processes regulated by constitutive kinase activation aiding in the development of improved combinatorial treatment regimens. PMID:28852199

Evolutionary Stasis in Cycad Plastomes and the First Case of Plastome GC-Biased Gene Conversion

PubMed Central

Wu, Chung-Shien; Chaw, Shu-Miaw

2015-01-01

In angiosperms, gene conversion has been known to reduce the mutational load of plastid genomes (the plastomes). Particularly, more frequent gene conversions in inverted repeat (IR) than in single copy (SC) regions result in contrasting substitution rates between these two regions. However, little has been known about the effect of gene conversion in the evolution of gymnosperm plastomes. Cycads (Cycadophyta) are the second largest gymnosperm group. Evolutionary study of their plastomes is limited to the basal cycad genus, Cycas. In this study, we addressed three questions. 1) Do the plastomes of other cycad genera evolve slowly as previously observed in the plastome of Cycas taitungensis? 2) Do substitution rates differ between their SC and IR regions? And 3) Does gene conversion occur in the cycad plastomes? If yes, is it AT-biased or GC-biased? Plastomes of eight species from other eight genera of cycads were sequenced. These plastomes are highly conserved in genome organization. Excluding ginkgo, cycad plastomes have significantly lower synonymous and nonsynonymous substitution rates than other gymnosperms, reflecting their evolutionary stasis in nucleotide mutations. In the IRs of cycad plastomes, the reduced substitution rates and GC-biased mutations are associated with a GC-biased gene conversion (gBGC) mechanism. Further investigations suggest that in cycads, gBGC is able to rectify plastome-wide mutations. Therefore, this study is the first to uncover the plastomic gBGC in seed plants. We also propose a gBGC model to interpret the dissimilar evolutionary patterns as well as the compositionally biased mutations in the SC and IR regions of cycad plastomes. PMID:26116919

Cystic Fibrosis Transmembrane Conductance Regulator Regulates Epithelial Cell Response to Aspergillus and Resultant Pulmonary Inflammation

PubMed Central

Chaudhary, Neelkamal; Datta, Kausik; Askin, Frederic B.; Staab, Janet F.

2012-01-01

Rationale: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) alter epithelial cell (EC) interactions with multiple microbes, such that dysregulated inflammation and injury occur with airway colonization in people with cystic fibrosis (CF). Aspergillus fumigatus frequently colonizes CF airways, but it has been assumed to be an innocent saprophyte; its potential role as a cause of lung disease is controversial. Objectives: To study the interactions between Aspergillus and EC, and the role of the fungus in evoking inflammatory responses. Methods: A. fumigatus expressing green fluorescent protein was developed for in vitro and in vivo models, which used cell lines and mouse tracheal EC. Measurements and Main Results: Fungal spores (conidia) are rapidly ingested by ECs derived from bronchial cell lines and murine tracheas, supporting a role for EC in early airway clearance. Bronchial ECs harboring CFTR mutations (ΔF508) or deletion demonstrate impaired uptake and killing of conidia, and ECs with CFTR mutation undergo more conidial-induced apoptosis. Germinated (hyphal) forms of the fungus evoke secretion of inflammatory mediators, with CFTR mutation resulting in increased airway levels of macrophage inflammatory protein 2 and KC, and higher lung monocyte chemotactic protein-1. After A. fumigatus inhalation, CFTR−/− mice develop exaggerated lymphocytic inflammation, mucin accumulation, and lung injury. Conclusions: Data demonstrate a critical role for CFTR in mediating EC responses to A. fumigatus. Results suggest that the fungus elicits aberrant pulmonary inflammation in the setting of CFTR mutation, supporting the potential role of antifungals to halt progressive CF lung disease. PMID:22135344

Primary ciliary dyskinesia caused by homozygous mutation in DNAL1, encoding dynein light chain 1.

PubMed

Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C; Aviram, Micha; Parvari, Ruti

2011-05-13

In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Multiplex single-tube screening for mutations in the Nijmegen Breakage Syndrome (NBS1) gene in Hodgkin's and non-Hodgkin's lymphoma patients of Slavic origin.

PubMed

Soucek, Pavel; Gut, Ivan; Trneny, Marek; Skovlund, Eva; Grenaker Alnaes, Grethe; Kristensen, Tom; Børresen-Dale, Anne-Lise; Kristensen, Vessela N

2003-05-01

Patients with Nijmegen Breakage Syndrome (NBS) have a high risk to develop malignant diseases, most frequently B-cell lymphomas. It has been demonstrated that this chromosomal breakage syndrome results from mutations in the NBS1 gene that cause either a loss of full-length protein expression or expression of a variant protein. A large proportion of the known NBS patients are of Slavic origin who carry a major founder mutation 657del5 in exon 6 of the NBS1 gene. The prevalence of this mutation in Slav populations is reported to be high, possibly contributing to higher cancer risk in these populations. Therefore, if mutations in NBS1 are associated with higher risk of developing lymphoid cancers it would be most likely to be observed in these populations. A multiplex assay for four of the most frequent NBS1 mutations was designed and a series of 119 lymphoma patients from Slavic origin as well as 177 healthy controls were tested. One of the patients was a heterozygote carrier of the ACAAA deletion mutation in exon 6 (1/119). No mutation was observed in the control group, despite the reported high frequency (1/177). The power of this study was 30% to detect a relative risk of 2.0.

[Alternating hemiplegia of childhood: ATP1A3 gene analysis in 16 patients].

PubMed

Ulate-Campos, Adriana; Fons, Carmen; Campistol, Jaume; Martorell, Loreto; Cancho-Candela, Ramón; Eiris, Jesús; López-Laso, Eduardo; Pineda, Mercedes; Sans, Anna; Velázquez, Ramón

2014-07-07

Alternating hemiplegia in childhood (AHC) is a disease characterized by recurrent episodes of hemiplegia, tonic or dystonic crisis and abnormal ocular movements. Recently, mutations in the ATP1A3 gene have been identified as the causal mechanism of AHC. The objective is to describe a series of 16 patients with clinical and genetic diagnosis of AHC. It is a descriptive, retrospective, multicenter study of 16 patients with clinical diagnosis of AHC in whom mutations in ATP1A3 were identified. Six heterozygous, de novo mutations were found in the ATP1A3 gene. The most frequent mutation was G2401A in 8 patients (50%) followed by G2443A in 3 patients (18.75%), G2893A in 2 patients (12.50%) and C2781G, G2893C and C2411T in one patient, respectively (6.25% each). In the studied population with AHC, de novo mutations were detected in 100% of patients. The most frequent mutations were D801N y la E815K, as reported in other series. Copyright © 2013 Elsevier España, S.L. All rights reserved.

Facile Affinity Maturation of Antibody Variable Domains Using Natural Diversity Mutagenesis

PubMed Central

Tiller, Kathryn E.; Chowdhury, Ratul; Li, Tong; Ludwig, Seth D.; Sen, Sabyasachi; Maranas, Costas D.; Tessier, Peter M.

2017-01-01

The identification of mutations that enhance antibody affinity while maintaining high antibody specificity and stability is a time-consuming and laborious process. Here, we report an efficient methodology for systematically and rapidly enhancing the affinity of antibody variable domains while maximizing specificity and stability using novel synthetic antibody libraries. Our approach first uses computational and experimental alanine scanning mutagenesis to identify sites in the complementarity-determining regions (CDRs) that are permissive to mutagenesis while maintaining antigen binding. Next, we mutagenize the most permissive CDR positions using degenerate codons to encode wild-type residues and a small number of the most frequently occurring residues at each CDR position based on natural antibody diversity. This mutagenesis approach results in antibody libraries with variants that have a wide range of numbers of CDR mutations, including antibody domains with single mutations and others with tens of mutations. Finally, we sort the modest size libraries (~10 million variants) displayed on the surface of yeast to identify CDR mutations with the greatest increases in affinity. Importantly, we find that single-domain (VHH) antibodies specific for the α-synuclein protein (whose aggregation is associated with Parkinson’s disease) with the greatest gains in affinity (>5-fold) have several (four to six) CDR mutations. This finding highlights the importance of sampling combinations of CDR mutations during the first step of affinity maturation to maximize the efficiency of the process. Interestingly, we find that some natural diversity mutations simultaneously enhance all three key antibody properties (affinity, specificity, and stability) while other mutations enhance some of these properties (e.g., increased specificity) and display trade-offs in others (e.g., reduced affinity and/or stability). Computational modeling reveals that improvements in affinity are generally not due to direct interactions involving CDR mutations but rather due to indirect effects that enhance existing interactions and/or promote new interactions between the antigen and wild-type CDR residues. We expect that natural diversity mutagenesis will be useful for efficient affinity maturation of a wide range of antibody fragments and full-length antibodies. PMID:28928732

Divergent epidermal growth factor receptor mutation patterns between smokers and non-smokers with lung adenocarcinoma.

PubMed

Tseng, Jeng-Sen; Wang, Chih-Liang; Yang, Tsung-Ying; Chen, Chih-Yi; Yang, Cheng-Ta; Chen, Kun-Chieh; Hsu, Kuo-Hsuan; Tsai, Chi-Ren; Chang, Gee-Chen

2015-12-01

Smoking status is an important determinant of the prevalence of epidermal growth factor receptor (EGFR) mutations in lung cancer patients. However, it is unclear whether smoking status could also influence the spectrum of EGFR mutations. We enrolled patients with lung adenocarcinoma from three medical centers in Taiwan. EGFR mutations were assessed by Sanger direct sequencing. The objective of this study was to evaluate the influence of smoking status on both the frequency and patterns of EGFR mutations. From 2001 to 2013, a total of 1175 patients with lung adenocarcinoma were enrolled for EGFR mutation analysis. The overall EGFR mutation rate was 59.6%, which was significantly higher in females than males (69.1% vs. 49.8%) and in non-smokers than current/former smokers (73.8% vs. 29.8%) (both P<0.001). Among patients harboring EGFR mutations, smokers expressed L858R mutation less frequently (35.2% vs. 50.2%, P=0.005) and exon 19 deletions more frequently (52.8% vs 38.8%, P=0.008) than non-smokers. Smokers and non-smokers also had divergent exon 19 deletions subtypes (Del E746-A750 82.5% vs. 57.6%, respectively, P<0.001). Among subgroup patients harboring the L858R mutation, smokers were associated with a higher rate of complex mutations than non-smokers (34.2% vs. 8.4%, P<0.001). Our results suggested that smoking status could influence not only the frequency but also the spectrum of EGFR mutations. These findings provide a clue for further investigation of EGFR mutagenesis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The Gene of the Ubiquitin-Specific Protease 8 Is Frequently Mutated in Adenomas Causing Cushing's Disease.

PubMed

Perez-Rivas, Luis G; Theodoropoulou, Marily; Ferraù, Francesco; Nusser, Clara; Kawaguchi, Kohei; Stratakis, Constantine A; Faucz, Fabio Rueda; Wildemberg, Luiz E; Assié, Guillaume; Beschorner, Rudi; Dimopoulou, Christina; Buchfelder, Michael; Popovic, Vera; Berr, Christina M; Tóth, Miklós; Ardisasmita, Arif Ibrahim; Honegger, Jürgen; Bertherat, Jerôme; Gadelha, Monica R; Beuschlein, Felix; Stalla, Günter; Komada, Masayuki; Korbonits, Márta; Reincke, Martin

2015-07-01

We have recently reported somatic mutations in the ubiquitin-specific protease USP8 gene in a small series of adenomas of patients with Cushing's disease. To determine the prevalence of USP8 mutations and the genotype-phenotype correlation in a large series of patients diagnosed with Cushing's disease. We performed a retrospective, multicentric, genetic analysis of 134 functioning and 11 silent corticotroph adenomas using Sanger sequencing. Biochemical and clinical features were collected and examined within the context of the mutational status of USP8, and new mutations were characterized by functional studies. A total of 145 patients who underwent surgery for an ACTH-producing pituitary adenoma. Mutational status of USP8. Biochemical and clinical features included sex, age at diagnosis, tumor size, preoperative and postoperative hormonal levels, and comorbidities. We found somatic mutations in USP8 in 48 (36%) pituitary adenomas from patients with Cushing's disease but in none of 11 silent corticotropinomas. The prevalence was higher in adults than in pediatric cases (41 vs 17%) and in females than in males (43 vs 17%). Adults having USP8-mutated adenomas were diagnosed at an earlier age than those with wild-type lesions (36 vs 44 y). Mutations were primarily found in adenomas of 10 ± 7 mm and were inversely associated with the development of postoperative adrenal insufficiency. All the mutations affected the residues Ser718 or Pro720, including five new identified alterations. Mutations reduced the interaction between USP8 and 14-3-3 and enhanced USP8 activity. USP8 mutants diminished epidermal growth factor receptor ubiquitination and induced Pomc promoter activity in immortalized AtT-20 corticotropinoma cells. USP8 is frequently mutated in adenomas causing Cushing's disease, especially in those from female adult patients diagnosed at a younger age.

Undifferentiated Endometrial Carcinomas Show Frequent Loss of Core Switch/Sucrose Nonfermentable Complex Proteins.

PubMed

Köbel, Martin; Hoang, Lien N; Tessier-Cloutier, Basile; Meng, Bo; Soslow, Robert A; Stewart, Colin J R; Lee, Cheng-Han

2018-01-01

Undifferentiated endometrial carcinoma is an aggressive type of endometrial carcinoma that typically presents with advanced stage disease and rapid clinical progression. In contrast to dedifferentiated endometrial carcinoma, undifferentiated carcinoma lacks a concurrent differentiated (typically low-grade endometrioid) carcinoma component, though the undifferentiated component of dedifferentiated carcinoma is similar histologically and immunophenotypically to pure undifferentiated carcinoma. We recently identified 3 mutually exclusive mechanisms of switch/sucrose nonfermentable (SWI/SNF) complex inactivation (BRG1 inactivation, INI1 inactivation or ARID1A/ARID1B co-inactivation) that are associated with histologic dedifferentiation in the majority of dedifferentiated endometrial carcinoma. In the current study, we aimed to determine by immunohistochemistry whether these patterns of SWI/SNF inactivation also occur in undifferentiated endometrial carcinomas. Of the 34 undifferentiated carcinomas examined, 17 (50%) exhibited SWI/SNF complex inactivation, with 11 tumors showing complete loss of both ARID1A and ARID1B, 5 showing complete loss of BRG1 and 1 showing complete loss of INI1. Ten of the remaining 17 undifferentiated carcinomas showed the following alterations: 5 tumors (15%) showed loss of ARID1A only with intact ARID1B, BRG1, and INI1 expression, 4 tumors (12%) showed mutated patterns of p53 staining with intact SWI/SNF protein expression, and 1 tumor (3%) harbored a POLE exonuclease domain mutation (P286R). SWI/SNF complex-inactivated tumors presented more frequently with extrauterine disease spread than those with intact expression (88% vs. 41%, respectively). In addition, patients with SWI/SNF complex-inactivated tumors had a significantly worse disease-specific survival (P=0.02). The findings here demonstrate frequent SWI/SNF complex inactivation in undifferentiated endometrial carcinomas, which has future implications regarding therapies that target chromatin remodelling and epigenetic control.

The proto-oncogene KRAS and BRAF profiles and some clinical characteristics in colorectal cancer in the Turkish population.

PubMed

Ozen, Filiz; Ozdemir, Semra; Zemheri, Ebru; Hacimuto, Gizem; Silan, Fatma; Ozdemir, Ozturk

2013-02-01

The aim of the current study was to investigate the prevalence and predictive significance of the KRAS and BRAF mutations in Turkish patients with colorectal cancer (CRC). Totally, 53 fresh tumoral tissue specimens were investigated in patients with CRC. All specimens were obtained during routine surgery of patients who were histopathologically diagnosed and genotyped for common KRAS and BRAF point mutations. After DNA extraction, the target mutations were analyzed using the AutoGenomics INFINITI(®) assay, and some samples were confirmed by quantitative real-time polymerase chain reaction fluorescence melting curve analyses. KRAS mutations were found in 26 (49.05%) CRC samples. Twenty-seven samples (50.95%) had wild-type profiles for KRAS codon 12, 13, and 61 in the current cohort. In 17 (65.38%) samples, codon 12; in 7 (26.93%) samples, codon 13; and in 2 (7.69%) samples, codon 61 were found to be mutated, particularly in grade 2 of tumoral tissues. No point mutation was detected in BRAF codon Val600Glu for the studied CRC patients. Our study, based on a representative collection of human CRC tumors, indicates that KRAS gene mutations were detected in 49.05% of the samples, and the most frequent mutation was in the G12D codon. Results also showed that codons 12 and 13 of KRAS are relatively frequently without BRAF mutation in a CRC cohort from the Turkish population.

[Analysis of genetic polymorphisms and mutations of 20 frequently used STR loci among ethnic Hans from Henan].

PubMed

Wang, Hongdan; Kang, Bing; Gao, Yue; Huo, Xiaodong; Li, Tao; Guo, Qiannan; Zhu, Bofeng; Liao, Shixiu

2017-04-10

To study the genetic polymorphisms and mutations of 20 frequently used autosomal microsatellites among ethnic Hans from Henan. Peripheral blood samples of 2604 individuals were collected. DNA was amplified and genotyped using a PowerPlex(TM) 21 system. The frequencies, forensic parameters and mutation rates of the 20 short tandem repeat (STR) loci were analyzed. A total of 323 alleles were found in this population and the allelic frequencies have ranged from 0.0003 to 0.5144. Except for D3S1358, TH01 and TPOX, mutations have been found in all of the remaining 17 STR loci, which totaled 47, with mutation rates ranging from 0 to 3.46 × 10 -3 . The 20 STR loci selected by the PowerPlex(TM) 21 system are highly polymorphic among ethnic Hans from Henan, and may be of great value in forensic and human population studies. As no similar study has been carried out previously, above results may be of great value for individual discrimination and paternal testing.

Role of TP53 mutations in triple negative and HER2-positive breast cancer treated with neoadjuvant anthracycline/taxane-based chemotherapy.

PubMed

Darb-Esfahani, Silvia; Denkert, Carsten; Stenzinger, Albrecht; Salat, Christoph; Sinn, Bruno; Schem, Christian; Endris, Volker; Klare, Peter; Schmitt, Wolfgang; Blohmer, Jens-Uwe; Weichert, Wilko; Möbs, Markus; Tesch, Hans; Kümmel, Sherko; Sinn, Peter; Jackisch, Christian; Dietel, Manfred; Reimer, Toralf; Loi, Sherene; Untch, Michael; von Minckwitz, Gunter; Nekljudova, Valentina; Loibl, Sibylle

2016-10-18

TP53 mutations are frequent in breast cancer, however their clinical relevance in terms of response to chemotherapy is controversial. 450 pre-therapeutic, formalin-fixed, paraffin-embedded core biopsies from the phase II neoadjuvant GeparSixto trial that included HER2-positive and triple negative breast cancer (TNBC) were subjected to Sanger sequencing of exons 5-8 of the TP53 gene. TP53 status was correlated to response to neoadjuvant anthracycline/taxane-based chemotherapy with or without carboplatin and trastuzumab/lapatinib in HER2-positive and bevacizumab in TNBC. p53 protein expression was evaluated by immunohistochemistry in the TNBC subgroup. Of 450 breast cancer samples 297 (66.0%) were TP53 mutant. Mutations were significantly more frequent in TNBC (74.8%) compared to HER2-positive cancers (55.4%, P < 0.0001). Neither mutations nor different mutation types and effects were associated with pCR neither in the whole study group nor in molecular subtypes (P > 0.05 each). Missense mutations tended to be associated with a better survival compared to all other types of mutations in TNBC (P = 0.093) and in HER2-positive cancers (P = 0.071). In TNBC, missense mutations were also linked to higher numbers of tumor-infiltrating lymphocytes (TILs, P = 0.028). p53 protein overexpression was also linked with imporved survival (P = 0.019). Our study confirms high TP53 mutation rates in TNBC and HER2-positive breast cancer. Mutations did not predict the response to an intense neoadjuvant chemotherapy in these two molecular breast cancer subtypes.

Network Analysis of Protein Adaptation: Modeling the Functional Impact of Multiple Mutations

PubMed Central

Beleva Guthrie, Violeta; Masica, David L; Fraser, Andrew; Federico, Joseph; Fan, Yunfan; Camps, Manel; Karchin, Rachel

2018-01-01

Abstract The evolution of new biochemical activities frequently involves complex dependencies between mutations and rapid evolutionary radiation. Mutation co-occurrence and covariation have previously been used to identify compensating mutations that are the result of physical contacts and preserve protein function and fold. Here, we model pairwise functional dependencies and higher order interactions that enable evolution of new protein functions. We use a network model to find complex dependencies between mutations resulting from evolutionary trade-offs and pleiotropic effects. We present a method to construct these networks and to identify functionally interacting mutations in both extant and reconstructed ancestral sequences (Network Analysis of Protein Adaptation). The time ordering of mutations can be incorporated into the networks through phylogenetic reconstruction. We apply NAPA to three distantly homologous β-lactamase protein clusters (TEM, CTX-M-3, and OXA-51), each of which has experienced recent evolutionary radiation under substantially different selective pressures. By analyzing the network properties of each protein cluster, we identify key adaptive mutations, positive pairwise interactions, different adaptive solutions to the same selective pressure, and complex evolutionary trajectories likely to increase protein fitness. We also present evidence that incorporating information from phylogenetic reconstruction and ancestral sequence inference can reduce the number of spurious links in the network, whereas preserving overall network community structure. The analysis does not require structural or biochemical data. In contrast to function-preserving mutation dependencies, which are frequently from structural contacts, gain-of-function mutation dependencies are most commonly between residues distal in protein structure. PMID:29522102

Biomarker Detection Using NAPPA Tumor Antigen Arrays: EDRN Supplement — EDRN Public Portal

Cancer.gov

The overall goal of this project application for the EDRN set-aside funds is to focus our collaborative efforts to identify p53 mutation-specific antibody biomarkers in breast, prostate, and ovarian cancer. P53-specific gene mutations are frequent in multiple cancer types. Of the common solid tumors, p53 mutations have been identified in 50% of lung and ovarian cancers, 45% of colon cancers, 20% of breast cancers, and 10-30% of prostate cancers (The p53 Mutation Handbook, T. Soussi, http://p53/free/fr). The most common mutations vary from cancer to cancer, with 50 point mutations covering the 10 most common mutations for all major solid tumors

Loss of GATA-1 Full Length as a Cause of Diamond–Blackfan Anemia Phenotype

PubMed Central

Parrella, Sara; Aspesi, Anna; Quarello, Paola; Garelli, Emanuela; Pavesi, Elisa; Carando, Adriana; Nardi, Margherita; Ellis, Steven R.; Ramenghi, Ugo; Dianzani, Irma

2015-01-01

Mutations in the hematopoietic transcription factor GATA-1 alter the proliferation/differentiation of hemopoietic progenitors. Mutations in exon 2 interfere with the synthesis of the full-length isoform of GATA-1 and lead to the production of a shortened isoform, GATA-1s. These mutations have been found in patients with Diamond–Blackfan anemia (DBA), a congenital erythroid aplasia typically caused by mutations in genes encoding ribosomal proteins. We sequenced GATA-1 in 23 patients that were negative for mutations in the most frequently mutated DBA genes. One patient showed a c.2T > C mutation in the initiation codon leading to the loss of the full-length GATA-1 isoform. PMID:24453067

Transcription factor mutations in myelodysplastic/myeloproliferative neoplasms

PubMed Central

Ernst, Thomas; Chase, Andrew; Zoi, Katerina; Waghorn, Katherine; Hidalgo-Curtis, Claire; Score, Joannah; Jones, Amy; Grand, Francis; Reiter, Andreas; Hochhaus, Andreas; Cross, Nicholas C.P.

2010-01-01

Background Aberrant activation of tyrosine kinases, caused by either mutation or gene fusion, is of major importance for the development of many hematologic malignancies, particularly myeloproliferative neoplasms. We hypothesized that hitherto unrecognized, cytogenetically cryptic tyrosine kinase fusions may be common in non-classical or atypical myeloproliferative neoplasms and related myelodysplastic/myeloproliferative neoplasms. Design and Methods To detect genomic copy number changes associated with such fusions, we performed a systematic search in 68 patients using custom designed, targeted, high-resolution array comparative genomic hybridization. Arrays contained 44,000 oligonucleotide probes that targeted 500 genes including all 90 tyrosine kinases plus downstream tyrosine kinase signaling components, other translocation targets, transcription factors, and other factors known to be important for myelopoiesis. Results No abnormalities involving tyrosine kinases were detected; however, nine cytogenetically cryptic copy number imbalances were detected in seven patients, including hemizygous deletions of RUNX1 or CEBPA in two cases with atypical chronic myeloid leukemia. Mutation analysis of the remaining alleles revealed non-mutated RUNX1 and a frameshift insertion within CEBPA. A further mutation screen of 187 patients with myelodysplastic/myeloproliferative neoplasms identified RUNX1 mutations in 27 (14%) and CEBPA mutations in seven (4%) patients. Analysis of other transcription factors known to be frequently mutated in acute myeloid leukemia revealed NPM1 mutations in six (3%) and WT1 mutations in two (1%) patients with myelodysplastic/myeloproliferative neoplasms. Univariate analysis indicated that patients with mutations had a shorter overall survival (28 versus 44 months, P=0.019) compared with patients without mutations, with the prognosis for cases with CEBPA, NPM1 or WT1 mutations being particularly poor. Conclusions We conclude that mutations of transcription and other nuclear factors are frequent in myelodysplastic/myeloproliferative neoplasms and are generally mutually exclusive. CEBPA, NPM1 or WT1 mutations may be associated with a poor prognosis, an observation that will need to be confirmed by detailed prospective studies. PMID:20421268

Convergent Evolution Driven by Rifampin Exacerbates the Global Burden of Drug-Resistant Staphylococcus aureus

PubMed Central

2018-01-01

ABSTRACT Mutations in the beta-subunit of bacterial RNA polymerase (RpoB) cause resistance to rifampin (Rifr), a critical antibiotic for treatment of multidrug-resistant Staphylococcus aureus. In vitro studies have shown that RpoB mutations confer decreased susceptibility to other antibiotics, but the clinical relevance is unknown. Here, by analyzing 7,099 S. aureus genomes, we demonstrate that the most prevalent RpoB mutations promote clinically relevant phenotypic plasticity resulting in the emergence of stable S. aureus lineages, associated with increased risk of therapeutic failure through generation of small-colony variants (SCVs) and coresistance to last-line antimicrobial agents. We found eight RpoB mutations that accounted for 93% (469/505) of the total number of Rifr mutations. The most frequently selected amino acid substitutions affecting residue 481 (H481N/Y) were associated with worldwide expansions of Rifr clones spanning decades. Recreating the H481N/Y mutations confirmed no impact on S. aureus growth, but the H481N mutation promoted the emergence of a subpopulation of stable Rifr SCVs with reduced susceptibility to vancomycin and daptomycin. Recreating the other frequent RpoB mutations showed similar impacts on resistance to these last-line agents. We found that 86% of all Rifr isolates in our global sample carried the mutations promoting cross-resistance to vancomycin and 52% to both vancomycin and daptomycin. As four of the most frequent RpoB mutations confer only low-level Rifr, equal to or below some international breakpoints, we recommend decreasing these breakpoints and reconsidering the appropriate use of rifampin to reduce the fixation and spread of these clinically deleterious mutations. IMPORTANCE Increasing antibiotic resistance in the major human pathogen Staphylococcus aureus is threatening the ability to treat patients with these infections. Recent laboratory studies suggest that mutations in the gene commonly associated with rifampin resistance may also impact susceptibility to other last-line antibiotics in S. aureus; however, the overall frequency and clinical impact of these mutations are unknown. By mining a global collection of clinical S. aureus genomes and by mutagenesis experiments, this work reveals that common rifampin-induced rpoB mutations promote phenotypic plasticity that has led to the global emergence of stable, multidrug-resistant S. aureus lineages that are associated with increased risk of therapeutic failure through coresistance to other last-line antimicrobials. We recommend decreasing susceptibility breakpoints for rifampin to allow phenotypic detection of critical rpoB mutations conferring low resistance to rifampin and reconsidering the appropriate use of rifampin to reduce the fixation and spread of these deleterious mutations globally. PMID:29404415

Impact of Antiretroviral Regimens on CSF Viral Escape in a Prospective Multicohort Study of ART-Experienced HIV-1 Infected Adults in the United States.

PubMed

Mukerji, Shibani S; Misra, Vikas; Lorenz, David R; Uno, Hajime; Morgello, Susan; Franklin, Donald; Ellis, Ronald J; Letendre, Scott; Gabuzda, Dana

2018-04-03

Cerebrospinal fluid (CSF) viral escape occurs in 4-20% of HIV-infected adults, yet the impact of antiretroviral therapy (ART) on CSF escape is unclear. Prospective study of 1063 participants with baseline plasma viral load (VL) ≤400 copies/ml between 2005-2016. Odds ratio for ART regimens (PI with nucleoside reverse transcriptase inhibitor [PI+NRTI] versus other ART) and CSF escape was estimated using mixed-effects models. Drug resistance mutation frequencies were calculated. Baseline mean age was 46, median plasma VL, CD4 nadir, and CD4 count were 50 copies/mL, 88 cells/μL, and 424 cells/μL, respectively; 48% on PI+NRTI, 33% on non-NRTI, and 6% on integrase inhibitors. During median follow-up of 4.4 years, CSF escape occurred in 77 participants (7.2%). PI+NRTI use was an independent predictor of CSF escape (OR 3.1 [95% CI 1.8-5.0]) in adjusted analyses and models restricted to plasma VL ≤50 copies/ml (p<0.001). Regimens containing atazanavir (ATV) were a stronger predictor of CSF viral escape than non-ATV PI+NRTI regimens. Plasma and CSF M184V/I combined with thymidine-analog mutations were more frequent in CSF escape versus no escape (23% vs. 2.3%). Genotypic susceptibility score-adjusted CNS penetration-effectiveness (CPE) values were calculated for CSF escape with M184V/I mutations (n=34). Adjusted CPE values were low (<5) for CSF and plasma in 27 (79%) and 13 (38%), respectively, indicating suboptimal CNS drug availability. PI+NRTI regimens are independent predictors of CSF escape in HIV-infected adults. Reduced CNS ART bioavailability may predispose to CSF escape in patients with M184V/I mutations. Optimizing ART regimens may reduce risk of CSF escape.

First WNK4-Hypokalemia Animal Model Identified by Genome-Wide Association in Burmese Cats

PubMed Central

Gandolfi, Barbara; Gruffydd-Jones, Timothy J.; Malik, Richard; Cortes, Alejandro; Jones, Boyd R.; Helps, Chris R.; Prinzenberg, Eva M.; Erhardt, George; Lyons, Leslie A.

2012-01-01

Burmese is an old and popular cat breed, however, several health concerns, such as hypokalemia and a craniofacial defect, are prevalent, endangering the general health of the breed. Hypokalemia, a subnormal serum potassium ion concentration ([K+]), most often occurs as a secondary problem but can occur as a primary problem, such as hypokalaemic periodic paralysis in humans, and as feline hypokalaemic periodic polymyopathy primarily in Burmese. The most characteristic clinical sign of hypokalemia in Burmese is a skeletal muscle weakness that is frequently episodic in nature, either generalized, or sometimes localized to the cervical and thoracic limb girdle muscles. Burmese hypokalemia is suspected to be a single locus autosomal recessive trait. A genome wide case-control study using the illumina Infinium Feline 63K iSelect DNA array was performed using 35 cases and 25 controls from the Burmese breed that identified a locus on chromosome E1 associated with hypokalemia. Within approximately 1.2 Mb of the highest associated SNP, two candidate genes were identified, KCNH4 and WNK4. Direct sequencing of the genes revealed a nonsense mutation, producing a premature stop codon within WNK4 (c.2899C>T), leading to a truncated protein that lacks the C-terminal coiled-coil domain and the highly conserved Akt1/SGK phosphorylation site. All cases were homozygous for the mutation. Although the exact mechanism causing hypokalemia has not been determined, extrapolation from the homologous human and mouse genes suggests the mechanism may involve a potassium-losing nephropathy. A genetic test to screen for the genetic defect within the active breeding population has been developed, which should lead to eradication of the mutation and improved general health within the breed. Moreover, the identified mutation may help clarify the role of the protein in K+ regulation and the cat represents the first animal model for WNK4-associated hypokalemia. PMID:23285264

Association of SMAD4 mutation with patient demographics, tumor characteristics, and clinical outcomes in colorectal cancer.

PubMed

Mehrvarz Sarshekeh, Amir; Advani, Shailesh; Overman, Michael J; Manyam, Ganiraju; Kee, Bryan K; Fogelman, David R; Dasari, Arvind; Raghav, Kanwal; Vilar, Eduardo; Manuel, Shanequa; Shureiqi, Imad; Wolff, Robert A; Patel, Keyur P; Luthra, Raja; Shaw, Kenna; Eng, Cathy; Maru, Dipen M; Routbort, Mark J; Meric-Bernstam, Funda; Kopetz, Scott

2017-01-01

SMAD4 is an essential mediator in the transforming growth factor-β pathway. Sporadic mutations of SMAD4 are present in 2.1-20.0% of colorectal cancers (CRCs) but data are limited. In this study, we aimed to evaluate clinicopathologic characteristics, prognosis, and clinical outcome associated with this mutation in CRC cases. Data for patients with metastatic or unresectable CRC who underwent genotyping for SMAD4 mutation and received treatment at The University of Texas MD Anderson Cancer Center from 2000 to 2014 were reviewed. Their tumors were sequenced using a hotspot panel predicted to cover 80% of the reported SMAD4 mutations, and further targeted resequencing that included full-length SMAD4 was performed on mutated tumors using a HiSeq sequencing system. Using The Cancer Genome Atlas data on CRC, the characteristics of SMAD4 and transforming growth factor-β pathway mutations were evaluated according to different consensus molecular subtypes of CRC. Among 734 patients with CRC, 90 (12%) had SMAD4 mutations according to hotspot testing. SMAD4 mutation was associated with colon cancer more so than with rectal cancer (odds ratio 2.85; p<0.001), female sex (odds ratio 1.71; p = 0.02), and shorter overall survival than in wild-type SMAD4 cases (median, 29 months versus 56 months; hazard ratio 2.08; p<0.001 [log-rank test]). SMAD4 mutation was not associated with age, stage at presentation, colonic location, distant metastasis, or tumor grade. A subset of patients with metastatic CRC (n = 44) wild-type for KRAS, NRAS, and BRAF who received anti-epidermal growth factor receptor therapy with mutated SMAD4 (n = 13) had shorter progression-free survival duration than did patients wild-type for SMAD4 (n = 31) (median, 111 days versus 180 days; p = 0.003 [log-rank test]). Full-length sequencing confirmed that missense mutations at R361 and P356 in the MH2 domain were the most common SMAD4 alterations. In The Cancer Genome Atlas data, SMAD4 mutation frequently occurred with KRAS, NRAS, and BRAF mutations and was more common in patients with the consensus molecular subtype 3 of CRC than in those with the other 3 subtypes. This is one of the largest retrospective studies to date characterizing SMAD4 mutations in CRC patients and demonstrates the prognostic role and lack of response of CRC to anti-epidermal growth factor receptor therapy. Further studies are required to validate these findings and the role of SMAD4 mutation in CRC.

Association of SMAD4 mutation with patient demographics, tumor characteristics, and clinical outcomes in colorectal cancer

PubMed Central

Sarshekeh, Amir Mehrvarz; Advani, Shailesh; Overman, Michael J.; Manyam, Ganiraju; Kee, Bryan K.; Fogelman, David R.; Dasari, Arvind; Raghav, Kanwal; Vilar, Eduardo; Manuel, Shanequa; Shureiqi, Imad; Wolff, Robert A.; Patel, Keyur P.; Luthra, Raja; Shaw, Kenna; Eng, Cathy; Maru, Dipen M.; Routbort, Mark J.; Meric-Bernstam, Funda

2017-01-01

SMAD4 is an essential mediator in the transforming growth factor-β pathway. Sporadic mutations of SMAD4 are present in 2.1–20.0% of colorectal cancers (CRCs) but data are limited. In this study, we aimed to evaluate clinicopathologic characteristics, prognosis, and clinical outcome associated with this mutation in CRC cases. Data for patients with metastatic or unresectable CRC who underwent genotyping for SMAD4 mutation and received treatment at The University of Texas MD Anderson Cancer Center from 2000 to 2014 were reviewed. Their tumors were sequenced using a hotspot panel predicted to cover 80% of the reported SMAD4 mutations, and further targeted resequencing that included full-length SMAD4 was performed on mutated tumors using a HiSeq sequencing system. Using The Cancer Genome Atlas data on CRC, the characteristics of SMAD4 and transforming growth factor-β pathway mutations were evaluated according to different consensus molecular subtypes of CRC. Among 734 patients with CRC, 90 (12%) had SMAD4 mutations according to hotspot testing. SMAD4 mutation was associated with colon cancer more so than with rectal cancer (odds ratio 2.85; p<0.001), female sex (odds ratio 1.71; p = 0.02), and shorter overall survival than in wild-type SMAD4 cases (median, 29 months versus 56 months; hazard ratio 2.08; p<0.001 [log-rank test]). SMAD4 mutation was not associated with age, stage at presentation, colonic location, distant metastasis, or tumor grade. A subset of patients with metastatic CRC (n = 44) wild-type for KRAS, NRAS, and BRAF who received anti-epidermal growth factor receptor therapy with mutated SMAD4 (n = 13) had shorter progression-free survival duration than did patients wild-type for SMAD4 (n = 31) (median, 111 days versus 180 days; p = 0.003 [log-rank test]). Full-length sequencing confirmed that missense mutations at R361 and P356 in the MH2 domain were the most common SMAD4 alterations. In The Cancer Genome Atlas data, SMAD4 mutation frequently occurred with KRAS, NRAS, and BRAF mutations and was more common in patients with the consensus molecular subtype 3 of CRC than in those with the other 3 subtypes. This is one of the largest retrospective studies to date characterizing SMAD4 mutations in CRC patients and demonstrates the prognostic role and lack of response of CRC to anti-epidermal growth factor receptor therapy. Further studies are required to validate these findings and the role of SMAD4 mutation in CRC. PMID:28267766

The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

PubMed

Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

2018-05-01

In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

Retroviral mutation rates and A-to-G hypermutations during different stages of retroviral replication.

PubMed Central

Kim, T; Mudry, R A; Rexrode, C A; Pathak, V K

1996-01-01

Retroviruses mutate at a high rate in vivo during viral replication. Mutations may occur during proviral transcription by RNA polymerase II, during minus-strand DNA synthesis (RNA template) by viral reverse transcriptase, or during plus-strand DNA synthesis (DNA template) by reverse transcriptase. To determine the contributions of different stages of replication to the retroviral mutation rates, we developed a spleen necrosis virus-based in vivo system to selectively identify mutations occurring during the early stage (RNA transcription plus minus-strand synthesis) and the late stage (plus-strand synthesis plus DNA repair). A lacZalpha reporter gene was inserted into the long terminal repeat (LTR) of a spleen necrosis virus shuttle vector, and proviruses were recovered from infected cells as plasmids containing either one or both LTRs. Plasmids containing both LTRs generated a mutant phenotype only if the lacZalpha genes in both LTRs were mutated, which is most likely to occur during the early stage. Mutant phenotypes were identified from plasmids containing one LTR regardless of the stage at which the mutations occurred. Thus, mutant frequencies obtained after recovery of plasmids containing both LTRs or one LTR provided early-stage and total mutation rates, respectively. Analysis of 56,409 proviruses suggested that the retroviral mutation rates during the early and late stages of replication were equal or within twofold of each other. In addition, two mutants with A-to-G hypermutations were discovered, suggesting a role for mammalian double-stranded RNA adenosine deaminase enzyme in retroviral mutations. These experiments provide a system to selectively identify mutations in the early stage of retroviral replication and to provide upper and lower limits to the in vivo mutation rates during minus-strand and plus-strand synthesis, respectively. PMID:8892879

KRAS and TP53 mutations in bronchoscopy samples from former lung cancer patients.

PubMed

Gao, Weimin; Jin, Jide; Yin, Jinling; Land, Stephanie; Gaither-Davis, Autumn; Christie, Neil; Luketich, James D; Siegfried, Jill M; Keohavong, Phouthone

2017-02-01

Mutations in the KRAS and TP53 genes have been found frequently in lung tumors and specimens from individuals at high risk for lung cancer and have been suggested as predictive markers for lung cancer. In order to assess the prognostic value of these two genes' mutations in lung cancer recurrence, we analyzed mutations in codon 12 of the KRAS gene and in hotspot codons of the TP53 gene in 176 bronchial biopsies obtained from 77 former lung cancer patients. Forty-seven patients (61.0%) showed mutations, including 35/77 (45.5%) in the KRAS gene and 25/77 (32.5%) in the TP53 gene, among them 13/77 (16.9%) had mutations in both genes. When grouped according to past or current smoking status, a higher proportion of current smokers showed mutations, in particular those in the TP53 gene (P = 0.07), compared with ex-smokers. These mutations were found in both abnormal lesions (8/20 or 40%) and histologically normal tissues (70/156 or 44.9%) (P = 0.812). They consisted primarily of G to A transition and G to T transversion in both the KRAS (41/56 or 73.2%) and TP53 (24/34 or 70.6%) genes, consistent with mutations found in lung tumors of smoking lung cancer patients. Overall, recurrence-free survival (RFS) among all subjects could be explained by age at diagnosis, tumor stage, tumor subtype, and smoking (P < 0.05, Cox proportional hazard). Therefore, KRAS and TP53 mutations were frequently detected in bronchial tissues of former lung cancer patients. However, the presence of mutation of bronchial biopsies was not significantly associated with a shorter RFS time. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

PubMed

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

ELANE Mutations in Cyclic and Severe Congenital Neutropenia—Genetics and Pathophysiology

PubMed Central

Horwitz, Marshall S.; Corey, Seth J.; Grimes, H. Leighton; Tidwell, Timothy

2012-01-01

There are two main forms of hereditary neutropenia: cyclic and severe congenital neutropenia (SCN). Cyclic neutropenia is an autosomal dominant disorder in which neutrophil counts fluctuate between nearly normal levels and close to zero with 21-day periodicity. In contrast, SCN, also known as Kostmann syndrome, consists of chronic and profound neutropenia, with a characteristic promyelocytic maturation arrest in the bone marrow. Unlike cyclic neutropenia, SCN displays frequent acquisition of somatic mutations in the gene, CSF3R, encoding the Granulocyte Colony-Stimulating Factor Receptor (G-CSFR), and a strong predisposition to developing myelodysplasia (MDS) and/or acute myeloid leukemia (AML). Cyclic neutropenia is caused by heterozygous mutations in the gene, ELANE (formerly known as ELA2), encoding the neutrophil granule serine protease, neutrophil elastase. SCN is genetically heterogeneous, but it is most frequently associated with ELANE mutations. While some of the different missense mutations in ELANE exhibit phenotype-genotype correlation, the same mutations are sometimes found in patients with either form of inherited neutropenia. The mutations lead to production of a mutant polypeptide, but no common biochemical abnormality, including effects on proteolysis, has been identified. Two non-mutually exclusive theories have been advanced to explain how the mutations might produce neutropenia. The mislocalization hypothesis states that mutations within neutrophil elastase or involving other proteins responsible for its intracellular trafficking cause neutrophil elastase to accumulate in inappropriate subcellular compartments. The misfolding hypothesis proposes that mutations prevent the protein from properly folding, thereby inducing the stress response pathway within the endoplasmic reticulum (ER). We discuss how the mutations themselves provide clues into pathogenesis, describe supporting and contradictory observations for both theories, and highlight outstanding questions relating to pathophysiology of neutropenia. PMID:23351986

Recurrence of superficial vein thrombosis in patients with varicose veins.

PubMed

Karathanos, Christos; Spanos, Konstantinos; Saleptsis, Vassileios; Tsezou, Aspasia; Kyriakou, Despina; Giannoukas, Athanasios D

2016-08-01

To investigate which factors other than history of superficial vein thrombosis (SVT) are associated with recurrent spontaneous SVT episodes in patients with varicose veins (VVs). Patients with a history of spontaneous SVT and VVs were followed up for a mean period of 55 months. Demographics, comorbidities, and thrombophilia screening test were analyzed. Patients were grouped according to the clinical-etiology-anatomy-pathophysiology classification. A multiple logistic regression analysis with the forward likelihood ratio method was undertaken. Thirteen patients out of 97 had a recurrence SVT episode during the follow-up period. All those patients were identified to have a thrombophilia defect. Protein C and S, antithrombin, and plasminogen deficiencies were more frequently present in patients without recurrence. Gene mutations were present in 38% in the nonrecurrence group and 77% in the recurrence group. After logistic regression analysis, patients with dislipidemia and mutation in prothrombin G20210A (FII) had an increased risk for recurrence by 5.4-fold and 4.6-fold, respectively. No deep vein thrombosis or pulmonary embolism occurred. Dislipidemia and gene mutations of F II are associated with SVT recurrence in patients with VVs. A selection of patients may benefit from anticoagulation in the short term and from VVs intervention in the long term. © The Author(s) 2015.

Oral bacteria in pancreatic cancer: mutagenesis of the p53 tumour suppressor gene

PubMed Central

Öğrendik, Mesut

2015-01-01

Carcinoma of exocrine pancreas is the fourth leading cause of cancer deaths, worldwide. The prevalence of this disease is very high in patients with chronic pancreatitis. Orodigestive cancers are frequently seen in patients with periodontitis. These findings suggest that this type of cancer may have some bacterial origins. This study hypothesizes that the peptidyl arginine deaminase (PAD) enzymes found in oral bacteria may be responsible for the p53 point mutations that occur in patients with pancreatic cancer. Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythia, and Treponema denticola possess the PAD enzyme, and p53 arginine mutations have been detected in patients with pancreatic cancer. Moreover, the Pro allele p53Arg72-Pro is a risk factor for the development of this cancer. Anti-P. gingivalis antibody titers have been found to be higher in patients with pancreatic cancer as compared to healthy controls. The hypothesis in question can be tested if the DNA of P. gingivalis or the antibodies against P. gingivalis can be detected in patients with the p53 arginine mutation.If this hypothesis is true, it could reveal the real cause of pancreatic cancer, which is a fatal disease. Further studies are necessary in order to confirm this hypothesis. PMID:26617937

Constraint shapes convergence in tetrodotoxin-resistant sodium channels of snakes.

PubMed

Feldman, Chris R; Brodie, Edmund D; Brodie, Edmund D; Pfrender, Michael E

2012-03-20

Natural selection often produces convergent changes in unrelated lineages, but the degree to which such adaptations occur via predictable genetic paths is unknown. If only a limited subset of possible mutations is fixed in independent lineages, then it is clear that constraint in the production or function of molecular variants is an important determinant of adaptation. We demonstrate remarkably constrained convergence during the evolution of resistance to the lethal poison, tetrodotoxin, in six snake species representing three distinct lineages from around the globe. Resistance-conferring amino acid substitutions in a voltage-gated sodium channel, Na(v)1.4, are clustered in only two regions of the protein, and a majority of the replacements are confined to the same three positions. The observed changes represent only a small fraction of the experimentally validated mutations known to increase Na(v)1.4 resistance to tetrodotoxin. These results suggest that constraints resulting from functional tradeoffs between ion channel function and toxin resistance led to predictable patterns of evolutionary convergence at the molecular level. Our data are consistent with theoretical predictions and recent microcosm work that suggest a predictable path is followed during an adaptive walk along a mutational landscape, and that natural selection may be frequently constrained to produce similar genetic outcomes even when operating on independent lineages.

Codon-Resolution Analysis Reveals a Direct and Context-Dependent Impact of Individual Synonymous Mutations on mRNA Level

PubMed Central

Chen, Siyu; Li, Ke; Cao, Wenqing; Wang, Jia; Zhao, Tong; Huan, Qing; Yang, Yu-Fei; Wu, Shaohuan; Qian, Wenfeng

2017-01-01

Abstract Codon usage bias (CUB) refers to the observation that synonymous codons are not used equally frequently in a genome. CUB is stronger in more highly expressed genes, a phenomenon commonly explained by stronger natural selection on translational accuracy and/or efficiency among these genes. Nevertheless, this phenomenon could also occur if CUB regulates gene expression at the mRNA level, a hypothesis that has not been tested until recently. Here, we attempt to quantify the impact of synonymous mutations on mRNA level in yeast using 3,556 synonymous variants of a heterologous gene encoding green fluorescent protein (GFP) and 523 synonymous variants of an endogenous gene TDH3. We found that mRNA level was positively correlated with CUB among these synonymous variants, demonstrating a direct role of CUB in regulating transcript concentration, likely via regulating mRNA degradation rate, as our additional experiments suggested. More importantly, we quantified the effects of individual synonymous mutations on mRNA level and found them dependent on 1) CUB and 2) mRNA secondary structure, both in proximal sequence contexts. Our study reveals the pleiotropic effects of synonymous codon usage and provides an additional explanation for the well-known correlation between CUB and gene expression level. PMID:28961875

Mutational jackpot events generate effective frequency-dependent selection in adapting populations

NASA Astrophysics Data System (ADS)

Hallatschek, Oskar

The site-frequency spectrum is one the most easily measurable quantities that characterize the genetic diversity of a population. While most neutral models predict that site frequency spectra should decay with increasing frequency, a high-frequency uptick has been reported in many populations. Anomalies in the high-frequency tail are particularly unsettling because the highest frequencies can be measured with greatest accuracy. Here, we show that an uptick in the spectrum of neutral mutations generally arises when mutant frequencies are dominated by rare jackpot events, mutational events with large descendant numbers. This leads to an effective pattern of frequency-dependent selection (or unstable internal equilibrium at one half frequency) that causes an accumulation of high-frequency polymorphic sites. We reproduce the known uptick occurring for recurrent hitchhiking (genetic draft) as well as rapid adaptation, and (in the future) generalize the shape of the high-frequency tail to other scenarios that are dominated by jackpot events, such as frequent range expansions. We also tackle (in the future) the inverse approach to use the high-frequency uptick for learning about the tail of the offspring number distribution. Positively selected alleles need to surpass, typically, an u NSF Career Award (PoLS), NIH NIGMS R01, Simons Foundation.

Discovery of naturally occurring ESR1 mutations in breast cancer cell lines modelling endocrine resistance.

PubMed

Martin, Lesley-Ann; Ribas, Ricardo; Simigdala, Nikiana; Schuster, Eugene; Pancholi, Sunil; Tenev, Tencho; Gellert, Pascal; Buluwela, Laki; Harrod, Alison; Thornhill, Allan; Nikitorowicz-Buniak, Joanna; Bhamra, Amandeep; Turgeon, Marc-Olivier; Poulogiannis, George; Gao, Qiong; Martins, Vera; Hills, Margaret; Garcia-Murillas, Isaac; Fribbens, Charlotte; Patani, Neill; Li, Zheqi; Sikora, Matthew J; Turner, Nicholas; Zwart, Wilbert; Oesterreich, Steffi; Carroll, Jason; Ali, Simak; Dowsett, Mitch

2017-11-30

Resistance to endocrine therapy remains a major clinical problem in breast cancer. Genetic studies highlight the potential role of estrogen receptor-α (ESR1) mutations, which show increased prevalence in the metastatic, endocrine-resistant setting. No naturally occurring ESR1 mutations have been reported in in vitro models of BC either before or after the acquisition of endocrine resistance making functional consequences difficult to study. We report the first discovery of naturally occurring ESR1 Y537C and ESR1 Y537S mutations in MCF7 and SUM44 ESR1-positive cell lines after acquisition of resistance to long-term-estrogen-deprivation (LTED) and subsequent resistance to fulvestrant (ICIR). Mutations were enriched with time, impacted on ESR1 binding to the genome and altered the ESR1 interactome. The results highlight the importance and functional consequence of these mutations and provide an important resource for studying endocrine resistance.

Genetics Home Reference: spondylothoracic dysostosis

MedlinePlus

... the MESP2 protein is nonfunctional or absent, somite segmentation does not occur properly, which results in ... mutations occur? How can gene mutations affect health and development? More about ...

Diet, Helicobacter pylori, and p53 mutations in gastric cancer: a molecular epidemiology study in Italy.

PubMed

Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F

1997-12-01

A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.

BRAF Mutation Correlates With High-Risk Langerhans Cell Histiocytosis and Increased Resistance to First-Line Therapy.

PubMed

Héritier, Sébastien; Emile, Jean-François; Barkaoui, Mohamed-Aziz; Thomas, Caroline; Fraitag, Sylvie; Boudjemaa, Sabah; Renaud, Florence; Moreau, Anne; Peuchmaur, Michel; Chassagne-Clément, Catherine; Dijoud, Frédérique; Rigau, Valérie; Moshous, Despina; Lambilliotte, Anne; Mazingue, Françoise; Kebaili, Kamila; Miron, Jean; Jeziorski, Eric; Plat, Geneviève; Aladjidi, Nathalie; Ferster, Alina; Pacquement, Hélène; Galambrun, Claire; Brugières, Laurence; Leverger, Guy; Mansuy, Ludovic; Paillard, Catherine; Deville, Anne; Armari-Alla, Corinne; Lutun, Anne; Gillibert-Yvert, Marion; Stephan, Jean-Louis; Cohen-Aubart, Fleur; Haroche, Julien; Pellier, Isabelle; Millot, Frédéric; Lescoeur, Brigitte; Gandemer, Virginie; Bodemer, Christine; Lacave, Roger; Hélias-Rodzewicz, Zofia; Taly, Valérie; Geissmann, Frédéric; Donadieu, Jean

2016-09-01

Langerhans cell histiocytosis (LCH) is an inflammatory myeloid neoplasia with a broad spectrum of clinical manifestations and outcomes in children. The somatic BRAF(V600E) mutation occurs frequently, but clinical significance remains to be determined. BRAF(V600E) mutation was investigated in a French LCH cohort. We analyzed associations between mutation status and clinical presentation, extent of disease, reactivation rate, response to therapy, and long-term permanent sequelae. Among 315 patients with successfully determined BRAF status, 173 (54.6%) carried a BRAF(V600E) mutation. Patients with BRAF(V600E) manifested more severe disease than did those with wild-type BRAF. Patients with BRAF(V600E) comprised 87.8% of patients (43 of 49) with multisystem LCH with risk organ involvement (liver, spleen, hematology), 68.6% of patients (35 of 51) with multisystem LCH without risk organ involvement, 43.9% of patients (86 of 196) with single-system LCH, and 42.1% of patients (8 of 19) with lung-involved LCH (P < .001). BRAF(V600E) mutation was also associated with organ involvement that could lead to permanent, irreversible damage, such as neurologic (75%) and pituitary (72.9%) injuries. Compared with patients with wild-type BRAF, patients with BRAF(V600E) more commonly displayed resistance to combined vinblastine and corticosteroid therapy (21.9% v 3.3%; P = .001), showed a higher reactivation rate (5-year reactivation rate, 42.8% v 28.1%; P = .006), and had more permanent, long-term consequences from disease or treatment (27.9% v 12.6%; P = .001). In children with LCH, BRAF(V600E) mutation was associated with high-risk features, permanent injury, and poor short-term response to chemotherapy. Further population-based studies should be undertaken to confirm our observations and to assess the impact of BRAF inhibitors for this subgroup of patients who may benefit from targeted therapy. © 2016 by American Society of Clinical Oncology.

Dihydropyrimidine dehydrogenase gene (DPYD) polymorphism among Caucasian and non-Caucasian patients with 5-FU- and capecitabine-related toxicity using full sequencing of DPYD.

PubMed

Saif, Muhammad Wasif

2013-01-01

Dihydropyrimidine dehydrogenase (DPD) is the rate-limiting enzyme of the degradation of pyrimidine base, and plays a pivotal role in the pharmacogenetic syndrome of 5-fluorouracil (5-FU). Deficiency of DPD activity leads to severe toxicities, even death, following administration of 5-FU. Several studies have demonstrated that molecular defects of the dihydropyrimidine dehydrogenase gene (DPYD) lead to the deficiency of DPD activity and cause this pharmacogenetic syndrome. We present the analysis of DPYD genotyping in untreated Caucasian patients (control group) and Caucasian patients with 5-FU/CAP-related grade 3/4 toxicities (toxicity group) who underwent a capecitabine TheraGuide 5-FU testing. Full sequencing of DPYD was performed in the Myriad Genetic Laboratories, Inc. as part of TheraGuide 5-FU test. Among 227 patients from the toxicity group, 27 (12%) had deleterious mutations in DPYD: twelve (5%) had IVS14 +1 G>A, eleven (5%) had D949V and four (2%) had other mutations. Only 7/192 (4%) patients from the control group had DPYD genotype abnormalities: two (1%) had IVS14 +1 G>A, four (2%) had D949V and one (1%) had other mutation. Genotype abnormalities were observed more frequently in the toxicity group (p=0.001). Among 65 patients with toxicities due to capecitabine, nine (14%) had mutated DPYD, which was more frequent than in the control group (p=0.006). Mutated DPYD is frequently observed in Caucasian patients who experience toxicities while receiving 5-FU/capecitabine. Screening of patients for DPYD mutations prior to administration of 5-FU/capecitabine using new pharmacogenetic testing methods, may help for identify those patients who are at greatest risk for adverse effects, allowing a more individualized approach to their chemotherapy management.

GAB2 amplifications refine molecular classification of melanoma.

PubMed

Chernoff, Karen A; Bordone, Lindsey; Horst, Basil; Simon, Katherine; Twadell, William; Lee, Keagan; Cohen, Jason A; Wang, Shuang; Silvers, David N; Brunner, Georg; Celebi, Julide Tok

2009-07-01

Gain-of-function mutations in BRAF, NRAS, or KIT are associated with distinct melanoma subtypes with KIT mutations and/or copy number changes frequently observed among melanomas arising from sun-protected sites, such as acral skin (palms, soles, and nail bed) and mucous membranes. GAB2 has recently been implicated in melanoma pathogenesis, and increased copy numbers are found in a subset of melanomas. We sought to determine the association of increased copy numbers of GAB2 among melanoma subtypes in the context of genetic alterations in BRAF, NRAS, and KIT. A total of 85 melanomas arising from sun-protected (n = 23) and sun-exposed sites (n = 62) were analyzed for copy number changes using array-based comparative genomic hybridization and for gain-of-function mutations in BRAF, NRAS, and KIT. GAB2 amplifications were found in 9% of the cases and were associated with melanomas arising from acral and mucosal sites (P = 0.005). Increased copy numbers of the KIT locus were observed in 6% of the cases. The overall mutation frequencies for BRAF and NRAS were 43.5% and 14%, respectively, and were mutually exclusive. Among the acral and mucosal melanomas studied, the genetic alteration frequency was 26% for GAB2, 13% for KIT, 30% for BRAF, and 4% for NRAS. Importantly, the majority of GAB2 amplifications occurred independent from genetic events in BRAF, NRAS, and KIT. GAB2 amplification is critical for melanomas arising from sun-protected sites. Genetic alterations in GAB2 will help refine the molecular classification of melanomas.

Behavioral phenotypes of genetic mouse models of autism.

PubMed

Kazdoba, T M; Leach, P T; Crawley, J N

2016-01-01

More than a hundred de novo single gene mutations and copy-number variants have been implicated in autism, each occurring in a small subset of cases. Mutant mouse models with syntenic mutations offer research tools to gain an understanding of the role of each gene in modulating biological and behavioral phenotypes relevant to autism. Knockout, knockin and transgenic mice incorporating risk gene mutations detected in autism spectrum disorder and comorbid neurodevelopmental disorders are now widely available. At present, autism spectrum disorder is diagnosed solely by behavioral criteria. We developed a constellation of mouse behavioral assays designed to maximize face validity to the types of social deficits and repetitive behaviors that are central to an autism diagnosis. Mouse behavioral assays for associated symptoms of autism, which include cognitive inflexibility, anxiety, hyperactivity, and unusual reactivity to sensory stimuli, are frequently included in the phenotypic analyses. Over the past 10 years, we and many other laboratories around the world have employed these and additional behavioral tests to phenotype a large number of mutant mouse models of autism. In this review, we highlight mouse models with mutations in genes that have been identified as risk genes for autism, which work through synaptic mechanisms and through the mTOR signaling pathway. Robust, replicated autism-relevant behavioral outcomes in a genetic mouse model lend credence to a causal role for specific gene contributions and downstream biological mechanisms in the etiology of autism. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Frequent associations between CTL and T-Helper epitopes in HIV-1 genomes and implications for multi-epitope vaccine designs

PubMed Central

2010-01-01

Background Epitope vaccines have been suggested as a strategy to counteract viral escape and development of drug resistance. Multiple studies have shown that Cytotoxic T-Lymphocyte (CTL) and T-Helper (Th) epitopes can generate strong immune responses in Human Immunodeficiency Virus (HIV-1). However, not much is known about the relationship among different types of HIV epitopes, particularly those epitopes that can be considered potential candidates for inclusion in the multi-epitope vaccines. Results In this study we used association rule mining to examine relationship between different types of epitopes (CTL, Th and antibody epitopes) from nine protein-coding HIV-1 genes to identify strong associations as potent multi-epitope vaccine candidates. Our results revealed 137 association rules that were consistently present in the majority of reference and non-reference HIV-1 genomes and included epitopes of two different types (CTL and Th) from three different genes (Gag, Pol and Nef). These rules involved 14 non-overlapping epitope regions that frequently co-occurred despite high mutation and recombination rates, including in genomes of circulating recombinant forms. These epitope regions were also highly conserved at both the amino acid and nucleotide levels indicating strong purifying selection driven by functional and/or structural constraints and hence, the diminished likelihood of successful escape mutations. Conclusions Our results provide a comprehensive systematic survey of CTL, Th and Ab epitopes that are both highly conserved and co-occur together among all subtypes of HIV-1, including circulating recombinant forms. Several co-occurring epitope combinations were identified as potent candidates for inclusion in multi-epitope vaccines, including epitopes that are immuno-responsive to different arms of the host immune machinery and can enable stronger and more efficient immune responses, similar to responses achieved with adjuvant therapies. Signature of strong purifying selection acting at the nucleotide level of the associated epitopes indicates that these regions are functionally critical, although the exact reasons behind such sequence conservation remain to be elucidated. PMID:20696039

Distribution of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mutations in a Cohort of Patients Residing in Palestine.

PubMed

Siryani, Issa; Jama, Mohamed; Rumman, Nisreen; Marzouqa, Hiyam; Kannan, Moein; Lyon, Elaine; Hindiyeh, Musa

2015-01-01

Cystic fibrosis (CF) is an autosomal recessive inherited life-threatening disorder that causes severe damage to the lungs and the digestive system. In Palestine, mutations in the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) that contributes to the clinical presentation of CF are ill defined. A cohort of thirty three clinically diagnosed CF patients from twenty one different Palestinian families residing in the central and southern part of Palestine were incorporated in this study. Sweat chloride testing was performed using the Sweat Chek Conductivity Analyzer (ELITECH Group, France) to confirm the clinical diagnosis of CF. In addition, nucleic acid from the patients' blood samples was extracted and the CFTR mutation profiles were assessed by direct sequencing of the CFTR 27 exons and the intron-exon boundaries. For patient's DNA samples where no homozygous or two heterozygous CFTR mutations were identified by exon sequencing, DNA samples were tested for deletions or duplications using SALSA MLPA probemix P091-D1 CFTR assay. Sweat chloride testing confirmed the clinical diagnosis of CF in those patients. All patients had NaCl conductivity >60 mmol/l. In addition, nine different CFTR mutations were identified in all 21 different families evaluated. These mutations were c.1393-1G>A, F508del, W1282X, G85E, c.313delA, N1303K, deletion exons 17a-17b-18, deletion exons 17a-17b and Q1100P. c.1393-1G>A was shown to be the most frequent occurring mutation among tested families. We have profiled the underling mutations in the CFTR gene of a cohort of 21 different families affected by CF. Unlike other studies from the Arab countries where F508del was reported to be the most common mutation, in southern/central Palestine, the c.1393-1G>A appeared to be the most common. Further studies are needed per sample size and geographic distribution to account for other possible CFTR genetic alterations and their frequencies. Genotype/phenotype assessments are also recommended and finally carrier frequency should be ascertained.

HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

The effects of mutational processes and selection on driver mutations across cancer types.

PubMed

Temko, Daniel; Tomlinson, Ian P M; Severini, Simone; Schuster-Böckler, Benjamin; Graham, Trevor A

2018-05-10

Epidemiological evidence has long associated environmental mutagens with increased cancer risk. However, links between specific mutation-causing processes and the acquisition of individual driver mutations have remained obscure. Here we have used public cancer sequencing data from 11,336 cancers of various types to infer the independent effects of mutation and selection on the set of driver mutations in a cancer type. First, we detect associations between a range of mutational processes, including those linked to smoking, ageing, APOBEC and DNA mismatch repair (MMR) and the presence of key driver mutations across cancer types. Second, we quantify differential selection between well-known alternative driver mutations, including differences in selection between distinct mutant residues in the same gene. These results show that while mutational processes have a large role in determining which driver mutations are present in a cancer, the role of selection frequently dominates.

Frequency and type of inheritable mutations induced by γ rays in rice as revealed by whole genome sequencing.

PubMed

Li, Shan; Zheng, Yun-Chao; Cui, Hai-Rui; Fu, Hao-Wei; Shu, Qing-Yao; Huang, Jian-Zhong

Mutation breeding is based on the induction of genetic variations; hence knowledge of the frequency and type of induced mutations is of paramount importance for the design and implementation of a mutation breeding program. Although γ ray irradiation has been widely used since the 1960s in the breeding of about 200 economically important plant species, molecular elucidation of its genetic effects has so far been achieved largely by analysis of target genes or genomic regions. In the present study, the whole genomes of six γ-irradiated M 2 rice plants were sequenced; a total of 144-188 million high-quality (Q>20) reads were generated for each M 2 plant, resulting in genome coverage of >45 times for each plant. Single base substitution (SBS) and short insertion/deletion (Indel) mutations were detected at the average frequency of 7.5×10 -6 -9.8×10 -6 in the six M 2 rice plants (SBS being about 4 times more frequent than Indels). Structural and copy number variations, though less frequent than SBS and Indel, were also identified and validated. The mutations were scattered in all genomic regions across 12 rice chromosomes without apparent hotspots. The present study is the first genome-wide single-nucleotide resolution study on the feature and frequency of γ irradiation-induced mutations in a seed propagated crop; the findings are of practical importance for mutation breeding of rice and other crop species.

The molecular pathogenesis of schwannomatosis, a paradigm for the co-involvement of multiple tumour suppressor genes in tumorigenesis.

PubMed

Kehrer-Sawatzki, Hildegard; Farschtschi, Said; Mautner, Victor-Felix; Cooper, David N

2017-02-01

Schwannomatosis is characterized by the predisposition to develop multiple schwannomas and, less commonly, meningiomas. Despite the clinical overlap with neurofibromatosis type 2 (NF2), schwannomatosis is not caused by germline NF2 gene mutations. Instead, germline mutations of either the SMARCB1 or LZTR1 tumour suppressor genes have been identified in 86% of familial and 40% of sporadic schwannomatosis patients. In contrast to patients with rhabdoid tumours, which are due to complete loss-of-function SMARCB1 mutations, individuals with schwannomatosis harbour predominantly hypomorphic SMARCB1 mutations which give rise to the synthesis of mutant proteins with residual function that do not cause rhabdoid tumours. Although biallelic mutations of SMARCB1 or LZTR1 have been detected in the tumours of patients with schwannomatosis, the classical two-hit model of tumorigenesis is insufficient to account for schwannoma growth, since NF2 is also frequently inactivated in these tumours. Consequently, tumorigenesis in schwannomatosis must involve the mutation of at least two different tumour suppressor genes, an occurrence frequently mediated by loss of heterozygosity of large parts of chromosome 22q harbouring not only SMARCB1 and LZTR1 but also NF2. Thus, schwannomatosis is paradigmatic for a tumour predisposition syndrome caused by the concomitant mutational inactivation of two or more tumour suppressor genes. This review provides an overview of current models of tumorigenesis and mutational patterns underlying schwannomatosis that will ultimately help to explain the complex clinical presentation of this rare disease.

Frequent germline deleterious mutations in DNA repair genes in familial prostate cancer cases are associated with advanced disease.

PubMed

Leongamornlert, D; Saunders, E; Dadaev, T; Tymrakiewicz, M; Goh, C; Jugurnauth-Little, S; Kozarewa, I; Fenwick, K; Assiotis, I; Barrowdale, D; Govindasami, K; Guy, M; Sawyer, E; Wilkinson, R; Antoniou, A C; Eeles, R; Kote-Jarai, Z

2014-03-18

Prostate cancer (PrCa) is one of the most common diseases to affect men worldwide and among the leading causes of cancer-related death. The purpose of this study was to use second-generation sequencing technology to assess the frequency of deleterious mutations in 22 tumour suppressor genes in familial PrCa and estimate the relative risk of PrCa if these genes are mutated. Germline DNA samples from 191 men with 3 or more cases of PrCa in their family were sequenced for 22 tumour suppressor genes using Agilent target enrichment and Illumina technology. Analysis for genetic variation was carried out by using a pipeline consisting of BWA, Genome Analysis Toolkit (GATK) and ANNOVAR. Clinical features were correlated with mutation status using standard statistical tests. Modified segregation analysis was used to determine the relative risk of PrCa conferred by the putative loss-of-function (LoF) mutations identified. We discovered 14 putative LoF mutations in 191 samples (7.3%) and these mutations were more frequently associated with nodal involvement, metastasis or T4 tumour stage (P=0.00164). Segregation analysis of probands with European ancestry estimated that LoF mutations in any of the studied genes confer a relative risk of PrCa of 1.94 (95% CI: 1.56-2.42). These findings show that LoF mutations in DNA repair pathway genes predispose to familial PrCa and advanced disease and therefore warrants further investigation. The clinical utility of these findings will become increasingly important as targeted screening and therapies become more widespread.

Genetic alterations in seborrheic keratoses

PubMed Central

Heidenreich, Barbara; Denisova, Evygenia; Rachakonda, Sivaramakrishna; Sanmartin, Onofre; Dereani, Timo; Hosen, Ismail; Nagore, Eduardo; Kumar, Rajiv

2017-01-01

Seborrheic keratoses are common benign epidermal lesions that are associated with increased age and sun-exposure. Those lesions despite harboring multiple somatic alterations in contrast to malignant tumors appear to be genetically stable. In order to investigate and characterize the presence of recurrent mutations, we performed exome sequencing on DNA from one seborrheic keratosis lesion and corresponding blood cells from the same patients with follow up investigation of alterations identified by exome sequencing in 24 additional lesions from as many patients. In addition we investigated alterations in all lesions at specific genes loci that included FGFR3, PIK3CA, HRAS, BRAF, CDKN2A and TERT and DHPH3 promoters. The exome sequencing data indicated three mutations per Mb of the targeted sequence. The mutational pattern depicted typical UV signature with majority of alterations being C>T and CC>TT base changes at dipyrimidinic sites. The FGFR3 mutations were the most frequent, detected in 12 of 25 (48%) lesions, followed by the PIK3CA (32%), TERT promoter (24%) and DPH3 promoter mutations (24%). TERT promoter mutations associated with increased age and were present mainly in the lesions excised from head and neck. Three lesions also carried alterations in CDKN2A. FGFR3, TERT and DPH3 expression did not correlate with mutations in the respective genes and promoters; however, increased FGFR3 transcript levels were associated with increased FOXN1 levels, a suggested positive feedback loop that stalls malignant progression. Thus, in this study we report overall mutation rate through exome sequencing and show the most frequent mutations seborrheic keratosis. PMID:28410231

Spectrum of genetic variants of BRCA1 and BRCA2 in a German single center study.

PubMed

Meisel, Cornelia; Sadowski, Carolin Eva; Kohlstedt, Daniela; Keller, Katja; Stäritz, Franziska; Grübling, Nannette; Becker, Kerstin; Mackenroth, Luisa; Rump, Andreas; Schröck, Evelin; Arnold, Norbert; Wimberger, Pauline; Kast, Karin

2017-05-01

Determination of mutation status of BRCA1 and BRCA2 has become part of the clinical routine. However, the spectrum of genetic variants differs between populations. The aim of this study was to deliver a comprehensive description of all detected variants. In families fulfilling one of the German Consortium for Hereditary Breast and Ovarian Cancer (GC-HBOC) criteria for genetic testing, one affected was chosen for analysis. DNA of blood lymphocytes was amplified by PCR and prescreened by DHPLC. Aberrant fragments were sequenced. All coding exons and splice sites of BRCA1 and BRCA2 were analyzed. Screening for large rearrangements in both genes was performed by MLPA. Of 523 index patients, 121 (23.1%) were found to carry a pathogenic or likely pathogenic (class 4/5) mutation. A variant of unknown significance (VUS) was detected in 73/523 patients (13.9%). Two mutations p.Gln1756Profs*74 and p.Cys61Gly comprised 42.3% (n = 33/78) of all detected pathogenic mutations in BRCA1. Most of the other mutations were unique mutations. The most frequently detected mutation in BRCA2 was p.Val1283Lys (13.9%; n = 6/43). Altogether, 101 different neutral genetic variants were counted in BRCA1 (n = 35) and in BRCA2 (n = 66). The two most frequently detected mutations are founder mutations in Poland and Czech Republic. More similarities seem to be shared with our direct neighbor countries compared to other European countries. For comparison of the extended genotype, a shared database is needed.

A detailed clinical analysis of 13 patients with AUTS2 syndrome further delineates the phenotypic spectrum and underscores the behavioural phenotype.

PubMed

Beunders, Gea; van de Kamp, Jiddeke; Vasudevan, Pradeep; Morton, Jenny; Smets, Katrien; Kleefstra, Tjitske; de Munnik, Sonja A; Schuurs-Hoeijmakers, Janneke; Ceulemans, Berten; Zollino, Marcella; Hoffjan, Sabine; Wieczorek, Stefan; So, Joyce; Mercer, Leanne; Walker, Tanya; Velsher, Lea; Parker, Michael J; Magee, Alex C; Elffers, Bart; Kooy, R Frank; Yntema, Helger G; Meijers-Heijboer, Elizabeth J; Sistermans, Erik A

2016-08-01

AUTS2 syndrome is an 'intellectual disability (ID) syndrome' caused by genomic rearrangements, deletions, intragenic duplications or mutations disrupting AUTS2. So far, 50 patients with AUTS2 syndrome have been described, but clinical data are limited and almost all cases involved young children. We present a detailed clinical description of 13 patients (including six adults) with AUTS2 syndrome who have a pathogenic mutation or deletion in AUTS2. All patients were systematically evaluated by the same clinical geneticist. All patients have borderline to severe ID/developmental delay, 83-100% have microcephaly and feeding difficulties. Congenital malformations are rare, but mild heart defects, contractures and genital malformations do occur. There are no major health issues in the adults; the oldest of whom is now 59 years of age. Behaviour is marked by it is a friendly outgoing social interaction. Specific features of autism (like obsessive behaviour) are seen frequently (83%), but classical autism was not diagnosed in any. A mild clinical phenotype is associated with a small in-frame 5' deletions, which are often inherited. Deletions and other mutations causing haploinsufficiency of the full-length AUTS2 transcript give a more severe phenotype and occur de novo. The 13 patients with AUTS2 syndrome with unique pathogenic deletions scattered around the AUTS2 locus confirm a phenotype-genotype correlation. Despite individual variations, AUTS2 syndrome emerges as a specific ID syndrome with microcephaly, feeding difficulties, dysmorphic features and a specific behavioural phenotype. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Safety of vemurafenib in patients with BRAF V600 mutated metastatic melanoma: the Spanish experience.

PubMed

Arance, A M; Berrocal, A; Lopez-Martin, J A; de la Cruz-Merino, L; Soriano, V; Martín Algarra, S; Alonso, L; Cerezuela, P; La Orden, B; Espinosa, E

2016-11-01

Vemurafenib tolerability was assessed in a large, open-label, multicentre study in patients with BRAF V600 mutated advanced melanoma. We investigated safety, tolerability and efficacy of vemurafenib in Spanish patients participating in that study. Patients with previously treated or treatment-naive, unresectable stage IIIC or stage IV, BRAF V600 mutation-positive melanoma received vemurafenib 960 mg twice daily until disease progression, unacceptable toxicity, withdrawal of consent or death. The primary endpoint was safety; secondary endpoints included overall response rate (ORR), progression-free survival (PFS) and overall survival (OS). 301 Spanish patients were included, 70 % with M1c disease, 22 % with brain metastases and 51 % with prior systemic therapy for metastatic disease. Most frequent adverse events included fatigue (48 %), arthralgia (45 %), rash (41 %), photosensitivity (34 %) and skin neoplasms (21 %). Grade 3/4 adverse events occurred in 156 patients (52 %), including cutaneous squamous cell carcinoma (including keratoacanthoma; 16 %), fatigue (6 %) and arthralgia (5 %). The ORR was 28 % (95 % CI 23-34 %). Responses occurred in patients with brain metastases (18 %), elevated baseline lactate dehydrogenase (19 %) and poor performance status (15 %), and elderly patients (22 %). Median PFS was 5.8 (95 % CI 5.0-6.4) months; median OS was 10.5 (95 % CI 9.5-13.5) months. Our results for Spanish patients in the vemurafenib safety study indicate similar efficacy and a comparable safety profile in Spanish patients with no new safety signals compared with the overall population. Clinical benefit was demonstrated in poor-prognosis patients and in those with favourable baseline characteristics, suggesting that poor-prognosis patients may also benefit from vemurafenib treatment.

Molecular evaluation of PIK3CA gene mutation in breast cancer: determination of frequency, distribution pattern and its association with clinicopathological findings in Indian patients.

PubMed

Ahmad, Firoz; Badwe, Anuya; Verma, Geeta; Bhatia, Simi; Das, Bibhu Ranjan

2016-07-01

Somatic mutations in the PIK3CA gene are common in breast cancer and represent a clinically useful marker for prognosis and therapeutic target. Activating mutations in the PI3K p110 catalytic subunit (PIK3CA) have been identified in 18-40 % of breast carcinomas. In this study, we evaluated PIK3CA mutation in 185 Indian breast cancer patients by direct DNA sequencing. PIK3CA mutations were observed in 23.2 % (43/185) of breast tumor samples. PIK3CA mutations were more frequent exon 30 (76.8 %) than in exon 9 (23.2 %). Mutations were mostly clustered within two hotspot region between nucleotides 1624 and 1636 or between 3129 and 3140. Sequencing analysis revealed four different missense mutations at codon 542 and 545 (E542K, E545K, E545A and E545G) in the helical domain and two different amino acid substitutions at codon 1047 (H1047R and H1047L) in the kinase domain. None of the cases harbored concomitant mutations at multiple codons. PIK3CA mutations were more frequent in older patients, smaller size tumors, ductal carcinomas, grade II tumors, lymph node-positive tumors and non-DCIS tumors; however, none of the differences were significant. In addition, PIK3CA mutations were common in ER+, PR+ and HER2+ cases (30 %), and a comparatively low frequency were noted in triple-negative tumors (13.6 %). In conclusion, to our knowledge, this is the largest study to evaluate the PIK3CA mutation in Indian breast cancer patients. The frequency and distribution pattern of PIK3CA mutations is similar to global reports. Furthermore, identification of molecular markers has unique strengths and can provide insights into the pathogenic process of breast carcinomas.

Prognostic value of mutational characteristics in gastrointestinal stromal tumors: a single-center experience in 275 cases.

PubMed

Wang, Ming; Xu, Jia; Zhao, Wenyi; Tu, Lin; Qiu, Weiqing; Wang, Chaojie; Shen, Yangyin; Liu, Qiang; Cao, Hui

2014-01-01

The objective of this study was to investigate the impact of KIT/PDGFRA mutations on the prognosis of gastrointestinal stromal tumors (GISTs). In the present study, genotype analyses were performed based on GIST samples from 275 patients. The relationship between mutation and clinicopathological characteristics were explored. All factors were evaluated for their impacts on relapse-free survival (RFS). Briefly, the results of genotype analyses showed that mutations were identified in 258 (93.8 %) patients, and deletion was the most frequent type of mutation accounting for 47.3 % (122/258) of all mutation cases, followed by substitution (87/258, 33.7 %) and duplication (49/258, 19.0 %). Moreover, for KIT exon 11 mutation, the most frequently involved area was from codon 557 to 560. Deep analyses showed that the mutation types were correlated with tumor location (P = 0.005), tumor size (P = 0.022), mitosis rate (P < 0.001), risk grade (P < 0.001), and relapse (P = 0.004). Furthermore, delW557-K558 correlated with mitosis rate (P = 0.042) and relapse (P = 0.036), and delTyr568/570 correlated with tumor origin (P = 0.018). Most importantly, mitotic rate [HR = 2.901 (95 % CI 1.094-7.695), P = 0.032] and risk grade [HR = 9.629 (95 % CI 1.997-46.416), P = 0.005] would be the representative traditional prognostic factors, and deletion with >3 codons would be an novel independent predictor of poor outcome for RFS in GIST patients with deletion mutation of KIT exon 11 [HR = 7.970 (95 % CI 1.774-35.803), P = 0.007]. All results indicated that mutation determined clinicopathological features and prognosis of GISTs, and more than three codons involvement may be a novel adverse indicator.

Frequency of ABL gene mutations in chronic myeloid leukemia patients resistant to imatinib and results of treatment switch to second-generation tyrosine kinase inhibitors.

PubMed

Marcé, Silvia; Zamora, Lurdes; Cabezón, Marta; Xicoy, Blanca; Boqué, Concha; Fernández, Cristalina; Grau, Javier; Navarro, José-Tomás; Fernández de Sevilla, Alberto; Ribera, Josep-Maria; Feliu, Evarist; Millá, Fuensanta

2013-08-04

Tyrosine kinase inhibitors (TKI) have improved the management of patients with chronic myeloid leukemia (CML). However, a significant proportion of patients do not achieve the optimal response or are resistant to TKI. ABL kinase domain mutations have been extensively implicated in the pathogenesis of TKI resistance. Treatment with second-generation TKI has produced high rates of hematologic and cytogenetic responses in mutated ABL patients. The aim of this study was to determine the type and frequency of ABL mutations in patients who were resistant to imatinib or had lost the response, and to analyze the effect of second-generation TKI on their outcome. The presence of ABL mutations in 45 CML patients resistant to imatinib was evaluated by direct sequencing and was correlated with the results of the cytogenetic study (performed in 39 cases). The outcome of these patients after therapy with nilotinib or dasatinib was analyzed. ABL mutations were detected in 14 out of 45 resistant patients. Patients with clonal cytogenetic evolution tended to develop mutations more frequently than those without clonal evolution. Nine out of the 15 patients with ABL mutation responded to a treatment switch to nilotinib (n=4), dasatinib (n=2), interferon (n=1) or hematopoietic stem cell transplantation (n=2). The frequency of ABL mutations in CML patients resistant to imatinib is high and is more frequent among those with clonal cytogenetic evolution. The change to second-generation TKI can overcome imatinib resistance in most of the mutated patients. Copyright © 2012 Elsevier España, S.L. All rights reserved.

Small Cell Lung Cancer Exhibits Frequent Inactivating Mutations in the Histone Methyltransferase KMT2D/MLL2: CALGB 151111 (Alliance)

PubMed Central

Augert, Arnaud; Zhang, Qing; Bates, Breanna; Cui, Min; Wang, Xiaofei; Wildey, Gary; Dowlati, Afshin; MacPherson, David

2017-01-01

Introduction SCLC is a lethal neuroendocrine tumor type that is highly prone to metastasis. There is an urgency to understand the mutated genes that promote SCLC, as there are no approved targeted therapies yet available. SCLC is rarely resected, limiting the number of samples available for genomic analyses of somatic mutations. Methods To identify potential driver mutations in human SCLC we sequenced the whole exomes of 18 primary SCLCs and seven cell lines along with matched normal controls. We extended these data by resequencing a panel of genes across 40 primary SCLCs and 48 cell lines. Results We report frequent mutations in the lysine methyltransferase 2D gene (KMT2D) (also known as MLL2), a key regulator of transcriptional enhancer function. KMT2D exhibited truncating nonsense/frameshift/splice site mutations in 8% of SCLC tumors and 17% of SCLC cell lines. We found that KMT2D mutation in human SCLC cell lines was associated with reduced lysine methyltransferase 2D protein levels and reduced monomethylation of histone H3 lysine 4, a mark associated with transcriptional enhancers. We also found mutations in other genes associated with transcriptional enhancer control, including CREB binding protein gene (CREBBP), E1A binding protein p300 gene (EP300), and chromodomain helicase DNA binding protein 7 gene (CHD7), and we report mutations in additional chromatin remodeling genes such as polybromo 1 gene (PBRM1). Conclusions These data indicate that KMT2D is one of the major mutated genes in SCLC, and they point to perturbation of transcriptional enhancer control as potentially contributing to SCLC. PMID:28007623

Role of TP53 mutations in triple negative and HER2-positive breast cancer treated with neoadjuvant anthracycline/taxane-based chemotherapy

PubMed Central

Darb-Esfahani, Silvia; Denkert, Carsten; Stenzinger, Albrecht; Salat, Christoph; Sinn, Bruno; Schem, Christian; Endris, Volker; Klare, Peter; Schmitt, Wolfgang; Blohmer, Jens-Uwe; Weichert, Wilko; Möbs, Markus; Tesch, Hans; Kümmel, Sherko; Sinn, Peter; Jackisch, Christian; Dietel, Manfred; Reimer, Toralf; Loi, Sherene; Untch, Michael; von Minckwitz, Gunter; Nekljudova, Valentina; Loibl, Sibylle

2016-01-01

Background TP53 mutations are frequent in breast cancer, however their clinical relevance in terms of response to chemotherapy is controversial. Methods 450 pre-therapeutic, formalin-fixed, paraffin-embedded core biopsies from the phase II neoadjuvant GeparSixto trial that included HER2-positive and triple negative breast cancer (TNBC) were subjected to Sanger sequencing of exons 5-8 of the TP53 gene. TP53 status was correlated to response to neoadjuvant anthracycline/taxane-based chemotherapy with or without carboplatin and trastuzumab/lapatinib in HER2-positive and bevacizumab in TNBC. p53 protein expression was evaluated by immunohistochemistry in the TNBC subgroup. Results Of 450 breast cancer samples 297 (66.0%) were TP53 mutant. Mutations were significantly more frequent in TNBC (74.8%) compared to HER2-positive cancers (55.4%, P < 0.0001). Neither mutations nor different mutation types and effects were associated with pCR neither in the whole study group nor in molecular subtypes (P > 0.05 each). Missense mutations tended to be associated with a better survival compared to all other types of mutations in TNBC (P = 0.093) and in HER2-positive cancers (P = 0.071). In TNBC, missense mutations were also linked to higher numbers of tumor-infiltrating lymphocytes (TILs, P = 0.028). p53 protein overexpression was also linked with imporved survival (P = 0.019). Conclusions Our study confirms high TP53 mutation rates in TNBC and HER2-positive breast cancer. Mutations did not predict the response to an intense neoadjuvant chemotherapy in these two molecular breast cancer subtypes. PMID:27611952

Increased Frequency of KRAS Mutations in African Americans Compared with Caucasians in Sporadic Colorectal Cancer.

PubMed

Staudacher, Jonas J; Yazici, Cemal; Bul, Vadim; Zeidan, Joseph; Khalid, Ahmer; Xia, Yinglin; Krett, Nancy; Jung, Barbara

2017-10-19

The basis for over-representation of colorectal cancer (CRC) in African-American (AA) populations compared with Caucasians are multifactorial and complex. Understanding the mechanisms for this racial disparity is critical for delivery of better care. Several studies have investigated sporadic CRC for differences in somatic mutations between AAs and Caucasians, but owing to small study sizes and conflicting results to date, no definitive conclusions have been reached. Here, we present the first systematic literature review and meta-analysis investigating the mutational differences in sporadic CRC between AAs and Caucasians focused on frequent driver mutations (APC,TP53, KRAS,PI3CA, FBXW7,SMAD4, and BRAF). Publication inclusion criteria comprised sporadic CRC, human subjects, English language, information on ethnicity (AA, Caucasian, or both), total subject number >20, and information on mutation frequencies. We identified 6,234 publications. Meta-analysis for APC, TP54, FBXW7, or SMAD4 was not possible owing to paucity of data. KRAS mutations were statistically less frequent in non-Hispanic Whites when compared with AAs (odds ratio, 0.640; 95% confidence interval (CI): 0.5342-0.7666; P=0.0001), while the mutational differences observed in BRAF and PI3CA did not reach statistical significance. Here, we report the mutational patterns for KRAS, BRAF, and PI3CA in sporadic CRC of AAs and Caucasians in a systematic meta-analysis of previously published data. We identified an increase in KRAS mutations in sporadic CRC in AAs, which may contribute to worse prognosis and increased mortality of CRC in AAs. Future studies investigating health-care disparities in CRC in AAs should control for KRAS mutational frequency.

iMARS--mutation analysis reporting software: an analysis of spontaneous cII mutation spectra.

PubMed

Morgan, Claire; Lewis, Paul D

2006-01-31

The sensitivity of any mutational assay is determined by the level at which spontaneous mutations occur in the corresponding untreated controls. Establishing the type and frequency at which mutations occur naturally within a test system is essential if one is to draw scientifically sound conclusions regarding chemically induced mutations. Currently, mutation-spectra analysis is laborious and time-consuming. Thus, we have developed iMARS, a comprehensive mutation-spectrum analysis package that utilises routinely used methodologies and visualisation tools. To demonstrate the use and capabilities of iMARS, we have analysed the distribution, types and sequence context of spontaneous base substitutions derived from the cII gene mutation assay in transgenic animals. Analysis of spontaneous mutation spectra revealed variation both within and between the transgenic rodent test systems Big Blue Mouse, MutaMouse and Big Blue Rat. The most common spontaneous base substitutions were G:C-->A:T transitions and G:C-->T:A transversions. All Big Blue Mouse spectra were significantly different from each other by distribution and nearly all by mutation type, whereas the converse was true for the other test systems. Twenty-eight mutation hotspots were observed across all spectra generally occurring in CG, GA/TC, GG and GC dinucleotides. A mutation hotspot at nucleotide 212 occurred at a higher frequency in MutaMouse and Big Blue Rat. In addition, CG dinucleotides were the most mutable in all spectra except two Big Blue Mouse spectra. Thus, spontaneous base-substitution spectra showed more variation in distribution, type and sequence context in Big Blue Mouse relative to spectra derived from MutaMouse and Big Blue Rat. The results of our analysis provide a baseline reference for mutation studies utilising the cII gene in transgenic rodent models. The potential differences in spontaneous base-substitution spectra should be considered when making comparisons between these test systems. The ease at which iMARS has allowed us to carry out an exhaustive investigation to assess mutation distribution, mutation type, strand bias, target sequences and motifs, as well as predict mutation hotspots provides us with a valuable tool in helping to distinguish true chemically induced hotspots from background mutations and gives a true reflection of mutation frequency.

Aggressive fibromatosis (desmoid tumors): definition, occurrence, pathology, diagnostic problems, clinical behavior, genetic background.

PubMed

Ferenc, Tomasz; Sygut, Jacek; Kopczyński, Janusz; Mayer, Magdalena; Latos-Bieleńska, Anna; Dziki, Adam; Kulig, Andrzej

2006-01-01

Aggressive fibromatosis, usually called desmoid tumor develops from muscle connective tissue, fasciae and aponeuroses. This neoplasm is composed of spindle (fibrocyte-like) cells. As regards the site, aggressive fibromatoses can be divided into: extra-abdominal in the area of the shoulder and pelvic girdle or chest and neck wall; abdominal in abdominal wall muscles; intra-abdominal concerning pelvis, mesentery connective tissue or retroperitoneal space. Desmoid tumor is a neoplasm which rarely turns malignant and is non-metastasizing but demonstrates ability to local infiltration into tissue and is characterized by high risk of recurrence (25-65%) after surgical treatment. Desmoid tumor etiology is uncertain. This neoplasm occurs in sporadic (idiopathic) form and is also associated with some familial neoplastic syndromes. Most sporadic cases of aggressive fibromatosis contain a somatic mutation in either the adenomatous polyposis coli (APC) or beta-catenin genes. Sporadic tumors are more frequent in women than in men from 2 : 1 to 5 : 1. In about 10-15 per cent of patients with familial adenomatous polyposis (FAP), aggressive fibromatosis is a parenteral manifestation of this familial syndrome conditioned by APC gene mutation. Abdomen injury--most frequently due to surgery is said to play an important role in the initiation of fibrous tissue proliferative process in the cases of abdominal and intra abdominal forms. High cells growth potential with relatively high local malignancy is observed in about 10% of cases with sporadic tumors as well as in those FAP-associated.

Pathology of Endometrial Carcinoma.

PubMed

Lax, Sigurd F

2017-01-01

On a clinicopathological and molecular level, two distinctive types of endometrial carcinoma, type I and type II, can be distinguished. Endometrioid carcinoma, the typical type I carcinoma, seems to develop through an estrogen-driven "adenoma carcinoma" pathway from atypical endometrial hyperplasia/endometrioid intraepithelial neoplasia (AEH/EIN). It is associated with elevated serum estrogen and high body mass index and expresses estrogen and progesterone receptors. They are mostly low grade and show a favorable prognosis. A subset progresses into high-grade carcinoma which is accompanied by loss of receptor expression and accumulation of TP53 mutations and behaves poorly. Other frequently altered genes in type I carcinomas are K-Ras, PTEN, and ß-catenin. Another frequent feature of type I carcinomas is microsatellite instability mainly caused by methylation of the MLH1 promoter. In contrast, the typical type II carcinoma, serous carcinoma, is not estrogen related since it usually occurs in a small uterus with atrophic endometrium. It is often associated with a flat putative precursor lesion called serous endometrial intraepithelial carcinoma (SEIC). The molecular pathogenesis of serous carcinoma seems to be driven by TP53 mutations, which are present in SEIC. Other molecular changes in serous carcinoma detectable by immunohistochemistry involve cyclin E and p16. Since many of the aforementioned molecular changes can be demonstrated by immunohistochemistry, they are useful ancillary diagnostic tools and may further contribute to a future molecular classification of endometrial carcinoma as recently suggested based on The Cancer Genome Atlas (TCGA) data.

Physiological Levels of Pik3ca H1047R Mutation in the Mouse Mammary Gland Results in Ductal Hyperplasia and Formation of ERα-Positive Tumors

PubMed Central

Tikoo, Anjali; Roh, Vincent; Montgomery, Karen G.; Ivetac, Ivan; Waring, Paul; Pelzer, Rebecca; Hare, Lauren; Shackleton, Mark; Humbert, Patrick; Phillips, Wayne A.

2012-01-01

PIK3CA, the gene coding for the p110α subunit of phosphoinositide 3-kinase, is frequently mutated in a variety of human tumors including breast cancers. To better understand the role of mutant PIK3CA in the initiation and/or progression of breast cancer, we have generated mice with a conditional knock-in of the common activating mutation, Pik3caH1047R, into one allele of the endogenous gene in the mammary gland. These mice developed a ductal anaplasia and hyperplasia by 6 weeks of age characterized by multi-layering of the epithelial lining of the mammary ducts and expansion of the luminal progenitor (Lin−; CD29lo; CD24+; CD61+) cell population. The Pik3caH1047R expressing mice eventually develop mammary tumors with 100% penetrance but with a long latency (>12 months). This is significantly longer than has been reported for transgenic models where expression of the mutant Pik3ca is driven by an exogenous promoter. Histological analysis of the tumors formed revealed predominantly ERα-positive fibroadenomas, carcinosarcomas and sarcomas. In vitro induction of Pik3caH1047R in immortalized mammary epithelial cells also resulted in tumor formation when injected into the mammary fat pad of immunodeficient recipient mice. This novel model, which reproduces the scenario of a heterozygous somatic mutation occurring in the endogenous PIK3CA gene, will thus be a valuable tool for investigating the role of Pik3caH1047R mutation in mammary tumorigenesis both in vivo and in vitro. PMID:22666336

Evolutionary Stasis in Cycad Plastomes and the First Case of Plastome GC-Biased Gene Conversion.

PubMed

Wu, Chung-Shien; Chaw, Shu-Miaw

2015-06-27

In angiosperms, gene conversion has been known to reduce the mutational load of plastid genomes (the plastomes). Particularly, more frequent gene conversions in inverted repeat (IR) than in single copy (SC) regions result in contrasting substitution rates between these two regions. However, little has been known about the effect of gene conversion in the evolution of gymnosperm plastomes. Cycads (Cycadophyta) are the second largest gymnosperm group. Evolutionary study of their plastomes is limited to the basal cycad genus, Cycas. In this study, we addressed three questions. 1) Do the plastomes of other cycad genera evolve slowly as previously observed in the plastome of Cycas taitungensis? 2) Do substitution rates differ between their SC and IR regions? And 3) Does gene conversion occur in the cycad plastomes? If yes, is it AT-biased or GC-biased? Plastomes of eight species from other eight genera of cycads were sequenced. These plastomes are highly conserved in genome organization. Excluding ginkgo, cycad plastomes have significantly lower synonymous and nonsynonymous substitution rates than other gymnosperms, reflecting their evolutionary stasis in nucleotide mutations. In the IRs of cycad plastomes, the reduced substitution rates and GC-biased mutations are associated with a GC-biased gene conversion (gBGC) mechanism. Further investigations suggest that in cycads, gBGC is able to rectify plastome-wide mutations. Therefore, this study is the first to uncover the plastomic gBGC in seed plants. We also propose a gBGC model to interpret the dissimilar evolutionary patterns as well as the compositionally biased mutations in the SC and IR regions of cycad plastomes. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Naturally occurring resistance mutations within the core and NS5B regions in hepatitis C genotypes, particularly genotype 5a, in South Africa.

PubMed

Prabdial-Sing, N; Blackard, J T; Puren, A J; Mahomed, A; Abuelhassan, W; Mahlangu, J; Vermeulen, M; Bowyer, S M

2016-03-01

Approximately 1 million South Africans are infected with Hepatitis C virus (HCV). The standard of care (SOC) in South Africa is combination therapy (pegylated interferon and ribavirin). HCV genotypes and/or mutations in the core/non-structural regions have been associated with response to therapy and/or disease progression. This study examines mutations in the core (29-280 amino acids, including ∼ 90 E1 amino acids) and NS5B (241-306 amino acids) regions on pre-treatment isolates from patients attending Johannesburg hospitals or asymptomatic South African blood donors. Diversity within known CD4+ and CD8+ T-cell epitopes was also explored. Samples grouped into subtypes 1a(N = 10) 1b(N = 12), 3a(N = 5), 4a(N = 3) and 5a(N = 61). Two mutations, associated with interferon resistance-R70Q and T110N-were present in 29 genotype 5a core sequences. No resistance mutation to NS5B nucleotide inhibitors, sofosbuvir was found. Six putative CD8+ and one CD4+ T-cell epitope sequence in the core region showed binding scores of <300 IC50nM to HLA alleles frequently observed in the South African population. No known CD8+ and CD4+ T-cell epitopes were mapped in the NS5B region. The analysis begs the question whether those infected with genotype 5a will benefit better on interferon-free combination therapies. This study provides new insight into one of the lesser studied HCV genotypes and compares the diversity seen in a large pre-treatment cohort with other subtypes. Copyright © 2015 Elsevier B.V. All rights reserved.

The Impact of Mutation and Gene Conversion on the Local Diversification of Antigen Genes in African Trypanosomes

PubMed Central

Gjini, Erida; Haydon, Daniel T.; Barry, J. David; Cobbold, Christina A.

2012-01-01

Patterns of genetic diversity in parasite antigen gene families hold important information about their potential to generate antigenic variation within and between hosts. The evolution of such gene families is typically driven by gene duplication, followed by point mutation and gene conversion. There is great interest in estimating the rates of these processes from molecular sequences for understanding the evolution of the pathogen and its significance for infection processes. In this study, a series of models are constructed to investigate hypotheses about the nucleotide diversity patterns between closely related gene sequences from the antigen gene archive of the African trypanosome, the protozoan parasite causative of human sleeping sickness in Equatorial Africa. We use a hidden Markov model approach to identify two scales of diversification: clustering of sequence mismatches, a putative indicator of gene conversion events with other lower-identity donor genes in the archive, and at a sparser scale, isolated mismatches, likely arising from independent point mutations. In addition to quantifying the respective probabilities of occurrence of these two processes, our approach yields estimates for the gene conversion tract length distribution and the average diversity contributed locally by conversion events. Model fitting is conducted using a Bayesian framework. We find that diversifying gene conversion events with lower-identity partners occur at least five times less frequently than point mutations on variant surface glycoprotein (VSG) pairs, and the average imported conversion tract is between 14 and 25 nucleotides long. However, because of the high diversity introduced by gene conversion, the two processes have almost equal impact on the per-nucleotide rate of sequence diversification between VSG subfamily members. We are able to disentangle the most likely locations of point mutations and conversions on each aligned gene pair. PMID:22735079

Transmission of HIV Drug Resistance and the Predicted Effect on Current First-line Regimens in Europe.

PubMed

Hofstra, L Marije; Sauvageot, Nicolas; Albert, Jan; Alexiev, Ivailo; Garcia, Federico; Struck, Daniel; Van de Vijver, David A M C; Åsjö, Birgitta; Beshkov, Danail; Coughlan, Suzie; Descamps, Diane; Griskevicius, Algirdas; Hamouda, Osamah; Horban, Andrzej; Van Kasteren, Marjo; Kolupajeva, Tatjana; Kostrikis, Leondios G; Liitsola, Kirsi; Linka, Marek; Mor, Orna; Nielsen, Claus; Otelea, Dan; Paraskevis, Dimitrios; Paredes, Roger; Poljak, Mario; Puchhammer-Stöckl, Elisabeth; Sönnerborg, Anders; Staneková, Danica; Stanojevic, Maja; Van Laethem, Kristel; Zazzi, Maurizio; Zidovec Lepej, Snjezana; Boucher, Charles A B; Schmit, Jean-Claude; Wensing, Annemarie M J; Puchhammer-Stockl, E; Sarcletti, M; Schmied, B; Geit, M; Balluch, G; Vandamme, A-M; Vercauteren, J; Derdelinckx, I; Sasse, A; Bogaert, M; Ceunen, H; De Roo, A; De Wit, S; Echahidi, F; Fransen, K; Goffard, J-C; Goubau, P; Goudeseune, E; Yombi, J-C; Lacor, P; Liesnard, C; Moutschen, M; Pierard, D; Rens, R; Schrooten, Y; Vaira, D; Vandekerckhove, L P R; Van den Heuvel, A; Van Der Gucht, B; Van Ranst, M; Van Wijngaerden, E; Vandercam, B; Vekemans, M; Verhofstede, C; Clumeck, N; Van Laethem, K; Beshkov, D; Alexiev, I; Lepej, S Zidovec; Begovac, J; Kostrikis, L; Demetriades, I; Kousiappa, I; Demetriou, V; Hezka, J; Linka, M; Maly, M; Machala, L; Nielsen, C; Jørgensen, L B; Gerstoft, J; Mathiesen, L; Pedersen, C; Nielsen, H; Laursen, A; Kvinesdal, B; Liitsola, K; Ristola, M; Suni, J; Sutinen, J; Descamps, D; Assoumou, L; Castor, G; Grude, M; Flandre, P; Storto, A; Hamouda, O; Kücherer, C; Berg, T; Braun, P; Poggensee, G; Däumer, M; Eberle, J; Heiken, H; Kaiser, R; Knechten, H; Korn, K; Müller, H; Neifer, S; Schmidt, B; Walter, H; Gunsenheimer-Bartmeyer, B; Harrer, T; Paraskevis, D; Hatzakis, A; Zavitsanou, A; Vassilakis, A; Lazanas, M; Chini, M; Lioni, A; Sakka, V; Kourkounti, S; Paparizos, V; Antoniadou, A; Papadopoulos, A; Poulakou, G; Katsarolis, I; Protopapas, K; Chryssos, G; Drimis, S; Gargalianos, P; Xylomenos, G; Lourida, G; Psichogiou, M; Daikos, G L; Sipsas, N V; Kontos, A; Gamaletsou, M N; Koratzanis, G; Sambatakou, H; Mariolis, H; Skoutelis, A; Papastamopoulos, V; Georgiou, O; Panagopoulos, P; Maltezos, E; Coughlan, S; De Gascun, C; Byrne, C; Duffy, M; Bergin, C; Reidy, D; Farrell, G; Lambert, J; O'Connor, E; Rochford, A; Low, J; Coakely, P; O'Dea, S; Hall, W; Mor, O; Levi, I; Chemtob, D; Grossman, Z; Zazzi, M; de Luca, A; Balotta, C; Riva, C; Mussini, C; Caramma, I; Capetti, A; Colombo, M C; Rossi, C; Prati, F; Tramuto, F; Vitale, F; Ciccozzi, M; Angarano, G; Rezza, G; Kolupajeva, T; Vasins, O; Griskevicius, A; Lipnickiene, V; Schmit, J C; Struck, D; Sauvageot, N; Hemmer, R; Arendt, V; Michaux, C; Staub, T; Sequin-Devaux, C; Wensing, A M J; Boucher, C A B; van de Vijver, D A M C; van Kessel, A; van Bentum, P H M; Brinkman, K; Connell, B J; van der Ende, M E; Hoepelman, I M; van Kasteren, M; Kuipers, M; Langebeek, N; Richter, C; Santegoets, R M W J; Schrijnders-Gudde, L; Schuurman, R; van de Ven, B J M; Åsjö, B; Kran, A-M Bakken; Ormaasen, V; Aavitsland, P; Horban, A; Stanczak, J J; Stanczak, G P; Firlag-Burkacka, E; Wiercinska-Drapalo, A; Jablonowska, E; Maolepsza, E; Leszczyszyn-Pynka, M; Szata, W; Camacho, R; Palma, C; Borges, F; Paixão, T; Duque, V; Araújo, F; Otelea, D; Paraschiv, S; Tudor, A M; Cernat, R; Chiriac, C; Dumitrescu, F; Prisecariu, L J; Stanojevic, M; Jevtovic, Dj; Salemovic, D; Stanekova, D; Habekova, M; Chabadová, Z; Drobkova, T; Bukovinova, P; Shunnar, A; Truska, P; Poljak, M; Lunar, M; Babic, D; Tomazic, J; Vidmar, L; Vovko, T; Karner, P; Garcia, F; Paredes, R; Monge, S; Moreno, S; Del Amo, J; Asensi, V; Sirvent, J L; de Mendoza, C; Delgado, R; Gutiérrez, F; Berenguer, J; Garcia-Bujalance, S; Stella, N; de Los Santos, I; Blanco, J R; Dalmau, D; Rivero, M; Segura, F; Elías, M J Pérez; Alvarez, M; Chueca, N; Rodríguez-Martín, C; Vidal, C; Palomares, J C; Viciana, I; Viciana, P; Cordoba, J; Aguilera, A; Domingo, P; Galindo, M J; Miralles, C; Del Pozo, M A; Ribera, E; Iribarren, J A; Ruiz, L; de la Torre, J; Vidal, F; Clotet, B; Albert, J; Heidarian, A; Aperia-Peipke, K; Axelsson, M; Mild, M; Karlsson, A; Sönnerborg, A; Thalme, A; Navér, L; Bratt, G; Karlsson, A; Blaxhult, A; Gisslén, M; Svennerholm, B; Bergbrant, I; Björkman, P; Säll, C; Mellgren, Å; Lindholm, A; Kuylenstierna, N; Montelius, R; Azimi, F; Johansson, B; Carlsson, M; Johansson, E; Ljungberg, B; Ekvall, H; Strand, A; Mäkitalo, S; Öberg, S; Holmblad, P; Höfer, M; Holmberg, H; Josefson, P; Ryding, U

2016-03-01

Numerous studies have shown that baseline drug resistance patterns may influence the outcome of antiretroviral therapy. Therefore, guidelines recommend drug resistance testing to guide the choice of initial regimen. In addition to optimizing individual patient management, these baseline resistance data enable transmitted drug resistance (TDR) to be surveyed for public health purposes. The SPREAD program systematically collects data to gain insight into TDR occurring in Europe since 2001. Demographic, clinical, and virological data from 4140 antiretroviral-naive human immunodeficiency virus (HIV)-infected individuals from 26 countries who were newly diagnosed between 2008 and 2010 were analyzed. Evidence of TDR was defined using the WHO list for surveillance of drug resistance mutations. Prevalence of TDR was assessed over time by comparing the results to SPREAD data from 2002 to 2007. Baseline susceptibility to antiretroviral drugs was predicted using the Stanford HIVdb program version 7.0. The overall prevalence of TDR did not change significantly over time and was 8.3% (95% confidence interval, 7.2%-9.5%) in 2008-2010. The most frequent indicators of TDR were nucleoside reverse transcriptase inhibitor (NRTI) mutations (4.5%), followed by nonnucleoside reverse transcriptase inhibitor (NNRTI) mutations (2.9%) and protease inhibitor mutations (2.0%). Baseline mutations were most predictive of reduced susceptibility to initial NNRTI-based regimens: 4.5% and 6.5% of patient isolates were predicted to have resistance to regimens containing efavirenz or rilpivirine, respectively, independent of current NRTI backbones. Although TDR was highest for NRTIs, the impact of baseline drug resistance patterns on susceptibility was largest for NNRTIs. The prevalence of TDR assessed by epidemiological surveys does not clearly indicate to what degree susceptibility to different drug classes is affected. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America.

Evolutionary History of the Plant Pathogenic Bacterium Xanthomonas axonopodis

PubMed Central

Mhedbi-Hajri, Nadia; Hajri, Ahmed; Boureau, Tristan; Darrasse, Armelle; Durand, Karine; Brin, Chrystelle; Saux, Marion Fischer-Le; Manceau, Charles; Poussier, Stéphane; Pruvost, Olivier

2013-01-01

Deciphering mechanisms shaping bacterial diversity should help to build tools to predict the emergence of infectious diseases. Xanthomonads are plant pathogenic bacteria found worldwide. Xanthomonas axonopodis is a genetically heterogeneous species clustering, into six groups, strains that are collectively pathogenic on a large number of plants. However, each strain displays a narrow host range. We address the question of the nature of the evolutionary processes – geographical and ecological speciation – that shaped this diversity. We assembled a large collection of X. axonopodis strains that were isolated over a long period, over continents, and from various hosts. Based on the sequence analysis of seven housekeeping genes, we found that recombination occurred as frequently as point mutation in the evolutionary history of X. axonopodis. However, the impact of recombination was about three times greater than the impact of mutation on the diversity observed in the whole dataset. We then reconstructed the clonal genealogy of the strains using coalescent and genealogy approaches and we studied the diversification of the pathogen using a model of divergence with migration. The suggested scenario involves a first step of generalist diversification that spanned over the last 25 000 years. A second step of ecology-driven specialization occurred during the past two centuries. Eventually, secondary contacts between host-specialized strains probably occurred as a result of agricultural development and intensification, allowing genetic exchanges of virulence-associated genes. These transfers may have favored the emergence of novel pathotypes. Finally, we argue that the largest ecological entity within X. axonopodis is the pathovar. PMID:23505513

[Chronologic analysis of clonal evolution in acquired aplastic anemia and sMDS].

PubMed

Yoshizato, Tetsuichi

2016-04-01

Acquired aplastic anemia (AA) is a prototype of idiopathic bone marrow failure, which is caused by immune-mediated destruction of hematopoietic progenitors but is also characterized by frequent evolution to clonal myeloid disorders, such as myelodysplastic syndromes or acute myeloid leukemia. However, the chronological behavior of the clonality and its link to myelodysplastic syndrome or acute myeloid leukemia has not been fully explored. To define the clonality and its chronological behavior in AA, we performed targeted sequencing (N=439) in cases with AA. Somatic mutations were detected in 1/3 of our cases. Mutations were most frequently found in DNMT3A, followed by BCOR, PIGA and ASXL1. The prevalence of mutations increased with age. The clone sizes in DNMT3A and ASXL1 were prone to increase, whereas those of BCOR and PIGA were more likely to decrease or remain stable. Mutations in PIGA, BCOR and BCORL1 correlated with a better response to immunosuppressive therapy and more favorable survival. On the other hand, other mutations were associated with worse outcomes. The chronological dynamics of clonality showed marked variability and were not necessarily associated with prognosis.

Novel and recurrent non-truncating mutations of the MITF basic domain: genotypic and phenotypic variations in Waardenburg and Tietz syndromes

PubMed Central

Léger, Sandy; Balguerie, Xavier; Goldenberg, Alice; Drouin-Garraud, Valérie; Cabot, Annick; Amstutz-Montadert, Isabelle; Young, Paul; Joly, Pascal; Bodereau, Virginie; Holder-Espinasse, Muriel; Jamieson, Robyn V; Krause, Amanda; Chen, Hongsheng; Baumann, Clarisse; Nunes, Luis; Dollfus, Hélène; Goossens, Michel; Pingault, Véronique

2012-01-01

The microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor, which regulates melanocyte development and the biosynthetic melanin pathway. A notable relationship has been described between non-truncating mutations of its basic domain and Tietz syndrome, which is characterized by albinoid-like hypopigmentation of the skin and hair, rather than the patchy depigmentation seen in Waardenburg syndrome, and severe hearing loss. Twelve patients with new or recurrent non-truncating mutations of the MITF basic domain from six families were enrolled in this study. We observed a wide range of phenotypes and some unexpected features. All the patients had blue irides and pigmentation abnormalities that ranged from diffuse hypopigmentation to Waardenburg-like patches. In addition, they showed congenital complete hearing loss, diffuse hypopigmentation of the skin, freckling and ocular abnormalities, more frequently than patients with MITF mutations outside the basic domain. In conclusion, the non-truncating mutations of the basic domain do not always lead to Tietz syndrome but rather to a large range of phenotypes. Sun-exposed freckles are interestingly observed more frequently in Asian populations. This variability argues for the possible interaction with modifier loci. PMID:22258527

[RIT1: a novel gene associated with Noonan syndrome].

PubMed

Arroyo-Carrera, I; Solo de Zaldivar-Tristancho, M; Martin-Fernandez, R; Vera-Torres, M; Gonzalez de Buitrago-Amigo, J F; Botet-Rodriguez, J

2016-10-16

Noonan syndrome is the most frequent of the congenital group of malformation syndromes caused by germline mutations that encode components of the RAS/MAPK pathway, termed RASopathies, one of the most frequent congenital genetic disorders in the clinical practice. Recently RIT1 mutations have been reported in patients with Noonan syndrome. A 7 years-old girl with a clinical diagnosis of Noonan syndrome, and with a hypertrophic cardiomyopathy included in her clinical manifestations, where a de novo heterozygous, probably pathogenic, novel mutation in RIT1, c.295T>C (p.Phe99Leu), has been identified. RIT1 shares homology with other RAS proteins and the expression of mutant alleles demonstrates a gain-of-function effect supporting a causative role in Noonan syndrome pathogenesis. Data suggest that the frequency of RIT1 mutations can be estimated as 3-5% in Noonan syndrome patients. These cases compared with Noonan patients harboring mutations in other genes are characterized by high frequency of prenatal abnormalities and hypertrophic cardiomyopathy, and lower frequencies of short stature and pectus abnormalities. We emphasize the importance of the novel identified genes in order to be included in the diagnostic panels.

Respiratory and sleep disorders in female children with atypical Rett syndrome caused by mutations in the CDKL5 gene.

PubMed

Hagebeuk, Eveline E O; van den Bossche, Renilde A S; de Weerd, Al W

2013-05-01

In female children with drug-resistant seizures and developmental delay from birth, atypical Rett syndrome caused by mutations in the CDKL5 gene should be considered. Several clinical features resemble classic Rett syndrome. Respiratory and sleep abnormalities are frequently present in Rett syndrome, whereas little is known in patients with CDKL5 mutations. In four genetically confirmed female patients with CDKL5 mutations (age range 2-15 y), the presence of breathing and sleep abnormalities was evaluated using the validated Sleep Disturbance Scale for Children and polysomnography (PSG). The Sleep Disturbance Scale for Children indicated disorders of initiating and maintaining sleep, daytime somnolence, and sleep breathing disorders. In one patient, PSG showed central apnoeas during sleep: her total apnoea-hypopnoea index (AHI) was 4.9, of which the central AHI was 3.4/h. When awake, central apnoeas were present in two of the four female children (central AHI 28/h and 41/h respectively), all preceded by hyperventilation. PSG showed low rapid eye movement (REM) sleep (9.7-18.3%), frequent awakenings, and low sleep efficiency (range 59-78%). Episodic hyperventilation followed by central apnoeas was present while awake in two of four patients. This may indicate failure of brainstem respiratory centres. In addition, low REM sleep, frequent arousals (not caused by apnoeas/seizures), and low sleep efficiency were present. Similar to Rett syndrome, in patients with CDKL5 mutations PSG seems warranted to evaluate breathing and sleep disturbances. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

Mutations in fibroblast growth-factor receptor 3 in sporadic cases of achondroplasia occur exclusively on the paternally derived chromosome.

PubMed Central

Wilkin, D J; Szabo, J K; Cameron, R; Henderson, S; Bellus, G A; Mack, M L; Kaitila, I; Loughlin, J; Munnich, A; Sykes, B; Bonaventure, J; Francomano, C A

1998-01-01

More than 97% of achondroplasia cases are caused by one of two mutations (G1138A and G1138C) in the fibroblast growth factor receptor 3 (FGFR3) gene, which results in a specific amino acid substitution, G380R. Sporadic cases of achondroplasia have been associated with advanced paternal age, suggesting that these mutations occur preferentially during spermatogenesis. We have determined the parental origin of the achondroplasia mutation in 40 sporadic cases. Three distinct 1-bp polymorphisms were identified in the FGFR3 gene, within close proximity to the achondroplasia mutation site. Ninety-nine families, each with a sporadic case of achondroplasia in a child, were analyzed in this study. In this population, the achondroplasia mutation occurred on the paternal chromosome in all 40 cases in which parental origin was unambiguous. This observation is consistent with the clinical observation of advanced paternal age resulting in new cases of achondroplasia and suggests that factors influencing DNA replication or repair during spermatogenesis, but not during oogenesis, may predispose to the occurrence of the G1138 FGFR3 mutations. PMID:9718331

Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern

PubMed Central

Hafner, Christian; López-Knowles, Elena; Luis, Nuno M.; Toll, Agustí; Baselga, Eulàlia; Fernández-Casado, Alex; Hernández, Silvia; Ribé, Adriana; Mentzel, Thomas; Stoehr, Robert; Hofstaedter, Ferdinand; Landthaler, Michael; Vogt, Thomas; Pujol, Ramòn M.; Hartmann, Arndt; Real, Francisco X.

2007-01-01

Activating mutations of the p110 α subunit of PI3K (PIK3CA) oncogene have been identified in a broad spectrum of malignant tumors. However, their role in benign or preneoplastic conditions is unknown. Activating FGF receptor 3 (FGFR3) mutations are common in benign skin lesions, either as embryonic mutations in epidermal nevi (EN) or as somatic mutations in seborrheic keratoses (SK). FGFR3 mutations are also common in low-grade malignant bladder tumors, where they often occur in association with PIK3CA mutations. Therefore, we examined exons 9 and 20 of PIK3CA and FGFR3 hotspot mutations in EN (n = 33) and SK (n = 62), two proliferative skin lesions lacking malignant potential. Nine of 33 (27%) EN harbored PIK3CA mutations; all cases showed the E545G substitution, which is uncommon in cancers. In EN, R248C was the only FGFR3 mutation identified. By contrast, 10 of 62 (16%) SK revealed the typical cancer-associated PIK3CA mutations E542K, E545K, and H1047R. The same lesions displayed a wide range of FGFR3 mutations. Corresponding unaffected tissue was available for four EN and two mutant SK: all control samples displayed a WT sequence, confirming the somatic nature of the mutations found in lesional tissue. Forty of 95 (42%) lesions showed at least one mutation in either gene. PIK3CA and FGFR3 mutations displayed an independent distribution; 5/95 lesions harbored mutations in both genes. Our findings suggest that, in addition to their role in cancer, oncogenic PIK3CA mutations contribute to the pathogenesis of skin tumors lacking malignant potential. The remarkable genotype–phenotype correlation as observed in this study points to a distinct etiopathogenesis of the mutations in keratinocytes occuring either during fetal development or in adult life. PMID:17673550

Disease-associated mitochondrial mutations and the evolution of primate mitogenomes

PubMed Central

Tavares, William Corrêa

2017-01-01

Several human diseases have been associated with mutations in mitochondrial genes comprising a set of confirmed and reported mutations according to the MITOMAP database. An analysis of complete mitogenomes across 139 primate species showed that most confirmed disease-associated mutations occurred in aligned codon positions and gene regions under strong purifying selection resulting in a strong evolutionary conservation. Only two confirmed variants (7.1%), coding for the same amino acids accounting for severe human diseases, were identified without apparent pathogenicity in non-human primates, like the closely related Bornean orangutan. Conversely, reported disease-associated mutations were not especially concentrated in conserved codon positions, and a large fraction of them occurred in highly variable ones. Additionally, 88 (45.8%) of reported mutations showed similar variants in several non-human primates and some of them have been present in extinct species of the genus Homo. Considering that recurrent mutations leading to persistent variants throughout the evolutionary diversification of primates are less likely to be severely damaging to fitness, we suggest that these 88 mutations are less likely to be pathogenic. Conversely, 69 (35.9%) of reported disease-associated mutations occurred in extremely conserved aligned codon positions which makes them more likely to damage the primate mitochondrial physiology. PMID:28510580

Somatic mutation of EZH2 (Y641) in follicular and diffuse large B-cell lymphomas of germinal center origin | Office of Cancer Genomics

Cancer.gov

Morin et al. describe recurrent somatic mutations in EZH2, a polycomb group oncogene. The mutation, found in the SET domain of this gene encoding a histone methyltransferase, is found only in a subset of lymphoma samples. Specifically, EZH2 mutations are found in about 12% of follicular lymphomas (FL) and almost 23% of diffuse large B-cell lymphomas (DLBCL) of germinal center origin. This paper goes on to demonstrate that altered EZH2 proteins, corresponding to the most frequent mutations found in human lymphomas, have reduced activity using in vitro histone methylation assays.

University of Texas MD Anderson Cancer Center: Characterization of PIK3R1 Neomorphic Mutations | Office of Cancer Genomics

Cancer.gov

The goal of this project was to functionally characterize the most frequent mutation of the PIK3R1 gene and to explore potential therapeutic approaches to target the aberration. Read the abstract Experimental Approaches Cytotoxicity Screen

University of Texas MD Anderson Cancer Center (UT-MDACC): Characterization of PIK3R1 Neomorphic Mutations | Office of Cancer Genomics

Cancer.gov

The goal of this project was to functionally characterize the most frequent mutation of the PIK3R1 gene and to explore potential therapeutic approaches to target the aberration. Read the abstract Experimental Approaches Cytotoxicity Screen

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

The Gene of the Ubiquitin-Specific Protease 8 Is Frequently Mutated in Adenomas Causing Cushing's Disease

PubMed Central

Perez-Rivas, Luis G.; Theodoropoulou, Marily; Ferraù, Francesco; Nusser, Clara; Kawaguchi, Kohei; Stratakis, Constantine A.; Faucz, Fabio Rueda; Wildemberg, Luiz E.; Assié, Guillaume; Beschorner, Rudi; Dimopoulou, Christina; Buchfelder, Michael; Popovic, Vera; Berr, Christina M.; Tóth, Miklós; Ardisasmita, Arif Ibrahim; Honegger, Jürgen; Bertherat, Jerôme; Gadelha, Monica R.; Beuschlein, Felix; Stalla, Günter; Komada, Masayuki; Korbonits, Márta

2015-01-01

Context: We have recently reported somatic mutations in the ubiquitin-specific protease USP8 gene in a small series of adenomas of patients with Cushing's disease. Objective: To determine the prevalence of USP8 mutations and the genotype-phenotype correlation in a large series of patients diagnosed with Cushing's disease. Design: We performed a retrospective, multicentric, genetic analysis of 134 functioning and 11 silent corticotroph adenomas using Sanger sequencing. Biochemical and clinical features were collected and examined within the context of the mutational status of USP8, and new mutations were characterized by functional studies. Patients: A total of 145 patients who underwent surgery for an ACTH-producing pituitary adenoma. Main Outcomes Measures: Mutational status of USP8. Biochemical and clinical features included sex, age at diagnosis, tumor size, preoperative and postoperative hormonal levels, and comorbidities. Results: We found somatic mutations in USP8 in 48 (36%) pituitary adenomas from patients with Cushing's disease but in none of 11 silent corticotropinomas. The prevalence was higher in adults than in pediatric cases (41 vs 17%) and in females than in males (43 vs 17%). Adults having USP8-mutated adenomas were diagnosed at an earlier age than those with wild-type lesions (36 vs 44 y). Mutations were primarily found in adenomas of 10 ± 7 mm and were inversely associated with the development of postoperative adrenal insufficiency. All the mutations affected the residues Ser718 or Pro720, including five new identified alterations. Mutations reduced the interaction between USP8 and 14-3-3 and enhanced USP8 activity. USP8 mutants diminished epidermal growth factor receptor ubiquitination and induced Pomc promoter activity in immortalized AtT-20 corticotropinoma cells. Conclusions: USP8 is frequently mutated in adenomas causing Cushing's disease, especially in those from female adult patients diagnosed at a younger age. PMID:25942478

Mechanisms of resistance to irreversible epidermal growth factor receptor tyrosine kinase inhibitors and therapeutic strategies in non-small cell lung cancer

PubMed Central

Xu, Jing; Wang, Jinghui; Zhang, Shucai

2017-01-01

Epidermal growth factor receptor (EGFR) T790M mutation is the most frequent mechanism which accounts for about 60% of acquired resistance to first-generation EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC) patients harboring EGFR activating mutations. Irreversible EGFR-TKIs which include the second-generation and third-generation EGFR-TKIs are developed to overcome T790M mediated resistance. The second-generation EGFR-TKIs inhibit the wide type (WT) EGFR combined with dose-limiting toxicity which limits its application in clinics, while the development of third-generation EGFR-TKIs brings inspiring efficacy either in vitro or in vivo. The acquired resistance, however, will also occur and limit their response. Understanding the mechanisms of resistance to irreversible EGFR-TKIs plays an important role in the choice of subsequent treatment. In this review, we show the currently known mechanisms of resistance which can be summarized as EGFR dependent and independent mechanisms and potential therapeutic strategies to irreversible EGFR-TKIs. PMID:29163853

BTKbase, mutation database for X-linked agammaglobulinemia (XLA).

PubMed Central

Vihinen, M; Brandau, O; Brandén, L J; Kwan, S P; Lappalainen, I; Lester, T; Noordzij, J G; Ochs, H D; Ollila, J; Pienaar, S M; Riikonen, P; Saha, B K; Smith, C I

1998-01-01

X-linked agammaglobulinemia (XLA) is an immunodeficiency caused by mutations in the gene coding for Bruton's agammaglobulinemia tyrosine kinase (BTK). A database (BTKbase) of BTK mutations has been compiled and the recent update lists 463 mutation entries from 406 unrelated families showing 303 unique molecular events. In addition to mutations, the database also lists variants or polymorphisms. Each patient is given a unique patient identity number (PIN). Information is included regarding the phenotype including symptoms. Mutations in all the five domains of BTK have been noticed to cause the disease, the most common event being missense mutations. The mutations appear almost uniformly throughout the molecule and frequently affect CpG sites that code for arginine residues. The putative structural implications of all the missense mutations are given in the database. The improved version of the registry having a number of new features is available at http://www. helsinki.fi/science/signal/btkbase.html PMID:9399844

[The prevalence and clinical significance of precore and core promoter mutations in Korean patients with chronic hepatitis B virus infection].

PubMed

Kim, Hyung Joon; Yoo, Byung Chul

2002-06-01

Precore and core promoter mutations of hepatitis B virus (HBV) have been reported in Korea but their prevalence and clinical significance have not been determined. The aims of this study were to determine the prevalence of precore and core promoter mutations and their relationships to hepatitis B e antigen (HBeAg) status, viral replication level, and severity of liver disease in Korea. Among the patients who visited the Liver Diseases Clinics (Chung Ang University Hospital) between December 1998 and August 1999, 150 patients were randomly selected: 50 HBeAg-positive HBV-DNA positive patients by a branched DNA (bDNA) assay, 50 HBeAg-negative bDNA-positive patients, and 50 HBeAg-negative bDNA-negative patients. Serum HBV-DNA was amplified by a polymerase chain reaction (PCR) in these patients and the core promoter/precore HBV sequence was determined in 135 of the patients whose sera were positive for HBV-DNA by PCR. All of the 135 determined HBV-DNA sequences had HBV genotype with T at nucleotide 1858. Precore mutation (A1896) was detected in 95.7% of HBeAg-negative bDNA-positive patients and 94.9% of HBeAg-negative bDNA-negative patients. In HBeAg-positive patients 88% had wild type and 12% had mixture of wild type and A1896 mutant. Core promoter TA mutation (T1762/A1764) was detected in 93.5% of HBeAg-negative bDNA-positive patients, 94.9% of HBeAg-negative bDNA-negative patients and 74% of HBeAg-positive patients. No correlation was found between the presence of precore/core promoter mutations and liver disease severity or HBV-DNA levels. Precore stop codon mutation occurred almost invariably, along with HBeAg seroconversion, irrespective of subsequent viral replication levels or disease severity. Core promoter TA mutation was frequent both in the HBeAg-positive patients and HBeAg-negative patients irrespective of viral replication levels or disease severity.

Somatic diversification of chicken immunoglobulin light chains by point mutations.

PubMed

Parvari, R; Ziv, E; Lantner, F; Heller, D; Schechter, I

1990-04-01

The light-chain locus of chicken has 1 functional V lambda 1 gene, 1 J gene, and 25 pseudo-V lambda-genes (where V = variable and J = joining). A major problem is which somatic mechanisms expand this extremely limited germ-line information to generate many different antibodies. Weill's group [Reynaud, C. A., Anquez, V., Grimal, H. & Weill, J. C. (1987) Cell 48, 379-388] has shown that the pseudo-V lambda-genes diversify the rearranged V lambda 1 by gene conversion. Here we demonstrate that chicken light chains are further diversified by somatic point mutations and by V lambda 1-J flexible joining. Somatic point mutations were identified in the J and 3' noncoding DNA of rearranged light-chain genes of chicken. These regions were analyzed because point mutations in V lambda 1 are obscured by gene conversion; the J and 3' noncoding DNA are presented in one copy per haploid genome and are not subject to gene conversion. In rodents point mutations occur as frequently in the V-J coding regions as in the adjacent flanking DNA. Therefore, we conclude that somatic point mutations diversify the V lambda 1 of chicken. The frequency (0-1%) and distribution of the mutations (decreasing in number with increased distance from the V lambda 1 segment) in chicken were as observed in rodents. Sequence variability at the V lambda 1-J junctions could be attributed to imprecise joining of the V lambda 1 and J genes. The modification by gene conversion of rearranged V lambda 1 genes in the bursa was similar in chicken aged 3 months (9.5%) or 3 weeks (9.1%)--i.e., gene conversion that generates the preimmune repertoire in the bursa seems to level off around 3 weeks of age. This preimmune repertoire can be further diversified by somatic point mutations that presumably lead to the formation of antibodies with increased affinity. A segment with structural features of a matrix association region [(A + T)-rich and four topoisomerase II binding sites] was identified in the middle of the J-C lambda intron (where C = constant).

SHP-2 acts via ROCK to regulate the cardiac actin cytoskeleton

PubMed Central

Langdon, Yvette; Tandon, Panna; Paden, Erika; Duddy, Jennifer; Taylor, Joan M.; Conlon, Frank L.

2012-01-01

Noonan syndrome is one of the most common causes of human congenital heart disease and is frequently associated with missense mutations in the protein phosphatase SHP-2. Interestingly, patients with acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), juvenile myelomonocytic leukemia (JMML) and LEOPARD syndrome frequently carry a second, somatically introduced subset of missense mutations in SHP-2. To determine the cellular and molecular mechanisms by which SHP-2 regulates heart development and, thus, understand how Noonan-associated mutations affect cardiogenesis, we introduced SHP-2 encoding the most prevalent Noonan syndrome and JMML mutations into Xenopus embryos. Resulting embryos show a direct relationship between a Noonan SHP-2 mutation and its ability to cause cardiac defects in Xenopus; embryos expressing Noonan SHP-2 mutations exhibit morphologically abnormal hearts, whereas those expressing an SHP-2 JMML-associated mutation do not. Our studies indicate that the cardiac defects associated with the introduction of the Noonan-associated SHP-2 mutations are coupled with a delay or arrest of the cardiac cell cycle in M-phase and a failure of cardiomyocyte progenitors to incorporate into the developing heart. We show that these defects are a result of an underlying malformation in the formation and polarity of cardiac actin fibers and F-actin deposition. We show that these defects can be rescued in culture and in embryos through the inhibition of the Rho-associated, coiled-coil-containing protein kinase 1 (ROCK), thus demonstrating a direct relationship between SHP-2N308D and ROCK activation in the developing heart. PMID:22278918

The three stages of epilepsy in patients with CDKL5 mutations.

PubMed

Bahi-Buisson, Nadia; Kaminska, Anna; Boddaert, Nathalie; Rio, Marlène; Afenjar, Alexandra; Gérard, Marion; Giuliano, Fabienne; Motte, Jacques; Héron, Delphine; Morel, Marie Ange N'guyen; Plouin, Perrine; Richelme, Christian; des Portes, Vincent; Dulac, Olivier; Philippe, Christophe; Chiron, Catherine; Nabbout, Rima; Bienvenu, Thierry

2008-06-01

Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene are responsible for a severe encephalopathy with early epilepsy. So far, the electroclinical phenotype remains largely unknown and no clear genotype-phenotype correlations have been established. To characterize the epilepsy associated with CDKL5 mutations and to look for a relationship between the genotype and the course of epilepsy. We retrospectively analyzed the electroclinical phenotypes of 12 patients aged from 2.5 to 19 years diagnosed with pathogenic CDKL5 mutations and one patient with a novel intronic sequence variation of uncertain pathogenicity and examined whether the severity of the epilepsy was linked to the type and location of mutations. The epilepsy course reveals three successive stages: (Stage I) early epilepsy (onset 1-10 weeks) with normal interictal electroencephalogram (EEG) (10/13) despite frequent convulsive seizures; (Stage II) epileptic encephalopathy with infantile spasms (8/8) and hypsarrhythmia (8/8). At the age of evaluation, seven patients were seizure free and six had developed refractory epilepsy (stage III) with tonic seizures and myoclonia (5/6). Interestingly, the patients carrying a CDKL5 mutations causing a truncation of the catalytic domain tended to develop a more frequent refractory epilepsy than patients with mutations located downstream (4/6, 66.6% versus 1/6, 16%) although, these trends are not yet significant. Our data contribute to a better definition of the epileptic phenotype in CDKL5 mutations, and might give some clues to a potential relationship between the phenotype and the genotype in these patients.

Epidermal growth factor receptor gene mutation defines distinct subsets among small adenocarcinomas of the lung.

PubMed

Haneda, Hiroshi; Sasaki, Hidefumi; Shimizu, Shigeki; Endo, Katsuhiko; Suzuki, Eriko; Yukiue, Haruhiro; Kobayashi, Yoshihiro; Yano, Motoki; Fujii, Yoshitaka

2006-04-01

Epidermal growth factor receptor (EGFR) gene mutations are frequently detected in lung cancer, especially in adenocarcinoma, in females, and non-smoking patients. EGFR mutations are closely associated with clinical response to EGFR tyrosine kinase inhibitor. Bronchioloalveolar carcinoma (BAC) appearance is a good predictor of response to this agent. Noguchi et al. subdivided small peripheral adenocarcinoma of the lung into two groups. One group was characterized with tumor cell growth replacing the normal alveolar cells with varying degree of fibrosis (types A-C), and the other shows non-replacing and destructive growth (types D-F). Using probes for the 13 mutations which have been previously described, we have genotyped the EGFR gene status in surgically resected atypical adenomatous hyperplasias (AAH) and small peripheral adenocarcinomas up to 2 cm in diameter using TaqMan PCR assay. In 95 small-sized adenocarcinomas, the EGFR mutations were detected in 37 patients (38.9%), and no mutations were found in five AAHs. In small peripheral adenocarcinomas, EGFR mutations were found 47.1% of types A, B, or C adenocarcinomas; it was less frequent (16%) in Noguchi's types D, E or F adenocarcinomas. These results suggest that type D, F adenocarcinomas are not derived from the less malignant types A-C adenocarcinomas; rather, they have arisen de novo by distinct mechanisms. Although types A and B adenocarcinomas are almost 100% cured by surgery, some type C adenocarcinoma show lymph node metastasis and relapse. EGFR mutation analysis may help identify patients who will respond to treatment with tyrosine kinase inhibitors, e.g., gefitinib.

SHP-2 acts via ROCK to regulate the cardiac actin cytoskeleton.

PubMed

Langdon, Yvette; Tandon, Panna; Paden, Erika; Duddy, Jennifer; Taylor, Joan M; Conlon, Frank L

2012-03-01

Noonan syndrome is one of the most common causes of human congenital heart disease and is frequently associated with missense mutations in the protein phosphatase SHP-2. Interestingly, patients with acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), juvenile myelomonocytic leukemia (JMML) and LEOPARD syndrome frequently carry a second, somatically introduced subset of missense mutations in SHP-2. To determine the cellular and molecular mechanisms by which SHP-2 regulates heart development and, thus, understand how Noonan-associated mutations affect cardiogenesis, we introduced SHP-2 encoding the most prevalent Noonan syndrome and JMML mutations into Xenopus embryos. Resulting embryos show a direct relationship between a Noonan SHP-2 mutation and its ability to cause cardiac defects in Xenopus; embryos expressing Noonan SHP-2 mutations exhibit morphologically abnormal hearts, whereas those expressing an SHP-2 JMML-associated mutation do not. Our studies indicate that the cardiac defects associated with the introduction of the Noonan-associated SHP-2 mutations are coupled with a delay or arrest of the cardiac cell cycle in M-phase and a failure of cardiomyocyte progenitors to incorporate into the developing heart. We show that these defects are a result of an underlying malformation in the formation and polarity of cardiac actin fibers and F-actin deposition. We show that these defects can be rescued in culture and in embryos through the inhibition of the Rho-associated, coiled-coil-containing protein kinase 1 (ROCK), thus demonstrating a direct relationship between SHP-2(N308D) and ROCK activation in the developing heart.

Meier–Gorlin syndrome genotype–phenotype studies: 35 individuals with pre-replication complex gene mutations and 10 without molecular diagnosis

PubMed Central

de Munnik, Sonja A; Bicknell, Louise S; Aftimos, Salim; Al-Aama, Jumana Y; van Bever, Yolande; Bober, Michael B; Clayton-Smith, Jill; Edrees, Alaa Y; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M; Hennekam, Raoul C; Jansweijer, Maaike C E; Johnson, Diana; Kant, Sarina G; Opitz, John M; Ramadevi, A Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T R M; Schoots, Jeroen; Temple, I Karen; Terhal, Paulien A; Toutain, Annick; Wise, Carol A; Wright, Michael; Skidmore, David L; Samuels, Mark E; Hoefsloot, Lies H; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

2012-01-01

Meier–Gorlin syndrome (MGS) is an autosomal recessive disorder characterized by microtia, patellar aplasia/hypoplasia, and short stature. Recently, mutations in five genes from the pre-replication complex (ORC1, ORC4, ORC6, CDT1, and CDC6), crucial in cell-cycle progression and growth, were identified in individuals with MGS. Here, we report on genotype–phenotype studies in 45 individuals with MGS (27 females, 18 males; age 3 months–47 years). Thirty-five individuals had biallelic mutations in one of the five causative pre-replication genes. No homozygous or compound heterozygous null mutations were detected. In 10 individuals, no definitive molecular diagnosis was made. The triad of microtia, absent/hypoplastic patellae, and short stature was observed in 82% of individuals with MGS. Additional frequent clinical features were mammary hypoplasia (100%) and abnormal genitalia (42% predominantly cryptorchidism and hypoplastic labia minora/majora). One individual with ORC1 mutations only had short stature, emphasizing the highly variable clinical spectrum of MGS. Individuals with ORC1 mutations had significantly shorter stature and smaller head circumferences than individuals from other gene categories. Furthermore, compared with homozygous missense mutations, compound heterozygous mutations appeared to have a more severe effect on phenotype, causing more severe growth retardation in ORC4 and more frequently pulmonary emphysema in CDT1. A lethal phenotype was seen in four individuals with compound heterozygous ORC1 and CDT1 mutations. No other clear genotype–phenotype association was observed. Growth hormone and estrogen treatment may be of some benefit, respectively, to growth retardation and breast hypoplasia, though further studies in this patient group are needed. PMID:22333897

Frequent Association between Alteration of the rdxA Gene and Metronidazole Resistance in French and North African Isolates of Helicobacter pylori

PubMed Central

Tankovic, Jacques; Lamarque, Dominique; Delchier, Jean-Charles; Soussy, Claude-James; Labigne, Agnes; Jenks, Peter J.

2000-01-01

Mutations in the rdxA gene have been associated with the acquisition of resistance to metronidazole in Helicobacter pylori. This gene encodes an NADPH nitroreductase whose expression is necessary for intracellular activation of the drug. We wished to examine whether mutations in rdxA were present in resistant H. pylori isolates infecting either French or North African patients. We determined the complete nucleotide sequences of the rdxA genes from seven French and six North African patients infected with paired resistant and sensitive strains. Genotyping by random amplified polymorphic DNA analysis confirmed the close genetic relatedness of the susceptible and resistant isolates from individual biopsies. Eight French and five North African individual resistant strains were also studied. For the French strains, an alteration in rdxA most probably implicated in resistance was found in 10 cases (seven frameshift mutations, two missense mutations, and one deletion of 211 bp). One to three putative missense mutations were identified in four cases, and a missense mutation possibly not implicated in resistance was discovered in the last case. For the North African strains, an alteration in rdxA was found in eight cases (three frameshift mutations, three missense mutations, one deletion of 6 bp, and one insertion of a variant of IS605). Two strains contained putative missense mutations, and no change was observed in rdxA of the last strain. Thus, inactivation of the rdxA gene is frequently, but not always, associated with resistance to metronidazole in French and North African clinical isolates of H. pylori. In addition, a variety of alterations of rdxA are associated with the resistant phenotype. PMID:10681326

PIK3CA mutations, phosphatase and tensin homolog, human epidermal growth factor receptor 2, and insulin-like growth factor 1 receptor and adjuvant tamoxifen resistance in postmenopausal breast cancer patients.

PubMed

Beelen, Karin; Opdam, Mark; Severson, Tesa M; Koornstra, Rutger H T; Vincent, Andrew D; Wesseling, Jelle; Muris, Jettie J; Berns, Els M J J; Vermorken, Jan B; van Diest, Paul J; Linn, Sabine C

2014-01-27

Inhibitors of the phosphatidylinositol-3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) pathway can overcome endocrine resistance in estrogen receptor (ER) α-positive breast cancer, but companion diagnostics indicating PI3K/AKT/mTOR activation and consequently endocrine resistance are lacking. PIK3CA mutations frequently occur in ERα-positive breast cancer and result in PI3K/AKT/mTOR activation in vitro. Nevertheless, the prognostic and treatment-predictive value of these mutations in ERα-positive breast cancer is contradictive. We tested the clinical validity of PIK3CA mutations and other canonic pathway drivers to predict intrinsic resistance to adjuvant tamoxifen. In addition, we tested the association between these drivers and downstream activated proteins. Primary tumors from 563 ERα-positive postmenopausal patients, randomized between adjuvant tamoxifen (1 to 3 years) versus observation were recollected. PIK3CA hotspot mutations in exon 9 and exon 20 were assessed with Sequenom Mass Spectometry. Immunohistochemistry was performed for human epidermal growth factor receptor 2 (HER2), phosphatase and tensin homolog (PTEN), and insulin-like growth factor 1 receptor (IGF-1R). We tested the association between these molecular alterations and downstream activated proteins (like phospho-protein kinase B (p-AKT), phospho-mammalian target of rapamycin (p-mTOR), p-ERK1/2, and p-p70S6K). Recurrence-free interval improvement with tamoxifen versus control was assessed according to the presence or absence of canonic pathway drivers, by using Cox proportional hazard models, including a test for interaction. PIK3CA mutations (both exon 9 and exon 20) were associated with low tumor grade. An enrichment of PIK3CA exon 20 mutations was observed in progesterone receptor- positive tumors. PIK3CA exon 20 mutations were not associated with downstream-activated proteins. No significant interaction between PIK3CA mutations or any of the other canonic pathway drivers and tamoxifen-treatment benefit was found. PIK3CA mutations do not have clinical validity to predict intrinsic resistance to adjuvant tamoxifen and may therefore be unsuitable as companion diagnostic for PI3K/AKT/mTOR inhibitors in ERα- positive, postmenopausal, early breast cancer patients.

Clinical relevance of CHEK2 and NBN mutations in the macedonian population.

PubMed

Kostovska, I Maleva; Jakimovska, M; Kubelka-Sabit, K; Karadjozov, M; Arsovski, A; Stojanovska, L; Plaseska-Karanfilska, D

2015-06-01

Clinical importance of the most common CHEK2 (IVS2+1 G>A, 1100delC, I157T and del5395) and NBN (R215W and 657del5) gene mutations for breast cancer development in Macedonian breast cancer patients is unknown. We performed a case-control study including 300 Macedonian breast cancer patients and 283 Macedonian healthy controls. Genotyping was done using a fast and highly accurate single-nucleotide primer extension method for the detection of five mutations in a single reaction. The detection of the del5395 was performed using an allele-specific duplex polymerase chain reaction (PCR) assay. We have found that mutations were more frequent in breast cancer patients (n = 13, 4.3%) than in controls (n = 5, 1.8%), although without statistical significance. Twelve patients were heterozygous for one of the analyzed mutations, while one patient had two mutations (NBN R215W and CHEK2 I157T). The most frequent variant was I157T, found in 10 patients and four controls (p = 0.176) and was found to be associated with familial breast cancer (p = 0.041). CHEK2 1100delC and NBN 657del5 were each found in one patient and not in the control group. CHEK2 IVS2+1G>A and del5395 were not found in our cohort. Frequencies of the studied mutations are low and they are not likely to represent alleles of clinical importance in the Macedonian population.

New mutations in non-syndromic primary ovarian insufficiency patients identified via whole-exome sequencing.

PubMed

Patiño, Liliana Catherine; Beau, Isabelle; Carlosama, Carolina; Buitrago, July Constanza; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Delemer, Brigitte; Young, Jacques; Binart, Nadine; Laissue, Paul

2017-07-01

Is it possible to identify new mutations potentially associated with non-syndromic primary ovarian insufficiency (POI) via whole-exome sequencing (WES)? WES is an efficient tool to study genetic causes of POI as we have identified new mutations, some of which lead to protein destablization potentially contributing to the disease etiology. POI is a frequently occurring complex pathology leading to infertility. Mutations in only few candidate genes, mainly identified by Sanger sequencing, have been definitively related to the pathogenesis of the disease. This is a retrospective cohort study performed on 69 women affected by POI. WES and an innovative bioinformatics analysis were used on non-synonymous sequence variants in a subset of 420 selected POI candidate genes. Mutations in BMPR1B and GREM1 were modeled by using fragment molecular orbital analysis. Fifty-five coding variants in 49 genes potentially related to POI were identified in 33 out of 69 patients (48%). These genes participate in key biological processes in the ovary, such as meiosis, follicular development, granulosa cell differentiation/proliferation and ovulation. The presence of at least two mutations in distinct genes in 42% of the patients argued in favor of a polygenic nature of POI. It is possible that regulatory regions, not analyzed in the present study, carry further variants related to POI. WES and the in silico analyses presented here represent an efficient approach for mapping variants associated with POI etiology. Sequence variants presented here represents potential future genetic biomarkers. This study was supported by the Universidad del Rosario and Colciencias (Grants CS/CIGGUR-ABN062-2016 and 672-2014). Colciencias supported Liliana Catherine Patiño´s work (Fellowship: 617, 2013). The authors declare no conflict of interest. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Activation of Dun1 in response to nuclear DNA instability accounts for the increase in mitochondrial point mutations in Rad27/FEN1 deficient S. cerevisiae.

PubMed

Kaniak-Golik, Aneta; Kuberska, Renata; Dzierzbicki, Piotr; Sledziewska-Gojska, Ewa

2017-01-01

Rad27/FEN1 nuclease that plays important roles in the maintenance of DNA stability in the nucleus has recently been shown to reside in mitochondria. Accordingly, it has been established that Rad27 deficiency causes increased mutagenesis, but decreased microsatellite instability and homologous recombination in mitochondria. Our current analysis of mutations leading to erythromycin resistance indicates that only some of them arise in mitochondrial DNA and that the GC→AT transition is a hallmark of the mitochondrial mutagenesis in rad27 null background. We also show that the mitochondrial mutator phenotype resulting from Rad27 deficiency entirely depends on the DNA damage checkpoint kinase Dun1. DUN1 inactivation suppresses the mitochondrial mutator phenotype caused by Rad27 deficiency and this suppression is eliminated at least in part by subsequent deletion of SML1 encoding a repressor of ribonucleotide reductase. We conclude that Rad27 deficiency causes a mitochondrial mutator phenotype via activation of DNA damage checkpoint kinase Dun1 and that a Dun1-mediated increase of dNTP pools contributes to this phenomenon. These results point to the nuclear DNA instability as the source of mitochondrial mutagenesis. Consistently, we show that mitochondrial mutations occurring more frequently in yeast devoid of Rrm3, a DNA helicase involved in rDNA replication, are also dependent on Dun1. In addition, we have established that overproduction of Exo1, which suppresses DNA damage sensitivity and replication stress in nuclei of Rad27 deficient cells, but does not enter mitochondria, suppresses the mitochondrial mutagenesis. Exo1 overproduction restores also a great part of allelic recombination and microsatellite instability in mitochondria of Rad27 deficient cells. In contrast, the overproduction of Exo1 does not influence mitochondrial direct-repeat mediated deletions in rad27 null background, pointing to this homologous recombination pathway as the direct target of Rad27 activity in mitochondria.

Activation of Dun1 in response to nuclear DNA instability accounts for the increase in mitochondrial point mutations in Rad27/FEN1 deficient S. cerevisiae

PubMed Central

Dzierzbicki, Piotr

2017-01-01

Rad27/FEN1 nuclease that plays important roles in the maintenance of DNA stability in the nucleus has recently been shown to reside in mitochondria. Accordingly, it has been established that Rad27 deficiency causes increased mutagenesis, but decreased microsatellite instability and homologous recombination in mitochondria. Our current analysis of mutations leading to erythromycin resistance indicates that only some of them arise in mitochondrial DNA and that the GC→AT transition is a hallmark of the mitochondrial mutagenesis in rad27 null background. We also show that the mitochondrial mutator phenotype resulting from Rad27 deficiency entirely depends on the DNA damage checkpoint kinase Dun1. DUN1 inactivation suppresses the mitochondrial mutator phenotype caused by Rad27 deficiency and this suppression is eliminated at least in part by subsequent deletion of SML1 encoding a repressor of ribonucleotide reductase. We conclude that Rad27 deficiency causes a mitochondrial mutator phenotype via activation of DNA damage checkpoint kinase Dun1 and that a Dun1-mediated increase of dNTP pools contributes to this phenomenon. These results point to the nuclear DNA instability as the source of mitochondrial mutagenesis. Consistently, we show that mitochondrial mutations occurring more frequently in yeast devoid of Rrm3, a DNA helicase involved in rDNA replication, are also dependent on Dun1. In addition, we have established that overproduction of Exo1, which suppresses DNA damage sensitivity and replication stress in nuclei of Rad27 deficient cells, but does not enter mitochondria, suppresses the mitochondrial mutagenesis. Exo1 overproduction restores also a great part of allelic recombination and microsatellite instability in mitochondria of Rad27 deficient cells. In contrast, the overproduction of Exo1 does not influence mitochondrial direct-repeat mediated deletions in rad27 null background, pointing to this homologous recombination pathway as the direct target of Rad27 activity in mitochondria. PMID:28678842

CNNM2 Mutations Cause Impaired Brain Development and Seizures in Patients with Hypomagnesemia

PubMed Central

Lameris, Anke L. L.; van Wijk, Erwin; Flik, Gert; Regele, Sabrina; Korenke, G. Christoph; Neophytou, Birgit; Rust, Stephan; Reintjes, Nadine; Konrad, Martin; Bindels, René J. M.; Hoenderop, Joost G. J.

2014-01-01

Intellectual disability and seizures are frequently associated with hypomagnesemia and have an important genetic component. However, to find the genetic origin of intellectual disability and seizures often remains challenging because of considerable genetic heterogeneity and clinical variability. In this study, we have identified new mutations in CNNM2 in five families suffering from mental retardation, seizures, and hypomagnesemia. For the first time, a recessive mode of inheritance of CNNM2 mutations was observed. Importantly, patients with recessive CNNM2 mutations suffer from brain malformations and severe intellectual disability. Additionally, three patients with moderate mental disability were shown to carry de novo heterozygous missense mutations in the CNNM2 gene. To elucidate the physiological role of CNNM2 and explain the pathomechanisms of disease, we studied CNNM2 function combining in vitro activity assays and the zebrafish knockdown model system. Using stable Mg2+ isotopes, we demonstrated that CNNM2 increases cellular Mg2+ uptake in HEK293 cells and that this process occurs through regulation of the Mg2+-permeable cation channel TRPM7. In contrast, cells expressing mutated CNNM2 proteins did not show increased Mg2+ uptake. Knockdown of cnnm2 isoforms in zebrafish resulted in disturbed brain development including neurodevelopmental impairments such as increased embryonic spontaneous contractions and weak touch-evoked escape behaviour, and reduced body Mg content, indicative of impaired renal Mg2+ absorption. These phenotypes were rescued by injection of mammalian wild-type Cnnm2 cRNA, whereas mammalian mutant Cnnm2 cRNA did not improve the zebrafish knockdown phenotypes. We therefore concluded that CNNM2 is fundamental for brain development, neurological functioning and Mg2+ homeostasis. By establishing the loss-of-function zebrafish model for CNNM2 genetic disease, we provide a unique system for testing therapeutic drugs targeting CNNM2 and for monitoring their effects on the brain and kidney phenotype. PMID:24699222

Clinicopathological analysis of endometrial carcinomas harboring somatic POLE exonuclease domain mutations.

PubMed

Hussein, Yaser R; Weigelt, Britta; Levine, Douglas A; Schoolmeester, J Kenneth; Dao, Linda N; Balzer, Bonnie L; Liles, Georgia; Karlan, Beth; Köbel, Martin; Lee, Cheng-Han; Soslow, Robert A

2015-04-01

The Cancer Genome Atlas described four major genomic groups of endometrial carcinomas, including a POLE ultramutated subtype comprising ∼10% of endometrioid adenocarcinoma, characterized by POLE exonuclease domain mutations, ultrahigh somatic mutation rates, and favorable outcome. Our aim was to examine the morphological and clinicopathological features of ultramutated endometrial carcinomas harboring somatic POLE exonuclease domain mutations. Hematoxylin and eosin slides and pathology reports for 8/17 POLE-mutated endometrial carcinomas described in the Cancer Genome Atlas study were studied; for the remaining cases, virtual whole slide images publicly available at cBioPortal (www.cbioportal.org) were examined. A second cohort of eight POLE mutated endometrial carcinomas from University of Calgary was also studied. Median age was 55 years (range 33-87 years). Nineteen patients presented as stage I, 1 stage II, and 5 stage III. The majority of cases (24 of the 25) demonstrated defining morphological features of endometrioid differentiation. The studied cases were frequently high grade (60%) and rich in tumor-infiltrating lymphocytes and/or peri-tumoral lymphocytes (84%); many tumors showed morphological heterogeneity (52%) and ambiguity (16%). Foci demonstrating severe nuclear atypia led to concern for serous carcinoma in 28% of cases. At the molecular level, the majority of the Cancer Genome Atlas POLE-mutated tumors were microsatellite stable (65%), and TP53 mutations were present in 35% of cases. They also harbored mutations in PTEN (94%), FBXW7 (82%), ARID1A (76%), and PIK3CA (71%). All patients from both cohorts were alive without disease, and none of the patients developed recurrence at the time of follow-up (median 33 months; range 2-102 months). In conclusion, the recognition of ultramutated endometrial carcinomas with POLE exonuclease domain mutation is important given their favorable outcome. Our histopathological review revealed that these tumors are commonly high grade, have obvious lymphocytic infiltrates, and can show ambiguous morphology. As they frequently harbor TP53 mutations, it is important not to misclassify them as serous carcinoma.

HIV drug resistance tendencies in Latvia.

PubMed

Kolupajeva, Tatjana; Aldins, Pauls; Guseva, Ludmila; Dusacka, Diana; Sondore, Valentina; Viksna, Ludmila; Rozentale, Baiba

2008-09-01

The treatment of HIV infection in Latvia by using highly active antiretroviral therapy (HAART) was started in 1996. The prevalence and tendencies of HIV drug resistance among treated and treatment-naive patients in Latvia in the years 2006-2007 were evaluated in this study. Data of HIV genotyping, performed in 132 HIV-1 infected during years 2006-2007 by TRUGENE HIV-1 genotyping assay (BayerHealthCare-diagnostics) are included in the study. Analysis of data showed that in the group of treatment-naive individuals majority carried wild type virus. Prevalence of resistance-associated mutations (RAMs) in the treatment-naive group according to IAS list was 28%. In most cases it was NRTI mutation A62V that is associated with multinucleoside resistance caused by Q151M, its effect in the absence of Q151M is not known. By many authors A62V is supposed to be a result of polymorphism in RT gene and is excluded from the list of resistance mutations. High prevalence of A62V is typical for HIV-1 subtype A. As majority of treatment-naive cases (89%) in this study were with HIV-1 subtypes A or AE, we excluded A62V mutation and estimated RAMs prevalence in group of treatment-naive HIV-infected individuals as 7%. Minor PI mutations were not included in analyses. In Europe published rates generally very between 5% and 15%. In the group of treatment-experienced HIV infected people 25/75 were with HIV-1 subtype B, the rest part--with non-B subtypes: A/AE (35/75), CRF-01AE (7/75), B/AE (4/75) and others. In treatment-experienced patients RAMs prevalence was estimated as 58.6%. Most frequently RAMs were found for nucleoside reverse transcriptase inhibitors (NRTI) (49.3%) followed by non-nucleoside reverse transcriptase inhibitors (NNRTI) (22.6%) and protease inhibitors (PI) (16%). In the group of NRTI mutations M184V (26/75; 34.6%), A62V (12/75; 16.0%) and T215Y (8/75; 10.6%), in NNRTI mutations K103N (10/75; 13.3%), G190S (6/75; 8.0%), in PI group mutations L90M (6/75; 8.0%) and M461/L (6/75; 8.0%) occurred most frequently. The following drug susceptibility was predicted according to the Trugen expert interpretations: in 33/75 (44%) patients no evidence of resistance, in 21/75 (28%) patients resistance to 1 drug class (NRTI--16/75, NNRTI--4/75, PI--1/75), in 17 patients (22.6%) resistance to 2 drug classes (NRTI+NNRTI--9/75, NRTI+PI--7/75, NNRTI+PI--1/75) and in 3/75 (4%) patients resistance to all 3 classes of drugs (NRTI+NNRTI+PI). We conclude, that prevalence of RAMs in treatment-naive HIV infected persons in Latvia is comparable with prevalence in Europe. The origin of predominated mutation A62V associated with NRTI at present is not clear. In more than half of treated HIV infected patients HIV resistance to at least one HAART class was predicted.

A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

PubMed

Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi

2014-07-01

Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development.

PubMed

Ortega-Molina, Ana; Boss, Isaac W; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A; Gascoyne, Randy D; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M; Wendel, Hans-Guido

2015-10-01

The gene encoding the lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma and diffuse large B cell lymphoma; however, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center involution and impedes B cell differentiation and class switch recombination. Integrative genomic analyses indicate that KMT2D affects methylation of lysine 4 on histone H3 (H3K4) and expression of a set of genes, including those in the CD40, JAK-STAT, Toll-like receptor and B cell receptor signaling pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3 and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell-activating pathways.

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

PubMed Central

Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

2015-01-01

The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

Prevalence of 185delAG and 5382insC mutations in BRCA1, and 6174delT in BRCA2 in women of Ashkenazi Jewish origin in southern Brazil

PubMed Central

Dillenburg, Crisle Vignol; Bandeira, Isabel Cristina; Tubino, Taiana Valente; Rossato, Luciana Grazziotin; Dias, Eleonora Souza; Bittelbrunn, Ana Cristina; Leistner-Segal, Sandra

2012-01-01

Certain mutations in BRCA1 and BRCA2 genes are frequent in the Ashkenazi Jewish population. Several factors contribute to this increased frequency, including consanguineous marriages and an event known as a “bottleneck”, which occurred in the past and caused a drastic reduction in the genetic variability of this population. Several studies were performed over the years in an attempt to elucidate the role of BRCA1 and BRCA2 genes in susceptibility to breast cancer. The aim of this study was to estimate the carrier frequency of certain common mutations in the BRCA1 (185delAG and 5382insC) and BRCA2 (6174delT) genes in an Ashkenazi Jewish population from Porto Alegre, Brazil. Molecular analyses were done by PCR followed by RFLP (ACRS). The carrier frequencies for BRCA1 185delAG and 5382insC were 0.78 and 0 respectively, and 0.4 for the BRCA2 6174deT mutation. These findings are similar to those of some prior studies but differ from others, possibly due to excluding individuals with a personal or family history of cancer. Our sample was drawn from the community group and included individuals with or without a family or personal history of cancer. Furthermore, increased dispersion among Ashkenazi subpopulations may be the result of strong genetic drift and/or admixture. It is therefore necessary to consider the effects of local admixture on the mismatch distributions of various Jewish populations. PMID:23055798

Prevalence of 185delAG and 5382insC mutations in BRCA1, and 6174delT in BRCA2 in women of Ashkenazi Jewish origin in southern Brazil.

PubMed

Dillenburg, Crisle Vignol; Bandeira, Isabel Cristina; Tubino, Taiana Valente; Rossato, Luciana Grazziotin; Dias, Eleonora Souza; Bittelbrunn, Ana Cristina; Leistner-Segal, Sandra

2012-07-01

Certain mutations in BRCA1 and BRCA2 genes are frequent in the Ashkenazi Jewish population. Several factors contribute to this increased frequency, including consanguineous marriages and an event known as a "bottleneck", which occurred in the past and caused a drastic reduction in the genetic variability of this population. Several studies were performed over the years in an attempt to elucidate the role of BRCA1 and BRCA2 genes in susceptibility to breast cancer. The aim of this study was to estimate the carrier frequency of certain common mutations in the BRCA1 (185delAG and 5382insC) and BRCA2 (6174delT) genes in an Ashkenazi Jewish population from Porto Alegre, Brazil. Molecular analyses were done by PCR followed by RFLP (ACRS). The carrier frequencies for BRCA1 185delAG and 5382insC were 0.78 and 0 respectively, and 0.4 for the BRCA2 6174deT mutation. These findings are similar to those of some prior studies but differ from others, possibly due to excluding individuals with a personal or family history of cancer. Our sample was drawn from the community group and included individuals with or without a family or personal history of cancer. Furthermore, increased dispersion among Ashkenazi subpopulations may be the result of strong genetic drift and/or admixture. It is therefore necessary to consider the effects of local admixture on the mismatch distributions of various Jewish populations.

PMP22 related neuropathies: Charcot-Marie-Tooth disease type 1A and Hereditary Neuropathy with liability to Pressure Palsies.

PubMed

van Paassen, Barbara W; van der Kooi, Anneke J; van Spaendonck-Zwarts, Karin Y; Verhamme, Camiel; Baas, Frank; de Visser, Marianne

2014-03-19

PMP22 related neuropathies comprise (1) PMP22 duplications leading to Charcot-Marie-Tooth disease type 1A (CMT1A), (2) PMP22 deletions, leading to Hereditary Neuropathy with liability to Pressure Palsies (HNPP), and (3) PMP22 point mutations, causing both phenotypes. Overall prevalence of CMT is usually reported as 1:2,500, epidemiological studies show that 20-64% of CMT patients carry the PMP22 duplication. The prevalence of HNPP is not well known. CMT1A usually presents in the first two decades with difficulty walking or running. Distal symmetrical muscle weakness and wasting and sensory loss is present, legs more frequently and more severely affected than arms. HNPP typically leads to episodic, painless, recurrent, focal motor and sensory peripheral neuropathy, preceded by minor compression on the affected nerve. Electrophysiological evaluation is needed to determine whether the polyneuropathy is demyelinating. Sonography of the nerves can be useful. Diagnosis is confirmed by finding respectively a PMP22 duplication, deletion or point mutation. Differential diagnosis includes other inherited neuropathies, and acquired polyneuropathies. The mode of inheritance is autosomal dominant and de novo mutations occur. Offspring of patients have a chance of 50% to inherit the mutation from their affected parent. Prenatal testing is possible; requests for prenatal testing are not common. Treatment is currently symptomatic and may include management by a rehabilitation physician, physiotherapist, occupational therapist and orthopaedic surgeon. Adult CMT1A patients show slow clinical progression of disease, which seems to reflect a process of normal ageing. Life expectancy is normal.

Cancer Associated E17K Mutation Causes Rapid Conformational Drift in AKT1 Pleckstrin Homology (PH) Domain

PubMed Central

Kumar, Ambuj; Purohit, Rituraj

2013-01-01

Background AKT1 (v-akt murine thymoma viral oncogene homologue 1) kinase is one of the most frequently activated proliferated and survival pathway of cancer. Recently it has been shown that E17K mutation in the Pleckstrin Homology (PH) domain of AKT1 protein leads to cancer by amplifying the phosphorylation and membrane localization of protein. The mutant has shown resistance to AKT1/2 inhibitor VIII drug molecule. In this study we have demonstrated the detailed structural and molecular consequences associated with the activity regulation of mutant protein. Methods The docking score exhibited significant loss in the interaction affinity to AKT1/2 inhibitor VIII drug molecule. Furthermore, the molecular dynamics simulation studies presented an evidence of rapid conformational drift observed in mutant structure. Results There was no stability loss in mutant as compared to native structure and the major cation–π interactions were also shown to be retained. Moreover, the active residues involved in membrane localization of protein exhibited significant rise in NHbonds formation in mutant. The rise in NHbond formation in active residues accounts for the 4-fold increase in the membrane localization potential of protein. Conclusion The overall result suggested that, although the mutation did not induce any stability loss in structure, the associated pathological consequences might have occurred due to the rapid conformational drifts observed in the mutant AKT1 PH domain. General Significance The methodology implemented and the results obtained in this work will facilitate in determining the core molecular mechanisms of cancer-associated mutations and in designing their potential drug inhibitors. PMID:23741320

Biodiversity in the cyclic competition system of three species according to the emergence of mutant species

NASA Astrophysics Data System (ADS)

Park, Junpyo

2018-05-01

Understanding mechanisms which promote or hinder existing ecosystems are important issues in ecological sciences. In addition to fundamental interactions such as competition and migration among native species, existing ecosystems can be easily disturbed by external factors, and the emergence of new species may be an example in such cases. The new species which does not exist in a current ecosystem can be regarded as either alien species entered from outside or mutant species born by mutation in existing normal species. Recently, as existing ecosystems are getting influenced by various physical/chemical external factors, mutation due to anthropogenic and environmental factors can occur more frequently and is thus attracting much attention for the maintenance of ecosystems. In this paper, we consider emergences of mutant species among self-competing three species in the cyclic dominance. By defining mutation as the birth of mutant species, we investigate how mutant species can affect biodiversity in the existing ecosystem. Through microscopic and macroscopic approaches, we have found that the society of existing normal species can be disturbed by mutant species either the society is maintained accompanying with the coexistence of all species or jeopardized by occupying of mutant species. Due to the birth of mutant species, the existing society may be more complex by constituting two different groups of normal and mutant species, and our results can be contributed to analyze complex ecosystems of many species. We hope our findings may propose a new insight on mutation in cyclic competition systems of many species.

Risk of Drug Resistance Among Persons Acquiring HIV Within a Randomized Clinical Trial of Single- or Dual-Agent Preexposure Prophylaxis

PubMed Central

Lehman, Dara A.; Baeten, Jared M.; McCoy, Connor O.; Weis, Julie F.; Peterson, Dylan; Mbara, Gerald; Donnell, Deborah; Thomas, Katherine K.; Hendrix, Craig W.; Marzinke, Mark A.; Frenkel, Lisa; Ndase, Patrick; Mugo, Nelly R.; Celum, Connie; Overbaugh, Julie; Matsen, Frederick A.; Celum, Connie; Baeten, Jared M.; Donnell, Deborah; Coombs, Robert W.; Frenkel, Lisa; Hendrix, Craig W.; Marzinke, Mark A.; Lingappa, Jairam; McElrath, M. Juliana; Fife, Kenneth; Were, Edwin; Tumwesigye, Elioda; Ndase, Patrick; Katabira, Elly; Katabira, Elly; Ronald, Allan; Bukusi, Elizabeth; Cohen, Craig; Wangisi, Jonathan; Campbell, James; Tappero, Jordan; Kiarie, James; Farquhar, Carey; John-Stewart, Grace; Mugo, Nelly Rwamba; Campbell, James; Tappero, Jordan; Wangisi, Jonathan

2015-01-01

Background. Preexposure prophylaxis (PrEP) with emtricitabine plus tenofovir disoproxil fumarate (FTC/TDF) or TDF alone reduces the risk of human immunodeficiency virus (HIV) acquisition. Understanding the risk of antiretroviral resistance selected by PrEP during breakthrough infections is important because of the risk of treatment failure during subsequent antiretroviral use. Methods. Within the largest randomized trial of FTC/TDF versus TDF as PrEP, plasma samples were tested for HIV with resistance mutations associated with FTC (K65R and M184IV) and TDF (K65R and K70E), using 454 sequencing. Results. Of 121 HIV seroconverters, 25 received FTC/TDF, 38 received TDF, and 58 received placebo. Plasma drug levels in 26 individuals indicated PrEP use during or after HIV acquisition, of which 5 had virus with resistance mutations associated with their PrEP regimen. Among those with PrEP drug detected during infection, resistance was more frequent in the FTC/TDF arm (4 of 7 [57%]), compared with the TDF arm (1 of 19 [5.3%]; P = .01), owing to the FTC-associated mutation M184IV. Of these cases, 3 had unrecognized acute infection at PrEP randomization, and 2 were HIV negative at enrollment. Conclusions. These results suggest that resistance selected by PrEP is rare but can occur both with PrEP initiation during acute seronegative HIV infection and in PrEP breakthrough infections and that FTC is associated with a greater frequency of resistance mutations than TDF. PMID:25587020

Genetic Alterations and Their Clinical Implications in High-Recurrence Risk Papillary Thyroid Cancer.

PubMed

Lee, Min-Young; Ku, Bo Mi; Kim, Hae Su; Lee, Ji Yun; Lim, Sung Hee; Sun, Jong-Mu; Lee, Se-Hoon; Park, Keunchil; Oh, Young Lyun; Hong, Mineui; Jeong, Han-Sin; Son, Young-Ik; Baek, Chung-Hwan; Ahn, Myung-Ju

2017-10-01

Papillary thyroid carcinomas (PTCs) frequently involve genetic alterations. The objective of this study was to investigate genetic alterations and further explore the relationships between these genetic alterations and clinicopathological characteristics in a high-recurrence risk (node positive, N1) PTC group. Tumor tissue blocks were obtained from 240 surgically resected patients with histologically confirmed stage III/IV (pT3/4 or N1) PTCs. We screened gene fusions using NanoString's nCounter technology and mutational analysis was performed by direct DNA sequencing. Data describing the clinicopathological characteristics and clinical courses were retrospectively collected. Of the 240 PTC patients, 207 (86.3%) had at least one genetic alteration, including BRAF mutation in 190 patients (79.2%), PIK3CA mutation in 25 patients (10.4%), NTRK1/3 fusion in six patients (2.5%), and RET fusion in 24 patients (10.0%). Concomitant presence of more than two genetic alterations was seen in 36 patients (15%). PTCs harboring BRAF mutation were associated with RET wild-type expression (p=0.001). RET fusion genes have been found to occur with significantly higher frequency in N1b stage patients (p=0.003) or groups of patients aged 45 years or older (p=0.031); however, no significant correlation was found between other genetic alterations. There was no trend toward favorable recurrence-free survival or overall survival among patients lacking genetic alterations. In the selected high-recurrence risk PTC group, most patients had more than one genetic alteration. However, these known alterations could not entirely account for clinicopathological features of high-recurrence risk PTC.

PMP22 related neuropathies: Charcot-Marie-Tooth disease type 1A and Hereditary Neuropathy with liability to Pressure Palsies

PubMed Central

2014-01-01

PMP22 related neuropathies comprise (1) PMP22 duplications leading to Charcot-Marie-Tooth disease type 1A (CMT1A), (2) PMP22 deletions, leading to Hereditary Neuropathy with liability to Pressure Palsies (HNPP), and (3) PMP22 point mutations, causing both phenotypes. Overall prevalence of CMT is usually reported as 1:2,500, epidemiological studies show that 20-64% of CMT patients carry the PMP22 duplication. The prevalence of HNPP is not well known. CMT1A usually presents in the first two decades with difficulty walking or running. Distal symmetrical muscle weakness and wasting and sensory loss is present, legs more frequently and more severely affected than arms. HNPP typically leads to episodic, painless, recurrent, focal motor and sensory peripheral neuropathy, preceded by minor compression on the affected nerve. Electrophysiological evaluation is needed to determine whether the polyneuropathy is demyelinating. Sonography of the nerves can be useful. Diagnosis is confirmed by finding respectively a PMP22 duplication, deletion or point mutation. Differential diagnosis includes other inherited neuropathies, and acquired polyneuropathies. The mode of inheritance is autosomal dominant and de novo mutations occur. Offspring of patients have a chance of 50% to inherit the mutation from their affected parent. Prenatal testing is possible; requests for prenatal testing are not common. Treatment is currently symptomatic and may include management by a rehabilitation physician, physiotherapist, occupational therapist and orthopaedic surgeon. Adult CMT1A patients show slow clinical progression of disease, which seems to reflect a process of normal ageing. Life expectancy is normal. PMID:24646194

Searching for the Advantages of Virus Sex

NASA Astrophysics Data System (ADS)

Turner, Paul E.

2003-02-01

Sex (genetic exchange) is a nearly universal phenomenon in biological populations. But this is surprising given the costs associated with sex. For example, sex tends to break apart co-adapted genes, and sex causes a female to inefficiently contribute only half the genes to her offspring. Why then did sex evolve? One famous model poses that sex evolved to combat Muller's ratchet, the mutational load that accrues when harmful mutations drift to high frequencies in populations of small size. In contrast, the Fisher-Muller Hypothesis predicts that sex evolved to promote genetic variation that speeds adaptation in novel environments. Sexual mechanisms occur in viruses, which feature high rates of deleterious mutation and frequent exposure to novel or changing environments. Thus, confirmation of one or both hypotheses would shed light on the selective advantages of virus sex. Experimental evolution has been used to test these classic models in the RNA bacteriophage φ6, a virus that experiences sex via reassortment of its chromosomal segments. Empirical data suggest that sex might have originated in φ6 to assist in purging deleterious mutations from the genome. However, results do not support the idea that sex evolved because it provides beneficial variation in novel environments. Rather, experiments show that too much sex can be bad for φ6 promiscuity allows selfish viruses to evolve and spread their inferior genes to subsequent generations. Here I discuss various explanations for the evolution of segmentation in RNA viruses, and the added cost of sex when large numbers of viruses co-infect the same cell.

A Novel Lamin A Mutant Responsible for Congenital Muscular Dystrophy Causes Distinct Abnormalities of the Cell Nucleus.

PubMed

Barateau, Alice; Vadrot, Nathalie; Vicart, Patrick; Ferreiro, Ana; Mayer, Michèle; Héron, Delphine; Vigouroux, Corinne; Buendia, Brigitte

2017-01-01

A-type lamins, the intermediate filament proteins participating in nuclear structure and function, are encoded by LMNA. LMNA mutations can lead to laminopathies such as lipodystrophies, premature aging syndromes (progeria) and muscular dystrophies. Here, we identified a novel heterozygous LMNA p.R388P de novo mutation in a patient with a non-previously described severe phenotype comprising congenital muscular dystrophy (L-CMD) and lipodystrophy. In culture, the patient's skin fibroblasts entered prematurely into senescence, and some nuclei showed a lamina honeycomb pattern. C2C12 myoblasts were transfected with a construct carrying the patient's mutation; R388P-lamin A (LA) predominantly accumulated within the nucleoplasm and was depleted at the nuclear periphery, altering the anchorage of the inner nuclear membrane protein emerin and the nucleoplasmic protein LAP2-alpha. The mutant LA triggered a frequent and severe nuclear dysmorphy that occurred independently of prelamin A processing, as well as increased histone H3K9 acetylation. Nuclear dysmorphy was not significantly improved when transfected cells were treated with drugs disrupting microtubules or actin filaments or modifying the global histone acetylation pattern. Therefore, releasing any force exerted at the nuclear envelope by the cytoskeleton or chromatin did not rescue nuclear shape, in contrast to what was previously shown in Hutchinson-Gilford progeria due to other LMNA mutations. Our results point to the specific cytotoxic effect of the R388P-lamin A mutant, which is clinically related to a rare and severe multisystemic laminopathy phenotype.

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Mutation Update for GNE Gene Variants Associated with GNE Myopathy

PubMed Central

Celeste, Frank V.; Vilboux, Thierry; Ciccone, Carla; de Dios, John Karl; Malicdan, May Christine V.; Leoyklang, Petcharat; McKew, John C.; Gahl, William A.; Carrillo-Carrasco, Nuria; Huizing, Marjan

2014-01-01

The GNE gene encodes the rate-limiting, bifunctional enzyme of sialic acid biosynthesis, UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE). Biallelic GNE mutations underlie GNE myopathy, an adult-onset progressive myopathy. GNE myopathy-associated GNE mutations are predominantly missense, resulting in reduced, but not absent, GNE enzyme activities. The exact pathomechanism of GNE myopathy remains unknown, but likely involves aberrant (muscle) sialylation. Here we summarize 154 reported and novel GNE variants associated with GNE myopathy, including 122 missense, 11 nonsense, 14 insertion/deletions and 7 intronic variants. All variants were deposited in the online GNE variation database (http://www.dmd.nl/nmdb2/home.php?select_db=GNE). We report the predicted effects on protein function of all variants as well as the predicted effects on epimerase and/or kinase enzymatic activities of selected variants. By analyzing exome sequence databases, we identified three frequently occurring, unreported GNE missense variants/polymorphisms, important for future sequence interpretations. Based on allele frequencies, we estimate the world-wide prevalence of GNE myopathy to be ~ 4–21/1,000,000. This previously unrecognized high prevalence confirms suspicions that many patients may escape diagnosis. Awareness among physicians for GNE myopathy is essential for the identification of new patients, which is required for better understanding of the disorder’s pathomechanism and for the success of ongoing treatment trials. PMID:24796702

Hepatitis B virus genotyping among chronic hepatitis B patients with resistance to treatment with lamivudine in the City of Ribeirão Preto, State of São Paulo.

PubMed

Haddad, Rodrigo; Martinelli, Ana de Lourdes Candolo; Uyemura, Sérgio Akira; Yokosawa, Jonny

2010-01-01

Lamivudine is a nucleoside analogue that is used clinically for treating chronic hepatitis B infection. However, the main problem with prolonged use of lamivudine is the development of viral resistance to the treatment. Mutations in the YMDD motif of the hepatitis B virus DNA polymerase gene have been associated with resistance to drug therapy. So far, there have not been many studies in Brazil reporting on genotype-dependent development of resistance to lamivudine. Thus, the aim of the present study was to determine the possible correlation between a certain genotype and increased development of resistance to lamivudine among chronic hepatitis B patients. HBV DNA in samples from 50 patients under lamivudine treatment was amplified by means of conventional PCR. Samples were collected at Hospital das Clínicas, FMRP-USP. The products were then sequenced and phylogenetic analysis was performed. Phylogenetic analysis revealed that 29 (58%) patients were infected with genotype D, 20 (40%) with genotype A and one (2%) with genotype F. Mutations in the YMDD motif occurred in 20% of the patients with genotype A and 27.6% of the patients with genotype D. Despite the small number of samples, our results indicated that mutations in the YMDD motif were 1.38 times more frequent in genotype D than in genotype A.

Targetable genetic features of primary testicular and primary central nervous system lymphomas

PubMed Central

Chapuy, Bjoern; Roemer, Margaretha G. M.; Stewart, Chip; Tan, Yuxiang; Abo, Ryan P.; Zhang, Liye; Dunford, Andrew J.; Meredith, David M.; Thorner, Aaron R.; Jordanova, Ekaterina S.; Liu, Gang; Feuerhake, Friedrich; Ducar, Matthew D.; Illerhaus, Gerald; Gusenleitner, Daniel; Linden, Erica A.; Sun, Heather H.; Homer, Heather; Aono, Miyuki; Pinkus, Geraldine S.; Ligon, Azra H.; Ligon, Keith L.; Ferry, Judith A.; Freeman, Gordon J.; van Hummelen, Paul; Golub, Todd R.; Getz, Gad; Rodig, Scott J.; de Jong, Daphne; Monti, Stefano

2016-01-01

Primary central nervous system lymphomas (PCNSLs) and primary testicular lymphomas (PTLs) are extranodal large B-cell lymphomas (LBCLs) with inferior responses to current empiric treatment regimens. To identify targetable genetic features of PCNSL and PTL, we characterized their recurrent somatic mutations, chromosomal rearrangements, copy number alterations (CNAs), and associated driver genes, and compared these comprehensive genetic signatures to those of diffuse LBCL and primary mediastinal large B-cell lymphoma (PMBL). These studies identify unique combinations of genetic alterations in discrete LBCL subtypes and subtype-selective bases for targeted therapy. PCNSLs and PTLs frequently exhibit genomic instability, and near-uniform, often biallelic, CDKN2A loss with rare TP53 mutations. PCNSLs and PTLs also use multiple genetic mechanisms to target key genes and pathways and exhibit near-uniform oncogenic Toll-like receptor signaling as a result of MYD88 mutation and/or NFKBIZ amplification, frequent concurrent B-cell receptor pathway activation, and deregulation of BCL6. Of great interest, PCNSLs and PTLs also have frequent 9p24.1/PD-L1/PD-L2 CNAs and additional translocations of these loci, structural bases of immune evasion that are shared with PMBL. PMID:26702065

Next-generation sequencing of translocation renal cell carcinoma reveals novel RNA splicing partners and frequent mutations of chromatin-remodeling genes.

PubMed

Malouf, Gabriel G; Su, Xiaoping; Yao, Hui; Gao, Jianjun; Xiong, Liangwen; He, Qiuming; Compérat, Eva; Couturier, Jérôme; Molinié, Vincent; Escudier, Bernard; Camparo, Philippe; Doss, Denaha J; Thompson, Erika J; Khayat, David; Wood, Christopher G; Yu, Willie; Teh, Bin T; Weinstein, John; Tannir, Nizar M

2014-08-01

MITF/TFE translocation renal cell carcinoma (TRCC) is a rare subtype of kidney cancer. Its incidence and the genome-wide characterization of its genetic origin have not been fully elucidated. We performed RNA and exome sequencing on an exploratory set of TRCC (n = 7), and validated our findings using The Cancer Genome Atlas (TCGA) clear-cell RCC (ccRCC) dataset (n = 460). Using the TCGA dataset, we identified seven TRCC (1.5%) cases and determined their genomic profile. We discovered three novel partners of MITF/TFE (LUC7L3, KHSRP, and KHDRBS2) that are involved in RNA splicing. TRCC displayed a unique gene expression signature as compared with other RCC types, and showed activation of MITF, the transforming growth factor β1 and the PI3K complex targets. Genes differentially spliced between TRCC and other RCC types were enriched for MITF and ID2 targets. Exome sequencing of TRCC revealed a distinct mutational spectrum as compared with ccRCC, with frequent mutations in chromatin-remodeling genes (six of eight cases, three of which were from the TCGA). In two cases, we identified mutations in INO80D, an ATP-dependent chromatin-remodeling gene, previously shown to control the amplitude of the S phase. Knockdown of INO80D decreased cell proliferation in a novel cell line bearing LUC7L3-TFE3 translocation. This genome-wide study defines the incidence of TRCC within a ccRCC-directed project and expands the genomic spectrum of TRCC by identifying novel MITF/TFE partners involved in RNA splicing and frequent mutations in chromatin-remodeling genes. ©2014 American Association for Cancer Research.

Genomic Characterization of Vulvar (Pre)cancers Identifies Distinct Molecular Subtypes with Prognostic Significance.

PubMed

Nooij, Linda S; Ter Haar, Natalja T; Ruano, Dina; Rakislova, Natalia; van Wezel, Tom; Smit, Vincent T H B M; Trimbos, Baptist J B M Z; Ordi, Jaume; van Poelgeest, Mariette I E; Bosse, Tjalling

2017-11-15

Purpose: Vulvar cancer (VC) can be subclassified by human papillomavirus (HPV) status. HPV-negative VCs frequently harbor TP53 mutations; however, in-depth analysis of other potential molecular genetic alterations is lacking. We comprehensively assessed somatic mutations in a large series of vulvar (pre)cancers. Experimental Design: We performed targeted next-generation sequencing (17 genes), p53 immunohistochemistry and HPV testing on 36 VC and 82 precursors (sequencing cohort). Subsequently, the prognostic significance of the three subtypes identified in the sequencing cohort was assessed in a series of 236 VC patients (follow-up cohort). Results: Frequent recurrent mutations were identified in HPV-negative vulvar (pre)cancers in TP53 (42% and 68%), NOTCH1 (28% and 41%), and HRAS (20% and 31%). Mutation frequency in HPV-positive vulvar (pre)cancers was significantly lower ( P = 0.001). Furthermore, a substantial subset of the HPV-negative precursors (35/60, 58.3%) and VC (10/29, 34.5%) were TP53 wild-type (wt), suggesting a third, not-previously described, molecular subtype. Clinical outcomes in the three different subtypes (HPV + , HPV - /p53wt, HPV - /p53abn) were evaluated in a follow-up cohort consisting of 236 VC patients. Local recurrence rate was 5.3% for HPV + , 16.3% for HPV - /p53wt and 22.6% for HPV - /p53abn tumors ( P = 0.044). HPV positivity remained an independent prognostic factor for favorable outcome in the multivariable analysis ( P = 0.020). Conclusions: HPV - and HPV + vulvar (pre)cancers display striking differences in somatic mutation patterns. HPV - /p53wt VC appear to be a distinct clinicopathologic subgroup with frequent NOTCH1 mutations. HPV + VC have a significantly lower local recurrence rate, independent of clinicopathological variables, opening opportunities for reducing overtreatment in VC. Clin Cancer Res; 23(22); 6781-9. ©2017 AACR . ©2017 American Association for Cancer Research.

Establishment of a novel monoclonal antibody SMab-1 specific for IDH1-R132S mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaneko, Mika Kato; Tian, Wei; Takano, Shingo

2011-03-25

Research highlights: {yields} IDH1 mutations are early and frequent genetic alterations in gliomas. {yields} We newly established an anti-IDH1-R132S-specific mAb SMab-1. {yields} SMab-1 reacted with the IDH1-R132S peptide, but not with other IDH1 mutants. {yields} SMab-1 specifically stained the IDH1-R132S-expressing glioblastoma cells in immunocytochemistry and immunohistochemistry. {yields} SMab-1 should be useful in diagnosis of mutation-bearing gliomas. -- Abstract: Isocitrate dehydrogenase 1 (IDH1) mutations, which are early and frequent genetic alterations in gliomas, are specific to a single codon in the conserved and functionally important Arginine 132 (R132) in IDH1. We earlier established a monoclonal antibody (mAb), IMab-1, which is specificmore » for R132H-containing IDH1 (IDH1-R132H), the most frequent IDH1 mutation in gliomas. To establish IDH1-R132S-specific mAb, we immunized mice with R132S-containing IDH1 (IDH1-R132S) peptide. After cell fusion using Sendai virus envelope, IDH1-R132S-specific mAbs were screened in ELISA. One mAb, SMab-1, reacted with the IDH1-R132S peptide, but not with other IDH1 mutants. Western-blot analysis showed that SMab-1 reacted only with the IDH1-R132S protein, not with IDH1-WT protein or IDH1 mutants, indicating that SMab-1 is IDH1-R132S-specific. Furthermore, SMab-1 specifically stained the IDH1-R132S-expressing glioblastoma cells in immunocytochemistry and immunohistochemistry, but did not react with IDH1-WT or IDH1-R132H-containing glioblastoma cells. We newly established an anti-IDH1-R132S-specific mAb SMab-1 for use in diagnosis of mutation-bearing gliomas.« less

HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?

PubMed

Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M

2010-12-15

Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.

RNF43 is mutated less frequently in Lynch Syndrome compared with sporadic microsatellite unstable colorectal cancers.

PubMed

Fennell, Lochlan J; Clendenning, Mark; McKeone, Diane M; Jamieson, Saara H; Balachandran, Samanthy; Borowsky, Jennifer; Liu, John; Kawamata, Futoshi; Bond, Catherine E; Rosty, Christophe; Burge, Matthew E; Buchanan, Daniel D; Leggett, Barbara A; Whitehall, Vicki L J

2018-01-01

The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers commonly arise in colorectal adenomas already bearing the APC mutation, whereas sporadic microsatellite unstable colorectal cancers arise from serrated polyps typically lacking APC mutation, decreasing the selection pressure on other WNT signaling related loci in Lynch syndrome.

Clinical aspects of Usher syndrome and the USH2A gene in a cohort of 433 patients.

PubMed

Blanco-Kelly, Fiona; Jaijo, Teresa; Aller, Elena; Avila-Fernandez, Almudena; López-Molina, María Isabel; Giménez, Ascensión; García-Sandoval, Blanca; Millán, José M; Ayuso, Carmen

2015-02-01

A new statistical approach is needed to describe the clinical differences between type I and type II Usher syndrome and between the 2 most frequent mutations in the USH2A gene. To describe the primary phenotypic characteristics and differences between type I and type II Usher syndrome and to establish a phenotype-genotype correlation for the 2 most frequent mutations in the USH2A gene. Cross-sectional study at a genetics department, in which clinical evaluations were performed for 433 patients (297 unrelated families) who were classified as having type I, II, III, atypical, or unclassified Usher syndrome according to their clinical history, pedigree data, results from ophthalmological studies, and audiological, neurophysiological, and vestibular test results. Molecular studies were performed for 304 patients (256 unrelated families). The Mann-Whitney U test or the χ2 test was used for calculating the differences between mean values for the analyzed parameters. Age at diagnosis; age at onset of night blindness, visual field loss, visual acuity loss, and cataracts; and severity and age at diagnosis of hearing loss. The comparison between patients with type I Usher syndrome and those with type II Usher syndrome revealed P < .001 for most items analyzed. The most frequent mutations in the USH2A gene were the p.Glu767Serfs*21 and p.Cys759Phe mutations, with an allelic frequency of 23.2% (63 of 272 alleles) and 8.1% (22 of 272 alleles), respectively. The phenotypic analysis for patients carrying p.Cys759Phe showed P < .001 for most items analyzed when compared with patients carrying p.Glu767Serfs*21 and when compared with patients carrying other mutations in the USH2A gene. None of the p.Cys759Phe patients exhibited a severe hearing loss phenotype, and more than 60% had only mild hearing loss. Most patients carrying the p.Glu767Serfs*21 mutation (72.1%) were moderately deaf. Our study presents the clinical differences between type I and type II Usher syndrome and between the 2 most frequent mutations in the USH2A gene. Detailed genotype-phenotype correlations, as presented in our study, allow for a better correlation of clinical signs with a known genotype and can improve the clinical management, genetic counseling, and risk assessment of patients with Usher syndrome because an estimated prognosis of their disease can be made.

Aberrant status and clinicopathologic characteristic associations of 11 target genes in 1,321 Chinese patients with lung adenocarcinoma.

PubMed

Zhao, Mengnan; Zhan, Cheng; Li, Ming; Yang, Xiaodong; Yang, Xinyu; Zhang, Yong; Lin, Miao; Xia, Yifeng; Feng, Mingxiang; Wang, Qun

2018-01-01

The aberrant status of target genes and their associations with clinicopathologic characteristics are still unclear in primary lung adenocarcinoma. The common mutations and translocations of nine target genes were evaluated in 1,247 specimens of surgically-resected primary lung adenocarcinoma. Immunohistochemistry was used to analyze the expressions of programmed death-1 (PD-1)/programmed death-ligand 1 (PD-L1) in 731 specimens. The frequency of the aberrations and their associations with clinicopathologic characteristics were analyzed. Overall, 952 (76.3%) of 1,247 patients harbored at least one target mutation or translocation: epidermal growth factor receptor ( EGFR ) (729, 58.5%), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog ( KRAS ) (83, 6.7%), human epidermal growth factor receptor 2 ( HER2 ) (82, 6.6%), anaplastic lymphoma kinase ( ALK) (23, 1.8%), phosphoinositide-3-kinase catalytic alpha polypeptide ( PIK3CA ) (20, 1.6%), Ret proto-oncogene RET (15, 1.2%), ROS proto-oncogene 1 receptor tyrosine kinase ( ROS1 ) (12, 1.0%), B-raf proto-oncogene ( BRAF ) (9, 0.7%), neuroblastoma RAS viral (v-ras) oncogene homolog ( NRAS ) (3, 0.2%). Fourteen (1.9%) of 731 patients were PD-1 positive and 95 (13.0%) were PD-L1 positive in tumor cells. In men and smokers, there were more frequent KRAS mutations (both P<0.001) and PD-L1 positive tumors (P<0.001, P=0.005, respectively), and less frequent EGFR mutations (P=0.049, <0.001, respectively). In ground-glass opacity (GGO) or ground-glass nodules (GGN), there were more HER2 (P=0.033) but less EGFR (P=0.025) and PIK3CA mutations (P=0.012), and ALK translocations (P=0.014). EGFR (P<0.001), KRAS mutations (P=0.004) and PD-L1 positive tumors (P=0.046) were more frequent in older patients, while HER2 (P<0.001), ALK (P=0.005) and ROS1 aberrations (P=0.044) were less frequent. Invasive mucinous adenocarcinoma was significantly associated with KRAS and ALK aberrations (both P<0.001), while solid predominant adenocarcinoma was associated with ROS1 translocations (P=0.036) and PD-L1 expression (P<0.001). KRAS, HER2, and ALK aberrations were scarce in patients with EGFR mutations (all P<0.001), while PD-L1 positive tumors positively correlated with ALK translocations (P=0.031) and negatively correlated with HER2 mutations (P=0.019). Most patients with primary lung adenocarcinoma harbored target gene aberrations. The frequency of each alteration differed in patients depending on clinicopathologic characteristics.

Acute intermittent porphyria in Argentina: an update.

PubMed

Cerbino, Gabriela Nora; Gerez, Esther Noemí; Varela, Laura Sabina; Melito, Viviana Alicia; Parera, Victoria Estela; Batlle, Alcira; Rossetti, María Victoria

2015-01-01

Porphyrias are a group of metabolic diseases that arise from deficiencies in the heme biosynthetic pathway. A partial deficiency in hydroxymethylbilane synthase (HMBS) produces a hepatic disorder named Acute Intermittent Porphyria (AIP); the acute porphyria is more frequent in Argentina. In this paper we review the results obtained for 101 Argentinean AIP families and 6 AIP families from foreign neighbour countries studied at molecular level at Centro de Investigaciones sobre Porfirinas y Porfirias (CIPYP). Thirty-five different mutations were found, of which 14 were described for the first time in our population. The most prevalent type of mutations was the missense mutations (43%) followed by splice defects (26%) and small deletions (20%). An odd case of a double heterozygous presentation of AIP in a foreign family from Paraguay is discussed. Moreover, it can be noted that 38 new families were found carrying the most frequent mutation in Argentina (p.G111R), increasing to 55.66% the prevalence of this genetic change in our population and adding further support to our previous hypothesis of a founder effect for this mutation in Argentina. Identification of patients with an overt AIP is important because treatment depends on an accurate diagnosis, but more critical is the identification of asymptomatic relatives to avoid acute attacks which may progress to death.