Sample records for frequently sampled iv

  1. Frequent ultraviolet brightenings observed in a solar active region with solar maximum mission

    NASA Technical Reports Server (NTRS)

    Porter, J. G.; Toomre, J.; Gebbie, K. B.

    1984-01-01

    Observations of the temporal behavior of ultraviolet emission from bright points within an active region of the sun are reported. Frequent and rapid brightenings in Si IV and O IV line emission are seen. The observations suggest that intermittent heating events of modest amplitude are occurring at many sites within an active region. By selecting the brightest site at any given time within an active region and then sampling its behavior in detail within a 120 s interval, it is found that about two-thirds of the samples show variations of the Si IV line intensity. The brightenings typically last about 40-60 s; intensity increases of about 20-100 percent are frequently observed. The results suggest that heating due to magnetic field reconnection within an active region is proceeding almost stochastically. Events involving only a modest release of energy occur the most frequently.

  2. Construct Validity of the WISC-IV[superscript UK] with a Large Referred Irish Sample

    ERIC Educational Resources Information Center

    Watkins, Marley W.; Canivez, Gary L.; James, Trevor; James, Kate; Good, Rebecca

    2013-01-01

    Irish educational psychologists frequently use the Wechsler Intelligence Scale for Children-Fourth U.K. Edition (WISC-IV[superscript UK]) in clinical assessments of children with learning difficulties. Unfortunately, reliability and validity studies of the WISC-IV[superscript UK] have not yet been reported. This study examined the construct…

  3. Construct Validity of the WISC-IV with a Referred Sample: Direct versus Indirect Hierarchical Structures

    ERIC Educational Resources Information Center

    Canivez, Gary L.

    2014-01-01

    The Wechsler Intelligence Scale for Children--Fourth Edition (WISC-IV) is one of the most frequently used intelligence tests in clinical assessments of children with learning difficulties. Construct validity studies of the WISC-IV have generally supported the higher order structure with four correlated first-order factors and one higher-order…

  4. Comparison of DSM-IV and DSM-5 criteria for alcohol use disorders in VA primary care patients with frequent heavy drinking enrolled in a trial.

    PubMed

    Takahashi, Traci; Lapham, Gwen; Chavez, Laura J; Lee, Amy K; Williams, Emily C; Richards, Julie E; Greenberg, Diane; Rubinsky, Anna; Berger, Douglas; Hawkins, Eric J; Merrill, Joseph O; Bradley, Katharine A

    2017-07-18

    Criteria for alcohol use disorders (AUD) in the Diagnostic and Statistical Manual of Mental Disorders, 5th edition (DSM-5) were intended to result in a similar prevalence of AUD as DSM-IV. We evaluated the prevalence of AUD using DSM-5 and DSM-IV criteria, and compared characteristics of patients who met criteria for: neither DSM-5 nor DSM-IV AUD, DSM-5 alone, DSM-IV alone, or both, among Veterans Administration (VA) outpatients in the Considering Healthier drinking Options In primary CarE (CHOICE) trial. VA primary care patients who reported frequent heavy drinking and enrolled in the CHOICE trial were interviewed at baseline using the DSM-IV Mini International Neuropsychiatric Interview for AUD, as well as questions about socio-demographics, mental health, alcohol craving, and substance use. We compared characteristics across 4 mutually exclusive groups based on DSM-5 and DSM-IV criteria. Of 304 participants, 13.8% met criteria for neither DSM-5 nor DSM-IV AUD; 12.8% met criteria for DSM-5 alone, and 73.0% met criteria for both DSM-IV and DSM-5. Only 1 patient (0.3%) met criteria for DSM-IV AUD alone. Patients meeting both DSM-5 and DSM-IV criteria had more negative drinking consequences, mental health symptoms and self-reported readiness to change compared with those meeting DSM-5 criteria alone or neither DSM-5 nor DSM-IV criteria. In this sample of primary care patients with frequent heavy drinking, DSM-5 identified 13% more patients with AUD than DSM-IV. This group had a lower mental health symptom burden and less self-reported readiness to change compared to those meeting criteria for both DSM-IV and DSM-5 AUD. Trial Registration ClinicalTrials.gov NCT01400581. 2011 February 17.

  5. Autism and Intellectual Disability: A Study of Prevalence on a Sample of the Italian Population

    ERIC Educational Resources Information Center

    La Malfa, G.; Lassi, S.; Bertelli, M.; Salvini, R.; Placidi, G. F.

    2004-01-01

    In 1994, the American Association on Mental Retardation with the DSM-IV has come to a final definition of pervasive developmental disorders (PDD), in agreement with the ICD-10. Prevalence of PDD in the general population is 0.10.15% according to the DSM-IV. PDD are more frequent in people with severe intellectual disability (ID). There is a strict…

  6. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  7. Dysthymic disorder: clinical characteristics in relation to age at onset.

    PubMed

    Barzega, G; Maina, G; Venturello, S; Bogetto, F

    2001-09-01

    The variability in the clinical presentation of dysthymia has given rise to a rich debate in literature, and various hypotheses have been proposed. One is that the clinical presentation differs in relation to age at onset. The aim of the study was to evaluate differences in socio-demographic and clinical characteristics in a sample of patients with dysthymia (DSM-IV), in relation to age at onset. 84 consecutive outpatients with a diagnosis of dysthymia (DSM-IV) were studied. All subjects were evaluated by a semistructured clinical interview and the following rating scales: HAM-A, HAM-D, MADRS, Paykel's Interview for Recent Life Events. 23.8% of the sample had early-onset (<21 yrs) dysthymia. Patients with early-onset disorder were significantly younger at the observation, more frequently female and single. They had a significantly longer duration of illness and in a significantly higher percentage had already received a specialist treatment before admission in the present trial. No differences in the frequency of symptoms were observed. A significantly higher percentage of patients with late-onset disease reported at least one stressful event in the year preceding the onset of dysthymia. A positive history of major depression was significantly more common among the early-onset group; social phobia, panic disorder and conversive disorder were also more frequent in this group. The late-onset patients frequently presented generalized anxiety disorder, substance abuse and somatization disorder. The study is retrospective and enrolls a limited number of cases. The present study agrees with other reports on the differences in clinical presentation of dysthymia according to age at onset. Although they are not actually related to age at onset, some interesting findings emerged in the symptomatological characterization of the disorder, referring to the diagnostic criteria proposed in DSM-IV.

  8. Sodium citrate vacuum tubes validation: preventing preanalytical variability in routine coagulation testing.

    PubMed

    Lima-Oliveira, Gabriel; Lippi, Giuseppe; Salvagno, Gian Luca; Montagnana, Martina; Picheth, Geraldo; Guidi, Gian Cesare

    2013-04-01

    Sometimes in-vitro diagnostic devices (e.g. blood collection tubes) are not validated before use or when the producer's brand is changed. The aim of this study was to validate five brands of sodium citrate vacuum tubes. Blood specimens from 50 volunteers were collected in five different tube brands (I: Venosafe, II: VACUETTE, III: BD Vacutainer, IV: LABOR IMPORT and V: S-Monovette). Routine coagulation tests [activated partial thromboplastin time (aPTT), prothrombin time (PT), and fibrinogen (FIB)] were performed on ACL TOP instrument using HemosIL reagents. The significance of the differences between samples was assessed by paired Student's t-test, set at P < 0.005. Significant differences were observed for: PT when comparing I vs. II, I vs. III, I vs. V, II vs. III, II vs. IV, II vs. V, III vs. IV, III vs. V and IV vs. V; aPTT when comparing I vs. II, I vs. III, I vs. IV, II vs. IV, III vs. IV and IV vs. V. No differences were observed among brands for FIB determination. We suggest that every laboratory management should both standardize the procedures and frequently evaluate the quality of in-vitro diagnostic devices.

  9. Construct Validity of the Wechsler Intelligence Scale for Children-Fourth UK Edition with a Referred Irish Sample: Wechsler and Cattell-Horn-Carroll Model Comparisons with 15 Subtests

    ERIC Educational Resources Information Center

    Canivez, Gary L.; Watkins, Marley W.; Good, Rebecca; James, Kate; James, Trevor

    2017-01-01

    Background: Irish educational psychologists frequently use the Wechsler Intelligence Scale for Children-Fourth UK Edition (WISC-IV[superscript UK]; Wechsler, 2004, Wechsler Intelligence Scale for Children-Fourth UK Edition, London, UK, Harcourt Assessment) in clinical assessments of children with learning difficulties. Unfortunately, reliability…

  10. Use and Effectiveness of Intraperitoneal Chemotherapy for Treatment of Ovarian Cancer

    PubMed Central

    Wright, Alexi A.; Cronin, Angel; Milne, Dana E.; Bookman, Michael A.; Burger, Robert A.; Cohn, David E.; Cristea, Mihaela C.; Griggs, Jennifer J.; Keating, Nancy L.; Levenback, Charles F.; Mantia-Smaldone, Gina; Matulonis, Ursula A.; Meyer, Larissa A.; Niland, Joyce C.; Weeks, Jane C.; O'Malley, David M.

    2015-01-01

    Purpose A 2006 randomized trial demonstrated a 16-month survival benefit with intraperitoneal and intravenous (IP/IV) chemotherapy administered to patients who had ovarian cancer, compared with IV chemotherapy alone, but more treatment-related toxicities. The objective of this study was to examine the use and effectiveness of IP/IV chemotherapy in clinical practice. Patients and Methods Prospective cohort study of 823 women with stage III, optimally cytoreduced ovarian cancer diagnosed at six National Comprehensive Cancer Network institutions. We examined IP/IV chemotherapy use in all patients diagnosed between 2003 and 2012 (N = 823), and overall survival and treatment-related toxicities with Cox regression and logistic regression, respectively, in a propensity score–matched sample (n = 402) of patients diagnosed from 2006 to 2012, excluding trial participants, to minimize selection bias. Results Use of IP/IV chemotherapy increased from 0% to 33% between 2003 and 2006, increased to 50% from 2007 to 2008, and plateaued thereafter. Between 2006 and 2012, adoption of IP/IV chemotherapy varied by institution from 4% to 67% (P < .001) and 43% of patients received modified IP/IV regimens at treatment initiation. In the propensity score–matched sample, IP/IV chemotherapy was associated with significantly improved overall survival (3-year overall survival, 81% v 71%; hazard ratio, 0.68; 95% CI, 0.47 to 0.99), compared with IV chemotherapy, but also more frequent alterations in chemotherapy delivery route (adjusted rates discontinuation or change, 20.4% v 10.0%; adjusted odds ratio, 2.83; 95% CI, 1.47 to 5.47). Conclusion Although the use of IP/IV chemotherapy increased significantly at National Comprehensive Cancer Network centers between 2003 and 2012, fewer than 50% of eligible patients received it. Increasing IP/IV chemotherapy use in clinical practice may be an important and underused strategy to improve ovarian cancer outcomes. PMID:26240233

  11. DSM-IV hypochondriasis in primary care.

    PubMed

    Escobar, J I; Gara, M; Waitzkin, H; Silver, R C; Holman, A; Compton, W

    1998-05-01

    The object of this study was to assess the prevalence and correlates of the DSM-IV diagnosis of hypochondriasis in a primary care setting. A large sample (N = 1456) of primary care users was given a structured interview to make diagnoses of mood, anxiety, and somatoform disorders and estimate levels of disability. The prevalence of hypochondriasis (DSM-IV) was about 3%. Patients with this disorder had higher levels of medically unexplained symptoms (abridged somatization) and were more impaired in their physical functioning than patients without the disorder. Of the various psychopathologies examined, major depressive syndromes were the most frequent among patients with hypochondriasis. Interestingly, unlike somatization disorder, hypochondriasis was not related to any demographic factor. Hypochondriasis is a relatively rare condition in primary care that is largely separable from somatization disorder but seems closely intertwined with the more severe depressive syndromes.

  12. Construct validity of the Wechsler Intelligence Scale for Children - Fourth UK Edition with a referred Irish sample: Wechsler and Cattell-Horn-Carroll model comparisons with 15 subtests.

    PubMed

    Canivez, Gary L; Watkins, Marley W; Good, Rebecca; James, Kate; James, Trevor

    2017-09-01

    Irish educational psychologists frequently use the Wechsler Intelligence Scale for Children - Fourth UK Edition (WISC-IV UK ; Wechsler, 2004, Wechsler Intelligence Scale for Children-Fourth UK Edition, London, UK, Harcourt Assessment) in clinical assessments of children with learning difficulties. Unfortunately, reliability and validity studies of the WISC-IV UK standardization sample have not yet been reported. Watkins et al. (2013, International Journal of School and Educational Psychology, 1, 102) found support for a bifactor structure with a large sample (N = 794) of Irish children who were administered the 10 WISC-IV UK core subtests in clinical assessments of learning difficulties and dominance of general intelligence. Because only 10 subtests were available, Cattell-Horn-Carroll (CHC; McGrew, 1997, 2005, Contemporary intellectual assessment: Theories, tests, and issues, New York, NY: Guilford; Schneider & McGrew, 2012, Contemporary intellectual assessment: Theories, tests, and issues, New York, NY, Guilford Press) models could not be tested and compared. The present study utilized confirmatory factor analyses to test the latent factor structure of the WISC-IV UK with a sample of 245 Irish children administered all 15 WISC-IV UK subtests in evaluations assessing learning difficulties in order to examine CHC- and Wechsler-based models. One through five, oblique first-order factor models and higher order versus bifactor models were examined and compared using CFA. Meaningful differences in fit statistics were not observed between the Wechsler and CHC representations of higher-order or bifactor models. In all four structures, general intelligence accounted for the largest portions of explained common variance, whereas group factors accounted for small to miniscule portions of explained common variance. Omega-hierarchical subscale coefficients indicated that unit-weighted composites that would be generated by WISC-IV UK group factors (Wechsler or CHC) would contain little unique variance and thus be of little value. These results were similar to those from other investigations, further demonstrating the replication of the WISC-IV factor structure across cultures and the importance of focusing primary interpretation on the FSIQ. © 2017 The British Psychological Society.

  13. The Dutch Cannabis Dependence (CanDep) study on the course of frequent cannabis use and dependence: objectives, methods and sample characteristics.

    PubMed

    van der Pol, Peggy; Liebregts, Nienke; de Graaf, Ron; Korf, Dirk J; van den Brink, Wim; van Laar, Margriet

    2011-09-01

    This paper presents an overview of the prospective cohort design of the Dutch Cannabis Dependence (CanDep) study, which investigates (i) the three-year natural course of frequent cannabis use (≥ three days per week in the past 12 months) and cannabis dependence; and (ii) the factors involved in the transition from frequent non-dependent cannabis use to cannabis dependence, and remission from dependence. Besides its scientific relevance, this knowledge may contribute to improve selective and indicated prevention, early detection, treatment and cannabis policies. The secondary objectives are the identification of factors related to treatment seeking and the validation of self report measures of cannabis use. Between September 2008 and April 2009, baseline data were collected from 600 frequent cannabis users with an average age of 22.1 years, predominantly male (79.3%) and an average cannabis use history of 7.1 years; 42.0% fulfilled a (12-month DSM-IV) diagnosis of cannabis dependence. The response rate was 83.7% after the first follow up at 18 months. The second and last follow-up is planned at 36 months. Computer assisted personal interviews (CAPI) were conducted which covered: cannabis use (including detailed assessments of exposure, motives for use and potency preference); use of other substances; DSM-IV internalizing and externalizing mental disorders; treatment seeking; personality; life events; social support and social functioning. Copyright © 2011 John Wiley & Sons, Ltd.

  14. The Dutch Cannabis Dependence (CanDep) study on the course of frequent cannabis use and dependence: objectives, methods and sample characteristics

    PubMed Central

    van der Pol, Peggy; Liebregts, Nienke; de Graaf, Ron; Korf, Dirk J; van den Brink, Wim; van Laar, Margriet

    2011-01-01

    This paper presents an overview of the prospective cohort design of the Dutch Cannabis Dependence (CanDep) study, which investigates (i) the three-year natural course of frequent cannabis use (≥ three days per week in the past 12 months) and cannabis dependence; and (ii) the factors involved in the transition from frequent non-dependent cannabis use to cannabis dependence, and remission from dependence. Besides its scientific relevance, this knowledge may contribute to improve selective and indicated prevention, early detection, treatment and cannabis policies. The secondary objectives are the identification of factors related to treatment seeking and the validation of self report measures of cannabis use. Between September 2008 and April 2009, baseline data were collected from 600 frequent cannabis users with an average age of 22.1 years, predominantly male (79.3%) and an average cannabis use history of 7.1 years; 42.0% fulfilled a (12-month DSM-IV) diagnosis of cannabis dependence. The response rate was 83.7% after the first follow up at 18 months. The second and last follow-up is planned at 36 months. Computer assisted personal interviews (CAPI) were conducted which covered: cannabis use (including detailed assessments of exposure, motives for use and potency preference); use of other substances; DSM-IV internalizing and externalizing mental disorders; treatment seeking; personality; life events; social support and social functioning. Copyright © 2011 John Wiley & Sons, Ltd. PMID:21815231

  15. Prevalence, correlates, comorbidities, and suicidal tendencies of premenstrual dysphoric disorder in a nationwide sample of Korean women.

    PubMed

    Hong, Jin Pyo; Park, Subin; Wang, Hee-Ryung; Chang, Sung Man; Sohn, Jee Hoon; Jeon, Hong Jin; Lee, Hae Woo; Cho, Seong-Jin; Kim, Byung-Soo; Bae, Jae Nam; Cho, Maeng Je

    2012-12-01

    We examined the prevalence, correlates, comorbidities, and suicidal tendencies of premenstrual dysphoric disorder (PMDD) according to the DSM-IV criteria in a nationwide sample of Korean women. A total of 2,499 women aged 18-64 years participated in this study. Diagnostic assessments were based on the Korean version of the Composite International Diagnostic Interview (CIDI) 2.1 and its 12-month PMDD diagnostic module, which were administered by lay interviewers. The frequencies of DSM-IV psychiatric disorders, insomnia, and suicidal tendency were analyzed among PMDD cases and compared with non-PMDD cases, and both odds ratios and significance levels were calculated. The 12-month prevalence rate of DSM-IV-diagnosed PMDD was 2.4 %. Among subjects with PMDD, 59.3 % had at least one psychiatric illness; in comparison, the control frequency was 21.8 %. Associations between PMDD and alcohol abuse/dependence, major depressive disorder, post-traumatic stress disorder, social phobia, specific phobia, somatoform disorder, insomnia, and suicidality were overwhelmingly positive and significant (p < 0.05), after controlling for age. Physical illness and being underweight were associated with increased risks of PMDD (p < 0.05). PMDD was prevalent in the nationwide sample of Korean women and was frequently associated with other psychiatric disorders, insomnia, and suicidality, suggesting the need to detect and treat women who experience PMDD.

  16. Is Salvage of Recently Infected Breast Implant After Breast Augmentation or Reconstruction Possible? An Experimental Study.

    PubMed

    Castus, P; Heymans, O; Melin, P; Renwart, L; Henrist, C; Hayton, E; Mordon, S; Leclère, F M

    2018-04-01

    The reinsertion of an infected implant when peri-prosthetic infection occurs early after breast augmentation or breast reconstruction remains controversial. In this experimental study, the authors tried to remove bacteria, and their biofilm, from the colonized surface of breast prostheses, without damaging their integrity. A total of 112 shell samples of silicone breast prostheses, smooth (SPSS) and textured (TPSS), were colonized by S. epidermidis (SE) or S. aureus (SA) strains, all able to produce biofilms. After 15 days, all the samples were removed from the contaminated culture broth and constituted 4 groups of 20 contaminated samples: SPSS/SE (group I), SPSS/SA (group II), TPSS/SE (group III), TPSS/SE (group IV). In another group-group SEM-, 16 colonized samples were used for documentation with scanning electron microscopy (SEM). The remaining 16 samples were used to test the limits of detection of the sterility test. All samples of groups I-IV and 8 samples of group SEM were « washed » with a smooth brush in a povidone-iodine bath and rinsed with saline solution. A subset of the washed samples was sent for SEM and the others were immersed in sterile broth and were incubated at 35 °C for 3 weeks (groups I-IV). Fifteen days after contamination, all the samples in groups I-IV were colonized. In the SEM group, SEM images attested to the presence of bacteria in biofilm attached to the shells. After cleaning, SEM did not reveal any bacteria and there was no visible alteration in the outer structure of the shell. Sterility tests performed after decontamination in groups I-IV remained negative for all the samples. Breast prostheses recently contaminated with Staphylococci, frequently involved in peri-prosthetic breast implant infection and capable of producing biofilms, can be efficiently decontaminated by the procedure used in this study. Our decontamination procedure did not alter the surface structure of the prostheses. This decontamination procedure could allow reinsertion of an infected implant when peri-prosthetic infection occurs early after breast augmentation or breast reconstruction and when a salvage procedure is indicated. This journal requires that authors assign a level of evidence to each submission to which Evidence-Based Medicine rankings are applicable. This excludes Review Articles, Book Reviews, and manuscripts that concern Basic Science, Animal Studies, Cadaver Studies, and Experimental Studies. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

  17. Measuring Working Memory With Digit Span and the Letter-Number Sequencing Subtests From the WAIS-IV: Too Low Manipulation Load and Risk for Underestimating Modality Effects.

    PubMed

    Egeland, Jens

    2015-01-01

    The Wechsler Adult Intelligence Scale (WAIS) is one of the most frequently used tests among psychologists. In the fourth edition of the test (WAIS-IV), the subtests Digit Span and Letter-Number Sequencing are expanded for better measurement of working memory (WM). However, it is not clear whether the new extended tasks contribute sufficient complexity to be sensitive measures of manipulation WM, nor do we know to what degree WM capacity differs between the visual and the auditory modality because the WAIS-IV only tests the auditory modality. Performance by a mixed sample of 226 patients referred for neuropsychological examination on the Digit Span and Letter-Number Sequencing subtests from the WAIS-IV and on Spatial Span from the Wechsler Memory Scale-Third Edition was analyzed in two confirmatory factor analyses to investigate whether a unitary WM model or divisions based on modality or level/complexity best fit the data. The modality model showed the best fit when analyzing summed scores for each task as well as scores for the longest span. The clinician is advised to apply tests with higher manipulation load and to consider testing visual span as well before drawing conclusions about impaired WM from the WAIS-IV.

  18. 78 FR 57571 - Negotiated Rulemaking Committee, Negotiator Nominations and Schedule of Committee Meetings-Title...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-19

    ... Committee, Negotiator Nominations and Schedule of Committee Meetings--Title IV Federal Student Aid Programs... rulemaking process, see The Negotiated Rulemaking Process for Title IV Regulations, Frequently Asked... for consideration were cash management of funds provided under the title IV Federal Student Aid...

  19. Programmable Infusion Pumps in ICUs: An Analysis of Corresponding Adverse Drug Events

    PubMed Central

    Bower, Anthony G.; Paddock, Susan M.; Hilborne, Lee H.; Wallace, Peggy; Rothschild, Jeffrey M.; Griffin, Anne; Fairbanks, Rollin J.; Carlson, Beverly; Panzer, Robert J.; Brook, Robert H.

    2007-01-01

    Background Patients in intensive care units (ICUs) frequently experience adverse drug events involving intravenous medications (IV-ADEs), which are often preventable. Objectives To determine how frequently preventable IV-ADEs in ICUs match the safety features of a programmable infusion pump with safety software (“smart pump”) and to suggest potential improvements in smart-pump design. Design Using retrospective medical-record review, we examined preventable IV-ADEs in ICUs before and after 2 hospitals replaced conventional pumps with smart pumps. The smart pumps alerted users when programmed to deliver duplicate infusions or continuous-infusion doses outside hospital-defined ranges. Participants 4,604 critically ill adults at 1 academic and 1 nonacademic hospital. Measurements Preventable IV-ADEs matching smart-pump features and errors involved in preventable IV-ADEs. Results Of 100 preventable IV-ADEs identified, 4 involved errors matching smart-pump features. Two occurred before and 2 after smart-pump implementation. Overall, 29% of preventable IV-ADEs involved overdoses; 37%, failures to monitor for potential problems; and 45%, failures to intervene when problems appeared. Error descriptions suggested that expanding smart pumps’ capabilities might enable them to prevent more IV-ADEs. Conclusion The smart pumps we evaluated are unlikely to reduce preventable IV-ADEs in ICUs because they address only 4% of them. Expanding smart-pump capabilities might prevent more IV-ADEs. PMID:18095043

  20. Metapopulation structure of the specialized herbivore Macrosiphoniella tanacetaria (Homoptera, Aphididae).

    PubMed

    Massonnet, Blandine; Simon, Jean-Christophe; Weisser, Wolfgang W

    2002-12-01

    We investigated population dynamics, genetic diversity and spatial structure in the aphid species Macrosiphoniella tanacetaria, a specialist herbivore feeding on tansy, Tanacetum vulgare. Tansy plants (genets) consist of many shoots (ramets), and genets are grouped in sites. Thus, aphids feeding on tansy can cluster at the level of ramets, genets and sites. We studied aphid population dynamics in 1997 and 2001 and found that within sites: (i). at any time, aphids used only a fraction of the available ramets and genets; (ii). at the level of ramets, most aphid colonies survived only one week; (iii). at the level of genets, mean survival time was less than 4 weeks; and (iv). colonization and extinction events occurred throughout the season. We sampled aphids in seven sites in the Alsace region, France (4-45 km apart) and two sites in Germany in 1999 to study genetic structure within and between populations. Genetic analyses using nine microsatellite loci showed that: (i). genotypic variability was high, (ii). none of the populations was in Hardy-Weinberg equilibrium, (iii). heterozygote deficits and linkage disequilibria were frequent, and (iv). all populations were genetically differentiated, even at a small geographical scale. Renewed sampling of the Alsace sites in 2001 showed that three populations had become extinct and significant genetic changes had occurred in the remaining four populations. The frequencies of extinction and colonization events at several spatial scales suggest a hierarchical metapopulation structure for M. tanacetaria. Frequent population turnover and drift are likely causes for the genetic differentiation of M. tanacetaria populations.

  1. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  2. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  3. Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China

    PubMed Central

    WANG, ZHANG-YANG; HONG, WEI-LONG; ZHU, ZHE-HUI; CHEN, YUN-HAO; YE, WEN-LE; CHU, GUANG-YU; LI, JIA-LIN; CHEN, BI-CHENG; XIA, PENG

    2015-01-01

    BK polyomavirus (BKV) is important pathogen for kidney transplant recipients, as it is frequently re-activated, leading to nephropathy. The aim of this study was to investigate the phylogenetic reconstruction and polymorphism of the VP2 gene in BKV isolated from Chinese kidney transplant recipients. Phylogenetic analysis was carried out in the VP2 region from 135 BKV-positive samples and 28 reference strains retrieved from GenBank. The unweighted pair-group method with arithmetic mean (UPGMA) grouped all strains into subtypes, but failed to subdivide strains into subgroups. Among the plasma and urine samples, all plasma (23/23) and 82 urine samples (82/95) were identified to contain subtype I; the other 10 urine samples contained subtype IV. A 86-bp fragment was identified as a highly conserved sequence. Following alignment with 36 published BKV sequences from China, 92 sites of polymorphism were identified, including 11 single nucleotide polymorphisms (SNPs) prevalent in Chinese individuals and 30 SNPs that were specific to the two predominant subtypes I and IV. The limitations of the VP2 gene segment in subgrouping were confirmed by phylogenetic analysis. The conserved sequence and polymorphism identified in this study may be helpful in the detection and genotyping of BKV. PMID:26640547

  4. Unnoticed intrusions: dissociations of meta-consciousness in thought suppression.

    PubMed

    Baird, Benjamin; Smallwood, Jonathan; Fishman, Daniel J F; Mrazek, Michael D; Schooler, Jonathan W

    2013-09-01

    The current research investigates the interaction between thought suppression and individuals' explicit awareness of their thoughts. Participants in three experiments attempted to suppress thoughts of a prior romantic relationship and their success at doing so was measured using a combination of self-catching and experience-sampling. In addition to thoughts that individuals spontaneously noticed, individuals were frequently caught engaging in thoughts of their previous partner at experience-sampling probes. Furthermore, probe-caught thoughts were: (i) associated with stronger decoupling of attention from the environment, (ii) more likely to occur under cognitive load, (iii) more frequent for individuals with a desire to reconcile, and (iv) associated with individual differences in the tendency to suppress thoughts. Together, these data suggest that individuals can lack meta-awareness that they have begun to think about a topic they are attempting to suppress, providing novel insight into the cognitive processes that are involved in attempting to control undesired mental states. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. LPA gene: interaction between the apolipoprotein(a) size ('kringle IV' repeat) polymorphism and a pentanucleotide repeat polymorphism influences Lp(a) lipoprotein level.

    PubMed

    Røsby, O; Berg, K

    2000-01-01

    In order to search for factors influencing the Lp(a) lipoprotein level, we have examined the apolipoprotein(a) (apo(a)) size polymorphism as well as a pentanucleotide (TTTTA) repeat polymorphism in the 5' control region of the LPA gene. Lp(a) lipoprotein levels were compared between individuals with different genotypes as defined by pulsed field gel electrophoresis of DNA plugs, and PCR of DNA samples followed by polyacrylamide gel electrophoresis. DNA plugs and DNA were prepared from blood samples collected from blood donors. Twenty-seven different K IV repeat alleles were observed in the 71 women and 92 men from which apo(a) size polymorphism results were obtained. Alleles encoding 26-32 Kringle IV repeats were the most frequent. Alleles encoding seven to 11 TTTTA repeats were detected in the 84 women and 122 men included in the pentanucleotide polymorphism study, and homozygosity for eight TTTTA repeats was the most common genotype. The eight TTTTA repeat allele occurred with almost any apo(a) allele. An inverse relationship between number of K IV repeats and Lp(a) concentration was confirmed. The contributions of the apo(a) size polymorphism and the pentanucleotide repeat polymorphism to the interindividual variance of Lp(a) lipoprotein concentrations were 9.7 and 3.5%, respectively (type IV sum of squares). Nineteen per cent of the variance in Lp(a) lipoprotein level appeared to be the result of the multiplication product (interaction) between the apo(a) size polymorphism and the pentanucleotide repeat polymorphism. The contribution of the apo(a) size polymorphism alone to the variation in Lp(a) lipoprotein level was lower than previously reported. However, the multiplicative interaction effect between the K IV repeat polymorphism and the pentanucleotide repeat polymorphism may be an important factor explaining the variation in Lp(a) lipoprotein levels among the populations.

  6. Consequences of receipt of a psychiatric diagnosis for completion of college.

    PubMed

    Hunt, Justin; Eisenberg, Daniel; Kilbourne, Amy M

    2010-04-01

    The purpose of this study was to evaluate the independent associations between DSM-IV psychiatric disorders and the failure to complete college among college entrants. Data were from the 2001-2002 National Epidemiologic Survey on Alcohol and Related Conditions (NESARC). The sample included 15,800 adults, aged 22 years and older, who at least entered college. Diagnoses were made with the NESARC survey instrument, the Alcohol Use Disorder and Associated Disability Interview Schedule-DSM-IV Version. The large sample permitted analysis of multiple psychiatric disorders in the same multivariable logistic regression models. Given the frequent comorbidity of these disorders, this approach is an important step toward disentangling the independent roles of disorders in postsecondary educational outcomes. Evaluation of the independent associations between specific psychiatric disorders and postsecondary educational attainment showed that five diagnoses were positively and significantly associated with the failure to graduate from college. Four were axis I diagnoses: bipolar I disorder, marijuana use disorder, amphetamine use disorder, and cocaine use disorder. One was an axis II diagnosis: antisocial personality disorder. This study provides new data on DSM-IV diagnoses associated with the failure to complete postsecondary education. The findings suggest that psychiatric factors play a significant role in college academic performance, and the benefits of prevention, detection, and treatment of psychiatric illness may therefore include higher college graduation rates.

  7. Bipolar disorder in children and adolescents: international perspective on epidemiology and phenomenology.

    PubMed

    Soutullo, César A; Chang, Kiki D; Díez-Suárez, Azucena; Figueroa-Quintana, Ana; Escamilla-Canales, Inmaculada; Rapado-Castro, Marta; Ortuño, Felipe

    2005-12-01

    There is considerable skepticism outside the US over the prevalence of pediatric bipolar disorder (BD). We wished to evaluate the epidemiology of BD in children and adolescents in non-US samples. We reviewed studies on the prevalence of BD in children and adolescents in international samples. We also describe our sample of 27 children with BD at the University of Navarra. There are important and frequently overlooked differences in the definition of BD between the International Classification of Diseases 10th edition (ICD-10) and DSM-IV and methodological differences in epidemiological studies that may partially explain international differences in prevalence of pediatric BD. The prevalence of bipolar spectrum disorder in young adults in Switzerland is 11%. In Holland the 6-month prevalence of mania in adolescents was 1.9% and of hypomania 0.9%. Only 1.2% of hospitalized youth (<15 years) in Denmark and 1.7% of adolescents in Finland had BD. In our clinic, the prevalence of DSM-IV BD in children 5-18 years old is 4%, and of any mood disorders 27%. There are also data from Brazil, India and Turkey with varying results. Relative lack of data, ICD-10 and DSM-IV differences in diagnostic criteria, different levels of recognition of Child and Adolescent Psychiatry as a true specialty in Europe, clinician bias against BD, an overdiagnosis of the disorder in USA and/or a true higher prevalence of pediatric BD in USA may explain these results. US-International differences may be a methodological artifact and research is needed in this field.

  8. EPIDEMIOLOGICAL STUDY ON LISFRANC INJURIES

    PubMed Central

    SOBRADO, MARCEL FARACO; SAITO, GUILHERME HONDA; SAKAKI, MARCOS HIDEYO; PONTIN, PEDRO AUGUSTO; SANTOS, ALEXANDRE LEME GODOY DOS; FERNANDES, TÚLIO DINIZ

    2017-01-01

    ABSTRACT Objective: To analyze the characteristics of patients with Lisfranc injuries and their associated fractures. Methods: This is a retrospective analysis on 42 patients with Lisfranc injuries hospitalized at Instituto de Ortopedia e Traumatologia do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, between 2006 and 2010. Parameters on patient profile, risk factors, fracture characteristics, data on treatment and acute complications were analyzed. Results: Analysis of 42 cases showed that in our sample, men were more affected than women, with a ratio of 4.25:1. The most frequent trauma mechanism was car accident, followed by motorcycle accident. The most frequent type of injury was isolated lesion type B of Quenu and Kuss classification, representing 50% of cases. The most common fracture on the sample was the second metatarsal bone, with 16 cases, followed by cuboid bone fracture. Among the 42 cases, 17% had exposed fractures and 33 patients presented other associated fractures. The mean time elapsed between the trauma and definitive treatment was 6.7 days, while the mean length of hospital stay was 13.8 days. Six patients presented acute postoperative complications. Conclusion: Lisfranc injuries are more common in men undergoing automobile trauma. The prevalence of associated fractures is a frequent finding and the hospital stay may be longstanding.Level of Evidence IV, Case Series. PMID:28642650

  9. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  10. HIV infection among intravenous drug users: epidemiology and risk reduction.

    PubMed

    Des Jarlais, D C; Friedman, S R

    1987-07-01

    Research on the epidemiology of HIV infection among IV drug users is still at a relatively early stage. Multilocation studies that would permit better geographic comparisons are greatly needed. Multi-method studies within single geographic areas are also needed to assess possible biases with respect to sample recruitment and data collection procedures. The continuation of the epidemic provides a changing historical context that complicates any comparisons. Despite these problems, there are some consistencies that can be seen across studies. Studies of HIV seroprevalence among IV drug users show wide variation among cities in the United States and Europe. The time that the virus was introduced into the IV drug using group within the city is one factor in explaining these differences; other cross-city factors have yet to be identified. Once HIV has been introduced into the IV drug use group within a particular geographic area, there is the possibility of rapid spread up to seroprevalence levels of 50% or greater. Thus, a currently low seroprevalence rate should not be seen as a stable situation. Frequency of injection and sharing of equipment with multiple other drug users (particularly at shooting galleries) have been frequently associated with HIV exposure. Being female, ethnicity (in the USA) and engaging in prostitution also may be associated with increased risk for HIV exposure, suggesting that prevention programs should include special consideration of sex and ethnic differences. Studies of AIDS risk reduction show that substantial proportions of IV drug users are changing their behavior to avoid exposure to HIV. This risk reduction is probably more advanced in New York, with its high seroprevalence and incidence of cases, but is also occurring in cities with lower seroprevalence and limited numbers of cases. The primary forms of risk reduction are increasing the use of sterile equipment, reducing the number of needle sharing partners, and reducing the frequency of injection. These behavior changes are very similar to the frequently identified behavioral risk factors associated with HIV exposure, suggesting that they should be effective in at least slowing the spread of HIV among IV drug users. No linkage of risk reduction to decreases in seroconversion has yet been shown, however, and greater risk reduction is clearly required. A variety of prevention strategies will probably be needed to reduce the spread of HIV among IV drug users. Prevention of initiation into drug injection is an undeniable long-term goal for the control of HIV infection, but there is very little research being conducted in this area.

  11. Non-psychotic psychiatric disorders after childbirth: prevalence and comorbidity in a community sample.

    PubMed

    Navarro, Purificación; García-Esteve, Lluïsa; Ascaso, Carlos; Aguado, Jaume; Gelabert, Estel; Martín-Santos, Rocío

    2008-07-01

    Postnatal psychiatric morbidity is a frequent and serious complication of childbirth. The aim of the present study was to determine the prevalence and co-occurrence of DSM-IV psychiatric disorders in a community sample of postpartum Spanish mothers. A two-phase cross-sectional study was conducted in which all consecutive women attending the routine 6-week postnatal control visit at the Department of Obstetric and Gynecology of a university-affiliated hospital over a one year period were included. In the first phase, 1453 women were screened with the Edinburgh Postnatal Depression Scale (EPDS). In the second phase, 428 participants stratified according to employment status and EPDS outcomes were randomly selected within each stratum for clinical psychiatric evaluation using the Structured Clinical Interview for DSM-IV. Weighted prevalence estimates were obtained for DSM-IV disorders with or without comorbidity. The overall 6-week prevalence rate for postpartum psychiatric disorders was 18.1% (95% CI 15.0-21.8) and 2.0% (95% CI 1.2-2.9) of postpartum women met criteria for more than one disorder. Mood disorders was the most prevalent group (9.8%; 95% CI 7.9-12.1) followed by adjustment disorders (4.3%; 95% CI 3.0-6.3), and anxiety disorders (4%; 95% CI 3.0-6.3). Comorbidity was associated to major depressive disorder. Underestimation of some disorders due to the cross-sectional design and the use of a screening instrument with good psychometric characteristics restricted to depression, anxiety, and adjustment disorders. In the context of a 6-week postnatal visit, a high prevalence and heterogeneity of postnatal psychiatric morbidity in a community sample of Spanish women was found.

  12. Reliability and validity of the Marijuana Motives Measure among young adult frequent cannabis users and associations with cannabis dependence.

    PubMed

    Benschop, Annemieke; Liebregts, Nienke; van der Pol, Peggy; Schaap, Rick; Buisman, Renate; van Laar, Margriet; van den Brink, Wim; de Graaf, Ron; Korf, Dirk J

    2015-01-01

    The Marijuana Motives Measure (MMM) has so far been examined mainly in student populations, often with relatively limited involvement in cannabis use. This study evaluated the factor structure of the MMM in a demographically mixed sample of 600 young adult (18-30 years) frequent (≥ 3 days per week) cannabis users in the Netherlands. Analysis confirmed a five-factor solution, denoting coping, enhancement, social, conformity and expansion motives. Additionally, the original MMM was extended with two items (boredom and habit), which formed a distinct, internally consistent sixth factor labelled routine motives. In a multivariable logistic regression analysis, coping and routine motives showed significant associations with 12-month DSM-IV cannabis dependence. The results suggest general reliability and validity of the MMM in a heterogeneous population of experienced cannabis users. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Pharmacokinetics of intravenously and orally administered sotalol hydrochloride in horses and effects on surface electrocardiogram and left ventricular systolic function.

    PubMed

    Broux, B; De Clercq, D; Decloedt, A; De Baere, S; Devreese, M; Van Der Vekens, N; Ven, S; Croubels, S; van Loon, G

    2016-02-01

    Arrhythmias are common in horses. Some, such as frequent atrial or ventricular premature beats, may require long-term anti-arrhythmic therapy. In humans and small animals, sotalol hydrochloride (STL) is often used for chronic oral anti-arrhythmic therapy. STL prolongs repolarization and the effective refractory period in all cardiac tissues. No information on STL pharmacokinetics or pharmacodynamics in horses is available and the aim of this study was to evaluate the pharmacokinetics of intravenously (IV) and orally (PO) administered STL and the effects on surface electrocardiogram and left ventricular systolic function. Six healthy horses were given 1 mg STL/kg bodyweight either IV or PO. Blood samples to determine plasma STL concentrations were taken before and at several time points after STL administration. Electrocardiography and echocardiography were performed at different time points before and after IV STL administration. Mean peak plasma concentrations after IV and PO administration of STL were 1624 ng/mL and 317 ng/mL, respectively. The oral bioavailability was intermediate (48%) with maximal absorption after 0.94 h, a moderate distribution and a mean elimination half-life of 15.24 h. After IV administration, there was a significant increase in QT interval, but no significant changes in other electrocardiographic and echocardiographic parameters. Transient transpiration was observed after IV administration, but no adverse effects were noted after a single oral dose of 1 mg/kg STL in any of the horses. It was concluded that STL has an intermediate oral bioavailability in the horse and might be useful in the treatment of equine arrhythmias. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Features and prevalence of patients with probable adult attention deficit hyperactivity disorder who request treatment for cocaine use disorders.

    PubMed

    Pérez de Los Cobos, José; Siñol, Núria; Puerta, Carmen; Cantillano, Vanessa; López Zurita, Cristina; Trujols, Joan

    2011-01-30

    To characterize those patients with probable adult attention deficit hyperactivity disorder (ADHD) who ask for treatment of cocaine use disorders; to estimate the prevalence of probable adult ADHD among these patients. This is a cross-sectional and multi-center study performed at outpatient resources of 12 addiction treatment centers in Spain. Participants were treatment-seeking primary cocaine abusers recruited consecutively at one center and through convenience sampling at the other centers. Assessments included semi-structured clinical interview focused on Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV) ADHD criteria adapted to adulthood, and the Wender-Utah Rating Scale (WURS) for screening childhood history of ADHD according to patients. Probable adult ADHD was diagnosed when patients met DSM-IV criteria of ADHD in adulthood and scored WURS>32. All participants were diagnosed with current cocaine dependence (n=190) or abuse (n=15). Patients with probable adult ADHD, compared with patients having no lifetime ADHD, were more frequently male, reported higher impulsivity, and began to use nicotine, alcohol, cannabis, or cocaine earlier. Before starting the current treatment, patients with probable adult ADHD also showed higher cocaine craving for the previous day, less frequent cocaine abstinence throughout the previous week, and higher use of cocaine and tobacco during the previous month. Impulsivity and male gender were the only independent risk factors of probable adult ADHD in a logistic regression analysis. The prevalence of probable adult ADHD was 20.5% in the sub-sample of patients consecutively recruited (n=78). A diagnosis of probable adult ADHD strongly distinguishes among treatment-seeking cocaine primary abusers regarding past and current key aspects of their addictive disorder; one-fifth of these patients present with probable adult ADHD. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

  15. Factors influencing response to intravenous lacosamide in emergency situations: LACO-IV study.

    PubMed

    Garcés, Mercedes; Villanueva, Vicente; Mauri, José Angel; Suller, Ana; García, Carolina; López González, Franscisco Javier; Rodríguez Osorio, Xiana; Fernández Pajarín, Gustavo; Piera, Anna; Guillamón, Edelmira; Santafé, Consuelo; Castillo, Ascensión; Giner, Pau; Torres, Nerea; Escalza, Inés; Del Villar, Ana; García de Casasola, Maria Carmen; Bonet, Macarena; Noé, Enrique; Olmedilla, Nuria

    2014-07-01

    Status epilepticus (SE) and acute repetitive seizures (ARSs) frequently result in emergency visits. Wide variations in response are seen with standard antiepileptic drugs (AEDs). Oral and intravenous (IV) formulations of lacosamide are approved as adjunctive therapy in the treatment of partial-onset seizures in adults and adolescents. The aim of the retrospective multicenter observational study (LACO-IV) was to analyze data from a large cohort of patients with SE or ARSs of varying severity and etiology, who received IV lacosamide in the emergency setting. Patient clinical data were entered into a database; lacosamide use and efficacy and tolerability variables were analyzed. In SE, IV lacosamide tended to be used mainly in nonconvulsive status epilepticus as second- or third-line treatment. The proportion of patients with no seizures when IV lacosamide was the last drug administered was 76.5% (70.9% SE and 83.7% ARSs). The rate of seizure cessation ≤ 24 h after IV lacosamide administration was 57.1% (49.1% SE and 67.4% ARSs). Of the factors analyzed, a shorter latency from seizure onset to IV lacosamide infusion influenced treatment response significantly. A nonsignificant tendency towards a higher response was seen with lacosamide dose >200mg versus ≤ 200 mg. Analysis of response according to mechanism of action showed no significant differences in response to IV lacosamide in patients receiving prior sodium channel blocker (SCB) or non-SCB AEDs in the overall or SE population; however, in ARSs, a tendency towards a higher response was observed in those receiving non-SCB AEDs. The frequency and nature of adverse events observed were in line with those reported in other studies (somnolence being the most frequent). In the absence of randomized prospective controlled studies of IV lacosamide, our observations suggest that IV lacosamide may be a potential alternative for treatment of SE/ARSs when seizures fail to improve with standard AEDs or when AEDs are contraindicated or not recommended. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Validity of the WISC-IV Spanish for a clinically referred sample of Hispanic children.

    PubMed

    San Miguel Montes, Liza E; Allen, Daniel N; Puente, Antonio E; Neblina, Cris

    2010-06-01

    The Wechsler Intelligence Scale for Children (WISC) is the most commonly used intelligence test for children. Five years ago, a Spanish version of the WISC-IV was published (WISC-IV Spanish; Wechsler, 2005), but a limited amount of published information is available regarding its utility when assessing clinical samples. The current study included 107 children who were Spanish speaking and of Puerto Rican descent that had been administered the WISC-IV Spanish. They were subdivided into a clinical sample of 35 children with diagnoses of various forms of brain dysfunction (primarily learning disability, attention-deficit/hyperactivity disorder, and epilepsy) and a comparison group made up of 72 normal children who were part of the WISC-IV Spanish version standardization sample. Comparisons between these groups and the standardization sample were performed for the WISC-IV Spanish index and subtest scores. Results indicated that the clinical sample performed worse than the comparison samples on the Working Memory and Processing Speed Indexes, although findings varied to some extent depending on whether the clinical group was compared with the normal comparison group or the standardization sample. These findings provide support for the criterion validity of the WISC-IV Spanish when it is used to assess a clinically referred sample with brain dysfunction.

  17. Generalizability of Evidence-Based Assessment Recommendations for Pediatric Bipolar Disorder

    ERIC Educational Resources Information Center

    Jenkins, Melissa M.; Youngstrom, Eric A.; Youngstrom, Jennifer Kogos; Feeny, Norah C.; Findling, Robert L.

    2012-01-01

    Bipolar disorder is frequently clinically diagnosed in youths who do not actually satisfy Diagnostic and Statistical Manual of Mental Disorders (4th ed., text revision; DSM-IV-TR; American Psychiatric Association, 1994) criteria, yet cases that would satisfy full DSM-IV-TR criteria are often undetected clinically. Evidence-based assessment methods…

  18. The Choice of Screening Instrument Matters: The Case of Problematic Cannabis Use Screening in Spanish Population of Adolescents

    PubMed Central

    Domingo-Salvany, Antónia; Barrio Anta, Gregorio; Sánchez Mañez, Amparo; Llorens Aleixandre, Noelia; Brime Beteta, Begoña; Vicente, Julián

    2013-01-01

    The aim of this study was to examine the feasibility of problem cannabis use screening instruments administration within wide school surveys, their psychometric properties, overlaps, and relationships with other variables. Students from 7 Spanish regions, aged 14–18, who attended secondary schools were sampled by two-stage cluster sampling (net sample 14,589). Standardized, anonymous questionnaire including DSM-IV cannabis abuse criteria, Cannabis Abuse Screening Test (CAST), and Severity of Dependence Scale (SDS) was self-completed with paper and pencil in the selected classrooms. Data was analysed using classical psychometric theory, bivariate tests, and multinomial logistic regression analysis. Not responding to instruments' items (10.5–12.3%) was associated with reporting less frequent cannabis use. The instruments overlapped partially, with 16.1% of positives being positive on all three. SDS was more likely to identify younger users with lower frequency of use who thought habitual cannabis use posed a considerable problem. CAST positivity was associated with frequent cannabis use and related problems. It is feasible to use short psychometric scales in wide school surveys, but one must carefully choose the screening instrument, as different instruments identify different groups of users. These may correspond to different types of problematic cannabis use; however, measurement bias seems to play a role too. PMID:25969832

  19. Interplay Between the Temporal Dynamics of the Vaginal Microbiota and Human Papillomavirus Detection

    PubMed Central

    Brotman, Rebecca M.; Shardell, Michelle D.; Gajer, Pawel; Tracy, J. Kathleen; Zenilman, Jonathan M.; Ravel, Jacques; Gravitt, Patti E.

    2014-01-01

    Background. We sought to describe the temporal relationship between vaginal microbiota and human papillomavirus (HPV) detection. Methods. Thirty-two reproductive-age women self-collected midvaginal swabs twice weekly for 16 weeks (937 samples). Vaginal bacterial communities were characterized by pyrosequencing of barcoded 16S rRNA genes and clustered into 6 community state types (CSTs). Each swab was tested for 37 HPV types. The effects of CSTs on the rate of transition between HPV-negative and HPV-positive states were assessed using continuous-time Markov models. Results. Participants had an average of 29 samples, with HPV point prevalence between 58%–77%. CST was associated with changes in HPV status (P < .001). Lactobacillus gasseri–dominated CSTs had the fastest HPV remission rate, and a low Lactobacillus community with high proportions of the genera Atopobium (CST IV-B) had the slowest rate compared to L. crispatus–dominated CSTs (adjusted transition rate ratio [aTRR], 4.43, 95% confidence interval [CI], 1.11–17.7; aTRR, 0.33, 95% CI, .12–1.19, respectively). The rate ratio of incident HPV for low Lactobacillus CST IV-A was 1.86 (95% CI, .52–6.74). Conclusions. Vaginal microbiota dominated by L. gasseri was associated with increased clearance of detectable HPV. Frequent longitudinal sampling is necessary for evaluation of the association between HPV detection and dynamic microbiota. PMID:24943724

  20. INTERNAL ROOT MORPHOLOGY IN MANDIBULAR FIRST PERMANENT MOLARS IN A KENYAN POPULATION.

    PubMed

    Muriithi, N J; Maina, S W; Okoth, J; Gathece, L W

    2012-05-01

    To determine the internal root morphology and gender variations in mandibular first permanent molars in a Kenyan population. In vitro descriptive cross sectional study. School of Dental Sciences, University of Nairobi The mesial root of mandibular first molars had two canals in 96.3% of the teeth in both males and females and-type IV canal configuration was most prevalent in the mesial root. The distal root of the mandibular first molar had one canal in 57.7% of the teeth in males and females. There were significant gender variations in the number of canals and canal configurations in the distal root. Two canals were more prevalent in females (53.6%) compared to males (30.4%) and a single canal was more frequent in males (69.6%) compared to females (46.4%) (P=0.001). Canal types 1, 11 and IV were the most frequent in the mandibular distal root. The gender variation in the frequency of canal types I, II and IV in the distal root was statistically significant (P=0.001). Most of the mandibular first molars have three canals (56%). Two canals in the distal root are more frequent among females (53.6%) compared to males (30.4%).

  1. Tetra- and Hexavalent Uranium Forms Bidentate-Mononuclear Complexes with Particulate Organic Matter in a Naturally Uranium-Enriched Peatland.

    PubMed

    Mikutta, Christian; Langner, Peggy; Bargar, John R; Kretzschmar, Ruben

    2016-10-04

    Peatlands frequently serve as efficient biogeochemical traps for U. Mechanisms of U immobilization in these organic matter-dominated environments may encompass the precipitation of U-bearing mineral(oid)s and the complexation of U by a vast range of (in)organic surfaces. The objective of this work was to investigate the spatial distribution and molecular binding mechanisms of U in soils of an alpine minerotrophic peatland (pH 4.7-6.6, E h = -127 to 463 mV) using microfocused X-ray fluorescence spectrometry and bulk and microfocused U L 3 -edge X-ray absorption spectroscopy. The soils contained 2.3-47.4 wt % organic C, 4.1-58.6 g/kg Fe, and up to 335 mg/kg geogenic U. Uranium was found to be heterogeneously distributed at the micrometer scale and enriched as both U(IV) and U(VI) on fibrous and woody plant debris (48 ± 10% U(IV), x̅ ± σ, n = 22). Bulk U X-ray absorption near edge structure (XANES) spectroscopy revealed that in all samples U(IV) comprised 35-68% of total U (x̅ = 50%, n = 15). Shell-fit analyses of bulk U L 3 -edge extended X-ray absorption fine structure (EXAFS) spectra showed that U was coordinated to 1.3 ± 0.2 C atoms at a distance of 2.91 ± 0.01 Å (x̅ ± σ), which implies the formation of bidentate-mononuclear U(IV/VI) complexes with carboxyl groups. We neither found evidence for U shells at ∼3.9 Å, indicative of mineral-associated U or multinuclear U(IV) species, nor for a substantial P/Fe coordination of U. Our data indicates that U(IV/VI) complexation by natural organic matter prevents the precipitation of U minerals as well as U complexation by Fe/Mn phases at our field site, and suggests that organically complexed U(IV) is formed via reduction of organic matter-bound U(VI).

  2. Deciphering the Diagnostic Codes: A Guide for School Counselors. Practical Skills for Counselors.

    ERIC Educational Resources Information Center

    Jones, W. Paul

    Although school counselors have more contact with children and adolescents than most other human service professionals, they are frequently left out of discussions on diagnostic coding. Ways in which school counselors can use the codes in the Diagnostic and Statistical Manual of Mental Disorders IV (DSM-IV) are explored in this text. The book…

  3. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Pt. 600, App. IV Appendix IV to Part 600...

  4. 46 CFR Appendix IV to Part 390 - Sample Addendum to Maritime Administration Capital Construction Fund Agreement

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Sample Addendum to Maritime Administration Capital Construction Fund Agreement IV Appendix IV to Part 390 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF... 390—Sample Addendum to Maritime Administration Capital Construction Fund Agreement This Agreement...

  5. Environmental contamination by Aspergillus spp. in laying hen farms and associated health risks for farm workers.

    PubMed

    Cafarchia, Claudia; Camarda, Antonio; Iatta, Roberta; Danesi, Patrizia; Favuzzi, Vincenza; Di Paola, Giancarlo; Pugliese, Nicola; Caroli, Anna; Montagna, Maria Teresa; Otranto, Domenico

    2014-03-01

    Data on the occurrence and epidemiology of Aspergillus spp. in laying hens farms are scant. With the aims of determining levels of airborne contamination in laying hen farms and evaluating the potential risk of infection for workers and animals, 57 air samples from 19 sheds (Group I), 69 from faeces (Group II), 19 from poultry feedstuffs (Group III) and 60 from three anatomical sites (i.e. nostrils, pharynx, ears) of 20 farm workers (Group IV) were cultured. The Aspergillus spp. prevalence in samples ranged from 31.6% (Group III) to 55.5% (Group IV), whereas the highest conidia concentration was retrieved in Group II (1.2 × 10(4) c.f.u. g(-1)) and in Group III (1.9 × 10(3) c.f.u. g(-1)). The mean concentration of airborne Aspergillus spp. conidia was 70 c.f.u. m(-3) with Aspergillus fumigatus (27.3%) being the most frequently detected species, followed by Aspergillus flavus (6.3%). These Aspergillus spp. were also isolated from human nostrils (40%) and ears (35%) (P<0.05) (Group IV). No clinical aspergillosis was diagnosed in hens. The results demonstrate a relationship between the environmental contamination in hen farms and presence of Aspergillus spp. on animals and humans. Even if the concentration of airborne Aspergillus spp. conidia (i.e. 70 c.f.u. m(-3)) herein detected does not trigger clinical disease in hens, it causes human colonization. Correct management of hen farms is necessary to control environmental contamination by Aspergillus spp., and could lead to a significant reduction of animal and human colonization.

  6. Referral pattern and special interests in children and adolescents with Asperger syndrome: a Turkish referred sample.

    PubMed

    Tanidir, Canan; Mukaddes, Nahit M

    2014-02-01

    To investigate the most frequent reasons for referral, the most common special interests, age at first referral to a mental health service, and the age of diagnosis in children and adolescents with Asperger syndrome living in Turkey. This study includes 61 children and adolescents diagnosed with Asperger syndrome using strict DSM-IV criteria. The mean age at first referral was 7.9 whereas the mean age when Asperger syndrome was diagnosed was 9.9, which is compatible with other studies. The most frequent reasons for the first referral were attention deficits, hyperactivity, and academic failure, and the most common special interest area was "electronic devices, computer, and technical interests". The types of special interests and referral reasons in our Asperger syndrome sample are very similar to the interest areas and referral reasons of individuals with Asperger syndrome from developed western countries indicating the universality of symptoms. It could be concluded that children and adolescents with Asperger syndrome may refer to mental health services with a variety of symptoms; therefore, it is important to make a detailed assessment of social difficulties especially in school-age children and adolescents for the differential diagnosis of Asperger syndrome.

  7. Self-assessment and characteristics of mixed depression in the French national EPIDEP study.

    PubMed

    Azorin, Jean-Michel; Kaladjian, Arthur; Adida, Marc; Fakra, Eric; Belzeaux, Raoul; Hantouche, Elie; Lancrenon, Sylvie

    2012-12-20

    Studies on mixed depression have been conducted so far on the basis of DSM-IV manic symptoms, i.e., a list of 7 symptoms which may provide limited information on the subsyndromal features associated with a full depressive episode. As part of the EPIDEP National Multisite French Study of 493 consecutive DSM-IV major depressive patients evaluated in at least two semi-structured interviews 1 month apart, 102 (23.8%) were classified as mixed depressives (≥3 hypomanic symptoms), and 146 (34%) as pure depressives (0 hypomanic symptom), after exclusion of bipolar I patients; hypomanic symptoms were assessed with the Multiple Visual Analog Scales of Bipolarity (MVAS-BP, 26 items) of Ahearn-Carroll in a self assessment format. A narrower definition of mixed depression, resting on those MVAS-BP items referring to DSM-IV hypomanic symptoms was also tested, as a sensitivity analysis. Compared to pure depressives, mixed depressive patients had more psychotic symptoms, atypical features and suicide attempts during their index episode; their illness course was characterized by early age at onset, frequent episodes, rapid cycling, and comorbidities. Mixed depressive patients were more frequently bipolar with a family history of bipolar disorder, alcohol abuse, and suicide. A dose-response relationship was found between intradepression hypomania and several clinical features, including temperament measures. The following independent variables were associated with mixed depression: hyperthymic temperament, cyclothymic temperament, irritable temperament, and alcohol abuse. Using the narrower definition of mixed depression missed risk factors such as suicidality and comorbidities. The following are the limitations of this study: retrospective design, recall bias, lack of sample homogeneity, no cross-validation of findings by hetero-evaluation of hypomanic symptoms. EPIDEP data showed the feasibility and face validity of self-assessment of intradepressive hypomania. They replicated previous findings on the severity and high suicidal risk of mixed depression profile. They confirmed, for mixed depression, that mixed states occur when mood episodes are superimposed upon temperaments of opposite polarity. They finally suggested that a definition of mixed depression only based on DSM-IV-TR hypomanic symptoms may not allow to identify the most unstable subforms of the entity. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Cystic fibrosis screening using the College panel: platform comparison and lessons learned from the first 20,000 samples.

    PubMed

    Strom, Charles M; Huang, Donghui; Buller, Arlene; Redman, Joy; Crossley, Beryl; Anderson, Ben; Entwistle, Tom; Sun, Weimin

    2002-01-01

    To determine the accuracy of two commercially available kits for cystic fibrosis (CF) genotyping and determine allele frequencies for the ACMG/ACOG recommended mutations. A total of 1,040 consecutive analyses using Roche CF Gold Strips and the ABI CF Genotyper were performed. Subsequently we performed analyses of 20,103 samples. Both kits accurately determined CF genotypes. The I148T mutation was found >100 times more frequently in carrier screening than in CF patients. Asymptomatic patients were identified who are compound heterozygotes for delta F508 and I148T. Four of 13 patients heterozygous for delta F508 and the IVS8-5T polymorphism had some symptoms of CF. Accurate and timely analysis can be performed for the ACMG CF panel. I148T is a low penetrance CF allele.

  9. 77 FR 19230 - Western Pacific Fishery Management Council; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-30

    .... Precious corals fishery and coral reef habitat status. iv. Update on Bio-Sampling Program data summary. v... precious coral fisheries. iv. Coral reef habitat status. v. Update on Bio-Sampling Program and Spearfishing... fisheries. iv. Precious corals fishery and coral reef habitat status. v. Update on Bio-Sampling Program Data...

  10. The Chemical Composition of Fogs and Clouds in Southern California.

    NASA Astrophysics Data System (ADS)

    Munger, James William

    Fog and clouds are frequent occurrences in Southern California. Their chemical composition is of interest due to their potential role in the transformation of sulfur and nitrogen oxides to sulfuric and nitric acid and in the subsequent deposition of those acids. In addition, cloud and fog droplets may be involved in the chemistry of low-molecular-weight carboxylic acids and carbonyl compounds. The major inorganic species in cloud and fogwater samples were NH_4^+, H ^+, NO_3^-, and SO_4^{2-}. Concentrations in fogwater samples were 1-10 times 10^ {-3} M; pH values ranged from ~eq2 to 6. Nitrate usually exceeded sulfate. Acidity depended on the availability of of NH_3 from agricultural operations. Stratus cloudwater had somewhat lower concentrations; pH values were in the range 3-4. The major factors accounting for variation in fog- or cloudwater composition were the preexisting aerosol and gas concentrations and variations in liquid water content. Deposition and entrainment or advection of different air masses were also important during extended cloud or fog episodes. The droplet size dependence of cloudwater composition was investigated on one occasion in an intercepted coastal stratus clouds. The observations were consistent with the hypothesis that small droplets form on small secondary aerosol composed of H_2SO _4, HNO_3, and their NH_4^+ salts, while large droplets form on large sea-salt and soil-dust aerosol. Species that can exist in the gas phase, such as HCl and HNO _3, may be found in either droplet-size fraction. Concentrations of S(IV) and CH_2 O in the range 100-1000 μm were observed in fogwater from urban sites in Southern California. Lower concentrations were observed in stratus clouds. The high levels of S(IV) and CH_2 O were attributed to the formation of hydroxymethanesulfonate (HMSA), the S(IV) adduct of CH_2O. Direct measurement of HMSA in fogwater samples from Bakersfield, CA were made by ion-pairing chromatography. Glyoxal and methylglyoxal were observed at concentrations comparable to CH_2O in fogwater samples from Riverside, CA and in stratus cloudwater samples from sites along the Santa Barbara Channel.

  11. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  12. Predictors of methamphetamine psychosis: History of ADHD-relevant childhood behaviors and drug exposure

    PubMed Central

    Salo, Ruth; Fassbender, Catherine; Iosif, Ana- Maria; Ursu, Stefan; Leamon, Martin H; Cameron, Carter

    2013-01-01

    The goal of this study was to extend our previous research that reported a significant association between Attention Deficit Hyperactivity Disorder (ADHD)-relevant childhood behaviors and the frequency of methamphetamine (MA)-induced psychotic symptoms in an expanded sample. 190 participants who met DSM-IV criteria for MA dependence were administered the Methamphetamine Experience Questionnaire that assessed MA-induced psychosis. Data related to MA exposure, comorbid drug use, education, familial psychiatric history and assessments of ADHD-relevant childhood behaviors as measured by the Wender Utah Rating Scale (WURS) were collected. Although WURS scores did not differ between 145 MAP+ and 45 MAP-subjects, MAP+ subjects with higher WURS scores were significantly more likely to report more frequent psychosis. Although mean daily MA dosage did not differ between the MAP+ and MAP- subjects, MAP+ who consumed larger doses of MA were significantly more likely to experience frequent psychosis. These data suggest that ADHD-relevant childhood behaviors may interact with MA exposure to reflect a neurobiological vulnerability related to the emergence of frequent MA-induced psychotic symptoms. These results may elucidate factors that contribute to the psychiatric sequelae of MA abuse. PMID:23896355

  13. Predictors of methamphetamine psychosis: history of ADHD-relevant childhood behaviors and drug exposure.

    PubMed

    Salo, Ruth; Fassbender, Catherine; Iosif, Ana-Maria; Ursu, Stefan; Leamon, Martin H; Carter, Cameron

    2013-12-15

    The goal of this study was to extend our previous research that reported a significant association between Attention Deficit Hyperactivity Disorder (ADHD)-relevant childhood behaviors and the frequency of methamphetamine (MA)-induced psychotic symptoms in an expanded sample. 190 participants who met DSM-IV criteria for MA dependence were administered the Methamphetamine Experience Questionnaire that assessed MA-induced psychosis. Data related to MA exposure, comorbid drug use, education, familial psychiatric history and assessments of ADHD-relevant childhood behaviors as measured by the Wender Utah Rating Scale (WURS) were collected. Although WURS scores did not differ between 145 MAP+ and 45 MAP- subjects, MAP+ subjects with higher WURS scores were significantly more likely to report more frequent psychosis. Although mean daily MA dosage did not differ between the MAP+ and MAP- subjects, MAP+ subjects who consumed larger doses of MA were significantly more likely to experience frequent psychosis. These data suggest that ADHD-relevant childhood behaviors may interact with MA exposure to reflect a neurobiological vulnerability related to the emergence of frequent MA-induced psychotic symptoms. These results may elucidate factors that contribute to the psychiatric sequelae of MA abuse. © 2013 Elsevier Ireland Ltd. All rights reserved.

  14. Sub-threshold panic attacks and agoraphobic avoidance increase comorbidity of mental disorders: results from an adult general population sample.

    PubMed

    Pané-Farré, Christiane A; Fenske, Kristin; Stender, Jan P; Meyer, Christian; John, Ulrich; Rumpf, Hans-Jürgen; Hapke, Ulfert; Hamm, Alfons O

    2013-06-01

    Full-blown panic attacks are frequently associated with other mental disorders. Most comorbidity analyses did not discriminate between isolated panic attacks vs. panic attacks that occurred in the context of a panic disorder and rarely evaluated the impact of comorbid agoraphobia. Moreover, there are no larger scale epidemiological studies regarding the influence of sub-threshold panic attacks. 4075 German-speaking respondents aged 18-64 were interviewed using the fully structured Munich Composite International Diagnostic Interview. Limited symptom attacks, isolated panic attacks, and panic disorder were associated with other lifetime DSM-IV disorders with monotonically increasing odds and increasing tendency for multiple comorbidities across the three groups. The presence of agoraphobia was associated with more frequent comorbidity in all panic subgroups and also in persons who never experienced panic attacks. The present study suggests that populations with isolated or limited symptom should be carefully attended to in clinical practice, especially if agoraphobia is present. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Interplay between the temporal dynamics of the vaginal microbiota and human papillomavirus detection.

    PubMed

    Brotman, Rebecca M; Shardell, Michelle D; Gajer, Pawel; Tracy, J Kathleen; Zenilman, Jonathan M; Ravel, Jacques; Gravitt, Patti E

    2014-12-01

    We sought to describe the temporal relationship between vaginal microbiota and human papillomavirus (HPV) detection. Thirty-two reproductive-age women self-collected midvaginal swabs twice weekly for 16 weeks (937 samples). Vaginal bacterial communities were characterized by pyrosequencing of barcoded 16S rRNA genes and clustered into 6 community state types (CSTs). Each swab was tested for 37 HPV types. The effects of CSTs on the rate of transition between HPV-negative and HPV-positive states were assessed using continuous-time Markov models. Participants had an average of 29 samples, with HPV point prevalence between 58%-77%. CST was associated with changes in HPV status (P<.001). Lactobacillus gasseri-dominated CSTs had the fastest HPV remission rate, and a low Lactobacillus community with high proportions of the genera Atopobium (CST IV-B) had the slowest rate compared to L. crispatus-dominated CSTs (adjusted transition rate ratio [aTRR], 4.43, 95% confidence interval [CI], 1.11-17.7; aTRR, 0.33, 95% CI, .12-1.19, respectively). The rate ratio of incident HPV for low Lactobacillus CST IV-A was 1.86 (95% CI, .52-6.74). Vaginal microbiota dominated by L. gasseri was associated with increased clearance of detectable HPV. Frequent longitudinal sampling is necessary for evaluation of the association between HPV detection and dynamic microbiota. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Generalizability of Evidence-Based Assessment Recommendations for Pediatric Bipolar Disorder

    PubMed Central

    Jenkins, Melissa M.; Youngstrom, Eric A.; Youngstrom, Jennifer Kogos; Feeny, Norah C.; Findling, Robert L.

    2013-01-01

    Bipolar disorder is frequently clinically diagnosed in youths who do not actually satisfy DSM-IV criteria, yet cases that would satisfy full DSM-IV criteria are often undetected clinically. Evidence-based assessment methods that incorporate Bayesian reasoning have demonstrated improved diagnostic accuracy, and consistency; however, their clinical utility is largely unexplored. The present study examines the effectiveness of promising evidence-based decision-making compared to the clinical gold standard. Participants were 562 youth, ages 5-17 and predominantly African American, drawn from a community mental health clinic. Research diagnoses combined semi-structured interview with youths’ psychiatric, developmental, and family mental health histories. Independent Bayesian estimates relied on published risk estimates from other samples discriminated bipolar diagnoses, Area Under Curve=.75, p<.00005. The Bayes and confidence ratings correlated rs =.30. Agreement about an evidence-based assessment intervention “threshold model” (wait/assess/treat) had K=.24, p<.05. No potential moderators of agreement between the Bayesian estimates and confidence ratings, including type of bipolar illness, were significant. Bayesian risk estimates were highly correlated with logistic regression estimates using optimal sample weights, r=.81, p<.0005. Clinical and Bayesian approaches agree in terms of overall concordance and deciding next clinical action, even when Bayesian predictions are based on published estimates from clinically and demographically different samples. Evidence-based assessment methods may be useful in settings that cannot routinely employ gold standard assessments, and they may help decrease rates of overdiagnosis while promoting earlier identification of true cases. PMID:22004538

  17. [A cross-sectional survey on personality disorder in mental disorder outpatients in Shanghai].

    PubMed

    Zhang, Tian-Hong; Xiao, Ze-Ping; Wang, Lan-Lan; Dai, Yun-Fei; Zhang, Hai-Yin; Qiu, Jian-Yin; Tao, Ming-Yi; Wang, Zhen; Wang, Xiao; Yu, Jun-Han; Wu, Yan-Ru; Jiang, Wen-Hui

    2010-08-01

    To study the prevalence and risk factors for personality disorder (PD) outpatients attending in for psychiatric and psychological counseling in Shanghai. 3075 subjects were sampled by systematic sampling method from outpatients in psycho-counseling clinics and psychiatric clinics in Shanghai Mental Health Center. Based on DSM-IV criteria, personality disorders were assessed by both questionnaires (personality diagnostic questionnaire, PDQ-4+) and interviews (structured clinical interview for DSM-IV Axis II, SCID-II). Logistic regression analysis was performed to determine the significant independent contributor to PD. 71.3% of the outpatients were found having pathological personality by using questionnaire of self rating PD scale. 982 outpatients (31.9%) met criteria for at least one personality disorder by using structured clinical interview. Younger age (OR = 1.8, 95%CI: 1.5 - 2.1), single or divorced (OR = 1.6, 95%CI: 1.4 - 1.9), psychological counseling outpatients (OR = 1.2, 95%CI: 1.1 - 1.3), mood and outpatients with neurosis disorders (OR = 1.7, 95%CI: 1.4 - 2.0) were more frequently assigned as personality disorders. Data from logistic regression analysis showed that patients of tender age, not nurtured and raised by their parents, with introvert characters were related risk factors of PD. High prevalence rate of PD was found in this sample of Chinese outpatients, especially in those psychological counseling outpatients with mood or neurosis disorders. More attention should be paid to the recognition and intervention of PD in outpatients with mental disorders.

  18. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  19. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  20. [Impulsive-compulsive behaviours in a German Parkinson's disease outpatient sample].

    PubMed

    Rohde, K; Riedel, O; Lueken, U; Rietzel, S; Fauser, M; Ossig, C; Reichmann, H; Storch, A

    2013-09-01

    Impulsive-compulsive behaviours (ICBs) are frequent complications of Parkinson's disease (PD), associated with treatment by dopamine agonists (DAs). These include impulse control disorders (ICDs), repetitive behaviour (RB) and the dopamine-dysregulation syndrome (DDS). A subsample of 72 patients of a large longitudinal study (n = 739) was screened with the Questionnaire for Impulsive-Compulsive Disorders in Parkinson's disease (QUIP). Results were associated with socio-demographic, clinical and neuropsychological parameters. A large proportion of the sample reported ICBs (60%), RBs were most frequent (47 %). Patients with ICBs consumed higher doses of DAs (343 ± 177 mg vs. 390 ± 153 mg; p < 0.01). Pramipexole was associated with RB but not ICDs (273 ± 225 mg and 53 ± 106 mg vs. 151 ± 209 mg in patients without ICB). Patients with ICDs reported more dyskinesias (UPDRS IV: 1.78 ± 1.6 vs. 0.55 ± 1.1 points; p = 0.012) and patients with multiple ICBs a longer duration of PD (9.3 ± 5.0 vs. 6.2 ± 4.0 years; p = 0.026) and worse quality of life (PDQ39: 29.9 ± 13.8 vs. 20.3 ± 13.4 points; p = 0.036) compared to patients without any ICB. ICBs are frequent even in outpatients with moderate duration and severity of PD and associated with DA dose. Because of possible serious psychosocial consequences, detecting and managing them is of high importance. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Evidence for S(IV) compounds other than dissolved SO2 in precipitation

    NASA Astrophysics Data System (ADS)

    Chapman, E. G.

    1986-12-01

    Preliminary results from a study characterizing S(IV) compounds in wintertime precipitation samples indicate that bisulfite ion is not the primary form of S(IV), as previously believed. By employing a differencing technique that permits estimation of both SO2 aq and non-SO2 aq compound concentrations, it was found that, on an average, more than 60 percent of the total S(IV) is present in a form other than dissolved SO2. Formaldehyde analyses on selected samples suggest that the most likely form of the S(IV) is hydroxymethanesulfonate, although other aldehyde-S(IV) adducts may also be present. The non-SO2 compounds represented a significant portion of the total sulfur concentrations present in the samples analyzed, with contributions ranging from 1.2 to 27 percent. Because of the stability and oxidation resistance of these S(IV) compounds, sulfur deposition estimates that are based solely on sulfate measurements are undoubtedly low, especially for wintertime events. The study underscores the importance of S(IV) compounds in atmospheric scavenging processes.

  2. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Sample Fuel Economy Labels for 2008... PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Pt. 600, App. IV Appendix IV to Part 600—Sample Fuel Economy Labels for 2008 and Later Model Year...

  3. Prevalence of Axis II disorders in a sample of clients undertaking psychiatric evaluation for sex reassignment surgery.

    PubMed

    Madeddu, Fabio; Prunas, Antonio; Hartmann, Diamante

    2009-12-01

    The aim of the present study is to assess the prevalence of Axis II disorders (DSM-IV-TR) in a sample of clients requesting sex reassignment surgery (SRS), consecutively admitted to a Gender Identity Disorder (GID) psychiatric unit. Fifty clients self-referred as transsexuals (34 biological males and 16 biological females; mean age = 31.74 +/- 7.06 years) were assessed through the SCID-II after a preliminary evaluation to exclude current major psychiatric disorders. Prevalence of any Axis II disorder was 52% (N = 26), with no significant differences related to biological sex. The most frequent personality disorders were Cluster B PDs (22% of total sample), followed by Cluster C (12%) and Cluster A PDs (2%). A significant prevalence of NOS PD (16%) was also found. Our data offers prevalence estimates slightly higher than those found in previous studies and does not provide evidence for any differences in the psychopathological profile and severity between MtF and FtM transsexuals.

  4. Parent and Teacher SNAP-IV Ratings of Attention Deficit Hyperactivity Disorder Symptoms: Psychometric Properties and Normative Ratings from a School District Sample

    ERIC Educational Resources Information Center

    Bussing, Regina; Fernandez, Melanie; Harwood, Michelle; Hou, Wei; Garvan, Cynthia Wilson; Eyberg, Sheila M.; Swanson, James M.

    2008-01-01

    To examine Swanson, Nolan, and Pelham-IV (SNAP-IV) psychometric properties, parent (N = 1,613) and teacher (N = 1,205) data were collected from a random elementary school student sample in a longitudinal attention deficit hyperactivity disorder (ADHD) detection study. SNAP-IV reliability was acceptable. Factor structure indicated two ADHD factors…

  5. Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.

    PubMed

    Muhammad, Raj; Shakeel, Muhammad; Rehman, Shoaib U; Lodhi, Muhammad A

    2017-03-01

    β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0-8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division.

  6. Drinking correlates of DSM-IV alcohol use disorder diagnostic orphans in college students.

    PubMed

    Hagman, Brett T; Cohn, Amy M

    2012-01-01

    One major limitation of the DSM-IV criteria for alcohol abuse and dependence is that a cluster of individuals who endorse a subthreshold number of dependence criteria and no abuse criteria do not receive a formal diagnosis; despite elevated risk for alcohol-related problems relative to those with an abuse diagnosis. These individuals have been referred to as diagnostic orphans. The primary aim of this study was to examine alcohol use correlates of a group of diagnostic orphans in a sample of 396 nontreatment seeking college students who reported drinking on at least one occasion in the last 90 days. DSM-IV criteria were assessed using a modified version of the Composite International Diagnostic Interview-Substance Abuse Module (CIDI-SAM). Diagnostic orphans represented 34.1% (n = 135) of the original sample who did not receive a formal diagnosis; with the most frequently endorsed dependence criteria being tolerance and drinking larger/longer amounts than intended. Diagnostic orphans reported a range of alcohol-related negative consequences and reported greater frequencies of social and enhancement drinking motives in comparison to coping motives. They were similar to alcohol abusers and dissimilar to those with dependence or those without a diagnosis on alcohol consumption, alcohol problem severity, drinking motives and restraint variables. The present findings indicate that diagnostic orphans in college students represent a distinct group of drinkers who may be at risk for the development of alcohol use disorders and may be in need of intervention, given their similarity to those with an abuse diagnosis. Prevention and intervention efforts across college campuses should target this group to prevent escalation of alcohol problem severity. Copyright © American Academy of Addiction Psychiatry.

  7. Assessment of DSM-5 Section II Personality Disorders With the MMPI-2-RF in a Nonclinical Sample.

    PubMed

    Sellbom, Martin; Smith, Alexander

    2017-01-01

    The Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Ben-Porath & Tellegen, 2008 / 2011 ) is frequently used in clinical practice. However, there has been a dearth of literature on how well this instrument can assess symptoms associated with personality disorders (PDs). This investigation examined a range of hypothesized MMPI-2-RF scales in predicting PD symptoms. We evaluated these associations in a sample of 397 university students who had been administered the MMPI-2-RF and the Structured Clinical Interview for DSM-IV Axis II Disorders-Personality Questionnaire (First, Gibbon, Spitzer, Williams, & Benjamin, 1997 ). Zero-order correlation analyses and negative binomial regression models indicated that a wide range of MMPI-2-RF scale hypotheses were supported; however, the least support was available for predicting schizoid and obsessive-compulsive PDs. Implications for MMPI-2-RF interpretation and PD diagnosis are discussed.

  8. Simultaneous speciation and preconcentration of ultra traces of inorganic tellurium and selenium in environmental samples by hollow fiber liquid phase microextraction prior to electrothermal atomic absorption spectroscopy determination.

    PubMed

    Ghasemi, Ensieh; Najafi, Nahid Mashkouri; Raofie, Farhad; Ghassempour, Alireza

    2010-09-15

    A simple and effective speciation and preconcentration method based on hollow fiber liquid phase microextraction (HF-LPME) was developed for simultaneous separation of trace inorganic tellurium and selenium in environmental samples prior to electrothermal atomic absorption spectroscopy (ETAAS) determination. The method involves the selective extraction of the Te (IV) and Se (IV) species by HF-LPME with the use of ammonium pyrrolidinecarbodithioate (APDC) as the chelating agent. The complex compounds were extracted into 10 microL of toluene and the solutions were injected into a graphite furnace for the determination of Te (IV) and Se (IV). To determine the total tellurium and selenium in the samples, first Te (VI) and Se (VI) were reduced to Te (IV) and Se (IV), and then the microextraction method was performed. The experimental parameters of HF-LPME were optimized using a central composite design after a 2(n-1) fractional factorial experimental design. Under optimum conditions, enrichment factors of up to 520 and 480 were achieved for Te (IV) and Se (IV), respectively. The detection limits were 4 ng L(-1) with 3.5% RSD (n=5, c=2.0 microg L(-1)) for Te (IV) and 5 ng L(-1) with 3.1% RSD for Se (IV). The applicability of the developed technique was evaluated by application to spiked, environmental water and soil samples. Copyright 2010 Elsevier B.V. All rights reserved.

  9. Correlates of frequent gambling and gambling-related chasing behaviors in individuals with schizophrenia-spectrum disorders.

    PubMed

    Yakovenko, Igor; Fortgang, Rebecca; Prentice, Jennifer; Hoff, Rani A; Potenza, Marc N

    2018-05-23

    Background and aims Published research on the relationship between disordered gambling and schizophrenia is limited. However, existing data suggest that individuals with schizophrenia/schizoaffective disorder may have a high prevalence of co-occurring disordered gambling. As such, effective strategies for screening and assessing gambling-related problems in individuals with psychosis are needed. The goal of this study was to explore the correlates of increased gambling frequency and chasing behavior, a hallmark feature of gambling disorder, in a sample of individuals with schizophrenia and schizoaffective disorders. Methods Data from 336 participants who met DSM-IV criteria for schizophrenia or schizoaffective disorder were used to examine differences between non-gamblers, infrequent gamblers, frequent gamblers who do not report chasing, and frequent gamblers who report chasing on a variety of associated features and symptoms of schizophrenia and disordered gambling. Results and discussion The results of the study support the conclusion that chasing behavior in individuals with schizophrenia/schizoaffective disorder lies on a continuum of severity, with more frequent gamblers endorsing greater chasing. Chasing was also associated with indicators of lower functioning across co-occurring disorders, such as greater problems with alcohol and drugs, greater gambling involvement, and a family history of gambling problems. The findings from the study suggest the utility of screening for chasing behavior as a brief and efficient strategy for assessing risk of gambling problems in individuals with psychotic-spectrum disorders.

  10. Loss of the smallest subunit of cytochrome c oxidase, COX8A, causes Leigh-like syndrome and epilepsy.

    PubMed

    Hallmann, Kerstin; Kudin, Alexei P; Zsurka, Gábor; Kornblum, Cornelia; Reimann, Jens; Stüve, Burkhard; Waltz, Stephan; Hattingen, Elke; Thiele, Holger; Nürnberg, Peter; Rüb, Cornelia; Voos, Wolfgang; Kopatz, Jens; Neumann, Harald; Kunz, Wolfram S

    2016-02-01

    Isolated cytochrome c oxidase (complex IV) deficiency is one of the most frequent respiratory chain defects in humans and is usually caused by mutations in proteins required for assembly of the complex. Mutations in nuclear-encoded structural subunits are very rare. In a patient with Leigh-like syndrome presenting with leukodystrophy and severe epilepsy, we identified a homozygous splice site mutation in COX8A, which codes for the ubiquitously expressed isoform of subunit VIII, the smallest nuclear-encoded subunit of complex IV. The mutation, affecting the last nucleotide of intron 1, leads to aberrant splicing, a frame-shift in the highly conserved exon 2, and decreased amount of the COX8A transcript. The loss of the wild-type COX8A protein severely impairs the stability of the entire cytochrome c oxidase enzyme complex and manifests in isolated complex IV deficiency in skeletal muscle and fibroblasts, similar to the frequent c.845_846delCT mutation in the assembly factor SURF1 gene. Stability and activity of complex IV could be rescued in the patient's fibroblasts by lentiviral expression of wild-type COX8A. Our findings demonstrate that COX8A is indispensable for function of human complex IV and its mutation causes human disease. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Synthesis and Characterization of Tin(IV) Oxide Obtained by Chemical Vapor Deposition Method

    NASA Astrophysics Data System (ADS)

    Nagirnyak, Svitlana V.; Lutz, Victoriya A.; Dontsova, Tatiana A.; Astrelin, Igor M.

    2016-07-01

    The effect of precursors on the characteristics of tin oxide obtained by chemical vapor deposition (CVD) method was investigated. The synthesis of nanosized tin(IV) oxide was carried out with the use of two different precursors: tin(II) oxalate obtained using tin chloride(II) and oxalic acid; tin(II) oxalate obtained using tin chloride(II); and ammonium oxalate. The synthesized tin(IV) oxide samples were studied by electron microscopy, X-ray diffraction and optical spectra. The lattice parameters of tin(IV) oxide samples were defined, the bandgap of samples were calculated.

  12. Auditory Processing Disorder in Relation to Developmental Disorders of Language, Communication and Attention: A Review and Critique

    ERIC Educational Resources Information Center

    Dawes, Piers; Bishop, Dorothy

    2009-01-01

    Background: Auditory Processing Disorder (APD) does not feature in mainstream diagnostic classifications such as the "Diagnostic and Statistical Manual of Mental Disorders, 4th Edition" (DSM-IV), but is frequently diagnosed in the United States, Australia and New Zealand, and is becoming more frequently diagnosed in the United Kingdom. Aims: To…

  13. Tetra- and hexavalent uranium forms bidentate-mononuclear complexes with particulate organic matter in a naturally uranium-enriched peatland

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikutta, Christian; Langner, Peggy; Bargar, John R.

    Peatlands frequently serve as efficient biogeochemical traps for U. Mechanisms of U immobilization in these organic matter-dominated environments may encompass the precipitation of U-bearing mineral(oid)s and the complexation of U by a vast range of (in)organic surfaces. The objective of this work was to investigate the spatial distribution and molecular binding mechanisms of U in soils of an alpine minerotrophic peatland (pH 4.7–6.6, E h = –127 to 463 mV) using microfocused X-ray fluorescence spectrometry and bulk and microfocused U L 3-edge X-ray absorption spectroscopy. The soils contained 2.3–47.4 wt % organic C, 4.1–58.6 g/kg Fe, and up to 335 mg/kg geogenic U. Uranium was found to be heterogeneously distributed at the micrometer scale and enriched as both U(IV) and U(VI) on fibrous and woody plant debris (48 ± 10% U(IV),more » $$\\bar{x}$$ ± σ, n = 22). Bulk U X-ray absorption near edge structure (XANES) spectroscopy revealed that in all samples U(IV) comprised 35–68% of total U ($$\\bar{x}$$ = 50%, n = 15). Shell-fit analyses of bulk U L 3-edge extended X-ray absorption fine structure (EXAFS) spectra showed that U was coordinated to 1.3 ± 0.2 C atoms at a distance of 2.91 ± 0.01 Å ($$\\bar{x}$$ ± σ), which implies the formation of bidentate-mononuclear U(IV/VI) complexes with carboxyl groups. We neither found evidence for U shells at ~3.9 Å, indicative of mineral-associated U or multinuclear U(IV) species, nor for a substantial P/Fe coordination of U. As a result, our data indicates that U(IV/VI) complexation by natural organic matter prevents the precipitation of U minerals as well as U complexation by Fe/Mn phases at our field site, and suggests that organically complexed U(IV) is formed via reduction of organic matter-bound U(VI).« less

  14. Tetra- and hexavalent uranium forms bidentate-mononuclear complexes with particulate organic matter in a naturally uranium-enriched peatland

    DOE PAGES

    Mikutta, Christian; Langner, Peggy; Bargar, John R.; ...

    2016-09-16

    Peatlands frequently serve as efficient biogeochemical traps for U. Mechanisms of U immobilization in these organic matter-dominated environments may encompass the precipitation of U-bearing mineral(oid)s and the complexation of U by a vast range of (in)organic surfaces. The objective of this work was to investigate the spatial distribution and molecular binding mechanisms of U in soils of an alpine minerotrophic peatland (pH 4.7–6.6, E h = –127 to 463 mV) using microfocused X-ray fluorescence spectrometry and bulk and microfocused U L 3-edge X-ray absorption spectroscopy. The soils contained 2.3–47.4 wt % organic C, 4.1–58.6 g/kg Fe, and up to 335 mg/kg geogenic U. Uranium was found to be heterogeneously distributed at the micrometer scale and enriched as both U(IV) and U(VI) on fibrous and woody plant debris (48 ± 10% U(IV),more » $$\\bar{x}$$ ± σ, n = 22). Bulk U X-ray absorption near edge structure (XANES) spectroscopy revealed that in all samples U(IV) comprised 35–68% of total U ($$\\bar{x}$$ = 50%, n = 15). Shell-fit analyses of bulk U L 3-edge extended X-ray absorption fine structure (EXAFS) spectra showed that U was coordinated to 1.3 ± 0.2 C atoms at a distance of 2.91 ± 0.01 Å ($$\\bar{x}$$ ± σ), which implies the formation of bidentate-mononuclear U(IV/VI) complexes with carboxyl groups. We neither found evidence for U shells at ~3.9 Å, indicative of mineral-associated U or multinuclear U(IV) species, nor for a substantial P/Fe coordination of U. As a result, our data indicates that U(IV/VI) complexation by natural organic matter prevents the precipitation of U minerals as well as U complexation by Fe/Mn phases at our field site, and suggests that organically complexed U(IV) is formed via reduction of organic matter-bound U(VI).« less

  15. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  16. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  17. Medication use in US youth with mental disorders.

    PubMed

    Merikangas, Kathleen R; He, Jian-ping; Rapoport, Judith; Vitiello, Benedetto; Olfson, Mark

    2013-02-01

    To evaluate the prevalence, demographic and clinical correlates, and specificity of classes of psychotropic medications indicated for mental disorders. Cross-sectional survey. Direct household interviews of combined household and school samples representative of the general population of adolescents in the United States. Ten thousand one hundred twenty-three adolescents aged 13 to 18 years who participated in the National Comorbidity Survey Adolescent Supplement. Diagnostic and Statistical Manual of Mental Disorders (Fourth Edition) (DSM-IV) mental disorders and neurodevelopmental disorders. Psychotropic medication use in the past 12 months. Among youth with any DSM-IV mental disorder, 14.2% reported that they had been treated with a psychotropic medication in the past 12 months. Strong associations emerged between specific disorders and classes of medications with evidence for efficacy. Antidepressants were most frequently used among those with primary mood disorders (14.1%); stimulant use was most common among those with attention-deficit/hyperactivity disorder (20.4%); and antipsychotic use was infrequent and mostly seen among those with serious developmental disorders. Less than 2.5% of adolescents without a 12-month mental disorder had been prescribed psychotropic medications, and most had evidence of psychological distress or impairment reflected in a previous mental disorder, subthreshold condition, or developmental disorder. Appropriate medication use was significantly more frequent among those in treatment in the mental health specialty sector than general medicine or other settings. These findings challenge recent concerns over widespread overmedication and misuse of psychotropic medications in US youth. In fact, these data highlight the need for greater recognition and appropriate treatment of youth with mental health disorders.

  18. Sensitive method for the determination of different S(IV) species in cloud and fog water.

    PubMed

    Lammel, G

    1996-08-01

    Suppressed ion chromatography has been applied to the determination of S(IV) species in cloud and fog water in the range 0.012-2.4 mg S(IV)-S/L. The samples have been preserved prior to storage and S(IV) species have been determined as hydroxy methanesulfonate (HMS) together with the low molecular weight carboxylic acid anions, formate and acetate. Samples have been divided and treated differently such that total S(IV) as well as the non-oxidizable fraction of S(IV) (as given by the reactivity with H(2)O(2), added in surplus) could be determined. The difference between the two corresponds to the S(IV) fraction subjected to oxididation, which is of paramount interest in cloud and fogwater chemistry.

  19. Early-switch/early-discharge opportunities for hospitalized patients with methicillin-resistant Staphylococcus aureus complicated skin and soft tissue infections: proof of concept in the United Arab Emirates.

    PubMed

    El Houfi, Ashraf; Javed, Nadeem; Solem, Caitlyn T; Macahilig, Cynthia; Stephens, Jennifer M; Raghubir, Nirvana; Chambers, Richard; Li, Jim Z; Haider, Seema

    2015-01-01

    To describe real-world treatment patterns and health care resource use and to estimate opportunities for early-switch (ES) from intravenous (IV) to oral (PO) antibiotics and early-discharge (ED) for patients hospitalized in the United Arab Emirates (UAE) with methicillin-resistant Staphylococcus aureus (MRSA) complicated skin and soft tissue infections. This retrospective observational medical chart review study enrolled physicians from four UAE sites to collect data for 24 patients with documented MRSA complicated skin and soft tissue infections, hospitalized between July 2010 and June 2011, and discharged alive by July 2011. Data include clinical characteristics and outcomes, hospital length of stay (LOS), MRSA-targeted IV and PO antibiotic use, and ES and ED eligibility using literature-based and expert-validated criteria. Five included patients (20.8%) were switched from IV to PO antibiotics while being inpatients. Actual length of MRSA-active treatment was 10.8±7.0 days, with 9.8±6.6 days of IV therapy. Patients were hospitalized for a mean 13.9±9.3 days. The most frequent initial MRSA-active therapies used were vancomycin (37.5%), linezolid (16.7%), and clindamycin (16.7%). Eight patients were discharged with MRSA-active antibiotics, with linezolid prescribed most frequently (n=3; 37.5%). Fifteen patients (62.5%) met ES criteria and potentially could have discontinued IV therapy 8.3±6.0 days sooner, and eight (33.3%) met ED criteria and potentially could have been discharged 10.9±5.8 days earlier. While approximately one-fifth of patients were switched from IV to PO antibiotics in the UAE, there were clear opportunities for further optimization of health care resource use. Over half of UAE patients hospitalized for MRSA complicated skin and soft tissue infections could be eligible for ES, with one-third eligible for ED opportunities, resulting in substantial potential for reductions in IV days and bed days.

  20. In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

    PubMed Central

    Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

    2009-01-01

    Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

  1. Magnetic location of C IV events in the quiet network

    NASA Technical Reports Server (NTRS)

    Porter, Jason G.; Reichmann, Ed J.; Moore, Ronald L.; Harvey, Karen L.

    1986-01-01

    Ultraviolet Spectrograph and Polarimeter (UVSP) observations of C IV intensity in the quiet sun were examined and compared to magnetograms and He I 10830 A spectroheliograms from Kitt Peak National Laboratory. The observations were made between 3 and 9 April, 1985. Spatially rastered UVSP intensity measurements were obtained at 11 wavelength positions in the 1548 A line of C IV. It was concluded that the stochastic process whereby convective shuffling of loop footprints leads to many topically dissipative events in active regions and the larger bipoles treated here continues to operate in regions of fewer, weaker flux loops, but the resulting events above threshold are less frequent.

  2. Needleless connectors substantially reduce flow of crystalloid and red blood cells during rapid infusion.

    PubMed

    Lehn, Robert A; Gross, Jeffrey B; McIsaac, Joseph H; Gipson, Keith E

    2015-04-01

    Although needleless connectors (NC) are frequently used in the perioperative setting, the potential of modern NCs to slow delivery of IV fluids has not been thoroughly studied. We examined flow characteristics of 5 NC models during pressurized delivery of crystalloid and banked red blood cells from a Level 1 warmer through various IV catheters. Crystalloid flow rates were reduced by 29% to 85% from control in catheters >18 gauge, while red blood cell flow reductions ranged from 22% to 76% in these catheters (all P < 0.0050). We suggest that practitioners consider eliminating NCs when large IV catheters are inserted for rapid fluid administration.

  3. Validity of the WISC-IV Spanish for a Clinically Referred Sample of Hispanic Children

    ERIC Educational Resources Information Center

    San Miguel Montes, Liza E.; Allen, Daniel N.; Puente, Antonio E.; Neblina, Cris

    2010-01-01

    The Wechsler Intelligence Scale for Children (WISC) is the most commonly used intelligence test for children. Five years ago, a Spanish version of the WISC-IV was published (WISC-IV Spanish; Wechsler, 2005), but a limited amount of published information is available regarding its utility when assessing clinical samples. The current study included…

  4. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR...

  5. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR...

  6. Impact of intravenous magnesium infusion rate during ambulatory replacements on serum magnesium concentrations after allogeneic stem cell transplant.

    PubMed

    Snyder, Matthew; Shillingburg, Alexandra; Newton, Michael; Hamadani, Mehdi; Kanate, Abraham S; Craig, Michael; Cumpston, Aaron

    2016-10-01

    For an outpatient cancer center to operate efficiently, optimizing the use of chair time is essential. Allogeneic hematopoietic cell transplant (allo-HCT) recipients are seen frequently in this setting after hospital discharge and regularly for several months thereafter. Aggressive electrolyte replacement is commonly required in these patients, primarily due to renal wasting with calcineurin inhibitor use. Frequent intravenous (IV) magnesium repletion, requiring several hours of infusion time, is often needed in these patients to adequately manage their magnesium deficiencies. The purpose of this study is to explore the impact of extending the infusion rate of intravenous magnesium sulfate on the frequency and degree of IV magnesium replacements required in allo-HCT recipients. We conducted a retrospective study to compare two cohorts of patients administered IV magnesium sulfate at a rate of 4 g/1 h versus 4 g/2 h. A total of 103 continuous patients were assessed in two groups as cohort 1 at the 4 g/1 h rate and cohort 2 at the 4 g/2 h rate. Cohort 1 required less IV magnesium per outpatient visit (median 2.2 vs. 2.9 g/visit, P = 0.0211) and less total IV magnesium replacement through day +100 (median 68 vs. 85 g, P = 0.0479) than cohort 2. These data suggest that there is no apparent benefit of prolonging magnesium infusion from 1 to 2 h in our outpatient allo-HCT population.

  7. Biologic Disease-modifying Antirheumatic Drug (bDMARD)-induced Neutropenia: A Registry from a Retrospective Cohort of Patients with Rheumatic Diseases Treated with 3 Classes of Intravenous bDMARD.

    PubMed

    Espinoza, Francisco; Le Blay, Pierre; Combe, Bernard

    2017-06-01

    To examine the rate, risks factors, and consequences of neutropenia induced by intravenous (IV) biologic disease-modifying antirheumatic drugs (bDMARD). We conducted a retrospective cohort study in 499 patients with rheumatic diseases treated by IV abatacept (ABA), infliximab (IFX), or tocilizumab (TCZ). Rheumatoid arthritis (RA) was the most frequent diagnosis (72%). Fifty-two patients (10.4%) experienced at least 1 episode of neutropenia. No episodes of grade 4 neutropenia were documented. TCZ was more frequently related to neutropenia than ABA or IFX (18.6% vs 3.8% and 2.8%, respectively, p < 0.001). The following factors were identified as predictors of experiencing neutropenia with IV bDMARD: history of neutropenia with methotrexate (MTX; synthetic DMARD; OR 1.56, 95% CI 1.17-7.14), concomitant treatment by MTX (OR 1.21, 95% CI 1.01-2.64), and TCZ treatment (OR 2.72, 95% CI 1.53-9.05). Patients experiencing a TCZ-induced neutropenia did not show a higher risk of severe infections; however, this group had a shorter drug survival (9 mos vs 20 mos, p < 0.02) compared with TCZ patients without neutropenia. Among 3 different classes of IV bDMARD, TCZ is associated with the higher risk of neutropenia. No increased frequency of infection episodes was documented in this group.

  8. WISC-IV and Clinical Validation of the Four- and Five-Factor Interpretative Approaches

    ERIC Educational Resources Information Center

    Weiss, Lawrence G.; Keith, Timothy Z.; Zhu, Jianjun; Chen, Hsinyi

    2013-01-01

    The purpose of this study was to determine the constructs measured by the WISC-IV and the consistency of measurement across large normative and clinical samples. Competing higher order four- and five-factor models were analyzed using the WISC-IV normative sample and clinical subjects. The four-factor solution is the model published with the test…

  9. Epidemiological findings and clinical and magnetic resonance presentations in subacute sclerosing panencephalitis.

    PubMed

    Cece, H; Tokay, L; Yildiz, S; Karakas, O; Karakas, E; Iscan, A

    2011-01-01

    Subacute sclerosing panencephalitis (SSPE) is a rare, progressive, inflammatory neurodegenerative disease. This study investigated the relationships of clinical stage with epidemiological and magnetic resonance imaging (MRI) findings in SSPE by retrospective review of 76 cases (57 male) diagnosed by typical periodic electroencephalographic features, clinical symptoms and elevated measles antibody titre in cerebrospinal fluid. Clinical stage at diagnosis was I or II in 48 patients, III in 25 and IV in three. Prominent findings at presentation were atonic/myoclonic seizures (57.9%) and mental deterioration with behaviour alteration (30.3%). Frequent MRI findings (13 - 32 patients) were subcortical, periventricular and cortical involvement and brain atrophy; the corpus callosum, basal ganglia, cerebellum and brainstem were less frequently involved. Five patients had pseudotumour cerebri. Cranial MRI at initial diagnosis was normal in 21 patients (19 stage I/II, two stage III/IV). Abnormal MRI findings were significantly more frequent in the later stages, thus a normal initial cranial MRI does not exclude SSPE, which should, therefore, be kept in mind in childhood demyelinating diseases even when the presentation is unusual.

  10. DSM-IV "criterion A" schizophrenia symptoms across ethnically different populations: evidence for differing psychotic symptom content or structural organization?

    PubMed

    McLean, Duncan; Thara, Rangaswamy; John, Sujit; Barrett, Robert; Loa, Peter; McGrath, John; Mowry, Bryan

    2014-09-01

    There is significant variation in the expression of schizophrenia across ethnically different populations, and the optimal structural and diagnostic representation of schizophrenia are contested. We contrasted both lifetime frequencies of DSM-IV criterion A (the core symptom criterion of the internationally recognized DSM classification system) symptoms and types/content of delusions and hallucinations in transethnic schizophrenia populations from Australia (n = 776), India (n = 504) and Sarawak, Malaysia (n = 259), to elucidate clinical heterogeneity. Differences in both criterion A symptom composition and symptom content were apparent. Indian individuals with schizophrenia reported negative symptoms more frequently than other sites, whereas individuals from Sarawak reported disorganized symptoms more frequently. Delusions of control and thought broadcast, insertion, or withdrawal were less frequent in Sarawak than Australia. Curiously, a subgroup of 20 Indian individuals with schizophrenia reported no lifetime delusions or hallucinations. These findings potentially challenge the long-held view in psychiatry that schizophrenia is fundamentally similar across cultural groups, with differences in only the content of psychotic symptoms, but equivalence in structural form.

  11. The Grism Lens-Amplified Survey from Space (GLASS). XI. Detection of C IV in Multiple Images of the z = 6.11 Lyα Emitter behind RXC J2248.7-4431

    NASA Astrophysics Data System (ADS)

    Schmidt, K. B.; Huang, K.-H.; Treu, T.; Hoag, A.; Bradač, M.; Henry, A. L.; Jones, T. A.; Mason, C.; Malkan, M.; Morishita, T.; Pentericci, L.; Trenti, M.; Vulcani, B.; Wang, X.

    2017-04-01

    The C III] and C IV rest-frame UV emission lines are powerful probes of the ionization states of galaxies. They have furthermore been suggested as alternatives for spectroscopic redshift confirmation of objects at the epoch of reionization (z> 6), where the most frequently used redshift indicator, Lyα, is attenuated by the high fraction of neutral hydrogen in the intergalactic medium. However, currently only very few confirmations of carbon UV lines at these high redshifts exist, making it challenging to quantify these claims. Here, we present the detection of C IV λλ1548, 1551 Å in Hubble Space Telescope slitless grism spectroscopy obtained by GLASS of a Lyα emitter at z = 6.11 multiply imaged by the massive foreground galaxy cluster RXC J2248.7-4431. The C IV emission is detected at the 3σ-5σ level in two images of the source, with marginal detection in two other images. We do not detect significant C III]λλ1907, 1909 Å emission implying an equivalent width {{EW}}{{C}{{III}}]}< 20 Å (1σ) and {{C}} {{IV}}/{{C}} {{III}}> 0.7 (2σ). Combined with limits on the rest-frame UV flux from the He II λ1640 Å emission line and the O III]λλ1661, 1666 Å doublet, we put constraints on the metallicity and the ionization state of the galaxy. The estimated line ratios and equivalent widths do not support a scenario where an AGN is responsible for ionizing the carbon atoms. SED fits, including nebular emission lines, imply a source with a mass of log(M/M ⊙) ˜ 9, SFR of around 10 M ⊙ yr-1, and a young stellar population < 50 {Myr} old. The source shows a stronger ionizing radiation field than objects with detected C IV emission at z< 2 and adds to the growing sample of low-mass (log(M/M ⊙) ≲ 9) galaxies at the epoch of reionization with strong radiation fields from star formation.

  12. Reboxetine for ADHD in children non-responders or with poor tolerance to methylphenidate: a prospective long-term open-label study.

    PubMed

    Quintero, Javier; López-Muñoz, Francisco; Alamo, Cecilio; Loro, Mercedes; García-Campos, Natalia

    2010-11-01

    Up to 30% of patients with attention-deficit hyperactivity disorder (ADHD) treated with psychostimulants discontinue the treatment because of intolerance or lack of therapeutic response. Therapeutic alternatives are needed for such patients. In the present case series, we study the effectiveness of reboxetine over a period of 6 months in a sample of 14 children diagnosed with ADHD according to DSM-IV-TR criteria, who had responded only partially or had presented poor tolerance to conventional treatment with methylphenidate. Clinical efficacy was evaluated through the application of the 18-item Attention-Deficit Hyperactivity Disorder Rating Scale (ADHD-RS-IV) and the Clinical Global Impressions-Global Improvement Scale (CGI-I). Percentages of responders (ADHD-RS ≥ 25%) and improvers (CGI-I absolute value < 4) were 90.9 and 72.7%, respectively. No serious side-effects were observed during treatment, the most frequent effects being headaches and insomnia. The initial findings of our study show that reboxetine may constitute an effective tool for long-term treatment of children with ADHD who present poor response or poor tolerance to initial treatment with methylphenidate.

  13. Somatization symptoms and hypochondriacal features in the general population.

    PubMed

    Rief, W; Hessel, A; Braehler, E

    2001-01-01

    The principal goal of this study is to examine the base rates of somatoform symptoms and of hypochondriacal features in the general population. A representative sample of 2050 persons in Germany was examined by use of screening for somatoform symptoms and the Whiteley Index. The most frequent somatoform symptoms were back pain, joint pain, pain in extremities, and headache, as well as abdominal symptoms (bloating or intolerance of several foods) and cardiovascular symptoms (palpitation). People reported a mean of two somatization symptoms of DSM-IV somatization disorder (SD) during the prior 2 years. Strong age and medium gender effects were found for most somatoform symptoms, as well as for composite indices. However, the sex ratio suggested in DSM-IV for SD seems to be an overestimation. Hypochondriacal features showed only small sex differences but, again, pronounced age effects. In contrast to low rates for SD, the base rates for somatization and hypochondriacal features were high and represented the health care relevance of subthreshold syndromes. We present base rates of hypochondriacal and somatization features that may be important facets in the development of classification criteria and in the interpretation of health care expenditure.

  14. The relationship of DSM-IV pathological gambling to compulsive buying and other possible spectrum disorders: results from the Iowa PG family study.

    PubMed

    Black, Donald W; Coryell, William; Crowe, Raymond; Shaw, Martha; McCormick, Brett; Allen, Jeff

    2015-03-30

    This study investigates the possible relationship between pathological gambling (PG) and potential spectrum disorders including the DSM-IV impulse control disorders (intermittent explosive disorder, kleptomania, pyromania, trichotillomania) and several non-DSM disorders (compulsive buying disorder, compulsive sexual behavior, Internet addiction). PG probands, controls, and their first-degree relatives were assessed with instruments of known reliability. Detailed family history information was collected on relatives who were deceased or unavailable. Best estimate diagnoses were assigned blind to family status. The results were analyzed using logistic regression by the method of generalized estimating equations. The sample included 95 probands with PG, 91 controls, and 1075 first-degree relatives (537 PG, 538 controls). Compulsive buying disorder and having "any spectrum disorder" were more frequent in the PG probands and their first-degree relatives vs. controls and their relatives. Spectrum disorders were significantly more prevalent among PG relatives compared to control relatives (adjusted OR=8.37), though much of this difference was attributable to the contribution from compulsive buying disorder. We conclude that compulsive buying disorder is likely part of familial PG spectrum. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Flow injection for the determination of Se(IV) and Se(VI) by hydride generation atomic absorption spectrometry with microwave oven on-line prereduction of Se(VI) to Se(IV)

    NASA Astrophysics Data System (ADS)

    Burguera, J. L.; Carrero, P.; Burguera, M.; Rondon, C.; Brunetto, M. R.; Gallignani, M.

    1996-12-01

    An on-line flow injection system has been developed for the selective determination of Se(IV) and Se(VI) in citric fruit juices and geothermal waters by hydride generation atomic absorption spectrometry with microwave-aided heating prereduction of Se(VI) to Se(IV). The samples and the prereductant solutions (4 mol l -1 HCl for Se(IV) and 12 mol l -1 HCl for Se(VI)) which circulated in a closed-flow circuit were injected by means of a time-based injector. This mixture was displaced by a carrier solution of 1% v/v of hydrochloric acid through a PTFE coil located inside the focused microwave oven and mixed downstream with a borohydride solution to generate the hydride. The linear ranges were 0-120 and 0-100 μg l -1 of Se(IV) and Se(VI), respectively. The detection limits were 1.0 μg l -1 for Se(IV) and 1.5 μg l -1 for Se(VI). The precision (about 2.0-2.5% RSD) and recoveries (96-98% for Se(IV) and 94-98% for Se(VI)) were good. Total selenium values were also obtained by electrothermal atomic absorption spectrometry which agreed with the content of both selenium species. The sample throughput was about 50 measurements per hour. The main advantage of the method is that the selective determination of Se(IV) and Se(VI) in citric fruit juices and geothermal waters is performed in a closed system with a minimum sample manipulation, exposure to the environment, minimum sample waste and operator attention.

  16. Diagnostic value of succinate ubiquinone reductase activity in the identification of patients with mitochondrial DNA depletion.

    PubMed

    Hargreaves, P; Rahman, S; Guthrie, P; Taanman, J W; Leonard, J V; Land, J M; Heales, S J R

    2002-02-01

    Mitochondrial DNA (mtDNA) depletion syndrome (McKusick 251880) is characterized by a progressive quantitative loss of mtDNA resulting in severe mitochondrial dysfunction. A diagnosis of mtDNA depletion can only be confirmed after Southern blot analysis of affected tissue. Only a limited number of centres have the facilities to offer this service, and this is frequently on an irregular basis. There is therefore a need for a test that can refine sample selection as well as complementing the molecular analysis. In this study we compared the activities of the nuclear-encoded succinate ubiquinone reductase (complex II) to the activities of the combined mitochondrial and nuclear-encoded mitochondrial electron transport chain (ETC) complexes; NADH:ubiquinone reductase (complex I), ubiquinol-cytochrome-c reductase (complex III), and cytochrome-c oxidase (complex IV), in skeletal muscle biopsies from 7 patients with confirmed mtDNA depletion. In one patient there was no evidence of an ETC defect. However, the remaining 6 patients exhibited reduced complex I and IV activities. Five of these patients also displayed reduced complex II-III (succinate:cytochrome-c reductase) activity. Individual measurement of complex II and complex III activities demonstrated normal levels of complex II activity compared to complex III, which was reduced in the 5 biopsies assayed. These findings suggest a possible diagnostic value for the detection of normal levels of complex II activity in conjunction with reduced complex I, III and IV activity in the identification of likely candidates for mtDNA depletion syndrome

  17. Primary Intravenous Set Consumption Across 3 Branded Infusion Pumps

    PubMed Central

    Hedlund, Nancy; Sarangpur, Shishir; Kayler, Shannon; O'Brien, Kathy

    2017-01-01

    This retrospective study of 6426 hip replacement, coronary artery bypass graft, and colectomy surgeries across 23 US hospitals found that intravenous (IV) set designs that can be interchanged for use both in gravity-fed and automated pump delivery systems are replaced less frequently than IV sets designed for use primarily by one delivery method. Semistructured interviews with nurses highlighted the impact of set design on nursing workflow when moving between gravity-fed and pump-based administration. Use of interchangeable, single-design IV sets across gravity and automated infusions minimizes disruptions to closed systems, may reduce nurses being distracted from patients' clinical needs when replacing sets, and may yield supply cost savings. PMID:28682999

  18. Successful electrical cardioversion of supraventricular tachycardia in a pregnant patient

    PubMed Central

    Yılmaz, Fevzi; Beydilli, Inan; Kavalcı, Cemil; Yılmaz, Serkan

    2012-01-01

    Summary Background: Pregnancy can precipitate cardiac arrhythmias not previously present in seemingly well individuals. Atrial and ventricular premature beats are frequently present during pregnancy and are usually benign. Supraventricular tachycardia and malignant ventricular tachyarrhythmias occur less frequently. Maternal and fetal arrhythmias occurring during pregnancy may jeopardize the life of the mother and the fetus. Case Report: A 32-year-old pregnant women at 26 weeks gestation presented to the emergency department with palpitation. She had mild chest discomfort after a supraventricular tachycardia (SVT) episode but did not have syncope. After monitoring and access of an IV line, vagal manoeuvres were applied but the rhythm was resistant. Then she was treated with 5 mg metoprolol IV, but the SVT persisted. Then after IV infusion of adenosine triphosphate 6 to 12 mg, the rhythm was resistant. Synchronized cardioversion with 100 joules was performed. Patients’ rhythm was normalized to a sinus rhythm. She was discharged from hospital without any adverse effects following 24-hour monitoring. Conclusions: All pregnant patients with SVT require careful maternal and fetal monitoring during treatment, and close collaboration between the managing obstetrician and the cardiologist is essential. PMID:23569481

  19. Long-Term IQ Stability Using the WISC-IV and WAIS-IV among a Sample of Special Education Students

    ERIC Educational Resources Information Center

    Spector, Hayley

    2013-01-01

    The present study investigated the stability of scores on the WISC-IV and WAIS-IV over an approximate six-year period. Previous research using older versions of the WISC and WAIS have suggested that these scales demonstrate strong stability of scores. Since research that has compared the stability of scores between the WISC-IV and the WAIS-IV is…

  20. Methicillin-resistant Staphylococcus aureus from dental school clinic surfaces and students.

    PubMed

    Roberts, Marilyn C; Soge, Olusegun O; Horst, Jeremy A; Ly, Kiet A; Milgrom, Peter

    2011-10-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolated from frequently touched dental school clinic surfaces were compared with MRSA isolated nasal cultures of dental students. Sixty-one dental students and 95 environmental surfaces from 7 clinics were sampled using SANICULT (Starplex Scientific Inc, Etobicoke, Ontario, Canada) swabs. Antimicrobial susceptibility testing was performed, and pulsed-field gel electrophoresis analysis, the mecA gene, multilocus sequence type, and SCCmec type were determined by polymerase chain reaction and sequencing. Thirteen (21%) dental students and 8 (8.4%) surfaces were MRSA positive. Three MRSA strains were SCCmec type IV, whereas 3 were nontypeable isolates and Panton-Valentine leukocidin positive (PVL+), and none were USA300. One surface and 1 student isolate shared the same multilocus sequence type ST 8 and were 75% related. Two groups of students carried the same MRSA strains. The MRSA-positive samples were from 4 of 7 dental clinics. In addition, 21% of the dental students carried MRSA, which is > 10 times higher than the general public and twice as frequent as in other university students. This is the first study to characterize MRSA from dental clinic surfaces and dental students and suggests that both may be reservoirs for MRSA. Further studies are needed to verify this premise. Copyright © 2011 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  1. Determination of sulphite in wine by coulometric titration.

    PubMed

    Lowinsohn, D; Bertotti, M

    2001-09-01

    A method for the determination of both free and bound S(IV) in white wine samples by coulometric titration with electrogenerated iodine is described, the S(IV) speciation being performed by extracting SO2 from samples acidified wiith hydrochloric acid. Titrations of samples treated with NaOH led to the total S(IV) concentration, the results being in agreement with the ones obtained by the distillation procedure as well as by using the classical Monier-Williams method. An average recovery of 97% was obtained for samples spiked with S(IV) in the range 0.4-1.2 mM, which demonstrated the validity of the proposed procedure. The repeatability was 1.3% and the limit of detection was estimated as 0.01 mM. Results from direct titrations of wine added to the electrochemical cell are reported, which give indications of the stability of adducts towards the reaction with iodine.

  2. Data Combination and Instrumental Variables in Linear Models

    ERIC Educational Resources Information Center

    Khawand, Christopher

    2012-01-01

    Instrumental variables (IV) methods allow for consistent estimation of causal effects, but suffer from poor finite-sample properties and data availability constraints. IV estimates also tend to have relatively large standard errors, often inhibiting the interpretability of differences between IV and non-IV point estimates. Lastly, instrumental…

  3. Traditional Living Habits of the Taz Tundra Population: A Paleoparasitological Study.

    PubMed

    Slepchenko, Sergey Mikhailovich; Ivanov, Sergey Nikolaevich; Nikolaevich, Bagashev Anatoly; Alekseevich, Tsybankov Alexander; Sergeyevich, Slavinsky Vyacheslav

    2016-10-01

    An excavation of the Vesakoyakha II-IV and Nyamboyto I burial grounds was conducted during the 2014 field season, and soil samples from intact burials dating from the 19th and 20th centuries, respectively, were analyzed to determine interactions between parasites and host/vectors. Considering the discovery of Diphyllobothrium sp. and Taenia sp. eggs in soil samples from the pelvic region, diphyllobothriasis was the most frequent helminthic infection among the Taz Nenets. The Nyamboyto Nenets mainly consumed uncooked fish, while the Vesakoyakha Nenets had a bigger variety in food choices, including reindeer meat. Nenets children were given raw fish from early childhood. The paleoparasitological results corroborate rare ethnographic records about the consumption of uncooked reindeer cerebrum which led to beef tapeworm helminthiases. This is the first parasitological report of helminthic diseases among the Taz Nenets, and, as such, it provides insight into their subsistence activities and food patterns and broadens our understanding of their health condition.

  4. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  5. 40 CFR 63.1574 - What notifications must I submit and when?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... catalyst regenerator. (iv) Procedures and analytical methods you will use to determine the equilibrium... of the sorbent material (but not less frequent than once every 4 hours during coke burn-off). If the...

  6. 40 CFR 63.1574 - What notifications must I submit and when?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... catalyst regenerator. (iv) Procedures and analytical methods you will use to determine the equilibrium... of the sorbent material (but not less frequent than once every 4 hours during coke burn-off). If the...

  7. 40 CFR 63.1574 - What notifications must I submit and when?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... catalyst regenerator. (iv) Procedures and analytical methods you will use to determine the equilibrium... of the sorbent material (but not less frequent than once every 4 hours during coke burn-off). If the...

  8. 45 CFR 308.1 - Self-assessment implementation methodology.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... selects statistically valid samples of cases from the IV-D program universe of cases; and (3) The State establishes a procedure for the design of samples and assures that no portions of the IV-D case universe are...

  9. 45 CFR 308.1 - Self-assessment implementation methodology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... selects statistically valid samples of cases from the IV-D program universe of cases; and (3) The State establishes a procedure for the design of samples and assures that no portions of the IV-D case universe are...

  10. 45 CFR 308.1 - Self-assessment implementation methodology.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... selects statistically valid samples of cases from the IV-D program universe of cases; and (3) The State establishes a procedure for the design of samples and assures that no portions of the IV-D case universe are...

  11. 45 CFR 308.1 - Self-assessment implementation methodology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... selects statistically valid samples of cases from the IV-D program universe of cases; and (3) The State establishes a procedure for the design of samples and assures that no portions of the IV-D case universe are...

  12. 45 CFR 308.1 - Self-assessment implementation methodology.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... selects statistically valid samples of cases from the IV-D program universe of cases; and (3) The State establishes a procedure for the design of samples and assures that no portions of the IV-D case universe are...

  13. OSO-8 observations of the impulsive phase of solar flares in the transition-zone and corona

    NASA Technical Reports Server (NTRS)

    Lites, B. W.; Bruner, E. C., Jr.; Wolfson, C. J.

    1981-01-01

    Several solar flares were observed from their onset in C IV 1548.2 A and 1-8 A X-rays using instruments on OSO-8. It is found that impulsive brightening in C IV is often accompanied by redshifts, interpreted as downflows, of the order of 80 km/s. The maximum soft X-ray intensity usually arrives several minutes after the maximum C IV intensity. The most energetic C IV event observed shows a small blueshift just before reaching maximum intensity; estimates of the mass flux associated with this upflow through the transition zone are consistent with the increase of mass in the coronal loops as observed in soft X-rays. Finally, it is suggested that the frequent occurrence of violent dynamical processes at the onset of the flare is associated with the initial energy release mechanism.

  14. The incidence of phlebitis with intravenous amiodarone at guideline dose recommendations.

    PubMed

    Slim, Ahmad M; Roth, Jason E; Duffy, Benjamin; Boyd, Sheri Y N; Rubal, Bernard J

    2007-12-01

    Postoperative atrial fibrillation following cardiothoracic surgery is common and frequently managed with intravenous (IV) amiodarone. Phlebitis is the most common complication with peripheral infusion of this agent. Current practice guidelines for peripheral IV administration of <2 mg/mL amiodarone were established to reduce the risk of phlebitis. The present study examines the incidence of phlebitis in a postoperative patient population given current dose recommendations. A total of 273 patient charts were reviewed. The incidence of phlebitis in patients given IV amiodarone (n = 36) was 13.9% (95% confidence interval, 2.6-25.2%; p = 0.001). Logistic regression analysis with backward elimination of other therapeutic risk factors suggests that the odds ratio for phlebitis using current dose regimens without IV filters is 19-fold greater than baseline risk in this population. Phlebitis remains a significant complication associated with peripheral infusion of amiodarone within recommended dosing limits.

  15. The Transmission of Family Food and Mealtime Practices From Adolescence to Adulthood: Longitudinal Findings From Project EAT-IV.

    PubMed

    Watts, Allison; Berge, Jerica M; Loth, Katie; Larson, Nicole; Neumark-Sztainer, Dianne

    2018-02-01

    To determine whether family food and mealtime practices experienced in adolescence are carried forward into parenthood. Baseline (Project Eating and Activity in Teens and Young Adults [EAT]-I) and 15-year follow-up (EAT-IV) survey data from a population-based cohort study (Project EAT). Cohort members identified as parents at follow-up (n = 727). To gain additional data about the practices of both parents in the household, significant others completed surveys at EAT-IV (n = 380). Frequency of family meals, healthfulness of foods at home, frequency of meals in front of the television, and expectations of being home for dinner. Linear regression models tested associations between parent food and mealtime practices reported at baseline and follow-up controlling for demographics. Healthy and unhealthy home food availability, expectations to be home for dinner, and eating in front of the television in adolescence predicted similar outcomes 15 years later among female parents (effect sizes range: β = .2-.3; P < .001), and to a lesser extent among males. Families ate more frequent family meals when either 1 or both parents reported frequent family meals as an adolescent compared with when neither parent reported frequent family meals as an adolescent. It is important to invest in parenting interventions that target healthful family food and mealtime practices because of the potential long-term impact on their own children's parenting practices. Copyright © 2017 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  16. Preanalytic Factors Associated With Hemolysis in Emergency Department Blood Samples.

    PubMed

    Phelan, Michael P; Reineks, Edmunds Z; Schold, Jesse D; Hustey, Frederic M; Chamberlin, Janelle; Procop, Gary W

    2018-02-01

    - Hemolysis of emergency department blood samples is a common occurrence and has a negative impact on health care delivery. - To determine the effect of preanalytic factors (straight stick, intravenous [IV] line, needle gauge, location of blood draw, syringe versus vacuum tube use, tourniquet time) on hemolysis in emergency department blood samples. - A single 65 000-visit emergency department's electronic health record was queried for emergency department potassium results and blood draw technique for all samples obtained in calendar year 2014, resulting in 54 531 potassium results. Hemolyzed potassium was measured by hemolysis index. Comparisons of hemolysis by sampling technique were conducted by χ 2 tests. - Overall hemolysis was 10.0% (5439 of 54 531). Hemolysis among samples obtained from straight stick was significantly less than among those obtained with IV line (5.4% [33 of 615] versus 10.2% [4821 of 47 266], P < .001). For IV-placed blood draws, antecubital location had a statistically significant lower overall hemolysis compared with other locations: 7.4% (2117 of 28 786) versus 14.6% (2622 of 17 960) ( P < .001). For blood drawn with a syringe compared with vacuum, hemolysis was 13.0% (92 of 705) and 11.0% (1820 of 16 590), respectively ( P = .09, not significant). For large-gauge IV blood draws versus smaller-gauge IV lines, a lower hemolysis was also observed (9.3% [3882 of 41 571] versus 16.7% [939 of 5633]) ( P < .001). For IV-drawn blood with tourniquet time less than 60 seconds, hemolysis was 10.3% (1362 of 13 162) versus 13.9% for more than 60 seconds (532 of 3832), P < .001. - This study confirmed previous findings that straight stick and antecubital location are significantly associated with reduced hemolysis and indicated that shorter tourniquet time and larger gauge for IV draws were significantly associated with lower hemolysis.

  17. Psychiatric disorders and clinical correlates of suicidal patients admitted to a psychiatric hospital in Tokyo

    PubMed Central

    2010-01-01

    Background Patients admitted to a psychiatric hospital with suicidal behavior (SB) are considered to be especially at high risk of suicide. However, the number of studies that have addressed this patient population remains insufficient compared to that of studies on suicidal patients in emergency or medical settings. The purpose of this study is to seek features of a sample of newly admitted suicidal psychiatric patients in a metropolitan area of Japan. Method 155 suicidal patients consecutively admitted to a large psychiatric center during a 20-month period, admission styles of whom were mostly involuntary, were assessed using Structured Clinical Interviews for DSM-IV Axis I and II Disorders (SCID-I CV and SCID-II) and SB-related psychiatric measures. Associations of the psychiatric diagnoses and SB-related characteristics with gender and age were examined. Results The common DSM-IV axis I diagnoses were affective disorders 62%, anxiety disorders 56% and substance-related disorders 38%. 56% of the subjects were diagnosed as having borderline PD, and 87% of them, at least one type of personality disorder (PD). SB methods used prior to admission were self-cutting 41%, overdosing 32%, self-strangulation 15%, jumping from a height 12% and attempting traffic death 10%, the first two of which were frequent among young females. The median (range) of the total number of SBs in the lifetime history was 7 (1-141). Severity of depressive symptomatology, suicidal intent and other symptoms, proportions of the subjects who reported SB-preceding life events and life problems, and childhood and adolescent abuse were comparable to those of the previous studies conducted in medical or emergency service settings. Gender and age-relevant life-problems and life events were identified. Conclusions Features of the studied sample were the high prevalence of affective disorders, anxiety disorders and borderline PD, a variety of SB methods used prior to admission and frequent SB repetition in the lifetime history. Gender and age appeared to have an influence on SB method selection and SB-preceding processes. The findings have important implications for assessment and treatment of psychiatric suicidal patients. PMID:21144041

  18. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    PubMed

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  19. Validation of a Spanish-language version of the ADHD Rating Scale IV in a Spanish sample.

    PubMed

    Vallejo-Valdivielso, M; Soutullo, C A; de Castro-Manglano, P; Marín-Méndez, J J; Díez-Suárez, A

    2017-07-14

    The purpose of this study is to validate a Spanish-language version of the 18-item ADHD Rating Scale-IV (ADHD-RS-IV.es) in a Spanish sample. From a total sample of 652 children and adolescents aged 6 to 17 years (mean age was 11.14±3.27), we included 518 who met the DSM-IV-TR criteria for ADHD and 134 healthy controls. To evaluate the factorial structure, validity, and reliability of the scale, we performed a confirmatory factor analysis (CFA) using structural equation modelling on a polychoric correlation matrix and maximum likelihood estimation. The scale's discriminant validity and predictive value were estimated using ROC (receiver operating characteristics) curve analysis. Both the full scale and the subscales of the Spanish-language version of the ADHD-RS-IV showed good internal consistency. Cronbach's alpha was 0.94 for the full scale and ≥ 0.90 for the subscales, and ordinal alpha was 0.95 and ≥ 0.90, respectively. CFA showed that a two-factor model (inattention and hyperactivity/impulsivity) provided the best fit for the data. ADHD-RS-IV.es offered good discriminant ability to distinguish between patients with ADHD and controls (AUC=0.97). The two-factor structure of the Spanish-language version of the ADHD-RS-IV (ADHD-RS-IV.es) is consistent with those of the DSM-IV-TR and DSM-5 as well as with the model proposed by the author of the original scale. Furthermore, it has good discriminant ability. ADHD-RS-IV.es is therefore a valid and reliable tool for determining presence and severity of ADHD symptoms in the Spanish population. Copyright © 2017 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Simple, Fast and Effective Correction for Irradiance Spatial Nonuniformity in Measurement of IVs of Large Area Cells at NREL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moriarty, Tom

    The NREL cell measurement lab measures the IV parameters of cells of multiple sizes and configurations. A large contributing factor to errors and uncertainty in Jsc, Imax, Pmax and efficiency can be the irradiance spatial nonuniformity. Correcting for this nonuniformity through its precise and frequent measurement can be very time consuming. This paper explains a simple, fast and effective method based on bicubic interpolation for determining and correcting for spatial nonuniformity and verification of the method's efficacy.

  1. Phase I study of 6-diazo-5-oxo-L-norleucine (DON).

    PubMed

    Sklaroff, R B; Casper, E S; Magill, G B; Young, C W

    1980-01-01

    We conducted a phase I study of 6-diazo-5-oxo-L-norleucine given iv on a twice weekly schedule. Twenty-six evaluable patients received 31 courses of the drug. Doses ranged from 100 to 500 mg/m2. Nausea with vomiting was the dose-limiting toxic effect, transient thrombocytopenia was seen frequently, and mucositis occurred in 39% of the patients. No definite therapeutic responses were observed in 18 patients with measurable lesions. The recommended dose for phase II studies is 200-300 mg/m2 iv twice weekly.

  2. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  3. Acute effects of THC on time perception in frequent and infrequent cannabis users.

    PubMed

    Sewell, R Andrew; Schnakenberg, Ashley; Elander, Jacqueline; Radhakrishnan, Rajiv; Williams, Ashley; Skosnik, Patrick D; Pittman, Brian; Ranganathan, Mohini; D'Souza, D Cyril

    2013-03-01

    Cannabinoids have been shown to alter time perception, but existing literature has several limitations. Few studies have included both time estimation and production tasks, few control for subvocal counting, most had small sample sizes, some did not record subjects' cannabis use, many tested only one dose, and used either oral or inhaled administration of Δ⁹-tetrahydrocannabinol (THC), leading to variable pharmacokinetics, and some used whole-plant cannabis containing cannabinoids other than THC. Our study attempted to address these limitations. This study aims to characterize the acute effects of THC and frequent cannabis use on seconds-range time perception. THC was hypothesized to produce transient, dose-related time overestimation and underproduction. Frequent cannabis smokers were hypothesized to show blunted responses to these alterations. IV THC was administered at doses from 0.015 to 0.05 mg/kg to 44 subjects who participated in several double-blind, randomized, counterbalanced, crossover, placebo-controlled studies. Visual time estimation and production tasks in the seconds range were presented to subjects three times on each test day. All doses induced time overestimation and underproduction. Chronic cannabis use had no effect on baseline time perception. While infrequent/nonsmokers showed temporal overestimation at medium and high doses and temporal underproduction at all doses, frequent cannabis users showed no differences. THC effects on time perception were not dose related. A psychoactive dose of THC increases internal clock speed as indicated by time overestimation and underproduction. This effect is not dose related and is blunted in chronic cannabis smokers who did not otherwise have altered baseline time perception.

  4. Solid-phase extraction of iridium from soil and water samples by using activated carbon cloth prior to its spectrophotometric determination.

    PubMed

    Ozkantar, Nebiye; Yilmaz, Erkan; Soylak, Mustafa; Tuzen, Mustafa

    2015-08-01

    A solid-phase extraction method for separation and preconcentration of Ir(IV) ion by using activated carbon cloth (ACC) has been presented. Ir(IV) as their 1-(2-pyridylazo) 2-naphtol (PAN) chelate was adsorbed on ACC at pH 2.0 and was eluted from ACC with acidic dimethylformamide (DMF). The Ir(IV) concentration was determined at 536 nm as Ir(IV)-PAN complex by using UV-vis spectrophotometer. The analytical parameters including pH, sample and eluent flow rates, amount of PAN, eluent type, concentration, and sample volume were optimized. The effects of foreign ions on the recoveries of iridium were also investigated. The preconcentration factor was calculated as 60. The limit of detection (LOD) and the limit of quantification (LOQ) of the method were found as 0.039 and 0.129 μg L(-1), respectively. The method was applied to soil and water samples for iridium determination.

  5. Orthogonal Higher Order Structure of the WISC-IV Spanish Using Hierarchical Exploratory Factor Analytic Procedures

    ERIC Educational Resources Information Center

    McGill, Ryan J.; Canivez, Gary L.

    2016-01-01

    As recommended by Carroll, the present study examined the factor structure of the Wechsler Intelligence Scale for Children-Fourth Edition Spanish (WISC-IV Spanish) normative sample using higher order exploratory factor analytic techniques not included in the WISC-IV Spanish Technical Manual. Results indicated that the WISC-IV Spanish subtests were…

  6. Simultaneous speciation of inorganic arsenic, selenium and tellurium in environmental water samples by dispersive liquid liquid microextraction combined with electrothermal vaporization inductively coupled plasma mass spectrometry.

    PubMed

    Liu, Ying; He, Man; Chen, Beibei; Hu, Bin

    2015-09-01

    A new method based on dispersive liquid liquid microextraction (DLLME) combined with electrothermal vaporization inductively coupled plasma mass spectrometry (ETV-ICP-MS) was developed for the simultaneous speciation of inorganic arsenic (As), selenium (Se) and tellurium (Te) with sodium diethyldithiocarbamate (DDTC) as both chelating reagent and chemical modifier. As(III), Se(IV) and Te(IV) were transformed into DDTC-chelates at pH 7 and extracted into the fine droplets formed by injecting the binary solution of bromobenzene (extraction solvent) and methanol (dispersive solvent) into the sample solution. After phase separation by centrifugation, As(III), Se(IV) and Te(IV) preconcentrated in the organic phase were determined by ETV-ICP-MS. Total inorganic As, Se and Te were obtained by reducing As(V), Se(VI) and Te(VI) to As(III), Se(IV) and Te(IV) with L-cysteine, which were then subjected to the same DLLME-ETV-ICP-MS process. The concentration of As(V), Se(VI), Te(VI) were calculated by subtracting the concentration of As(III), Se(IV) and Te(IV) from the total inorganic As, Se and Te, respectively. The main factors affecting the microextraction efficiency and the vaporization behavior of target species were investigated in detail. Under the optimal conditions, the limits of detection were 2.5, 8.6 and 0.56 ng L(-1) for As(III), Se(IV) and Te(IV), respectively, with the relative standard deviations (n=7) of 8.5-9.7%. The developed method was applied to the speciation of inorganic As, Se and Te in Certified Reference Materials of GSBZ50004-88, GBW(E)080395 and GBW(E)080548 environmental waters, and the determined values are in good agreement with the certified values. The method was also successfully applied to the simultaneous speciation of inorganic As, Se and Te in different environmental water samples with the recoveries in the range of 86.3-107% for the spiked samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Argentine tango: Another behavioral addiction?

    PubMed Central

    Targhetta, Remi; Nalpas, Bertrand; Pascal, Perney

    2013-01-01

    Background: Behavioral addiction is an emerging concept based on the resemblance between symptoms or feelings provided by drugs and those obtained with various behaviors such as gambling, etc. Following an observational study of a tango dancer exhibiting criteria of dependence on this dance, we performed a survey to assess whether this case was unique or frequently encountered in the tango dancing community. Methods: We designed an online survey based on both the DSM-IV and Goodman's criteria of dependence; we added questions relative to the positive and negative effects of tango dancing and a self-evaluation of the degree of addiction to tango. The questionnaire was sent via Internet to all the tango dancers subscribing to “ToutTango”, an electronic monthly journal. The prevalence of dependence was analyzed using DSM-IV, Goodman's criteria and self-rating scores separately. Results: 1,129 tango dancers answered the questionnaire. Dependence rates were 45.1, 6.9 and 35.9%, respectively, according to the DSM-IV, Goodman's criteria and self-rating scores. Physical symptoms of withdrawal were reported by 20% of the entire sample and one-third described a strong craving for dancing. Positive effects were high both in dependent and non-dependent groups and were markedly greater than negative effects. Long practice of tango dancing did not modify the dependence rate or reduce the level of positive effects. Conclusions: Tango dancing could lead to dependence as currently defined. However, this dependence is associated with marked and sustained positive effects whilst the negative are few. Identifying the precise substratum of this dependence needs further investigation. PMID:25215199

  8. Mood disorders in eating disorder patients: Prevalence and chronology of ONSET.

    PubMed

    Godart, N; Radon, L; Curt, F; Duclos, J; Perdereau, F; Lang, F; Venisse, J L; Halfon, O; Bizouard, P; Loas, G; Corcos, M; Jeammet, Ph; Flament, M F

    2015-10-01

    In a clinical population, we estimated the frequency of mood disorders among 271 patients suffering from Anorexia Nervosa (AN) and Bulimia Nervosa (BN) in comparison to a control group matched for age and gender. The frequency of mood disorders was measured using the Mini International Neuropsychiatric Interview (MINI), DSM-IV version. Mood disorders were more frequent among eating disorder (ED) patients than among controls, with a global prevalence of the order of 80% for each ED group. The majority of the mood disorders comorbid with ED were depressive disorders (MDD and dysthymia). The relative chronology of onset of these disorders was equivocal, because mood disorders in some cases preceded and in others followed the onset of the eating disorders. Our sample was characterized by patients with severe ED and high comorbidities, and thus do not represent the entire population of AN or BN. This also may have resulted in an overestimation of prevalence. Mood disorders appear significantly more frequently in patients seeking care for ED than in controls. These results have implications for the assessment and treatment of ED patients, and for the aetio-pathogenesis of these disorders. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Occurrence of yeasts, pseudomonads and enteric bacteria in the oral cavity of patients undergoing head and neck radiotherapy

    PubMed Central

    Gaetti-Jardim, Elerson; Ciesielski, Francisco Isaak Nicolas; de Sousa, Fátima Regina Nunes; Nwaokorie, Francisca; Schweitzer, Christiane Marie; Avila-Campos, Mario Júlio

    2011-01-01

    The aim of this study was to evaluate the occurrence of yeasts, pseudomonads and enteric bacteria in the oral cavity of patients undergoing radiotherapy (RT) for treatment of head and neck cancer. Fifty patients receiving RT were examined before, during and 30 days after RT. Saliva, mucosa, and biofilm samples were collected and microorganisms were detected by culture and polymerase chain reaction (PCR). The most prevalent yeasts in patients submitted to RT were Candida albicans, C. tropicalis, C. krusei, C. glabrata and C. parapsilosis. Citrobacter, Enterobacter, Enterococcus, Klebsiella, Proteus, and Pseudomonas were the most frequently cultivated bacteria. Before RT, targeted bacteria were cultivated from 22.2% of edentulous patients and 16.6% of dentate patients; 30 days after RT, these microorganisms were recovered from 77.8% edentulous and 46.8% dentate patients. By PCR, these microorganisms were detected from all edentulous patients, 78.1% of dentate patients. The presence of Gram-negative enteric roads and fungi was particularly frequent in patients presenting mucositis level III or IV. Modifications in the oral environment due to RT treatment seem to facilitate the colonization of oral cavity by members of family Enterobacteriaceae, genera Enterococcus and Candida. PMID:24031721

  10. Comparison of DSM-IV Symptoms in Elementary School-Age Children with PDD versus Clinic and Community Samples

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Devincent, Carla J.; Pomeroy, John; Azizian, Allen

    2005-01-01

    This study compares DSM-IV symptoms in children (ages 6 to 12 years) with pervasive developmental disorder (PDD), clinic controls, and community-based samples. Parents/teachers completed the Child Symptom Inventory-4 for four samples: PDD (N= 284/284) and non-PDD psychiatric clinic referrals (N= 189/181) and pupils in regular (N= 385/404) and…

  11. Effect of method of crystallization on the IV-III and IV-II polymorphic transitions of ammonium nitrate.

    PubMed

    Vargeese, Anuj A; Joshi, Satyawati S; Krishnamurthy, V N

    2009-01-15

    A study has been undertaken on the effect of crystallization method on the IV<-->III transition of ammonium nitrate (AN). AN is crystallized in three different ways, viz. recrystallization, evaporative crystallization and melt crystallization. When the samples were crystallized from saturated aqueous solution, ideal crystals were formed, which behaved differently from the crystals formed from the other methods. The DTA examination of the crystals showed that the crystals have different transition behaviour. The moisture uptake of the samples determined were found to have influenced by the mode of crystallization. The samples were further analyzed by powder X-ray diffraction (XRD) and scanning electron microscopy (SEM). The present study showed that the parameters like thermal history, number of previous transformations and moisture content have a very negligible influence on the IV<-->III transition of AN as compared to the method of crystallization.

  12. A study of low scores in Canadian children and adolescents on the Wechsler Intelligence Scale For Children, Fourth Edition (WISC-IV).

    PubMed

    Brooks, Brian L

    2011-01-01

    Knowing the prevalence of low neurocognitive scores for the WISC-IV Canadian normative sample (WISC-IV(CDN)) is an important supplement for clinical interpretation of test performance. On the WISC-IV(CDN), it is uncommon for children and adolescents to have 4 or more subtest scores or 2 or more Index scores ≤ 9th percentile when all scores on the battery are considered simultaneously. As the level of the child's intelligence increases or the number of years of parental education increases, the prevalence of low scores decreases. These results are consistent with existing studies of the base rates of low scores in children and adolescents on pediatric cognitive batteries, including the WISC-IV American normative sample. Tables provided are ready for clinical use.

  13. Trypanosoma cruzi discrete typing units in Chagas disease patients from endemic and non-endemic regions of Argentina.

    PubMed

    Cura, C I; Lucero, R H; Bisio, M; Oshiro, E; Formichelli, L B; Burgos, J M; Lejona, S; Brusés, B L; Hernández, D O; Severini, G V; Velazquez, E; Duffy, T; Anchart, E; Lattes, R; Altcheh, J; Freilij, H; Diez, M; Nagel, C; Vigliano, C; Favaloro, L; Favaloro, R R; Merino, D E; Sosa-Estani, S; Schijman, A G

    2012-04-01

    Genetic diversity of Trypanosoma cruzi may play a role in pathogenesis of Chagas disease forms. Natural populations are classified into 6 Discrete Typing Units (DTUs) Tc I-VI with taxonomical status. This study aimed to identify T. cruzi DTUs in bloodstream and tissue samples of Argentinean patients with Chagas disease. PCR-based strategies allowed DTU identification in 256 clinical samples from 239 Argentinean patients. Tc V prevailed in blood from both asymptomatic and symptomatic cases and Tc I was more frequent in bloodstream, cardiac tissues and chagoma samples from immunosuppressed patients. Tc II and VI were identified in a minority of cases, while Tc III and Tc IV were not detected in the studied population. Interestingly, Tc I and Tc II/VI sequences were amplified from the same skin biopsy slice from a kidney transplant patient suffering Chagas disease reactivation. Further data also revealed the occurrence of mixed DTU populations in the human chronic infection. In conclusion, our findings provide evidence of the complexity of the dynamics of T. cruzi diversity in the natural history of human Chagas disease and allege the pathogenic role of DTUs I, II, V and VI in the studied population.

  14. Seven common mistakes in population genetics and how to avoid them.

    PubMed

    Meirmans, Patrick G

    2015-07-01

    As the data resulting from modern genotyping tools are astoundingly complex, genotyping studies require great care in the sampling design, genotyping, data analysis and interpretation. Such care is necessary because, with data sets containing thousands of loci, small biases can easily become strongly significant patterns. Such biases may already be present in routine tasks that are present in almost every genotyping study. Here, I discuss seven common mistakes that can be frequently encountered in the genotyping literature: (i) giving more attention to genotyping than to sampling, (ii) failing to perform or report experimental randomization in the laboratory, (iii) equating geopolitical borders with biological borders, (iv) testing significance of clustering output, (v) misinterpreting Mantel's r statistic, (vi) only interpreting a single value of k and (vii) forgetting that only a small portion of the genome will be associated with climate. For every of those issues, I give some suggestions how to avoid the mistake. Overall, I argue that genotyping studies would benefit from establishing a more rigorous experimental design, involving proper sampling design, randomization and better distinction of a priori hypotheses and exploratory analyses. © 2015 John Wiley & Sons Ltd.

  15. Symptom Profile of ADHD in Youth With High-Functioning Autism Spectrum Disorder: A Comparative Study in Psychiatrically Referred Populations.

    PubMed

    Joshi, Gagan; Faraone, Stephen V; Wozniak, Janet; Tarko, Laura; Fried, Ronna; Galdo, Maribel; Furtak, Stephannie L; Biederman, Joseph

    2017-08-01

    To compare the clinical presentation of ADHD between youth with autism spectrum disorder (ASD) and ADHD and a sample of youth with ADHD only. A psychiatrically referred sample of autism spectrum disorder (ASD) youth with ADHD attending a specialized ambulatory program for ASD ( n = 107) and a sample of youth with ADHD attending a general child psychiatry ambulatory clinic ( n = 74) were compared. Seventy-six percent of youth with ASD met Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV) criteria for ADHD. The clinical presentation of ADHD in youth with ASD was predominantly similar to its typical presentation including age at onset (3.5 ± 1.7 vs. 4.0 ± 1.9; p = .12), distribution of diagnostic subtypes, the qualitative and quantitative symptom profile, and symptom severity. Combined subtype was the most frequent presentation of ADHD in ASD youth. Despite the robust presentation of ADHD, a significant majority of ASD youth with ADHD failed to receive appropriate ADHD treatment (41% vs. 24%; p = .02). A high rate of comorbidity with ADHD was observed in psychiatrically referred youth with ASD, with a clinical presentation typical of the disorder.

  16. Incidence of phlebitis associated with the use of peripheral IV catheter and following catheter removal

    PubMed Central

    Urbanetto, Janete de Souza; Peixoto, Cibelle Grassmann; May, Tássia Amanda

    2016-01-01

    ABSTRACT Objective: to investigate the incidence of phlebitis and its association with risk factors when using peripheral IV catheters (PIC) and following their removal - (post-infusion phlebitis) in hospitalized adults. Method: a cohort study of 171 patients using PIC, totaling 361 punctures. Sociodemographic variables and variables associated with the catheter were collected. Descriptive and analytical statistical analyses were performed. Results: average patient age was 56.96 and 51.5% of the sample population was male. The incidence of phlebitis was 1.25% while using PIC, and 1.38% post-infusion. The incidence of phlebitis while using PIC was associated with the length of time the catheter remained in place, whereas post-infusion phlebitis was associated with puncture in the forearm. Ceftriaxone, Clarithromycin and Oxacillin are associated with post-infusion phlebitis. Conclusions: this study made it possible to investigate the association between risk factors and phlebitis during catheter use and following its removal. The frequency of post-infusion phlebitis was larger than the incidence of phlebitis with the catheter in place, with Phlebitis Grade III and II being the most frequently found in each of these situations, respectively. Aspects related to post-infusion phlebitis can be explained, given the limited number of studies addressing this theme from this perspective. PMID:27508916

  17. Sex differences in antisocial personality disorder: results from the National Epidemiological Survey on Alcohol and Related Conditions.

    PubMed

    Alegria, Analucia A; Blanco, Carlos; Petry, Nancy M; Skodol, Andrew E; Liu, Shang-Min; Grant, Bridget; Hasin, Deborah

    2013-07-01

    Despite the 3:1 prevalence ratio of men versus women with Antisocial Personality Disorder (ASPD), research on sex differences on correlates of ASPD in the general population is scarce. The purpose of this study was to examine sex differences in childhood and adult adverse events, lifetime psychiatric comorbidity, and clinical correlates of DSM-IV ASPD. The sample included 819 men and 407 women with DSM-IV ASPD diagnosis. Data were derived from the National Epidemiologic Survey on Alcohol and Related Conditions (NESARC) (N = 43,093). Compared to men, women with ASPD reported more frequent childhood emotional neglect (AOR = 2.25; 95% CI: 1.52-3.34) and sexual abuse (AOR = 4.20; 95% CI: 2.78-6.35), any parent-related adverse event during childhood (e.g., parental substance use disorder) (AOR = 2.47; 95% CI: 1.60-3.82), and adverse events during adulthood (AOR = 4.20; 95% CI: 2.78-6.35). Although women with ASPD present less violent antisocial behaviors and higher rates of aggressiveness and irritability (OR = 0.46; 95% CI: 0.31-0.67), they have higher rates of victimization, greater impairment, and lower social support. Our findings suggest increased mental health needs in women with ASPD, meriting development of different treatment programs for women and men.

  18. Prevalence of Mental Health problems in sentenced men in prisons from Andalucía (Spain).

    PubMed

    López, M; Saavedra, F J; López, A; Laviana, M

    2016-12-01

    To estimate the prevalence of different mental health problems in men serving prison sentences in Andalusia. Descriptive, cross-sectional study of a random sample of 472 men interned in two prisons located in Andalusia. We collected socio-demographic and general criminal and penitentiary data, and we identified mental health problems with two validated instruments for epidemiological research in mental health: the SCID-I interview to diagnose Axis 1 disorders of the DSM-IV and the self-applied questionnaire IPDE to estimate personality disorders. We analyzed the data (proportions and confidence intervals) with the SPSS-18 statistical package. 82.6% of the sample had a history of having suffered some type of mental health problem throughout their life (prevalence-life) and 25.8 have suffered from them in the past month (month prevalence). The most common disorders of the Axis I (DSM-IV) are related to abuse of and dependence on psychoactive substances (prevalence life of 65.9% and month prevalence of 6.6%), with an important but less frequent presence of affective (31.4%-9.3%), anxiety (30.9%-10, 4%) and psychotic disorders (9.5%-3, 4%). As regards personality disorders, the estimated probable prevalence lies between the 56.6% ("5" cutoff point) and the 79.9 ("4" cut-off point). The male inmate population in prisons in Andalucía shows a high prevalence of mental health problems, similar to that found in other Spanish and international prisons, but their care needs should take into account the different pathologies that they present.

  19. Specificity of abnormal brain volume in major depressive disorder: a comparison with borderline personality disorder.

    PubMed

    Depping, Malte S; Wolf, Nadine D; Vasic, Nenad; Sambataro, Fabio; Thomann, Philipp A; Christian Wolf, R

    2015-03-15

    Abnormal brain volume has been frequently demonstrated in major depressive disorder (MDD). It is unclear if these findings are specific for MDD since aberrant brain structure is also present in disorders with depressive comorbidity and affective dysregulation, such as borderline personality disorder (BPD). In this transdiagnostic study, we aimed to investigate if regional brain volume loss differentiates between MDD and BPD. Further, we tested for associations between brain volume and clinical variables within and between diagnostic groups. 22 Females with a DSM-IV diagnosis of MDD, 17 females with a DSM-IV diagnosis of BPD and without comorbid posttraumatic stress disorder, and 22 age-matched female healthy controls (HC) were investigated using magnetic resonance imaging. High-resolution structural data were analyzed using voxel-based morphometry. A significant (p<0.05, cluster-corrected) volume decrease of the anterior cingulate cortex (ACC) was found in MDD compared to HC, as opposed to volume decreases of the amygdala in BPD compared to both HC and MDD. Sensitivity and specificity of regional gray matter volume for a diagnosis of MDD were modest to fair. Amygdala volume was related to depressive symptoms across the entire patient sample. Potential limitations of this study include the modest sample size and the heterogeneous psychotropic drug treatment. ACC volume reduction is more pronounced in MDD with an intermediate degree of volume loss in BPD compared to HC. In contrast, amygdala volume loss is more pronounced in BPD compared to MDD, yet amygdala volume is associated with affective symptom expression in both disorders. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Panic disorder and agoraphobia: A direct comparison of their multivariate comorbidity patterns.

    PubMed

    Greene, Ashley L; Eaton, Nicholas R

    2016-01-15

    Scientific debate has long surrounded whether agoraphobia is a severe consequence of panic disorder or a frequently comorbid diagnosis. Multivariate comorbidity investigations typically treat these diagnoses as fungible in structural models, assuming both are manifestations of the fear-subfactor in the internalizing-externalizing model. No studies have directly compared these disorders' multivariate associations, which could clarify their conceptualization in classification and comorbidity research. In a nationally representative sample (N=43,093), we examined the multivariate comorbidity of panic disorder (1) without agoraphobia, (2) with agoraphobia, and (3) regardless of agoraphobia; and (4) agoraphobia without panic. We conducted exploratory and confirmatory factor analyses of these and 10 other lifetime DSM-IV diagnoses in a nationally representative sample (N=43,093). Differing bivariate and multivariate relations were found. Panic disorder without agoraphobia was largely a distress disorder, related to emotional disorders. Agoraphobia without panic was largely a fear disorder, related to phobias. When considered jointly, concomitant agoraphobia and panic was a fear disorder, and when panic was assessed without regard to agoraphobia (some individuals had agoraphobia while others did not) it was a mixed distress and fear disorder. Diagnoses were obtained from comprehensively trained lay interviewers, not clinicians and analyses used DSM-IV diagnoses (rather than DSM-5). These findings support the conceptualization of agoraphobia as a distinct diagnostic entity and the independent classification of both disorders in DSM-5, suggesting future multivariate comorbidity studies should not assume various panic/agoraphobia diagnoses are invariably fear disorders. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Methicillin-resistant Staphylococcus aureus in public transportation vehicles (buses): another piece to the epidemiologic puzzle.

    PubMed

    Lutz, Jonathan K; van Balen, Joany; Crawford, John Mac; Wilkins, John R; Lee, Jiyoung; Nava-Hoet, Rocio C; Hoet, Armando E

    2014-12-01

    Little is known about the occurrence and epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) in public transportation in the United States. This research sought to determine the background prevalence and phenotypic and genotypic characteristics of MRSA strains circulating on buses from a large, metropolitan transportation agency. Electrostatic wipes were used to collect 237 surface samples from 40 buses randomly selected from July-October 2010. Six samples were collected from each bus immediately postservice and before any cleaning and disinfection. Positive isolates were analyzed for antibiotic resistance, staphylococcal cassette chromosome mec (SCCmec) type, and pulsed-field gel electrophoresis; and potential epidemiologic factors were examined. Of the buses, 68% (27/40) were contaminated with S aureus, and 63% (25/40) were contaminated with MRSA. Seats and seat rails were the surfaces most frequently contaminated, followed by the back door and stanchions. Most (62.9%) of the MRSA isolates were classified as community-associated MRSA clones (SCCmec type IV), and 22.9% were health care-associated MRSA clones (SCCmec type II). Of the MRSA strains, 65% (5/20) were multidrug resistant. MRSA was frequently isolated from commonly touched surfaces in buses serving both hospital and community routes. Phenotypic and genotypic analysis demonstrated that buses may be effective mixing vessels for MRSA strains of both community and health care-associated origin. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  2. Social phobia in Finnish general adolescent population: prevalence, comorbidity, individual and family correlates, and service use.

    PubMed

    Ranta, Klaus; Kaltiala-Heino, Riittakerttu; Rantanen, Päivi; Marttunen, Mauri

    2009-01-01

    Few studies have investigated the epidemiology of social phobia (SP) among early to middle adolescents, at the time of suggested mean onset of the disorder. The objective of this study was to investigate the prevalence, comorbidity, individual and familial correlates, and service use associated with SP among Finnish 12-17-year-old adolescents in general population. A sample of 784 adolescents was screened with the Social Phobia Inventory, and a sub-sample (n=350) was interviewed with a semi-structured clinical interview to identify SP, sub-clinical SP (SSP), and a range of other axis I DSM-IV disorders. Individual and familial correlates, and service use associated with SP were also inquired. We found a 12-month prevalence of 3.2% for SP, and 4.6% for SSP. The prevalence rose and the gender ratio shifted to female preponderance as age increased. SP was frequently comorbid with other anxiety disorders (41%) and depressive disorders (41%). Adolescents with SP/SSP were impaired in their academic and global functioning, and reported more parental psychiatric treatment contacts. Two thirds (68%) of adolescents with SP reported having been bullied by peers. Only one fifth of adolescents with non-comorbid SP had been in contact with a mental health professional. We conclude that adolescent SP is a relatively frequent, undertreated and highly comorbid condition, associated with educational impairment, depression and anxiety in parents, and peer victimization. (c) 2009 Wiley-Liss, Inc.

  3. Overview of the study design, participation and field work of the German Environmental Survey on Children 2003-2006 (GerES IV).

    PubMed

    Schulz, Christine; Seiwert, Margarete; Babisch, Wolfgang; Becker, Kerstin; Conrad, André; Szewzyk, Regine; Kolossa-Gehring, Marike

    2012-07-01

    The German Federal Environment Agency carried out its fourth German Environmental Survey (GerES IV), which is the first survey on children only and the environment-related module of the German Health Interview and Examination Survey for Children and Adolescents (German acronym: KiGGS), conducted by the Robert Koch Institute (RKI). The German Environmental Surveys are nationwide population studies conducted to determine the exposure to environmental pollutants, to explore exposure pathways and to identify sub-groups with higher exposure. GerES IV was conducted on randomly selected 1790 children aged 3-14 years from the cross-sectional sample of KiGGS. The participants of GerES IV lived in 150 sampling locations all over Germany. Field work was carried out from May 2003 to May 2006. The response rate in GerES IV was 77.3%. Due to the fact that participation in GerES IV was limited to children that had previously participated in the KiGGS study, the total response rate in GerES IV resulted in 52.6%. Response rates did neither differ significantly between West and East Germany, nor between different community sizes, age groups and gender. The basic study programme included blood samples, morning urine, tap water and house dust as well as comprehensive questionnaire-based interviews. In addition, subgroups were studied with regard to "noise, hearing capacity and stress hormones", "chemical contamination of indoor air" and "biogenic indoor contamination". A key element of the field work in GerES IV was a home visit to carry out interviews, conduct measurements and collect samples. An exception was blood sampling which was carried out within KiGGS. The quality of field work, data collection, evaluation, and chemical, biological and physical analyses was successfully evaluated by internal and external quality assurance. This comprehensive overview aims at giving other research groups the opportunity to compare different study designs or to adapt their own design to get comparable results. Copyright © 2012 Elsevier GmbH. All rights reserved.

  4. Preconcentration and speciation of ultra-trace Se (IV) and Se (VI) in environmental water samples with nano-sized TiO2 colloid and determination by HG-AFS.

    PubMed

    Fu, Jiaqi; Zhang, Xu; Qian, Shahua; Zhang, Lin

    2012-05-30

    A united method for speciation analysis of Se (IV) and Se (VI) in environmental water samples was developed using nano-sized TiO(2) colloid as adsorbent and hydride generation atomic fluorescence spectrometry (HG-AFS) as determination means. When the pH values of bulk solution were between 6.0 and 7.0, successful adsorption onto 1 mL nano-sized TiO(2) colloid (0.2%) was achieved for more than 97.0% of Se (IV) while Se (VI) barely got adsorbed. Therefore, the method made it possible to preconcentrate and determine Se (IV) and Se (VI) separately. The precipitated TiO(2) with concentrated selenium was directly converted to colloid without desorption. Selenium in the resulting colloid was then determined by HG-AFS. The detection limits (3σ) and relative standard deviations (R.S.D) of this method were 24 ng/L and 42 ng/L, 7.8% (n=6) and 7.0% (n=6) for Se (IV) and Se (VI), respectively. This simple, sensitive, and united method was successfully applied to the separation and speciation of ultra-trace Se (IV) and Se (VI) in environmental water samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Graphene oxide-TiO2 composite solid phase extraction combined with graphite furnace atomic absorption spectrometry for the speciation of inorganic selenium in water samples.

    PubMed

    Zhang, Yanan; Chen, Beibei; Wu, Shaowei; He, Man; Hu, Bin

    2016-07-01

    In this paper, a method of graphene oxide (GO)-TiO2 composite solid phase extraction followed by graphite furnace atomic absorption spectrometry (GFAAS) detection was proposed for the speciation of inorganic selenium in environmental waters. The adsorption behavior of inorganic Se(IV) and Se(VI) on the GO-TiO2(1:1) composite was investigated. It was found that Se(IV) was quantitatively retained on the GO-TiO2 composites within a wide pH range of 0.5-10, while Se(VI) was quantitatively adsorbed on GO-TiO2(1:1) composite at pH 0.5-2, and no obvious adsorption of Se(VI) within the pH range of 4-10 was found. By selecting pH 6.0, Se(IV) could be easily determined. After reduction of Se(VI), total Se was determined by the proposed method, and Se(VI) was calculated as the difference between the total Se and Se(IV). The factors affecting the separation/preconcentration of Se(IV) and Se(VI) were studied. Under the optimum conditions, the isothermal adsorption of Se(IV) on the GO-TiO2(1:1) composite fitted Langmuir model; a linear range over 0.1-12ngmL(-1) was obtained. The limit of detection (LOD) and precision of the method for Se(IV) was 0.04ngmL(-1) and 9.4% (cSe(IV)=0.5ngmL(-1), n=7), respectively. In order to verify the accuracy of the method, a standard water sample (GSBZ50031-94) was analyzed, and the determined value was in a good agreement to the certified value. The established method was applied to inorganic Se speciation in environmental water samples and the recovery of 87.4-102% was obtained for the spiked samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Identifying cases of heroin toxicity where 6-acetylmorphine (6-AM) is not detected by toxicological analyses.

    PubMed

    Ellis, Ashley D; McGwin, Gerald; Davis, Gregory G; Dye, Daniel W

    2016-09-01

    Heroin has a half-life of 2-6 min and is metabolized too quickly to be detected in autopsy samples. The presence of 6-acetylmophine (6-AM) in urine, blood, or other samples is convincing evidence of heroin use by a decedent, but 6-AM itself has a half-life of 6-25 min before it is hydrolyzed to morphine, so 6-AM may not be present in sufficient concentration to detect in postmortem samples. Codeine is often present in heroin preparations as an impurity and is not a metabolite of heroin. Studies report that a ratio of morphine to codeine greater than one indicates heroin use. We hypothesize that the ratio of morphine to codeine in our decedents abusing drugs intravenously will be no different in individuals with 6-AM present than in individuals where no 6-AM is detected, and we report our study of this hypothesis. All accidental deaths investigated by the Jefferson County Coroner/Medical Examiner Office from 2010 to 2013 with morphine detected in blood samples collected at autopsy were reviewed. Five deaths where trauma caused or contributed to death were excluded from the review. The presence or absence of 6-AM and the concentrations of morphine and codeine were recorded for each case. The ratio of morphine to codeine was calculated for all decedents. Any individual in whom no morphine or codeine was detected in a postmortem sample was excluded from further study. Absence or presence of drug paraphernalia or evidence of intravascular (IV) drug use was documented in each case to identify IV drug users. The proportion of the IV drug users with and without 6-AM present in a postmortem sample was compared to the M/C ratio for the individuals. Of the 230 deaths included in the analysis, 103 IV drug users with quantifiable morphine and codeine in a postmortem sample were identified allowing for calculation of an M/C ratio. In these IV drug users, the M/C ratio was greater than 1 in 98 % of decedents. When controlling for the absence or presence of 6-AM there was no statistically significant difference in the proportion of IV drug users when compared to non IV drug users with an M/C ratio of greater than 1 (p = 1.000). The M/C ratio in IV drug users, if greater than 1, is seen in deaths due to heroin toxicity where 6-AM is detected in a postmortem sample. This study provides evidence that a M/C ratio greater than one in an IV drug user is evidence of a death due to heroin toxicity even if 6-AM is not detected in the blood. Using the M/C ratio, in addition to scene and autopsy findings, provides sufficient evidence to show heroin is the source of the morphine and codeine. Listing heroin as a cause or contributing factor in deaths with evidence of IV drug abuse and where the M/C ratio exceeds 1 will improve identification of heroin fatalities, which will allow better allocation of resources for public health initiatives.

  7. Bipolar obsessive-compulsive disorder and personality disorders.

    PubMed

    Maina, Giuseppe; Albert, Umberto; Pessina, Enrico; Bogetto, Filippo

    2007-11-01

    Relatively few systematic data exist on the clinical impact of bipolar comorbidity in obsessive-compulsive disorder (OCD) and no studies have investigated the influence of such a comorbidity on the prevalence and pattern of Axis II comorbidity. The aim of the present study was to explore the comorbidity of personality disorders in a group of patients with OCD and comorbid bipolar disorder (BD). The sample consisted of 204 subjects with a principal diagnosis of OCD (DSM-IV) and a Yale-Brown Obsessive-Compulsive Scale (Y-BOCS) score>or=16 recruited from all patients consecutively referred to the Anxiety and Mood Disorders Unit, Department of Neuroscience, University of Turin over a period of 5 years (January 1998-December 2002). Diagnostic evaluation and Axis I comorbidities were collected by means of the Structured Clinical Interview for DSM-IV Axis I Disorders (SCID-I). Personality status was assessed by using the Structured Clinical Interview for DSM-IV Axis II Disorders (SCID-II). Socio-demographic and clinical features (including Axis II comorbidities) were compared between OCD patients with and without a lifetime comorbidity of BD. A total of 21 patients with OCD (10.3%) met DSM-IV criteria for a lifetime BD diagnosis: 4 (2.0%) with BD type I and 17 (8.3%) with BD type II. Those without a BD diagnosis showed significantly higher rates of male gender, sexual and hoarding obsessions, repeating compulsions and lifetime comorbid substance use disorders, when compared with patients with BD/OCD. With regard to personality disorders, those with BD/OCD showed higher prevalence rates of Cluster A (42.9% versus 21.3%; p=0.027) and Cluster B (57.1% versus 29.0%; p=0.009) personality disorders. Narcissistic and antisocial personality disorders were more frequent in BD/OCD. Our results point towards clinically relevant effects of comorbid BD on the personality profiles of OCD patients, with higher rates of narcissistic and antisocial personality disorders in BD/OCD patients.

  8. Screening and characterization of Staphylococcus aureus from ophthalmology clinic surfaces: a proposed surveillance tool

    PubMed Central

    Reem, Rachel E.; Van Balen, Joany; Hoet, Armando E.; Cebulla, Colleen M.

    2014-01-01

    Purpose To screen environmental surfaces of an outpatient ophthalmic clinic for methicillin-susceptible and methicillin-resistant Staphylococcus aureus (MSSA and MRSA); to identify the most commonly contaminated surfaces; and to phenotype and genotype all collected isolates Design A single institution, one-year prospective environmental study Methods Commonly touched surfaces from examination rooms and common areas were targeted and sampled on a quarterly basis for one year. Samples were collected using electrostatic cloths and swabs. S. aureus was isolated using non-selective and selective media. Morphological characteristics and standard biological testing were used to confirm staphylococcal species. S. aureus isolates were phenotypically (Kirby-Bauer method) and genotypically characterized (mecA confirmation, SCCmec typing and pulsed-field gel electrophoresis). Dendrogram analysis was used to establish genetic relatedness between the isolates. Results Of 112 total samples, 27 (24%) and 5 (4%) were MSSA- and MRSA-positive, respectively. Both community-associated (SCCmec IV, USA300) and hospital-associated (SCCmec II, USA100) MRSA isolates were found. No single surface remained consistently positive with the same isolate over time and molecular analysis demonstrated high levels of diversity among isolates. Doorknobs, slit-lamp head/chinrests, and computer keyboards were frequently contaminated. Conclusions The proposed surveillance protocol successfully allowed the detection of both MSSA and MRSA contaminating important high-touch surfaces in a representative ophthalmology clinic. Frequently contaminated surfaces must be targeted for routine cleaning and disinfection as a there is a constant introduction of clones over time. Hence, other clinics may consider implementing and adapting surveillance tools, as the one here described, to help them control these important nosocomial pathogens. PMID:24412125

  9. Occurrence, Molecular Characterization and Assessment of Zoonotic Risk of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Pigs in Henan, Central China.

    PubMed

    Wang, Haiyan; Zhang, Yiqi; Wu, Yayun; Li, Junqiang; Qi, Meng; Li, Tingwen; Wang, Jianling; Wang, Rongjun; Zhang, Sumei; Jian, Fuchun; Ning, Changshen; Zhang, Longxian

    2018-05-12

    Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi are common gastrointestinal pathogens in humans and animals. Little is known about them and the range of species/assemblages/genotypes occurring in domestic pigs in China. Here, we present data on the occurrence and molecular diversity of these pathogens detected in the faeces from farms in Henan, central China. Of 897 fecal samples tested, 28 (3.1%), 15 (1.7%) and 408 (45.5%) samples were positive for Cryptosporidium, G. duodenalis and E. bieneusi, respectively. Cryptosporidium and G. duodenalis were most frequently detected in piglets, while E. bieneusi was markedly more prevalent in fattening pigs. Sequence analysis of SSU rRNA gene revealed that positive Cryptosporidium strains belonged to C. suis (n=18) and C. scrofarum (n=10). G. duodenalis assemblages E (n=9), assemblages A (n=3) and assemblages C (n=3) were characterized based on the sequence analysis of tpi gene. Thirteen E. bieneusi genotypes comprising four novel (pigHN-I to pigHN-IV) and nine known (EbpC, EbpA, pigEbITS5, LW1, H, CM8, G, CHG19, and CHS5) genotypes were identified by ITS sequence analysis of a large proportion (n=200) of E. bieneusi-positive samples. EbpC was the most frequent genotype, detected in 60 specimens. All 13 genotypes identified in this study clustered in zoonotic Group 1. The findings indicate that the presence of zoonotic species/assemblages/genotypes of these pathogens poses a threat to public health, suggesting that pigs in Henan province could be a significant source of human infection and water pollution. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Discrepancy Score Reliabilities in the WAIS-IV Standardization Sample

    ERIC Educational Resources Information Center

    Glass, Laura A.; Ryan, Joseph J.; Charter, Richard A.

    2010-01-01

    In the present investigation, the authors provide internal consistency reliabilities for Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) subtest and Index discrepancy scores using the standardization sample as the data source. Reliabilities ranged from 0.55 to 0.88 for subtest discrepancy scores and 0.80 to 0.91 for Index discrepancy…

  11. The prevalence of ADHD in a population-based sample

    PubMed Central

    Rowland, Andrew S.; Skipper, Betty J.; Umbach, David M.; Rabiner, David L.; Campbell, Richard A.; Naftel, A. Jack; Sandler, Dale P.

    2014-01-01

    Objective Few studies of ADHD prevalence have used population-based samples, multiple informants, and DSM-IV criteria. In addition, children who are asymptomatic while receiving ADHD mediction often have been misclassified. Therefore, we conducted a population-based study to estimate the prevalence of ADHD in elementary school children using DSM-IV critera. Methods We screened 7587 children for ADHD. Teachers of 81% of the children completed a DSM-IV checklist. We then interviewed parents using a structured interview (DISC). Of these, 72% participated. Parent and teacher ratings were combined to determine ADHD status. We also estimated the proportion of cases attributable to other conditions. Results Overall, 15.5% of our sample (95% confidence interval (C.I.) 14.6%-16.4%) met DSM-IV-TR criteria for ADHD. Over 40% of cases reported no previous diagnosis. With additional information, other conditions explained about 9% of cases. Conclusions The prevalence of ADHD in this population-based sample was higher than the 3-7% commonly reported. To compare study results, the methods used to implement the DSM criteria need to be standardized. PMID:24336124

  12. CMS-G from Beta vulgaris ssp. maritima is maintained in natural populations despite containing an atypical cytochrome c oxidase.

    PubMed

    Meyer, Etienne H; Lehmann, Caroline; Boivin, Stéphane; Brings, Lea; De Cauwer, Isabelle; Bock, Ralph; Kühn, Kristina; Touzet, Pascal

    2018-02-23

    While mitochondrial mutants of the respiratory machinery are rare and often lethal, cytoplasmic male sterility (CMS), a mitochondrially inherited trait that results in pollen abortion, is frequently encountered in wild populations. It generates a breeding system called gynodioecy. In Beta vulgaris ssp. maritima , a gynodioecious species, we found CMS-G to be widespread across the distribution range of the species. Despite the sequencing of the mitochondrial genome of CMS-G, the mitochondrial sterilizing factor causing CMS-G is still unknown. By characterizing biochemically CMS-G, we found that the expression of several mitochondrial proteins is altered in CMS-G plants. In particular, Cox1, a core subunit of the cytochrome c oxidase (complex IV), is larger but can still assemble into complex IV. However, the CMS-G-specific complex IV was only detected as a stabilized dimer. We did not observe any alteration of the affinity of complex IV for cytochrome c ; however, in CMS-G, complex IV capacity is reduced. Our results show that CMS-G is maintained in many natural populations despite being associated with an atypical complex IV. We suggest that the modified complex IV could incur the associated cost predicted by theoretical models to maintain gynodioecy in wild populations. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  13. [Ehlers Danlos type IV syndrome presenting with simultaneous dissection of both internal carotid and both vertebral arteries].

    PubMed

    Mondon, K; de Toffol, B; Georgesco, G; Cassarini, J-F; Machet, M-C; Cottier, J-P; Arbeille, B; Autret, A

    2004-04-01

    Dissection of cervical arteries is a frequent cause of stroke in young subjects. We report the case of a 34-year-old patient who experienced simultaneous dissection of both internal carotid arteries and both vertebral arteries leading to repeated motor deficit of the right half-body associated with persistent otalgia. Search for an etiology led to the diagnosis of Ehlers-Danlos syndrome type IV. Search for the cause of cervical artery dissection must consider connective tIssue disease, particularly vascular forms of Ehler-Danlos syndrome. Diagnostic, therapeutic as well as prognostic aspects are discussed.

  14. The prognosis and incidence of social phobia in an elderly population. A 5-year follow-up.

    PubMed

    Karlsson, B; Sigström, R; Waern, M; Ostling, S; Gustafson, D; Skoog, I

    2010-07-01

    To examine the prognosis and incidence of social fears and phobia in an elderly population sample followed for 5 years. A general population sample (N = 612) of non-demented men (baseline age 70) and women (baseline age 70 and 78-86) was investigated in 2000-2001 and in 2005-2006 with semi-structured psychiatric examinations including the Comprehensive Psychopathological Rating Scale, and the Mini International Neuropsychiatric Interview. Social phobia was diagnosed according to the DSM-IV criteria. Among nine individuals with DSM-IV social phobia in 2000, 5 (55.6%) had no social fears in 2005, and 1 (11.1%) still met the criteria for DSM-IV social phobia. Among individuals without DSM-IV social phobia in 2000 (N = 603), 12 (2.0%) had DSM-IV social phobia in 2005. These findings challenge the notion that social phobia is a chronic disorder with rare occurrence in old age.

  15. GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico.

    PubMed

    Hernández-Juárez, Aideé Alejandra; Lugo-Trampe, José de Jesús; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Angel; Treviño-González, José Luis; de-la-Cruz-Ávila, Israel; Martínez-de-Villarreal, Laura Elia

    2014-12-01

    Mutations in the DFNB1 locus are the most common cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL) worldwide. The aim of this study was to identify the most frequent mutations in patients with ARNSHL who reside in Northeastern Mexico. We determined the nucleotide sequence the coding region of GJB2 of 78 patients with ARNSHL. Polymerase chain reaction assays were used to detect the GJB2 IVS1+1G>A mutation and deletions within GJB6. GJB2 mutations were detected in 9.6% of the alleles, and c.35delG was the most frequent. Six other less-frequent mutations were detected, including an extremely rare variant (c.645_648delTAGA), a novel mutation (c.35G>A), and one of possible Mexican origin (c.34G>T). GJB6 deletions and GJB2 IVS1+1G>A were not detected. These data suggest that mutations in the DFNB1 locus are a rare cause of ARNSHL among the population of Northeastern Mexico. This confirms the genetic heterogeneity of this condition and indicates that further research is required to determine the other mechanisms of pathogenesis of ARNSHL in Mexicans. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Exercise dependence among customers from a Parisian sport shop.

    PubMed

    Lejoyeux, Michel; Guillot, Cecilia; Chalvin, Florence; Petit, Aymeric; Lequen, Valerie

    2012-03-01

    We assessed exercise dependence (ED), alcohol and nicotine use disorders, eating disorders, hypochondria and compulsive buying and in a population of customers of a Parisian sport shop. Five hundred consecutive customers of a sport shop were invited to participate. Diagnostic of exercise dependence was made with the Exercise Addiction Inventory and a specific questionnaire checking all diagnostic criteria. The DSM-IV-TR criteria for bulimia, alcohol and nicotine use disorders were checked and all subjects answered the CAGE and Fagerström questionnaires. Hypochondria was assessed with the DSM-IV-TR criteria and the Whiteley Index of Health Anxiety. For all parameters, customers with (ED+) and without (ED-) exercise dependence were compared. The prevalence of exercise dependence was 29.6%. Subjects from the ED+ group were younger than in the ED-group (27.1 vs 29.8 years) and there were more women. They were more dependent on alcohol, had higher scores at the CAGE questionnaire. ED+ subjects more often presented hypochondria (23 vs 15%), bulimia and binge eating and they more often made gifts to themselves and to others. Exercise dependence appears as a frequent and almost always unrecognized form of behavioral dependence in non clinical population frequenting sport shops. It is frequently associated to chemical dependence and eating disorders.

  17. [The forensic medical evaluation of the injuries to the cervical spine in the driver and the front-seat passenger of a modern motor vehicle after the frontal crash].

    PubMed

    Pigolkin, Yu I; Dubrovin, I A; Sedykh, E P; Mosoyan, A S

    2015-01-01

    The objective of the present study was to elucidate the specific features of the lesions of the cervical spine in the driver and the front-seat passenger of a modern car after the frontal crash. We made use of the archival materials of forensic medical expertises concerning the traffic accidents carried out in the city of Moscow during the period from 2005 to 2012. The study was focused on the analysis of the character of the fractures of cervical vertebrae in the drivers (n = 55) and the front-seat passengers (n = 85) of a modern motor vehicle involved in a traffic accident. It was shown that the drivers most frequently suffer bending-extension fractures of the cervical vertebrae, with the II-IV vertebrae being especially frequently subject to multiple fractures resulting in the damage to the anterior support column, sometimes to both the anterior and posterior columns, and much rarer to the posterior column. The front-seat passengers also suffer bending-extension fractures. The IV-VI vertebrae are most frequently affected in them with isolated damages to either the anterior or the posterior support column of the neck vertebrae.

  18. A fast-track anaemia clinic in the Emergency Department: feasibility and efficacy of intravenous iron administration for treating sub-acute iron deficiency anaemia.

    PubMed

    Quintana-Díaz, Manuel; Fabra-Cadenas, Sara; Gómez-Ramírez, Susana; Martínez-Virto, Ana; García-Erce, José A; Muñoz, Manuel

    2016-03-01

    Clinically significant anaemia, requiring red blood cell transfusions, is frequently observed in Emergency Departments (ED). To optimise blood product use, we developed a clinical protocol for the management of iron-deficiency anaemia in a fast-track anaemia clinic within the ED. From November 2010 to January 2014, patients presenting with sub-acute, moderate-to-severe anaemia (haemoglobin [Hb] <11 g/dL) and confirmed or suspected iron deficiency were referred to the fast-track anaemia clinic. Those with absolute or functional iron deficiency were given intravenous (IV) ferric carboxymaltose 500-1,000 mg/week and were reassessed 4 weeks after receiving the total iron dose. The primary study outcome was the haematological response (Hb≥12 g/dL and/or Hb increment ≥2 g/dL). Changes in blood and iron parameters, transfusion rates and IV iron-related adverse drug effects were secondary outcomes. Two hundred and two anaemic patients with iron deficiency (150 women/52 men; mean age, 64 years) were managed in the fast-track anaemia clinic, and received a median IV iron dose of 1,500 mg (1,000-2,000 mg). Gastro-intestinal (44%) or gynaecological (26%) bleeding was the most frequent cause of the anaemia. At follow-up (183 patients), the mean Hb increment was 3.9±2.2 g/dL; 84% of patients were classified as responders and blood and iron parameters normalised in 90%. During follow-up, 35 (17%) patients needed transfusions (2 [range: 1-3] units per patient) because they had low Hb levels, symptoms of anaemia and/or were at risk. Eight mild and one moderate, self-limited adverse drug effects were witnessed. Our data support the feasibility of a clinical protocol for management of sub-acute anaemia with IV iron in the ED. IV iron was efficacious, safe and well tolerated. Early management of anaemia will improve the use of blood products in the ED.

  19. No bacterial growth found in spiked intravenous fluids over an 8-hour period.

    PubMed

    Haas, Richard E; Beitz, Edwin; Reed, Amy; Burtnett, Howard; Lowe, Jason; Crist, Arthur E; Stierer, Kevin A; Birenberg, Allan M

    2017-04-01

    Protocol changes prompted by the Joint Commission mandating intravenous (IV) fluid bags to be used within 1 hour of spiking because of possible bacterial contamination have sparked clinical and economic concerns. This study investigated the degree of bacterial growth in which samples were obtained from spiked IV fluid bags at the time of spiking and 1, 2, 4, and 8 hours after spiking. No bacterial growth occurred in any of the 80 bags of Lactated Ringer's (LR) IV solutions sampled. This study demonstrated that LR IV bags do not support any bacterial growth for up to 8 hours after spiking. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  20. Performing both propensity score and instrumental variable analyses in observational studies often leads to discrepant results: a systematic review.

    PubMed

    Laborde-Castérot, Hervé; Agrinier, Nelly; Thilly, Nathalie

    2015-10-01

    Propensity score (PS) and instrumental variable (IV) are analytical techniques used to adjust for confounding in observational research. More and more, they seem to be used simultaneously in studies evaluating health interventions. The present review aimed to analyze the agreement between PS and IV results in medical research published to date. Review of all published observational studies that evaluated a clinical intervention using simultaneously PS and IV analyses, as identified in MEDLINE and Web of Science. Thirty-seven studies, most of them published during the previous 5 years, reported 55 comparisons between results from PS and IV analyses. There was a slight/fair agreement between the methods [Cohen's kappa coefficient = 0.21 (95% confidence interval: 0.00, 0.41)]. In 23 cases (42%), results were nonsignificant for one method and significant for the other, and IV analysis results were nonsignificant in most situations (87%). Discrepancies are frequent between PS and IV analyses and can be interpreted in various ways. This suggests that researchers should carefully consider their analytical choices, and readers should be cautious when interpreting results, until further studies clarify the respective roles of the two methods in observational comparative effectiveness research. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Difference in drug resistance patterns between minor HIV-1 populations in cerebrospinal fluid and plasma.

    PubMed

    Bergroth, T; Ekici, H; Gisslén, M; Hagberg, L; Sönnerborg, A

    2009-02-01

    The aim of the study was to determine to what extent unique drug resistance patterns appear in minor and major HIV-1 quasispecies in cerebrospinal fluid (CSF) as compared with blood. Forty-four plasma and CSF samples from 13 multi-treatment-experienced patients, seven of whom provided longitudinal samples, were included in the study. The subjects had failed antiretroviral therapy including lamivudine. The reverse transcriptase (RT) gene was examined by selective real-time polymerase chain reaction (SPCR), which can detect M184I/V mutants down to 0.2% of the viral population. SPCR revealed differences at amino acid position 184 in the plasma/CSF populations in 12 paired samples from eight patients. One plasma sample was positive by SPCR where direct sequencing showed wild-type M184. The other 11 paired samples showed quantitative differences in the mixed populations of the mutant or wild-type M184 quasispecies. Differences in other resistance-associated mutations between plasma and CSF viruses were also found by direct sequencing. In multi-treatment-experienced patients with therapy failure, differences in drug resistance patterns were found frequently between plasma and CSF in both minor and major viral populations. To what extent this was a true biological phenomenon remains to be established, and the clinical relevance of these findings is yet to be determined.

  2. Graphical Models for Quasi-Experimental Designs

    ERIC Educational Resources Information Center

    Steiner, Peter M.; Kim, Yongnam; Hall, Courtney E.; Su, Dan

    2017-01-01

    Randomized controlled trials (RCTs) and quasi-experimental designs like regression discontinuity (RD) designs, instrumental variable (IV) designs, and matching and propensity score (PS) designs are frequently used for inferring causal effects. It is well known that the features of these designs facilitate the identification of a causal estimand…

  3. [Differentiation of spa types and staphylococcal cassette chromosome mec (SCCmec) in clinical methicillin-resistant Staphylococcus aureus isolated in medical sites of Gdańsk region].

    PubMed

    Kasprzyk, Joanna; Piechowicz, Lidia; Wiśniewska, Katarzyna; Dziewit, Łukasz; Bronk, Marek; Świeć, Krystyna

    2015-01-01

    Methicillin-resistant Staphylococcus aureus bacteria are one of the key etiological factors of hospital-acquired and community-acquired infections. MRSA strains have an ability of causing a broad spectrum infections: from a relatively mild skin infections to severe life-threatening systemic infections. They are characterized by multi-drug resistance, virulence of a number of factors, may clonally spread within the hospitals and between hospitals. The study embraced a number of 75 isolates of MRSA isolated from patients of 7 medical sites of the Gdansk region within the period of six months (June to December 2013). Strains have derived from various clinical materials, both of hospitalized patients (n=59) and outpatient (n=16). The isolates were tested for the susceptibility to antimicrobial agents accordance with the guidelines EUCAST. To estimate of the variability of occurrence of S. aureus clones used were standard spa gene, consisting in the amplified polymorphic region of the X gene encoding the protein A gene (spa). After receiving the results, a spa types were identified using international database Ridom Spa Server (www.spaserver.ridom.de). To determine the polymorphism cassette carrying the inecA gene from MRSA strains, used typing five major chromosomal cassette SCCmec (I-V) by multiplex PCR. MRSA population genetic analysis carried out on the basis of typing SCCmec cassettes and spa gene has showed a predominance of strains with SCCmec type II casette (46.7%) and SCCmec IV casette (38.7%). Less frequently detected were strains containing SCCmec I cassette (12.0%) and SCCmec III cassette (2.6%). Spa typing revealed the presence of 13 gene types in MRSA. The most frequently observed spa types were: t151 (24.0%), t003 (16.0%) in strains of the SCCmec II cassette and t437 (16.0%) and t008 (14.8%) in the isolates with SCCmec cassette IV, whereas staphylococcus with the type of spa t011 (12.0%) had SCCmec cassette I. In our population most frequent strains cassette SCCmec II (46.7%), in most representing types of spa t151 (51.4%) and t003 (34.3%), generally resistant not only to β-lactam antibiotics, but as erythromycin, clindamycin and norfloxacin (82.8%), the more frequently they were isolated from patients than a hospital outpatient centers. The strains SCCmec IV that represent the majority of outpatient centers (68.8%), the most represented type t437 (41.4%) and often occurred in hospital centers.

  4. Developmental differences according to age at onset in juvenile bipolar disorder.

    PubMed

    Masi, Gabriele; Perugi, Giulio; Millepiedi, Stefania; Mucci, Maria; Toni, Cristina; Bertini, Nicoletta; Pfanner, Chiara; Berloffa, Stefano; Pari, Cinzia

    2006-12-01

    This study on a large sample of unselected, consecutive children and adolescents referred to a third-level hospital who received a diagnosis of bipolar disorder (BD) was aimed at exploring whether childhood-onset BD, as compared with adolescent-onset BD, presents specific clinical features in terms of severity, functional impairment, course, prevalent mood, pattern of co-morbidity, and treatment outcome. A total of 136 patients, 81 males (59.6%) and 55 females (40.4%), mean age 13.5 +/- 2.9 years, meeting the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV) diagnosis of BD according to a structured clinical interview Schedule for Affective Disorders and Schizophrenia for School-Age Children-Present and Lifetime Version (KSADS-PL), were included in the study. Eighty patients (58.8%) had a childhood-onset BD (before 12 years of age) and 56 (41.2%) had an adolescents-onset BD. Compared with the adolescent-onset BD, patients with childhood-onset were more frequently males and had a more frequent co-morbidity with attention-deficit/hyperactivity disorder (ADHD) and oppositional defiant disorder (ODD). An episodic course was found in only 42.5% of bipolar children, but 76.8% of youngsters with adolescent-onset BD. Severity, 6-month treatment outcome, prevalent mood (elated versus irritable), and co-morbid anxiety did not differentiate the two groups. Our findings suggest that a very early age at onset may identify a form of BD with a more frequent subcontinuous course and a heavy co-morbidity with ADHD.

  5. Applying Independent Verification and Validation to Automatic Test Equipment

    NASA Technical Reports Server (NTRS)

    Calhoun, Cynthia C.

    1997-01-01

    This paper describes a general overview of applying Independent Verification and Validation (IV&V) to Automatic Test Equipment (ATE). The overview is not inclusive of all IV&V activities that can occur or of all development and maintenance items that can be validated and verified, during the IV&V process. A sampling of possible IV&V activities that can occur within each phase of the ATE life cycle are described.

  6. Self-report assessment of the DSM-IV personality disorders. Measurement of trait and distress characteristics: the ADP-IV.

    PubMed

    Schotte, C K; de Doncker, D; Vankerckhoven, C; Vertommen, H; Cosyns, P

    1998-09-01

    Self-report instruments assessing the DSM personality disorders are characterized by overdiagnosis due to their emphasis on the measurement of personality traits rather than the impairment and distress associated with the criteria. The ADP-IV, a Dutch questionnaire, introduces an alternative assessment method: each test item assesses 'Trait' as well as 'Distress/impairment' characteristics of a DSM-IV criterion. This item format allows dimensional as well as categorical diagnostic evaluations. The present study explores the validity of the ADP-IV in a sample of 659 subjects of the Flemish population. The dimensional personality disorder subscales, measuring Trait characteristics, are internally consistent and display a good concurrent validity with the Wisconsin Personality Disorders Inventory. Factor analysis at the item-level resulted in 11 orthogonal factors, describing personality dimensions such as psychopathy, social anxiety and avoidance, negative affect and self-image. Factor analysis at the subscale-level identified two basic dimensions, reflecting hostile (DSM-IV Cluster B) and anxious (DSM-IV Cluster C) interpersonal attitudes. Categorical ADP-IV diagnoses are obtained using scoring algorithms, which emphasize the Trait or the Distress concepts in the diagnostic evaluation. Prevalences of ADP-IV diagnoses of any personality disorder according to these algorithms vary between 2.28 and 20.64%. Although further research in clinical samples is required, the present results support the validity of the ADP-IV and the potential of the measurement of trait and distress characteristics as a method for assessing personality pathology.

  7. Relationships between dry matter content, ensiling, ammonia-nitrogen, and ruminal in vitro starch digestibility in high-moisture corn samples.

    PubMed

    Ferraretto, L F; Taysom, K; Taysom, D M; Shaver, R D; Hoffman, P C

    2014-05-01

    The objectives of the study were (1) to determine relationships between high-moisture corn (HMC) dry matter (DM), ammonia-N [% of crude protein (CP)], and soluble CP concentrations, and pH, with 7-h ruminal in vitro starch digestibility (ivStarchD), and (2) to evaluate the effect of ensiling on pH, ammonia-N, soluble CP, and ivStarchD measurements in HMC. A data set comprising 6,131 HMC samples (55 to 80% DM) obtained from a commercial feed analysis laboratory was used for this study. Month of sample submittal was assumed to be associated with length of the ensiling period. Data for month of sample submittal were analyzed using Proc Mixed in SAS (SAS Institute Inc., Cary, NC) with month as a fixed effect. Regressions to determine linear and quadratic relationships between ivStarchD and ammonia-N, soluble CP, pH, and DM content were performed using Proc Mixed. The ivStarchD increased by 9 percentage units from October to August of the following year. Similar results were observed for ammonia-N and soluble CP with increases from 1.8 to 4.6% of CP and 31.3 to 46.4% of CP, respectively, from October to August of the following year. Ammonia-N was positively related to ivStarchD (R(2)=0.61). The DM content of HMC at silo removal was negatively related (R(2)=0.47) to ivStarchD with a decrease of 1.6 percentage units in ivStarchD per 1-percentage-unit increase in DM content. The pH of HMC was negatively related to ammonia-N (R(2)=0.53), soluble CP (R(2)=0.57), and ivStarchD (R(2)=0.51). Combined, ammonia-N, DM, soluble CP, and pH provided a good prediction of ivStarchD (adjusted R(2)=0.70). Increasing pH, ammonia-N, soluble CP, and ivStarchD values indicate that HMC may need up to 10 mo of ensiling to reach maximum starch digestibility. Ammonia-N, DM content, soluble CP concentration, and pH are good indicators of ruminal in vitro starch digestibility for high-moisture corn. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Comparison of the effects of IV administration of meloxicam, carprofen, and flunixin meglumine on prostaglandin E(2) concentration in aqueous humor of dogs with aqueocentesis-induced anterior uveitis.

    PubMed

    Gilmour, Margi A; Payton, Mark E

    2012-05-01

    To compare the effects of meloxicam, carprofen, and flunixin meglumine administered IV on the concentration of prostaglandin E(2) (PGE(2)) in the aqueous humor of dogs with aqueocentesis-induced anterior uveitis. 15 adult dogs with ophthalmically normal eyes. Each dog was assigned to 1 of 4 treatment groups. Treatment groups were saline (0.9% NaCl) solution (1 mL, IV), meloxicam (0.2 mg/kg, IV), carprofen (4.4 mg/kg, IV), and flunixin meglumine (0.5 mg/kg, IV). Each dog was anesthetized, treatment was administered, and aqueocentesis was performed on each eye at 30 and 60 minutes after treatment. Aqueous humor samples were frozen at -80°C until assayed for PGE(2) concentration with an enzyme immunoassay kit. For all 4 treatment groups, PGE(2) concentration was significantly higher in samples obtained 60 minutes after treatment, compared with that in samples obtained 30 minutes after treatment, which indicated aqueocentesis-induced PGE(2) synthesis. For aqueous humor samples obtained 60 minutes after treatment, PGE(2) concentration did not differ significantly among groups treated with saline solution, meloxicam, and carprofen; however, the PGE(2) concentration for the group treated with flunixin meglumine was significantly lower than that for each of the other 3 treatment groups. Flunixin meglumine was more effective than meloxicam or carprofen for minimizing the PGE(2) concentration in the aqueous humor of dogs with experimentally induced uveitis. Flunixin meglumine may be an appropriate pre-medication for use prior to intraocular surgery in dogs.

  9. DSM-IV antisocial personality disorder and conduct disorder: evidence for taxonic structures among individuals with and without substance use disorders in the general population.

    PubMed

    Kerridge, Bradley T; Saha, Tulshi D; Hasin, Deborah S

    2014-05-01

    The categorical-dimensional status of DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition) conduct disorder (CD) and antisocial personality disorder (ASPD) is a source of controversy. This study examined whether the underlying structure of DSM-IV CD and ASPD was dimensional or categorical (taxonic) among individuals with and without substance use disorders. Using a national large representative survey of U.S. adults (n = 43,093), taxometric analyses of DSM-IV CD and ASPD diagnostic criteria were conducted on the total sample and among those with and without substance use disorders. Results of three taxometric procedures were consistent in showing that the structures underlying DSM-IV CD and ASPD were clearly taxonic in the total sample and among individuals with and without substance use disorders. Comparison curve fit indices exceeded 0.57 for each model. Taxonic findings of the present study were in contrast to the dimensional results of prior taxometric research among incarcerated samples with substantial comorbidity of antisocial syndromes and substance use disorders. Results supported the categorical representation and diagnostic thresholds of ASPD and CD as defined in DSM-IV and DSM-5. That the structure of ASPD and CD may be taxonic suggests that further research on these disorders use group comparative designs in which samples with and without these disorders are compared in terms of sociodemographic and clinical correlates, comorbidity, and treatment utilization. The taxonic structure of ASPD and CD may contribute to future research on causal processes through which these antisocial syndromes develop.

  10. Zirconium(IV) functionalized magnetic nanocomposites for extraction of organophosphorus pesticides from environmental water samples.

    PubMed

    Jiang, Li; Huang, Tengjun; Feng, Shun; Wang, Jide

    2016-07-22

    The widespread use of organophosphate pesticides (OPPs) in agriculture leads to residue accumulation in the environment which is dangerous to human health and disrupts the ecological balance. In this work, one nanocomposite immobilized zirconium (Zr, IV) was prepared and used as the affinity probes to quickly and selectively extract organophosphorus pesticides (OPPs) from water samples. The Fe3O4-ethylenediamine tetraacetic acid (EDTA)@Zr(IV) nanocomposites (NPs) were prepared by simply mixing Zr(IV) ions with Fe3O4-EDTA NPs synthesized by one-pot chemical co-precipitation method. The immobilized Zr(IV) ions were further utilized to capture OPPs based on their high affinity for the phosphate moiety in OPPs. Coupled with GC-MS, four OPPs were used as models to demonstrate the feasibility of this approach. Under the optimum conditions, the limits of detection for target OPPs were in the range of 0.10-10.30ngmL(-1) with relative standard deviations (RSDs) of 0.61-4.40% (n=3), respectively. The linear ranges were over three orders of magnitudes (correlation coefficients, R(2)>0.9995). The Fe3O4-EDTA@Zr(IV) NPs were successfully applied to extract OPPs samples with recoveries of 86.95-112.60% and RSDs of 1.20-10.42% (n=3) from two spiked real water. By the proposed method, the matrix interference could be effectively eliminated. We hope our finding can provide a promising alternative for the fast extraction of OPPs from complex real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Concordance between DSM-5 and DSM-IV nicotine, alcohol, and cannabis use disorder diagnoses among pediatric patients.

    PubMed

    Kelly, Sharon M; Gryczynski, Jan; Mitchell, Shannon Gwin; Kirk, Arethusa; O'Grady, Kevin E; Schwartz, Robert P

    2014-07-01

    The recently published Diagnostic and Statistical Manual of Mental Disorders-5 (DSM-5) includes several major revisions to substance use diagnoses. Studies have evaluated the impact of these changes among adult samples but research with adolescent samples is lacking. 525 adolescents (93% African American) awaiting primary care appointments in Baltimore, Maryland were recruited for a study evaluating a substance use screening instrument. Participants were assessed for DSM-5 nicotine, alcohol, and cannabis use disorder, DSM-IV alcohol and cannabis abuse, and DSM-IV dependence for all three substances during the past year using the modified Composite International Diagnostic Interview-2, Substance Abuse Module. Contingency tables examining DSM-5 vs. DSM-IV joint frequency distributions were examined for each substance. Diagnoses were more prevalent using DSM-5 criteria compared with DSM-IV for nicotine (4.0% vs. 2.7%), alcohol (4.6% vs. 3.8%), and cannabis (10.7% vs. 8.2%). Cohen's κ, Somers' d, and Cramer's V ranged from 0.70 to 0.99 for all three substances. Of the adolescents categorized as "diagnostic orphans" under DSM-IV, 7/16 (43.8%), 9/29 (31.0%), and 13/36 (36.1%) met criteria for DSM-5 disorder for nicotine, alcohol, and cannabis, respectively. Additionally, 5/17 (29.4%) and 1/21 (4.8%) adolescents who met criteria for DSM-IV abuse did not meet criteria for a DSM-5 diagnosis for alcohol and cannabis, respectively. Categorizing adolescents using DSM-5 criteria may result in diagnostic net widening-particularly for cannabis use disorders-by capturing adolescents who were considered diagnostic orphans using DSM-IV criteria. Future research examining the validity of DSM-5 substance use disorders with larger and more diverse adolescent samples is needed. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Concordance between DSM-5 and DSM-IV nicotine, alcohol, and cannabis use disorder diagnoses among pediatric patients

    PubMed Central

    Kelly, Sharon M.; Gryczynski, Jan; Mitchell, Shannon Gwin; Kirk, Arethusa; O’Grady, Kevin E.; Schwartz, Robert P.

    2014-01-01

    Background The recently published Diagnostic and Statistical Manual of Mental Disorders-5 (DSM-5) includes several major revisions to substance use diagnoses. Studies have evaluated the impact of these changes among adult samples but research with adolescent samples is lacking. Methods 525 adolescents (93% African American) awaiting primary care appointments in Baltimore, Maryland were recruited for a study evaluating a substance use screening instrument. Participants were assessed for DSM-5 nicotine, alcohol, and cannabis use disorder, DSM-IV alcohol and cannabis abuse, and DSM-IV dependence for all three substances during the past year using the modified Composite International Diagnostic Interview-2, Substance Abuse Module. Contingency tables examining DSM-5 vs. DSM-IV joint frequency distributions were examined for each substance. Results Diagnoses were more prevalent using DSM-5 criteria compared with DSM-IV for nicotine (4.0% vs. 2.7%), alcohol (4.6% vs. 3.8%), and cannabis (10.7% vs. 8.2%). Cohen's κ, Somers' d, and Cramer's V ranged from 0.70-0.99 for all three substances. Of the adolescents categorized as “diagnostic orphans” under DSM-IV, 7/16 (43.8%), 9/29 (31.0%), and 13/36 (36.1%) met criteria for DSM-5 disorder for nicotine, alcohol, and cannabis, respectively. Additionally, 5/17 (29.4%) and 1/21 (4.8%) adolescents who met criteria for DSM-IV abuse did not meet criteria for a DSM-5 diagnosis for alcohol and cannabis, respectively. Conclusions Categorizing adolescents using DSM-5 criteria may result in diagnostic net widening-particularly for cannabis use disorders-by capturing adolescents who were considered diagnostic orphans using DSM-IV criteria. Future research examining the validity of DSM-5 substance use disorders with larger and more diverse adolescent samples is needed. PMID:24793367

  13. Exploratory and Confirmatory Factor Analyses of the WISC-IV with Gifted Students

    ERIC Educational Resources Information Center

    Rowe, Ellen W.; Dandridge, Jessica; Pawlush, Alexandra; Thompson, Dawna F.; Ferrier, David E.

    2014-01-01

    These 2 studies investigated the factor structure of the Wechsler Intelligence Scale for Children-4th edition (WISC-IV; Wechsler, 2003a) with exploratory factor analysis (EFA; Study 1) and confirmatory factor analysis (CFA; Study 2) among 2 independent samples of gifted students. The EFA sample consisted of 225 children who were referred for a…

  14. Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE PAGES

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui; ...

    2017-09-07

    We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  15. Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  16. Enhanced 99 Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    Technetium (99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals. Two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 – 1,000 oC. After being cooled, the solid glass specimens prepared at different temperatures were analyzed for Tc oxidation state using Tc K-edge XANES. In most samples, Tc wasmore » partially oxidized from Tc(IV) to Tc(VII) as the melt temperature increased. However, Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were moderately higher than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  17. Wechsler Adult Intelligence Scale-IV Dyads for Estimating Global Intelligence.

    PubMed

    Girard, Todd A; Axelrod, Bradley N; Patel, Ronak; Crawford, John R

    2015-08-01

    All possible two-subtest combinations of the core Wechsler Adult Intelligence Scale-IV (WAIS-IV) subtests were evaluated as possible viable short forms for estimating full-scale IQ (FSIQ). Validity of the dyads was evaluated relative to FSIQ in a large clinical sample (N = 482) referred for neuropsychological assessment. Sample validity measures included correlations, mean discrepancies, and levels of agreement between dyad estimates and FSIQ scores. In addition, reliability and validity coefficients were derived from WAIS-IV standardization data. The Coding + Information dyad had the strongest combination of reliability and validity data. However, several other dyads yielded comparable psychometric performance, albeit with some variability in their particular strengths. We also observed heterogeneity between validity coefficients from the clinical and standardization-based estimates for several dyads. Thus, readers are encouraged to also consider the individual psychometric attributes, their clinical or research goals, and client or sample characteristics when selecting among the dyadic short forms. © The Author(s) 2014.

  18. Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities.

    PubMed

    Salavera, Carlos; Tricás, José M; Lucha, Orosia

    2011-12-11

    Homeless people have high dropout rates when they participate in therapeutic processes. The causes of this failure are not always known. This study investigates whether dropping-out is mediated by personality disorders or whether psychosocial problems are more important. Eighty-nine homeless people in a socio-laboral integration process were assessed. An initial interview was used, and the MCMI II questionnaire was applied to investigate the presence of psychosocial disorders (DSM-IV-TR axis IV). This was designed as an ex post-facto prospective study. Personality disorders were very frequent among the homeless people examined. Moreover, the high index of psychosocial problems (axis IV) in this population supported the proposal that axis IV disorders are influential in failure to complete therapy. The outcomes of the study show that the homeless people examined presented with more psychopathological symptoms, in both axis II and axis IV, than the general population. This supports the need to take into account the comorbidity between these two types of disorder among homeless people, in treatment and in the development of specific intervention programs. In conclusion, the need for more psychosocial treatments addressing the individual problems of homeless people is supported.

  19. Functional assessment of a novel COL4A5 splice region variant and immunostaining of plucked hair follicles as an alternative method of diagnosis in X-linked Alport syndrome.

    PubMed

    Malone, Andrew F; Funk, Steven D; Alhamad, Tarek; Miner, Jeffrey H

    2017-06-01

    Many COL4A5 splice region variants have been described in patients with X-linked Alport syndrome, but few have been confirmed by functional analysis to actually cause defective splicing. We sought to demonstrate that a novel COL4A5 splice region variant in a family with Alport syndrome is pathogenic using functional studies. We also describe an alternative method of diagnosis. Targeted next-generation sequencing results of an individual with Alport syndrome were analyzed and the results confirmed by Sanger sequencing in family members. A splicing reporter minigene assay was used to examine the variant's effect on splicing in transfected cells. Plucked hair follicles from patients and controls were examined for collagen IV proteins using immunofluorescence microscopy. A novel splice region mutation in COL4A5, c.1780-6T>G, was identified and segregated with disease in this family. This variant caused frequent skipping of exon 25, resulting in a frameshift and truncation of collagen α5(IV) protein. We also developed and validated a new approach to characterize the expression of collagen α5(IV) protein in the basement membranes of plucked hair follicles. Using this approach we demonstrated reduced collagen α5(IV) protein in affected male and female individuals in this family, supporting frequent failure of normal splicing. Differing normal to abnormal transcript ratios in affected individuals carrying splice region variants may contribute to variable disease severity observed in Alport families. Examination of plucked hair follicles in suspected X-linked Alport syndrome patients may offer a less invasive alternative method of diagnosis and serve as a pathogenicity test for COL4A5 variants of uncertain significance.

  20. Functional assessment of a novel COL4A5 splice region variant and immunostaining of plucked hair follicles as an alternative method of diagnosis in X-linked Alport syndrome

    PubMed Central

    Malone, Andrew F.; Funk, Steven D.; Alhamad, Tarek; Miner, Jeffrey H.

    2016-01-01

    Introduction Many COL4A5 splice region variants have been described in patients with X-linked Alport syndrome, but few have been confirmed by functional analysis to actually cause defective splicing. We sought to demonstrate that a novel COL4A5 splice region variant in a family with Alport syndrome is pathogenic using functional studies. We also describe an alternative method of diagnosis. Methods We analyzed targeted next-generation sequencing results of an individual with Alport syndrome and confirmed results by Sanger sequencing in family members. A splicing reporter minigene assay was used to examine the variant’s effect on splicing in transfected cells. Plucked hair follicles from patients and controls were examined for collagen IV proteins using immunofluorescence microscopy. Results A novel splice region mutation in COL4A5, c.1780-6T>G, was identified and segregated with disease in this family. This variant caused frequent skipping of exon 25, resulting in a frameshift and truncation of collagen α5(IV) protein. We also developed and validated a new approach to characterize the expression of collagen α5(IV) protein in the basement membranes of plucked hair follicles. We demonstrated reduced collagen α5(IV) protein in affected male and female individuals in this family, supporting frequent failure of normal splicing. Conclusions Differing normal to abnormal transcript ratios in affected individuals carrying splice region variants may contribute to variable disease severity observed in Alport families. Examination of plucked hair follicles in suspected X-linked Alport syndrome patients may offer a less invasive alternative method of diagnosis and serve as a pathogenicity test for COL4A5 variants of uncertain significance. PMID:28013382

  1. Cystic Fibrosis-Related Diabetes with strict glycaemic control is not associated with frequent intravenous antibiotics use for pulmonary infections.

    PubMed

    Belle-van Meerkerk, G; de Valk, H W; Stam-Slob, M C; Teding van Berkhout, F; Zanen, P; van de Graaf, E A

    2016-06-01

    Pulmonary infections are more frequent in and associated with higher mortality in Cystic Fibrosis-Related Diabetes (CFRD) patients compared to CF patients without CFRD. Hyperglycaemia can lead to a higher vulnerability for infections. Aim of the study was to test whether the infection rate in well-controlled CFRD patients was similar to that in CF patients without CFRD. This is a retrospective six-year cohort analysis on a consecutive series of 138 CF patients. They were categorized in two groups with CFRD or without CFRD. Pulmonary infection frequency was defined as the number of intravenous (IV) antibiotic treatments. Clinical factors associated with infection frequency were collected. CFRD was diagnosed in 54 (39%) CF patients of whom 44 (81%) achieved target value for glycaemic control (HbA1c 7.0% (⩽53mmol/mol)). Median frequency of IV antibiotics was 0 without CFRD and 3 episodes in patients with CFRD (rate ratio (RR) 2.9 (95% CI 1.6-5.2)). Multivariate analysis showed that frequency of IV antibiotics was significantly related to Pseudomonas aeruginosa colonization (RR 3.7) and lower lung function at baseline (RR 0.97) but not to CFRD by itself. In this cohort with overall strict glycaemic control, the frequency of IV antibiotics use was related to chronic infection and impaired lung function at baseline, but not to CFRD by itself. Although this study in itself does not prove beneficial effect of strict glycaemic control, it does emphasize the potential role of glycaemic control on infection frequency in CF patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. IV. Aquatics

    Treesearch

    Michael K. Young

    2011-01-01

    The problem of invasive aquatic species has long been recognized by scientists at the Rocky Mountain Research Station. Fausch and others (2006, 2009) recently overviewed this issue. A point that often distinguishes nonnative aquatic species from nonnatives in other environments is that the presence of some species is frequently prized by managers and the public. For...

  3. Eating Disorder Diagnoses: Empirical Approaches to Classification

    ERIC Educational Resources Information Center

    Wonderlich, Stephen A.; Joiner, Thomas E., Jr.; Keel, Pamela K.; Williamson, Donald A.; Crosby, Ross D.

    2007-01-01

    Decisions about the classification of eating disorders have significant scientific and clinical implications. The eating disorder diagnoses in the Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV; American Psychiatric Association, 1994) reflect the collective wisdom of experts in the field but are frequently not supported in…

  4. Confirmatory Factor Analysis of the WISC-IV in a Hospital Referral Sample

    ERIC Educational Resources Information Center

    Devena, Sarah E.; Gay, Catherine E.; Watkins, Marley W.

    2013-01-01

    Confirmatory factor analysis was used to determine the factor structure of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) scores of 297 children referred to a children's hospital in the Southwestern United States. Results support previous findings that indicate the WISC-IV is best represented by a direct hierarchical…

  5. Low rates of depressed mood and depression diagnoses in a clinic review of children and adolescents with autistic disorder.

    PubMed

    Henry, Charles A; Nowinski, Lisa; Koesterer, Karmen; Ferrone, Christine; Spybrook, Jessaca; Bauman, Margaret

    2014-09-01

    The purpose of this study was to investigate the prevalence of depression diagnoses and related clinical data in an outpatient sample of youth with autistic disorder. Records of 123 psychiatrically referred children and adolescents with a Diagnostic and Statistical Manual of Mental Disorders, 4th ed., Text Revision (DSM-IV-TR) diagnosis of autistic disorder were examined. Mood disorder diagnoses and chief complaints along with family mood disorder history were the primary variables analyzed. Four subjects (3%) presented with depressed mood. Irritability complaints were frequent (n=78, 63%). Six subjects (5%) received a mood disorder diagnosis; all with mood disorder, not otherwise specified. No subjects received a depressive disorder diagnosis. Family history of mood disorders was common. Findings raise questions about the appropriate characterization and potential misdiagnoses of depression in youth with autistic disorder.

  6. A rapid screening with direct sequencing from blood samples for the diagnosis of Leigh syndrome.

    PubMed

    Shimbo, Hiroko; Takagi, Mariko; Okuda, Mitsuko; Tsuyusaki, Yu; Takano, Kyoko; Iai, Mizue; Yamashita, Sumimasa; Murayama, Kei; Ohtake, Akira; Goto, Yu-Ichi; Aida, Noriko; Osaka, Hitoshi

    2014-01-01

    Large numbers of genes are responsible for Leigh syndrome (LS), making genetic confirmation of LS difficult. We screened our patients with LS using a limited set of 21 primers encompassing the frequently reported gene for the respiratory chain complexes I (ND1-ND6, and ND4L), IV(SURF1), and V(ATP6) and the pyruvate dehydrogenase E1α-subunit. Of 18 LS patients, we identified mutations in 11 patients, including 7 in mDNA (two with ATP6), 4 in nuclear (three with SURF1). Overall, we identified mutations in 61% of LS patients (11/18 individuals) in this cohort. Sanger sequencing with our limited set of primers allowed us a rapid genetic confirmation of more than half of the LS patients and it appears to be efficient as a primary genetic screening in this cohort.

  7. [Diagnosis of primary hyperlipoproteinemia in umbilical cord blood (author's transl)].

    PubMed

    Parwaresch, M R; Radzun, H J; Mäder, C

    1977-10-01

    The aim of the present investigation was to assay the frequency of primary dyslipoproteinemia in a random sample of one hundred newborns and to describe the minimal methodical requirements for sound diagnosis. After comparison of different methods total lipids were determined by gravimetry, cholesterol and triglycerides by enzymatic methods, nonesterified fatty acids by direct colorimetry; phospholipids were estimated indirectly. All measurements were applied to umbilical cord sera and to lipoprotein fractions separated by selective precipitation. The diagnosis of hyperlipoproteinemia type IV, which is the most frequent one in adults, is highly afflicted with pitfalls in the postnatal period. A primary hyper-alpha-liproteinemia occured in one case and type II-hyperlipoproteinemia in two cases, one of the parents being involved in each case. For mass screening triglycerides should be assayed in serum and cholesterol in precipitated and resolubilized LDL-fraction, for which the minimal requirements are described.

  8. Dietary habits of Serbian preschool and schoolchildren with regard to food of animal origin

    NASA Astrophysics Data System (ADS)

    Đorđević, V.; Šarčević, D.; Glišić, M.

    2017-09-01

    The goal of this study was to explore attitudes and habits of Serbian preschool and school children in consumption of meat products, milk and milk products, eggs and egg products and honey and bee products. The survey was conducted on a sample of 227 children, divided into three different age groups: preschool (ages 4-6), primary school I-IV grade (ages 7-11) and primary school V-VIII grade (ages 12-15). The results showed that all examined groups of children consumed meat products, milk and milk products, eggs and egg products, and honey and bee products. In all groups of children, the most frequently consumed food (among our food category choices) was dried ham (consumed by 19.64% of preschool children; 23.75% of schoolchildren from I-IV grade; 19.74% of schoolchildren from V-VIII grade). Fewer preschool children consumed sterilized milk compared to children of school age. The results showed that in all three groups of children, the most commonly consumed milk products were yoghurt (from 12.20 to 15.29% of children consumed these) and sour cream (from 11.57 to 12.74% of children consumed this), while kefir was the least-consumed product. In addition, there was no difference in consumption of boiled or fried eggs in the examined groups of children, while the consumption of egg products (mayonnaise) was higher in the group of preschool children than in the group of schoolchildren from V-VIII grade. Preschool children consumed honey 14.99% more often than schoolchildren from I-IV grade, and 14.49% more often than did schoolchildren from grade V-VIII.

  9. The Effect of Cavity Design on Fracture Resistance and Failure Pattern in Monolithic Zirconia Partial Coverage Restorations - An In vitro Study.

    PubMed

    Harsha, Madhavareddy Sri; Praffulla, Mynampati; Babu, Mandava Ramesh; Leneena, Gudugunta; Krishna, Tejavath Sai; Divya, G

    2017-05-01

    Cavity preparations of posterior teeth have been frequently associated with decreased fracture strength of the teeth. Choosing the correct indirect restoration and the cavity design when restoring the posterior teeth i.e., premolars was difficult as it involves aesthetic, biomechanical and anatomical considerations. To evaluate the fracture resistance and failure pattern of three different cavity designs restored with monolithic zirconia. Human maxillary premolars atraumatically extracted for orthodontic reasons were chosen. A total of 40 teeth were selected and divided into four groups (n=10). Group I-Sound teeth (control with no preparation). Group II-MOD Inlay, Group III-Partial Onlay, Group IV-Complete Onlay. Restorations were fabricated with monolithic partially sintered zirconia CAD (SAGEMAX- NexxZr). All the 30 samples were cemented using Multilink Automix (Ivoclar) and subjected to fracture resistance testing using Universal Testing Machine (UTM) (Instron) with a steel ball of 3.5 mm diameter at crosshead speed of 0.5 mm/minute. Stereomicroscope was used to evaluate the modes of failure of the fractured specimen. Fracture resistance was tested using parametric one way ANOVA test, unpaired t-test and Tukey test. Fracture patterns were assessed using non-parametric Chi-square test. Group IV (Complete Onlay) presented highest fracture resistance and showed statistical significant difference. Group II (MOD Inlay) and Group III (Partial Onlay) showed significantly lower values than the Group I (Sound teeth). However, Groups I, II and III presented no significant difference from each other. Coming to the modes of failure, Group II (MOD Inlay) and Group III (Partial Onlay) presented mixed type of failures; Group IV (Complete Onlay) demonstrated 70% Type I failures. Of the three cavity designs evaluated, Complete Onlay had shown a significant increase in the fracture resistance than the Sound teeth.

  10. Differential somatostatin, CXCR4 chemokine and endothelin A receptor expression in WHO grade I-IV astrocytic brain tumors.

    PubMed

    Lange, Franziska; Kaemmerer, Daniel; Behnke-Mursch, Julianne; Brück, Wolfgang; Schulz, Stefan; Lupp, Amelie

    2018-04-25

    Glioblastomas represent the most common primary malignant tumor of the nervous system and the most frequent type of astrocytic tumors. Despite improved therapeutic options, prognosis has remained exceptionally poor over the last two decades. Therefore, new treatment approaches are urgently needed. An overexpression of somatostatin (SST) as well as chemokine CXCR4 and endothelin A (ETA) receptors has been shown for many types of cancer. Respective expression data for astrocytic brain tumors, however, are scarce and contradictory. SST subtype, CXCR4 and ETA expression was comparatively evaluated in a total of 57 grade I-IV astrocytic tumor samples by immunohistochemistry using well-characterized monoclonal antibodies. Overall, receptor expression on the tumor cells was only very low. SST5 was the most prominently expressed receptor, followed by SST3, ETA, SST2 and CXCR4. In contrast, tumor capillaries displayed strong SST2, SST3, SST5, CXCR4 and ETA expression. Presence of SST5, CXCR4 and ETA on tumor cells and of SST3, CXCR4 and ETA on microvessels gradually increased from grade II to grade IV tumors. Ki-67 values correlated significantly with CXCR4 expression on tumor cells and with vascular SST3, CXCR4 or ETA positivity. SST5 or CXCR4 positivity of tumor cells and vascular SST3 or CXCR4 expression negatively correlated with patient outcome. Though having some prognostic value, SST, CXCR4 or ETA expression on astrocytic tumor cells is clearly of no therapeutic relevance. Indirect targeting of these highly vascularized tumors via SST3, SST5, CXCR4 or ETA on the microvessels, in contrast, may represent a promising additional therapeutic strategy.

  11. [Comparison of effects on the oxidant/antioxidant system of sevoflurane, desflurane and propofol infusion during general anesthesia].

    PubMed

    Erbas, Mesut; Demiraran, Yavuz; Yildirim, Hayriye Ak; Sezen, Gulbin; Iskender, Abdulkadir; Karagoz, Ibrahim; Kandis, Hayati

    2015-01-01

    Desflurane and sevoflurane are frequently used for maintenance of anesthesia and studies have shown that these anesthetics cause a variety of changes to the oxidative stress and antioxidative defense mechanisms. This study aims to compare the effects of sevoflurane, desflurane and propofol infusion anesthesia on the oxidant and antioxidant systems of patients undergoing laparoscopic cholecystectomy. 45 patients between 18 and 50 years with planned laparoscopic cholecystectomy under general anesthetic were included in the study. Patients were divided into three groups on the way to surgery: propofol (group P, n=15), sevoflurane (group S, n=15) and desflurane (group D, n=15). All groups were given hypnotic 2mg/kg propofol IV, 1mcg/kg fentanyl IV and 0.1mg/kg vecuronium IV for induction. For maintenance of anesthesia group S were ventilated with 2% sevoflurane, group D cases were given 6% desflurane and group P were given propofol infusions of 12mg/kg/h for the first 10minutes, 9mg/kg/h for the second 10minutes and 6mg/kg/h after that. Before induction and after the operation venous blood samples were taken to evaluate the levels of glutation peroxidase, total oxidants and antioxidants. The 45 patients included in the study were 22 male and 23 female patients. The demographic characteristics of the groups were similar. In the postoperative period we observed that while sevoflurane and propofol increased antioxidants by a statistically significant level, desflurane increased the total oxidants level by a significant amount compared to levels before the operation. Copyright © 2014 Sociedade Brasileira de Anestesiologia. Publicado por Elsevier Editora Ltda. All rights reserved.

  12. Further insights on the French WISC-IV factor structure through Bayesian structural equation modeling.

    PubMed

    Golay, Philippe; Reverte, Isabelle; Rossier, Jérôme; Favez, Nicolas; Lecerf, Thierry

    2013-06-01

    The interpretation of the Wechsler Intelligence Scale for Children--Fourth Edition (WISC-IV) is based on a 4-factor model, which is only partially compatible with the mainstream Cattell-Horn-Carroll (CHC) model of intelligence measurement. The structure of cognitive batteries is frequently analyzed via exploratory factor analysis and/or confirmatory factor analysis. With classical confirmatory factor analysis, almost all cross-loadings between latent variables and measures are fixed to zero in order to allow the model to be identified. However, inappropriate zero cross-loadings can contribute to poor model fit, distorted factors, and biased factor correlations; most important, they do not necessarily faithfully reflect theory. To deal with these methodological and theoretical limitations, we used a new statistical approach, Bayesian structural equation modeling (BSEM), among a sample of 249 French-speaking Swiss children (8-12 years). With BSEM, zero-fixed cross-loadings between latent variables and measures are replaced by approximate zeros, based on informative, small-variance priors. Results indicated that a direct hierarchical CHC-based model with 5 factors plus a general intelligence factor better represented the structure of the WISC-IV than did the 4-factor structure and the higher order models. Because a direct hierarchical CHC model was more adequate, it was concluded that the general factor should be considered as a breadth rather than a superordinate factor. Because it was possible for us to estimate the influence of each of the latent variables on the 15 subtest scores, BSEM allowed improvement of the understanding of the structure of intelligence tests and the clinical interpretation of the subtest scores. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  13. Diagnostic crossover and outcome predictors in eating disorders according to DSM-IV and DSM-V proposed criteria: a 6-year follow-up study.

    PubMed

    Castellini, Giovanni; Lo Sauro, Carolina; Mannucci, Edoardo; Ravaldi, Claudia; Rotella, Carlo Maria; Faravelli, Carlo; Ricca, Valdo

    2011-04-01

    To evaluate in a 6-year follow-up study the course of a large clinical sample of patients with eating disorders (EDs) who were treated with individual cognitive behavior therapy. The diagnostic crossover, recovery, and relapses were assessed, applying both Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) and the DSM-V proposed criteria. Patients with EDs move in and out of illness states over time, display frequent relapses, show a relevant lifetime psychiatric comorbidity, and migrate between different diagnoses. A total of 793 patients (including anorexia nervosa, bulimia nervosa, binge eating disorder, and EDs not otherwise specified) were evaluated on the first day of admission, at the end of treatment, 3 years after the end of treatment, and 3 years after the first follow-up. Clinical data were collected through a face-to-face interview; diagnosis was performed by means of the Structured Clinical Interview for DSM-IV and the Eating Disorder Examination Questionnaire was applied. A consistent rate of relapse and crossover between the different diagnoses over time was observed. Mood disorders comorbidity has been found to be an important determinant of diagnostic instability, whereas the severity of shape concern represented a relevant outcome modifier. Using the DSM-V proposed criteria, most patients of EDs not otherwise specified were reclassified, so that the large majority of ED patients seeking treatment would be included in full-blown diagnoses. Among EDs, there are different subgroups of patients displaying various courses and outcomes. The diagnostic instability involves the large majority of patients. An integration of categorical and dimensional approaches could improve the psychopathological investigation and the treatment choices.

  14. A simpler definition of major depressive disorder.

    PubMed

    Zimmerman, M; Galione, J N; Chelminski, I; McGlinchey, J B; Young, D; Dalrymple, K; Ruggero, C J; Witt, C Francione

    2010-03-01

    The DSM-IV symptom criteria for major depressive disorder (MDD) are somewhat lengthy, with many studies showing that treatment providers have difficulty recalling all nine symptoms. Moreover, the criteria include somatic symptoms that are difficult to apply in patients with medical illnesses. In a previous report, we developed a briefer definition of MDD that was composed of the mood and cognitive symptoms of the DSM-IV criteria, and found high levels of agreement between the simplified and full DSM-IV definitions. The goal of the present study was to replicate these findings in another large sample of psychiatric out-patients and to extend the findings to other patient samples. We interviewed 1100 psychiatric out-patients and 210 pathological gamblers presenting for treatment and 1200 candidates for bariatric surgery. All patients were interviewed by a diagnostic rater who administered a semi-structured interview. We inquired about all symptoms of depression for all patients. In all three samples high levels of agreement were found between the DSM-IV and the simpler definition of MDD. Summing across all 2510 patients, the level of agreement between the two definitions was 95.5% and the kappa coefficient was 0.87. After eliminating the four somatic criteria from the DSM-IV definition of MDD, a high level of concordance was found between this simpler definition and the original DSM-IV classification. This new definition offers two advantages over the current DSM-IV definition--it is briefer and it is easier to apply with medically ill patients because it is free of somatic symptoms.

  15. Study of current-voltage characteristics of ferromagnetic α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide under magnetic fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vijayasri, G., E-mail: vsvijiguna.physics@gmail.com; Bhowmik, R. N.

    We report the influence of magnetic field on I-V characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} sample. Synchrotron X-ray diffraction pattern and Raman Spectroscopy have confirmed rhombohedral structure with space group R3C in the sample. The sample exhibits ferromagnetic feature at room temperature and non saturation of magnetization up to 7Tesla suggests the effect of non-collinear structure (canting) of the spins on the ferromagnetic properties. We have recorded I-V characteristics of the sample under magnetic field to study the effect of non-collinear spin structure on the electrical properties. Space charge limited current mechanism controlled the nature of non-linear I-V curves andmore » the curves are significantly affected by magnetic field.« less

  16. Comparative estimations of 137Cs distribution in a boreal forest in northern Sweden using a traditional sampling approach and a portable NaI detector.

    PubMed

    Plamboeck, A H; Nylén, T; Agren, G

    2006-01-01

    Field-portable detectors have been frequently used in routine monitoring and hazard assessment studies. However, there have been few thorough attempts to evaluate their potential as an alternative to the traditional procedure of collecting samples and analysing them in the laboratory. Thus, in this study the two approaches were compared in terms of their utility for monitoring (137)Cs activity in the Nyänget catchment in northern Sweden. The objectives were: (i) to determine the (137)Cs activity in soils associated with three types of vegetation, (ii) to map the geographical distribution of (137)Cs using the portable NaI detector connected to a GPS system (GDM-40), (iii) to identify (137)Cs anomalies in the catchment, and (iv) to compare the measurements obtained with the NaI detector and traditional sampling followed by laboratory analysis. Our results demonstrate that the GDM-40 has very good potential for making (137)Cs inventories and for detecting (137)Cs anomalies within large areas. The GDM-40 measurements identified differences between different hydrological areas that were not determined with the soil sampling method. The GDM-40 method is much faster than a traditional soil sampling method. However, soil sampling cannot be totally excluded because it is needed to calibrate the GDM-40. The agreement between the (137)Cs activity values obtained by the two approaches was 20% which is good in the field where so many factors vary.

  17. Structure of the Wechsler Intelligence Scale for Children-Fourth Edition among a National Sample of Referred Students

    ERIC Educational Resources Information Center

    Watkins, Marley W.

    2010-01-01

    The structure of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV; D. Wechsler, 2003a) was analyzed via confirmatory factor analysis among a national sample of 355 students referred for psychoeducational evaluation by 93 school psychologists from 35 states. The structure of the WISC-IV core battery was best represented by four…

  18. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  19. Astragaloside IV attenuates injury caused by myocardial ischemia/reperfusion in rats via regulation of toll-like receptor 4/nuclear factor-κB signaling pathway.

    PubMed

    Lu, Meili; Tang, Futian; Zhang, Jing; Luan, Aina; Mei, Meng; Xu, Chonghua; Zhang, Suping; Wang, Hongxin; Maslov, Leonid N

    2015-04-01

    Myocardial ischemia/reperfusion (MI/R) injury, in which inflammatory response and cell apoptosis play a vital role, is frequently encountered in clinical practice. Astragaloside IV (AsIV), a small molecular saponin of Astragalus membranaceus, has been shown to confer protective effects against many cardiovascular diseases. The present study was aimed to investigate the antiinflammatory and antiapoptotic effects and the possible mechanism of AsIV on MI/R injury in rats. Rats were randomly divided into sham operation group, MI/R group and groups with combinations of MI/R and different doses of AsIV. The results showed that the expressions of myocardial toll-like receptor 4 (TLR4) and nuclear factor-κB (NF-κB) were significantly increased, and apoptosis of cardiomyocytes was induced in MI/R group compared with that in sham operation group. Administration of AsIV attenuated MI/R injury, downregulated the expressions of TLR4 and NF-κB and inhibited cell apoptosis as evidenced by decreased terminal deoxynucleotidyl transferase dUTP nick end labeling positive cells, B-cell lymphoma-2 associated X protein and caspase-3 expressions and increased B-cell lymphoma-2 expression compared with that in MI/R group. In addition, AsIV treatment reduced levels of inflammatory cytokines induced by MI/R injury. In conclusion, our results demonstrated that AsIV downregulates TLR4/NF-κB signaling pathway and inhibits cell apoptosis, subsequently attenuating MI/R injury in rats. Copyright © 2015 John Wiley & Sons, Ltd.

  20. Revisiting Weak Emission-line Quasars with a Simple Approach to Deduce their Nature and the Tracers of X-ray Weakness

    NASA Astrophysics Data System (ADS)

    Ni, Qingling

    2018-01-01

    We present an X-ray and multi-wavelength study of 17 “bridge” weak emission-line quasars (WLQs) and 16 “extreme” WLQs naturally divided by their C IV rest equivalent widths (REWs), which constitute our clean WLQ sample together. New Chandra 3.1-4.8 ks observations were obtained for 14 objects while the other 19 have archival X-ray observations. 4 of the 17 bridge WLQs appear to be X-ray weak, while 9 of the 16 extreme WLQs appear to be X-ray weak. The X-ray weak fraction in the bridge sample (23.5%) is lower than in the extreme sample(56.3%), indicating the fraction of X-ray weak objects along with rising C IV REWs.X-ray stacking analysis is performed for the X-ray weak WLQs in the clean sample. We measured a relatively hard (Γeff=1.37) effective power-law photon index for a stack of the X-ray weak subsample, suggesting X-ray absorption due to shielding material inside the broad emission-line region (BELR). We proposed a geometrically and optically thick inner accretion disk as the natural shield, which could also explain the behavior of the X-ray weak fraction along with C IV REW.Futhermore, we ran Peto-Prentice tests to assess if the distributions of optical-UV spectral properties are different between X-ray weak WLQs and X-ray normal WLQs. We also examined correlations between △αOX and optical-UV spectral properties. The C IV REW, C IV blueshift, C IV FWHM, REWs of the Si IV, λ1900, Fe II, and Mg II emission features, and the relative SDSS color △(g - i) are examined in our study. △(g - i) turned out to be the most effective tracer of X-ray weakness.

  1. DSM-IV Antisocial Personality Disorder and Conduct Disorder: Evidence for Taxonic Structures Among Individuals With and Without Substance Use Disorders in the General Population

    PubMed Central

    Kerridge, Bradley T; Saha, Tulshi D; Hasin, Deborah S

    2014-01-01

    Objective: The categorical-dimensional status of DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition) conduct disorder (CD) and antisocial personality disorder (ASPD) is a source of controversy. This study examined whether the underlying structure of DSM-IV CD and ASPD was dimensional or categorical (taxonic) among individuals with and without substance use disorders. Method: Using a national large representative survey of U.S. adults (n = 43,093), taxometric analyses of DSM-IV CD and ASPD diagnostic criteria were conducted on the total sample and among those with and without substance use disorders. Results: Results of three taxometric procedures were consistent in showing that the structures underlying DSM-IV CD and ASPD were clearly taxonic in the total sample and among individuals with and without substance use disorders. Comparison curve fit indices exceeded 0.57 for each model. Conclusions: Taxonic findings of the present study were in contrast to the dimensional results of prior taxometric research among incarcerated samples with substantial comorbidity of antisocial syndromes and substance use disorders. Results supported the categorical representation and diagnostic thresholds of ASPD and CD as defined in DSM-IV and DSM-5. That the structure of ASPD and CD may be taxonic suggests that further research on these disorders use group comparative designs in which samples with and without these disorders are compared in terms of sociodemographic and clinical correlates, comorbidity, and treatment utilization. The taxonic structure of ASPD and CD may contribute to future research on causal processes through which these antisocial syndromes develop. PMID:24766762

  2. Interpersonal Violence among College Students: Does Sexual Orientation Impact Risk of Victimization?

    ERIC Educational Resources Information Center

    Snyder, Jamie A.; Scherer, Heidi L.; Fisher, Bonnie S.

    2018-01-01

    Researchers have shown that college students are at an increased risk of experiencing interpersonal violence (IV). One factor that appears to play a role in shaping their likelihood of IV is sexual orientation. However, little is known about this relationship and how IV risk varies across categories of sexual orientation. Utilizing a sample of…

  3. WAIS-IV and Clinical Validation of the Four- and Five-Factor Interpretative Approaches

    ERIC Educational Resources Information Center

    Weiss, Lawrence G.; Keith, Timothy Z.; Zhu, Jianjun; Chen, Hsinyi

    2013-01-01

    The fourth edition of the Wechsler Adult Intelligence Scale (WAIS-IV) is a revised and substantially updated version of its predecessor. The purposes of this research were to determine the constructs measured by the test and the consistency of measurement across large normative and clinical samples. Competing higher order WAIS-IV four- and…

  4. Evaluation of Two Library-Independent Microbial Source Tracking Methods To Identify Sources of Fecal Contamination in French Estuaries▿

    PubMed Central

    Gourmelon, Michèle; Caprais, Marie Paule; Ségura, Raphaël; Le Mennec, Cécile; Lozach, Solen; Piriou, Jean Yves; Rincé, Alain

    2007-01-01

    In order to identify the origin of the fecal contamination observed in French estuaries, two library-independent microbial source tracking (MST) methods were selected: (i) Bacteroidales host-specific 16S rRNA gene markers and (ii) F-specific RNA bacteriophage genotyping. The specificity of the Bacteroidales markers was evaluated on human and animal (bovine, pig, sheep, and bird) feces. Two human-specific markers (HF183 and HF134), one ruminant-specific marker (CF193′), and one pig-specific marker (PF163) showed a high level of specificity (>90%). However, the data suggest that the proposed ruminant-specific CF128 marker would be better described as an animal marker, as it was observed in all bovine and sheep feces and 96% of pig feces. F RNA bacteriophages were detected in only 21% of individual fecal samples tested, in 60% of pig slurries, but in all sewage samples. Most detected F RNA bacteriophages were from genotypes II and III in sewage samples and from genotypes I and IV in bovine, pig, and bird feces and from pig slurries. Both MST methods were applied to 28 water samples collected from three watersheds at different times. Classification of water samples as subject to human, animal, or mixed fecal contamination was more frequent when using Bacteroidales markers (82.1% of water samples) than by bacteriophage genotyping (50%). The ability to classify a water sample increased with increasing Escherichia coli or enterococcus concentration. For the samples that could be classified by bacteriophage genotyping, 78% agreed with the classification obtained from Bacteroidales markers. PMID:17557850

  5. Effects of dexamethasone-21-isonicotinate on peripheral insulin action in dairy cows 5 days after surgical correction of abomasal displacement.

    PubMed

    Kusenda, M; Kaske, M; Piechotta, M; Locher, L; Starke, A; Huber, K; Rehage, J

    2013-01-01

    Dexamethasone frequently is used for treatment of ketosis in dairy cows, but its effects are not fully understood. Dexamethasone treatment affects whole body insulin sensitivity. Twelve German Holstein cows, 2-4 weeks postpartum, 5 days after omentopexy to correct left abomasal displacement. Randomized, blinded, case-control study. Treatment with dexamethasone-21-isonicotinate (DG; 40 μg/kg IM; n = 6) or saline (control group [CG], 15 mL IM, n = 6) on day 0 (d0). Blood samples were obtained before (d0) and after treatment (d1 and d2), and analyzed for glucose, insulin, and nonesterified fatty acid (NEFA) concentrations. Hepatic triglycerides (TAG) were measured in liver samples taken on d0 and d2. Five consecutive hyperinsulinemic-euglycemic clamps (HEC-I-V; insulin dosages: 0.1, 0.5, 2, 5, 10 mU/kg/min, respectively) were performed on d1 and steady state glucose infusion rate (SSGIR), insulin concentration (SSIC), insulin sensitivity index (ISI = SSGIR/SSIC), and plasma NEFA concentration (SSNEFA) were assessed. Compared with CG-cows, DG-cows on d1 had higher plasma glucose (P = .004) and insulin (P < .001) concentrations, decreased SSGIR (HEC-II, P = .002; HEC-IV, P = .033), ISI (HEC-I, P < .015; HEC-II, P = .004), and insulin-stimulated decrease in SSNEFA (HEC-II, P = .006; HEC-III, P = .01; HEC-IV, P = .003; HEC-V, P = .011). Decrease in hepatic TAG content in DG-cows was higher compared with CG-cows (P < .001). Dexamethasone decreases whole body insulin sensitivity and affects glucose and lipid metabolism in early lactating dairy cows. Copyright © 2012 by the American College of Veterinary Internal Medicine.

  6. History of postpartum depression in a clinic-based sample of women with premenstrual dysphoric disorder.

    PubMed

    Kepple, Alyson L; Lee, Ellen E; Haq, Nazli; Rubinow, David R; Schmidt, Peter J

    2016-04-01

    Overlapping comorbidities between premenstrual dysphoric disorder (PMDD) and postpartum depression (PPD) suggest that these disorders represent a continuum of vulnerability with shared pathophysiology. We report the past histories of PPD (and other Axis I psychiatric illnesses) in a clinic-based sample of women meeting criteria for PMDD. 215 women, ages 19 to 51 years, who attended the National Institute of Mental Health Mood Disorders Clinic between 1988 and 2013 seeking treatment for PMDD and in whom we confirmed the diagnosis of PMDD (DSM-IV), were identified. All were administered the Structured Clinical Interview for DSM-III-R or -IV. The frequency of PPD (major or minor) was established in the subgroup of women (n = 137) who had delivered at least 1 child. Ninety-three women (43.3%) had a past history of a mood disorder (ie, either major [n = 67; 31.2%] or minor [n = 10; 4.7%] depression or PPD [n = 16; 7.4%; 11.7% of parous women]). Nine of the 16 women with PMDD and a past PPD had either a past major depressive episode (MDE) or subsyndromal anxiety disorder. Thirty-three women (15.3%) had a past history of an Axis I anxiety disorder. A total of 40 women (18.6%) met criteria for past alcohol or drug abuse, 3 (1.4%) met criteria for bulimia nervosa, and 2 (0.9%) met criteria for anorexia nervosa. Our data demonstrate that PMDD and PPD do not frequently co-occur. These data do not suggest that PMDD and PPD share similar pathophysiology beyond being ovarian-steroid-triggered mood disorders. The high comorbidity of past MDE could contribute to the increased risk both for future MDE and for PPD in some women with PMDD. © Copyright 2016 Physicians Postgraduate Press, Inc.

  7. The suicidality continuum in a large sample of obsessive-compulsive disorder (OCD) patients.

    PubMed

    Velloso, P; Piccinato, C; Ferrão, Y; Aliende Perin, E; Cesar, R; Fontenelle, L; Hounie, A G; do Rosário, M C

    2016-10-01

    Obsessive-compulsive disorder (OCD) has a chronic course leading to huge impact in the patient's functioning. Suicidal thoughts and attempts are much more frequent in OCD subjects than once thought before. To empirically investigate whether the suicidal phenomena could be analyzed as a suicidality severity continuum and its association with obsessive-compulsive (OC) symptom dimensions and quality of life (QoL), in a large OCD sample. Cross-sectional study with 548 patients diagnosed with OCD according to the DSM-IV criteria, interviewed in the Brazilian OCD Consortium (C-TOC) sites. Patients were evaluated by OCD experts using standardized instruments including: Yale-Brown Obsessive-Compulsive Scale (YBOCS); Dimensional Yale-Brown Obsessive-Compulsive Scale (DYBOCS); Beck Depression and Anxiety Inventories; Structured Clinical Interview for DSM-IV (SCID); and the SF-36 QoL Health Survey. There were extremely high correlations between all the suicidal phenomena. OCD patients with suicidality had significantly lower QoL, higher severity in the "sexual/religious", "aggression" and "symmetry/ordering" OC symptom dimensions, higher BDI and BA scores and a higher frequency of suicide attempts in a family member. In the regression analysis, the factors that most impacted suicidality were the sexual dimension severity, the SF-36 QoL Mental Health domain, the severity of depressive symptoms and a relative with an attempted suicide history. Suicidality could be analyzed as a severity continuum and patients should be carefully monitored since they present with suicidal ideation. Lower QoL scores, higher scores on the sexual dimension and a family history of suicide attempts should be considered as risk factors for suicidality among OCD patients. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Development of a simple and fast voltammetric procedure for determination of trace quantity of Se(IV) in natural lake and river water samples.

    PubMed

    Grabarczyk, Malgorzata; Korolczuk, Mieczyslaw

    2010-03-15

    A simple and fast cathodic stripping voltammetric procedure for determination of trace quantity of Se(IV) in natural samples containing high concentrations of surfactants and humic substances was developed. The procedure exploiting selenium accumulation (from sample solution spiked with 0.1 mol L(-1) HClO(4) and 4 x 10(-4)mol L(-1) Cu(NO(3))(2)) as Cu(2)Se was employed as the initial method. The deposited Cu(2)Se was stripped by differential pulse cathodic potential scan. The interference from dissolved organic matter such as surfactants and humic substances was eliminated by adding Amberlite XAD-7 resin to the voltammetric cell. The whole procedure was applied to a single cell, which allows one to monitor the voltammetric scan. Optimum conditions for removing the surfactants and humic substances due to their adsorption on XAD-7 resin were evaluated. The method was tested on synthetic samples spiked with surfactants and humic substances. The calibration graph for Se(IV) under optimized conditions following the accumulation of 30s was linear in the range from 2 x 10(-9) to 2 x 10(-7)mol L(-1) and was found to obey the equation y=0.74x-0.61, where y and x are the peak current (nA) and Se(IV) concentration (nmol L(-1)), respectively. The linear correlation coefficient was r=0.9993. The relative standard deviation for determination of Se(IV) at the concentration of 1 x 10(-8)mol L(-1) was 3.7% (n=5). The detection limit estimated from three times the standard deviation for low Se(IV) concentration and accumulation time of 30s was about 7.8 x 10(-10)mol L(-1). The presented procedure was successfully applied to selenium determination in TMRAIN-95 certified reference material and to real samples including spiked lake and river waters for selenium speciation. (c) 2009 Elsevier B.V. All rights reserved.

  9. Endovascular thrombectomy for acute ischemic stroke in failed intravenous tissue plasminogen activator versus non-intravenous tissue plasminogen activator patients: revascularization and outcomes stratified by the site of arterial occlusions.

    PubMed

    Shi, Zhong-Song; Loh, Yince; Walker, Gary; Duckwiler, Gary R

    2010-06-01

    Intracranial mechanical thrombectomy is a therapeutic option for acute ischemic stroke patients failing intravenous tissue plasminogen activator (IV tPA). We compared patients treated by mechanical embolus removal in cerebral ischemia (MERCI) thrombectomy after failed IV tPA with those treated with thrombectomy alone. We pooled MERCI and Multi MERCI study patients, grouped them either as failed IV tPA or non-IV tPA, and assessed revascularization rates, procedural complications, symptomatic hemorrhage rates, clinical outcomes, and mortality. We also evaluated outcomes stratified by the occlusion site and final revascularization. Among 305 patients, 48 failed, and 257 were ineligible for IV tPA. Nonresponders to IV tPA trended toward a higher revascularization rate (73% versus 63%) and less mortality (27.7% versus 40.1%) and had similar rates of symptomatic hemorrhage and procedural complications. Favorable 90-day outcomes were similar in failed and non-IV tPA patients (38% versus 31%), with no difference according to occlusion site. Among patients failing IV tPA, good outcomes tended to occur more frequently in revascularized patients (47.1% versus 15.4%), although this relationship was attributable solely to middle cerebral artery and not internal carotid artery occlusions, with no difference in mortality. Among IV tPA-ineligible patients, revascularization correlated with good outcome (47.4% versus 4.4%) and less mortality (28.5% versus 59.6%). The risks of hemorrhage and procedure-related complications after mechanical thrombectomy do not differ with respect to previous IV tPA administration. Thrombectomy after IV tPA achieves similar rates of good outcomes, a tendency toward lower mortality, and similar revascularization rates when stratified by clot location. Good outcomes correlate with successful revascularization except with internal carotid artery occlusions in tPA-nonresponders.

  10. Outerbridge Grade IV Cartilage Lesions in the Hip Identified at Arthroscopy.

    PubMed

    Bhatia, Sanjeev; Nowak, Douglas D; Briggs, Karen K; Patterson, Diana C; Philippon, Marc J

    2016-05-01

    To determine factors associated with grade IV cartilage defects in the hip in patients undergoing hip arthroscopy with joint pain. Data from consecutive patients who underwent hip arthroscopy performed by a single surgeon over a period of 4 years were included in this study. The study group included 1,097 patients (491 women and 606 men; mean age, 37 years) who underwent hip arthroscopy for pain, had no prior hip surgery, and were aged 18 years or older. Preoperative radiographs, patient demographic characteristics, and operative details were used to identify risk factors for cartilage defects. Grade IV chondral defects were present in 308 of 1,097 hips (28%). Isolated chondral lesions were more frequently observed on the acetabulum (76%) than on the femoral head (24%). Defects of the acetabulum were more commonly anterosuperior (94.7%) and less commonly posterolateral (5.3%). Patients with less than 2 mm of joint space on preoperative radiographs were 8 times more likely to have a grade IV lesion than those with more than 2 mm. Men were more likely than women to have grade IV lesions (35% v 19%, P = .0001); patients with grade IV lesions were older than those without (42 years v 34 years, P = .0001). Hips with grade IV lesions had significantly higher alpha angles than those without (74° v 70°, P = .0001). Patients with grade IV defects reported a longer duration of symptoms than those without (37 months v 27 months, P = .007). Independent risk factors for the presence of grade IV chondral defects were less than 2 mm of joint space, male gender, increasing age, larger alpha angle, and longer duration of symptoms. Grade IV chondral defects in patients undergoing hip arthroscopy were associated with decreased joint space, increased time from symptom onset to arthroscopy, male gender, and larger alpha angles associated with femoroacetabular impingement. Level IV, prognostic case series. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  11. A phase III, open label, randomized multicenter controlled trial of oral versus intravenous treosulfan in heavily pretreated recurrent ovarian cancer: a study of the North-Eastern German Society of Gynecological Oncology (NOGGO).

    PubMed

    Sehouli, Jalid; Tomè, Oliver; Dimitrova, Desislava; Camara, Oumar; Runnebaum, Ingo Bernhard; Tessen, Hans Werner; Rautenberg, Beate; Chekerov, Radoslav; Muallem, Mustafa Zelal; Lux, Michael Patrick; Trarbach, Tanja; Gitsch, Gerald

    2017-03-01

    In recurrent ovarian cancer (ROC), there is a high demand on effective therapies with a mild toxicity profile. Treosulfan is an alkylating agent approved as oral (p.o.) and intravenous (i.v.) formulation for the treatment of recurrent ovarian cancer. Data on safety and efficacy for either formulation are rare. For the first time we conducted a randomized phase III study comparing both formulations in women with ROC. Patients having received at least two previous lines of chemotherapy were randomly assigned to one of two treatment arms: treosulfan i.v. 7000 mg/m 2 d1 q4w or treosulfan p.o. 600 mg/m 2 d1-28 q8w. Primary endpoint was safety regarding hematological and gastrointestinal toxicity grade III/IV, secondary endpoints were other toxicities, clinical benefit rate (CBR), time to progression (TTP), overall survival (OS) and quality of life. 250 patients were treated with treosulfan i.v. (128) or treosulfan p.o. (122). In general treosulfan therapy was well tolerated in both treatment arms. Leukopenia grade III/IV occurred significantly more frequently in the p.o. arm (3.9% i.v. arm, 14.8% p.o. arm, p = 0.002). Other toxicities were similar in both arms. CBR was comparable between arms (41.4% i.v. arm, 36.9% p.o. arm). No difference in TTP (3.7 months i.v. arm, 3.5 months p.o. arm) or OS (13.6 months i.v. arm, 10.4 months p.o. arm, p = 0.087) occurred. Given the safety and efficacy results treosulfan is an acceptable option for heavily pretreated OC patients. Regarding the toxicity profile the i.v. application was better tolerated with less grade III and IV toxicities.

  12. Evidence That the [beta] Subunit of Chlamydia trachomatis Ribonucleotide Reductase Is Active with the Manganese Ion of Its Manganese(IV)/Iron(III) Cofactor in Site 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dassama, Laura M.K.; Boal, Amie K.; Krebs, Carsten

    2014-10-02

    The reaction of a class I ribonucleotide reductase (RNR) begins when a cofactor in the {beta} subunit oxidizes a cysteine residue {approx}35 {angstrom} away in the {alpha} subunit, generating a thiyl radical. In the class Ic enzyme from Chlamydia trachomatis (Ct), the cysteine oxidant is the Mn{sup IV} ion of a Mn{sup IV}/Fe{sup III} cluster, which assembles in a reaction between O{sub 2} and the Mn{sup II}/Fe{sup II} complex of {beta}. The heterodinuclear nature of the cofactor raises the question of which site, 1 or 2, contains the Mn{sup IV} ion. Because site 1 is closer to the conserved locationmore » of the cysteine-oxidizing tyrosyl radical of class Ia and Ib RNRs, we suggested that the Mn{sup IV} ion most likely resides in this site (i.e., {sup 1}Mn{sup IV}/{sup 2}Fe{sup III}), but a subsequent computational study favored its occupation of site 2 ({sup 1}Fe{sup III}/{sup 2}Mn{sup IV}). In this work, we have sought to resolve the location of the Mn{sup IV} ion in Ct RNR-{beta} by correlating X-ray crystallographic anomalous scattering intensities with catalytic activity for samples of the protein reconstituted in vitro by two different procedures. In samples containing primarily Mn{sup IV}/Fe{sup III} clusters, Mn preferentially occupies site 1, but some anomalous scattering from site 2 is observed, implying that both {sup 1}Mn{sup II}/{sup 2}Fe{sup II} and {sup 1}Fe{sup II}/{sup 2}Mn{sup II} complexes are competent to react with O{sub 2} to produce the corresponding oxidized states. However, with diminished Mn{sup II} loading in the reconstitution, there is no evidence for Mn occupancy of site 2, and the greater activity of these 'low-Mn' samples on a per-Mn basis implies that the {sup 1}Mn{sup IV}/{sup 2}Fe{sup III}-{beta} is at least the more active of the two oxidized forms and may be the only active form.« less

  13. Social phobia and depression: prevalence and comorbidity.

    PubMed

    Ohayon, Maurice M; Schatzberg, Alan F

    2010-03-01

    Social phobia may seriously impair the functioning of affected individuals. It is frequently associated with other mental disorders. To estimate the co-occurrence of social phobia with major depressive disorder (MDD) and to analyze their interaction. Subjects were 18,980 individuals, aged 15 years or older, representative of the general population of the United Kingdom, Germany, Italy, Spain and Portugal, who were interviewed by telephone. DSM-IV diagnoses were made with the Sleep-EVAL system. The point prevalence for social phobia was 4.4% (95% confidence interval: 4.1-4.7%) of the sample. It was higher in women (odds ratio: 1.6) and decreased with age. MDDs were found in 19.5% of participants with social phobia. Co-occurrence of another anxiety disorder was high and increased when a MDD was present (65.2%). The odds of developing a major depressive episode 2 years after the appearance of the social phobia was of 5.74. Social phobia is highly prevalent in the general population. It increases the risk of developing a MDD and has a high comorbidity with other mental disorders. Social phobia is often present in the course of depression, more obviously during remission period of MDD. Physicians must explore and treat more systematically this frequent pathology. Copyright 2010 Elsevier Inc. All rights reserved.

  14. [The prevalence of Parkinson's disease, associated dementia, and depression in Dresden].

    PubMed

    Riedel, O; Schneider, C; Klotsche, J; Reichmann, H; Storch, A; Wittchen, H-U

    2013-02-01

    Parkinson's disease (PD) is frequently compounded by dementia and depression. Yet local total estimates on the prevalence of PD with dementia/depression are still lacking. These are socioeconomically important, especially for the eastern federal states in Germany due to the demographic structures. We conducted a two-staged total estimation in the area of Dresden. First, all local office-based neurologists, hospitals and retirement homes were asked to list their patients/residents with PD on a single study day. Then a random sample of patients/home residents was neuropsycholoigcally examined, including the Mini-mental-state exam and the Montgomery-Asberg Depression rating scale. Dementia was diagnosed according to DSM-IV criteria. Overall, 886 PD cases (95 % CI: 809 - 926) were estimated, of which 252 (95 % CI: 226 - 279) suffered from dementia and 216 (95 % CI: 191 - 242) from depression. Dementia rates increased by age with 13.8 % (≤ 65 years) to 40.2 % (≥ 76 years). Depression rates ranged from 23.3 % to 28.0 %. Overall, 20.6 % of all ambulatory treated PD patients and 85.7 % of all home residents with PD had dementia. The prevalence of PD in Dresden dovetails with previous reported estimates. Dementia and depression are frequent complications in outpatients as well as home residents with PD. © Georg Thieme Verlag KG Stuttgart · New York.

  15. Effect of engineered environment on microbial community structure in biofilter and biofilm on reverse osmosis membrane.

    PubMed

    Jeong, Sanghyun; Cho, Kyungjin; Jeong, Dawoon; Lee, Seockheon; Leiknes, TorOve; Vigneswaran, Saravanamuthu; Bae, Hyokwan

    2017-11-01

    Four dual media filters (DMFs) were operated in a biofiltration mode with different engineered environments (DMF I and II: coagulation with/without acidification and DMF III and IV: without/with chlorination). Designed biofilm enrichment reactors (BERs) containing the removable reverse osmosis (RO) coupons, were connected at the end of the DMFs in parallel to analyze the biofilm on the RO membrane by DMF effluents. Filtration performances were evaluated in terms of dissolved organic carbon (DOC) and assimilable organic carbon (AOC). Organic foulants on the RO membrane were also quantified and fractionized. The bacterial community structures in liquid (seawater and effluent) and biofilm (DMF and RO) samples were analyzed using 454-pyrosequencing. The DMF IV fed with the chlorinated seawater demonstrated the highest reductions of DOC including LMW-N as well as AOC among the other DMFs. The DMF IV was also effective in reducing organic foulants on the RO membrane surface. The bacterial community structure was grouped according to the sample phase (i.e., liquid and biofilm samples), sampling location (i.e., DMF and RO samples), and chlorination (chlorinated and non-chlorinated samples). In particular, the biofilm community in the DMF IV differed from the other DMF treatments, suggesting that chlorination exerted as stronger selective pressure than pH adjustment or coagulation on the biofilm community. In the DMF IV, several chemoorganotrophic chlorine-resistant biofilm-forming bacteria such as Hyphomonas, Erythrobacter, and Sphingomonas were predominant, and they may enhance organic carbon degradation efficiency. Diverse halophilic or halotolerant organic degraders were also found in other DMFs (i.e., DMF I, II, and III). Various kinds of dominant biofilm-forming bacteria were also investigated in RO membrane samples; the results provided possible candidates that cause biofouling when DMF process is applied as the pretreatment option for the RO process. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Acute compartment syndrome of hand resulting from radiographic contrast iohexol extravasation

    PubMed Central

    Vinod, Kolar Vishwanath; Shravan, Rampelli; Shrivarthan, Radhakrishnan; Radhakrishna, Pedapati; Dutta, Tarun Kumar

    2016-01-01

    Intravenous (IV) administration of iodinated contrast agents (ICAs) is frequently employed for image enhancement while performing radiographic studies such as computed tomography and angiography. Complications related to IV administration of ICAs such as immediate hypersensitivity reactions and nephrotoxicity are well-known. However, severe skin and soft tissue injuries and acute compartment syndrome resulting from contrast extravasation are rare. This is especially so with small volume extravasation of a low osmolar, nonionic ICA such as iohexol. Here, we report a 63-year-old woman who developed acute compartment syndrome of left hand following iohexol extravasation and had swelling, blistering, cutaneous and soft tissue necrosis. She underwent fasciotomy for acute compartment syndrome of hand and later surgical debridement of necrotic skin and soft tissues was carried out. Clinical pharmacology of ICAs, extravasation injuries following their IV administration, their management and measures to reduce them are discussed in brief. PMID:27127398

  17. Acute compartment syndrome of hand resulting from radiographic contrast iohexol extravasation.

    PubMed

    Vinod, Kolar Vishwanath; Shravan, Rampelli; Shrivarthan, Radhakrishnan; Radhakrishna, Pedapati; Dutta, Tarun Kumar

    2016-01-01

    Intravenous (IV) administration of iodinated contrast agents (ICAs) is frequently employed for image enhancement while performing radiographic studies such as computed tomography and angiography. Complications related to IV administration of ICAs such as immediate hypersensitivity reactions and nephrotoxicity are well-known. However, severe skin and soft tissue injuries and acute compartment syndrome resulting from contrast extravasation are rare. This is especially so with small volume extravasation of a low osmolar, nonionic ICA such as iohexol. Here, we report a 63-year-old woman who developed acute compartment syndrome of left hand following iohexol extravasation and had swelling, blistering, cutaneous and soft tissue necrosis. She underwent fasciotomy for acute compartment syndrome of hand and later surgical debridement of necrotic skin and soft tissues was carried out. Clinical pharmacology of ICAs, extravasation injuries following their IV administration, their management and measures to reduce them are discussed in brief.

  18. Mismatch of Posttraumatic Stress Disorder (PTSD) Symptoms and DSM-IV Symptom Clusters in a Cancer Sample: Exploratory Factor Analysis of the PTSD Checklist-Civilian Version

    PubMed Central

    Shelby, Rebecca A.; Golden-Kreutz, Deanna M.; Andersen, Barbara L.

    2007-01-01

    The Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV; American Psychiatric Association, 1994a) conceptualization of posttraumatic stress disorder (PTSD) includes three symptom clusters: reexperiencing, avoidance/numbing, and arousal. The PTSD Checklist-Civilian Version (PCL-C) corresponds to the DSM-IV PTSD symptoms. In the current study, we conducted exploratory factor analysis (EFA) of the PCL-C with two aims: (a) to examine whether the PCL-C evidenced the three-factor solution implied by the DSM-IV symptom clusters, and (b) to identify a factor solution for the PCL-C in a cancer sample. Women (N = 148) with Stage II or III breast cancer completed the PCL-C after completion of cancer treatment. We extracted two-, three-, four-, and five-factor solutions using EFA. Our data did not support the DSM-IV PTSD symptom clusters. Instead, EFA identified a four-factor solution including reexperiencing, avoidance, numbing, and arousal factors. Four symptom items, which may be confounded with illness and cancer treatment-related symptoms, exhibited poor factor loadings. Using these symptom items in cancer samples may lead to overdiagnosis of PTSD and inflated rates of PTSD symptoms. PMID:16281232

  19. Stapled haemorrhoidectomy in the operative treatment of grade III and IV haemorrhoids.

    PubMed

    Shrestha, S; Pradhan, G B N; Shrestha, R; Poudel, P; Bhattachan, C L

    2014-09-01

    Stapled haemorrhoidectomy (SH) is a minimally invasive intervention that uses a stapling device which avoids the need for wounds in the sensitive anal area and reduces the pain after surgery. This study was undertaken in Nepal Medical College Teaching Hospital from January 2010 to December 2012 to evaluate the efficacy of this modality of treatment among patients (32) who presented in the Surgery OPD with grade III and grade IV haemorrhoids. The results of SH were evaluated by the relief of symptoms, severity of post operative pain, and complications of SH. Twenty five (78.1%) patients had grade III and 7 (21.9%) presented with grade IV hemorrhoids. The most frequent presentation reported in our study was bleeding per rectum with perianal prolapse. Mean operating time was 40-60 minutes whereas mean hospital stay was 1.9 days. Urinary retention was the most common complication found in 12 (37.5%) patients in the immediate post operative period. SH is a safe, rapid, and convenient surgical remedy for grade III and grade IV hemorrhoids with low rate of complications, minimal postoperative pain, and shorter hospital stay.

  20. Daily Tobacco Smoking in Treatment-Seeking Pathological Gamblers: Clinical Correlates and Co-occurring Psychiatric Disorders.

    PubMed

    Grant, Jon E; Kim, Suck Won; Odlaug, Brian L; Potenza, Marc N

    2008-01-01

    Tobacco smoking and pathological gambling (PG) frequently co-occur. Little is known, however, about the clinical correlates and co-occurring psychiatric disorders in treatment-seeking pathological gamblers with and without daily tobacco smoking. Among a sample of 465 consecutive treatment-seeking subjects with current DSM-IV PG, those with daily tobacco smoking were compared to those without daily tobacco smoking on measures of gambling symptom severity (South Oaks Gambling Screen [SOGS] and the Yale Brown Obsessive Compulsive Scale Modified for Pathological Gambling [PG-YBOCS]), types of gambling, social and legal problems, and co-occurring disorders. Two hundred and nine (44.9%) of the 465 subjects with PG reported current daily tobacco smoking. Gamblers with daily tobacco smoking as compared to those without had higher SOGS scores, had more severe PG-YBOCS behavior scores, endorsed more DSM-IV PG criteria, lost more money gambling, and were more likely to engage in non-strategic gambling, and were less likely to have a co-occurring mood disorder. Gamblers with daily tobacco smoking and a current substance use disorder reported a greater percentage of income lost to gambling during the past year. Daily tobacco smoking in PG is common and associated with multiple important clinical features including more severe gambling and financial problems. These findings suggest that pathological gamblers with daily tobacco smoking might need unique or enhanced treatment strategies.

  1. Sex Differences in Antisocial Personality Disorder: Results From the National Epidemiological Survey on Alcohol and Related Conditions

    PubMed Central

    Alegria, Analucia A.; Petry, Nancy M.; Liu, Shang-Min; Blanco, Carlos; Skodol, Andrew E.; Grant, Bridget; Hasin, Deborah

    2013-01-01

    Despite the 3:1 prevalence ratio of men versus women with Antisocial Personality Disorder (ASPD), research on sex differences on correlates of ASPD in the general population is scarce. The purpose of this study was to examine sex differences in childhood and adult adverse events, lifetime psychiatric comorbidity, and clinical correlates of DSM–IV ASPD. The sample included 819 men and 407 women with DSM-IV ASPD diagnosis. Data were derived from the National Epidemiologic Survey on Alcohol and Related Conditions (NESARC) (N = 43,093). Compared to men, women with ASPD reported more frequent childhood emotional neglect (AOR = 2.25; 95% CI: 1.52–3.34) and sexual abuse (AOR = 4.20; 95% CI: 2.78–6.35), any parent-related adverse event during childhood (e.g., parental substance use disorder) (AOR = 2.47; 95% CI: 1.60–3.82), and adverse events during adulthood (AOR = 4.20; 95% CI: 2.78–6.35). Although women with ASPD present less violent antisocial behaviors and higher rates of aggressiveness and irritability (OR = 0.46; 95% CI: 0.31–0.67), they have higher rates of victimization, greater impairment, and lower social support. Our findings suggest increased mental health needs in women with ASPD, meriting development of different treatment programs for women and men. PMID:23544428

  2. Ocular penetration of intravenously administered enrofloxacin in the horse.

    PubMed

    Divers, T J; Irby, N L; Mohammed, H O; Schwark, W S

    2008-03-01

    Information on antibiotic concentrations in the equine eye following systemic therapy is limited. Reports that Leptospira spp. are frequently present in the eyes of horses with recurrent uveitis, emphasises a need for studies on ocular concentrations of specific antibiotics. 1) Enrofloxacin, administered i.v. at 7.5 mg/kg bwt q. 24 h, results in aqueous humour concentrations greater than the reported minimum inhibitory concentration (MIC) for Leptospira pomona. 2) Aqueous humour paracentesis sufficiently disrupts the blood-aqueous humour barrier (BAB) to cause an increase in aqueous humour protein and enrofloxacin concentrations. Aqueous humour enrofloxacin and total protein concentrations were determined in 6 healthy, mature horses after i.v. administration of enrofloxacin. Paracentesis was performed on the left eye on Days 3 and 4, 1 h following enrofloxacin administration, to determine enrofloxacin concentrations in healthy eyes and in eyes with mechanical disruption of the BAB. Paracentesis was also performed on the right eye 23 h after enrofloxacin administration. Blood samples were collected from the horses at identical times to determine enrofloxacin aqueous humour:plasma ratios. Mean +/- s.d. enrofloxacin concentration in the aqueous humour 1 h post administration on Day 3 was 0.32 +/- 0.10 mg/l (range 0.18-0.47); and aqueous humour enrofloxacin, total protein and aqueous humour:plasma enrofloxacin ratios were higher on Day 4 than Day 3. Following disruption of the BAB, enrofloxacin concentrations were above the reported MIC for Leptospira pomona.

  3. Current comorbidity among consecutive adolescent psychiatric outpatients with DSM-IV mood disorders.

    PubMed

    Karlsson, Linnea; Pelkonen, Mirjami; Ruuttu, Titta; Kiviruusu, Olli; Heilä, Hannele; Holi, Matti; Kettunen, Kirsi; Tuisku, Virpi; Tuulio-Henriksson, Annamari; Törrönen, Johanna; Marttunen, Mauri

    2006-06-01

    To compare selected characteristics (age, sex, age of onset for depression, impairment, severity of depression, somatic comorbidity, and treatment status) of adolescents with currently comorbid and non-comorbid depression. A sample of 218 consecutive adolescent (13-19 years) psychiatric outpatients with depressive disorders, and 200 age- and sex-matched school-attending controls were interviewed for DSM-IV Axis I and Axis II diagnoses. Current comorbidity, most commonly with anxiety disorders, was equally frequent (>70%) in outpatients and depressed controls. Younger age (OR 0.20; 95% CI 0.08, 0.51) and male gender (OR 0.02; 95% CI 0.09, 0.55) were associated with concurrent disruptive disorders. Current comorbidity with substance use disorders (SUD) was independent of age (OR 1.13; 95% CI 0.51, 2.49) and sex (OR 0.51; 95% CI 0.22, 1.17). Personality disorders associated with older age (OR 2.06; 95% CI 1.10, 3.86). In multivariable logistic regression analysis, impairment (GAF

  4. Epidemiology of melasma in Brazilian patients: a multicenter study.

    PubMed

    Hexsel, Doris; Lacerda, Davi A; Cavalcante, Andrea S; Machado Filho, Carlos A S; Kalil, Célia Luiza P V; Ayres, Eloísa L; Azulay-Abulafia, Luna; Weber, Magda B; Serra, Marcio S; Lopes, Nádya F P; Cestari, Tania F

    2014-04-01

    Melasma is an acquired, irregularly patterned, light to dark-brown hypermelanosis, with symmetric distribution mostly over the face. The aim of this study was to evaluate clinical characteristics and factors related to melasma in Brazilian patients. This was a cross-sectional, multicenter study performed in Brazil. Investigators examined and questioned 953 patients over 18 years of age on clinical characteristics and other factors related to their melasma. Melasma was more prevalent in women (97.5%) and in Fitzpatrick skin phototypes II (12.8%), III (36.3%), and IV (39.7%). Skin phototypes II and III and family history of melasma had early onset of the disorder when compared with skin phototypes IV, V, and VI (P<0.0001). Similar results were also observed when these same groups were compared with the absence of family history (P<0.0001). Extra-facial melasma was more frequent in postmenopausal women compared with those who were not experiencing menopause (14.2% vs. 3.5%, P<0.0001). Data suggested that the age of melasma onset are related to skin phototypes and family history. Additionally, extra-facial melasma was more common in menopausal women. This is the first study on the epidemiology of melasma in Brazil involving a large sample of the population. These data can be a source of new relevant research on the cause and development of melasma. © 2013 The International Society of Dermatology.

  5. Plutonium(IV) and (V) sorption to goethite at sub-femtomolar to micromolar concentrations: Redox transformations and surface precipitation

    DOE PAGES

    Zhao, Pihong; Begg, James D.; Zavarin, Mavrik; ...

    2016-06-06

    Here, Pu(IV) and Pu(V) sorption to goethite was investigated over a concentration range of 10 –15–10 –5 M at pH 8. Experiments with initial Pu concentrations of 10 –15 – 10 –8 M produced linear Pu sorption isotherms, demonstrating that Pu sorption to goethite is not concentration-dependent across this concentration range. Equivalent Pu(IV) and Pu(V) sorption Kd values obtained at 1 and 2-week sampling time points indicated that Pu(V) is rapidly reduced to Pu(IV) on the goethite surface. Further, it suggested that Pu surface redox transformations are sufficiently rapid to achieve an equilibrium state within 1 week, regardless of themore » initial Pu oxidation state. At initial concentrations >10 –8 M, both Pu oxidation states exhibited deviations from linear sorption behavior and less Pu was adsorbed than at lower concentrations. NanoSIMS and HRTEM analysis of samples with initial Pu concentrations of 10 –8 – 10 –6 M indicated that Pu surface and/or bulk precipitation was likely responsible for this deviation. In 10 –6 M Pu(IV) and Pu(V) samples, HRTEM analysis showed the formation of a body centered cubic (bcc) Pu 4O 7 structure on the goethite surface, confirming that reduction of Pu(V) had occurred on the mineral surface and that epitaxial distortion previously observed for Pu(IV) sorption occurs with Pu(V) as well.« less

  6. Clinical Implications of DSM-IV Subtyping of Bipolar Disorders in Referred Children and Adolescents

    ERIC Educational Resources Information Center

    Masi, Gabriele; Perugi, Giulio; Millepiedi, Stefania; Mucci, Maria; Pari, Cinzia; Pfanner, Chiara; Berloffa, Stefano; Toni, Cristina

    2007-01-01

    Objective: According to DSM-IV, bipolar disorders (BDs) include four subtypes, BD I, BD II, cyclothymic disorder, and BD not otherwise specified (NOS). We explore the clinical implications of this subtyping in a naturalistic sample of referred youths with BD I, BD II, and BD-NOS. Method: The sample consisted of 217 patients, 135 males and 82…

  7. Black hole mass estimates and emission-line properties of a sample of redshift z > 6.5 quasars

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Rosa, Gisella; Peterson, Bradley M.; Frank, Stephan

    We present the analysis of optical and near-infrared spectra of the only four z > 6.5 quasars known to date, discovered in the UKIDSS-LAS and VISTA-VIKING surveys. Our data set consists of new Very Large Telescope/X-Shooter and Magellan/FIRE observations. These are the best optical/NIR spectroscopic data that are likely to be obtained for the z > 6.5 sample using current 6-10 m facilities. We estimate the black hole (BH) mass, the Eddington ratio, and the Si IV/C IV, C III]/C IV, and Fe II/Mg II emission-line flux ratios. We perform spectral modeling using a procedure that allows us to derivemore » a probability distribution for the continuum components and to obtain the quasar properties weighted upon the underlying distribution of continuum models. The z > 6.5 quasars show the same emission properties as their counterparts at lower redshifts. The z > 6.5 quasars host BHs with masses of ∼10{sup 9} M{sub ☉} that are accreting close to the Eddington luminosity ((log(L{sub Bol}/L{sub Edd})) = –0.4 ± 0.2), in agreement with what has been observed for a sample of 4.0 < z < 6.5 quasars. By comparing the Si IV/C IV and C III]/C IV flux ratios with the results obtained from luminosity-matched samples at z ∼ 6 and 2 ≤ z ≤ 4.5, we find no evidence of evolution of the line ratios with cosmic time. We compare the measured Fe II/Mg II flux ratios with those obtained for a sample of 4.0 < z < 6.4 sources. The two samples are analyzed using a consistent procedure. There is no evidence that the Fe II/Mg II flux ratio evolves between z = 7 and z = 4. Under the assumption that the Fe II/Mg II traces the Fe/Mg abundance ratio, this implies the presence of major episodes of chemical enrichment in the quasar hosts in the first ∼0.8 Gyr after the Big Bang.« less

  8. An enhanced cerium(IV)-rhodamine 6G chemiluminescence system using guest-host interactions in a lab-on-a-chip platform for estimating the total phenolic content in food samples.

    PubMed

    Al Haddabi, Buthaina; Al Lawati, Haider A J; Suliman, FakhrEldin O

    2016-04-01

    Two chemiluminescence-microfluidic (CL-MF) systems, e.g., Ce(IV)-rhodamine B (RB) and Ce(IV)-rhodamine 6G (R6G), for the determination of the total phenolic content in teas and some sweeteners were evaluated. The results indicated that the Ce(IV)-R6G system was more sensitive in comparison to the Ce(IV)-RB CL system. Therefore, a simple (CL-MF) method based on the CL of Ce(IV)-R6G was developed, and the sensitivity, selectivity and stability of this system were evaluated. Selected phenolic compounds (PCs), such as quercetin (QRC), catechin (CAT), rutin (RUT), gallic acid (GA), caffeic acid (CA) and syringic acid (SA), produced analytically useful chemiluminescence signals with low detection limits ranging from 0.35 nmol L(-1) for QRC to 11.31 nmol L(-1) for SA. The mixing sequence and the chip design were crucial, as the sensitivity and reproducibility could be substantially affected by these two factors. In addition, the anionic surfactant (i.e., sodium dodecyl sulfate (SDS)) can significantly enhance the CL signal intensity by as much as 300% for the QRC solution. Spectroscopic studies indicated that the enhancement was due to a strong guest-host interaction between the cationic R6G molecules and the anionic amphiphilic environment. Other parameters that could affect the CL intensities of the PCs were carefully optimized. Finally, the method was successfully applied to tea and sweetener samples. Six different tea samples exhibited total phenolic/antioxidant levels from 7.32 to 13.5 g per 100g of sample with respect to GA. Four different sweetener samples were also analyzed and exhibited total phenolic/antioxidant levels from 500.9 to 3422.9 mg kg(-1) with respect to GA. The method was selective, rapid and sensitive when used to estimate the total phenolic/antioxidant level, and the results were in good agreement with those reported for honey and tea samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. 7 CFR 701.5 - Land eligibility.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... must determine that land that is the subject of the cost share: (1) Will have new conservation problems..., except for wind erosion, is not of the type likely to recur frequently in the same area; and (iv) Be so... agricultural use. Conservation problems existing prior to the disaster are not eligible for cost-share...

  10. Symptom Profile of Attention-Deficit/Hyperactivity Disorder in Youth with High-functioning Autism Spectrum Disorder: A Comparative Study in Psychiatrically Referred Populations

    PubMed Central

    Joshi, Gagan; Faraone, Stephen V.; Wozniak, Janet; Tarko, Laura; Fried, Ronna; Galdo, Maribel; Furtak, Stephannie L.; Biederman, Joseph

    2014-01-01

    Objective To compare the clinical presentation of ADHD between youth with autism spectrum disorder (ASD) and ADHD and a sample of youth with ADHD only. Method A psychiatrically referred sample of autism spectrum disorder (ASD) youth with ADHD attending a specialized ambulatory program for ASD (n = 107) and a sample of youth with ADHD attending a general child psychiatry ambulatory clinic (n = 74) were compared. Results Seventy-six percent of youth with ASD met Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV) criteria for ADHD. The clinical presentation of ADHD in youth with ASD was predominantly similar to its typical presentation including age at onset (3.5 ± 1.7 vs. 4.0 ± 1.9; p = .12), distribution of diagnostic subtypes, the qualitative and quantitative symptom profile, and symptom severity. Combined subtype was the most frequent presentation of ADHD in ASD youth. Conclusion Despite the robust presentation of ADHD, a significant majority of ASD youth with ADHD failed to receive appropriate ADHD treatment (41% vs. 24%; p = .02). A high rate of comorbidity with ADHD was observed in psychiatrically referred youth with ASD, with a clinical presentation typical of the disorder. PMID:25085653

  11. The Nature of the Star-Grazing Bodies in a System at the Age of the Late Heavy Bombardment

    NASA Astrophysics Data System (ADS)

    Grady, Carol

    2017-08-01

    Studies of bodies exhibiting redshifted gaseous absorption features associated with star-grazing planetesimals offer unique data on the composition of the bodies, as well as the presence of planetesimal belt analogs and giant planets in systems throughout the stellar lifecycle. Studies of young systems, such as the A stars in the beta Pictoris moving group, suggest that the star grazing bodies contain abundant carbon and water dissociation products, indicating a cometary origin. A recent analysis of another system, phi Leo (A7 IV, age=400-900 Myr) shows similar infall features in Ca II and Ti II, with what may be a 15-year cycle. This system is similar in age to the Late Heavy Bombardment in our system, a time when terrestrial planets in our system are thought to have been veneered in organics and water. The available data indicate frequent infall events interpreted as transiting exo-comets, but sample only lithophile to super-refractory elements. Archival IUE data lack the FUV S/N to establish high carbon abundance or the presence of water dissociation products. We therefore seek COS and STIS spectra to sample the volatile gas dat, and constrain the origin of the star-grazing bodies. The FUV data will be augmented with NUV data sampling siderophiles and lithophiles.

  12. Abdominal Emergencies in Patients with Stage IV Melanoma: The Role of Surgery: A Single-centre Experience.

    PubMed

    Mantas, Dimitrios; Damaskos, Christos; Garmpis, Nikolaos; Dimitroulis, Dimitrios; Garmpi, Anna; Gogas, Helen

    2018-06-01

    Metastatic melanoma is an aggressive disease with poor prognosis. Melanoma can potentially involve any organ. In this article, we report on a single-centre experience in emergency surgery for M1c melanoma. Twenty-eight consecutive patients with M1c melanoma underwent surgical exploration due to abdominal emergencies. Pre-operative computed tomography confirmed the diagnosis and the location of the affected site. Pre-operative lactate dehydrogenase serum levels and post-operative histopathology findings were recorded. Intestinal obstruction was the most frequent intraoperative finding (75%). The ileum was most frequently affected (28.6%). Multifocal disease and extra-gastrointestinal tract metastases were present in 25% of cases each. Lactate dehydrogenase serum level was increased in 75% of the patients. Most patients underwent an enterectomy. Curative surgery for stage IV melanoma remains debatable, but surgery for patients presenting with abdominal emergencies appears to improve both survival rate and prognosis. Combined novel therapies and surgical resection is currently being studied with promising results. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. Evidences of grain boundary capacitance effect on the colossal dielectric permittivity in (Nb + In) co-doped TiO2 ceramics

    NASA Astrophysics Data System (ADS)

    Li, Jinglei; Li, Fei; Li, Chao; Yang, Guang; Xu, Zhuo; Zhang, Shujun

    2015-02-01

    The (Nb + In) co-doped TiO2 ceramics were synthesized by conventional solid-state sintering (CSSS) and spark plasma sintering (SPS) methods. The phases and microstructures were studied by X-ray diffraction, Raman spectra, field-emission scanning electron microscopy and transmission electron microscopy, indicating that both samples were in pure rutile phase while showing significant difference in grain size. The dielectric and I-V behaviors of SPS and CSSS samples were investigated. Though both possess colossal permittivity (CP), the SPS samples exhibited much higher dielectric permittivity/loss factor and lower breakdown electric field when compared to their CSSS counterparts. To further explore the origin of CP in co-doped TiO2 ceramics, the I-V behavior was studied on single grain and grain boundary in CSSS sample. The nearly ohmic I-V behavior was observed in single grain, while GBs showed nonlinear behavior and much higher resistance. The higher dielectric permittivity and lower breakdown electric field in SPS samples, thus, were thought to be associated with the feature of SPS, by which reduced space charges and/or impurity segregation can be achieved at grain boundaries. The present results support that the grain boundary capacitance effect plays an important role in the CP and nonlinear I-V behavior of (Nb + In) co-doped TiO2 ceramics.

  14. Evidences of grain boundary capacitance effect on the colossal dielectric permittivity in (Nb + In) co-doped TiO2 ceramics.

    PubMed

    Li, Jinglei; Li, Fei; Li, Chao; Yang, Guang; Xu, Zhuo; Zhang, Shujun

    2015-02-06

    The (Nb + In) co-doped TiO2 ceramics were synthesized by conventional solid-state sintering (CSSS) and spark plasma sintering (SPS) methods. The phases and microstructures were studied by X-ray diffraction, Raman spectra, field-emission scanning electron microscopy and transmission electron microscopy, indicating that both samples were in pure rutile phase while showing significant difference in grain size. The dielectric and I-V behaviors of SPS and CSSS samples were investigated. Though both possess colossal permittivity (CP), the SPS samples exhibited much higher dielectric permittivity/loss factor and lower breakdown electric field when compared to their CSSS counterparts. To further explore the origin of CP in co-doped TiO2 ceramics, the I-V behavior was studied on single grain and grain boundary in CSSS sample. The nearly ohmic I-V behavior was observed in single grain, while GBs showed nonlinear behavior and much higher resistance. The higher dielectric permittivity and lower breakdown electric field in SPS samples, thus, were thought to be associated with the feature of SPS, by which reduced space charges and/or impurity segregation can be achieved at grain boundaries. The present results support that the grain boundary capacitance effect plays an important role in the CP and nonlinear I-V behavior of (Nb + In) co-doped TiO2 ceramics.

  15. Nanometer-sized alumina packed microcolumn solid-phase extraction combined with field-amplified sample stacking-capillary electrophoresis for the speciation analysis of inorganic selenium in environmental water samples.

    PubMed

    Duan, Jiankuan; Hu, Bin; He, Man

    2012-10-01

    In this paper, a new method of nanometer-sized alumina packed microcolumn SPE combined with field-amplified sample stacking (FASS)-CE-UV detection was developed for the speciation analysis of inorganic selenium in environmental water samples. Self-synthesized nanometer-sized alumina was packed in a microcolumn as the SPE adsorbent to retain Se(IV) and Se(VI) simultaneously at pH 6 and the retained inorganic selenium was eluted by concentrated ammonia. The eluent was used for FASS-CE-UV analysis after NH₃ evaporation. The factors affecting the preconcentration of both Se(IV) and Se(VI) by SPE and FASS were studied and the optimal CE separation conditions for Se(IV) and Se(VI) were obtained. Under the optimal conditions, the LODs of 57 ng L⁻¹ (Se(IV)) and 71 ng L⁻¹ (Se(VI)) were obtained, respectively. The developed method was validated by the analysis of a certified reference material of GBW(E)080395 environmental water and the determined value was in a good agreement with the certified value. It was also successfully applied to the speciation analysis of inorganic selenium in environmental water samples, including Yangtze River water, spring water, and tap water. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. WISC-IV Profiles in Children with Traumatic Brain Injury: Similarities to and Differences from the WISC-III

    ERIC Educational Resources Information Center

    Allen, Daniel N.; Thaler, Nicholas S.; Donohue, Brad; Mayfield, Joan

    2010-01-01

    The Wechsler Intelligence Scale for Children--Fourth Edition (WISC-IV; D. Wechsler, 2003a) is often utilized to assess children with traumatic brain injury (TBI), although little information is available regarding its psychometric properties in these children. The current study examined WISC-IV performance in a sample of 61 children with TBI. As…

  17. Factor Structure of the Wechsler Intelligence Scale for Children: Fourth Edition in Children with ADHD.

    PubMed

    Thaler, Nicholas S; Barchard, Kimberly A; Parke, Elyse; Jones, W Paul; Etcoff, Lewis M; Allen, Daniel N

    2015-12-01

    Recent evidence suggests that the factor structure of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) is better explained by a five-factor model rather than the four-factor model in the standardization sample. The current study examined the WISC-IV's factor structure in a sample of children with ADHD. Participants included 314 children and adolescents who were diagnosed with ADHD. Confirmatory factor analysis was conducted on the 10 core subtests of the WISC-IV, and three models were examined including two based on Cattell-Horn-Carroll (CHC) theory. A five-factor model consisting of Gc, Gf, Gv, Gsm, and Gs factors provided the best fit for the data. The Perceptual Reasoning factor identified in the original four-factor model split into the two CHC factors, Gf and Gv, and cross-loaded the Symbol Search subtest onto the Gv factor. A five-factor model based on CHC theory provided superior fit for the WISC-IV in children with ADHD, as has been found with the standardization sample. © The Author(s) 2012.

  18. Dyadic Short Forms of the Wechsler Adult Intelligence Scale-IV.

    PubMed

    Denney, David A; Ringe, Wendy K; Lacritz, Laura H

    2015-08-01

    Full Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) administration can be time-consuming and may not be necessary when intelligence quotient estimates will suffice. Estimated Full Scale Intelligence Quotient (FSIQ) and General Ability Index (GAI) scores were derived from nine dyadic short forms using individual regression equations based on data from a clinical sample (n = 113) that was then cross validated in a separate clinical sample (n = 50). Derived scores accounted for 70%-83% of the variance in FSIQ and 77%-88% of the variance in GAI. Predicted FSIQs were strongly associated with actual FSIQ (rs = .73-.88), as were predicted and actual GAIs (rs = .80-.93). Each of the nine dyadic short forms of the WAIS-IV was a good predictor of FSIQ and GAI in the validation sample. These data support the validity of WAIS-IV short forms when time is limited or lengthier batteries cannot be tolerated by patients. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Applicability of the ICD-11 proposal for PTSD: a comparison of prevalence and comorbidity rates with the DSM-IV PTSD classification in two post-conflict samples

    PubMed Central

    Stammel, Nadine; Abbing, Eva M.; Heeke, Carina; Knaevelsrud, Christine

    2015-01-01

    Background The World Health Organization recently proposed significant changes to the posttraumatic stress disorder (PTSD) diagnostic criteria in the 11th edition of the International Classification of Diseases (ICD-11). Objective The present study investigated the impact of these changes in two different post-conflict samples. Method Prevalence and rates of concurrent depression and anxiety, socio-demographic characteristics, and indicators of clinical severity according to ICD-11 in 1,075 Cambodian and 453 Colombian civilians exposed to civil war and genocide were compared to those according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV). Results Results indicated significantly lower prevalence rates under the ICD-11 proposal (8.1% Cambodian sample and 44.4% Colombian sample) compared to the DSM-IV (11.2% Cambodian sample and 55.0% Colombian sample). Participants meeting a PTSD diagnosis only under the ICD-11 proposal had significantly lower rates of concurrent depression and a lower concurrent total score (depression and anxiety) compared to participants meeting only DSM-IV diagnostic criteria. There were no significant differences in socio-demographic characteristics and indicators of clinical severity between these two groups. Conclusions The lower prevalence of PTSD according to the ICD-11 proposal in our samples of persons exposed to a high number of traumatic events may counter criticism of previous PTSD classifications to overuse the PTSD diagnosis in populations exposed to extreme stressors. Also another goal, to better distinguish PTSD from comorbid disorders could be supported with our data. PMID:25989951

  20. Applicability of the ICD-11 proposal for PTSD: a comparison of prevalence and comorbidity rates with the DSM-IV PTSD classification in two post-conflict samples.

    PubMed

    Stammel, Nadine; Abbing, Eva M; Heeke, Carina; Knaevelsrud, Christine

    2015-01-01

    The World Health Organization recently proposed significant changes to the posttraumatic stress disorder (PTSD) diagnostic criteria in the 11th edition of the International Classification of Diseases (ICD-11). The present study investigated the impact of these changes in two different post-conflict samples. Prevalence and rates of concurrent depression and anxiety, socio-demographic characteristics, and indicators of clinical severity according to ICD-11 in 1,075 Cambodian and 453 Colombian civilians exposed to civil war and genocide were compared to those according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV). Results indicated significantly lower prevalence rates under the ICD-11 proposal (8.1% Cambodian sample and 44.4% Colombian sample) compared to the DSM-IV (11.2% Cambodian sample and 55.0% Colombian sample). Participants meeting a PTSD diagnosis only under the ICD-11 proposal had significantly lower rates of concurrent depression and a lower concurrent total score (depression and anxiety) compared to participants meeting only DSM-IV diagnostic criteria. There were no significant differences in socio-demographic characteristics and indicators of clinical severity between these two groups. The lower prevalence of PTSD according to the ICD-11 proposal in our samples of persons exposed to a high number of traumatic events may counter criticism of previous PTSD classifications to overuse the PTSD diagnosis in populations exposed to extreme stressors. Also another goal, to better distinguish PTSD from comorbid disorders could be supported with our data.

  1. Molecular Diversity of Trypanosoma cruzi Detected in the Vector Triatoma protracta from California, USA.

    PubMed

    Shender, Lisa A; Lewis, Michael D; Rejmanek, Daniel; Mazet, Jonna A K

    2016-01-01

    Trypanosoma cruzi, causative agent of Chagas disease in humans and dogs, is a vector-borne zoonotic protozoan parasite that can cause fatal cardiac disease. While recognized as the most economically important parasitic infection in Latin America, the incidence of Chagas disease in the United States of America (US) may be underreported and even increasing. The extensive genetic diversity of T. cruzi in Latin America is well-documented and likely influences disease progression, severity and treatment efficacy; however, little is known regarding T. cruzi strains endemic to the US. It is therefore important to expand our knowledge on US T. cruzi strains, to improve upon the recognition of and response to locally acquired infections. We conducted a study of T. cruzi molecular diversity in California, augmenting sparse genetic data from southern California and for the first time investigating genetic sequences from northern California. The vector Triatoma protracta was collected from southern (Escondido and Los Angeles) and northern (Vallecito) California regions. Samples were initially screened via sensitive nuclear repetitive DNA and kinetoplast minicircle DNA PCR assays, yielding an overall prevalence of approximately 28% and 55% for southern and northern California regions, respectively. Positive samples were further processed to identify discrete typing units (DTUs), revealing both TcI and TcIV lineages in southern California, but only TcI in northern California. Phylogenetic analyses (targeting COII-ND1, TR and RB19 genes) were performed on a subset of positive samples to compare Californian T. cruzi samples to strains from other US regions and Latin America. Results indicated that within the TcI DTU, California sequences were similar to those from the southeastern US, as well as to several isolates from Latin America responsible for causing Chagas disease in humans. Triatoma protracta populations in California are frequently infected with T. cruzi. Our data extend the northern limits of the range of TcI and identify a novel genetic exchange event between TcI and TcIV. High similarity between sequences from California and specific Latin American strains indicates US strains may be equally capable of causing human disease. Additional genetic characterization of Californian and other US T. cruzi strains is recommended.

  2. Power and instrument strength requirements for Mendelian randomization studies using multiple genetic variants.

    PubMed

    Pierce, Brandon L; Ahsan, Habibul; Vanderweele, Tyler J

    2011-06-01

    Mendelian Randomization (MR) studies assess the causality of an exposure-disease association using genetic determinants [i.e. instrumental variables (IVs)] of the exposure. Power and IV strength requirements for MR studies using multiple genetic variants have not been explored. We simulated cohort data sets consisting of a normally distributed disease trait, a normally distributed exposure, which affects this trait and a biallelic genetic variant that affects the exposure. We estimated power to detect an effect of exposure on disease for varying allele frequencies, effect sizes and samples sizes (using two-stage least squares regression on 10,000 data sets-Stage 1 is a regression of exposure on the variant. Stage 2 is a regression of disease on the fitted exposure). Similar analyses were conducted using multiple genetic variants (5, 10, 20) as independent or combined IVs. We assessed IV strength using the first-stage F statistic. Simulations of realistic scenarios indicate that MR studies will require large (n > 1000), often very large (n > 10,000), sample sizes. In many cases, so-called 'weak IV' problems arise when using multiple variants as independent IVs (even with as few as five), resulting in biased effect estimates. Combining genetic factors into fewer IVs results in modest power decreases, but alleviates weak IV problems. Ideal methods for combining genetic factors depend upon knowledge of the genetic architecture underlying the exposure. The feasibility of well-powered, unbiased MR studies will depend upon the amount of variance in the exposure that can be explained by known genetic factors and the 'strength' of the IV set derived from these genetic factors.

  3. Schizoaffective disorder diagnosed according to different diagnostic criteria--systematic literature search and meta-analysis of key clinical characteristics and heterogeneity.

    PubMed

    Pagel, Tobias; Franklin, Jeremy; Baethge, Christopher

    2014-03-01

    Schizoaffective disorder is viewed as a heterogeneous diagnosis among psychotic illnesses. Different diagnostic systems differ in their definition with DSM (-IIIR, -IV, and -V) providing a narrower definition than RDC and ICD-10. It is unclear whether this difference is reflected in patient samples diagnosed according to different diagnostic systems. Exploratory study based on a systematic review of studies of schizoaffective disorder samples diagnosed by either RDC and ICD-10 (group of "broad criteria") or DSM-IIIR and -IV ("narrow criteria"); comparison (by Mann-Whitney-U-tests) of key characteristics, such as age, number of hospitalizations, or scores in psychometric tests, between more broadly and more narrowly defined schizoaffective disorder samples using standard deviations as a measurement of heterogeneity as well as weighted means and percentages. To reduce selection bias only studies including schizoaffective patient samples together with affective disorder and schizophrenia samples were selected. 55 studies were included, 14 employing RDC, 4 ICD-10, 20 DSM-IIIR, and 17 DSM-IV. Thirteen characteristics were compared: patients diagnosed according to broader criteria had fewer previous hospitalizations (2.2 vs. 5.4) and were both less often male (42 vs. 51%) and married (21 vs. 40%). Heterogeneity was similar in both groups but slightly higher in RDC and ICD-10 samples than in DSM-IIIR and -IV-samples: +4% regarding demographic and clinical course data and +13% regarding psychometric tests (pooled SD). Secular trends and different designs may have confounded the results and limit generalizability. Some comparisons were underpowered. Differences in diagnostic criteria are reflected in key characteristics of samples. The association of larger heterogeneity with wider diagnostic criteria supports employing standard deviations as a measurement of heterogeneity. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Hot Gas Lines in T Tauri Stars

    NASA Astrophysics Data System (ADS)

    Ardila, David R.; Herczeg, Gregory J.; Gregory, Scott G.; Ingleby, Laura; France, Kevin; Brown, Alexander; Edwards, Suzan; Johns-Krull, Christopher; Linsky, Jeffrey L.; Yang, Hao; Valenti, Jeff A.; Abgrall, Hervé; Alexander, Richard D.; Bergin, Edwin; Bethell, Thomas; Brown, Joanna M.; Calvet, Nuria; Espaillat, Catherine; Hillenbrand, Lynne A.; Hussain, Gaitee; Roueff, Evelyne; Schindhelm, Eric R.; Walter, Frederick M.

    2013-07-01

    For Classical T Tauri Stars (CTTSs), the resonance doublets of N V, Si IV, and C IV, as well as the He II 1640 Å line, trace hot gas flows and act as diagnostics of the accretion process. In this paper we assemble a large high-resolution, high-sensitivity data set of these lines in CTTSs and Weak T Tauri Stars (WTTSs). The sample comprises 35 stars: 1 Herbig Ae star, 28 CTTSs, and 6 WTTSs. We find that the C IV, Si IV, and N V lines in CTTSs all have similar shapes. We decompose the C IV and He II lines into broad and narrow Gaussian components (BC and NC). The most common (50%) C IV line morphology in CTTSs is that of a low-velocity NC together with a redshifted BC. For CTTSs, a strong BC is the result of the accretion process. The contribution fraction of the NC to the C IV line flux in CTTSs increases with accretion rate, from ~20% to up to ~80%. The velocity centroids of the BCs and NCs are such that V BC >~ 4 V NC, consistent with the predictions of the accretion shock model, in at most 12 out of 22 CTTSs. We do not find evidence of the post-shock becoming buried in the stellar photosphere due to the pressure of the accretion flow. The He II CTTSs lines are generally symmetric and narrow, with FWHM and redshifts comparable to those of WTTSs. They are less redshifted than the CTTSs C IV lines, by ~10 km s-1. The amount of flux in the BC of the He II line is small compared to that of the C IV line, and we show that this is consistent with models of the pre-shock column emission. Overall, the observations are consistent with the presence of multiple accretion columns with different densities or with accretion models that predict a slow-moving, low-density region in the periphery of the accretion column. For HN Tau A and RW Aur A, most of the C IV line is blueshifted suggesting that the C IV emission is produced by shocks within outflow jets. In our sample, the Herbig Ae star DX Cha is the only object for which we find a P-Cygni profile in the C IV line, which argues for the presence of a hot (105 K) wind. For the overall sample, the Si IV and N V line luminosities are correlated with the C IV line luminosities, although the relationship between Si IV and C IV shows large scatter about a linear relationship and suggests that TW Hya, V4046 Sgr, AA Tau, DF Tau, GM Aur, and V1190 Sco are silicon-poor, while CV Cha, DX Cha, RU Lup, and RW Aur may be silicon-rich.

  5. Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities

    PubMed Central

    2011-01-01

    Background Homeless people have high dropout rates when they participate in therapeutic processes. The causes of this failure are not always known. This study investigates whether dropping-out is mediated by personality disorders or whether psychosocial problems are more important. Method Eighty-nine homeless people in a socio-laboral integration process were assessed. An initial interview was used, and the MCMI II questionnaire was applied to investigate the presence of psychosocial disorders (DSM-IV-TR axis IV). This was designed as an ex post-facto prospective study. Results Personality disorders were very frequent among the homeless people examined. Moreover, the high index of psychosocial problems (axis IV) in this population supported the proposal that axis IV disorders are influential in failure to complete therapy. Conclusion The outcomes of the study show that the homeless people examined presented with more psychopathological symptoms, in both axis II and axis IV, than the general population. This supports the need to take into account the comorbidity between these two types of disorder among homeless people, in treatment and in the development of specific intervention programs. In conclusion, the need for more psychosocial treatments addressing the individual problems of homeless people is supported. PMID:22151623

  6. [Intravenous ferric carboxymaltose-associated hypophosphatemia in patients with iron deficiency anemia. A common side effect].

    PubMed

    Sánchez González, Rebeca; Ternavasio-de la Vega, Hugo Guillermo; Moralejo Alonso, Leticia; Inés Revuelta, Sandra; Fuertes Martín, Aurelio

    2015-08-07

    To determine the frequency, severity, time of onset and factors associated with the development of hypophosphatemia (HF) in patients with iron deficiency anemia treated with intravenous ferric carboxymatose (ivFCM). Retrospective cohort study in patients iron deficiency anemia who received ivFCM and had an a prior and subsequent determination of serum phosphate. We carried out a comparative analysis between baseline and post-ivFCM levels of serum phosphate. In order to identify variables independently associated with HF a logistic regression analysis was also performed. One hundred twenty-five patients were included. HF frequency was 58%. The median time to onset of HF was 18 days. Age, baseline ferritin levels and baseline phosphate levels were independently associated with the development of HF. The risk of HF in patients with baseline phosphate levels ≤ 3.1mg/dl was 67% higher than patients with ≥ 3.7 mg/dl. ivFCM-associated HF is a frequent, early and, sometimes, prolonged effect in patients with iron deficiency anemia. Serum phosphate levels should be monitored after ivFCM administration, especially in older patients and in those with lower baseline phosphate or ferritin levels. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  7. Structure of the endonuclease IV homologue from Thermotoga maritima in the presence of active-site divalent metal ions

    PubMed Central

    Tomanicek, Stephen J.; Hughes, Ronny C.; Ng, Joseph D.; Coates, Leighton

    2010-01-01

    The most frequent lesion in DNA is at apurinic/apyrimidinic (AP) sites resulting from DNA-base losses. These AP-site lesions can stall DNA replication and lead to genome instability if left unrepaired. The AP endonucleases are an important class of enzymes that are involved in the repair of AP-site intermediates during damage-general DNA base-excision repair pathways. These enzymes hydrolytically cleave the 5′-phosphodiester bond at an AP site to generate a free 3′-­hydroxyl group and a 5′-terminal sugar phosphate using their AP nuclease activity. Specifically, Thermotoga maritima endonuclease IV is a member of the second conserved AP endonuclease family that includes Escherichia coli endonuclease IV, which is the archetype of the AP endonuclease superfamily. In order to more fully characterize the AP endonuclease family of enzymes, two X-­ray crystal structures of the T. maritima endonuclease IV homologue were determined in the presence of divalent metal ions bound in the active-site region. These structures of the T. maritima endonuclease IV homologue further revealed the use of the TIM-barrel fold and the trinuclear metal binding site as important highly conserved structural elements that are involved in DNA-binding and AP-site repair processes in the AP endonuclease superfamily. PMID:20823514

  8. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  9. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  10. Lowered serum dipeptidyl peptidase IV activity is associated with depressive symptoms and cytokine production in cancer patients receiving interleukin-2-based immunotherapy.

    PubMed

    Maes, M; Capuron, L; Ravaud, A; Gualde, N; Bosmans, E; Egyed, B; Dantzer, R; Neveu, P J

    2001-02-01

    There is some evidence that treatment with interleukin-2 (IL-2) and interferon-alpha (IFNalpha) frequently induces depressive symptoms and activation of the inflammatory response system (IRS). There is evidence that major depression is accompanied by lowered serum activity of dipeptidyl peptidase IV (DPP IV; EC 3.4.14.5), a membrane-bound serine protease which catalyses the cleavage of some cytokines and neuro-active peptides and which modulates T cell activation and the production of cytokines, such as IL-2. This study was carried out to examine the effects of immunochemotherapy with IL-2 and IFNalpha, alone and together, in cancer patients on serum DPP IV activity in relation to changes in depressive symptoms and the IRS. The Montgomery and Asberg Rating Scale (MADRS), serum DPP IV activity, and the serum IL-6, and IL-2 receptor (IL-2R) concentrations were measured in 26 patients with metastatic cancers before and three and five days after treatment with IL-2 and IFNalpha, alone or together. Treatment with IL-2 with or without IFNalpha significantly suppressed serum DPP IV activity. The MADRS scores were significantly elevated by treatment with IL-2 with or without IFNalpha, but not IFNalpha alone. The immunochemotherapy-induced decreases in serum DPP IV were significantly and inversely correlated with the increases in the MADRS. Treatment with IL-2 alone or combined with IFNalpha also elevated serum IL-6 and IL-2R. There were significant and inverse correlations between the immuchemotherapy-induced decreases in serum DPP IV and the elevations in serum IL-6 or IL-2R. In conclusion, treatment with IL-2/IFNalpha decreases serum DPP IV activity within 3-5 days and the immunochemotherapy-induced decreases in serum DPP IV activity are significantly and inversely related to treatment-induced increases in severity of depression and signs of activation of the IRS.

  11. Prophylactic treatment of local reactions to i.v. vinorelbine: a randomized study.

    PubMed

    Quant, Eva; Bergman, Bengt

    2012-08-01

    Local reactions on the site of infusion are common with i.v. vinorelbine treatment. The study aims were to evaluate whether an i.v. saline infusion or steroid injection, or the combination of these measures, could decrease vinorelbine-related local reactions and to study to what extent such reactions actually occur. Patients with lung cancer and planned chemotherapy containing i.v. vinorelbine were randomized in a 2 × 2 factorial design to receive either 4 mg betamethasone or placebo i.v. prior to and either 20 or 250 ml saline infusion following the vinorelbine infusion. Local infusion site signs and symptoms were recorded during and 1 h after the vinorelbine infusion and collected by a study-specific diary 24-48 h following each treatment course. A total of 79 patients were randomized and evaluable. Local infusion site signs, symptoms and reactions occurred in 63% of all patients (49% during vinorelbine monotherapy courses), with local pain being most frequently reported. Pre-treatment with i.v. betamethasone was associated with a reduced risk of local pain (5/38 vs. 20/39; p < 0.001) or any symptoms (14/38 vs. 29/39; p = 0.01) compared with placebo during the 48 h following the vinorelbine infusion. The reduced pain effect was seen both during vinorelbine monotherapy courses and during combination chemotherapy with carboplatin. In contrast, there was no difference between post-treatment infusion with 20 or 250 ml saline with regard to local signs or symptoms. Local infusion site side effects are common with i.v. vinorelbine. Pre-treatment with 4 mg betamethasone i.v. is associated with a reduced risk of local symptoms or reactions, local pain in particular.

  12. A Pilot Chemical and Physical Stability Study of Extemporaneously Compounded Levetiracetam Intravenous Solution.

    PubMed

    Raphael, Chenzira D; Zhao, Fang; Hughes, Susan E; Juba, Katherine M

    2015-01-01

    Levetiracetam is a commonly used antiepileptic medication for tumor-related epilepsy. However, the 100 mL intravenous (IV) infusion volume can be burdensome to imminently dying hospice patients. A reduced infusion volume would improve patient tolerability. The purpose of this study was to evaluate the stability of 1000 mg/25 mL (40 mg/mL) levetiracetam IV solution in sodium chloride 0.9%. We prepared levetiracetam 40 mg/mL IV solution and added it to polyvinyl chloride (PVC) bags, polyolefin bags, and polypropylene syringes. Triplicate samples of each product were stored at refrigeration (2-8°C) and analyzed on days 0, 1, 4, 7, and 14. Samples were subjected to visual inspection, pH measurement, and stability-indicating high-performance liquid chromatography (HPLC) analysis. Over the 2-week storage period, there was no significant change in visual appearance or pH for any of the stability samples. The HPLC results confirmed that all stability samples retained 94.2-101.3% of initial drug concentration and no degradation products or leachable material from the packaging materials were observed. We conclude that levetiracetam 1000 mg/25 mL IV solution in sodium chloride 0.9% is physically and chemically stable for up to 14 days under refrigeration in polypropylene syringes, PVC bags, and polyolefin bags.

  13. Evaluation of the proposed social anxiety disorder specifier change for DSM-5 in a treatment-seeking sample of anxious youth.

    PubMed

    Kerns, Caroline E; Comer, Jonathan S; Pincus, Donna B; Hofmann, Stefan G

    2013-08-01

    The current proposal for the DSM-5 definition of social anxiety disorder (SAD) is to replace the DSM-IV generalized subtype specifier with one that specifies fears in performance situations only. Relevant evaluations to support this change in youth samples are sparse. The present study examined rates and correlates of the DSM-IV and proposed DSM-5 specifiers in a sample of treatment-seeking children and adolescents with SAD (N = 204). When applying DSM-IV subtypes, 64.2% of the sample was classified as having a generalized subtype of SAD, with the remaining 35.2% classifying as having a nongeneralized subtype SAD. Youth with generalized SAD, relative to those with nongeneralized SAD, were older, had more clinically severe SAD, showed greater depressive symptoms, and were more likely to have a comorbid depressive disorder. No children in the current sample endorsed discrete fear in performance situations only in the absence of fear in other social situations. The present findings call into question the meaningfulness of the proposed changes in treatment-seeking youth with SAD. © 2013 Wiley Periodicals, Inc.

  14. A fast-track anaemia clinic in the Emergency Department: feasibility and efficacy of intravenous iron administration for treating sub-acute iron deficiency anaemia

    PubMed Central

    Quintana-Díaz, Manuel; Fabra-Cadenas, Sara; Gómez-Ramírez, Susana; Martínez-Virto, Ana; García-Erce, José A.; Muñoz, Manuel

    2016-01-01

    Background Clinically significant anaemia, requiring red blood cell transfusions, is frequently observed in Emergency Departments (ED). To optimise blood product use, we developed a clinical protocol for the management of iron-deficiency anaemia in a fast-track anaemia clinic within the ED. Materials and methods From November 2010 to January 2014, patients presenting with sub-acute, moderate-to-severe anaemia (haemoglobin [Hb] <11 g/dL) and confirmed or suspected iron deficiency were referred to the fast-track anaemia clinic. Those with absolute or functional iron deficiency were given intravenous (IV) ferric carboxymaltose 500–1,000 mg/week and were reassessed 4 weeks after receiving the total iron dose. The primary study outcome was the haematological response (Hb≥12 g/dL and/or Hb increment ≥2 g/dL). Changes in blood and iron parameters, transfusion rates and IV iron-related adverse drug effects were secondary outcomes. Results Two hundred and two anaemic patients with iron deficiency (150 women/52 men; mean age, 64 years) were managed in the fast-track anaemia clinic, and received a median IV iron dose of 1,500 mg (1,000–2,000 mg). Gastro-intestinal (44%) or gynaecological (26%) bleeding was the most frequent cause of the anaemia. At follow-up (183 patients), the mean Hb increment was 3.9±2.2 g/dL; 84% of patients were classified as responders and blood and iron parameters normalised in 90%. During follow-up, 35 (17%) patients needed transfusions (2 [range: 1–3] units per patient) because they had low Hb levels, symptoms of anaemia and/or were at risk. Eight mild and one moderate, self-limited adverse drug effects were witnessed. Discussion Our data support the feasibility of a clinical protocol for management of sub-acute anaemia with IV iron in the ED. IV iron was efficacious, safe and well tolerated. Early management of anaemia will improve the use of blood products in the ED. PMID:26674819

  15. The 12-Month Prevalence of DSM-IV Anxiety Disorders among Nigerian Secondary School Adolescents Aged 13-18 Years

    ERIC Educational Resources Information Center

    Adewuya, Abiodun O.; Ola, Bola A.; Adewumi, Tomi A.

    2007-01-01

    Aims: To estimate the 12-month prevalence of DSM-IV-specific anxiety disorders among Nigerian secondary school adolescents aged 13-18 years. Method: A representative sample of adolescents (n=1090) from senior secondary schools in a semi-urban town in Nigeria was assessed for the 12-month prevalence of DSM-IV-specific anxiety. Results: The 12-month…

  16. A Prospective Study of the Concordance of DSM-IV and DSM-5 Diagnostic Criteria for Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Mazurek, Micah O.; Lu, Frances; Symecko, Heather; Butter, Eric; Bing, Nicole M.; Hundley, Rachel J.; Poulsen, Marie; Kanne, Stephen M.; Macklin, Eric A.; Handen, Benjamin L.

    2017-01-01

    The transition from DSM-IV to DSM-5 criteria for autism spectrum disorder (ASD) sparked considerable concern about the potential implications of these changes. This study was designed to address limitations of prior studies by prospectively examining the concordance of DSM-IV and final DSM-5 criteria on a consecutive sample of 439 children…

  17. Simultaneous Detection of Antibodies against Apx Toxins ApxI, ApxII, ApxIII, and ApxIV in Pigs with Known and Unknown Actinobacillus pleuropneumoniae Exposure Using a Multiplexing Liquid Array Platform

    PubMed Central

    Giménez-Lirola, Luis G.; Jiang, Yong-Hou; Sun, Dong; Hoang, Hai; Yoon, Kyoung-Jin; Halbur, Patrick G.

    2014-01-01

    Surveillance for the presence of Actinobacillus pleuropneumoniae infection in a population plays a central role in controlling the disease. In this study, a 4-plex fluorescent microbead-based immunoassay (FMIA), developed for the simultaneous detection of IgG antibodies to repeat-in-toxin (RTX) toxins (ApxI, ApxII, ApxIII, and ApxIV) of A. pleuropneumoniae, was evaluated using (i) blood serum samples from pigs experimentally infected with each of the 15 known A. pleuropneumoniae serovars or with Actinobacillus suis, (ii) blood serum samples from pigs vaccinated with a bacterin containing A. pleuropneumoniae serovar 1, 3, 5, or 7, and (iii) blood serum samples from pigs with an unknown A. pleuropneumoniae exposure status. The results were compared to those obtained in a previous study where a dual-plate complement fixation test (CFT) and three commercially available enzyme-linked immunosorbent assays (ELISAs) were conducted on the same sample set. On samples from experimentally infected pigs, the 4-plex Apx FMIA detected specific seroconversion to Apx toxins as early as 7 days postinfection in a total of 29 pigs inoculated with 14 of the 15 A. pleuropneumoniae serovars. Seroconversion to ApxII and ApxIII was detected by FMIA in pigs inoculated with A. suis. The vaccinated pigs showed poor humoral responses against ApxI, ApxII, ApxIII, and ApxIV. In the field samples, the humoral response to ApxIV and the A. pleuropneumoniae seroprevalence increased with age. This novel FMIA (with a sensitivity of 82.7% and a specificity of 100% for the anti-ApxIV antibody) was found to be more sensitive and accurate than current tests (sensitivities, 9.5 to 56%; specificity, 100%) and is potentially an improved tool for the surveillance of disease and for monitoring vaccination compliance. PMID:24226091

  18. 9 CFR 113.3 - Sampling of biological products.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... bacterial vaccines; (iii) Two samples of Coccidiosis Vaccine; (iv) Eighteen samples of Rabies Vaccine...) Twenty-two single-dose or 14 multiple-dose samples of Rabies Vaccine, Killed Virus; (viii) Sixteen single...

  19. 9 CFR 113.3 - Sampling of biological products.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... bacterial vaccines; (iii) Two samples of Coccidiosis Vaccine; (iv) Eighteen samples of Rabies Vaccine...) Twenty-two single-dose or 14 multiple-dose samples of Rabies Vaccine, Killed Virus; (viii) Sixteen single...

  20. 9 CFR 113.3 - Sampling of biological products.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... bacterial vaccines; (iii) Two samples of Coccidiosis Vaccine; (iv) Eighteen samples of Rabies Vaccine...) Twenty-two single-dose or 14 multiple-dose samples of Rabies Vaccine, Killed Virus; (viii) Sixteen single...

  1. A proposed method to estimate premorbid full scale intelligence quotient (FSIQ) for the Canadian Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) using demographic and combined estimation procedures.

    PubMed

    Schoenberg, Mike R; Lange, Rael T; Saklofske, Donald H

    2007-11-01

    Establishing a comparison standard in neuropsychological assessment is crucial to determining change in function. There is no available method to estimate premorbid intellectual functioning for the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV). The WISC-IV provided normative data for both American and Canadian children aged 6 to 16 years old. This study developed regression algorithms as a proposed method to estimate full-scale intelligence quotient (FSIQ) for the Canadian WISC-IV. Participants were the Canadian WISC-IV standardization sample (n = 1,100). The sample was randomly divided into two groups (development and validation groups). The development group was used to generate regression algorithms; 1 algorithm only included demographics, and 11 combined demographic variables with WISC-IV subtest raw scores. The algorithms accounted for 18% to 70% of the variance in FSIQ (standard error of estimate, SEE = 8.6 to 14.2). Estimated FSIQ significantly correlated with actual FSIQ (r = .30 to .80), and the majority of individual FSIQ estimates were within +/-10 points of actual FSIQ. The demographic-only algorithm was less accurate than algorithms combining demographic variables with subtest raw scores. The current algorithms yielded accurate estimates of current FSIQ for Canadian individuals aged 6-16 years old. The potential application of the algorithms to estimate premorbid FSIQ is reviewed. While promising, clinical validation of the algorithms in a sample of children and/or adolescents with known neurological dysfunction is needed to establish these algorithms as a premorbid estimation procedure.

  2. Q&A on the For-Profit College "90-10 Rule"

    ERIC Educational Resources Information Center

    Project on Student Debt, 2015

    2015-01-01

    An update to the 2012 edition, this brief report provides frequently asked questions regarding the "90-10" rule, a federal law barring for-profit colleges from receiving more than 90% of their revenues from Department of Education Title IV federal student aid, including information on proposals for strengthening it. The 90-10 Rule is…

  3. Blood-injection-injury phobia in older adults.

    PubMed

    Miloyan, Beyon; Eaton, William W

    2016-06-01

    This study aims to (i) estimate the prevalence of blood-injection-injury phobia (BIIP) diagnosed as present at any time during the life prior to the interview, with or without another Specific Phobia diagnosed as present during the 12 months prior to the interview, (ii) characterize types and frequencies of co-occurring fears, (iii) evaluate the association with chronic medical conditions and lifetime psychiatric comorbidity, and (iv) explore medical service use associations in a nationally representative sample of older adults. A sample of 8,205 older adults, aged 65 years or older, was derived from Wave 1 of the National Epidemiological Survey on Alcohol and Related Conditions (NESARC). The weighted lifetime prevalence of BIIP with and without 12-month Specific Phobia was 0.6% (95% CI: 0.4-0.8) and 4.2% (95% CI: 3.7-4.8), respectively, and these two groups ranked similarly in terms of sociodemographic, health, and psychiatric characteristics. BIIP most frequently co-occurred with other lifetime fears, and was positively associated with hypertension and lifetime history of anxiety and personality disorders after controlling for sociodemographic and psychiatric confounders. Our findings suggest that lifetime BIIP may bear mental and physical health significance in older adults.

  4. [Clinical significance of suicidal behaviour in delusional disorder: a 44 case-series descriptive study].

    PubMed

    González-Rodríguez, Alexandre; Molina-Andreu, Oriol; Penadés Rubio, Rafael; Catalán Campos, Rosa; Bernardo Arroyo, Miguel

    2014-04-07

    Suicidal behaviour in delusional disorder (DD) has been poorly studied. This study aimed to describe the prevalence of clinically significant depression, suicidal ideation and behaviour in these patients, and to relate them with psychotic or depressive symptoms. A cross-sectional study including 44 outpatients with DD (DSM-IV-TR) was conducted. Demographic and clinical data, as well as scores in clinical assessment scales: Positive and Negative Syndrome Scale (PANSS), Personal and Social Performance Scale, Hamilton Depression Rating Scale (17-item version) and Columbia Suicide Severity Rating Scale, were recorded. The sample was divided into 2 groups according to presence or absence of comorbid depression (CD). Fifteen patients (34.1%) had CD, 14 (31.8%) suicidal ideation and 7 (15.9%) suicidal behaviour in the previous 2 years. Patients with CD had an earlier age at onset and for a first psychiatric appointment, and had higher scores on the PANSS general subscale (p=0,043) and in intensity of suicidal ideation (p=0,001). In our sample, patients with DD and CD have more frequently suicidal ideation and behaviour than those without CD. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  5. [Dissociative symptoms in patients with mood and anxiety disorders].

    PubMed

    Moscariello, Marianna Margherita; Ratti, Flavia; Quartini, Adele; Forcén, Fernando Espí; Munuera, Joaquin Nieto; Bersani, Giuseppe

    2010-01-01

    The objective of this study was to evaluate the occurrence of dissociative symptoms in outpatients affected by mood or anxiety disorder and their potential implication in general psychopathology and treatment response. The sample was recruited at Italian and Spanish psychiatric outpatient services. The sample consisted in 40 (13 Male, 27 Female) outpatients, 22 Italians (55%) and 18 Spanish (45%). Inclusion criteria were the Axis I diagnosis of any DSM-IV-TR mood or anxiety disorder and Clinical Global Impression/Global Severity Index (CGI) baseline scores > or = 3 and Hamilton Depression Rating Scale (HAM-D) and Hamilton Anxiety Scale (HAM-A) baseline scores > or = 18. General psychopathology, dissociative symptoms and personality traits were respectively assessed by the self-report symptom inventory Symptom Check-List 90 (SCL-90), the Dissociative Experience Scale (DES) and the Cloninger's Temperament and Character Inventory (TCI). Dissociative symptoms emerged as relatively frequent in mood and anxiety disorders. Globally, depression symptoms seem to correlate positively with the dissociative experiences and the severity of global psychopathology. Dissociative symptoms seem to correlate positively with some personality traits and the severity of global psychopathology and should receive further investigation in clinical practice, as might be a predictor of poor response to conventional drug treatment.

  6. An evaluation of ICD-11 posttraumatic stress disorder criteria in two samples of adolescents and young adults exposed to mass shootings: factor analysis and comparisons to ICD-10 and DSM-IV.

    PubMed

    Haravuori, Henna; Kiviruusu, Olli; Suomalainen, Laura; Marttunen, Mauri

    2016-05-12

    The proposed posttraumatic stress disorder (PTSD) criteria for the International Classification of Diseases (ICD) 11th revision are simpler than the criteria in ICD-10, DSM-IV or DSM-5. The aim of this study was to evaluate the ICD-11 PTSD factor structure in samples of young people, and to compare PTSD prevalence rates and diagnostic agreement between the different diagnostic systems. Possible differences in clinical characteristics of the PTSD cases identified by ICD-11, ICD-10 and DSM-IV are explored. Two samples of adolescents and young adults were followed after exposure to similar mass shooting incidents in their schools. Semi-structured diagnostic interviews were performed to assess psychiatric diagnoses and PTSD symptom scores (N = 228, mean age 17.6 years). PTSD symptom item scores were used to compose diagnoses according to the different classification systems. Confirmatory factor analyses indicated that the proposed ICD-11 PTSD symptoms represented two rather than three factors; re-experiencing and avoidance symptoms comprised one factor and hyperarousal symptoms the other factor. In the studied samples, the three-factor ICD-11 criteria identified 51 (22.4%) PTSD cases, the two-factor ICD-11 identified 56 (24.6%) cases and the DSM-IV identified 43 (18.9%) cases, while the number of cases identified by ICD-10 was larger, being 85 (37.3%) cases. Diagnostic agreement of the ICD-11 PTSD criteria with ICD-10 and DSM-IV was moderate, yet the diagnostic agreement turned to be good when an impairment criterion was imposed on ICD-10. Compared to ICD-11, ICD-10 identified cases with less severe trauma exposure and posttraumatic symptoms and DSM-IV identified cases with less severe trauma exposure. The findings suggest that the two-factor model of ICD-11 PTSD is preferable to the three-factor model. The proposed ICD-11 criteria are more restrictive compared to the ICD-10 criteria. There were some differences in the clinical characteristics of the PTSD cases identified by ICD-11, when compared to ICD-10 and DSM-IV.

  7. Tubing misconnections: normalization of deviance.

    PubMed

    Simmons, Debora; Symes, Lene; Guenter, Peggi; Graves, Krisanne

    2011-06-01

    Accidental connection of an enteral system to an intravenous (IV) system frequently results in the death of the patient. Misconnections are commonly attributed to the presence of universal connectors found in the majority of patient care tubing systems. Universal connectors allow for tubing misconnections between physiologically incompatible systems. The purpose of this review of case studies of tubing misconnections and of current expert recommendations for safe tubing connections was to answer the following questions: In tubing connections that have the potential for misconnections between enteral and IV tubing, what are the threats to safety? What are patient outcomes following misconnections between enteral and IV tubing? What are the current recommendations for preventing misconnections between enteral and IV tubing? Following an extensive literature search and guided by 2 models of threats and errors, the authors analyzed case studies and expert opinions to identify technical, organizational, and human errors; patient-related threats; patient outcomes; and recommendations. A total of 116 case studies were found in 34 publications. Each involved misconnections of tubes carrying feedings, intended for enteral routes, to IV lines. Overwhelmingly, the recommendations were for redesign to eliminate universal connectors and prevent misconnections. Other recommendations were made, but the analysis indicates they would not prevent all misconnections. This review of the published case studies and current expert recommendations supports a redesign of connectors to ensure incompatibility between enteral and IV systems. Despite the cumulative evidence, little progress has been made to safeguard patients from tubing misconnections.

  8. Bowel perforation in type IV vascular Ehlers-Danlos syndrome. A systematic review.

    PubMed

    El Masri, H; Loong, T-H; Meurette, G; Podevin, J; Zinzindohoue, F; Lehur, P-A

    2018-05-01

    Spontaneous gastrointestinal (GI) perforation is a well-known complication occurring in patients suffering from Type IV vascular Ehlers-Danlos syndrome (EDS IV). The aim of the present study was to review the current literature on spontaneous GI perforation in EDS IV and illustrate the surgical management and outcome when possible. A systematic review of all the published data on EDS IV patients with spontaneous GI perforation between January 2000 and December 2015 was conducted using three major databases PUBMED, EMBASE, and Cochrane Central Register of Controlled Trails. References of the selected articles were screened to avoid missing main articles. Twenty-seven published case reports and four retrospective studies, including 31 and 527 cases, respectively, matched the search criteria. A case from our institution was added. Mean age was 26 years (range 6-64 years). The most frequent site of perforation was the colon, particularly the sigmoid, followed by small bowel, upper rectum, and finally stomach. The majority of cases were initially managed with Hartmann's procedure. In recurrent perforations, total colectomy was performed. The reperforation rate was considerably higher in the "partial colectomy with anastomosis" group than in the Hartmann group. Colonic perforation is the most common spontaneous GI perforation in EDS IV patients. An unexpected fragility of the tissues should raise the possibility of a connective tissue disorder and prompt further investigation with eventual management of these high-risk patients with a multidisciplinary team approach in dedicated centres. In the emergency setting, a Hartmann procedure should be performed.

  9. Application of F⁺RNA Coliphages as Source Tracking Enteric Viruses on Parsley and Leek Using RT-PCR.

    PubMed

    Shahrampour, Dina; Yavarmanesh, Masoud; Najafi, Mohammad Bagher Habibi; Mohebbi, Mohebbat

    2015-12-01

    The objective of this study was to identify sources of fecal contamination in leek and parsley, by using four different F(+)RNA coliphage genogroups (IV, I indicate animal fecal contamination and II, III indicate human fecal contamination). Three different concentrations (10(2), 10(4), 10(6) pfu/ml) of MS2 coliphage were inoculated on the surface of parsley and leek samples for detection of phage recovery efficiency among two methods of elution concentration (PEG-precipitation and Ultracentrifugation) by performing double agar layer (DAL) assay in three replications. Highest recovery of MS2 was observed in PEG method and in 10(6) inoculation concentration. Accordingly, the PEG method was used for washing and isolation of potentially contaminated phages of 30 collected samples (15 samples from the market and 15 samples from the farm). The final solutions of PEG method were tested for the enumeration of plaques by DAL assay. Total RNA was then extracted from recovered phages, and RT-PCR was performed by using four primer sets I, II, III, and IV. Incidence of F(+)RNA coliphages was observed in 12/15 (80 %) and 10/15 (66/6 %) of samples were obtained from farm and market, respectively, using both DAL and RT-PCR test methods. Different genotypes (I, II, and IV) of F(+)RNA coliphages were found in farm samples, while only genotype I was detected in market samples by using the primer sets. Due to the higher frequency of genotype I and IV, the absence of genotype III, and also the low frequency of genotype II, it is concluded that the contamination of vegetable (parsley and leek) in Neyshabour, Iran is most likely originated from animal sources.

  10. Stromal fibroblasts are associated with collagen IV in scar tissues of alkali-burned and lacerated corneas.

    PubMed

    Ishizaki, M; Shimoda, M; Wakamatsu, K; Ogro, T; Yamanaka, N; Kao, C W; Kao, W W

    1997-04-01

    Corneal wound healing frequently leads to the formation of opaque scar tissue. We examined whether stromal fibroblastic cells of injured corneas express collagen IV and contributes to the formation of a basal lamina-like structure. Rabbits were anesthetized, and central corneal alkali burn (8 mm in diameter; 1 M NaOH, 1 min) or laceration (8 mm long) were produced. The injured corneas, which had healed for 1, 7, 21 and 45 days, were subjected to histological and immunohistochemical studies with goat anti-collagen IV antibodies, using light and electron microscopy, and in situ hybridization with an antisense digoxigenin-labeled riboprobe of collagen alpha 1(IV) mRNA. For comparison, twenty-day-old fetal corneas were subjected to immunohistochemical study and transmission electron microscopy (TEM). TEM examinations revealed that the stromal collagenous matrix was organized in orthogonal lamellae during corneal development, whereas that of alkali-burned cornea, which had healed for 3 weeks, was disorganized. The stroma of twenty-day-old fetal cornea was not labeled by the anti-collagen IV antibodies. In contrast, one week after injury, specific collagen IV immunostaining was detected in the injured stroma. As the healing proceeded (21-45 days), the antibodies reacted with fibroblastic cells and the extracellular matrix of scar tissues located in the anterior portion of alkali-burned corneas, as well as the posterior portion of lacerated corneas. The middle portion of the stromal tissues was weakly labeled by the anti-collagen IV antibodies with the exception of the blood vessel wall. Immuno-electron microscopic study showed that collagen IV and fibronectin were closely associated with the fibroblastic cells. In situ hybridization demonstrated that epithelial and endothelial cells and fibroblastic cells in the wounded corneal stroma and retro-corneal membrane expressed alpha 1(IV) mRNA, whereas in normal corneas the expression of alpha 1(IV) mRNA was limited to epithelial and endothelial cells. The enhanced expression of collagen IV by the fibroblastic cells in the stroma of injured corneas is consistent with the notion that they may contribute to the formation of basal lamina-like structures in injured corneas.

  11. Comparative study of Se oxyanions retention on three argillaceous rocks: Upper Toarcian (Tournemire, France), Black Shales (Tournemire, France) and Opalinus Clay (Mont Terri, Switzerland).

    PubMed

    Frasca, B; Savoye, S; Wittebroodt, C; Leupin, O X; Michelot, J-L

    2014-01-01

    A comparative study of selenium oxyanion sorption was carried out by means of batch sorption experiments on three argillaceous rocks that differ in their mineralogical compositions and textural properties. The results show no selenate (Se(VI)) sorption onto the argillaceous rocks after 60 days, but clear sorption of selenite (Se(IV)), the extent being closely related to the initial Se(IV) concentration. At the lowest concentration ([Se(IV)]eq < 10(-8) mol L(-1)), the ranking of rock affinity for Se(IV) is Black Shales > Opalinus Clay (OPA) > Upper Toarcian, with Rd values of 910 ± 70, 600 ± 65 and 470 ± 70 mL g(-1) respectively. The Se(IV) sorption isotherms acquired for the three argillaceous rocks can be reproduced well by means of Langmuir formalism, particularly with a two-site Langmuir model. The comparison of the Se(IV) sorption isotherms obtained for these three rocks led to identification of pyrite associated with natural organic matter (NOM) as one of the main phases involved in selenium retention. While the desorption results suggested a significant Se(IV) reduction in the Upper Toarcian samples, the reversible sorption shown on the Black Shales and OPA samples was correlated with a sulfate increase, symptomatic of surface oxidation of pyrite which could limit the Se(IV) reduction in favor of sorption. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. The Reinforcing and Subjective Effects of Intravenous and Intranasal Buprenorphine in Heroin Users

    PubMed Central

    Jones, Jermaine D.; Madera, Gabriela; Comer, Sandra D.

    2014-01-01

    Abuse of buprenorphine (BUP) by the intravenous (IV) route has been documented in several studies, and reports of intranasal (IN) abuse are increasing. However, no studies have directly compared the effects of BUP when it is administered intranasally and intravenously. The present secondary analysis used data from two separate studies to compare the reinforcing and subjective effects of IV and IN buprenorphine. One study evaluated IV buprenorphine (N=13) and the other evaluated IN buprenorphine (N=12). Participants were maintained on 2 mg sublingual (SL) BUP and tested with each intranasal or intravenous buprenorphine test dose (0 mg, 2 mg, 4 mg, 8 mg, and 16 mg). During morning laboratory sessions, participants received money (US $20) and sample doses of IN or IV BUP, and then completed subjective effects questionnaires. Later that day, they completed a self-administration task to receive 10% portions of the drug and/or money they previously sampled. In general, positive subjective ratings for both IV and IN BUP were significantly greater than placebo, with IV BUP having a greater effect than IN BUP. All active BUP doses (IV and IN) maintained significantly higher progressive ratio breakpoint values than placebo, but breakpoint values for IV BUP were greater than for IN BUP. Buprenorphine is an effective maintenance treatment for opioid dependence, valued for its ability to reduce the positive subjective effects of other opioids. Nevertheless, the present data demonstrate that in participants maintained on a low dose of SL BUP, the medication itself has abuse liability when used intravenously or intranasally. PMID:24793093

  13. Memory assessment and depression: testing for factor structure and measurement invariance of the Wechsler Memory Scale-Fourth Edition across a clinical and matched control sample.

    PubMed

    Pauls, Franz; Petermann, Franz; Lepach, Anja Christina

    2013-01-01

    Between-group comparisons are permissible and meaningfully interpretable only if diagnostic instruments are proved to measure the same latent dimensions across different groups. Addressing this issue, the present study was carried out to provide a rigorous test of measurement invariance. Confirmatory factor analyses were used to determine which model solution could best explain memory performance as measured by the Wechsler Memory Scale-Fourth Edition (WMS-IV) in a clinical depression sample and in healthy controls. Multigroup confirmatory factor analysis was conducted to evaluate the evidence for measurement invariance. A three-factor model solution including the dimensions of auditory memory, visual memory, and visual working memory was identified to best fit the data in both samples, and measurement invariance was partially satisfied. The results supported clinical utility of the WMS-IV--that is, auditory and visual memory performances of patients with depressive disorders are interpretable on the basis of the WMS-IV standardization data. However, possible differences in visual working memory functions between healthy and depressed individuals could restrict comparisons of the WMS-IV working memory index.

  14. Separation, preconcentration and inductively coupled plasma-mass spectrometric (ICP-MS) determination of thorium(IV), titanium(IV), iron(III), lead(II) and chromium(III) on 2-nitroso-1-naphthol impregnated MCI GEL CHP20P resin.

    PubMed

    Aydin, Funda Armagan; Soylak, Mustafa

    2010-01-15

    A simple and effective method is presented for the separation and preconcentration of Th(IV), Ti(IV), Fe(III), Pb(II) and Cr(III) by solid phase extraction on 2-nitroso-1-naphthol impregnated MCI GEL CHP20P resin prior to their inductively coupled plasma-mass spectrometric determinations. The influence of analytical parameters including pH of the aqueous solution, flow rates of sample and eluent solutions and sample volume on the quantitative recoveries of analyte ions was investigated. Matrix effects caused by the presence of alkali, earth alkali and some metal ions in the analyzed solutions were investigated. The presented solid phase extraction method was applied to BCR-144R Sewage Sludge (domestic origin), BCR-141R Calcareous Loam Soil, NIST 1568a Rice Flour and NIST 1577b Bovine Liver certified reference materials (CRMs) for the determination of analyte ions and the results were in good agreement with the certified values. The separation procedure presented was also applied to the various natural water samples collected from Turkey with satisfactory results.

  15. Black Hole Mass Estimates and Emission-line Properties of a Sample of Redshift z > 6.5 Quasars

    NASA Astrophysics Data System (ADS)

    De Rosa, Gisella; Venemans, Bram P.; Decarli, Roberto; Gennaro, Mario; Simcoe, Robert A.; Dietrich, Matthias; Peterson, Bradley M.; Walter, Fabian; Frank, Stephan; McMahon, Richard G.; Hewett, Paul C.; Mortlock, Daniel J.; Simpson, Chris

    2014-08-01

    We present the analysis of optical and near-infrared spectra of the only four z > 6.5 quasars known to date, discovered in the UKIDSS-LAS and VISTA-VIKING surveys. Our data set consists of new Very Large Telescope/X-Shooter and Magellan/FIRE observations. These are the best optical/NIR spectroscopic data that are likely to be obtained for the z > 6.5 sample using current 6-10 m facilities. We estimate the black hole (BH) mass, the Eddington ratio, and the Si IV/C IV, C III]/C IV, and Fe II/Mg II emission-line flux ratios. We perform spectral modeling using a procedure that allows us to derive a probability distribution for the continuum components and to obtain the quasar properties weighted upon the underlying distribution of continuum models. The z > 6.5 quasars show the same emission properties as their counterparts at lower redshifts. The z > 6.5 quasars host BHs with masses of ~109 M ⊙ that are accreting close to the Eddington luminosity (langlog(L Bol/L Edd)rang = -0.4 ± 0.2), in agreement with what has been observed for a sample of 4.0 < z < 6.5 quasars. By comparing the Si IV/C IV and C III]/C IV flux ratios with the results obtained from luminosity-matched samples at z ~ 6 and 2 <= z <= 4.5, we find no evidence of evolution of the line ratios with cosmic time. We compare the measured Fe II/Mg II flux ratios with those obtained for a sample of 4.0 < z < 6.4 sources. The two samples are analyzed using a consistent procedure. There is no evidence that the Fe II/Mg II flux ratio evolves between z = 7 and z = 4. Under the assumption that the Fe II/Mg II traces the Fe/Mg abundance ratio, this implies the presence of major episodes of chemical enrichment in the quasar hosts in the first ~0.8 Gyr after the Big Bang. Based on observations collected at the European Southern Observatory, Chile, programs 286.A-5025, 087.A-0890, and 088.A-0897. This paper also includes data gathered with the 6.5 m Magellan Telescope located at Las Campanas Observatory, Chile.

  16. Stage IV-S neuroblastoma. Results with definitive therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stokes, S.H.; Thomas, P.R.; Perez, C.A.

    1984-05-15

    The results of management of 14 patients with Stage IV-S neuroblastoma are reported. The treatment policy, although not consistent over this time span, in general used a combination of radiotherapy and chemotherapy or infrequently one modality alone. Twelve of 14 (86%) survived more than 6 years. One patient, with a solitary mediastinal primary tumor, died of rapidly progressive disease at three months. The other death occurred in a 4.5-year-old presenting with hepatomegaly at diagnosis followed by skeletal dissemination 2.5 years later. Thirteen of the patients were younger than 1 year of age. Of the 11 patients that received radiotherapy, 4more » experienced mild asymptomatic scoliosis or kyphoscoliosis at 3 to 12 years after initial therapy. A review of the literature indicates that spontaneous regression in this tumor is very frequent; therefore, it is recommended that for the common presentation of massive hepatomegaly in an infant, close observation is warranted, unless life threatening complications occur. However, initial therapeutic intervention may be indicated in those patients with life threatening presentations. This data did not substantiate the necessity for complete surgical excision of the primary tumor, as has been suggested by others.« less

  17. Treatment of mild to moderate dehydration in children with oral rehydration therapy.

    PubMed

    Diggins, Kristene C

    2008-08-01

    To review current literature on the effectiveness of oral rehydration therapy (ORT) in the treatment of mild to moderate dehydration in children. Recommendations from American Academy of Pediatrics (AAP), World Health Organization (WHO), selected research articles (2000-2006), and Internet sources. Dehydration is a common diagnosis in pediatric primary care. The literature indicates that dehydration is more often treated with intravenous (IV) therapy when ORT would be equally effective. ORT is an effective treatment for children with mild to moderate dehydration. ORT could be used more frequently rather than IV rehydration therapy. The use of ORT versus traditional methods of IV hydration matches the nursing philosophy of holistic care by enhancing client comfort and autonomy. Current practice in the treatment of mild to moderate dehydration in children does not match both AAP and WHO guidelines, which are based on evidence supporting ORT effectiveness. Treatment with ORT allows children more flexibility to be treated at home and thus decreases hospital stay. Evidence shows that the time required to initiate ORT is actually quicker than IV therapy and allows for a less stressful therapy that can be performed in the home.

  18. Estimation of maximal cortisol secretion rate in healthy humans.

    PubMed

    Dorin, Richard I; Qiao, Zhi; Qualls, Clifford R; Urban, Frank K

    2012-04-01

    Cortisol secretion is related to ACTH concentration by a sigmoidal dose-response curve, in which high ACTH concentrations drive maximal cortisol secretion rates (CSR(max)). We sought to estimate CSR(max) and free cortisol half-life in healthy humans (n = 21) using numerical methods applied to data acquired during cosyntropin (250 μg) stimulation. We also evaluated the effect of overnight dexamethasone (DEX; 1 mg) vs. placebo on estimates of CSR(max) and free cortisol half-life. This study was a double-blind, placebo-controlled, randomized order of overnight DEX vs. placebo, cosyntropin (250 μg) stimulation with frequent serum cortisol sampling and computer-assisted numerical analysis. The study was conducted at a single academic medical center. Twenty-one healthy adult subjects (15 females and six males), mean aged 46 yr, participated in the study. Intervention in the study included DEX vs. placebo pretreatment, cosyntropin (250 μg) iv with frequent cortisol sampling. CSR(max) and free cortisol half-life estimates, R² for goodness of fit, were measured. Mean ± sd CSR(max) was 0.44 ± 0.13 nm/second, with free cortisol half-life of 2.2 ± 1.1 min. DEX did not significantly affect estimates of CSR(max) or free cortisol half-life. Our model accounts for most of the variability of measured cortisol concentrations (overall R² = 90.9 ±11.0%) and was more accurate (P = 0.004) during DEX suppression (R² = 94.6 ± 4.6%) compared with placebo (R² = 87.2 ± 8.7%). Application of a mass-action model under conditions of cosyntropin stimulation provides a relatively simple method for estimation CSR(max) that accurately predicts measured cortisol concentrations. DEX administration did not significantly affect estimates of CSR(max) or free cortisol half-life.

  19. Estimation of Maximal Cortisol Secretion Rate in Healthy Humans

    PubMed Central

    Qiao, Zhi; Qualls, Clifford R.; Urban, Frank K.

    2012-01-01

    Context: Cortisol secretion is related to ACTH concentration by a sigmoidal dose-response curve, in which high ACTH concentrations drive maximal cortisol secretion rates (CSRmax). Objective: We sought to estimate CSRmax and free cortisol half-life in healthy humans (n = 21) using numerical methods applied to data acquired during cosyntropin (250 μg) stimulation. We also evaluated the effect of overnight dexamethasone (DEX; 1 mg) vs. placebo on estimates of CSRmax and free cortisol half-life. Design: This study was a double-blind, placebo-controlled, randomized order of overnight DEX vs. placebo, cosyntropin (250 μg) stimulation with frequent serum cortisol sampling and computer-assisted numerical analysis. Setting: The study was conducted at a single academic medical center. Participants: Twenty-one healthy adult subjects (15 females and six males), mean aged 46 yr, participated in the study. Intervention: Intervention in the study included DEX vs. placebo pretreatment, cosyntropin (250 μg) iv with frequent cortisol sampling. Main Outcome Measures: CSRmax and free cortisol half-life estimates, R2 for goodness of fit, were measured. Results: Mean ± sd CSRmax was 0.44 ± 0.13 nm/second, with free cortisol half-life of 2.2 ± 1.1 min. DEX did not significantly affect estimates of CSRmax or free cortisol half-life. Our model accounts for most of the variability of measured cortisol concentrations (overall R2 = 90.9 ±11.0%) and was more accurate (P = 0.004) during DEX suppression (R2 = 94.6 ± 4.6%) compared with placebo (R2 = 87.2 ± 8.7%). Conclusions: Application of a mass-action model under conditions of cosyntropin stimulation provides a relatively simple method for estimation CSRmax that accurately predicts measured cortisol concentrations. DEX administration did not significantly affect estimates of CSRmax or free cortisol half-life. PMID:22337905

  20. Mass spectrometric detection of peginesatide in human urine in doping control analysis.

    PubMed

    Möller, Ines; Thomas, Andreas; Delahaut, Philippe; Geyer, Hans; Schänzer, Wilhelm; Thevis, Mario

    2012-11-01

    Erythropoiesis-stimulating agents (ESAs) have frequently been confessed to be illicitly used in elite sports due to their endurance enhancing effects. Recently, peginesatide, the first representative of a new generation of ESAs, referred to as Erythropoietin (EPO)-mimetic peptides, obtained approval in the USA under the trade name Omontys(®) for the treatment of anaemic patients. Lacking sequence homology with EPO, it consists of a pegylated homodimeric peptide of approximately 45 kDa, and thus, specific approaches for the determination of peginesatide in blood were developed as conventional detection assays for EPO do not allow for the analysis of the EPO-mimetic peptides. However, as urine specimens are the most frequently provided doping control samples and pharmacokinetic studies conducted in rats and monkeys revealed the excretion of the pegylated peptide into urine, a detection method for peginesatide in urine would be desirable. A mass spectrometric assay in human urine was developed consisting of protein precipitation with acetonitrile followed by proteolytic digestion after the removal of the acetonitrile fraction under reduced pressure. Purification and concentration of the resulting proteotypic target peptide was accomplished by means of solid-phase extraction on strong cation-exchange resin prior to liquid chromatographic-tandem mass spectrometric analysis. Method validation was performed for qualitative purposes and demonstrated specificity, precision, linearity as well as sufficient sensitivity (limit of detection: 0.5 ng/ml) while proof-of-concept for the applicability of the assay for the determination of peginesatide in authentic urine samples was obtained by analyzing animal in vivo specimens collected after a single i.v. administration of peginesatide over a period of 4 days. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Severe role impairment associated with mental disorders: Results of the WHO World Mental Health Surveys International College Student Project.

    PubMed

    Alonso, Jordi; Mortier, Philippe; Auerbach, Randy P; Bruffaerts, Ronny; Vilagut, Gemma; Cuijpers, Pim; Demyttenaere, Koen; Ebert, David D; Ennis, Edel; Gutiérrez-García, Raul A; Green, Jennifer Greif; Hasking, Penelope; Lochner, Christine; Nock, Matthew K; Pinder-Amaker, Stephanie; Sampson, Nancy A; Zaslavsky, Alan M; Kessler, Ronald C

    2018-05-30

    College entrance is a stressful period with a high prevalence of mental disorders. To assess the role impairment associated with 12-month mental disorders among incoming first-year college students within a large cross-national sample. Web-based self-report surveys assessing the prevalence of DSM-IV mental disorders and health-related role impairment (Sheehan Disability Scale) were obtained and analyzed from 13,984 incoming first-year college students (Response = 45.5%), across 19 universities in eight countries. Impairment was assessed in the following domains: home management, work (e.g., college-related problems), close personal relationships, and social life. Mean age of the sample was 19.3 (SD = 0.59) and 54.4% were female. Findings showed that 20.4% of students reported any severe role impairment (10% of those without a mental disorder vs. 42.9% of those with at least one disorder, P < 0.01). In bivariate analyses, panic disorder, and mania were associated most frequently with severe impairment (60.6% and 57.5%, respectively). Students reporting three or more mental disorders had almost fivefold more frequently severe impairment relative to those without mental disorders. Multiple logistic regression showed that major depression (OR = 4.0; 95%CI = 3.3, 4.8), generalized anxiety (OR = 3.9; 95%CI = 3.1, 4.8), and panic disorder (OR = 2.9; 95%CI 2.4, 4.2) were associated with the highest odds of severe impairment. Only minimal deviations from these overall associations were found across countries. Mental disorders among first-year college students are associated with substantial role impairment. Providing preventative interventions targeting mental disorders and associated impairments is a critical need for institutions to address. © 2018 Wiley Periodicals, Inc.

  2. Energy drink consumption and increased risk for alcohol dependence

    PubMed Central

    Arria, Amelia M.; Caldeira, Kimberly M.; Kasperski, Sarah J.; Vincent, Kathryn B.; Griffiths, Roland R.; O'Grady, Kevin E.

    2010-01-01

    Background Energy drinks are highly caffeinated beverages that are increasingly consumed by young adults. Prior research has established associations between energy drink use and heavier drinking and alcohol-related problems among college students. This study investigated the extent to which energy drink use might pose additional risk for alcohol dependence over and above that from known risk factors. Methods Data were collected via personal interview from 1,097 fourth-year college students sampled from one large public university as part of an ongoing longitudinal study. Alcohol dependence was measured with DSM-IV criteria. Results After adjustment for the sampling design, 51.3%wt of students were classified as “low-frequency” energy drink users (1 to 51 days in the past year) and 10.1%wt as “high-frequency” users (≥52 days). Typical caffeine consumption varied widely depending on the brand consumed. Compared to the low-frequency group, high-frequency users drank alcohol more frequently (141.6 vs. 103.1 days) and in higher quantities (6.15 vs. 4.64 drinks/typical drinking day). High-frequency users were at significantly greater risk for alcohol dependence relative to both non-users (AOR=2.40, 95% CI=1.27-4.56, p=.007) and low-frequency users (AOR=1.86, 95% CI=1.10, 3.14, p=.020), even after holding constant demographics, typical alcohol consumption, fraternity/sorority involvement, depressive symptoms, parental history of alcohol/drug problems, and childhood conduct problems. Low-frequency energy drink users did not differ from non-users on their risk for alcohol dependence. Conclusions Weekly or daily energy drink consumption is strongly associated with alcohol dependence. Further research is warranted to understand the possible mechanisms underlying this association. College students who frequently consume energy drinks represent an important target population for alcohol prevention. PMID:21073486

  3. Effect of microwave disinfection on compressive and tensile strengths of dental stones.

    PubMed

    Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

    2013-01-01

    Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

  4. Collecting and Studying Blood and Tissue Samples From Patients With Locally Recurrent or Metastatic Prostate or Bladder/Urothelial Cancer

    ClinicalTrials.gov

    2017-12-04

    Healthy Control; Localized Urothelial Carcinoma of the Renal Pelvis and Ureter; Metastatic Malignant Neoplasm in the Bone; Metastatic Malignant Neoplasm in the Soft Tissues; Metastatic Urothelial Carcinoma of the Renal Pelvis and Ureter; Recurrent Bladder Carcinoma; Recurrent Prostate Carcinoma; Recurrent Urothelial Carcinoma of the Renal Pelvis and Ureter; Stage IV Bladder Cancer; Stage IV Bladder Urothelial Carcinoma; Stage IV Prostate Cancer

  5. LPA and PLG sequence variation and kringle IV-2 copy number in two populations.

    PubMed

    Crawford, Dana C; Peng, Ze; Cheng, Jan-Fang; Boffelli, Dario; Ahearn, Magdalena; Nguyen, Dan; Shaffer, Tristan; Yi, Qian; Livingston, Robert J; Rieder, Mark J; Nickerson, Deborah A

    2008-01-01

    Lp(a) levels have long been recognized as a potential risk factor for coronary heart disease that is almost completely under genetic control. Much of the genetics impacting Lp(a) levels has been attributed to the highly polymorphic LPA kringle IV-2 copy number variant, and most of the variance in Lp(a) levels in populations of European-descent is inversely correlated with kringle IV copy number. However, less of the variance is explained in African-descent populations for the same structural variation. African-descent populations have, on average, higher levels of Lp(a), suggesting other genetic factors contribute to Lp(a) level variability across populations. To identify potential cis-acting factors, we re-sequenced the gene LPA for single nucleotide polymorphism (SNP) discovery in 23 European-Americans and 24 African-Americans. We also re- sequenced the neighboring gene plasminogen (PLG) and genotyped the kringle IV copy number variant in the same reference samples. These data are the most comprehensive description of sequence variation in LPA and its relationship with the kringle IV copy number variant. With these data, we demonstrate that only a fraction of LPA sequence diversity has been previously documented. Also, we identify several high frequency SNPs present in the African-American sample but absent in the European-American sample. Finally, we show that SNPs within PLG are not in linkage disequilibrium with SNPs in LPA, and we show that kringle IV copy number variation is not in linkage disequilibrium with either LPA or PLG SNPs. Together, these data suggest that LPA SNPs could independently contribute to Lp(a) levels in the general population. Copyright (c) 2008 S. Karger AG, Basel.

  6. Evaluating WAIS-IV structure through a different psychometric lens: structural causal model discovery as an alternative to confirmatory factor analysis.

    PubMed

    van Dijk, Marjolein J A M; Claassen, Tom; Suwartono, Christiany; van der Veld, William M; van der Heijden, Paul T; Hendriks, Marc P H

    Since the publication of the WAIS-IV in the U.S. in 2008, efforts have been made to explore the structural validity by applying factor analysis to various samples. This study aims to achieve a more fine-grained understanding of the structure of the Dutch language version of the WAIS-IV (WAIS-IV-NL) by applying an alternative analysis based on causal modeling in addition to confirmatory factor analysis (CFA). The Bayesian Constraint-based Causal Discovery (BCCD) algorithm learns underlying network structures directly from data and assesses more complex structures than is possible with factor analysis. WAIS-IV-NL profiles of two clinical samples of 202 patients (i.e. patients with temporal lobe epilepsy and a mixed psychiatric outpatient group) were analyzed and contrasted with a matched control group (N = 202) selected from the Dutch standardization sample of the WAIS-IV-NL to investigate internal structure by means of CFA and BCCD. With CFA, the four-factor structure as proposed by Wechsler demonstrates acceptable fit in all three subsamples. However, BCCD revealed three consistent clusters (verbal comprehension, visual processing, and processing speed) in all three subsamples. The combination of Arithmetic and Digit Span as a coherent working memory factor could not be verified, and Matrix Reasoning appeared to be isolated. With BCCD, some discrepancies from the proposed four-factor structure are exemplified. Furthermore, these results fit CHC theory of intelligence more clearly. Consistent clustering patterns indicate these results are robust. The structural causal discovery approach may be helpful in better interpreting existing tests, the development of new tests, and aid in diagnostic instruments.

  7. Laboratory Assessment of Commercially Available Ultrasonic Rangefinders

    DTIC Science & Technology

    2015-11-01

    how the room was designed to prevent sound reflections (a combination of the wedges absorbing the waveforms and not having a flat wall ). When testing... sound booth at 0.5 m. ...................................................................................... 5  iv This page is intentionally...environments for sound measurements using a tape measure. This mapping method can be time- consuming and unreliable as objects frequently move around in

  8. Deficits in Attention to Emotional Stimuli Distinguish Youth with Severe Mood Dysregulation from Youth with Bipolar Disorder

    ERIC Educational Resources Information Center

    Rich, Brendan A.; Brotman, Melissa A.; Dickstein, Daniel P.; Mitchell, Derek G. V.; Blair, R. James R.; Leibenluft, Ellen

    2010-01-01

    Studying attention in the context of emotional stimuli may aid in differentiating pediatric bipolar disorder (BD) from severe mood dysregulation (SMD). SMD is characterized by chronic irritability, arousal, and hyper-reactivity; SMD youth frequently receive a BD diagnosis although they do not meet DSM-IV criteria for BD because they lack manic…

  9. 75 FR 62395 - Calculation of Annual Federal Medical Assistance Percentages for Indian Tribes for Use in the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-08

    ... any time in the future. Indian Tribes not operating their own programs may receive title IV-E funds... through the decennial census ``long form'' will in the future be collected by the Census Bureau using the... frequently than Decennial Census data, leading to more current estimates in the future. The ACS provides...

  10. Non-Lethal Weapons (NLW) Reference Book

    DTIC Science & Technology

    2012-01-01

    Array (DSLA) 7 Navy Anti- Swimmer Grenade 7 CP DEVELOPMENTAL NLW Improved Flash Bang Grenade (IFBG) 8 Airburst Non-Lethal Munitions (ANLM) 8...to take all feasible precautions to avoid the incidence of permanent blindness to unenhanced vision training . Frequently Asked Questions iv v...deliver an electro-muscular disruption charge out to 35 feet to disable resistant individuals. This device enhances force protection and mission

  11. Intestinal volvulus: aetiology, morbidity and mortality in Tunisian children.

    PubMed

    Faouzi, Nouira; Yosra, Ben Ahmed; Said, Jlidi; Soufiane, Ghorbel; Aouatef, Charieg; Rachid, Khemakhem; Beji, Chaouachi

    2011-01-01

    Intestinal volvulus (IV) can occur at various sites of the gastrointestinal tract. In Europe, IV in children is most frequently due to malrotation but in Asia Ascaris infestation is a common cause. This report reviews the experience with IV in children in Tunisia; analyzes the aetiologies as well as the clinical presentations and the benefits of the Ladd's procedure in the treatment of the IV. The authors retrospectively reviewed the case records of all children with IV from January 2000 to December 2009 at the Tunis Children's Hospital. There were 22 boys and nine girls with an age range of one day to four years. Twenty-five (80%) patients presented during the neonatal period. The most common presentation was bilious vomiting and dehydration. The aetiology was identified in all patients: Anomalies in rotation (n=22), omphalo-mesenteric duct (n=3), internal hernia (n=3), cystic lymphangioma (n=2), caocal volvulus (n=1). The bowel resection rate for gangrene was 16%. All patients with malrotation had Ladd's procedure performed. Five patients (19%) developed wound infections. One patient presented with adhesive small bowel obstruction. There were no recurrences following Ladd's procedure for malrotation. Two neonates (6%) died from overwhelming infections. Intestinal volvulus in our environment differs in aetiology from other reports. The resection rates are not similar, however. Early diagnosis reduced the high morbidity and mortality in our study.

  12. The 1-month prevalence of generalized anxiety disorder according to DSM-IV, DSM-V, and ICD-10 among nondemented 75-year-olds in Gothenburg, Sweden.

    PubMed

    Nilsson, Johan; Östling, Svante; Waern, Margda; Karlsson, Björn; Sigström, Robert; Guo, Xinxin; Skoog, Ingmar

    2012-11-01

    To examine the 1-month prevalence of generalized anxiety disorder (GAD) according to Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV), Diagnostic and Statistical Manual of Mental, Fifth Edition (DSM-V), and International Classification of Diseases, Tenth Revision (ICD-10), and the overlap between these criteria, in a population sample of 75-year-olds. We also aimed to examine comorbidity between GAD and other psychiatric diagnoses, such as depression. During 2005-2006, a comprehensive semistructured psychiatric interview was conducted by trained nurses in a representative population sample of 75-year-olds without dementia in Gothenburg, Sweden (N = 777; 299 men and 478 women). All psychiatric diagnoses were made according to DSM-IV. GAD was also diagnosed according to ICD-10 and DSM-V. The 1-month prevalence of GAD was 4.1% (N = 32) according to DSM-IV, 4.5% (N = 35) according to DSM-V, and 3.7% (N = 29) according to ICD-10. Only 46.9% of those with DSM-IV GAD fulfilled ICD-10 criteria, and only 51.7% and 44.8% of those with ICD-10 GAD fulfilled DSM-IV/V criteria. Instead, 84.4% and 74.3% of those with DSM-IV/V GAD and 89.7% of those with ICD-10 GAD had depression. Also other psychiatric diagnoses were common in those with ICD-10 and DSM-IV GAD. Only a small minority with GAD, irrespective of criteria, had no other comorbid psychiatric disorder. ICD-10 GAD was related to an increased mortality rate. While GAD was common in 75-year-olds, DSM-IV/V and ICD-10 captured different individuals. Current definitions of GAD may comprise two different expressions of the disease. There was greater congruence between GAD in either classification system and depression than between DSM-IV/V GAD and ICD-10 GAD, emphasizing the close link between these entities. 2012 American Association for Geriatric Psychiatry

  13. Non-invasive high-intensity focused ultrasound for UV-induced hyperpigmentation in Fitzpatrick skin types III and IV: a prospective, randomized, controlled, evaluator-blinded trial.

    PubMed

    Vachiramon, Vasanop; Jurairattanaporn, Natthachat; Harnchoowong, Sarawin; Chayavichitsilp, Pamela

    2018-02-01

    Skin hyperpigmentation is a frequently encountered problem, particularly in darker skin types. Unfortunately, standard treatments for this condition have shown disappointing results. High-intensity focused ultrasound (HIFU) is commonly indicated for skin laxity, but recently was used to treat UV-induced hyperpigmentation in animal models. This study is aimed to evaluate the efficacy and safety of high-intensity focused ultrasound for UVB-induced hyperpigmentation in human subjects. A randomized, evaluator-blinded pilot study was conducted on 20 subjects. Each subject was induced three hyperpigmentary spots by local broadband UVB. After 2 weeks, each spot was randomly allocated to control, low-energy, and high-energy HIFU. Subjects were instructed to follow up weekly for a duration of 1 month. Lightness index measurements, mean improvement scores, subjects' satisfaction, pain scores, and side effects were evaluated. All 20 subjects completed the study. Fourteen subjects had Fitzpatrick (FPT) skin type III and six subjects had FPT skin type IV. Twelve subjects showed greater improvement at control sites while eight subjects showed greater improvement at HIFU-treated sites. In FPT skin type III, HIFU appeared to be inferior to control in both lightness index and mean improvement scores, but in FPT skin type IV, HIFU had greater lightness index improvement and higher improvement scores than control. Side effects were more frequent in high-energy-treated areas. Focused ultrasound may be offered in some patients with hyperpigmentary conditions. More research is needed to determine proper energy settings for optimal outcome.

  14. Material-specific retroactive interference effects of the Wechsler Adult Intelligence Scale-Fourth Edition on the Wechsler Memory Scale-Fourth Edition in a nonclinical sample.

    PubMed

    Ingram, Nicolette S; Diakoumakos, Jessica V; Sinclair, Erin R; Crowe, Simon F

    2016-01-01

    This study investigated proactive and retroactive interference effects between the Wechsler Memory Scale-Fourth Edition (WMS-IV) using the flexible approach, and the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV). One hundred and eighty nonclinical participants were assigned to a four (visual interference, verbal interference, visual and verbal interference, vs. no interference) by two (retroactive vs. proactive) between-subjects design. The administration order of the tests was counterbalanced (i.e., administration of the WAIS-IV prior to the WMS-IV, and the WAIS-IV administered during the delay interval of the WMS-IV). The WAIS-IV produced significant retroactive interference effects on the WMS-IV; however, no proactive interference effect was observed. The retroactive interference effect was dependent on material specificity. The results indicate that material presented within the delay of the WMS-IV can have a significant effect on subsequent delayed recall. Clinicians should carefully consider the effects associated with carry-over effects of these tests when using them in combination.

  15. Psychiatric comorbidity and plasma levels of 2-acyl-glycerols in outpatient treatment alcohol users. Analysis of gender differences.

    PubMed

    García Marchena, Nuria; Araos, Pedro; Pavón, Francisco Javier; Ponce, Guillermo; Pedraz, María; Serrano, Antonia; Arias, Francisco; Romero-Sanchiz, Pablo; Suárez, Juan; Pastor, Antoni; De la Torre, Rafael; Torrens, Marta; Rubio, Gabriel; Rodríguez de Fonseca, Fernando

    2016-09-29

    Alcohol addiction is associated with high psychiatric comorbidity. Objective stratification of patients is necessary to optimize care and improve prognosis. The present study is designed to gain insights into this challenge by addressing the following objectives: a) to estimate the prevalence of psychiatric comorbidities in a sample of outpatients seeking treatment for alcohol use disorder, b) to describe the existence of gender differences and c) to validate 2-acyl-glycerols as biomarkers of alcohol use disorder and/or psychiatric comorbidity. One hundred and sixty-two patients were recruited and evaluated with the semi-structured interview PRISM. The presence of psychopathology was associated with a greater number of criteria for alcohol abuse and dependence according to DSM-IV-TR. We found gender differences in psychiatric comorbidity, e.g., mood disorder, as well as in comorbid substance use disorders. The prevalence of lifetime psychiatric comorbidity was 68.5%, with mood disorders the most frequent (37%), followed by attention deficit disorder (24.7%) and anxiety disorders (17.9%). Substance-induced disorders were more frequent in mood and psychotic disorders, whereas the primary disorders were more prevalent in patients with comorbid anxiety disorders. We found that 2-acyl-glycerols were significantly decreased in comorbid anxiety disorders in alcohol dependent patients in the last year, which makes them a potential biomarker for this psychopathological condition.

  16. Determination of total selenium in food samples by d-CPE and HG-AFS.

    PubMed

    Wang, Mei; Zhong, Yizhou; Qin, Jinpeng; Zhang, Zehua; Li, Shan; Yang, Bingyi

    2017-07-15

    A dual-cloud point extraction (d-CPE) procedure was developed for the simultaneous preconcentration and determination of trace level Se in food samples by hydride generation-atomic fluorescence spectrometry (HG-AFS). The Se(IV) was complexed with ammonium pyrrolidinedithiocarbamate (APDC) in a Triton X-114 surfactant-rich phase, which was then treated with a mixture of 16% (v/v) HCl and 20% (v/v) H 2 O 2 . This converted the Se(IV)-APDC into free Se(IV), which was back extracted into an aqueous phase at the second cloud point extraction stage. This aqueous phase was analyzed directly by HG-AFS. Optimization of the experimental conditions gave a limit of detection of 0.023μgL -1 with an enhancement factor of 11.8 when 50mL of sample solution was preconcentrated to 3mL. The relative standard deviation was 4.04% (c=6.0μgL -1 , n=10). The proposed method was applied to determine the Se contents in twelve food samples with satisfactory recoveries of 95.6-105.2%. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Energetic particle abundances in solar electron events

    NASA Technical Reports Server (NTRS)

    Reames, D. V.; Cane, H. V.; Von Rosenvinge, T. T.

    1990-01-01

    The results of a comprehensive search of the ISEE 3 energetic particle data for solar electron events with associated increases in elements with atomic number Z = 6 or greater are reported. A sample of 90 such events was obtained. The events support earlier evidence of a bimodal distribution in Fe/O or, more clearly, in Fe/C. Most of the electron events belong to the group that is Fe-rich in comparison with the coronal abundance. The Fe-rich events are frequently also He-3-rich and are associated with type III and type V radio bursts and impulsive solar flares. Fe-poor events are associated with type IV bursts and with interplanetary shocks. With some exceptions, event-to-event enhancements in the heavier elements vary smoothly with Z and with Fe/C. In fact, these variations extend across the full range of events despite inferred differences in acceleration mechanism. The origin of source material in all events appears to be coronal and not photospheric.

  18. Academic performance in ADHD when controlled for comorbid learning disorders, family income, and parental education in Brazil.

    PubMed

    Pastura, Giuseppe Mario Carmine; Mattos, Paulo; Araújo, Alexandra Prufer de Queiroz Campos

    2009-03-01

    Scholastic achievement in a nonclinical sample of ADHD children and adolescents was evaluated taking into consideration variables such as comorbid learning disorders, family income, and parental education which may also be associated with poor academic performance. After screening for ADHD in 396 students, the authors compared academic performance of 26 ADHD individuals and 31 controls paired for gender, age, and intelligence level considering both mathematics and Portuguese language scores. Learning disorders were investigated and the Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV ) criteria were met using structured interviews. The prevalence of academic underachievement was 2.98 times higher in students with ADHD, the most frequent subtype being predominantly inattentive. Parental educational level, family income, and comorbid learning disorders could not explain the discrepancies between ADHD students and controls. ADHD seems to be associated with poor academic performance even in the absence of comorbid learning disorders, lower family income, and parental educational level.

  19. A time-lagged momentary assessment study on daily life physical activity and affect.

    PubMed

    Wichers, Marieke; Peeters, Frenk; Rutten, Bart P F; Jacobs, Nele; Derom, Catherine; Thiery, Evert; Delespaul, Philippe; van Os, Jim

    2012-03-01

    Novel study designs using within-subject methodology and frequent and prospective measurements are required to unravel direction of causality and dynamic processes of behavior over time. The current study examined the effects of physical activity on affective state. A primary and within-study replication sample was derived from twin pairs. Female twins (n = 504) participated in an experience sampling method study at baseline. Positive and negative affective changes were examined before and following daily life increases in physical activity. Neuroticism was measured at baseline and depressive symptoms were assessed at baseline and at each of four follow-up assessments. Diagnoses, derived by Structured Clinical Interview for Diagnostic and Statistical Manual for Mental Health-IV axis I disorders, (A. P. A., 1994) were obtained at baseline. A significant increase in positive affect (PA) following the moment of increase in physical activity was replicated across both samples up to 180 min after physical activity. There was no effect of physical activity on negative affect (NA). Across the two samples, a history of fulfilling diagnostic criteria for depression at least once moderated the effect of physical activity on PA, in that the effect was lost more rapidly. The study supports a causal effect of physical activity on PA. However, people with past experience of clinical depression may benefit less from the PA-inducing effect of physical activity. These findings have implications for the use of physical exercise in clinical practice.

  20. Effects of intravenous lipopolysaccharide infusion on glucose and insulin dynamics in horses with equine metabolic syndrome.

    PubMed

    Tadros, Elizabeth M; Frank, Nicholas; De Witte, Fiamma Gomez; Boston, Raymond C

    2013-07-01

    To test the hypothesis that glucose and insulin dynamics during endotoxemia differ between healthy horses and horses with equine metabolic syndrome (EMS). 6 healthy adult mares and 6 horses with EMS. Each horse randomly received an IV infusion of lipopolysaccharide (20 ng/kg [in 60 mL of sterile saline {0.9% NaCl} solution]) or saline solution, followed by the other treatment after a 7-day washout period. Baseline insulin-modified frequently sampled IV glucose tolerance tests were performed 27 hours before and then repeated at 0.5 and 21 hours after infusion. Results were assessed via minimal model analysis and area under the curve values for plasma glucose and serum insulin concentrations. Lipopolysaccharide infusion decreased insulin sensitivity and increased area under the serum insulin concentration curve (treatment × time) in both healthy and EMS-affected horses, compared with findings following saline solution administration. The magnitude of increase in area under the plasma glucose curve following LPS administration was greater for the EMS-affected horses than it was for the healthy horses. Horses with EMS that received LPS or saline solution infusions had decreased insulin sensitivity over time. Glucose and insulin responses to endotoxemia differed between healthy horses and horses with EMS, with greater loss of glycemic control in EMS-affected horses. Horses with EMS also had greater derangements in glucose and insulin homeostasis that were potentially stress induced. It may therefore be helpful to avoid exposure of these horses to stressful situations.

  1. Symptom dimensions, clinical course and comorbidity in men and women with obsessive-compulsive disorder.

    PubMed

    Torresan, Ricardo C; Ramos-Cerqueira, Ana Teresa A; Shavitt, Roseli G; do Rosário, Maria Conceição; de Mathis, Maria Alice; Miguel, Euripedes C; Torres, Albina R

    2013-09-30

    The study aimed to compare male and female patients with obsessive-compulsive disorder (OCD) across symptom dimensions, clinical course and comorbidity. A cross-sectional study was undertaken with 858 adult OCD patients (DSM-IV) from the Brazilian Research Consortium on Obsessive-Compulsive Spectrum Disorders. Patients were evaluated using structured interviews, including the Dimensional Yale-Brown Obsessive-Compulsive Scale (DY-BOCS) and the Structured Clinical Interview for DSM-IV Axis I disorders (SCID-I). The sample was composed of 504 women (58.7%) and 354 men (41.3%) with a mean age of 35.4 years-old (range: 18-77). Men were younger, more frequently single and presented more tics, social phobia and alcohol use disorders. Among men, symptom interference occurred earlier and symptoms of the sexual/religious dimension were more common and more severe. Conversely, women were more likely to present symptoms of the aggressive, contamination/cleaning and hoarding dimension and comorbidity with specific phobias, anorexia nervosa, bulimia, trichotillomania, skin picking and "compulsive" buying. In the logistic regression, female gender remained independently associated with the aggressive and contamination/cleaning dimensions. In both genders the aggressive dimension remained associated with comorbid post-traumatic stress disorder, the sexual/religious dimension with major depression and the hoarding dimension with tic disorders. Gender seems to be relevant in the determination of OCD clinical presentation and course and should be considered an important aspect when defining more homogeneous OCD subgroups. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. [Analysis on 2011 quality control results on aerobic plate count of microbiology laboratories in China].

    PubMed

    Han, Haihong; Li, Ning; Li, Yepeng; Fu, Ping; Yu, Dongmin; Li Zhigang; Du, Chunming; Guo, Yunchang

    2015-01-01

    To test the aerobic plate count examining capability of microbiology laboratories, to ensure the accuracy and comparability of quantitative bacteria examination results, and to improve the quality of monitoring. The 4 different concentration aerobic plate count piece samples were prepared and noted as I, II, III and IV. After homogeneity and stability tests, the samples were delivered to monitoring institutions. The results of I, II, III samples were logarithmic transformed, and evaluated with Z-score method using the robust average and standard deviation. The results of IV samples were evaluated as "satisfactory" when reported as < 10 CFU/piece or as "not satisfactory" otherwise. Pearson χ2 test was used to analyze the ratio results. 309 monitoring institutions, which was 99.04% of the total number, reported their results. 271 institutions reported a satisfactory result, and the satisfactory rate was 87.70%. There was no statistical difference in satisfactory rates of I, II and III samples which were 81.52%, 88.30% and 91.40% respectively. The satisfactory rate of IV samples was 93.33%. There was no statistical difference in satisfactory rates between provincial and municipal CDC. The quality control program has provided scientific data that the aerobic plate count capability of the laboratories meets the requirements of monitoring tasks.

  3. Toward DSM-V: an item response theory analysis of the diagnostic process for DSM-IV alcohol abuse and dependence in adolescents.

    PubMed

    Gelhorn, Heather; Hartman, Christie; Sakai, Joseph; Stallings, Michael; Young, Susan; Rhee, Soo Hyun; Corley, Robin; Hewitt, John; Hopfer, Christian; Crowley, Thomas

    2008-11-01

    Item response theory analyses were used to examine alcohol abuse and dependence symptoms and diagnoses in adolescents. Previous research suggests that the DSM-IV alcohol use disorder (AUD) symptoms in adolescents may be characterized by a single dimension. The present study extends prior research with a larger and more comprehensive sample and an examination of an alternative diagnostic algorithm for AUDs. Approximately 5,587 adolescents between the ages of 12 and 18 years from adjudicated, clinical, and community samples were administered structured clinical interviews. Analyses were conducted to examine the severity of alcohol abuse and dependence symptoms and the severity of alcohol use problems (AUDs) within the diagnostic categories created by the DSM-IV. Although the DSM-IV diagnostic categories differ in severity of AUDs, there is substantial overlap and inconsistency in AUD severity of persons across these categories. Item Response Theory-based AUD severity estimates suggest that many persons diagnosed with abuse have AUD severity greater than persons with dependence. Similarly, many persons who endorse some symptoms but do not qualify for a diagnosis (i.e., diagnostic orphans) have more severe AUDs than persons with an abuse diagnosis. Additionally, two dependence items, "tolerance" and "larger/longer," show differences in severity between samples. The distinction between DSM-IV abuse and dependence based on severity can be improved using an alternative diagnostic algorithm that considers all of the alcohol abuse and dependence symptoms conjointly.

  4. Simultaneous spectrophotometric determination of trace amounts of uranium, thorium, and zirconium using the partial least squares method after their preconcentration by alpha-benzoin oxime modified Amberlite XAD-2000 resin.

    PubMed

    Ghasemi, Jahan B; Zolfonoun, E

    2010-01-15

    A new solid phase extraction method for separation and preconcentration of trace amounts of uranium, thorium, and zirconium in water samples is proposed. The procedure is based on the adsorption of U(VI), Th(IV) and Zr(IV) ions on a column of Amberlite XAD-2000 resin loaded with alpha-benzoin oxime prior to their simultaneous spectrophotometric determination with Arsenazo III using orthogonal signal correction partial least squares method. The enrichment factor for preconcentration of uranium, thorium, and zirconium was found to be 100. The detection limits for U(VI), Th(IV) and Zr(IV) were 0.50, 0.54, and 0.48microgL(-1), respectively. The precision of the method, evaluated as the relative standard deviation obtained by analyzing a series of 10 replicates, was below 4% for all elements. The practical applicability of the developed sorbent was examined using synthetic seawater, natural waters and ceramic samples.

  5. Estimating premorbid general cognitive functioning for children and adolescents using the American Wechsler Intelligence Scale for Children-Fourth Edition: demographic and current performance approaches.

    PubMed

    Schoenberg, Mike R; Lange, Rael T; Brickell, Tracey A; Saklofske, Donald H

    2007-04-01

    Neuropsychologic evaluation requires current test performance be contrasted against a comparison standard to determine if change has occurred. An estimate of premorbid intelligence quotient (IQ) is often used as a comparison standard. The Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) is a commonly used intelligence test. However, there is no method to estimate premorbid IQ for the WISC-IV, limiting the test's utility for neuropsychologic assessment. This study develops algorithms to estimate premorbid Full Scale IQ scores. Participants were the American WISC-IV standardization sample (N = 2172). The sample was randomly divided into 2 groups (development and validation). The development group was used to generate 12 algorithms. These algorithms were accurate predictors of WISC-IV Full Scale IQ scores in healthy children and adolescents. These algorithms hold promise as a method to predict premorbid IQ for patients with known or suspected neurologic dysfunction; however, clinical validation is required.

  6. On the association between diabetes and mental disorders in a community sample: results from the German National Health Interview and Examination Survey.

    PubMed

    Kruse, Johannes; Schmitz, Norbert; Thefeld, Wolfgang

    2003-06-01

    To determine the relationship between mental disorders and diabetes in a representative community sample. This was a cross-sectional study. Data on diabetes and HbA(1c) values were obtained by structured questionnaires and by laboratory assessments. Current psychiatric disorders were diagnosed by a modified version of the Composite International Diagnostic Interview (CIDI). People with diabetes (PWD) were not more likely to meet Diagnostic and Statistical Manual of Psychiatric Disorders, 4th edition (DSM-IV) criteria for at least one mental disorder than were individuals without diabetes. However, a different diagnostic pattern occurred compared with the general population: odds ratios (ORs) for anxiety disorders in PWD were higher (OR 1.93, 95% CI 1.19-3.14). Although PWD had higher prevalence rates of affective disorders, the relationship between diabetes and affective disorders was not statistically significant after controlling for age, sex, marital status, and socioeconomic status. In contrast, the relationship between diabetes and anxiety disorders remained significant after controlling for these variables. In contrast to individuals without mental disorders, PWD with affective or anxiety disorders more frequently had adequate glycemic control. Diabetes was associated with an increased likelihood of anxiety disorders. The association between mental disorders, diabetes, and glycemic control should be evaluated carefully in terms of potentially confounding sociodemographic variables, sample characteristics, and definitions of the disorders.

  7. Polyethylene glycol assisted growth of Sn-doped ZnO nanorod arrays prepared via sol-gel immersion method

    NASA Astrophysics Data System (ADS)

    Ismail, A. S.; Mamat, M. H.; Malek, M. F.; Saidi, S. A.; Yusoff, M. M.; Mohamed, R.; Sin, N. D. Md; Suriani, A. B.; Rusop, M.

    2018-05-01

    Tin-doped zinc oxide (SZO) nanorod films at different concentrations of polyethylene glycol (PEG) were successfully deposited on zinc oxide (ZnO) seeded layer catalyst using sol-gel immersion method. The morphology of the samples were characterized using field emission scanning electron microscopy (FESEM), optical properties using UV-Vis spectrophotometer and electrical properties using I-V measurement system. The current-voltage (I-V) characteristics displayed that 5 wt % sample produced the highest conductivity.

  8. The dependence of C IV broad absorption line properties on accompanying Si IV and Al III absorption: relating quasar-wind ionization levels, kinematics, and column densities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Filiz Ak, N.; Brandt, W. N.; Schneider, D. P.

    2014-08-20

    We consider how the profile and multi-year variability properties of a large sample of C IV Broad Absorption Line (BAL) troughs change when BALs from Si IV and/or Al III are present at corresponding velocities, indicating that the line of sight intercepts at least some lower ionization gas. We derive a number of observational results for C IV BALs separated according to the presence or absence of accompanying lower ionization transitions, including measurements of composite profile shapes, equivalent width (EW), characteristic velocities, composite variation profiles, and EW variability. We also measure the correlations between EW and fractional-EW variability for Cmore » IV, Si IV, and Al III. Our measurements reveal the basic correlated changes between ionization level, kinematics, and column density expected in accretion-disk wind models; e.g., lines of sight including lower ionization material generally show deeper and broader C IV troughs that have smaller minimum velocities and that are less variable. Many C IV BALs with no accompanying Si IV or Al III BALs may have only mild or no saturation.« less

  9. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Crosswalk between DSM-IV Dependence and DSM-5 Substance Use Disorders for Opioids, Cannabis, Cocaine and Alcohol

    PubMed Central

    Compton, Wilson M.; Dawson, Deborah A.; Goldstein, Risë B.; Grant, Bridget F.

    2013-01-01

    Background Ascertaining agreement between DSM-IV and DSM-5 is important to determine the applicability of treatments for DSM-IV conditions to persons diagnosed according to the proposed DSM-5. Methods Data from a nationally representative sample of US adults were used to compare concordance of past-year DSM-IV Opioid, Cannabis, Cocaine and Alcohol Dependence with past-year DSM-5 disorders at thresholds of 3+, 4+ 5+ and 6+ positive DSM-5 criteria among past-year users of opioids (n=264), cannabis (n=1,622), cocaine (n=271) and alcohol (n=23,013). Substance-specific 2×2 tables yielded overall concordance (kappa), sensitivity, specificity, positive predictive values (PPV) and negative predictive values (NPV). Results For DSM-IV Alcohol, Cocaine and Opioid Dependence, optimal concordance occurred when 4+ DSM-5 criteria were endorsed, corresponding to the threshold for moderate DSM-5 Alcohol, Cocaine and Opioid Use Disorders. Maximal concordance of DSM-IV Cannabis Dependence and DSM-5 Cannabis Use Disorder occurred when 6+ criteria were endorsed, corresponding to the threshold for severe DSM-5 Cannabis Use Disorder. At these optimal thresholds, sensitivity, specificity, PPV and NPV generally exceeded 85% (>75% for cannabis). Conclusions Overall, excellent correspondence of DSM-IV Dependence with DSM-5 Substance Use Disorders was documented in this general population sample of alcohol, cannabis, cocaine and opioid users. Applicability of treatments tested for DSM-IV Dependence is supported by these results for those with a DSM-5 Alcohol, Cocaine or Opioid Use Disorder of at least moderate severity or Severe Cannabis Use Disorder. Further research is needed to provide evidence for applicability of treatments for persons with milder substance use disorders. PMID:23642316

  11. Frequent downregulation of miR-34 family in human ovarian cancers.

    PubMed

    Corney, David C; Hwang, Chang-Il; Matoso, Andres; Vogt, Markus; Flesken-Nikitin, Andrea; Godwin, Andrew K; Kamat, Aparna A; Sood, Anil K; Ellenson, Lora H; Hermeking, Heiko; Nikitin, Alexander Yu

    2010-02-15

    The miR-34 family is directly transactivated by tumor suppressor p53, which is frequently mutated in human epithelial ovarian cancer (EOC). We hypothesized that miR-34 expression would be decreased in EOC and that reconstituted miR-34 expression might reduce cell proliferation and invasion of EOC cells. miR-34 expression was determined by quantitative reverse transcription-PCR and in situ hybridization in a panel of 83 human EOC samples. Functional characterization of miR-34 was accomplished by reconstitution of miR-34 expression in EOC cells with synthetic pre-miR molecules followed by determining changes in proliferation, apoptosis, and invasion. miR-34a expression is decreased in 100%, and miR-34b*/c in 72%, of EOC with p53 mutation, whereas miR-34a is also downregulated in 93% of tumors with wild-type p53. Furthermore, expression of miR-34b*/c is significantly reduced in stage IV tumors compared with stage III (P = 0.0171 and P = 0.0029, respectively). Additionally, we observed promoter methylation and copy number variations at mir-34. In situ hybridization showed that miR-34a expression is inversely correlated with MET immunohistochemical staining, consistent with translational inhibition by miR-34a. Finally, miR-34 reconstitution experiments in p53 mutant EOC cells resulted in reduced proliferation, motility, and invasion, the latter of which was dependent on MET expression. Our work suggests that miR-34 family plays an important role in EOC pathogenesis and reduced expression of miR-34b*/c may be particularly important for progression to the most advanced stages. Part of miR-34 effects on motility and invasion may be explained by regulation of MET, which is frequently overexpressed in EOC.

  12. Performance evaluation of the Abbott CELL-DYN Emerald for use as a bench-top analyzer in a research setting.

    PubMed

    Khoo, T-L; Xiros, N; Guan, F; Orellana, D; Holst, J; Joshua, D E; Rasko, J E J

    2013-08-01

    The CELL-DYN Emerald is a compact bench-top hematology analyzer that can be used for a three-part white cell differential analysis. To determine its utility for analysis of human and mouse samples, we evaluated this machine against the larger CELL-DYN Sapphire and Sysmex XT2000iV hematology analyzers. 120 human (normal and abnormal) and 30 mouse (normal and abnormal) samples were analyzed on both the CELL-DYN Emerald and CELL-DYN Sapphire or Sysmex XT2000iV analyzers. For mouse samples, the CELL-DYN Emerald analyzer required manual recalibration based on the histogram populations. Analysis of the CELL-DYN Emerald showed excellent precision, within accepted ranges (white cell count CV% = 2.09%; hemoglobin CV% = 1.68%; platelets CV% = 4.13%). Linearity was excellent (R² ≥ 0.99), carryover was minimal (<1%), and overall interinstrument agreement was acceptable for both human and mouse samples. Comparison between the CELL-DYN Emerald and Sapphire analyzers for human samples or Sysmex XT2000iV analyzer for mouse samples showed excellent correlation for all parameters. The CELL-DYN Emerald was generally comparable to the larger reference analyzer for both human and mouse samples. It would be suitable for use in satellite research laboratories or as a backup system in larger laboratories. © 2012 John Wiley & Sons Ltd.

  13. Indirect spectrophotometric determination of small amounts of selenium(IV) and arsenic(V) by simple extraction using flotation columns.

    PubMed

    Mostafa, G A; Ghazy, S E

    2001-10-01

    A simple, rapid and selective procedure for the indirect spectrophotometric determination of Se(IV) and As(V) has been developed. It is based on the reduction of Se(IV) to Se(0) and As(V) to As(III) with hydroiodic acid (KI + HCl). The liberated iodine, equivalent to each analyte, is quantitatively extracted with oleic acid (HOL) surfactant. The iodine-HOL system exhibits its maximum absorbance at 435 nm. The different analytical parameters affecting the extraction and determination processes have been examined. The calibration graphs were found to be linear over the ranges 5-120 and 0.25-20 ppm of Se(IV) and As(V), with lower detection limits of 2.5 and 0.15 ppm and molar absorptivities of 1 x 10(4) and 0.5 x 10(4) dm3 mol(-1) cm(-1), respectively. Sandell's sensitivity was calculated to be 0.0078 and 0.0149 microg/cm2 in the same order. The relative standard deviation for five replicate analyses of 40 ppm Se(IV) and 4 ppm As(V) were 1.0 and 0.9%, respectively. The proposed procedure in the presence of EDTA as a masking agent for foreign ions has been successfully applied to the determination of Se(IV) in a reference sample and As(V) in copper metal, in addition to their determination in spiked and polluted water samples.

  14. PM101: a cyclodextrin-based intravenous formulation of amiodarone devoid of adverse hemodynamic effects.

    PubMed

    Cushing, Daniel J; Kowey, Peter R; Cooper, Warren D; Massey, Bill W; Gralinski, Michael R; Lipicky, Raymond J

    2009-04-01

    Intravenous amiodarone (Amiodarone i.v.) is widely used to treat cardiac arrhythmias. The most frequent clinical adverse event associated with Amiodarone i.v. administration is systemic hypotension which has been attributed to the cosolvents used in the formulation, polysorbate 80 and benzyl alcohol. To minimize hypotension Amiodarone i.v. is diluted in 5% dextrose in water prior to administration and slowly infused. PM101 is a novel intravenous formulation that uses sulfobutylether-7-beta-cyclodextrin to solubilize amiodarone, and thus should be devoid of the untoward hemodynamic effects associated with polysorbate 80 and benzyl alcohol. Beagle dogs (n=7/group) were anesthetized with morphine and alpha-chloralose and instrumented to assess aortic blood pressure, cardiac output, cardiac contractility, and heart rate. Animals were treated with the U.S. approved human-equivalent loading dose (2.14 mg/kg) of Amiodarone i.v., PM101, and their respective vehicle controls. Administration of Amiodarone i.v. rapidly and significantly decreased mean aortic pressure, cardiac output, and cardiac contractility. A significant increase in heart rate was also observed as was a transient, but not significant, decrease in systemic vascular resistance. A similar pattern of rapid and significant hemodynamic changes was produced by the Amiodarone i.v. Vehicle (polysorbate 80/benzyl alcohol) alone. In marked contrast, PM101 and its vehicle produced no significant hemodynamic effects. This study provides a useful model for the continued search for a safe and effective intravenous amiodarone formulation devoid of the hypotensive risk associated with the current commercial formulation.

  15. The likelihood of khat chewing serving as a neglected and reverse ‘gateway’ to tobacco use among UK adult male khat chewers: a cross sectional study

    PubMed Central

    2014-01-01

    Background Chewing khat leaves is often accompanied by tobacco use. We assessed aspects of tobacco use and explored factors associated with tobacco use patterns (frequency of use per week) among khat chewers who used tobacco only when chewing khat (“simultaneous tobacco and khat users”, STKU). Methods A sample of 204 male khat chewers was recruited during random visits to khat outlets. Data collected included socio-demographic items, tobacco use and khat chewing behaviours. Both psychological and physical dependence on khat were assessed using the Severity of Psychological Dependence on Khat (SDS-Khat) Scale, the Diagnostic Statistical Manual IV (DSM-IV) and adapted items from the Fagerström Test for Nicotine Dependence (chewing even when ill, and difficulty in abstaining from khat chewing for an entire week). Descriptive statistics and non-parametric analyses were conducted. Results Of the 204 khat chewers, 35% were khat chewers only, 20% were STKU, and the remainder were daily cigarette smokers. The mean age of STKU was 38.12 (±14.05) years. Fifty seven percent of STKU smoked tobacco and chewed khat for two days per week and 43% smoked and chewed more frequently (three to six days: 33%, daily: 10%). Three quarters (74%) were former daily tobacco users. Khat chewing initiated tobacco smoking among 45% of STKU and 71% reported attempts to quit tobacco smoking during khat chew. Among STKU, smoking tobacco for more than two days per week was significantly associated (p < 0.05) with psychological dependence (increased levels of SDS-Khat), physical dependence (increased levels of DSM-IV symptoms, chewing even when ill, difficulty in abstaining from chewing for an entire week and self-reported health conditions) and behavioural factors (e.g. amount of khat chewed in typical khat session). Conclusions Khat chewing may promote different patterns of tobacco smoking, initiate and sustain tobacco smoking, and trigger tobacco cessation relapses among STKU. Increased frequency of tobacco smoking among STKU was linked to psycho-physical and behavioural factors. Further investigation within large and representative samples of both sexes of STKU in different contexts should be considered for health research and policy development. Khat chewing should be considered when designing tobacco prevention uptake, cessation interventions and relapse prevention programmes. PMID:24885131

  16. Evaluation of the route dependency of the pharmacokinetics and neuro-pharmacokinetics of tramadol and its main metabolites in rats.

    PubMed

    Sheikholeslami, Behjat; Gholami, Mahdi; Lavasani, Hoda; Rouini, Mohammadreza

    2016-09-20

    Tramadol hydrochloride is a centrally acting analgesic used for the treatment of moderate-to-severe pain. It has three main metabolites: O-desmethyltramadol (M1), N-desmethyltramadol (M2), and N,O-didesmethyltramadol (M5). Because of the frequent use of tramadol by patients and drug abusers, the ability to determine the parent drug and its metabolites in plasma and cerebrospinal fluid is of great importance. In the present study, a pharmacokinetic approach was applied using two groups of five male Wistar rats administered a 20mg/kg dose of tramadol via intravenous (i.v.) or intraperitoneal (i.p.) routes. Plasma and CSF samples were collected at 5-360min following tramadol administration. Our results demonstrate that the plasma values of Cmax (C0 in i.v. group) and area under the curve (AUC)0-t for tramadol were 23,314.40±6944.85 vs. 3187.39±760.25ng/mL (Cmax) and 871.15±165.98 vs. 414.04±149.25μg·min/mL in the i.v. and i.p. groups, respectively (p<0.05). However, there were no significant differences between i.v. and i.p. plasma values for tramadol metabolites (p>0.05). Tramadol rapidly penetrated the blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BCSFB) (5.00±0.00 vs. 10.00±5.77min in i.v. and i.p. groups, respectively). Tramadol and its metabolites (M1 and M2) were present to a lesser extent in the cerebrospinal fluid (CSF) than in the plasma. M5 hardly penetrated the CSF, owing to its high polarity. There was no significant difference between the AUC0-t of tramadol in plasma (414.04±149.25μg·min/mL) and CSF (221.81±83.02μg·min/mL) in the i.p. group. In addition, the amounts of metabolites (M1 and M2) in the CSF showed no significant differences following both routes of administration. There were also no significant differences among the Kp,uu,CSF(0-360) (0.51±0.12 vs. 0.63±0.04) and Kp,uu,CSF(0-∞) (0.61±0.10 vs. 0.62±0.02) for i.v. and i.p. pathways, respectively (p>0.05). Drug targeting efficiency (DTE) values of tramadol after i.p. injection were more than unity for all scheduled time points. Considering the main analgesic effect of M1, it is hypothesized that both routes of administration may produce the same amount of analgesia. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Phylogenetic characterisation of Taenia tapeworms in spotted hyenas and reconsideration of the "Out of Africa" hypothesis of Taenia in humans.

    PubMed

    Terefe, Yitagele; Hailemariam, Zerihun; Menkir, Sissay; Nakao, Minoru; Lavikainen, Antti; Haukisalmi, Voitto; Iwaki, Takashi; Okamoto, Munehiro; Ito, Akira

    2014-07-01

    The African origin of hominins suggests that Taenia spp. in African carnivores are evolutionarily related to the human-infecting tapeworms Taenia solium, Taenia saginata and Taenia asiatica. Nevertheless, the hypothesis has not been verified through molecular phylogenetics of Taenia. This study aimed to perform phylogenetic comparisons between Taenia spp. from African hyenas and the congeneric human parasites. During 2010-2013, 233 adult specimens of Taenia spp. were collected from 11 spotted hyenas in Ethiopia. A screening based on short DNA sequences of the cytochrome c oxidase subunit 1 gene classified the samples into four mitochondrial lineages designated as I-IV. DNA profiles of nuclear genes for DNA polymerase delta (pold) and phosphoenolpyruvate carboxykinase (pepck) showed that lineages II and III can be assigned as two independent species. Common haplotypes of pold and pepck were frequently found in lineages I and IV, suggesting that they constitute a single species. Morphological observations suggested that lineage II is Taenia crocutae, but the other lineages were morphologically inconsistent with known species, suggesting the involvement of two new species. A phylogenetic tree of Taenia spp. was reconstructed by the maximum likelihood method using all protein-coding genes of their mitochondrial genomes. The tree clearly demonstrated that T. crocutae is sister to T. saginata and T. asiatica, whereas T. solium was confirmed to be sister to the brown bear tapeworm, Taenia arctos. The tree also suggested that T. solium and T. arctos are related to two species of Taenia in hyenas, corresponding to lineages I+IV and III. These results may partially support the African origin of human-infecting Taenia spp., but there remains a possibility that host switching of Taenia to hominins was not confined to Africa. Additional taxa from African carnivores are needed for further testing of the "Out of Africa" hypothesis of Taenia in humans. Copyright © 2014 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  18. Spectrophotometric determination of vanadium in rutile and in mafic igneous rocks

    USGS Publications Warehouse

    Marinenko, John; Mei, Leung

    1974-01-01

    Minor and major levels of vanadium in rutile are separated from titanium and iron by sample fusion with sodium carbonate followed by water leach and filtration. The filtrate is then acidified with hydrochloric acid. Silicates are decomposed with a mixture of hydrofluoric and hydrochloric acids, and iron is separated by extraction of its chloride with diethyl ether. Sample vanadium in hydrochloric acid is then quantitatively reduced to vanadium(IV) with sulfurous acid. The remaining sulfur dioxide is expelled by heating. Vanadium (IV) then is reacted with excess of iron(III) at reduced acidity (pH 5) in the presence of 1,10-phenanthroline to yield the orange-red iron(II) 1,10-phenanthroline complex. Iron(II) generated by vanadium(IV) is a measure of total vanadium in the sample. The proposed method is free from elemental interferences because the color development cannot take place without the two redox reactions described above, and these are, under the outlined experimental conditions, quantitative only for vanadium.

  19. Single- and multiple-dose pharmacokinetics and absolute bioavailability of tedizolid.

    PubMed

    Flanagan, Shawn; Fang, Edward; Muñoz, Kelly A; Minassian, Sonia L; Prokocimer, Philippe G

    2014-09-01

    Tedizolid phosphate is a novel antibacterial under investigation for the treatment of gram-positive infections. This study was conducted to assess the pharmacokinetics, safety, and tolerability of intravenous tedizolid phosphate as well as the oral bioavailability of tedizolid phosphate. Double-blind, single-ascending dose, multiple-dose pharmacokinetics study, as well as tolerability and open-label crossover studies. Single center in the United States (Covance Clinical Research Unit, Madison, WI) between September 2009 and January 2010. Ninety healthy volunteers. Single intravenous (IV) doses of tedizolid phosphate 50 mg (lead-in) and 100-400 mg. Single oral and IV dose of tedizolid phosphate 200 mg in crossover fashion. Multiple IV doses of tedizolid phosphate 200 and 300 mg for up to 7 days. A dose-dependent increase was observed in the maximum plasma concentration (1.2-5.1 μg/ml) and the area under the concentration-time curve (17.4-58.7 μg × hr/ml) of tedizolid (the microbiologically active moiety of tedizolid phosphate) after single IV doses of tedizolid phosphate 100-400 mg. Administration of IV tedizolid phosphate 200 mg once/day for 7 days resulted in minimal (28%) tedizolid accumulation. The absolute oral bioavailability of tedizolid after a single 200-mg dose of tedizolid phosphate was 91%; pharmacokinetic parameters of tedizolid were similar with oral and IV administration. Treatment-related adverse events occurred in 41% of subjects. Most adverse events were related to infusion site and became more frequent with multiple dosing. In an additional 3-day tolerability study, IV tedizolid phosphate 200 mg and placebo were similarly tolerated, based on visual infusion phlebitis scores. These results from a population of healthy volunteers support once/day dosing of tedizolid phosphate 200 mg with both the oral and IV formulations, without the need for dose adjustment when switching administration routes. © 2014 Cubist Pharmaceuticals. Pharmacotherapy published by Wiley Periodicals, Inc. on behalf of Pharmacotherapy Publications, Inc.

  20. First direct comparison of high and low ionization line kinematics in active galactic nuclei

    NASA Technical Reports Server (NTRS)

    Sulentic, J. W.; Marziani, P.; Dultzin-Hacyan, D.; Calvani, M.; Moles, M.

    1995-01-01

    We present first results of a comparison of emission line shift properties for the high (HILs) and low (LILs) ionization lines in 43 low-reshift quasars. We identify a core sample of C IV lambda 1549 and hydrogen beta profiles with a wide distribution of red- and blueshifts (less than or equal to +/- 1000 km/sec). We also identify two tails in this distribution: one with large hydrogen beta redshifts (greater than or equal to 2000 km/sec) and another with large C IV blueshifts (greater than or equal to 1500 km/sec). The tails are mutually exclusive. All objects with extreme hydrogen beta redshift are radio loud, and all objects with extreme C IV blueshift are radio quiet. The core samples of smaller shifts can be most simply divided into: (1) hydrogen beta - a redshifted radio-loud population (related to the tail) and a radio-quiet population with mean shift near zero, and (2) C IV - a blueshifted radio-quiet population (related to the tail) and a radio-loud population with mean shift near zero. The results suggest fundamentally different kinematics for the HILs and LILs. They also suggest very different kinematics for radio-loud and radio-quiet active galactic nuclei. They also favor a predominance of radial motion in a large fraction of the sample.

  1. Mutation analysis of SLC26A4 (Pendrin) gene in a Brazilian sample of hearing-impaired subjects.

    PubMed

    Nonose, Renata Watanabe; Lezirovitz, Karina; de Mello Auricchio, Maria Teresa Balester; Batissoco, Ana Carla; Yamamoto, Guilherme Lopes; Mingroni-Netto, Regina Célia

    2018-05-08

    Mutations in the SLC26A4 gene are associated with Pendred syndrome and autosomal recessive non-syndromic deafness (DFNB4). Both disorders have similar audiologic characteristics: bilateral hearing loss, often severe or profound, which may be associated with abnormalities of the inner ear, such as dilatation of the vestibular aqueduct or Mondini dysplasia. But, in Pendred syndrome (OMIM #274600), with autosomal recessive inheritance, besides congenital sensorineural deafness, goiter or thyroid dysfunctions are frequently present. The aim of this study was to determine whether mutations in SLC26A4 are a frequent cause of hereditary deafness in Brazilian patients. Microsatellite haplotypes linked to SLC26A4 were investigated in 68 families presenting autosomal recessive non-syndromic deafness. In the probands of the 16 families presenting segregation consistent with linkage to SLC26A4, Sanger sequencing of the 20 coding exons was performed. In an additional sample of 15 individuals with suspected Pendred syndrome, because of the presence of hypothyroidism or cochleovestibular malformations, the SLC26A4 gene coding region was also sequenced. In two of the 16 families with indication of linkage to SLC26A4, the probands were found to be compound heterozygotes for probably pathogenic different mutations: three novel (c.1003 T > G (p. F335 V), c.1553G > A (p.W518X), c.2235 + 2 T > C (IVS19 + 2 T > C), and one already described, c.84C > A (p.S28R). Two of the 15 individuals with suspected Pendred syndrome because of hypothyreoidism or cochleovestibular malformations were monoallelic for likely pathogenic mutations: a splice mutation (IVS7 + 2 T > C) and the previously described c.1246A > C (p.T416P). Pathogenic copy number variations were excluded in the monoallelic cases and in those with normal results after Sanger sequencing. Additional mutations in the SLC26A4 gene or other definite molecular cause for deafness were not identified in the monoallelic patients, after exome sequencing. Biallelic pathogenic mutations in SLC26A4 explained ~ 3% of cases selected because of autosomal recessive deafness. Monoallelic mutations were present in ~ 13% of isolated cases of deafness with cochleovestibular malformations or suspected Pendred syndrome. These data reinforce the importance of mutation screening of SLC26A4 in Brazilian subjects and highlight the elevated frequency of monoallelic patients.

  2. WISC-IV and WISC-III profiles in children with ADHD.

    PubMed

    Mayes, Susan Dickerson; Calhoun, Susan L

    2006-02-01

    Wechsler Intelligence Scale for Children, 3rd and 4th editions (WISC-III n = 586 and WISC-IV n = 118), profiles were compared for children with ADHD and normal intelligence. Mean Verbal Comprehension Index (VCI) and Perceptual Organization/Perceptual Reasoning Index (POI/PRI) scores were significantly higher than Freedom From Distractibility/Working Memory Index (FDI/WMI) and Processing Speed Index (PSI), and Symbol Search was higher than Coding. FDI/WMI and PSI scores were similar on both tests, but VCI and POI/PRI were higher on the WISC-IV than on the WISC-III. Therefore, index discrepancies were greater for the WISC-IV, suggesting that the WISC-IV might be better than the WISC-III in delineating the strengths and weaknesses of children with ADHD. All children in the WISC-IV sample scored lowest on WMI or PSI, whereas only 88% of the WISC-III children scored lowest on FDI or PSI. Thus, the WISC-IV may be more helpful in diagnosing ADHD than the WISC-III.

  3. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  4. Prescribing Patterns of Intravenous Golimumab for Rheumatoid Arthritis.

    PubMed

    Brady, Brenna L; Tkacz, Joseph P; Lofland, Jennifer; Meyer, Roxanne; Bolge, Susan C

    2015-09-01

    The use of intravenous golimumab (GLM-IV), in combination with methotrexate, was approved by the US Food and Drug Administration in July 2013 for the treatment of moderate to severe, active rheumatoid arthritis (RA). GLM-IV is available in 50-mg vials, and the prescribing information specifies a dosing regimen of 2 mg/kg at 0 and 4 weeks and then every 8 weeks thereafter. The purpose of this study was to examine the patterns of prescribing and administration of GLM-IV, including the demographic, clinical, and utilization characteristics of patients with RA newly treated with GLM-IV. Rheumatology practices across the continental United States were solicited for a chart-review study. Inclusion criteria were: (1) diagnosis of RA; (2) current treatment with GLM-IV; (3) age ≥18 years; and (4) lack of pregnancy (in female patients). Physicians were offered a monetary incentive for each eligible chart provided. An electronic case-report form was developed to aid in the chart data extraction and included fields for demographic characteristics, available comorbid diagnoses, prior RA treatments, and doses and dates of GLM-IV administration. A total of 117 eligible patient charts from 15 rheumatologist practices were reviewed. The patient sample was predominantly female (81.2%), with a mean (SD) age of 55.4 (14.5) years. A total of 55.6% of patients had evidence of biologic treatment before receiving GLM-IV, and 53% had at least 1 comorbid condition. In total, 300 individual GLM-IV infusions from this sample were reviewed. Due to the relatively recent approval of GLM-IV use by the US Food and Drug Administration, the majority of patients in this sample (69.2%) had received only between 2 and 4 infusions at the time of the review. For infusion records with valid dose data, the mean number of administered vials was 3.6 (0.8) (total dose, 180 mg); the majority of patients received a dose consistent with the prescribed dose of 2 mg/kg. Combination therapy with methotrexate was observed in the charts of a minority of patients (27.4%). The mean interval between induction and the first follow-up infusion was 32.9 (11.4) days, with a mean maintenance interval of 56.5 (13.3) days. This analysis provides an early glimpse of the patterns of prescribing GLM-IV. Overall, patients appeared to have been receiving GLM-IV in accordance with Food and Drug Administration labeling; although the rate of prescribing methotrexate was low, dosages and administration intervals were within the expected ranges. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Special testing for possible carry over effects using the Intoximeters, Inc. Alco-Sensor IV at 10 degrees celsius

    DOT National Transportation Integrated Search

    2002-03-01

    Laboratory testing showed that when simulator samples at 0.170 grams of ethanol per 210 liters were repeatedly tested with an Intoximeters, Ins. Alco-Sensor IV at 10 degrees C ambient temperature, some ethanol and water eventually condensed onto the ...

  6. Structural Validity of the WISC-IV for Students with Learning Disabilities

    ERIC Educational Resources Information Center

    Styck, Kara M.; Watkins, Marley W.

    2016-01-01

    The structural validity of the "Wechsler Intelligence Scale for Children-Fourth Edition" (WISC-IV) was evaluated using confirmatory factor analysis for a clinical sample of 1,537 students diagnosed with specific learning disabilities (SLD) by school psychologists in two large southwestern school districts. Results indicated that a…

  7. From DSM-IV to DSM-5 alcohol use disorder: an overview of epidemiological data.

    PubMed

    Bartoli, Francesco; Carrà, Giuseppe; Crocamo, Cristina; Clerici, Massimo

    2015-02-01

    The fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) has made several changes to criteria for alcohol use disorder (AUD). The objective of this systematic review is to assess if new DSM-5 diagnostic criteria will increase the prevalence rates of AUD in clinical and non-clinical samples as compared with DSM-IV criteria. We searched PubMed, Scopus, and PsycINFO (via ProQuest) electronic databases, with no language restrictions. We included studies with data available on both DSM-IV (and DSM-IV-TR) and DSM-5 AUD in samples of adults, estimating from each study an expected increase in prevalence rates with relevant 95% confidence intervals (CIs). Twelve studies were included in this review. Seven studies showed an increase, two no substantial difference, and three a decrease in AUD prevalence according to DSM-5 diagnostic criteria, with differences in rates (95% CIs) varying between -12.4% (-27.4 to +5.6%) and +61.3% (+46.7 to +77.3%). Additional analyses provided confirmatory results. DSM-5 diagnostic criteria seem to inflate prevalence rates of AUD as compared with DSM-IV. The increasing likelihood of a DSM-5 AUD diagnosis may be explained by the amount of DSM-IV 'diagnostic orphans' which are more prevalent than DSM-IV single-criterion alcohol abuse individuals. Further research should be aimed to study if similar trends are detectable also for other substance use disorders that experienced similar changes in DSM-5 diagnostic criteria. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. The Effect of Draft DSM-5 Criteria on Posttraumatic Stress Disorder Prevalence

    PubMed Central

    Calhoun, Patrick S.; Hertzberg, Jeffrey S.; Kirby, Angela C.; Dennis, Michelle F.; Hair, Lauren P.; Dedert, Eric A.; Beckham, Jean C.

    2012-01-01

    Background This study was designed to examine the concordance of proposed DSM-5 posttraumatic stress disorder (PTSD) criteria with DSM-IV classification rules and examine the impact of the proposed DSM-5 PTSD criteria on prevalence. Method The sample (N=185) included participants who were recruited for studies focused on trauma and health conducted at an academic medical center and VA medical center in the southeastern United States. The prevalence and concordance between DSM-IV and the proposed DSM-5 classifications were calculated based on results from structured clinical interviews. Prevalence rates and diagnostic efficiency indices including sensitivity, specificity, area under the curve (AUC), and Kappa were calculated for each of the possible ways to define DSM-5 PTSD. Results Ninety-five percent of the sample reported an event that met both DSM-IV PTSD Criterion A1 and A2, but only 89% reported a trauma that met Criterion A on DSM-5. Results examining concordance between DSM-IV and DSM-5 algorithms indicated that several of the algorithms had AUCs above .90. The requirement of two symptoms from both Clusters D and E provided strong concordance to DSM-IV (AUC = .93; Kappa = .86) and a greater balance between sensitivity and specificity than requiring three symptoms in both Clusters D and E. Conclusions Despite several significant changes to the diagnostic criteria for PTSD for DSM-5, several possible classification rules provided good concordance with DSM-IV. The magnitude of the impact of DSM-5 decision rules on prevalence will be largely affected by the DSM-IV PTSD base rate in the population of interest. PMID:23109002

  9. Diagnostic assignment of criteria: clinicians and DSM-IV.

    PubMed

    Linde, J A; Clark, L A

    1998-01-01

    The study examined clinician matching of diagnostic criteria to selected DSM-IV Axis I and II disorders. A national sample of clinical psychologists and psychiatrists assigned symptom criteria, presented in scrambled order by axis, to DSM-IV diagnoses with which they believed the criteria belonged, without using the DSM. On average, clinicians assigned 69% of Axis I criteria and 75% of Axis II criteria to the designated DSM-IV diagnosis. The Axis II data represent increased agreement over the 66% found for DSM-III-R. Reasons for the increase are discussed, focusing on modifications made in DSM-IV and increased familiarity with personality disorders. The significantly higher rate of agreement for Axis II over Axis I contrasts with typical reliability data which suggests that Axis I disorders are better defined. Specific points of disagreement between clinician criteria assignments and the DSM-IV are discussed.

  10. Panic attack symptoms differentiate patients with epilepsy from those with psychogenic nonepileptic spells (PNES).

    PubMed

    Hendrickson, Rick; Popescu, Alexandra; Dixit, Ronak; Ghearing, Gena; Bagic, Anto

    2014-08-01

    Psychogenic nonepileptic spells (PNES) are frequently challenging to differentiate from epileptic seizures. The experience of panic attack symptoms during an event may assist in distinguishing PNES from seizures secondary to epilepsy. A retrospective analysis of 354 patients diagnosed with PNES (N=224) or with epilepsy (N=130) investigated the thirteen Diagnostic and Statistical Manual-IV-Text Revision panic attack criteria endorsed by the two groups. We found a statistically higher mean number of symptoms reported by patients with PNES compared with those with epilepsy. In addition, the majority of the panic attack symptoms including heart palpitations, sweating, shortness of breath, choking feeling, chest discomfort, dizziness/unsteadiness, derealization or depersonalization, fear of dying, paresthesias, and chills or hot flashes were significantly more frequent in those with PNES. As patients with PNES frequently have poor clinical outcomes, treatment addressing the anxiety symptomatology may be beneficial. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. A new titanium-bearing calcium aluminosilicate phase. 2: Crystallography and crystal chemistry of grains formed in slowly cooled melts with bulk compositions of calcium-aluminium-rich inclusions

    NASA Technical Reports Server (NTRS)

    Barber, David J.; Beckett, John R.; Paque, Julie M.; Stolper, Edward

    1994-01-01

    The crystallography and crystal chemistry of a new calcium- titanium-aluminosilicate mineral (UNK) observed in synthetic analogs to calcium-aluminum-rich inclusions (CAIs) from carbonaceous chondrites was studied by electron diffraction techniques. The unit cell is primitive hexagonal or trigonal, with a = 0.790 +/- 0.02 nm and c = 0.492 +/- 0.002 nm, similar to the lattice parameters of melilite and consistent with cell dimensions for crystals in a mixer furnace slag described by Barber and Agrell (1994). The phase frequently displays an epitactic relationship in which melilite acts as the host, with (0001)(sub UNK) parallel (001)(sub mel) and zone axis group 1 0 -1 0(sub UNK) parallel zone axis group 1 0 0(sub mel). If one of the two space groups determined by Barber and Agrell (1994) for their sample of UNK is applicable (P3m1 or P31m), then the structure is probably characterized by puckered sheets of octahedra and tetrahedra perpendicular to the c-axis with successive sheets coordinated by planar arrays of Ca. In this likely structure, each unit cell contains three Ca sites located in mirror planes, one octahedrally coordinated cation located along a three-fold axis and five tetrahedrally coordinated cations, three in mirrors and two along triads. The octahedron contains Ti but, because there are 1.3-1.9 cations of Ti/formula unit, some of the Ti must also be in tetrahedral coordination, an unusual but not unprecedented situation for a silicate. Tetrahedral sites in mirror planes would contain mostly Si, with lesser amounts of Al while those along the triads correspondingly contain mostly Al with subordinate Ti. The structural formula, therefore, can be expressed as Ca(sub 3)(sup VIII)(Ti,Al)(sup VI)(Al,Ti,Si)(sub 2)(sup IV)(Si,Al)(sub 3)(sup IV)O14 with Si + Ti = 4. Compositions of meteoritic and synthetic Ti-bearing samples of the phase can be described in terms of a binary solid solution between the end-members Ca3TiAl2Si3O14 and Ca3Ti(AlTi)(AlSi2)O14. A Ti-free analog with a formula of Ca3Al2Si4O14 synthesized by Paque et al. (1994) is thought to be related structurally but with the octahedral site being occupied by Al, that is, Ca(sub 3)(sup VIII)Al(sup VI)(Al,Si)(sub 2)(sup IV)(Si)(sub 3)(sup IV)O14.

  12. Mutation analysis of the PAH gene in phenylketonuria patients from Rio de Janeiro, Southeast Brazil.

    PubMed

    Vieira Neto, Eduardo; Laranjeira, Francisco; Quelhas, Dulce; Ribeiro, Isaura; Seabra, Alexandre; Mineiro, Nicole; D M Carvalho, Lilian; Lacerda, Lúcia; G Ribeiro, Márcia

    2018-05-10

    Phenylketonuria (PKU) is an autosomal recessive disease resulting from mutations in the PAH gene. Most of the patients are compound heterozygotes, and genotype is a major factor in determining the phenotypic variability of PKU. More than 1,000 variants have been described in the PAH gene. Rio de Janeiro's population has a predominance of Iberian, followed by African and Amerindian ancestries. It is expected that most PKU variants in this Brazilian state have originated in the Iberian Peninsula. However, rare European, African or pathogenic variants that are characteristic of the admixed population of the state might also be found. A total of 102 patients were included in this study. Genomic DNA was isolated from dried blood spots. Sanger sequencing was used for PAH gene variant identification. Deletions and duplications were also screened using MLPA analysis. Haplotypes were also determined. Nine (8.8%) homozygous and 93 (91.2%) compound heterozygous patients were found. The spectrum included 37 causative mutations. Missense, nonsense, and splicing pathogenic variants corresponded to 63.7%, 2.9%, and 22.6% of the mutant alleles, respectively. Large (1.5%), and small deletions, inframe (5.4%) and with frameshift (3.9%), comprised the remainder. The most frequent pathogenic variants were: p.V388M (12.7%), p.R261Q (11.8%), IVS10-11G>A (10.3%), IVS2+5G>C (6.4%), p.S349P (6.4%), p.R252W (5.4%), p.I65T (4.4%), p.T323del (4.4%), and p.P281L (3.4%). One novel variant was detected: c.934G>T (p.G312C) [rs763115697]. The three most frequent pathogenic variants in our study (34.8% of the alleles) were also the most common in other Brazilian states, Portugal, and Spain (p.V388M, p.R261Q, IVS10-11G>A), corroborating that the Iberian Peninsula is the major source of PAH mutations in Rio de Janeiro. Pathogenic variants that have other geographical origins, such IVS2+5G>C, p.G352Vfs*48, and IVS12+1G>A were also detected. Genetic drift and founder effect may have also played a role in the mutation spectrum we observed. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  13. The effects of intravenous, enteral and combined administration of glutamine on malnutrition in sepsis: a randomized clinical trial.

    PubMed

    Koksal, Guniz Meyancı; Erbabacan, Emre; Tunali, Yusuf; Karaoren, Gulsah; Vehid, Suphi; Oz, Huseyin

    2014-01-01

    Our aim was to compare the effects of intravenous, enteral, and enteral plus intravenous supplemented glutamine on plasma transferrin, nitrogen balance, and creatinine/height index in septic patients with malnutrition. Blood and urine samples were collected for transferrin, urea and creatinine measurements. Samples, SOFA score and protein-calorie intake values were repeated on days 7 and 15. Patients (n:120) were randomly divided into 4 groups. Group I received 30 g/day IV glutamine, group II received 30 g/day enteral glutamine, group III received 15 g/day IV and 15 g/day enteral glutamine. Group IV received only enteral feeding as a control group. Transferrin levels decreased in group IV (p<0.01 0-7 days, p<0.01 7-15 days, p<0.01 0-15 days). Nitrogen balance levels were highest in group IV when compared with group I (p<0.05, p<0.001), group II (p<0.001), and group III (p<0.05, p<0.001) on days 7-15. Creatinine/height indexes increased in group I (p<0.001), group II (p<0.001), group III (p<0.001), and group IV (p<0.05) on day 15. In group III the creatinine/height index was higher than in groups I and II (p<0.05). In group IV, creatinine/height index was lower than in group I (p<0.01) and group II (p<0.001). Protein-calorie intake in group IV was higher than others on day 7 (p<0.05). SOFA scores of group IV were higher than the other groups on day 15 (p<0.05). This study demonstrated, that combined route of gln supplementation resulted in the most positive outcome to transferrin, creatine/height index and nitrogen balance (on days 7 and 15) during the catabolic phase of septic patients with malnutrition.

  14. Seasonal influenza vaccination coverage and its determinants among nursing homes personnel in western France.

    PubMed

    Elias, Christelle; Fournier, Anna; Vasiliu, Anca; Beix, Nicolas; Demillac, Rémi; Tillaut, Hélène; Guillois, Yvonnick; Eyebe, Serge; Mollo, Bastien; Crépey, Pascal

    2017-07-07

    Influenza-associated deaths is an important risk for the elderly in nursing homes (NHs) worldwide. Vaccination coverage among residents is high but poorly effective due to immunosenescence. Hence, vaccination of personnel is an efficient way to protect residents. Our objective was to quantify the seasonal influenza vaccination (IV) coverage among NH for elderly workers and identify its determinants in France. We conducted a cross-sectional study in March 2016 in a randomized sample of NHs of the Ille-et-Vilaine department of Brittany, in western France. A standardized questionnaire was administered to a randomized sample of NH workers for face-to-face interviews. General data about the establishment was also collected. Among the 33 NHs surveyed, IV coverage for the 2015-2016 season among permanent workers was estimated at 20% (95% Confidence Interval (CI) 15.3%-26.4%) ranging from 0% to 69% depending on the establishments surveyed. Moreover, IV was associated with having previously experienced a "severe" influenza episode in the past (Prevalence Ratio 1.48, 95% CI 1.01-2.17), and varied by professional categories (p < 0.004) with better coverage among administrative staff. Better knowledge about influenza prevention tools was also correlated (p < 0.001) with a higher IV coverage. Individual perceptions of vaccination benefits had a significant influence on the IV coverage (p < 0.001). Although IV coverage did not reach a high rate, our study showed that personnel considered themselves sufficiently informed about IV. IV coverage remains low in the NH worker population in Ille-et-Vilaine and also possibly in France. Strong variations of IV coverage among NHs suggest that management and working environment play an important role. To overcome vaccine "hesitancy", specific communication tools may be required to be adapted to the various NH professionals to improve influenza prevention.

  15. [Symptoms of DSM IV borderline personality disorder in a nonclinical population of adolescents: study of a series of 35 patients].

    PubMed

    Chabrol, H; Chouicha, K; Montovany, A; Callahan, S

    2001-01-01

    1,363 high school students were solicited to complete a personality disorder questionnaire and were encouraged to continue in the study by signing up for interviews with Master's level psychology students. 107 students (7.8%, 34 males, 73 females, mean age = 16.7 +/- 1.8) manifested themselves for the interview and were assessed by using structured diagnostic interviews for borderline personality disorder and major depressive disorder (DIB-R, Revised Diagnostic Interview for Borderlines; MINI, Mini International Neuropsychiatric Interview). The interviews were audiotaped. Interrater reliability was determined by independent ratings of 12 borderline subjects and 12 non-borderline subjects (kappa: 0.795). The distribution of the 107 subjects based on the number of DSM IV borderline personality disorder criteria indicated a gradual dispersion suggesting a continuum from normality to borderline personality disorder: 8% of the subjects met none of the criteria; 16% met one criterion; 17% met two; 12.5%, three; 13.7%, four; 8.4%, five; 5.6%, six; 9.3%, seven; 4.6%, eight; 4.6%, nine. Thirty-five of these 107 subjects (32.7%, 6 males, 29 females, mean age = 16.7 +/- 1.7) received a diagnosis of borderline personality disorder according to DSM IV criteria. The most frequent symptoms were paranoid ideation or dissociative symptoms (97.1%), affective instability (88.6%), inappropriate, intense anger (85.6%), suicidal gestures or automutilation (82.9%), followed by frantic efforts to avoid abandonment (77%), impulsivity (65.7%), unstable and intense relationships (62.9%), identity disturbance (60%), and emptiness (57.1%). The comparison between borderline and non-borderline subjects showed that all borderline personality disorder criteria discriminated significantly between the two groups. The high incidence of paranoid ideation (97.1%) and dissociative experiences (65.7%) in the borderline group suggests the pertinence of criterion 9 in the diagnosis of borderline personality disorder in adolescents. Two criteria of schizotypal personality disorder were also frequent in this group: 68.6% of the borderline group reported odd beliefs or magical thinking, in particular beliefs in clairvoyance or telepathy and 88.6% reported unusual perceptual experiences, in particular sensing the presence of a force or person and bodily illusions. Moreover, 31.4% of the borderline group reported transient "quasi" psychotic experiences, mainly "quasi" visual hallucinations. Auditory hallucinations or delusional ideas were not observed. This symptomatology suggests a "quasi" psychotic dimension of adolescent borderline personality disorder. Affective instability was the next most frequent symptom which was usually marked by a cyclothymic appearance. Comorbidity with major depressive disorder was high: 85.7% of the borderline subjects had a concurrent diagnosis of major depression versus 45.8% of the non-borderline subjects. Thus, major depression is more frequent than most of the borderline personality disorder criteria, with the exception of the already noted paranoid ideation and affective instability. Hypomanic symptoms were frequent in the borderline group (65.7%) as well as in the non-borderline group (38.8%). This symptomatology suggests that adolescent borderline personality disorder is linked to an attenuated bipolar spectrum characterised by major depressive episodes and soft signs of bipolarity. However, hypomanic symptoms, which were quite frequent in non-borderline subjects, might also be due to a mechanism of defence, i.e. the denial of depression. Comorbidity with anxiety disorders appeared also to be high: anxiety symptoms were found in 91.4% of the borderline subjects who reported symptoms of generalised anxiety disorder, panic disorder, and somatoform disorders. The overall clinical appearance of these borderline adolescents not referred for treatment seemed to be quite similar to that of borderline adolescents in clinical samples. This study shows that adolescent borderline personality disorder in non-clinical population is a serious disorder characterised by the importance of mental suffering and behavioural disturbances the disorganising power of which may fix the developmental process in a pathological pathway. Adolescent borderline personality disorder appears in this study to be strongly associated with major depressive disorder and at-risk behaviours linked to impulsivity, affective instability, and suicidal ideation. However, this study found an absence of precise cut-off between borderline and non-borderline subjects. Two factors might have contributed to the appearance of a continuum. First, some degree of impulsivity and instability in affectivity, self-images and interpersonal relationships is part of normal adolescence. (ABSTRACT TRUNCATED)

  16. [Metabolic intolerance to exercise].

    PubMed

    Arenas, J; Martín, M A

    2003-01-01

    Exercise intolerance (EI) is a frequent cause of medical attention, although it is sometimes difficult to come to a final diagnosis. However, there is a group of patients in whom EI is due to a metabolic dysfunction. McArdle's disease (type V glucogenosis) is due to myophosphorylase (MPL) deficiency. The ischemic exercise test shows a flat lactate curve. The most frequent mutations in the PYGM gene (MPL gene) in Spanish patients with MPL deficiency are R49X and W797R. Carnitine palmitoyltransferase (CPT) II deficiency is invariably associated to repetitive episodes of myoglobinuria triggered by exercise, cold, fever or fasting. The diagnosis depends on the demonstration of CPT II deficiency in muscle. The most frequent mutation in the CPT2 gene is the S113L. Patients with muscle adenylate deaminase deficiency usually show either a mild myopathy or no symptom. The diagnosis is based on the absence of enzyme activity in muscle and the lack of rise of ammonia in the forearm ischemic exercise test. The mutation Q12X in the AMPD1 gene is strongly associated with the disease. Exercise intolerance is a common complaint in patients with mitochondrial respiratory chain (MRC) deficiencies, although it is often overshadowed by other symptoms and signs. Only recently we have come to appreciate that exercise intolerance can be the sole presentation of defects in the mtDNA, particularly in complex I, complex III, complex IV, or in some tRNAs. In addition, myoglobinuria can be observed in patients under statin treatment, particularly if associated with fibrates, due to an alteration in the assembly of the complex IV of the MRC.

  17. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  18. DSM-5 illness anxiety disorder and somatic symptom disorder: Comorbidity, correlates, and overlap with DSM-IV hypochondriasis.

    PubMed

    Newby, Jill M; Hobbs, Megan J; Mahoney, Alison E J; Wong, Shiu Kelvin; Andrews, Gavin

    2017-10-01

    To investigate the reliability, validity and utility of DSM-5 illness anxiety disorder (IAD) and somatic symptom disorder (SSD), and explore their overlap with DSM-IV Hypochondriasis in a health anxious sample. Treatment-seeking patients with health anxiety (N=118) completed structured diagnostic interviews to assess DSM-IV Hypochondriasis, DSM-5 IAD, SSD, and comorbid mental disorders, and completed self-report measures of health anxiety, comorbid symptoms, cognitions and behaviours, and service utilization. IAD and SSD were more reliable diagnoses than Hypochondriasis (kappa estimates: IAD: 0.80, SSD: 0.92, Hypochondriasis: 0.60). 45% of patients were diagnosed with SSD, 47% with IAD, and 8% with comorbid IAD/SSD. Most patients with IAD fluctuated between seeking and avoiding care (61%), whereas care-seeking (25%) and care-avoidant subtypes were less common (14%). Half the sample met criteria for DSM-IV Hypochondriasis; of those, 56% met criteria for SSD criteria, 36% for IAD, and 8% for comorbid IAD/SSD. Compared to IAD, SSD was characterized by more severe health anxiety, somatic symptoms, depression, and higher health service use, and higher rates of major depressive disorder, panic disorder and agoraphobia. DSM-5 IAD and SSD classifications reliably detect more cases of clinically significant health anxiety than DSM-IV Hypochondriasis. The differences between IAD and SSD appear to be due to severity. Future research should explore the generalizability of these findings to other samples, and whether diagnostic status predicts treatment response and long-term outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. The use of alcohol use disorders identification test (AUDIT) in detecting alcohol use disorder and risk drinking in the general population: validation of AUDIT using schedules for clinical assessment in neuropsychiatry.

    PubMed

    Lundin, Andreas; Hallgren, Mats; Balliu, Natalja; Forsell, Yvonne

    2015-01-01

    The alcohol use disorders identification test (AUDIT) and AUDIT-Consumption (AUDIT-C) are commonly used in population surveys but there are few validations studies in the general population. Validity should be estimated in samples close to the targeted population and setting. This study aims to validate AUDIT and AUDIT-C in a general population sample (PART) in Stockholm, Sweden. We used a general population subsample age 20 to 64 that answered a postal questionnaire including AUDIT who later participated in a psychiatric interview (n = 1,093). Interviews using Schedules for Clinical Assessment in Neuropsychiatry was used as criterion standard. Diagnoses were set according to the fourth version of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV). Agreement between the diagnostic test and criterion standard was measured with area under the receiver operator characteristics curve (AUC). A total of 1,086 (450 men and 636 women) of the interview participants completed AUDIT. There were 96 individuals with DSM-IV-alcohol dependence, 36 DSM-IV-Alcohol Abuse, and 153 Risk drinkers. AUCs were for DSM-IV-alcohol use disorder 0.90 (AUDIT-C 0.85); DSM-IV-dependence 0.94 (AUDIT-C 0.89); risk drinking 0.80 (AUDIT-C 0.80); and any criterion 0.87 (AUDIT-C 0.84). In this general population sample, AUDIT and AUDIT-C performed outstanding or excellent in identifying dependency, risk drinking, alcohol use disorder, any disorder, or risk drinking. Copyright © 2015 by the Research Society on Alcoholism.

  20. The utilization of intravenous therapy programs in community long-term care nursing facilities.

    PubMed

    Weinberg, A D; Pals, J K; Wei, J Y

    1997-01-01

    To determine if non-federal Boston-area long-term care nursing facilities are actively using intravenous (IV) therapy as a form of treatment, the specific design of such programs and to assess the availability of central line IVs, percutaneous endoscopic gastrostomy (PEG) tubes and hypodermoclysis for hydration in this setting. DESIGN/SETTINGS: A prospective telephone survey of 100 Boston-area skilled nursing facilities, each with a minimum of 50 beds and representing a total of 12,763 beds, certified to provide both Medicaid (Title-19) and Medicare services, to ascertain their ability to provide IV and other modes of hydration for their residents. A series of questions were asked of a member of the staff knowledgeable in the operations of the nursing facility. Questions included whether an IV program was in existence, duration of the program, provider of IV training for nurses, presence of a subacute unit, whether IVs were administered in non-subacute areas, frequency of IV usage, the ability to manage central lines and the use of PEG tubes or hypodermoclysis for hydration. A total of 100 nursing facilities were surveyed between September and October of 1996. A total of 79 nursing facilities had active IV programs (79%) and 54 of those (68%) also managed central lines. However, in those facilities with active IV programs, 73% (N = 58) reported administering a total of less than five IVs per month. Training for 82% of the nursing facilities (N = 65) was by an outside vendor pharmacy and initial training ranged from one to three days in duration. Of the 19 nursing facilities with IV programs available only in subacute or equivalent units, only 26% (N = 5) did not allow direct transfer of residents from other wards into these units. Of the 79 nursing facilities having IV capability, a total of 91% (N = 72) have also used PEG tubes for hydration and nutritional needs although only 6% (N = 5) have ever used hypodermoclysis for hydration. The majority of nursing facilities in the Boston area provide IV programs for their residents, although in limited numbers on a monthly basis. Residents with central lines are admitted in the majority of these nursing facilities although total staff training time is only one to three days. The use of PEG tubes for hydration is quite frequent, although the use of hypodermoclysis was extremely low. Further work is necessary to fully elucidate the clinical implications of whether these programs decrease the need for acute hospitalization or are used mainly in the post-hospitalization (Medicare A-covered) period.

  1. Optical radiation hazards of laser welding processes. Part II: CO2 laser.

    PubMed

    Rockwell, R J; Moss, C E

    1989-08-01

    There has been an extensive growth within the last five years in the use of high-powered lasers in various metalworking processes. The two types of lasers used most frequently for laser welding/cutting processes are the Neodymium-yttrium-aluminum-garnet (Nd:YAG) and the carbon dioxide (CO2) systems. When such lasers are operated in an open beam configuration, they are designated as a Class IV laser system. Class IV lasers are high-powered lasers that may present an eye and skin hazard under most common exposure conditions, either directly or when the beam has been diffusely scattered. Significant control measures are required for unenclosed (open beam), Class IV laser systems since workers may be exposed to scattered or reflected beams during the operation, maintenance, and service of these lasers. In addition to ocular and/or skin exposure hazards, such lasers also may present a multitude of nonlaser beam occupational concerns. Radiant energy measurements are reported for both the scattered laser radiation and the plasma-related plume radiations released during typical high-powered CO2 laser-target interactions. In addition, the application of the nominal hazard zone (NHZ) and other control measures also are discussed with special emphasis on Class IV industrial CO2 laser systems.

  2. Delayed haemolysis secondary to treatment of severe malaria with intravenous artesunate: Report on the experience of a referral centre for tropical infections in Spain.

    PubMed

    Aldámiz-Echevarría Lois, Teresa; López-Polín, Ana; Norman, Francesca F; Monge-Maillo, Begoña; López-Vélez, Rogelio; Perez-Molina, Jose A

    Post-artesunate delayed haemolysis is described as hemolytic anemia presenting days after malaria treatment in hyperparasitemic patients. Physiopathological mechanisms and clinical manifestations have not been thoroughly characterised. We conducted a retrospective study of hospitalised malaria patients who received artemisinin derivatives from January 1, 2010 to December 31, 2015. 21 patients were included in the study: 11 travellers, 8 travellers visiting friends and relatives and 2 immigrants. Median age was 35.5 years (IQR: 25.7-44.8) and 11 were men. Eight patients received oral and 13 received intravenous (IV) artemisinin-based drugs. Follow-up after the malaria episode was available for 15 patients (12 with IV treatment). Four patients presented with delayed haemolysis 9-14 days after artesunate treatment; all had been admitted with severe malaria, were treated IV and had hyperparasitaemia (17%-33%). Other than hyperparasitaemia, no other factors were associated with artesunate haemolysis. Patients' outcomes were favourable and the only additional therapeutic measure needed was a blood transfusion. Delayed haemolysis is a frequent complication in hyperparasitemic malaria treated with IV artesunate. Follow-up is mandatory for at least 2 weeks after treatment initiation. This condition is potentially severe but does not appear to be life threatening. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Mutation screening of ASMT, the last enzyme of the melatonin pathway, in a large sample of patients with intellectual disability.

    PubMed

    Pagan, Cecile; Botros, Hany Goubran; Poirier, Karine; Dumaine, Anne; Jamain, Stéphane; Moreno, Sarah; de Brouwer, Arjan; Van Esch, Hilde; Delorme, Richard; Launay, Jean-Marie; Tzschach, Andreas; Kalscheuer, Vera; Lacombe, Didier; Briault, Sylvain; Laumonnier, Frédéric; Raynaud, Martine; van Bon, Bregje W; Willemsen, Marjolein H; Leboyer, Marion; Chelly, Jamel; Bourgeron, Thomas

    2011-01-20

    Intellectual disability (ID) is frequently associated with sleep disorders. Treatment with melatonin demonstrated efficacy, suggesting that, at least in a subgroup of patients, the endogenous melatonin level may not be sufficient to adequately set the sleep-wake cycles. Mutations in ASMT gene, coding the last enzyme of the melatonin pathway have been reported as a risk factor for autism spectrum disorders (ASD), which are often comorbid with ID. Thus the aim of the study was to ascertain the genetic variability of ASMT in a large cohort of patients with ID and controls. Here, we sequenced all exons of ASMT in a sample of 361 patients with ID and 440 controls. We then measured the ASMT activity in B lymphoblastoid cell lines (BLCL) of patients with ID carrying an ASMT variant and compared it to controls. We could identify eleven variations modifying the protein sequence of ASMT (ID only: N13H, N17K, V171M, E288D; controls only: E61Q, D210G, K219R, P243L, C273S, R291Q; ID and controls: L298F) and two deleterious splice site mutations (IVS5+2T>C and IVS7+1G>T) only observed in patients with ID. We then ascertained ASMT activity in B lymphoblastoid cell lines from patients carrying the mutations and showed significantly lower enzyme activity in patients carrying mutations compared to controls (p = 0.004). We could identify patients with deleterious ASMT mutations as well as decreased ASMT activity. However, this study does not support ASMT as a causative gene for ID since we observed no significant enrichment in the frequency of ASMT variants in ID compared to controls. Nevertheless, given the impact of sleep difficulties in patients with ID, melatonin supplementation might be of great benefit for a subgroup of patients with low melatonin synthesis.

  4. Lifetime and 12-month prevalence estimates for mental disorders in northeastern Germany: findings from the Study of Health in Pomerania.

    PubMed

    Asselmann, E; Beesdo-Baum, K; Hamm, A; Schmidt, C O; Hertel, J; Grabe, H J; Pané-Farré, C A

    2018-06-15

    Few epidemiological studies presented 12-month and lifetime prevalence estimates for DSM-IV mental disorders in the adult general population by sex and age up to very old age. From 2007 to 2010, DSM-IV mental disorders were assessed with the DIA-X/M-CIDI among N = 2400 participants (aged 29-89 years) from the Study of Health in Pomerania, an epidemiological study based on a two-stage stratified cluster sample randomly drawn from the adult general population in northeastern Germany. 36.3% of the sample was affected by any 12-month and 54.8% by any lifetime mental disorder. The most frequent diagnostic groups were anxiety (12-month: 14.8%, lifetime: 23.4%), substance use (12-month: 14.5%, lifetime: 25.0%), somatoform (12-month: 12.9%, lifetime: 20.4%) and depressive (12-month: 7.3%, lifetime: 18.6%) disorders. Except for substance use (higher prevalence in men) and bipolar disorders (comparable prevalence in men and women), higher 12-month and lifetime prevalence estimates were found in women vs. men. Moreover, lower 12-month and lifetime prevalence estimates were found in older (aged 60-74 or 75-89 years) vs. younger (aged 29-44 or 45-59 years) age groups. 22.6% (men: 21.1%, women: 23.9%) of those affected by any 12-month disorder met criteria for two and 13.6% (men: 9.6%, women: 16.9%) for three or more 12-month diagnoses. Similarly, 26.4% (men: 25.7%, women: 26.9%) of those affected by any lifetime disorder met criteria for two and 22.7% (men: 19.6%, women: 25.2%) for three or more lifetime diagnoses. Our findings demonstrate the frequency of mental disorders in northeastern Germany and emphasize the need for continued prevention and intervention efforts.

  5. Sequestration of Tellurium From Seawater by Ferromanganese Crusts: A XANES/EXAFS Perspective

    NASA Astrophysics Data System (ADS)

    Hein, J. R.; Bargar, J.; Koschinsky, A.; Dunham, R.; Halliday, A. N.

    2007-12-01

    Marine iron-oxyhydroxide/manganese-oxide crusts (Fe-Mn crusts) provide the richest known source of tellurium (Te). Te averages about 50 ppm in Fe-Mn crusts distributed globally, with concentrations locally up to 210 ppm. The sorption of Te onto Fe-Mn crusts likely controls the dominant redox species and concentration of Te in the global ocean (Hein et al., 2003). However, little is known about the mechanisms by which Te is sequestered by Fe-Mn crusts and Fe-Mn colloids in the water column, and then stabilized in the Fe/Mn oxyhydroxide/oxide framework. Two primary hypotheses are being tested: (a) Te(IV) is initially the predominant adsorbed species, which is subsequently oxidized on the Fe-oxyhydroxide and/or Mn oxide phases in natural systems and in sorption experiments. (b) Once oxidized, Te(VI) remains tightly bound to the Fe phase in Fe-Mn crusts as adsorbed surface complexes. These hypotheses are being examined by using the Stanford Synchrotron Radiation Laboratory's (SSRL) synchrotron-based XANES (x-ray absorption near-edge structure) spectroscopy to assess Te oxidation state in natural samples and samples in which Te(IV) and Te(VI) were sorbed onto synthetic and natural FeOOH and Mn oxides. EXAFS (extended x-ray absorption fine structure) spectroscopy is being used to resolve the local molecular-scale structure around Te in these same samples. Data have thus far been obtained for six Fe-Mn crusts from a variety of geographic locations and water depths of occurrence, with differing chemical compositions; and two model compounds, Te(IV) sorbed on FeOOH and Te(IV) sorbed on MnO2. XANES data show that for all six Fe-Mn crust samples, 85 to 100 percent of the Te occurs as Te(VI). For the model compounds, about 65 percent of the Te(IV) sorbed onto the MnO2 had oxidized to Te(VI) by the time (one week) the sample was analyzed, whereas Te sorbed onto FeOOH remained at about 100 percent Te(IV). The most striking result from the EXAFS data is that all spectra for the six Fe-Mn crust samples are virtually identical, regardless of location, depositional conditions, or chemical and mineralogical compositions. This uniformity indicates that the local structure around Te is similar for all samples and, therefore, the mode of incorporation of Te into the Fe-Mn crusts does not vary despite varying environments of formation. This implies that a single set of processes applies throughout the global ocean to the incorporation of Te into Fe-Mn crusts. Hein, J.R., Koschinsky, A., and Halliday, A.N., 2003, Geochim. Cosmochim. Acta 67: 1117-1127.

  6. Stability of cyclosporine solutions stored in polypropylene-polyolefin bags and polypropylene syringes.

    PubMed

    Li, Mengqing; Forest, Jean-Marc; Coursol, Christian; Leclair, Grégoire

    2011-09-01

    The stability of cyclosporine diluted to 0.2 or 2.5 mg/mL with 0.9% sodium chloride injection or 5% dextrose injection and stored in polypropylene-polyolefin containers or polypropylene syringes was evaluated. Intravenous cyclosporine solutions (0.2 and 2.5 mg/mL) were aseptically prepared and transferred to 250-mL polypropylene-polyolefin bags or 60-mL polypropylene syringes. Chemical stability was measured using a stability-indicating high-performance liquid chromatography (HPLC) assay. Physical stability was assessed by visual inspection and a dynamic light scattering (DLS) method. After 14 days, HPLC assay showed that the samples of i.v. cyclosporine stored in polypropylene-polyolefin bags remained chemically stable (>98% of initial amount remaining); the physical stability of the samples was confirmed by DLS and visual inspection. The samples stored in polypropylene syringes were found to contain an impurity (attributed to leaching of a syringe component by the solution) that could be detected by HPLC after 1 day; on further investigation, no leaching was detected when the syringes were exposed to undiluted i.v. cyclosporine 50 mg/mL for 10 minutes. Samples of i.v. cyclosporine solutions of 0.2 and 2.5 mg/mL diluted in 0.9% sodium chloride injection or 5% dextrose injection and stored at 25 °C in polypropylene-polyolefin bags were physically and chemically stable for at least 14 days. When stored in polypropylene syringes, the samples were contaminated by an impurity within 1 day; however, the short-term (i.e., ≤10 minutes) use of the syringes for the preparation and transfer of i.v. cyclosporine solution is considered safe.

  7. Characteristics of algal succession following rock scraping at Imwon area in the east coast of Korea

    NASA Astrophysics Data System (ADS)

    Kim, Young Dae; Ahn, Jung Kwan; Nam, Myung Mo; Lee, Chu; Yoo, Hyun Il; Yeon, Su Yeoung; Kim, Young Hwan; Kim, Jang Kyun; Choi, Jae Suk

    2016-12-01

    This study was conducted to clarify the characteristics of algal succession following rock scraping using hoe or high-pressure water sprayer in the period from June 2010 to April 2011. We divided the research area off the eastern coast of Korean near Imwon into 3 categories depending upon the severity of the barren ground, i.e., the urchin barren-affected, urchin barren-ongoing and urchin barren-free areas. In April 2011, in the urchin barren-affected area with 25 seaweed species, the cover percentage and importance value (IV) of crustose coralline algae were higher than those of other species. In the urchin barren-ongoing area with 33 seaweed species, crustose coralline algae (mean IV = 62%) as well as Sargassum sp. (mean IV = 28%), and Gelidium amansii (mean IV = 19%) were observed following rock scraping. In the urchin barren-free area where seaweed communities were relatively abundant with 42 species, a variety of algal species including G. amansii (mean IV = 32%) underwent algal succession. Overall, it was observed that, as an aspect of algal succession, the weaker the barren ground severity was, the more frequent and diverse the seaweeds were, and the more complex the succession pattern was in the study. As an aspect of recovering algal community, rock scraping using hoe was shown to be superior to the method using high-pressure water spraying. Therefore, we conclude that rock scraping using hoe is a very effective strategy for recovering the algal community in urchin barren-ongoing area.

  8. Molecular Diversity of Trypanosoma cruzi Detected in the Vector Triatoma protracta from California, USA

    PubMed Central

    Shender, Lisa A.; Lewis, Michael D.; Rejmanek, Daniel; Mazet, Jonna A. K.

    2016-01-01

    Background Trypanosoma cruzi, causative agent of Chagas disease in humans and dogs, is a vector-borne zoonotic protozoan parasite that can cause fatal cardiac disease. While recognized as the most economically important parasitic infection in Latin America, the incidence of Chagas disease in the United States of America (US) may be underreported and even increasing. The extensive genetic diversity of T. cruzi in Latin America is well-documented and likely influences disease progression, severity and treatment efficacy; however, little is known regarding T. cruzi strains endemic to the US. It is therefore important to expand our knowledge on US T. cruzi strains, to improve upon the recognition of and response to locally acquired infections. Methodology/Principle Findings We conducted a study of T. cruzi molecular diversity in California, augmenting sparse genetic data from southern California and for the first time investigating genetic sequences from northern California. The vector Triatoma protracta was collected from southern (Escondido and Los Angeles) and northern (Vallecito) California regions. Samples were initially screened via sensitive nuclear repetitive DNA and kinetoplast minicircle DNA PCR assays, yielding an overall prevalence of approximately 28% and 55% for southern and northern California regions, respectively. Positive samples were further processed to identify discrete typing units (DTUs), revealing both TcI and TcIV lineages in southern California, but only TcI in northern California. Phylogenetic analyses (targeting COII-ND1, TR and RB19 genes) were performed on a subset of positive samples to compare Californian T. cruzi samples to strains from other US regions and Latin America. Results indicated that within the TcI DTU, California sequences were similar to those from the southeastern US, as well as to several isolates from Latin America responsible for causing Chagas disease in humans. Conclusions/Significance Triatoma protracta populations in California are frequently infected with T. cruzi. Our data extend the northern limits of the range of TcI and identify a novel genetic exchange event between TcI and TcIV. High similarity between sequences from California and specific Latin American strains indicates US strains may be equally capable of causing human disease. Additional genetic characterization of Californian and other US T. cruzi strains is recommended. PMID:26797311

  9. Coverage and parental perceptions of influenza vaccination among parents of children aged 6 to 23 months in Hong Kong

    PubMed Central

    2013-01-01

    Background The impact of influenza on young children can be severe and even fatal. Influenza vaccination (IV) has been shown to be effective in reducing complications of influenza among children. This study investigated the prevalence and factors of IV among children aged 6-23 months in Hong Kong. Methods A sample of 401 Chinese parents of children aged 6-23 months were interviewed at local Maternal and Child Health Centers. Socio-demographic information, variables related to Health Belief Model, including perceptions about the child’s chance of contracting influenza, perceived harm of influenza on children, perceived benefits and side-effects of IV, having received recommendations from health professionals to uptake IV, and IV behaviors of the children were measured. Multivariate analysis was used to examine factors associated with IV behaviors of children. Results Only 9% of the children had ever been vaccinated. Among those parents who had heard of IV (92.0%), substantial proportions perceived that IV could reduce the risk of influenza-induced complications (70.5%), hospitalization (70.5%) and death (65.9%). Relatively few of the participants believed that IV had no side effects (17.1%) and even less had been recommended by health care professionals to uptake IV (10.6%). Results from multivariate analysis showed that physician recommendations were associated with a higher likelihood for IV among younger children, whilst parental perceptions of the side effects of IV was associated with a lower likelihood for IV. Conclusion The prevalence of IV among children aged 6-23 months in Hong Kong was very low. Promotion of IV with the component of physician recommendations and parents’ knowledge about IV safety for this group is warranted. PMID:24171947

  10. Macro- and microscale investigation of selenium speciation in Blackfoot river, Idaho sediments.

    PubMed

    Oram, Libbie L; Strawn, Daniel G; Marcus, Matthew A; Fakra, Sirine C; Möller, Gregory

    2008-09-15

    The transport and bioavailability of selenium in the environment is controlled by its chemical speciation. However, knowledge of the biogeochemistry and speciation of Se in streambed sediment is limited. We investigated the speciation of Se in sediment cores from the Blackfoot River (BFR), Idaho using sequential extractions and synchrotron-based micro-X-ray fluorescence (micro-SXRF). We collected micro-SXRF oxidation state maps of Se in sediments, which had not been done on natural sediment samples. Selective extractions showed that most Se in the sediments is present as either (1) nonextractable Se or (2) base extractable Se. Results from micro-SXRF showed three defined species of Se were present in all four samples: Se(-II,O), Se(IV), and Se(VI). Se(-II,O) was the predominant species in samples from one location, and Se(IV) was the predominant species in samples from a second location. Results from both techniques were consistent, and suggested that the predominant species were Se(-II) species associated with recalcitrant organic matter, and Se(IV) species tightly bound to organic materials. This information can be used to predict the biogeochemical cycling and bioavailability of Se in streambed sediment environments.

  11. GENES AS INSTRUMENTS FOR STUDYING RISK BEHAVIOR EFFECTS: AN APPLICATION TO MATERNAL SMOKING AND OROFACIAL CLEFTS

    PubMed Central

    Jugessur, Astanand; Murray, Jeffrey C.; Moreno, Lina; Wilcox, Allen; Lie, Rolv T.

    2011-01-01

    This study uses instrumental variable (IV) models with genetic instruments to assess the effects of maternal smoking on the child’s risk of orofacial clefts (OFC), a common birth defect. The study uses genotypic variants in neurotransmitter and detoxification genes relateded to smoking as instruments for cigarette smoking before and during pregnancy. Conditional maximum likelihood and two-stage IV probit models are used to estimate the IV model. The data are from a population-level sample of affected and unaffected children in Norway. The selected genetic instruments generally fit the IV assumptions but may be considered “weak” in predicting cigarette smoking. We find that smoking before and during pregnancy increases OFC risk substantially under the IV model (by about 4–5 times at the sample average smoking rate). This effect is greater than that found with classical analytic models. This may be because the usual models are not able to consider self-selection into smoking based on unobserved confounders, or it may to some degree reflect limitations of the instruments. Inference based on weak-instrument robust confidence bounds is consistent with standard inference. Genetic instruments may provide a valuable approach to estimate the “causal” effects of risk behaviors with genetic-predisposing factors (such as smoking) on health and socioeconomic outcomes. PMID:22102793

  12. Impact of the DSM-5 attention-deficit/hyperactivity disorder age-of-onset criterion in the US adolescent population.

    PubMed

    Vande Voort, Jennifer L; He, Jian-Ping; Jameson, Nicole D; Merikangas, Kathleen R

    2014-07-01

    The present study aims to compare the prevalence and clinical correlates of DSM-IV versus DSM-5-defined attention-deficit/hyperactivity disorder (ADHD) and subtypes in a nationally representative sample of US youth based on the age-of-onset criterion. The sample includes 1,894 participants 12 to 15 years of age from cross-sectional National Health and Nutrition Examination Survey (NHANES) surveys conducted from 2001 to 2004. Data on DSM-IV and DSM-5 criteria for ADHD were derived from administration of the parental ADHD module of the National Institute of Mental Health (NIMH) Diagnostic Interview Schedule for Children, Version IV (DISC-IV). Extension of the age-of-onset criterion from 7 to 12 years led to an increase in the prevalence rate of ADHD from 7.38% (DSM-IV) to 10.84% (DSM-5). Youth with later age of onset did not differ from those with earlier age of onset in terms of severity and patterns of comorbidity. However, the group with later age of onset was more likely to be from lower income and ethnic minority families. The comparability of the clinical significance of the early and later age-of-onset groups supports the DSM-5 extension of the age-of-onset criterion in ADHD. Published by Elsevier Inc.

  13. Sample data processing in an additive and reproducible taxonomic workflow by using character data persistently linked to preserved individual specimens

    PubMed Central

    Kilian, Norbert; Henning, Tilo; Plitzner, Patrick; Müller, Andreas; Güntsch, Anton; Stöver, Ben C.; Müller, Kai F.; Berendsohn, Walter G.; Borsch, Thomas

    2015-01-01

    We present the model and implementation of a workflow that blazes a trail in systematic biology for the re-usability of character data (data on any kind of characters of pheno- and genotypes of organisms) and their additivity from specimen to taxon level. We take into account that any taxon characterization is based on a limited set of sampled individuals and characters, and that consequently any new individual and any new character may affect the recognition of biological entities and/or the subsequent delimitation and characterization of a taxon. Taxon concepts thus frequently change during the knowledge generation process in systematic biology. Structured character data are therefore not only needed for the knowledge generation process but also for easily adapting characterizations of taxa. We aim to facilitate the construction and reproducibility of taxon characterizations from structured character data of changing sample sets by establishing a stable and unambiguous association between each sampled individual and the data processed from it. Our workflow implementation uses the European Distributed Institute of Taxonomy Platform, a comprehensive taxonomic data management and publication environment to: (i) establish a reproducible connection between sampled individuals and all samples derived from them; (ii) stably link sample-based character data with the metadata of the respective samples; (iii) record and store structured specimen-based character data in formats allowing data exchange; (iv) reversibly assign sample metadata and character datasets to taxa in an editable classification and display them and (v) organize data exchange via standard exchange formats and enable the link between the character datasets and samples in research collections, ensuring high visibility and instant re-usability of the data. The workflow implemented will contribute to organizing the interface between phylogenetic analysis and revisionary taxonomic or monographic work. Database URL: http://campanula.e-taxonomy.net/ PMID:26424081

  14. Variable rainfall intensity and tillage effects on runoff, sediment, and carbon losses from a loamy sand under simulated rainfall.

    PubMed

    Truman, C C; Strickland, T C; Potter, T L; Franklin, D H; Bosch, D D; Bednarz, C W

    2007-01-01

    The low-carbon, intensively cropped Coastal Plain soils of Georgia are susceptible to runoff, soil loss, and drought. Reduced tillage systems offer the best management tool for sustained row crop production. Understanding runoff, sediment, and chemical losses from conventional and reduced tillage systems is expected to improve if the effect of a variable rainfall intensity storm was quantified. Our objective was to quantify and compare effects of a constant (Ic) intensity pattern and a more realistic, observed, variable (Iv) rainfall intensity pattern on runoff (R), sediment (E), and carbon losses (C) from a Tifton loamy sand cropped to conventional-till (CT) and strip-till (ST) cotton (Gossypium hirsutum L.). Four treatments were evaluated: CT-Ic, CT-Iv, ST-Ic, and ST-Iv, each replicated three times. Field plots (n=12), each 2 by 3 m, were established on each treatment. Each 6-m2 field plot received simulated rainfall at a constant (57 mm h(-1)) or variable rainfall intensity pattern for 70 min (12-run ave.=1402 mL; CV=3%). The Iv pattern represented the most frequent occurring intensity pattern for spring storms in the region. Compared with CT, ST decreased R by 2.5-fold, E by 3.5-fold, and C by 7-fold. Maximum runoff values for Iv events were 1.6-fold higher than those for Ic events and occurred 38 min earlier. Values for Etot and Ctot for Iv events were 19-36% and 1.5-fold higher than corresponding values for Ic events. Values for Emax and Cmax for Iv events were 3-fold and 4-fold higher than corresponding values for Ic events. Carbon enrichment ratios (CER) were or=1.0 for CT plots (except for first 20 min). Maximum CER for CT-Ic, CT-Iv, ST-Ic, and ST-Iv were 2.0, 2.2, 1.0, and 1.2, respectively. Transport of sediment, carbon, and agrichemicals would be better understood if variable rainfall intensity patterns derived from natural rainfall were used in rainfall simulations to evaluate their fate and transport from CT and ST systems.

  15. Child Physical Abuse and Adult Mental Health: A National Study

    PubMed Central

    Sugaya, Luisa; Hasin, Deborah S.; Olfson, Mark; Lin, Keng-Han; Grant, Bridget F.; Blanco, Carlos

    2013-01-01

    This study characterizes adults who report being physically abused during childhood, and examines associations of reported type and frequency of abuse with adult mental health. Data were derived from the 2000–2001 and 2004–2005 National Epidemiologic Survey on Alcohol and Related Conditions, a large cross-sectional survey of a representative sample (N = 43,093) of the U.S. population. Weighted means, frequencies, and odds ratios of sociodemographic correlates and prevalence of psychiatric disorders were computed. Logistic regression models were used to examine the strength of associations between child physical abuse and adult psychiatric disorders adjusted for sociodemographic characteristics, other childhood adversities, and comorbid psychiatric disorders. Child physical abuse was reported by 8% of the sample and was frequently accompanied by other childhood adversities. Child physical abuse was associated with significantly increased adjusted odds ratios (AORs) of a broad range of DSM-IV psychiatric disorders (AOR = 1.16–2.28), especially attention-deficit hyperactivity disorder, posttraumatic stress disorder, and bipolar disorder. A dose-response relationship was observed between frequency of abuse and several adult psychiatric disorder groups; higher frequencies of assault were significantly associated with increasing adjusted odds. The long-lasting deleterious effects of child physical abuse underscore the urgency of developing public health policies aimed at early recognition and prevention. PMID:22806701

  16. Child physical abuse and adult mental health: a national study.

    PubMed

    Sugaya, Luisa; Hasin, Deborah S; Olfson, Mark; Lin, Keng-Han; Grant, Bridget F; Blanco, Carlos

    2012-08-01

    This study characterizes adults who report being physically abused during childhood, and examines associations of reported type and frequency of abuse with adult mental health. Data were derived from the 2000-2001 and 2004-2005 National Epidemiologic Survey on Alcohol and Related Conditions, a large cross-sectional survey of a representative sample (N = 43,093) of the U.S. population. Weighted means, frequencies, and odds ratios of sociodemographic correlates and prevalence of psychiatric disorders were computed. Logistic regression models were used to examine the strength of associations between child physical abuse and adult psychiatric disorders adjusted for sociodemographic characteristics, other childhood adversities, and comorbid psychiatric disorders. Child physical abuse was reported by 8% of the sample and was frequently accompanied by other childhood adversities. Child physical abuse was associated with significantly increased adjusted odds ratios (AORs) of a broad range of DSM-IV psychiatric disorders (AOR = 1.16-2.28), especially attention-deficit hyperactivity disorder, posttraumatic stress disorder, and bipolar disorder. A dose-response relationship was observed between frequency of abuse and several adult psychiatric disorder groups; higher frequencies of assault were significantly associated with increasing adjusted odds. The long-lasting deleterious effects of child physical abuse underscore the urgency of developing public health policies aimed at early recognition and prevention. Copyright © 2012 International Society for Traumatic Stress Studies.

  17. Dysfunctional parental styles perceived during childhood in outpatients with substance use disorders.

    PubMed

    Icick, Romain; Lauer, Sophie; Romo, Lucia; Dupuy, Gaël; Lépine, Jean-Pierre; Vorspan, Florence

    2013-12-15

    People who suffer from substance use disorders (SUDs) frequently report to have undergone childhood adversity that is often associated with father or mother dysfunction, or both. Yet that issue has been barely addressed in opiate dependent patients. Therefore we sought to evaluate parent-specific dysfunctional styles perceived during childhood in a clinical sample from an outpatient addiction treatment program using the Measure Of Parental Styles (MOPS) questionnaire. DSM-IV diagnoses of substance use disorders and history of suicide attempts, family structure and changes of caregiver during childhood were obtained from 159 consecutive outpatients, along with their perception of parental bonding with the MOPS, in which mother and father scores are separate. Mother neglect dimension was significantly correlated with an earlier age at onset of several substances' use, the number of prior hospitalizations and of lifetime suicide attempts. Most of these associations remained significant in multivariate models. This was the first assessment of a representative sample of outpatients with SUDs by the MOPS questionnaire. Given its excellent acceptance and its association with several key correlates of SUDs, it should be used to design specific interventions targeted at attachment and familial management as well as in research models on gene × environment interactions. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Differential Relationships between WISC-IV and WIAT-II Scales: An Evaluation of Potentially Moderating Child Demographics

    ERIC Educational Resources Information Center

    Konold, Timothy R.; Canivez, Gary L.

    2010-01-01

    Considerable debate exists regarding the accuracy of intelligence tests with members of different groups. This study investigated differential predictive validity of the "Wechsler Intelligence Scale for Children-Fourth Edition". Participants from the WISC-IV--WIAT-II standardization linking sample (N = 550) ranged in age from 6 through…

  19. Identification of yeast strains isolated from marcha in Sikkim, a microbial starter for amylolytic fermentation.

    PubMed

    Tsuyoshi, Naoko; Fudou, Ryosuke; Yamanaka, Shigeru; Kozaki, Michio; Tamang, Namrata; Thapa, Saroj; Tamang, Jyoti P

    2005-03-15

    Marcha or murcha is a traditional amylolytic starter used to produce sweet-sour alcoholic drinks, commonly called jaanr in the Himalayan regions of India, Nepal, Bhutan, and Tibet (China). The aim of this study was to examine the microflora of marcha collected from Sikkim in India, focusing on yeast flora and their roles. Twenty yeast strains were isolated from six samples of marcha and identified by genetic and phenotypic methods. They were first classified into four groups (Group I, II, III, and IV) based on physiological features using an API test. Phylogenetic, morphological, and physiological characterization identified the isolates as Saccharomyces bayanus (Group I); Candida glabrata (Group II); Pichia anomala (Group III); and Saccharomycopsis fibuligera, Saccharomycopsis capsularis, and Pichia burtonii (Group IV). Among them, the Group I, II, and III strains produced ethanol. The isolates of Group IV had high amylolytic activity. Because all marcha samples tested contained both starch degraders and ethanol producers, it was hypothesized that all four groups of yeast (Group I, II, III, and IV) contribute to starch-based alcohol fermentation.

  20. EPR and IR spectral investigations on some leafy vegetables of Indian origin

    NASA Astrophysics Data System (ADS)

    Prasuna, C. P. Lakshmi; Chakradhar, R. P. S.; Rao, J. L.; Gopal, N. O.

    2009-09-01

    EPR spectral investigations have been carried out on four edible leafy vegetables of India, which are used as dietary component in day to day life. In Rumex vesicarius leaf sample, EPR spectral investigations at different temperatures indicate the presence of anti-ferromagnetically coupled Mn(IV)-Mn(IV) complexes. EPR spectra of Trigonella foenum graecum show the presence of Mn ions in multivalent state and Fe 3+ ions in rhombic symmetry. EPR spectra of Basella rubra indicate the presence of Mn(IV)-O-Mn(IV) type complexes. The EPR spectra of Basella rubra have been studied at different temperatures. It is found that the spin population for the resonance signal at g = 2.06 obeys the Boltzmann distribution law. The EPR spectra of Moringa oliefera leaves show the presence of Mn 2+ ions. Radiation induced changes in free radical of this sample have also been studied. The FT-IR spectra of Basella rubra and Moringa oliefera leaves show the evidences for the protein matrix bands and those corresponding to carboxylic C dbnd O bonds.

  1. Clinical validation of three short forms of the Dutch Wechsler Memory Scale-Fourth Edition (WMS-IV-NL) in a mixed clinical sample.

    PubMed

    Bouman, Zita; Hendriks, Marc P H; Van Der Veld, William M; Aldenkamp, Albert P; Kessels, Roy P C

    2016-06-01

    The reliability and validity of three short forms of the Dutch version of the Wechsler Memory Scale-Fourth Edition (WMS-IV-NL) were evaluated in a mixed clinical sample of 235 patients. The short forms were based on the WMS-IV Flexible Approach, that is, a 3-subtest combination (Older Adult Battery for Adults) and two 2-subtest combinations (Logical Memory and Visual Reproduction and Logical Memory and Designs), which can be used to estimate the Immediate, Delayed, Auditory and Visual Memory Indices. All short forms showed good reliability coefficients. As expected, for adults (16-69 years old) the 3-subtest short form was consistently more accurate (predictive accuracy ranged from 73% to 100%) than both 2-subtest short forms (range = 61%-80%). Furthermore, for older adults (65-90 years old), the predictive accuracy of the 2-subtest short form ranged from 75% to 100%. These results suggest that caution is warranted when using the WMS-IV-NL Flexible Approach short forms to estimate all four indices. © The Author(s) 2015.

  2. Determining Optimal Waste Volume From an Intravenous Catheter

    PubMed Central

    Baker, Rachel B.; Summer, Suzanne S.; Lawrence, Michelle; Shova, Amy; McGraw, Catherine A.; Khoury, Jane

    2013-01-01

    Waste is blood drawn from an intravenous (IV) catheter to remove saline before obtaining a blood sample. This study examines the minimum waste volume resulting in an undiluted sample. A repeated measures design was used. Investigators placed an IV catheter in 60 healthy adults and obtained samples at baseline and following waste volume ranging from 0.5 mL to 3 mL. A random effects mixed model was used to determine the stabilizing point. For sodium and glucose measurements, this stabilizing point was 1 mL of waste. Knowing that only 1 mL of waste is needed will prevent clinicians from obtaining extra waste and discarding blood needlessly. PMID:23455970

  3. [Evolution of non-invasive ventilation in acute bronchiolitis].

    PubMed

    Toledo del Castillo, B; Fernández Lafever, S N; López Sanguos, C; Díaz-Chirón Sánchez, L; Sánchez da Silva, M; López-Herce Cid, J

    2015-08-01

    The aim of the study was to analyse the evolution, over a12-year period, of the use of non-invasive (NIV) and invasive ventilation (IV) in children admitted to a Paediatric Intensive Care Unit (PICU) due to acute bronchiolitis. A retrospective observational study was performed including all children who were admitted to the PICU requiring NIV or IV between 2001 and 2012. Demographic characteristics, ventilation assistance and clinical outcome were analysed. A comparison was made between the first six years and the last 6 years of the study. A total of 196 children were included; 30.1% of the subjects required IV and 93.3% required NIV. The median duration of IV was 9.5 days and NIV duration was 3 days. The median PICU length of stay was 7 days, and 2% of the patients died. The use of NIV increased from 79.4% in first period to 100% in the second period (P<.0001) and IV use decreased from 46% in first period to 22.6% in the last 6 years (P<.0001). Continuous positive airway pressure and nasopharyngeal tube were the most frequently used modality and interface, although the use of bi-level non-invasive ventilation (P<.001) and of nasal cannulas significantly increased (P<.0001) in the second period, and the PICU length of stay was shorter (P=.011). The increasing use of NIV in bronchiolitis in our PICU during the last 12 years was associated with a decrease in the use of IV and length of stay in the PICU. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

  4. Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

    PubMed Central

    Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

    1998-01-01

    Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

  5. Air Purity in Diving from Submarines. 1. Review and Preliminary Analyses

    DTIC Science & Technology

    1987-12-01

    Nathaniel Howard for technical assistance, and Susan Cecire for editorial assistance. iv INTRODUCTION The need for divers to use compressed air from...pneumatic control systems) and emergency submarine functions, and submarine interior air is frequently compressed back into the bank which will cycle...breathe the interior air for long periods, so why the concern for divers? First, the processes of compression (by multi-stage oil lubricated

  6. Speciation and determination of ultra trace amounts of inorganic tellurium in environmental water samples by dispersive liquid-liquid microextraction and electrothermal atomic absorption spectrometry.

    PubMed

    Najafi, Nahid Mashkouri; Tavakoli, Hamed; Alizadeh, Reza; Seidi, Shahram

    2010-06-18

    A simple and powerful method has been developed for the rapid and selective determination of Te(IV) and Te(VI), employing dispersive liquid-liquid microextraction combined with electrothermal atomic absorption spectrometry using palladium as permanent modifier. Under acidic conditions pH 1, only Te(IV) can form a complex with ammonium pyrrolidine dithiocarbamate (APDC) and therefore be extracted into fine droplets of carbon tetrachloride (extraction solvent) which are dispersed with ethanol into the water sample solution. After centrifugation, Te(IV) was determined in the sedimented organic phase while Te(VI) remained in the aqueous phase. Total inorganic tellurium was determined after the reduction of the Te(VI) to Te(IV). Te(VI) was calculated as the difference between the measured total inorganic tellurium and Te(IV) content. The effective parameters for improving the efficiency of microextraction process were investigated by using experimental and central composite designs. Under optimal conditions the enrichment factor was 125 and the calibration graph was linear in the range of 0.015-1 ng mL(-1) with detection limit and characteristic mass of 0.004 ng mL(-1) and 0.033 pg, respectively. The relative standard deviation for 0.5 ng mL(-1) of tellurium measurement was 3.6% (n=6) at ash and atomization temperature, 900 and 2600 degrees C, respectively. The recoveries of spiked Te(IV) and Te(VI) to the environmental water samples were 89.6-101.3% and 96.6-99.1%, respectively. The accuracy is also evaluated by applying the proposed method to certified reference material (NIST SRM 1643e), for which the result was in a good agreement with the certified values reported for this CRM (95% confidence level). 2010 Elsevier B.V. All rights reserved.

  7. A field study on chemistry, S(IV) oxidation rates and vertical transport during fog conditions

    NASA Astrophysics Data System (ADS)

    Joos, F.; Baltensperger, U.

    An extensive fog study was carried out in the central plateu of Switzerland. Ninety-seven fog samples were collected along with aerosol filter and cascade impactor samples, and measurements of O 3, SO 2, NO, NO x, PAN, temperature, and wind speed and direction. Maximum levels in fogwater were 4.3, 4.4., 0.033, 1.7, 0.5, 0.024 and 9.2 mmol ℓ -1 for Cl -, NO 3-, NO 2-, SO 42-, S(IV), oxalate and NH 4+, respectively. pH varied between 2.9 and 7.1. Sixteen additional elements were determined in the fog samples by ICP. The sum of the concentrations of SO 42- and S(IV) agreed very with the total sulfur concentration as determined by ICP. A substantial excess of S(IV) (up to 0.2 mmol ℓ -1) compared to Henry and acid-base equilibrium calculations was found, which can probably be attributed to complex formations with aldehydes. S(IV) oxidation rates of up to 650 nmol ℓ -1 s -1 with ozone and of up to 100 nmol ℓ -1 s -1 with NO 2 were calculated. S(IV) oxidation due to PAN, NO 2- and Fe(III) was of minor importance. A substantial fraction of the major ions was present in the intersitial aerosol (aerosol particles < 4 μm) even during fog conditions. High correlations were found for NH 4+, NO 32-. From their ratios in the fog water and the aerosol (< 4 μm) it could be concluded that at least 40% of NO 3- and 20% of NH 4+ in fog water was due to gas phase scavenging. Increasing concentrations in fog water were found during fog dissipation. Concentrations decreased with increasing height. A vertical transport model including turbulent diffusion and droplet sedimentation is introduced, which matches the experimental data of this vertical profile.

  8. Effects of humerus intraosseous versus intravenous amiodarone administration in a hypovolemic porcine model.

    PubMed

    Holloway, Cpt Monica M; Jurina, Cpt Shannan L; Orszag, Cpt Joshua D; Bragdon, Lt George R; Green, Lt Rustin D; Garcia-Blanco, Jose C; Benham, Brian E; Adams, Ltc Timothy S; Johnson, Don

    2016-01-01

    To compare the effects of amiodarone administration by humerus intraosseous (HIO) and intravenous (IV) routes on return of spontaneous circulation (ROSC), time to maximum concentration (Tmax), maximum plasma drug concentration (Cmax), time to ROSC, and mean concentrations over time in a hypovolemic cardiac arrest model. Prospective, between subjects, randomized experimental design. TriService Research Facility. Yorkshire-cross swine (n = 28). Swine were anesthetized and placed into cardiac arrest. After 2 minutes, cardiopulmonary resuscitation was initiated. After an additional 2 minutes, amiodarone 300 mg was administered via the HIO or the IV route. Blood samples were collected over 5 minutes. The samples were analyzed using high-performance liquid chromatography tandem mass spectrometry. ROSC, Tmax, Cmax, time to ROSC, and mean concentrations over time. There was no difference in ROSC between the HIO and IV groups; each had five achieve ROSC and two that did not (p = 1). There was no difference in Tmax (p = 0.501) or in Cmax between HIO and IV groups (p = 0.232). Means ± standard deviations in seconds were 94.3 ± 78.3 compared to 115.7 ± 87.3 in the IV versus HIO groups, respectively. The mean ± standard deviation in nanograms per milliliter for the HIO was 49,041 ± 21,107 and 74,258 ± 33,176 for the IV group. There were no significant differences between the HIO and IV groups relative to time to ROSC (p = 0.220). A repeated analysis of variance indicated that there were no significant differences between the groups relative to concentrations over time (p > 0.05). The humerus intraosseous provides rapid and reliable access to administer life-saving medications during cardiac arrest.

  9. Pharmacokinetics and selected pharmacodynamics of trazodone following intravenous and oral administration to horses undergoing fitness training.

    PubMed

    Knych, Heather K; Mama, Khursheed R; Steffey, Eugene P; Stanley, Scott D; Kass, Philip H

    2017-10-01

    OBJECTIVE To measure concentrations of trazodone and its major metabolite in plasma and urine after administration to healthy horses and concurrently assess selected physiologic and behavioral effects of the drug. ANIMALS 11 Thoroughbred horses enrolled in a fitness training program. PROCEDURES In a pilot investigation, 4 horses received trazodone IV (n = 2) or orally (2) to select a dose for the full study; 1 horse received a vehicle control treatment IV. For the full study, trazodone was initially administered IV (1.5 mg/kg) to 6 horses and subsequently given orally (4 mg/kg), with a 5-week washout period between treatments. Blood and urine samples were collected prior to drug administration and at multiple time points up to 48 hours afterward. Samples were analyzed for trazodone and metabolite concentrations, and pharmacokinetic parameters were determined; plasma drug concentrations following IV administration best fit a 3-compartment model. Behavioral and physiologic effects were assessed. RESULTS After IV administration, total clearance of trazodone was 6.85 ± 2.80 mL/min/kg, volume of distribution at steady state was 1.06 ± 0.07 L/kg, and elimination half-life was 8.58 ± 1.88 hours. Terminal phase half-life was 7.11 ± 1.70 hours after oral administration. Horses had signs of aggression and excitation, tremors, and ataxia at the highest IV dose (2 mg/kg) in the pilot investigation. After IV drug administration in the full study (1.5 mg/kg), horses were ataxic and had tremors; sedation was evident after oral administration. CONCLUSIONS AND CLINICAL RELEVANCE Administration of trazodone to horses elicited a wide range of effects. Additional study is warranted before clinical use of trazodone in horses can be recommended.

  10. Low immunogenicity of tocilizumab in patients with rheumatoid arthritis.

    PubMed

    Burmester, Gerd R; Choy, Ernest; Kivitz, Alan; Ogata, Atsushi; Bao, Min; Nomura, Akira; Lacey, Stuart; Pei, Jinglan; Reiss, William; Pethoe-Schramm, Attila; Mallalieu, Navita L; Wallace, Thomas; Michalska, Margaret; Birnboeck, Herbert; Stubenrauch, Kay; Genovese, Mark C

    2017-06-01

    Subcutaneous (SC) and intravenous formulations of tocilizumab (TCZ) are available for the treatment of patients with rheumatoid arthritis (RA), based on the efficacy and safety observed in clinical trials. Anti-TCZ antibody development and its impact on safety and efficacy were evaluated in adult patients with RA treated with intravenous TCZ (TCZ-IV) or TCZ-SC as monotherapy or in combination with conventional synthetic disease-modifying antirheumatic drugs (csDMARDs). Data from 5 TCZ-SC and 8 TCZ-IV phase III clinical trials and 1 TCZ-IV clinical pharmacology safety study (>50 000 samples) were pooled to assess the immunogenicity profile of TCZ-SC and TCZ-IV (8974 total patients). The analysis included antidrug antibody (ADA) measurement following TCZ-SC or TCZ-IV treatment as monotherapy or in combination with csDMARDs, after dosing interruptions or in TCZ-washout samples, and the correlation of ADAs with clinical response, adverse events or pharmacokinetics (PK). The proportion of patients who developed ADAs following TCZ-SC or TCZ-IV treatment was 1.5% and 1.2%, respectively. ADA development was also comparable between patients who received TCZ monotherapy and those who received concomitant csDMARDs (0.7-2.0%). ADA development did not correlate with PK or safety events, including anaphylaxis, hypersensitivity or injection-site reactions, and no patients who developed ADAs had loss of efficacy. The immunogenicity risk of TCZ-SC and TCZ-IV treatment was low, either as monotherapy or in combination with csDMARDs. Anti-TCZ antibodies developed among the small proportion of patients had no evident impact on PK, efficacy or safety. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  11. The effect of draft DSM-V criteria on posttraumatic stress disorder prevalence.

    PubMed

    Calhoun, Patrick S; Hertzberg, Jeffrey S; Kirby, Angela C; Dennis, Michelle F; Hair, Lauren P; Dedert, Eric A; Beckham, Jean C

    2012-12-01

    This study was designed to examine the concordance of proposed DSM-V posttraumatic stress disorder (PTSD) criteria with DSM-IV classification rules and examine the impact of the proposed DSM-V PTSD criteria on prevalence. The sample (N = 185) included participants who were recruited for studies focused on trauma and health conducted at an academic medical center and VA medical center in the southeastern United States. The prevalence and concordance between DSM-IV and the proposed DSM-V classifications were calculated based on results from structured clinical interviews. Prevalence rates and diagnostic efficiency indices including sensitivity, specificity, area under the curve (AUC), and Kappa were calculated for each of the possible ways to define DSM-V PTSD. Ninety-five percent of the sample reported an event that met both DSM-IV PTSD Criterion A1 and A2, but only 89% reported a trauma that met Criterion A on DSM-V. Results examining concordance between DSM-IV and DSM-V algorithms indicated that several of the algorithms had AUCs above 0.90. The requirement of two symptoms from both Clusters D and E provided strong concordance to DSM-IV (AUC = 0.93; Kappa = 0.86) and a greater balance between sensitivity and specificity than requiring three symptoms in both Clusters D and E. Despite several significant changes to the diagnostic criteria for PTSD for DSM-V, several possible classification rules provided good concordance with DSM-IV. The magnitude of the impact of DSM-V decision rules on prevalence will be largely affected by the DSM-IV PTSD base rate in the population of interest. © 2012 Wiley Periodicals, Inc.

  12. The Haemophilus influenzae Hap Autotransporter Binds to Fibronectin, Laminin, and Collagen IV

    PubMed Central

    Fink, Doran L.; Green, Bruce A.; St. Geme III, Joseph W.

    2002-01-01

    Nontypeable Haemophilus influenzae (NTHI) initiates infection by colonizing the upper respiratory tract mucosa. NTHI disease frequently occurs in the context of respiratory tract inflammation, where organisms encounter damaged epithelium and exposed basement membrane. In this study, we examined interactions between the H. influenzae Hap adhesin and selected extracellular matrix proteins. Hap is an autotransporter protein that undergoes autoproteolytic cleavage, with release of the adhesive passenger domain, Haps, from the bacterial cell surface. We found that Hap promotes bacterial adherence to purified fibronectin, laminin, and collagen IV and that Hap-mediated adherence is enhanced by inhibition of autoproteolysis. Adherence is inhibited by pretreatment of bacteria with a polyclonal antiserum recognizing Haps. Purified Haps binds with high affinity to fibronectin, laminin, and collagen IV but not to collagen II. Binding of Haps to fibronectin involves interaction with the 45-kDa gelatin-binding domain but not the 30-kDa heparin-binding domain of fibronectin. Taken together, these observations suggest that interactions between Hap and extracellular matrix proteins may play an important role in NTHI colonization of the respiratory tract. PMID:12183535

  13. A Prospective Study of the Concordance of DSM-IV and DSM-5 Diagnostic Criteria for Autism Spectrum Disorder.

    PubMed

    Mazurek, Micah O; Lu, Frances; Symecko, Heather; Butter, Eric; Bing, Nicole M; Hundley, Rachel J; Poulsen, Marie; Kanne, Stephen M; Macklin, Eric A; Handen, Benjamin L

    2017-09-01

    The transition from DSM-IV to DSM-5 criteria for autism spectrum disorder (ASD) sparked considerable concern about the potential implications of these changes. This study was designed to address limitations of prior studies by prospectively examining the concordance of DSM-IV and final DSM-5 criteria on a consecutive sample of 439 children referred for autism diagnostic evaluations. Concordance and discordance were assessed using a consistent diagnostic battery. DSM-5 criteria demonstrated excellent overall specificity and good sensitivity relative to DSM-IV criteria. Sensitivity and specificity were strongest for children meeting DSM-IV criteria for autistic disorder, but poor for those meeting criteria for Asperger's disorder and pervasive developmental disorder. Higher IQ, older age, female sex, and less pronounced ASD symptoms were associated with greater discordance.

  14. Study of uranium oxidation states in geological material.

    PubMed

    Pidchenko, I; Salminen-Paatero, S; Rothe, J; Suksi, J

    2013-10-01

    A wet chemical method to determine uranium (U) oxidation states in geological material has been developed and tested. The problem faced in oxidation state determinations with wet chemical methods is that U redox state may change when extracted from the sample material, thereby leading to erroneous results. In order to quantify and monitor U redox behavior during the acidic extraction in the procedure, an analysis of added isotopic redox tracers, (236)U(VI) and (232)U(IV), and of variations in natural uranium isotope ratio ((234)U/(238)U) of indigenous U(IV) and U(VI) fractions was performed. Two sample materials with varying redox activity, U bearing rock and U-rich clayey lignite sediment, were used for the tests. The Fe(II)/Fe(III) redox-pair of the mineral phases was postulated as a potentially disturbing redox agent. The impact of Fe(III) on U was studied by reducing Fe(III) with ascorbic acid, which was added to the extraction solution. We observed that ascorbic acid protected most of the U from oxidation. The measured (234)U/(238)U ratio in U(IV) and U(VI) fractions in the sediment samples provided a unique tool to quantify U oxidation caused by Fe(III). Annealing (sample heating) to temperatures above 500 °C was supposed to heal ionizing radiation induced defects in the material that can disturb U redox state during extraction. Good agreement between two independent methods was obtained for DL-1a material: an average 38% of U(IV) determined by redox tracer corrected wet chemistry and 45% for XANES. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. A reflectance flow-through thionine sol-gel sensor for the determination of Se(IV).

    PubMed

    Carvalhido, Joana A E; Almeida, Agostinho A; Araújo, Alberto N; Montenegro, Maria C B S M

    2010-01-01

    In this work, a reversible sensor to assess the total Se(IV) content in samples is described. Pre-activated glass slides were spin-coated with 100 microL of a 20-h aged sol-gel mixture of 1 mL of tetramethoxysilane, 305 microL of 50 mmol L(-1) HCl and 2.0 mg of thionine. The flow-cell consisted of one of those slides as a window, and was filled with beads of a polystyrene anionic exchange resin to retain Se(IV) in the form of selenite ions. A reflectance transduction scheme at a wavelength of 596 nm was adopted. The cell was coupled to a multicommutation flow system where a programmed volume of a sample solution and 373 microL of 0.4 mmol L(-1) iodide in a 1.6 mol L(-1) HCl solution were sequentially inserted into the cell. The iodine produced from the reaction of retained Se(IV) with iodide bleached the blue color of thionine. Considering a sample volume of 2.30 mL, with which the preconcentration step was minimized, a linear dynamic working range between 1.5 to 20 microg mL(-1) and a detection limit of 0.29 microg mL(-1) were obtained. The sensor enabled us to perform approximately 200 assays, and provided results similar to those of electrothermal atomic absorption spectrometry.

  16. Seeing the forest for the trees: prevalence of low scores on the Wechsler Intelligence Scale for Children, fourth edition (WISC-IV).

    PubMed

    Brooks, Brian L

    2010-09-01

    Low scores across a battery of tests are common in healthy people and vary by demographic characteristics. The purpose of the present article was to present the base rates of low scores for the Wechsler Intelligence Scale for Children, fourth edition (WISC-IV; D. Wechsler, 2003). Participants included 2,200 children and adolescents between 6 and 16 years of age from the WISC-IV U.S. standardization sample. Measures considered in the base rates analyses included the 10 core subtests and the 4 index scores. Analyses were conducted for the entire standardization sample as well as stratified by different classifications of intelligence and different years of parental education. In the total sample, it is uncommon to have 6 or more subtest scores or 2 or more Index scores

  17. High Energy Electron Radiation Degradation of Gallium Arsenide Solar Cells.

    DTIC Science & Technology

    1986-03-01

    Subroutine Print Instruct ions Print / Completed/ Sample Ch . 0 Return Calculate C1 6 Print C1 IISample Ch . 2 70 -j.. .,.1-I.,.... ,.L.L...PLOTTER * 270 * AND THE CONNECTION DIAGRAM FOR THE SYSTEM MAY * 280 " * MAY BE FOUND IN CH 2, FIGURE (3). THE GPIB * 290’ * DRIVER IS REPRODUCED FROM REF...PLOT I-V CURVE ON HP 7845 PLOTTER." 2180 PRINT 2190 PRINT ř. PLOT I-V CURVE ON RGB MONITOR." 2200 PRINT 2210 PRINT Ś. WRITE I-V DATA TO FLOPPY DISK

  18. Impact of dietary fat source and concentration and daily fatty acid intake on the composition of carcass fat and iodine value sampled in three regions of the pork carcass.

    PubMed

    Kellner, T A; Prusa, K J; Patience, J F

    2014-12-01

    The increased inclusion of unsaturated fats in pig diets has raised issues related to pork carcass fat quality. The objective of this experiment was to more precisely measure how differing levels of daily fatty acid intake alters the fatty acid composition in 3 different fat depots. A total of 42 gilts and 21 barrows (PIC 337×C22/29) with an average initial weight of 77.80±0.38 kg were allotted randomly based on sex and BW to 7 treatments: 3 and 6% of each of tallow (TAL; iodine value [IV]=41.9), choice white grease (CWG; IV=66.5), or corn oil (CO; IV=123.1) and a control (CNTR) corn-soybean meal-based diet with no added fat. Pigs were individually housed to allow accurate measurement of individual feed intake, in particular, daily dietary fatty acid and energy intake. Fat samples were collected from the jowl, belly, and loin at slaughter. Diet and carcass fat samples were analyzed for IV. Belly weights were recorded at slaughter along with a subjective belly firmness score (1=firmest to 3=least firm). Carcass lipid IV was increased (P<0.001) by increasing the degree of unsaturation of the dietary fat source (66.8, 70.3, and 76.3 for TAL, CWG, and CO, respectively). Carcass lipid IV for TAL and CWG was not affected (P>0.05) by inclusion levels; however, carcass lipid IV was greater (P<0.001) in pigs fed 6 than 3% CO (80.0 vs. 72.6), and carcasses of gilts had greater IV (P<0.001) than carcasses of barrows (71.5 vs. 69.1). Increasing the level of TAL and CO but not CWG from 3 to 6% decreased the apparent total tract digestibility of GE, resulting in a source×level interaction (P<0.05). Dietary fat source had no effect (P≥0.66) on apparent total tract digestibility of either DM or GE, but feeding 6% dietary fat increased G:F (P=0.006) over pigs fed 3% fat (0.358 vs. 0.337). Of all the fatty acids measured, only linoleic acid intake presented a reasonable coefficient of determination (R2=0.61). Overall, IV product (IVP) was approximately equal to linoleic acid intake as a predictor of carcass IV (R2=0.93 vs. R2=0.94). When inclusion of dietary fat and PUFA intake increased, IVP placed more emphasis on the dietary fat inclusion level rather than the dietary fat composition. Linoleic acid intake corrected the overemphasis placed on dietary fat inclusion by IVP. To conclude, linoleic acid intake showed a strong relationship with carcass IV and can be used as a predictor.

  19. Pediatric procedural sedation with ketamine: time to discharge after intramuscular versus intravenous administration.

    PubMed

    Ramaswamy, Preeti; Babl, Franz E; Deasy, Conor; Sharwood, Lisa N

    2009-02-01

    Ketamine is an attractive agent for pediatric procedural sedation. There are limited data on time to discharge comparing intramuscular (IM) vs. intravenous (IV) ketamine. The authors set out to determine whether IM or IV ketamine leads to quicker discharge from the emergency department (ED) and how side effect profiles compare. All patients who had received ketamine IM or IV at a tertiary children's hospital ED during the 3-year study period (2004-2007) were identified. Prospective sedation registry data, retrospective medical records, and administrative data were reviewed for drug dosages, use of additional agents, time of drug administration to discharge, total ED time (triage to discharge), and adverse events. A subgroup analysis for patients requiring five or fewer sutures (short suture group) was performed. A total of 229 patients were enrolled (60% male) with median age of 2.8 years (IQR =1.8-4.3 years) and median weight of 15.7 kg (range = 8.7-74 kg). Ketamine was most frequently employed for laceration repair (80%) and foreign body removal (9%). Overall, 48% received ketamine IM and 52% received it IV. In the short-suture subgroup, 52% received ketamine IM, while 48% received it IV. Multivariate linear regression analysis determined time from drug administration to patient discharge as 21 minutes shorter for IV compared with IM administration, adjusted for age and number of additional doses (R(2) = -0.35; 95% CI = -0.5 to -0.19; p < 0.001). Total time in the ED (triage to discharge) comparing IV versus IM administration, adjusting for age and gender and number of additional doses, was not significantly different (p = 0.16). In the short-suture subgroup, time to discharge from administration was also shorter in the IV ketamine group (R(2) = -0.454; 95%CI = -0.66 to -0.25; p < 0.001) but similar for total time in ED (p = 0.16). Overall, adverse events occurred in 35% (95% CI = 27% to 45%) of the IM group and 20% (95% CI = 13% to 28%) of the IV group (p = 0.01). Only one patient required brief bag-mask ventilation. In this institution, time from drug injection to discharge was shorter in the IV compared to IM ketamine group, both overall and for the short-suture group. However, time from triage to discharge was similar.

  20. Multimarker Quantitative Real-Time PCR Detection of Circulating Melanoma Cells in Peripheral Blood: Relation to Disease Stage in Melanoma Patients

    PubMed Central

    Koyanagi, Kazuo; Kuo, Christine; Nakagawa, Taku; Mori, Takuji; Ueno, Hideaki; Lorico, Arnulfo R.; Wang, He-Jing; Hseuh, Eddie; O’Day, Steven J.; Hoon, Dave S.B.

    2010-01-01

    Background Detection of melanoma cells in circulation may be important in assessing tumor progression. The objective of this study was to develop a specific, reliable, multimarker quantitative real-time reverse transcription-PCR (qRT) assay for detecting melanoma cells in patients’ blood. Methods We developed qRT assays for the mRNA of four melanoma-associated markers: MART-1, GalNAc-T, PAX-3, and MAGE-A3. In optimization studies, we tested 17 melanoma cell lines and 49 peripheral blood leukocyte (PBL) samples from volunteers. We performed RNA and melanoma cell dilution studies to assess the detection limits and imprecision of the assays. We measured the mRNAs in blood specimens from 94 melanoma patients [American Joint Committee on Cancer (AJCC) stage I, n = 20; II, n = 20; III, n = 32; IV, n = 22]. Results All markers were frequently detected in melanoma cell lines, whereas none of the markers was detected in PBLs from volunteers. The qRT assay could detect 1 melanoma cell in 107 PBLs in the melanoma cell-dilution studies. Markers were detected in 15%, 30%, 75%, and 86% of melanoma patients with AJCC stage I, II, III, and IV disease, respectively. The number of positive markers and AJCC stage were significantly correlated (Spearman correlation coefficient = 0.58; P <0.0001). Conclusions Multimarker qRT can detect circulating melanoma cells in blood. Measurement of the studied molecular markers in blood may be useful in detection of metastasis and monitoring treatment response of melanoma patients. PMID:15817820

  1. Effects of pretreatment with dexamethasone or levothyroxine sodium on endotoxin-induced alterations in glucose and insulin dynamics in horses.

    PubMed

    Tóth, Ferenc; Frank, Nicholas; Geor, Raymond J; Boston, Raymond C

    2010-01-01

    To investigate the effects of dexamethasone or levothyroxine sodium on endotoxin-induced alterations in glucose and insulin dynamics. 24 horses. Horses were randomly allocated to 3 treatment groups and received 48 mg of levothyroxine mixed with 200 g of oats, 20 mg of dexamethasone plus oats, or oats alone (control) for 15 days, followed by IV infusion of lipopolysaccharide (20 ng/kg) while individually housed in stalls. Frequently sampled IV glucose tolerance tests were performed prior to pretreatment, after pretreatment, and 20 hours after lipopolysaccharide administration. Area under the curve for plasma glucose and serum insulin concentrations was calculated, and minimal model analyses were performed. Significant treatment-by-time effects were detected for insulin sensitivity (SI) and area under the curve for glucose and insulin in the 15-day pretreatment period. Insulin sensitivity significantly decreased over time in all treatment groups, with the largest decrease detected in the dexamethasone group. Administration of lipopolysaccharide further decreased mean SI by 71% and 63% in the dexamethasone and control groups, respectively, but did not affect horses in the levothyroxine group. Mean SI was the lowest in the dexamethasone group, but percentage reduction was the same for dexamethasone and control groups. Insulin sensitivity decreased during the pretreatment period in all 3 groups, indicating that hospitalization affected glucose and insulin dynamics. Dexamethasone significantly lowered SI, and endotoxemia further exacerbated insulin resistance. In contrast, there was no additional effect of endotoxemia on SI in horses pretreated with levothyroxine, suggesting that this treatment prevented endotoxemia-induced insulin resistance.

  2. Short Communication: Transplacental Nucleoside Analogue Exposure and Mitochondrial Parameters in HIV-Uninfected Children

    PubMed Central

    Brogly, Susan B.; DiMauro, Salvatore; Van Dyke, Russell B.; Williams, Paige L.; Naini, Ali; Libutti, Daniel E.; Choi, Julia; Chung, Michelle

    2011-01-01

    Abstract Transplacental nucleoside analogue exposure can affect infant mitochondrial DNA (mtDNA). We evaluated mitochondria in peripheral blood mononuclear cells of children with and without clinical signs of mitochondrial dysfunction (MD) and antiretroviral (ARV) exposure. We previously identified 20 children with signs of MD (cases) among 1037 HIV-uninfected children born to HIV-infected women. We measured mtDNA copies/cell and oxidative phosphorylation (OXPHOS) NADH dehydrogenase (complex I) and cytochrome c oxidase (complex IV) protein levels and enzyme activities, determined mtDNA haplogroups and deletions in 18 of 20 cases with stored samples and in sex- and age-matched HIV-uninfected children, both ARV exposed and unexposed, (1) within 18 months of birth and (2) at the time of presentation of signs of MD. In specimens drawn within 18 months of birth, mtDNA levels were higher and OXPHOS protein levels and enzyme activities lower in cases than controls. In contrast, at the time of MD presentation, cases and ARV-exposed controls had lower mtDNA levels, 214 and 215 copies/cell, respectively, than ARV-unexposed controls, 254 copies/cell. OXPHOS protein levels and enzyme activities were lower in cases than exposed controls, and higher in cases than unexposed controls, except for complex IV activity, which was higher in cases. Haplotype H was less frequent among cases (6%) than controls (31%). No deletions were found. The long-term significance of these small but potentially important alterations should continue to be studied as these children enter adolescence and adulthood. PMID:21142587

  3. Characteristics of children with elevated symptoms of mania: the Longitudinal Assessment of Manic Symptoms (LAMS) Study

    PubMed Central

    Findling, Robert L.; Youngstrom, Eric A.; Fristad, Mary A.; Birmaher, Boris; Kowatch, Robert A.; Arnold, L. Eugene; Frazier, Thomas W.; Axelson, David; Ryan, Neal; Demeter, Christine; Gill, Mary Kay; Fields, Benjamin; Depew, Judith; Kennedy, Shawn M.; Marsh, Linda; Rowles, Brieana M.; Horwitz, Sarah McCue

    2011-01-01

    Objective To examine differences in psychiatric symptomatology, diagnoses, demographics, functioning, and psychotropic medication exposure in children with elevated symptoms of mania (ESM+) compared to youth without ESM (ESM−). Method Guardians of consecutively ascertained new outpatients 6 to 12 years of age were asked to complete the Parent General Behavior Inventory-10 Item Mania Scale (PGBI-10M). Patients with scores ≥ 12 on the PGBI-10M (ESM+) and a matched sample of screen negatives (ESM−) were invited to participate. Results 707 children [621 ESM+, 86 ESM−; mean age 9.4 (2.0) years] were evaluated. The ESM+ group, compared to the ESM− group, more frequently met DSM-IV criteria for a mood disorder (p< 0.001), bipolar spectrum disorders (BPSD, p< 0.001), and disruptive behavior disorders (p<0.01). Furthermore, they showed poorer overall functioning and more severe manic, depressive, attention deficit/hyperactivity, disruptive behavioral, and anxiety symptoms. Nevertheless, rates of BPSD were relatively low in the ESM+ group (25%), with almost half of these BPSD patients (12.1% of ESM+) meeting DSM-IV criteria for bipolar disorder not otherwise specified (BP-NOS). ESM+ children with BPSD had significantly more: current prescriptions for antipsychotics, mood stabilizers and anticonvulsants; psychiatric hospitalizations, and biological parents with elevated mood; and were lower functioning compared to ESM+ children without BPSD. Conclusion Although ESM+ was associated with higher rates of BPSD than ESM−, 75% of ESM+ children did not meet criteria for BSPD. Results suggest longitudinal assessment is needed to examine which factors are associated with diagnostic evolution to BPSD in children with ESM+. PMID:21034685

  4. Preanalytical management: serum vacuum tubes validation for routine clinical chemistry.

    PubMed

    Lima-Oliveira, Gabriel; Lippi, Giuseppe; Salvagno, Gian Luca; Montagnana, Martina; Picheth, Geraldo; Guidi, Gian Cesare

    2012-01-01

    The validation process is essential in accredited clinical laboratories. Aim of this study was to validate five kinds of serum vacuum tubes for routine clinical chemistry laboratory testing. Blood specimens from 100 volunteers in five different serum vacuum tubes (Tube I: VACUETTE, Tube II: LABOR IMPORT, Tube III: S-Monovette, Tube IV: SST and Tube V: SST II) were collected by a single, expert phlebotomist. The routine clinical chemistry tests were analyzed on cobas 6000 module. The significance of the differences between samples was assessed by paired Student's t-test after checking for normality. The level of statistical significance was set at P < 0.005. Finally, the biases from Tube I, Tube II, Tube III, Tube IV and Tube V were compared with the current desirable quality specifications for bias (B), derived from biological variation. Basically, our validation will permit the laboratory or hospital managers to select the brand's vacuum tubes validated according him/her technical or economical reasons, in order to perform the following laboratory tests: glucose, total cholesterol, high density lipoprotein-cholesterol, triglycerides, total protein, albumin, blood urea nitrogen, uric acid, alkaline phosphatise, aspartate aminotransferase, gamma-glutamyltransferase, lactate dehydrogenase, creatine kinase, total bilirubin, direct bilirubin, calcium, iron, sodium and potassium. On the contrary special attention will be required if the laboratory already performs creatinine, amylase, phosphate and magnesium determinations and the quality laboratory manager intend to change the serum tubes. We suggest that laboratory management should both standardize the procedures and frequently evaluate the quality of in vitro diagnostic devices.

  5. Preanalytical management: serum vacuum tubes validation for routine clinical chemistry

    PubMed Central

    Lima-Oliveira, Gabriel; Lippi, Giuseppe; Salvagno, Gian Luca; Montagnana, Martina; Picheth, Geraldo; Guidi, Gian Cesare

    2012-01-01

    Introduction The validation process is essential in accredited clinical laboratories. Aim of this study was to validate five kinds of serum vacuum tubes for routine clinical chemistry laboratory testing. Materials and methods: Blood specimens from 100 volunteers in five diff erent serum vacuum tubes (Tube I: VACUETTE®, Tube II: LABOR IMPORT®, Tube III: S-Monovette®, Tube IV: SST® and Tube V: SST II®) were collected by a single, expert phlebotomist. The routine clinical chemistry tests were analyzed on cobas® 6000 module. The significance of the diff erences between samples was assessed by paired Student’s t-test after checking for normality. The level of statistical significance was set at P < 0.005. Finally, the biases from Tube I, Tube II, Tube III, Tube IV and Tube V were compared with the current desirable quality specifications for bias (B), derived from biological variation. Results and conclusions: Basically, our validation will permit the laboratory or hospital managers to select the brand’s vacuum tubes validated according him/her technical or economical reasons, in order to perform the following laboratory tests: glucose, total cholesterol, high density lipoprotein-cholesterol, triglycerides, total protein, albumin, blood urea nitrogen, uric acid, alkaline phosphatise, aspartate aminotransferase, gamma-glutamyltransferase, lactate dehydrogenase, creatine kinase, total bilirubin, direct bilirubin, calcium, iron, sodium and potassium. On the contrary special attention will be required if the laboratory already performs creatinine, amylase, phosphate and magnesium determinations and the quality laboratory manager intend to change the serum tubes. We suggest that laboratory management should both standardize the procedures and frequently evaluate the quality of in vitro diagnostic devices. PMID:22838184

  6. Risk of Drug Resistance Among Persons Acquiring HIV Within a Randomized Clinical Trial of Single- or Dual-Agent Preexposure Prophylaxis

    PubMed Central

    Lehman, Dara A.; Baeten, Jared M.; McCoy, Connor O.; Weis, Julie F.; Peterson, Dylan; Mbara, Gerald; Donnell, Deborah; Thomas, Katherine K.; Hendrix, Craig W.; Marzinke, Mark A.; Frenkel, Lisa; Ndase, Patrick; Mugo, Nelly R.; Celum, Connie; Overbaugh, Julie; Matsen, Frederick A.; Celum, Connie; Baeten, Jared M.; Donnell, Deborah; Coombs, Robert W.; Frenkel, Lisa; Hendrix, Craig W.; Marzinke, Mark A.; Lingappa, Jairam; McElrath, M. Juliana; Fife, Kenneth; Were, Edwin; Tumwesigye, Elioda; Ndase, Patrick; Katabira, Elly; Katabira, Elly; Ronald, Allan; Bukusi, Elizabeth; Cohen, Craig; Wangisi, Jonathan; Campbell, James; Tappero, Jordan; Kiarie, James; Farquhar, Carey; John-Stewart, Grace; Mugo, Nelly Rwamba; Campbell, James; Tappero, Jordan; Wangisi, Jonathan

    2015-01-01

    Background. Preexposure prophylaxis (PrEP) with emtricitabine plus tenofovir disoproxil fumarate (FTC/TDF) or TDF alone reduces the risk of human immunodeficiency virus (HIV) acquisition. Understanding the risk of antiretroviral resistance selected by PrEP during breakthrough infections is important because of the risk of treatment failure during subsequent antiretroviral use. Methods. Within the largest randomized trial of FTC/TDF versus TDF as PrEP, plasma samples were tested for HIV with resistance mutations associated with FTC (K65R and M184IV) and TDF (K65R and K70E), using 454 sequencing. Results. Of 121 HIV seroconverters, 25 received FTC/TDF, 38 received TDF, and 58 received placebo. Plasma drug levels in 26 individuals indicated PrEP use during or after HIV acquisition, of which 5 had virus with resistance mutations associated with their PrEP regimen. Among those with PrEP drug detected during infection, resistance was more frequent in the FTC/TDF arm (4 of 7 [57%]), compared with the TDF arm (1 of 19 [5.3%]; P = .01), owing to the FTC-associated mutation M184IV. Of these cases, 3 had unrecognized acute infection at PrEP randomization, and 2 were HIV negative at enrollment. Conclusions. These results suggest that resistance selected by PrEP is rare but can occur both with PrEP initiation during acute seronegative HIV infection and in PrEP breakthrough infections and that FTC is associated with a greater frequency of resistance mutations than TDF. PMID:25587020

  7. Relationship between Pyruvate Kinase Activity and Cariogenic Biofilm Formation in Streptococcus mutans Biotypes in Caries Patients

    PubMed Central

    Krzyściak, Wirginia; Papież, Monika; Jurczak, Anna; Kościelniak, Dorota; Vyhouskaya, Palina; Zagórska-Świeży, Katarzyna; Skalniak, Anna

    2017-01-01

    Streptococcus mutans (MS) and its biotype I are the strains most frequently found in dental plaque of young children. Our results indicate that in children pyruvate kinase (PK) activity increases significantly in dental plaque, and this corresponds with caries progression. The MS strains isolated in this study or their main glycolytic metabolism connected with PK enzymes might be useful risk factors for studying the pathogenesis and target points of novel therapies for dental caries. The relationship between PK activity, cariogenic biofilm formation and selected biotypes occurrence was studied. S. mutans dental plaque samples were collected from supragingival plaque of individual deciduous molars in 143 subjects. PK activity was measured at different time points during biofilm formation. Patients were divided into two groups: initial stage decay, and extensive decay. Non-parametric analysis of variance and analysis of covariance were used to determine the connections between S. mutans levels, PK activity and dental caries biotypes. A total of 143 strains were derived from subjects with caries. Biotyping data showed that 62, 23, 50, and 8 strains were classified as biotypes I, II, III, IV, respectively. PK activity in biotypes I, II, and IV was significantly higher in comparison to that in biotype III. The correlation between the level of S. mutans in dental plaque and PK activity was both statistically significant (p < 0.05) and positive. The greater the level of S. mutans in the biofilm (colony count and total biomass), the higher the PK activity; similarly, a low bacterial count correlated with low PK activity. PMID:28559883

  8. Pharmacokinetics and pharmacodynamics of famotidine and ranitidine in critically ill children.

    PubMed

    Madani, Shailender; Kauffman, Ralph; Simpson, Pippa; Lehr, Victoria Tutag; Lai, Mary Lieh; Sarniak, Ashok; Tolia, Vasundhara

    2014-02-01

    To characterize and compare acid suppression (pharmacodynamics) and pharmacokinetics of IV famotidine and ranitidine in critically ill children at risk for stress gastritis. Single-blind, randomized study in PICU patients 6 months to 18 years requiring mechanical ventilation with continuous gastric pH monitoring, randomized to IV famotidine 12 mg/m(2) or ranitidine 60 mg/m(2) when gastric pH < 4.0 >1 hour with serial blood sampling following first dose. Twenty-four children randomized to either famotidine (n = 12) or ranitidine (n = 12). Sixteen out of twenty-four completed both PK and PD study arms (7/12 famotidine; 4.7 ± 3.4 years; 9/12 ranitidine; 6.6 ± 4.7 years; p = 0.38). Time to gastric pH 4.0 and total time pH above 4.0 similar with no difference in pH at 6 and 12 hours (p > 0.2). No difference between drugs in clearance, volume of distribution and half-life (p > 0.05). Ratio of AUC pH to AUC drug concentration 0-12 hours after first dose was significantly greater for famotidine (0.06849 ± 0.01460 SD) than ranitidine (0.02453 ± 0.01448; p < 0.001) demonstrating greater potency of famotidine. pH lowering efficacy of both drugs is similar. Greater potency of famotidine may offer clinical advantage due to lower drug exposure and less frequent dosing to achieve same pH lowering effect. © 2013, The American College of Clinical Pharmacology.

  9. The MUSCLES Treasury Survey. IV. Scaling Relations for Ultraviolet, Ca II K, and Energetic Particle Fluxes from M Dwarfs

    NASA Astrophysics Data System (ADS)

    Youngblood, Allison; France, Kevin; Loyd, R. O. Parke; Brown, Alexander; Mason, James P.; Schneider, P. Christian; Tilley, Matt A.; Berta-Thompson, Zachory K.; Buccino, Andrea; Froning, Cynthia S.; Hawley, Suzanne L.; Linsky, Jeffrey; Mauas, Pablo J. D.; Redfield, Seth; Kowalski, Adam; Miguel, Yamila; Newton, Elisabeth R.; Rugheimer, Sarah; Segura, Antígona; Roberge, Aki; Vieytes, Mariela

    2017-07-01

    Characterizing the UV spectral energy distribution (SED) of an exoplanet host star is critically important for assessing its planet’s potential habitability, particularly for M dwarfs, as they are prime targets for current and near-term exoplanet characterization efforts and atmospheric models predict that their UV radiation can produce photochemistry on habitable zone planets different from that on Earth. To derive ground-based proxies for UV emission for use when Hubble Space Telescope (HST) observations are unavailable, we have assembled a sample of 15 early to mid-M dwarfs observed by HST and compared their nonsimultaneous UV and optical spectra. We find that the equivalent width of the chromospheric Ca II K line at 3933 Å, when corrected for spectral type, can be used to estimate the stellar surface flux in ultraviolet emission lines, including H I Lyα. In addition, we address another potential driver of habitability: energetic particle fluxes associated with flares. We present a new technique for estimating soft X-ray and >10 MeV proton flux during far-UV emission line flares (Si IV and He II) by assuming solar-like energy partitions. We analyze several flares from the M4 dwarf GJ 876 observed with HST and Chandra as part of the MUSCLES Treasury Survey and find that habitable zone planets orbiting GJ 876 are impacted by large Carrington-like flares with peak soft X-ray fluxes ≥10-3 W m-2 and possible proton fluxes ˜102-103 pfu, approximately four orders of magnitude more frequently than modern-day Earth.

  10. Pain outcomes in children who received intrathecal vs intravenous opioids for pain control following major urologic surgery: a retrospective review.

    PubMed

    Putnam, Elizabeth M; Koppera, Prabhat; Malviya, Shobha; Voepel-Lewis, Terri

    2015-12-01

    Intrathecal (IT) opioid administration has been associated with postoperative benefits including reduced pain and opioid use in children. However, the postoperative benefits and risks of IT opioid administration during major urologic surgery in children remain unclear. The aim of this study was to compare postoperative pain and adverse event outcomes among children who received IT vs intravenous (IV) opioids during major urologic surgery. We reviewed the medical records of children 3-17 years of age who underwent ureteroneocystostomy or pyeloplasty between 2006 and 2012. Electronically captured anesthetic and surgical data, postanesthesia care recovery unit (PACU) and nursing flowsheets, and daily progress notes through hospital discharge were reviewed. Analgesic techniques (i.e., IT or IV patient/nurse controlled opioids), all analgesic drugs and doses were recorded. Outcome measures included pain scores, need for rescue analgesics, opioid-related adverse events, and their treatments. Seventy-seven children received IT opioids and 51 received IV opioids. More children in the IV group required rescue analgesics and had higher pain scores at PACU discharge. Children in the IV group required rescue opioids more frequently than the IT group from 0 to 8 h and 8 to 16 h after PACU discharge, but rates were similar by 16-24 h 70% of children in IT group transitioned directly to oral opioids. Seven IT placements were considered as failed due to early need for rescue opioids. Four (8%) of the IV group and seven (9%) of the IT group experienced oxygen desaturation. Two of these, both in IT group required naloxone and one was admitted to ICU for observation. The IT group experienced a higher incidence of pruritus, constipation and hypotension. We observed better postoperative pain control in children who received IT vs IV opioids for the first 16 h with no discernible difference thereafter. The intrathecal group experienced higher incidences of pruritus, constipation, and hypotension. © 2015 John Wiley & Sons Ltd.

  11. Silica-gel Particles Loaded with an Ionic Liquid for Separation of Zr(IV) Prior to Its Determination by ICP-OES.

    PubMed

    Marwani, Hadi M; Alsafrani, Amjad E; Asiri, Abdullah M; Rahman, Mohammed M

    2016-06-29

    A new ionic liquid loaded silica gel amine (SG-APTMS-N,N-EPANTf₂) was developed, as an adsorptive material, for selective adsorption and determination of zirconium, Zr(IV), without the need for a chelating intermediate. Based on a selectivity study, the SG-APTMS-N,N-EPANTf₂ phase showed a perfect selectivity towards Zr(IV) at pH 4 as compared to other metallic ions, including gold [Au(III)], copper [Cu(II)], cobalt [Co(II)], chromium [Cr(III)], lead [Pb(II)], selenium [Se(IV)] and mercury [Hg(II)] ions. The influence of pH, Zr(IV) concentration, contact time and interfering ions on SG-APTMS-N,N-EPANTf₂ uptake for Zr(IV) was evaluated. The presence of incorporated donor atoms in newly synthesized SG-APTMS-N,N-EPANTf₂ phase played a significant role in enhancing its uptake capacity of Zr(IV) by 78.64% in contrast to silica gel (activated). The equilibrium and kinetic information of Zr(IV) adsorption onto SG-APTMS-N,N-EPANTf₂ were best expressed by Langmuir and pseudo second-order kinetic models, respectively. General co-existing cations did not interfere with the extraction and detection of Zr(IV). Finally, the analytical efficiency of the newly developed method was also confirmed by implementing it for the determination of Zr(IV) in several water samples.

  12. Clinical variables and implications of the personality on the outcome of bipolar illness: a pilot study

    PubMed Central

    Casas-Barquero, Nieves; García-López, Olga; Fernández-Argüelles, Pedro; Camacho-Laraña, Manuel

    2007-01-01

    Outcome in bipolar patients is affected by comorbidity. Comorbid personality disorders are frequent and may complicate the course of bipolar illness. This pilot study examined a series of 40 euthymic bipolar patients (DSM-IV criteria) (bipolar I disorder 31, bipolar II disorder 9) to assess the effect of clinical variables and the influence of comorbid personality on the clinical course of bipolar illness. Bipolar patients with a diagnosis of comorbid personality disorder (n = 30) were compared with “pure” bipolar patients (n = 10) with regard to demographic, clinical, and course of illness variables. Comorbid personality disorder was diagnosed in 75% of patients according to ICD-10 criteria, with obsessive-compulsive personality disorder being the most frequent type. Sixty-three per cent of subjects had more than one comorbid personality disorder. Bipolar patients with and without comorbid personality disorder showed no significant differences regarding features of the bipolar illness, although the group with comorbid personality disorder showed a younger age at onset, more depressive episodes, and longer duration of bipolar illness. In subjects with comorbid personality disorders, the number of hospitalizations correlated significantly with depressive episodes and there was an inverse correlation between age at the first episode and duration of bipolar illness. These findings, however, should be interpreted taking into account the preliminary nature of a pilot study and the contamination of the sample with too many bipolar II patients. PMID:19300559

  13. DSM-IV and DSM-5 Prevalence of Social Anxiety Disorder in a Population Sample of Older People.

    PubMed

    Karlsson, Björn; Sigström, Robert; Östling, Svante; Waern, Margda; Börjesson-Hanson, Anne; Skoog, Ingmar

    2016-12-01

    To examine the prevalence of social anxiety disorders (SAD) with (DSM-IV) and without (DSM-5) the person's own assessment that the fear was unreasonable, in a population sample of older adults. Further, to determine whether clinical and sociodemographic correlates of SAD differ depending on the criteria applied. Cross-sectional. General population in Gothenburg, Sweden. A random population-based sample of 75- and 85-year olds (N = 1200) without dementia. Psychiatric research nurses carried out a semi-structured psychiatric examination including the Comprehensive Psychopathological Rating Scale. DSM-IV SAD was diagnosed with the Mini International Neuropsychiatric Interview. SAD was diagnosed according to DSM-IV and DSM-5 criteria. The 6-month duration criterion in DSM-5 was not applied because of lack of information. Other assessments included the Global Assessment of Functioning (GAF), the Brief Scale for Anxiety (BSA), and the Montgomery Åsberg Depression Rating Scale (MADRS). The 1-month prevalence of SAD was 2.5% (N = 30) when the unreasonable fear criterion was defined in accordance with DSM-IV and 5.1% (N = 61) when the DSM-5 criterion was applied. Clinical correlates (GAF, MADRS, and BSA) were worse in SAD cases identified by either procedure compared with all others, and ratings for those reporting unreasonable fear suggested greater (albeit nonsignificant) overall psychopathology. Shifting the judgment of how reasonable the fear was, from the individual to the clinician, doubled the prevalence of SAD. This indicates that the DSM-5 version might increase prevalence rates of SAD in the general population. Further studies strictly applying all DSM-5 criteria are needed in order to confirm these findings. Copyright © 2016 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

  14. Prevalence and severity of eating disorders: A comparison of DSM-IV and DSM-5 among German adolescents.

    PubMed

    Ernst, Verena; Bürger, Arne; Hammerle, Florian

    2017-11-01

    Changes in the DSM-5 eating disorders criteria sought to increase the clarity of the diagnostic categories and to decrease the preponderance of nonspecified eating disorders. The first objective of this study was to analyze how these revisions affect threshold and EDNOS/OSFED eating disorder diagnoses in terms of prevalence, sex ratios, and diagnostic distribution in a student sample. Second, we aimed to compare the impairment levels of participants with a threshold, an EDNOS/OSFED and no diagnosis using both DSM-IV and DSM-5. A sample of 1654 7th and 8th grade students completed self-report questionnaires to determine diagnoses and impairment levels in the context of an eating disorder prevention program in nine German secondary schools. Height and weight were measured. The prevalence of threshold disorders increased from .48% (DSM-IV) to 1.15% (DSM-5). EDNOS disorders increased from 2.90 to 6.23% when using OSFED-categories. A higher proportion of girls was found throughout all the diagnostic categories, and the sex ratios remained stable. The effect sizes of DSM-5 group differences regarding impairment levels were equal to or larger than those of the DSM-IV comparisons, ranging from small to medium. We provide an in-depth overview of changes resulting from the revisions of DSM eating disorder criteria in a German adolescent sample. Despite the overall increase in prevalence estimates, the results suggest that the DSM-5 criteria differentiate participants with threshold disorders and OSFED from those no diagnosis as well as or even more distinctly than the DSM-IV criteria. © 2017 Wiley Periodicals, Inc.

  15. Practitioner Expectations and Experiences with the Certificate IV in Training and Assessment (TAA40104): Support Document

    ERIC Educational Resources Information Center

    Clayton, Berwyn; Meyers, Dave; Bateman, Andrea; Bluer, Robert

    2010-01-01

    This document supports the report "Practitioner Expectations and Experiences with the Certificate IV in Training and Assessment (TAA40104)". The first section outlines the methodology used to undertake the research and covers the design of the research, sample details, data collection processes and the strategy for data analysis and…

  16. Exploratory and Higher-Order Factor Analyses of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) Adolescent Subsample

    ERIC Educational Resources Information Center

    Canivez, Gary L.; Watkins, Marley W.

    2010-01-01

    The factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV; Wechsler, 2008a) with the adolescent participants (ages 16-19 years; N = 400) in the standardization sample was assessed using exploratory factor analysis, multiple factor extraction criteria, and higher-order exploratory factor analyses. Results from…

  17. Future Viability of Title IV Revenue: A Descriptive Study of Perceptions of Select ABHE Institutional Leadership

    ERIC Educational Resources Information Center

    Palmer, Kris Russell

    2017-01-01

    There is a looming threat to the economic vitality of the organizational community of intentionally Christian colleges and universities, relevant to the use of Title IV funds. Within the framework of organizational ecology, this qualitative descriptive study investigated and summarized perceptions of the leadership from sample ABHE Bible colleges…

  18. Testing Structural Models of DSM-IV Symptoms of Common Forms of Child and Adolescent Psychopathology

    ERIC Educational Resources Information Center

    Lahey, Benjamin B.; Rathouz, Paul J.; Van Hulle, Carol; Urbano, Richard C.; Krueger, Robert F.; Applegate, Brooks; Garriock, Holly A.; Chapman, Derek A.; Waldman, Irwin D.

    2008-01-01

    Confirmatory factor analyses were conducted of "Diagnostic and Statistical Manual of Mental Disorders", Fourth Edition (DSM-IV) symptoms of common mental disorders derived from structured interviews of a representative sample of 4,049 twin children and adolescents and their adult caretakers. A dimensional model based on the assignment of symptoms…

  19. 7 CFR 42.112 - Defects of containers: Tables IV, V, VI, VII, VIII, IX, and X.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ..., and X. 42.112 Section 42.112 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... Stationary Lot Sampling and Inspection § 42.112 Defects of containers: Tables IV, V, VI, VII, VIII, IX, and X... Table X—Unitizing [Plastic or other type of casing/unitizing] Defects Categories Major Minor Not...

  20. Factor Structure of the DSM-IV Criteria for College Students Using the Adult Behavior Checklist.

    ERIC Educational Resources Information Center

    Johnson, Brian D.; Smith, Everett V., Jr.

    1998-01-01

    The factor structure of the "Diagnostic and Statistical Manual of Mental Disorders" (DSM-IV) criteria for attention deficit hyperactivity disorder (ADHD) is evaluated in a sample of 1,503 college students. The Adult Behavior Checklist is evaluated as a screening instrument. Results support the extension of ADHD criteria for diagnosis to college…

  1. Chromogenic Detection of Dipeptidyl Peptidase IV (DPP-IV) Activity using Peptide-Functionalized Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Abul-Huda, Yasin Mohammad

    Metal nanoparticles offer a useful platform for a wide range of biological applications especially for biosensing, bioimaging and drug delivery. This thesis presents a body of original research describing the synthesis, characterisation and development of a novel and convenient biosensing assay for detection of dipeptidyl peptidase IV (DPP-IV) enzyme activity using peptide functionalized gold nanoparticles. The distinctive optical and physical properties of gold nanoparticles (Au NP) were harnessed for the development of a colorimetric assay for rapid sensing of DPP-IV activities and screening DPP-IV inhbitors. The citrate reduction method for Au NPs synthesis was optimised and several potential peptide substrates (GPDC, VP-EN-DC, C/G dipeptide, GPG-EN-PEG4-LA, GPDCALNNC) were designed to provide substrates that mimic the DPP-IV natural substrates. The performances of the substrate functionalized Au NPs were assessed for their appropriateness for the detection of the enzyme activity. Addition of DPP-IV to the solutions containing the functionalized Au NPs resulted in cleavage of the substrate and thus causing the aggregation of the Au NPs which in turn led to a shift of the surface plasmon peak toward longer wavelengths, and a change of the colour of the colloidal suspension from red to blue. Overall, real-time detection of DPP-IV activity over a broader range (0-40 U/L) with high selectivity and stability was obtained, thus providing a method that can be used to determine the levels of DPP-IV/CD26 in biological fluids such as serum and plasma. Further assay developments were conducted to overcome limitations encountered with the original Au NP assay, especially the narrow dynamic linear range and stability in high ionic strength solutions. Validation and comparison of the Au NP assay developed has revealed that this method is highly correlated to the gold standard chromogenic Gly-Pro-pNA method for detection of enzyme activity in biological samples. Very good recoveries (in the range 83.6 -114.9%) were obtained in spiked serum samples, which indicate that this assay could provide a suitable alternative for enzyme activity detection with the naked eye and without the need for sophisticated instruments. Investigations into the effects of incorporating different stabilizers in order to improve the stability of the peptide functionalized Au NP in high ionic strength solutions were also investigated. Gold nanoparticles have different shapes and structures and an alternative approach for detection of DPP-IV activity using gold nanorods due to their higher refractive index sensitivities was explored. As a conclusion, three out of five approaches, all utilising Au NP-ligand conjugates were demonstrated useful for the detection of the DPP-IV activity. The system developed here is portable and would permit on-site analysis of samples, which offers a real alternative approach from traditional assays and reduces the need for laboratory testing. The logical next step in this research would be the continuation of experiments to transform this test into a point of care testing device that could offer an early detection tool for disease management.

  2. Compassion fatigue and burnout: prevalence among oncology nurses.

    PubMed

    Potter, Patricia; Deshields, Teresa; Divanbeigi, Joyce; Berger, Julie; Cipriano, Doreen; Norris, Lori; Olsen, Sarah

    2010-10-01

    This descriptive, cross-sectional survey was conducted in inpatient nursing units and outpatient clinics in a cancer center in the midwestern United States. The sample of 153 healthcare providers included RNs, medical assistants, and radiology technicians. The fourth revision of the 30-item Professional Quality of Life (ProQOL R-IV) scale was used for measuring compassion fatigue, compassion satisfaction, and burnout. A series of cross tab analyses examined the relationship between participant demographics and three ProQOL R-IV subscales. The study sample scored similarly on compassion satisfaction and burnout when compared with participants who used the ProQOL R-IV in previous studies. Value exists in analyzing the prevalence of burnout and compassion fatigue among oncology healthcare providers. Understanding the needs of distinct demographic groups offers valuable direction for intervention program development. Applying internal evidence in the design of a relevant stress-reduction program will better equip healthcare providers to recognize and manage compassion fatigue and burnout.

  3. Structural and incremental validity of the Wechsler Adult Intelligence Scale-Fourth Edition with a clinical sample.

    PubMed

    Nelson, Jason M; Canivez, Gary L; Watkins, Marley W

    2013-06-01

    Structural and incremental validity of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV; Wechsler, 2008a) was examined with a sample of 300 individuals referred for evaluation at a university-based clinic. Confirmatory factor analysis indicated that the WAIS-IV structure was best represented by 4 first-order factors as well as a general intelligence factor in a direct hierarchical model. The general intelligence factor accounted for the most common and total variance among the subtests. Incremental validity analyses indicated that the Full Scale IQ (FSIQ) generally accounted for medium to large portions of academic achievement variance. For all measures of academic achievement, the first-order factors combined accounted for significant achievement variance beyond that accounted for by the FSIQ, but individual factor index scores contributed trivial amounts of achievement variance. Implications for interpreting WAIS-IV results are discussed. (PsycINFO Database Record (c) 2013 APA, all rights reserved).

  4. Structure of the Wechsler Intelligence Scale for Children--Fourth Edition among a national sample of referred students.

    PubMed

    Watkins, Marley W

    2010-12-01

    The structure of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV; D. Wechsler, 2003a) was analyzed via confirmatory factor analysis among a national sample of 355 students referred for psychoeducational evaluation by 93 school psychologists from 35 states. The structure of the WISC-IV core battery was best represented by four first-order factors as per D. Wechsler (2003b), plus a general intelligence factor in a direct hierarchical model. The general factor was the predominate source of variation among WISC-IV subtests, accounting for 48% of the total variance and 75% of the common variance. The largest 1st-order factor, Processing Speed, only accounted for 6.1% total and 9.5% common variance. Given these explanatory contributions, recommendations favoring interpretation of the 1st-order factor scores over the general intelligence score appear to be misguided.

  5. Psychopathology in methamphetamine-dependent adults 3 years after treatment.

    PubMed

    Glasner-Edwards, Suzette; Mooney, Larissa J; Marinelli-Casey, Patricia; Hillhouse, Maureen; Ang, Alfonso; Rawson, Richard A

    2010-01-01

    Although psychiatric symptoms are frequently observed in methamphetamine (MA) users, little is known about the prevalence of psychiatric disorders in MA-dependent individuals. This is the first study to examine the association of psychiatric disorders with substance use and psychosocial functioning in a large sample of MA users 3 years after treatment. We predicted that psychiatric diagnoses and severity would be associated with substance use and poorer overall functioning over the 3 year post-treatment course. Participants (N = 526) received psychosocial treatment for MA dependence as part of the Methamphetamine Treatment Project and were reassessed for psychosocial functioning and substance use at a mean of 3 years after treatment initiation. DSM-IV psychiatric diagnoses were assessed at follow-up using the Mini-International Neuropsychiatric Interview. Psychosocial functioning was assessed using the Addiction Severity Index. Overall, 48.1% of the sample met criteria for a current or past psychiatric disorder other than a substance use disorder. Consistent with prior reports from clinical samples of cocaine users, this rate was largely accounted for by mood disorders, anxiety disorders and antisocial personality. Those with an Axis I psychiatric disorder evidenced increased MA use and greater functional impairment over time relative to those without a psychiatric disorder. This initial investigation of psychiatric diagnoses in MA users after treatment indicates elevated rates of Axis I and II disorders in this population and underscores the need for integrated psychiatric assessment and intervention in drug abuse treatment settings.

  6. Prevalence of intestinal protozoa infection among school-aged children on Pemba Island, Tanzania, and effect of single-dose albendazole, nitazoxanide and albendazole-nitazoxanide.

    PubMed

    Speich, Benjamin; Marti, Hanspeter; Ame, Shaali M; Ali, Said M; Bogoch, Isaac I; Utzinger, Jürg; Albonico, Marco; Keiser, Jennifer

    2013-01-04

    Pathogenic intestinal protozoa infections are common in school-aged children in the developing world and they are frequently associated with malabsorption syndromes and gastrointestinal morbidity. Since diagnosis of these parasites is difficult, prevalence data on intestinal protozoa is scarce. We collected two stool samples from school-aged children on Pemba Island, Tanzania, as part of a randomized controlled trial before and 3 weeks after treatment with (i) single-dose albendazole (400 mg); (ii) single-dose nitazoxanide (1,000 mg); (iii) nitazoxanide-albendazole combination (1,000 mg-400 mg), with each drug given separately on two consecutive days; and (iv) placebo. Formalin-fixed stool samples were examined for the presence of intestinal protozoa using an ether-concentration method to determine the prevalence and estimate cure rates (CRs). Almost half (48.7%) of the children were diagnosed with at least one of the (potentially) pathogenic protozoa Giardia intestinalis, Entamoeba histolytica/E. dispar and Blastocystis hominis. Observed CRs were high for all treatment arms, including placebo. Nitazoxanide showed a significant effect compared to placebo against the non-pathogenic protozoon Entamoeba coli. Intestinal protozoa infections might be of substantial health relevance even in settings where they are not considered as a health problem. Examination of a single stool sample with the ether-concentration method lacks sensitivity for the diagnosis of intestinal protozoa, and hence, care is indicated when interpreting prevalence estimates and treatment effects.

  7. Prevalence of intestinal protozoa infection among school-aged children on Pemba Island, Tanzania, and effect of single-dose albendazole, nitazoxanide and albendazole-nitazoxanide

    PubMed Central

    2013-01-01

    Background Pathogenic intestinal protozoa infections are common in school-aged children in the developing world and they are frequently associated with malabsorption syndromes and gastrointestinal morbidity. Since diagnosis of these parasites is difficult, prevalence data on intestinal protozoa is scarce. Methods We collected two stool samples from school-aged children on Pemba Island, Tanzania, as part of a randomized controlled trial before and 3 weeks after treatment with (i) single-dose albendazole (400 mg); (ii) single-dose nitazoxanide (1,000 mg); (iii) nitazoxanide-albendazole combination (1,000 mg–400 mg), with each drug given separately on two consecutive days; and (iv) placebo. Formalin-fixed stool samples were examined for the presence of intestinal protozoa using an ether-concentration method to determine the prevalence and estimate cure rates (CRs). Results Almost half (48.7%) of the children were diagnosed with at least one of the (potentially) pathogenic protozoa Giardia intestinalis, Entamoeba histolytica/E. dispar and Blastocystis hominis. Observed CRs were high for all treatment arms, including placebo. Nitazoxanide showed a significant effect compared to placebo against the non-pathogenic protozoon Entamoeba coli. Conclusions Intestinal protozoa infections might be of substantial health relevance even in settings where they are not considered as a health problem. Examination of a single stool sample with the ether-concentration method lacks sensitivity for the diagnosis of intestinal protozoa, and hence, care is indicated when interpreting prevalence estimates and treatment effects. PMID:23289920

  8. Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products.

    PubMed

    Ranjbar, Reza; Safarpoor Dehkordi, Farhad; Sakhaei Shahreza, Mohammad Hossein; Rahimi, Ebrahim

    2018-01-01

    Shiga-toxigenic Escherichia coli strains are one of the most important foodborne bacteria with an emergence of antibiotic resistance. Foodborne STEC strains are mainly associated with presence of certain virulence factors and O-seogroups. The present investigation was done to study the distribution of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxigenic Escherichia coli isolated from milk and dairy products. Six-hundred samples were randomly collected and immediately transferred to laboratory. All samples were cultured and E. coli strains were isolated. STEC strains were identified based on the presence of putative virulence factors and subtypes. STEC isolates were subjected to multiplex PCR and disk diffusion methods. One-hundred and eighty-one out of 600 samples (30.16%) harbored E. coli . Prevalence of STEC strains was 10.66%. O157 (43.75%) and O26 (37.50%) were the most frequently identified serogroups. Aac(3)-IV (100%), CITM (96.87%) and tetA (76.56%) were the most commonly detected antibiotic resistance genes. STEC strains had the highest prevalence of resistance against ampicillin (100%), gentamicin (100%) and tetracycline (96.87%). Kashk and dough were negative for presence of E. coli strains. High prevalence of resistant-O157 strains and simultaneous presence of multiple virulence factors pose an important public health problem regarding the consumption of raw milk and dairy products.

  9. Flow injection chemiluminescence determination of the total phenolics levels in plant-derived beverages using soluble manganese(IV).

    PubMed

    Nalewajko-Sieliwoniuk, Edyta; Tarasewicz, Iwona; Kojło, Anatol

    2010-05-23

    This study established a flow injection (FI) methodology for the determination of the total phenolic content in plant-derived beverages based on soluble manganese(IV) chemiluminescence (CL) detection. It was found that mixing polyphenols with acidic soluble manganese(IV) in the presence of formaldehyde evoked chemiluminescence. Based on this finding, a new FI-CL method was developed for the estimation of the total content of phenolic compounds (expressed as milligrams of gallic acid equivalent per litre of drink) in a variety of wine, tea and fruit juice samples. The proposed method is sensitive with a detection limit of 0.02 ng mL(-1) (gallic acid), offers a wide linear dynamic range (0.5-400 ng mL(-1)) and high sample throughput (247 samples h(-1)). The relative standard deviation for 15 measurements was 3.8% for 2 ng mL(-1) and 0.45% for 10 ng mL(-1) of gallic acid. Analysis of 36 different samples showed that the results obtained by the proposed FI-CL method correlate highly with those obtained by spectrophotometric methods commonly used for the evaluation of the total phenolic/antioxidant level. However, the FI-CL method was found to be far simpler, more rapid and selective, with almost no interference from non-phenolic components of the samples examined. Copyright 2010 Elsevier B.V. All rights reserved.

  10. A comparison of levofloxacin and moxifloxacin use in hospitalized community-acquired pneumonia (CAP) patients in the US: focus on length of stay.

    PubMed

    Schein, Jeff; Janagap-Benson, Carmela; Grant, Richard; Sikirica, Vanja; Doshi, Dilesh; Olson, William

    2008-03-01

    Length of stay (LOS) and hospitalization costs were compared among patients admitted for community-acquired pneumonia (CAP) and initially treated with either levofloxacin 750 mg intravenous (IV) or with moxifloxacin 400 mg IV. Hospital-related complications and relationship of LOS and comorbidities were descriptively examined. A retrospective database study was conducted of adult patients admitted for CAP and given levofloxacin 750 mg IV or moxifloxacin 400 mg IV through the first 3 days of hospitalization, using the Premier Perspective comparative database. Cohorts were matched 1:1 by hospital geographic location, by coarse caliper propensity scores using all baseline covariates, and by Mahalanobis metric matching based on age and severity (All Patient Refined-Diagnosis-related Groups Severity of Illness (APR-DRG SOI) index). Comparisons between groups were further adjusted for characteristics that remained imbalanced after matching using generalized estimating equation methodology. The initial sample of 3868 patients (levofloxacin = 827; moxifloxacin = 3041) was reduced to 1594 (797 patients per treatment group) after matching. Analyses of matched cohorts showed that the mean hospital LOS was significantly shorter for patients treated with levofloxacin 750 mg IV than for those patients treated with moxifloxacin 400 mg IV (5.8 vs. 6.4 days, respectively; least squares mean difference = 0.54 days; p = 0.020). Hospitalization costs were also lower for the levofloxacin 750 mg IV-treated patients (least squares mean difference = US$129; p = 0.753). There were no significant differences in the percentage of patients experiencing complications. Although claims databases provide large sample sizes and reflect routine care, they do have several inherent limitations. Since randomization of subjects is not possible, adequate statistical techniques must be used to ensure treatment groups are balanced with respect to patient and clinical characteristics. In addition, data may be missing or miscoded. This retrospective study suggests that among patients hospitalized with CAP, initial treatment with levofloxacin 750 mg IV is associated with a significantly shorter mean hospital LOS compared with treatment with moxifloxacin 400 mg IV. The clinical implications of a shorter hospital LOS include improved patient and economic outcomes.

  11. Growth performance and pork fat quality as measured by three methods of pigs fed 20% DDGS and slaughtered using a standard industry split marketing strategy.

    PubMed

    Shircliff, K E; Callahan, Z D; Wilmoth, T A; Ohman, C E; Johnson, R C; Wiegand, B R

    2015-10-01

    A total of 40 pens containing 22 crossbred barrows (initial BW = 43.07 ± 1.61 kg; PIC 1050 × PIC 337 genetics) were housed in a commercial wean to finish facility. Pens were randomly allotted to dietary treatments in a 2 × 3 factorial arrangement with 2 levels of dried distillers grains with solubles (DDGS; 0% or 20%) and chosen for 1 of 3 marketing cuts removing 4, 8, and 10 animals from each pen. Fat tissue samples were removed from the anterior tip of the jowl and posterior to the sternum on the belly edge 1d postmortem. Fatty acid composition was determined via the Folch method, and iodine values (IV) were calculated from chemical titrations, fatty acid profile (GC IV), and in-plant Bruker near-infrared (NIR) spectroscopy. Pearson's correlation coefficients for IV determination methods were estimated. Inclusion of 20% DDGS did not change ( > 0.05) growth performance, whereas marketing cut affected performance, with the second cut producing the most efficient pigs ( < 0.01). Total SFA and MUFA concentrations were higher ( < 0.01) in belly and jowl fat from pigs fed 0% DDGS. Total PUFA and the PUFA:SFA in belly and jowl fat was higher ( < 0.01) when 20% DDGS was fed. Dried distillers grains with solubles inclusion increased IV in belly and jowl as determined by all 3 methods. Regardless of dietary treatment or fat depot, Pearson correlation coefficients between titration and GC IV, titration and NIR, and GC IV and NIR were 0.46 ( < 0.01), 0.68 ( < 0.01), and 0.43 ( < 0.01), respectively. These correlations suggest methods may rank samples equally but do not provide the same absolute IV. Belly fat had a lower IV ( < 0.01) than jowl fat using titration or GC IV methods, suggesting pigs have varied degrees of physiological maturity at specific fat depots when weight end points are used during the finishing phase. In conclusion, feeding 20% DDGS negatively affected fat quality but not growth performance, and marketing time changed growth performance.

  12. An empirical evaluation of the structure of DSM-IV personality disorders in a nationally representative sample: results of confirmatory factor analysis in the National Epidemiologic Survey on Alcohol and Related Conditions Waves 1 and 2.

    PubMed

    Cox, Brian J; Clara, Ian P; Worobec, Lydia M; Grant, Bridget F

    2012-12-01

    Individual personality disorders (PD) are grouped into three clusters in the DSM-IV (A, B, and C). There is very little empirical evidence available concerning the validity of this model in the general population. The current study included all 10 of the DSM-IV PD assessed in Wave 1 and Wave 2 of the National Epidemiologic Survey on Alcohol and Related Conditions (NESARC). Confirmatory factor analysis was used to evaluate three plausible models of the structure of Axis II personality disorders (the current hierarchical DSM-IV three-factor model in which individual PD are believed to load on their assigned clusters, which in turn load onto a single Axis II factor; a general single-factor model; and three independent factors). Each of these models was tested in both the total and also separately for gender. The higher order DSM-IV model demonstrated good fit to the data on a number of goodness-of-fit indices. The results for this model were very similar across genders. A model of PD based on the current DSM-IV hierarchical conceptualization of a higher order classification scheme received strong empirical support through confirmatory factor analysis using a number of goodness-of-fit indices in a nationally representative sample. Other models involving broad, higher order personality domains such as neuroticism in relation to personality disorders have yet to be tested in epidemiologic surveys and represent an important avenue for future research.

  13. The alcohol use disorder and associated disabilities interview schedule-IV (AUDADIS-IV): reliability of new psychiatric diagnostic modules and risk factors in a general population sample.

    PubMed

    Ruan, W June; Goldstein, Risë B; Chou, S Patricia; Smith, Sharon M; Saha, Tulshi D; Pickering, Roger P; Dawson, Deborah A; Huang, Boji; Stinson, Frederick S; Grant, Bridget F

    2008-01-01

    This study presents test-retest reliability statistics and information on internal consistency for new diagnostic modules and risk factors for alcohol, drug, and psychiatric disorders from the Alcohol Use Disorder and Associated Disabilities Interview Schedule-IV (AUDADIS-IV). Test-retest statistics were derived from a random sample of 1899 adults selected from 34,653 respondents who participated in the 2004-2005 Wave 2 National Epidemiologic Survey on Alcohol and Related Conditions (NESARC). Internal consistency of continuous scales was assessed using the entire Wave 2 NESARC. Both test and retest interviews were conducted face-to-face. Test-retest and internal consistency results for diagnoses and symptom scales associated with posttraumatic stress disorder, attention-deficit/hyperactivity disorder, and borderline, narcissistic, and schizotypal personality disorders were predominantly good (kappa>0.63; ICC>0.69; alpha>0.75) and reliability for risk factor measures fell within the good to excellent range (intraclass correlations=0.50-0.94; alpha=0.64-0.90). The high degree of reliability found in this study suggests that new AUDADIS-IV diagnostic measures can be useful tools in research settings. The availability of highly reliable measures of risk factors for alcohol, drug, and psychiatric disorders will contribute to the validity of conclusions drawn from future research in the domains of substance use disorder and psychiatric epidemiology.

  14. Non-equilibrium character of resistive switching and negative differential resistance in Ga-doped Cr2O3 system

    NASA Astrophysics Data System (ADS)

    Bhowmik, R. N.; Siva, K. Venkata

    2018-07-01

    The samples of Ga-doped Cr2O3 system in rhombohedral crystal structure with space group R 3 bar C were prepared by chemical co-precipitation route and annealing at 800 °C. The current-voltage (I-V) curves exhibited many unique non-linear properties, e.g., hysteresis loop, resistive switching, and negative differential resistance (NDR). In this work, we report non-equilibrium properties of resistive switching and NDR phenomena. The non-equilibrium I-V characteristics were confirmed by repetiting measurement and time relaxation of current. The charge conduction process was understood by analysing the I-V curves using electrode-limited and bulk-limited charge conduction mechanisms, which were proposed for metal electrode/metal oxide/metal electrode structure. The I-V curves in the NDR regime and at higher bias voltage regime in our samples did not obey Fowler-Nordheim equation, which was proposed for charge tunneling mechanism in many thin film junctions. The non-equilibrium I-V phenomena were explained by considering the competitions between the injection of charge carriers from metal electrode to metal oxide, the charge flow through bulk material mediated by trapping/de-trapping and recombination of charge carriers at the defect sites of ions, the space charge effects at the junctions of electrodes and metal oxides, and finally, the out flow of electrons from metal oxide to metal electrode.

  15. Comparison of Wechsler Memory Scale-Fourth Edition (WMS-IV) and Third Edition (WMS-III) dimensional structures: improved ability to evaluate auditory and visual constructs.

    PubMed

    Hoelzle, James B; Nelson, Nathaniel W; Smith, Clifford A

    2011-03-01

    Dimensional structures underlying the Wechsler Memory Scale-Fourth Edition (WMS-IV) and Wechsler Memory Scale-Third Edition (WMS-III) were compared to determine whether the revised measure has a more coherent and clinically relevant factor structure. Principal component analyses were conducted in normative samples reported in the respective technical manuals. Empirically supported procedures guided retention of dimensions. An invariant two-dimensional WMS-IV structure reflecting constructs of auditory learning/memory and visual attention/memory (C1 = .97; C2 = .96) is more theoretically coherent than the replicable, heterogeneous WMS-III dimension (C1 = .97). This research suggests that the WMS-IV may have greater utility in identifying lateralized memory dysfunction.

  16. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  17. The very high rotators in the late-B and early-A stars: Shell stars with Si IV and C IV features the case of HD 119921

    NASA Technical Reports Server (NTRS)

    Freireferrero, R.; Bruhweiler, Frederick C.; Grady, C. A.

    1990-01-01

    Study of several stars in the late B and early A spectral types shows that very high rotators are associated with shell characteristics (sometimes not detected at all in the visible spectra) and also with C IV and some Si IV spectral absorption features which can be explained by circumstellar phenomena superimposed over stellar metallic blends. These particularities are evidenced by comparison with other spectra of low and high rotators in the same spectral range. HD 119921, a star with similar characteristics to the other ones of the sample, is given special attention. A possible scenario is suggested to explain the observed superionization features.

  18. Dihydropyrimidine dehydrogenase gene (DPYD) polymorphism among Caucasian and non-Caucasian patients with 5-FU- and capecitabine-related toxicity using full sequencing of DPYD.

    PubMed

    Saif, Muhammad Wasif

    2013-01-01

    Dihydropyrimidine dehydrogenase (DPD) is the rate-limiting enzyme of the degradation of pyrimidine base, and plays a pivotal role in the pharmacogenetic syndrome of 5-fluorouracil (5-FU). Deficiency of DPD activity leads to severe toxicities, even death, following administration of 5-FU. Several studies have demonstrated that molecular defects of the dihydropyrimidine dehydrogenase gene (DPYD) lead to the deficiency of DPD activity and cause this pharmacogenetic syndrome. We present the analysis of DPYD genotyping in untreated Caucasian patients (control group) and Caucasian patients with 5-FU/CAP-related grade 3/4 toxicities (toxicity group) who underwent a capecitabine TheraGuide 5-FU testing. Full sequencing of DPYD was performed in the Myriad Genetic Laboratories, Inc. as part of TheraGuide 5-FU test. Among 227 patients from the toxicity group, 27 (12%) had deleterious mutations in DPYD: twelve (5%) had IVS14 +1 G>A, eleven (5%) had D949V and four (2%) had other mutations. Only 7/192 (4%) patients from the control group had DPYD genotype abnormalities: two (1%) had IVS14 +1 G>A, four (2%) had D949V and one (1%) had other mutation. Genotype abnormalities were observed more frequently in the toxicity group (p=0.001). Among 65 patients with toxicities due to capecitabine, nine (14%) had mutated DPYD, which was more frequent than in the control group (p=0.006). Mutated DPYD is frequently observed in Caucasian patients who experience toxicities while receiving 5-FU/capecitabine. Screening of patients for DPYD mutations prior to administration of 5-FU/capecitabine using new pharmacogenetic testing methods, may help for identify those patients who are at greatest risk for adverse effects, allowing a more individualized approach to their chemotherapy management.

  19. Ketamine Patient Controlled Analgesia for Acute Pain in Trauma Patients: A Randomized, Active Comparator Controlled, Blinded, Pilot Trial

    DTIC Science & Technology

    2017-01-11

    patient- controlled analgesia per the primary treating team. Four subjects in the ketamine group and one subject in the hydromorphone group withdrew...occurred more frequently in the ketamine group , although this was not statistically significant (40% vs. 0%, P=0.090). Ketamine patient- controlled ...breakthrough IV morphine equivalents between groups . 4.0 RESULTS 4.1 Participants Due to unanticipated barriers to enrollment, including a

  20. MRI and CT contrast media extravasation: A systematic review.

    PubMed

    Heshmatzadeh Behzadi, Ashkan; Farooq, Zerwa; Newhouse, Jeffery H; Prince, Martin R

    2018-03-01

    This systematic review combines data from multiple papers on contrast media extravasation to identify factors contributing to increased extravasation risk. Data were extracted from 17 papers reporting 2191 extravasations in 1,104,872 patients (0.2%) undergoing computed tomography (CT) or magnetic resonance imaging (MRI). Extravasation rates were 0.045% for gadolinium-based contrast agents (GBCA) and nearly 6-fold higher, 0.26% for iodinated contrast agents. Factors associated with increased contrast media extravasations included: older age, female gender, using an existing intravenous (IV) instead of placing a new IV in radiology, in-patient status, use of automated power injection, high injection rates, catheter location, and failing to warm up the more viscous contrast media to body temperature. Contrast media extravasation is infrequent but nearly 6 times less frequent with GBCA for MRI compared with iodinated contrast used in CT.

  1. Hepatic intra-arterial versus intravenous fotemustine in patients with liver metastases from uveal melanoma (EORTC 18021): a multicentric randomized trial.

    PubMed

    Leyvraz, S; Piperno-Neumann, S; Suciu, S; Baurain, J F; Zdzienicki, M; Testori, A; Marshall, E; Scheulen, M; Jouary, T; Negrier, S; Vermorken, J B; Kaempgen, E; Durando, X; Schadendorf, D; Gurunath, R Karra; Keilholz, U

    2014-03-01

    In uveal melanoma (UM) with metastatic disease limited to the liver, the effect of an intrahepatic treatment on survival is unknown. We investigated prospectively the efficacy and toxicity of hepatic intra-arterial (HIA) versus systemic (IV) fotemustine in patients with liver metastases from UM. Patients were randomly assigned to receive either IV or HIA fotemustine at 100 mg/m(2) on days 1, 8, 15 (and 22 in HIA arm only) as induction, and after a 5-week rest period every 3 weeks as maintenance. Primary end point was overall survival (OS). Response rate (RR), progression-free survival (PFS) and safety were secondary end points. Accrual was stopped after randomization of 171 patients based on the results of a futility OS analysis. A total of 155 patients died and 16 were still alive [median follow-up 1.6 years (range 0.25-6 years)]. HIA did not improve OS (median 14.6 months) when compared with the IV arm (median 13.8 months), hazard ratio (HR) 1.09; 95% confidence interval (CI) 0.79-1.50, log-rank P = 0.59. However, there was a significant benefit on PFS for HIA compared with IV with a median of 4.5 versus 3.5 months, respectively (HR 0.62; 95% CI 0.45-0.84, log-rank P = 0.002). The 1-year PFS rate was 24% in the HIA arm versus 8% in the IV arm. An improved RR was seen in the HIA (10.5%) compared with IV treatment (2.4%). In the IV arm, the most frequent grade ≥3 toxicity was thrombocytopenia (42.1%) and neutropenia (62.6%), compared with 21.2% and 28.7% in the HIA arm. The main grade ≥3 toxicity related to HIA was catheter complications (12%) and liver toxicity (4.5%) apart from two toxic deaths. HIA treatment with fotemustine did not translate into an improved OS compared with IV treatment, despite better RR and PFS. Intrahepatic treatment should still be considered as experimental. 2004-002245-12 and NCT00110123.

  2. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  3. Bupropion versus methylphenidate in the treatment of children with attention-deficit/hyperactivity disorder: randomized double-blind study.

    PubMed

    Jafarinia, Morteza; Mohammadi, Mohammad-Reza; Modabbernia, Amirhossein; Ashrafi, Mandana; Khajavi, Danial; Tabrizi, Mina; Yadegari, Noorollah; Akhondzadeh, Shahin

    2012-07-01

    To compare the safety and efficacy of bupropion with methylphenidate in children and adolescents with attention-deficit/hyperactivity disorder (ADHD). In a 6-week randomized double-blind study, 44 patients with a DSM-IV-TR diagnosis of ADHD were randomly assigned to receive bupropion 100-150 mg/day (100 mg/day for <30 kg and 150 mg/day for >30 kg) or methylphenidate 20-30 mg/day. Symptoms were assessed using Teacher and Parent Attention-Deficit/Hyperactivity Disorder Rating Scale-IV (ADHD-RS-IV) at baseline and weeks 3 and 6. Forty patients had at least one post-baseline measurement, and 38 patients completed the trial. No significant difference was found between the two groups on the Parent and Teacher ADHD-RS-IV scores ([F(1, 38) = 0.266, p = 0.609] and [F(1, 38) = 0.001, p = 0.972], respectively). By week 6, 18 patients (90%) in each group achieved response on the Parent scale (Fisher's exact test p-value = 1.0). With the Teacher ADHD-RS-IV used, eight (40%) patients in the bupropion group and 12 (60%) patients in the methylphenidate group achieved response by week 6 (χ(2) (1) = 1.600, p = 0.206). Headache was observed more frequently in the methylphenidate group. Frequency of other side effects was not significantly different between the two groups. Bupropion has a comparable safety and efficacy profile with methylphenidate in children and adolescents with ADHD. Copyright © 2012 John Wiley & Sons, Ltd.

  4. Intravenous dexamethasone versus ketamine gargle versus intravenous dexamethasone combined with ketamine gargle for evaluation of post-operative sore throat and hoarseness: A randomized, placebo-controlled, double blind clinical trial

    PubMed Central

    Safavi, Mohammadreza; Honarmand, Azim; Fariborzifar, Arghavan; Attari, Mohammadali

    2014-01-01

    Background: Sore throat and hoarseness are the most frequent subjective complaints after tracheal intubation for general anesthesia. We conducted a prospective, randomized, double-blind, placebo controlled study to evaluate the efficacy of intravenous (IV) dexamethasone plus ketamine gargle for reducing the incidence and severity of post-operative sore throat (POST) and hoarseness. Materials and Methods: 140 patients (aged 16-65 year) scheduled for elective surgery were enrolled. Patients were randomly allocated into four groups of 35 subjects each: Group K, gargled 40 mg ketamine in 30 ml saline; Group D, were infused 0.2 mg/kg IV dexamethasone; Group KD, gargled 40 mg ketamine in 30 ml saline plus 0.2 mg/kg IV dexamethasone; Group P (placebo) that received saline (gargle and IV). POST was graded at 0, 2, 4, 8, 16 and 24 h after operation on a four-point scale (0-3). Results: The incidence and severity of POST were significantly lower in Group KD, compared with the other groups at all times after tracheal extubation for up to 24 h (P < 0.05). Also the incidence and severity of hoarseness were significantly lower in each Groups of KD and K and D compared with group placebo (P < 0.05). Conclusion: The prophylactic use of 0.2 mg/kg of IV dexamethasone plus ketamine gargle significantly reduced the incidence and severity of POST compared with using each of these drugs alone or using placebo. PMID:25371869

  5. Brittle diabetes: Psychopathology and personality.

    PubMed

    Pelizza, Lorenzo; Pupo, Simona

    The term "brittle" is used to describe an uncommon subgroup of patients with type I diabetes whose lives are disrupted by severe glycaemic instability with repeated and prolonged hospitalization. Psychosocial problems are the major perceived underlying causes of brittle diabetes. Aim of this study is a systematic psychopathological and personological assessment of patients with brittle diabetes in comparison with subjects without brittle diabetes, using specific parameters of general psychopathology and personality disorders following the multi-axial format of the current DSM-IV-TR (Diagnostic and Statistical manual of Mental Disorders - IV Edition - Text Revised) diagnostic criteria for mental disorders. Patients comprised 42 subjects with brittle diabetes and a case-control group of 42 subjects with stable diabetes, matched for age, gender, years of education, and diabetes duration. General psychopathology and the DSM-IV-TR personality disorders were assessed using the Symptom Checklist-90-Revised (SCL-90-R) and the Structured Clinical Interview for axis II personality Disorders (SCID-II). The comparison for SCL-90-R parameters revealed no differences in all primary symptom dimensions and in the three global distress indices between the two groups. However, patients with brittle diabetes showed higher percentages in borderline, histrionic, and narcissistic personality disorder. In this study, patients with brittle diabetes show no differences in terms of global severity of psychopathological distress and specific symptoms of axis I DSM-IV-TR psychiatric diagnoses in comparison with subjects without brittle diabetes. Differently, individuals with brittle diabetes are more frequently affected by specific DSM-IV-TR cluster B personality disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Screening and staging for non-small cell lung cancer by serum laser Raman spectroscopy.

    PubMed

    Wang, Hong; Zhang, Shaohong; Wan, Limei; Sun, Hong; Tan, Jie; Su, Qiucheng

    2018-08-05

    Lung cancer is the leading cause of cancer-related death worldwide. Current clinical screening methods to detect lung cancer are expensive and associated with many complications. Raman spectroscopy is a spectroscopic technique that offers a convenient method to gain molecular information about biological samples. In this study, we measured the serum Raman spectral intensity of healthy volunteers and patients with different stages of non-small cell lung cancer. The purpose of this study was to evaluate the application of serum laser Raman spectroscopy as a low cost alternative method in the screening and staging of non-small cell lung cancer (NSCLC). The Raman spectra of the sera of peripheral venous blood were measured with a LabRAM HR 800 confocal Micro Raman spectrometer for individuals from five groups including 14 healthy volunteers (control group), 23 patients with stage I NSCLC (stage I group), 24 patients with stage II NSCLC (stage II group), 19 patients with stage III NSCLC (stage III group), 11 patients with stage IV NSCLC (stage IV group). Each serum sample was measured 3 times at different spots and the average spectra represented the signal of Raman spectra in each case. The Raman spectrum signal data of the five groups were statistically analyzed by analysis of variance (ANOVA), principal component analysis (PCA), linear discriminant analysis (LDA), and cross-validation. Raman spectral intensity was sequentially reduced in serum samples from control group, stage I group, stage II group and stage III/IV group. The strongest peak intensity was observed in the control group, and the weakest one was found in the stage III/IV group at bands of 848 cm -1 , 999 cm -1 , 1152 cm -1 , 1446 cm -1 and 1658 cm -1 (P < 0.05). Linear discriminant analysis showed that the sensitivity to identify healthy people, stage I, stage II, and stage III/IV NSCLC was 86%, 65%, 75%, and 87%, respectively; the specificity was 95%, 94%, 88%, and 93%, respectively; and the overall accuracy rate was 92% (71/77). The laser Raman spectroscopy can effectively identify patients with stage I, stage II or stage III/IV Non-Small Cell Lung cancer using patient serum samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Differentially Private Frequent Sequence Mining via Sampling-based Candidate Pruning

    PubMed Central

    Xu, Shengzhi; Cheng, Xiang; Li, Zhengyi; Xiong, Li

    2016-01-01

    In this paper, we study the problem of mining frequent sequences under the rigorous differential privacy model. We explore the possibility of designing a differentially private frequent sequence mining (FSM) algorithm which can achieve both high data utility and a high degree of privacy. We found, in differentially private FSM, the amount of required noise is proportionate to the number of candidate sequences. If we could effectively reduce the number of unpromising candidate sequences, the utility and privacy tradeoff can be significantly improved. To this end, by leveraging a sampling-based candidate pruning technique, we propose a novel differentially private FSM algorithm, which is referred to as PFS2. The core of our algorithm is to utilize sample databases to further prune the candidate sequences generated based on the downward closure property. In particular, we use the noisy local support of candidate sequences in the sample databases to estimate which sequences are potentially frequent. To improve the accuracy of such private estimations, a sequence shrinking method is proposed to enforce the length constraint on the sample databases. Moreover, to decrease the probability of misestimating frequent sequences as infrequent, a threshold relaxation method is proposed to relax the user-specified threshold for the sample databases. Through formal privacy analysis, we show that our PFS2 algorithm is ε-differentially private. Extensive experiments on real datasets illustrate that our PFS2 algorithm can privately find frequent sequences with high accuracy. PMID:26973430

  8. Pesticides detected in urban streams in King County, Washington, 1998-2003

    USGS Publications Warehouse

    Frans, Lonna M.

    2004-01-01

    The U.S. Geological Survey and the King County Department of Natural Resources collected water samples from 14 sites on urban streams in King County during storms and during base flow between 1998 and 2003. The samples were analyzed for the presence of 155 pesticides and pesticide transformation products. Thirty-nine of the compounds were detected at least once during the study: 20 herbicides, 9 insecticides, 2 fungicides, 6 pesticide transformation products, and 2 other types of compounds. The most widespread compound was 4-nitrophenol, which was detected at all 14 sampling sites. The most frequently detected compound was pentachlorophenol, a fungicide, which occurred in more than 80 percent of the samples. The most frequently detected herbicides were prometon, trichlopyr, 2,4-D, and MCPP, and the most frequently detected insecticides were diazinon and carbaryl. All of the most frequently detected herbicides and insecticides were sold for homeowner use over the timeframe of this study. More compounds were detected during storms than during base flow, and were detected more frequently and typically at high concentrations during storms. Seven compounds were detected only during storms. Most of the compounds that were detected during storms occurred more frequently during spring storms than during autumn storms.

  9. Repeated exposure to intra-amniotic LPS partially protects against adverse effects of intravenous LPS in preterm lambs.

    PubMed

    Gisslen, Tate; Hillman, Noah H; Musk, Gabrielle C; Kemp, Matthew W; Kramer, Boris W; Senthamaraikannan, Paranthaman; Newnham, John P; Jobe, Alan H; Kallapur, Suhas G

    2014-02-01

    Histologic chorioamnionitis, frequently associated with preterm births and adverse outcomes, results in prolonged exposure of preterm fetuses to infectious agents and pro-inflammatory mediators, such as LPS. Endotoxin tolerance-type effects were demonstrated in fetal sheep following repetitive systemic or intra-amniotic (i.a.) exposures to LPS, suggesting that i.a. LPS exposure would cause endotoxin tolerance to a postnatal systemic dose of LPS in preterm sheep. In this study, randomized pregnant ewes received either two i.a. injections of LPS or saline prior to preterm delivery. Following operative delivery, the lambs were treated with surfactant, ventilated, and randomized to receive either i.v. LPS or saline at 30  min of age. Physiologic variables and indicators of systemic and lung inflammation were measured. Intravenous LPS decreased blood neutrophils and platelets values following i.a. saline compared to that after i.a. LPS. Intra-amniotic LPS prevented blood pressure from decreasing following the i.v. LPS, but also caused an increased oxygen index. Intra-amniotic LPS did not cause endotoxin tolerance as assessed by cytokine expression in the liver, lung or plasma, but increased myeloperoxidase-positive cells in the lung. The different compartments of exposure to LPS (i.a. vs i.v.) are unique to the fetal to newborn transition. Intra-amniotic LPS incompletely tolerized fetal lambs to postnatal i.v. LPS.

  10. Influenza Virus Database (IVDB): an integrated information resource and analysis platform for influenza virus research.

    PubMed

    Chang, Suhua; Zhang, Jiajie; Liao, Xiaoyun; Zhu, Xinxing; Wang, Dahai; Zhu, Jiang; Feng, Tao; Zhu, Baoli; Gao, George F; Wang, Jian; Yang, Huanming; Yu, Jun; Wang, Jing

    2007-01-01

    Frequent outbreaks of highly pathogenic avian influenza and the increasing data available for comparative analysis require a central database specialized in influenza viruses (IVs). We have established the Influenza Virus Database (IVDB) to integrate information and create an analysis platform for genetic, genomic, and phylogenetic studies of the virus. IVDB hosts complete genome sequences of influenza A virus generated by Beijing Institute of Genomics (BIG) and curates all other published IV sequences after expert annotation. Our Q-Filter system classifies and ranks all nucleotide sequences into seven categories according to sequence content and integrity. IVDB provides a series of tools and viewers for comparative analysis of the viral genomes, genes, genetic polymorphisms and phylogenetic relationships. A search system has been developed for users to retrieve a combination of different data types by setting search options. To facilitate analysis of global viral transmission and evolution, the IV Sequence Distribution Tool (IVDT) has been developed to display the worldwide geographic distribution of chosen viral genotypes and to couple genomic data with epidemiological data. The BLAST, multiple sequence alignment and phylogenetic analysis tools were integrated for online data analysis. Furthermore, IVDB offers instant access to pre-computed alignments and polymorphisms of IV genes and proteins, and presents the results as SNP distribution plots and minor allele distributions. IVDB is publicly available at http://influenza.genomics.org.cn.

  11. Verbal versus Physical Aggression in Intermittent Explosive Disorder

    PubMed Central

    Look, Amy E.; McCloskey, Michael S.; Coccaro, Emil F.

    2015-01-01

    Intermittent Explosive Disorder (IED) is the only adult psychiatric diagnosis for which pathological aggression is primary. DSM-IV criteria focused on physical aggression, but DSM-5 allows for an IED diagnosis in the presence of frequent verbal aggression with or without concurrent physical aggression. It remains unclear how individuals with verbal aggression differ from those with physical aggression with respect to cognitive-affective deficits and psychosocial functioning. The current study compared individuals who met IED criteria with either frequent verbal aggression without physical aggression (IED-V), physical aggression without frequent verbal aggression (IED-P), or both frequent verbal aggression and physical aggression (IED-B) as well as a non-aggressive personality-disordered (PD) comparison group using behavioral and self-report measures of aggression, anger, impulsivity, and affective lability, and psychosocial impairment. Results indicate all IED groups showed increased anger/aggression, psychosocial impairment, and affective lability relative to the PD group. The IED-B group showed greater trait anger, anger dyscontrol, and aggression compared to the IED-V and IED-P groups. Overall, the IED-V and IED-P groups reported comparable deficits and impairment. These results support the inclusion of verbal aggression within the IED criteria and suggest a more severe profile for individuals who engage in both frequent verbal arguments and repeated physical aggression. PMID:25534757

  12. Personality disorders and treatment drop out in the homeless

    PubMed Central

    Salavera, Carlos; Tricás, José M; Lucha, Orosia

    2013-01-01

    The homeless drop out of treatment relatively frequently. Also, prevalence rates of personality disorders are much higher in the homeless group than in the general population. We hypothesize that when both variables coexist — homelessness and personality disorders — the possibility of treatment drop out grows. The aim of this study was to analyze the hypotheses, that is, to study how the existence of personality disorders affects the evolution of and permanence in treatment. One sample of homeless people in a therapeutic community (N = 89) was studied. The structured clinical interview for the diagnostic and statistical manual of mental disorders (DSM-IV-TR) was administered and participants were asked to complete the Millon Clinical Multiaxial Inventory-II (MCMI-II). Cluster B personality disorders (antisocial, borderline, and narcissistic) avoided permanence in the treatment process while cluster C disorders, as dependent, favored adhesion to the treatment and improved the prognosis. Knowledge of these personality characteristics should be used to advocate for better services to support homeless people and prevent their dropping out before completing treatment. PMID:23569378

  13. A psychosocial comparison of computer-mediated and face-to-face language use among severely disturbed adolescents.

    PubMed

    Zimmerman, D P

    1987-01-01

    This study analyzes the content of communications among 18 severely disturbed adolescents. Interactions were recorded from two sources: computer-based "conferences" for the group, and small group face-to-face sessions which addressed similar topics. The purpose was to determine whether there are important differences in indications of psychological state, interpersonal interest, and expressive style. The research was significant, given the strong attraction of computers to many adolescents and the paucity of research on social-psychological effects of this technology. A content analysis based on a total sample of 10,224 words was performed using the Harvard IV Psychosociological Dictionary. Results indicated that computer-mediated communication was more expressive of feelings and made more frequent mention of interpersonal issues. Further, it displayed a more positive object-relations stance, was less negative in expressive style, and appeared to diminish certain traditional gender differences in group communication. These findings suggest that the computer may have an interesting adjunct role to play in reducing communication deficits commonly observed in severely disturbed adolescent clinical populations.

  14. Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

    PubMed

    Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

    2017-06-01

    The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

  15. Does the Dynamic Indicators of Basic Early Literacy Skills Next Assessment Take a "Simple View" of Reading?

    ERIC Educational Resources Information Center

    Munger, Kristen A.; LoFaro, Stephen A.; Kawryga, Erin A.; Sovocool, Elizabeth A.; Medina, Siani Y.

    2014-01-01

    This study involved examination of the validity evidence of the Dynamic Indicators of Basic Early Literacy Skills-Next Edition (DIBELS Next) for a sample of 85 third-and fifth-grade students, in reference to the "simple view" of reading. Tests administered included DIBELS Next, Peabody Picture Vocabulary Test-IV (PPVT-IV), Group Reading…

  16. Incremental Validity of WISC-IV[superscript UK] Factor Index Scores with a Referred Irish Sample: Predicting Performance on the WIAT-II[superscript UK

    ERIC Educational Resources Information Center

    Canivez, Gary L.; Watkins, Marley W.; James, Trevor; Good, Rebecca; James, Kate

    2014-01-01

    Background: Subtest and factor scores have typically provided little incremental predictive validity beyond the omnibus IQ score. Aims: This study examined the incremental validity of Wechsler Intelligence Scale for Children-Fourth UK Edition (WISC-IV[superscript UK]; Wechsler, 2004a, "Wechsler Intelligence Scale for Children-Fourth UK…

  17. Examining the Stability of "DSM-IV" and Empirically Derived Eating Disorder Classification: Implications for "DSM-5"

    ERIC Educational Resources Information Center

    Peterson, Carol B.; Crow, Scott J.; Swanson, Sonja A.; Crosby, Ross D.; Wonderlich, Stephen A.; Mitchell, James E.; Agras, W. Stewart; Halmi, Katherine A.

    2011-01-01

    Objective: The purpose of this investigation was to derive an empirical classification of eating disorder symptoms in a heterogeneous eating disorder sample using latent class analysis (LCA) and to examine the longitudinal stability of these latent classes (LCs) and the stability of DSM-IV eating disorder (ED) diagnoses. Method: A total of 429…

  18. Getting Back to the Main Point: A Reply to Miller et al.

    ERIC Educational Resources Information Center

    Harrison, Allyson G.; Holmes, Alana; Silvestri, Robert; Armstrong, Irene T.

    2015-01-01

    Miller et al. have challenged the findings of our two previous studies, based largely on the assumption that our findings are biased due to the clinical sample used. However, they fail to address the primary tenet of our studies, namely, that clinicians will obtain different scores on the Wechsler Adult Intelligence Scale-IV (WAIS-IV) depending on…

  19. Concurrent Validity of the WISC-IV and DAS-II in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Kuriakose, Sarah

    2014-01-01

    Cognitive assessments are used for a variety of research and clinical purposes in children with autism spectrum disorder (ASD). This study establishes concurrent validity of the Wechsler Intelligence Scales for Children-fourth edition (WISC-IV) and Differential Ability Scales-second edition (DAS-II) in a sample of children with ASD with a broad…

  20. Adsorption of Se species on crushed granite: a direct linkage with its internal iron-related minerals.

    PubMed

    Jan, Yi-Lin; Wang, Tsing-Hai; Li, Ming-Hsu; Tsai, Shih-Chin; Wei, Yuan-Yaw; Teng, Shi-Ping

    2008-01-01

    The adsorption of selenium species on crushed granite is investigated directly linking to its internal iron-related minerals. Experimental results demonstrated that granite has higher affinity toward Se(IV) adsorption than Se(VI) adsorption. Se(IV) adsorption on granite is insensitive to background electrolytes while the effect of ionic strength on Se(VI) adsorption is not observed, which is attributed to the overloading of Se(VI) ions. Results of chemical sequential extraction showed that the removal of crystalline iron oxides dramatically reduces Se(IV) adsorption, which corresponds to the disappearance of goethite signal within XRD pattern. Based on our results, it is proposed that goethite within granite dominates Se adsorption in crushed granite. Although these goethites probably stem from some sample preparation processes including drilling in situ, crushing, washing and drying granite samples in laboratory, the formation of goethite enhances the granite affinity toward Se species adsorption. Images of SEM/EDS furthermore revealed that goethite is embedded within the fractures. In addition, quantification by standard addition method by spiking goethite suspension indicates that only around 20% of goethite minerals are available during Se(IV) adsorption.

  1. Use of the Panic Attack Questionnaire-IV to assess non-clinical panic attacks and limited symptom panic attacks in student and community samples.

    PubMed

    Norton, Peter J; Zvolensky, Michael J; Bonn-Miller, Marcel O; Cox, Brian J; Norton, G Ron

    2008-10-01

    Since its development in the mid-1980s, the Panic Attack Questionnaire (PAQ) has been one of the more, if not the most, commonly used self-report tools for assessing panic attacks. The usage of the instrument, however, has come amid potential concerns that instructions and descriptions may lead to an over-estimate of the prevalence of panic attacks. Furthermore, the instrument has not been revised since 1992, despite changes in DSM-IV criteria and more recent developments in the understanding of panic attacks. As a result, this paper describes a revision of the PAQ to improve the instruction and descriptive set, and to fully assess features of panic derived from recent conceptualizations. Students meeting DSM-IV panic attack criteria and those endorsing panic attacks, but not meeting criteria, showed few differences with the exception that those not meeting DSM-IV criteria typically reported a longer onset-to-peak intensity time than did Panickers. Results were cross-validated and extended using an independent Community Sample. A full descriptive phenomenology of panic attacks is described, and future directions for studying panic attacks using the PAQ are presented.

  2. DSM-5 Gambling Disorder: Prevalence and Characteristics in a Substance Use Disorder Sample

    PubMed Central

    Rennert, Lior; Denis, Cécile; Peer, Kyle; Lynch, Kevin G.; Gelernter, Joel; Kranzler, Henry R.

    2014-01-01

    Background The fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) replaced the DSM-IV diagnosis of Pathological Gambling (PG) with Gambling Disorder (GD). GD requires four rather than five criteria for the diagnosis and excludes the “Illegal Acts” criterion. We examined the prevalence of GD and its characteristics and validity in a substance use disorder (SUD) sample. Methods Participants (N=6,613) in genetic studies of substance dependence underwent a semi-structured psychiatric interview. Individuals who reported ever having gambled $10 at least monthly (n = 1,507) were the focus of the analyses. Results Approximately one-third of acknowledged gamblers (n = 563; 8.5% of the total sample) received both PG (DSM-IV) and GD (DSM-5) diagnoses and 678 (10.3% of the total) received a DSM-5 diagnosis, representing an increase of 20.4% relative to DSM-IV. Although the three groups were comparable demographically, the DSM-5-Only group was intermediate between the other two groups on the prevalence of comorbid substance use disorders, the distribution of DSM-IV PG criteria endorsed, and the types of gambling reported. Multinomial logistic regression analysis showed that the DSM-5-Only group was more likely than the No-Diagnosis group and less likely than the Both-Diagnoses group to acknowledge a gambling problem. Conclusion There was a high prevalence of PG in this SUD sample. Analysis of non-DSM variables suggested that the increased sensitivity of the DSM-5 GD diagnosis successfully identifies a broader set of individuals with clinically significant gambling-related problems. Prospective studies of individuals with GD are needed to validate this finding. PMID:24490711

  3. Restless Legs Syndrome in a Community Sample of Korean Adults: Prevalence, Impact on Quality of Life, and Association with DSM-IV Psychiatric Disorders

    PubMed Central

    Cho, Seong-Jin; Hong, Jin Pyo; Hahm, Bong-Jin; Jeon, Hong Jin; Chang, Sung Man; Cho, Maeng Je; Lee, Hochang B.

    2009-01-01

    Study Objectives: Conflicting reports on prevalence of RLS exist in Asian countries due to differences in sampling strategies and assessment instruments. We assessed the prevalence, correlates, quality of life, and psychiatric comorbidity of RLS in South Korea. Design/setting: Cross-sectional nationwide survey. Participants: Nationally representative sample of 6,509 Korean adults aged 18–64. Measurement & Results: Face-to-face interviews based on the Korean translation of the four features of RLS defined by the International RLS Study Group (IRLSSG), the Korean version of Composite International Diagnostic Interview (K-CIDI), and EuroQol (EQ-5D) were conducted for all participants. The weighted prevalence of RLS in South Korea was 0.9% (men, 0.6%; women, 1.3%). Subjects with RLS had a lower quality of life according to EQ-5D than those without RLS. Adjusted odds ratio for lifetime diagnosis of DSM-IV major depressive disorder (2.57, 95% confidence interval [1.33, 4.96]), panic disorder (18.9 [4.72, 75.9]) and posttraumatic stress disorder (3.76 [1.32, 10.7]) suggest strong association between RLS and DSM-IV depression and anxiety disorders. Conclusions: Prevalence of RLS estimated based on the IRLSSG diagnostic criteria is substantially lower in South Korea than in Western countries. Differences in culture and risk factors that affect the expression of RLS may vary across the countries. Citation: Cho SJ; Hong JP; Hahm BJ; Jeon HJ; Chang SM; Cho MJ; Lee HB. Restless legs syndrome in a community sample of korean adults: prevalence, impact on quality of life, and association with DSM-IV psychiatric disorders. SLEEP 2009;32(8):1069-1076. PMID:19725258

  4. Comorbid psychiatric disorders in 201 cases of encopresis.

    PubMed

    Unal, Fatih; Pehlivantürk, Berna

    2004-01-01

    Although encopresis is a common and complex disorder, relatively few studies have evaluated the comorbid psychiatric disorders in this condition. This study was performed to investigate the comorbid psychiatric disorders in encopresis. One hundred and sixty boys (79.6%) and 41 girls (20.4%) fulfilled the diagnostic criteria for encopresis according to DSM-IV. There was at least one comorbid diagnosis in 149 (74.1%) patients. The most frequent comorbid diagnosis was enuresis (55.2%). Clinical and demographical data were compared between patients with comorbid disorders and others. Primary encopresis was significantly more frequent in patients with comorbid disorders, and the mean age at admission was lower in these patients. The mean interval between the onset of symptoms and the diagnosis was significantly shorter in secondary encopretic patients with comorbid disorders. Furthermore, there were significantly more psychiatric disorders in the first-degree relatives of patients with comorbid disorders. Encopresis is frequently accompanied with a psychiatric disorder. Clinicians need to inquire about symptoms of other psychiatric disorders in patients who present with encopresis and vice versa.

  5. Groundwater-quality characteristics for the Wyoming Groundwater-Quality Monitoring Network, November 2009 through September 2012

    USGS Publications Warehouse

    Boughton, Gregory K.

    2014-01-01

    Groundwater samples were collected from 146 shallow (less than or equal to 500 feet deep) wells for the Wyoming Groundwater-Quality Monitoring Network, from November 2009 through September 2012. Groundwater samples were analyzed for physical characteristics, major ions and dissolved solids, trace elements, nutrients and dissolved organic carbon, uranium, stable isotopes of hydrogen and oxygen, volatile organic compounds, and coliform bacteria. Selected samples also were analyzed for gross alpha radioactivity, gross beta radioactivity, radon, tritium, gasoline range organics, diesel range organics, dissolved hydrocarbon gases (methane, ethene, and ethane), and wastewater compounds. Water-quality measurements and concentrations in some samples exceeded numerous U.S. Environmental Protection Agency (EPA) drinking water standards. Physical characteristics and constituents that exceeded EPA Maximum Contaminant Levels (MCLs) in some samples were arsenic, selenium, nitrite, nitrate, gross alpha activity, and uranium. Total coliforms and Escherichia coli in some samples exceeded EPA Maximum Contaminant Level Goals. Measurements of pH and turbidity and concentrations of chloride, sulfate, fluoride, dissolved solids, aluminum, iron, and manganese exceeded EPA Secondary Maximum Contaminant Levels in some samples. Radon concentrations in some samples exceeded the alternative MCL proposed by the EPA. Molybdenum and boron concentrations in some samples exceeded EPA Health Advisory Levels. Water-quality measurements and concentrations also exceeded numerous Wyoming Department of Environmental Quality (WDEQ) groundwater standards. Physical characteristics and constituents that exceeded WDEQ Class I domestic groundwater standards in some samples were measurements of pH and concentrations of chloride, sulfate, dissolved solids, iron, manganese, boron, selenium, nitrite, and nitrate. Measurements of pH and concentrations of chloride, sulfate, dissolved solids, aluminum, iron, manganese, boron, and selenium exceeded WDEQ Class II agriculture groundwater standards in some samples. Measurements of pH and concentrations of sulfate, dissolved solids, aluminum, boron, and selenium exceeded WDEQ Class III livestock groundwater standards in some samples. The concentrations of dissolved solids in two samples exceeded the WDEQ Class IV industry groundwater standard. Measurements of pH and concentrations of dissolved solids, aluminum, iron, manganese, and selenium exceeded WDEQ Class special (A) fish and aquatic life groundwater standards in some samples. Stable isotopes of hydrogen and oxygen measured in water samples were compared to the Global Meteoric Water Line and Local Meteoric Water Lines. Results indicated that recharge to all of the wells was derived from precipitation and that the water has undergone some fractionation, possibly because of evaporation. Concentrations of organic compounds did not exceed any State or Federal water-quality standards. Few volatile organic compounds were detected in samples, whereas gasoline range organics, diesel range organics, and methane were detected most frequently. Concentrations of wastewater compounds did not exceed any State or Federal water-quality standards. The compounds N,N-diethyl-meta-toluamide (DEET), benzophenone, and phenanthrene were detected most frequently. Bacteria samples were collected, processed, incubated, and enumerated in the field or at the U.S. Geological Survey Wyoming-Montana Water Science Center. Total coliforms and Escherichia coli were detected in some samples.

  6. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV).

    PubMed

    Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao

    2016-10-12

    Zr(IV) can form phosphate and Zr(IV) (-PO₃ 2- -Zr 4+ -) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A 520nm / A 650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.

  7. Sex Differences in DSM-IV Posttraumatic Stress Disorder Symptoms Expression Using Item Response Theory: a Population-based Study

    PubMed Central

    Rivollier, Fabrice; Peyre, Hugo; Hoertel, Nicolas; Blanco, Carlos; Limosin, Frédéric; Delorme, Richard

    2015-01-01

    Background Whether there are systematic sex differences in posttraumatic stress disorder (PTSD) symptom expression remains debated. Using methods based on item response theory (IRT), we aimed at examining differences in the likelihood of reporting DSM-IV symptoms of PTSD between women and men, while stratifying for major trauma type and equating for PTSD severity. Method We compared data from women and men in a large nationally representative adult sample, the National Epidemiologic Survey on Alcohol and Related Conditions. Analyses were conducted in the full population sample of individuals who met the DSM-IV criterion A (n = 23,860) and in subsamples according to trauma types. Results The clinical presentation of the 17 DSM-IV PTSD symptoms in the general population did not substantially differ in women and men in the full population and by trauma type after equating for levels of PTSD severity. The only exception was the symptom “foreshortened future”, which was more likely endorsed by men at equivalent levels of PTSD severity. Limitations The retrospective nature of the assessment of PTSD symptoms could have led to recall bias. Our sample size was too small to draw conclusions among individuals who experienced war-related traumas. Conclusions Our findings suggest that the clinical presentation of PTSD does not differ substantially between women and men. We also provide additional psychometric support to the exclusion of the symptom “foreshortened future” from the diagnostic criteria for PTSD in the DSM-5. PMID:26342916

  8. Sex differences in DSM-IV posttraumatic stress disorder symptoms expression using item response theory: A population-based study.

    PubMed

    Rivollier, Fabrice; Peyre, Hugo; Hoertel, Nicolas; Blanco, Carlos; Limosin, Frédéric; Delorme, Richard

    2015-11-15

    Whether there are systematic sex differences in posttraumatic stress disorder (PTSD) symptom expression remains debated. Using methods based on item response theory (IRT), we aimed at examining differences in the likelihood of reporting DSM-IV symptoms of PTSD between women and men, while stratifying for major trauma type and equating for PTSD severity. We compared data from women and men in a large nationally representative adult sample, the National Epidemiologic Survey on Alcohol and Related Conditions. Analyses were conducted in the full population sample of individuals who met the DSM-IV criterion A (n=23,860) and in subsamples according to trauma types. The clinical presentation of the 17 DSM-IV PTSD symptoms in the general population did not substantially differ in women and men in the full population and by trauma type after equating for levels of PTSD severity. The only exception was the symptom "foreshortened future", which was more likely endorsed by men at equivalent levels of PTSD severity. The retrospective nature of the assessment of PTSD symptoms could have led to recall bias. Our sample size was too small to draw conclusions among individuals who experienced war-related traumas. Our findings suggest that the clinical presentation of PTSD does not differ substantially between women and men. We also provide additional psychometric support to the exclusion of the symptom "foreshortened future" from the diagnostic criteria for PTSD in the DSM-5. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Correcting C IV-based virial black hole masses

    NASA Astrophysics Data System (ADS)

    Coatman, Liam; Hewett, Paul C.; Banerji, Manda; Richards, Gordon T.; Hennawi, Joseph F.; Prochaska, J. Xavier

    2017-02-01

    The C IVλλ1498,1501 broad emission line is visible in optical spectra to redshifts exceeding z ˜ 5. C IV has long been known to exhibit significant displacements to the blue and these `blueshifts' almost certainly signal the presence of strong outflows. As a consequence, single-epoch virial black hole (BH) mass estimates derived from C IV velocity widths are known to be systematically biased compared to masses from the hydrogen Balmer lines. Using a large sample of 230 high-luminosity (LBol = 1045.5-1048 erg s-1), redshift 1.5 < z < 4.0 quasars with both C IV and Balmer line spectra, we have quantified the bias in C IV BH masses as a function of the C IV blueshift. C IV BH masses are shown to be a factor of 5 larger than the corresponding Balmer-line masses at C IV blueshifts of 3000 km s-1and are overestimated by almost an order of magnitude at the most extreme blueshifts, ≳5000 km s-1. Using the monotonically increasing relationship between the C IV blueshift and the mass ratio BH(C IV)/BH(Hα), we derive an empirical correction to all C IV BH masses. The scatter between the corrected C IV masses and the Balmer masses is 0.24 dex at low C IV blueshifts (˜0 km s-1) and just 0.10 dex at high blueshifts (˜3000 km s-1), compared to 0.40 dex before the correction. The correction depends only on the C IV line properties - i.e. full width at half-maximum and blueshift - and can therefore be applied to all quasars where C IV emission line properties have been measured, enabling the derivation of unbiased virial BH-mass estimates for the majority of high-luminosity, high-redshift, spectroscopically confirmed quasars in the literature.

  10. Psychological variables and Wechsler Adult Intelligence Scale-IV performance.

    PubMed

    Gass, Carlton S; Gutierrez, Laura

    2017-01-01

    The MMPI-2 and WAIS-IV are commonly used together in neuropsychological evaluations yet little is known about their interrelationships. This study explored the potential influence of psychological factors on WAIS-IV performance in a sample of 180 predominantly male veteran referrals that underwent a comprehensive neuropsychological examination in a VA Medical Center. Exclusionary criteria included failed performance validity testing and self-report distortion on the MMPI-2. A Principal Components Analysis was performed on the 15 MMPI-2 content scales, yielding three broader higher-order psychological dimensions: Internalized Emotional Dysfunction (IED), Externalized Emotional Dysfunction (EED), and Fear. Level of IED was not related to performance on the WAIS-IV Full Scale IQ or its four indexes: (Verbal Comprehension, Perceptual Reasoning, Working Memory, and Processing Speed). EED was not related to WAIS-IV performance. Level of Fear, which encompasses health preoccupations (HEA) and distorted perceptions (BIZ), was significantly related to WAIS-IV Full Scale IQ and Verbal Comprehension. These results challenge the common use of high scores on the MMPI-2 IED measures (chiefly depression and anxiety) to explain deficient WAIS-IV performance. In addition, they provide impetus for further investigation of the relation between verbal intelligence and Fear.

  11. Comparison of nucleotide sequences of recent and previous lineages of peste-des-petits-ruminants viruses of sheep and goats in Nigeria.

    PubMed

    Mantip, Samuel; Quan, Melvyn; Shamaki, David; Van Vuuren, Moritz

    2016-08-31

    Peste-des-petits-ruminants virus (PPRV) is a highly contagious, fatal and economically important viral disease of small ruminants that is still endemic and militates against the production of sheep and goats in endemic areas of the world. The aim of this study was to describe the viral strains within the country. This was carried out by collecting tissue and swab samples from sheep and goats in various agro-ecological zones of Nigeria. The phylogeny of archived PPRV strains or isolates and those circulating and causing recent outbreaks was determined by sequencing of the nucleoprotein (N)-gene. Twenty tissue and swab samples from apparently healthy and sick sheep and goats were collected randomly from 18 states, namely 3 states in each of the 6 agro-ecological zones visited. A total of 360 samples were collected. A total of 35 samples of 360 (9.7%) tested positive by reverse transcriptase-polymerase chain reaction, of which 25 were from oculo-nasal swabs and 10 were from tissue samples. Neighbour-joining phylogenetic analysis using Phylogenetic Analysis Using Parsimony (PAUP) identified four different lineages, that is, lineages I, II, III and IV. Interestingly, the Nigerian strains described in this study grouped in two separate major lineages, that is, lineages II and IV. Strains from Sokoto, Oyo, Plateau and Ondo states grouped according to the historical distribution of PPRV together with the Nigerian 75/1 strain of lineage II, while other strains from Sokoto, Oyo, Plateau, Akwa-Ibom, Adamawa, Kaduna, Lagos, Bauchi, Niger and Kano states grouped together with the East African and Asian strains of lineage IV. This finding confirms that both lineage II and IV strains of PPRV are circulating in Nigeria. Previously, only strains of lineage II were found to be present in the country.

  12. Identification of Trypanosoma cruzi Discrete Typing Units (DTUs) in Latin-American migrants in Barcelona (Spain).

    PubMed

    Abras, Alba; Gállego, Montserrat; Muñoz, Carmen; Juiz, Natalia A; Ramírez, Juan Carlos; Cura, Carolina I; Tebar, Silvia; Fernández-Arévalo, Anna; Pinazo, María-Jesús; de la Torre, Leonardo; Posada, Elizabeth; Navarro, Ferran; Espinal, Paula; Ballart, Cristina; Portús, Montserrat; Gascón, Joaquim; Schijman, Alejandro G

    2017-04-01

    Trypanosoma cruzi, the causative agent of Chagas disease, is divided into six Discrete Typing Units (DTUs): TcI-TcVI. We aimed to identify T. cruzi DTUs in Latin-American migrants in the Barcelona area (Spain) and to assess different molecular typing approaches for the characterization of T. cruzi genotypes. Seventy-five peripheral blood samples were analyzed by two real-time PCR methods (qPCR) based on satellite DNA (SatDNA) and kinetoplastid DNA (kDNA). The 20 samples testing positive in both methods, all belonging to Bolivian individuals, were submitted to DTU characterization using two PCR-based flowcharts: multiplex qPCR using TaqMan probes (MTq-PCR), and conventional PCR. These samples were also studied by sequencing the SatDNA and classified as type I (TcI/III), type II (TcII/IV) and type I/II hybrid (TcV/VI). Ten out of the 20 samples gave positive results in the flowcharts: TcV (5 samples), TcII/V/VI (3) and mixed infections by TcV plus TcII (1) and TcV plus TcII/VI (1). By SatDNA sequencing, we classified the 20 samples, 19 as type I/II and one as type I. The most frequent DTU identified by both flowcharts, and suggested by SatDNA sequencing in the remaining samples with low parasitic loads, TcV, is common in Bolivia and predominant in peripheral blood. The mixed infection by TcV-TcII was detected for the first time simultaneously in Bolivian migrants. PCR-based flowcharts are very useful to characterize DTUs during acute infection. SatDNA sequence analysis cannot discriminate T. cruzi populations at the level of a single DTU but it enabled us to increase the number of characterized cases in chronically infected patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Energy drink consumption and increased risk for alcohol dependence.

    PubMed

    Arria, Amelia M; Caldeira, Kimberly M; Kasperski, Sarah J; Vincent, Kathryn B; Griffiths, Roland R; O'Grady, Kevin E

    2011-02-01

    Energy drinks are highly caffeinated beverages that are increasingly consumed by young adults. Prior research has established associations between energy drink use and heavier drinking and alcohol-related problems among college students. This study investigated the extent to which energy drink use might pose additional risk for alcohol dependence over and above that from known risk factors. Data were collected via personal interview from 1,097 fourth-year college students sampled from 1 large public university as part of an ongoing longitudinal study. Alcohol dependence was assessed according to DSM-IV criteria. After adjustment for the sampling design, 51.3%(wt) of students were classified as "low-frequency" energy drink users (1 to 51 days in the past year) and 10.1%(wt) as "high-frequency" users (≥52 days). Typical caffeine consumption varied widely depending on the brand consumed. Compared to the low-frequency group, high-frequency users drank alcohol more frequently (141.6 vs. 103.1 days) and in higher quantities (6.15 vs. 4.64 drinks/typical drinking day). High-frequency users were at significantly greater risk for alcohol dependence relative to both nonusers (AOR = 2.40, 95% CI = 1.27 to 4.56, p = 0.007) and low-frequency users (AOR = 1.86, 95% CI = 1.10, 3.14, p = 0.020), even after holding constant demographics, typical alcohol consumption, fraternity/sorority involvement, depressive symptoms, parental history of alcohol/drug problems, and childhood conduct problems. Low-frequency energy drink users did not differ from nonusers on their risk for alcohol dependence. Weekly or daily energy drink consumption is strongly associated with alcohol dependence. Further research is warranted to understand the possible mechanisms underlying this association. College students who frequently consume energy drinks represent an important target population for alcohol prevention. Copyright © 2010 by the Research Society on Alcoholism.

  14. The behavior of dissolved inorganic selenium in the Changjiang Estuary

    NASA Astrophysics Data System (ADS)

    Chang, Yan; Zhang, Jing; Qu, Jianguo; Zhang, Guosen; Zhang, Anyu; Zhang, Ruifeng

    2016-02-01

    To investigate the behavior of inorganic selenium species in the Changjiang Estuary, samples were taken during summer (July 2011) and winter (March 2012). Dissolved inorganic selenium (DISe) concentrations averaged 1.79 nmol/L in summer and 1.24 nmol/L in winter; the average selenite [Se(IV)] to selenate [Se(VI)] ratio [Se(IV)/Se(VI)] was 0.42 in summer and 0.61 in winter. The data show that Se(IV) and Se(VI) concentrations in the estuary behaved strictly conservatively during winter but non-conservatively during summer due to adsorption by suspended particulate matter (SPM) and assimilation by phytoplankton. In addition, the Se concentration distributions in the Changjiang Estuary were controlled by three water masses, each with a specific Se(IV)/Se(VI) ratio "signature": the Changjiang Water input, the Taiwan Warm Current, and the Yellow Sea Coastal Current. The Se(IV) concentrations were related to the nitrate, silicate, and phosphate concentrations in the estuary. The DISe and Se(IV) concentrations were comparable to those found in other coastal regions and estuaries, which were considered to be natural levels.

  15. Genetically distinct genogroup IV norovirus strains identified in wastewater.

    PubMed

    Kitajima, Masaaki; Rachmadi, Andri T; Iker, Brandon C; Haramoto, Eiji; Gerba, Charles P

    2016-12-01

    We investigated the prevalence and genetic diversity of genogroup IV norovirus (GIV NoV) strains in wastewater in Arizona, United States, over a 13-month period. Among 50 wastewater samples tested, GIV NoVs were identified in 13 (26 %) of the samples. A total of 47 different GIV NoV strains were identified, which were classified into two genetically distinct clusters: the GIV.1 human cluster and a unique genetic cluster closely related to strains previously identified in Japanese wastewater. The results provide additional evidence of the considerable genetic diversity among GIV NoV strains through the analysis of wastewater containing virus strains shed from all populations.

  16. Simultaneous extraction and preconcentration of uranium and thorium in aqueous samples by new modified mesoporous silica prior to inductively coupled plasma optical emission spectrometry determination.

    PubMed

    Yousefi, Seyed Reza; Ahmadi, Seyed Javad; Shemirani, Farzaneh; Jamali, Mohammad Reza; Salavati-Niasari, Masoud

    2009-11-15

    A new synthesized modified mesoporous silica (MCM-41) using 5-nitro-2-furaldehyde (fural) was applied as an effective sorbent for the solid phase extraction of uranium(VI) and thorium(IV) ions from aqueous solution for the measurement by inductively coupled plasma optical emission spectrometry (ICP OES). The influences of some analytical parameters on the quantitative recoveries of the analyte ions were investigated in batch method. Under optimal conditions, the analyte ions were sorbed by the sorbent at pH 5.5 and then eluted with 1.0 mL of 1.0 mol L(-1) HNO(3). The preconcentration factor was 100 for a 100mL sample volume. The limits of detection (LOD) obtained for uranium(VI) and thorium(IV) were 0.3 microg L(-1). The maximum sorption capacity of the modified MCM-41 was found to be 47 and 49 mg g(-1) for uranium(VI) and thorium(IV), respectively. The sorbent exhibited good stability, reusability, high adsorption capacity and fast rate of equilibrium for sorption/desorption of uranium and thorium ions. The applicability of the synthesized sorbent was examined using CRM and real water samples.

  17. Voc Degradation in TF-VLS Grown InP Solar Cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Yubo; Sun, Xingshu; Johnston, Steve

    2016-11-21

    Here we consider two hypotheses to explain the open-circuit voltage (VOC) degradation observed in thin-film vapor-liquid-solid (TF-VLS) grown p-type InP photovoltaic cells: bandgap narrowing and local shunting. First, a bandgap (Eg) narrowing effect is hypothesized, based on the surface inhomogeneity of VLS InP captured by the photoluminescence (PL) image. The PL data was used to estimate a spatially-resolved active VOC across surface of the InP sample. Combining this data with the effective Jsc allowed an assessment of the I-V characteristics of individual unit cells. Next, an H-SPICE diode compact model was utilized to reproduce the I-V characteristics of the wholemore » sample. We find a good fit to the I-V performance of TF-VLS grown InP solar cell. Second, a local shunting effect was also considered as an alternative explanation of the VOC degradation effect. Again, PL image data was used, and small local shunt resistance was added in arbitrary elementary unit cells to represent certain dark spots seen in the PL image and dictate the VOC degradation occurred in the sample.« less

  18. The incremental validity of borderline personality disorder relative to major depressive disorder for suicidal ideation and deliberate self-harm in adolescents.

    PubMed

    Sharp, Carla; Green, Kelly L; Yaroslavsky, Ilya; Venta, Amanda; Zanarini, Mary C; Pettit, Jeremy

    2012-12-01

    Few studies have examined the relation between suicide-related behaviors and Borderline Personality Disorder (BPD) in adolescent samples. The current study investigated the incremental validity of BPD relative to Major Depressive Disorder (MDD) for suicide-related behaviors in a psychiatric sample of adolescents at the cross-sectional level of analysis. The sample included N = 156 consecutive admissions (55.1% female; M age = 15.47; SD = 1.41), to the adolescent treatment program of an inpatient treatment facility. Of the sample 19.2% (n = 30) met criteria for BPD on the Child Interview for DSM-IV Borderline Personality Disorder and 39.1% (n = 61) met criteria for MDD on the Computerized Diagnostic Interview Schedule for Children-IV. Results showed that BPD conferred additional risk for suicidal ideation and deliberate self-harm. Our findings support the clinical impression that BPD should be evaluated in inpatient samples of adolescents either through intake interviews or more structured assessments.

  19. [Autocontrol of muscle relaxation with vecuronium].

    PubMed

    Sibilla, C; Zatelli, R; Marchi, M; Zago, M

    1990-01-01

    The optimal conditions for maintaining desired levels of muscle relaxation with vecuronium are obtained by means of the continuous infusion (I.V.) technique. A frequent correction of the infusion flow is required, since it is impossible to predict the exact amount for the muscle relaxant in single case. In order to overcome such limits the authors propose a very feasible infusion system for the self-control of muscle relaxation; furthermore they positively consider its possible daily clinical application.

  20. Evaluation of the Impact of ESEA Title I Programs for Migrant Children of Migrant Agricultural Workers. Volume IV--Appendices. Final Report.

    ERIC Educational Resources Information Center

    Exotech Systems, Inc., Falls Church, VA.

    Volume IV of the evaluation report consists of case studies from 10 migrant education projects in 8 of the sample States. These projects were visited in July through September 1973. The case studies give noteworthy or innovative aspects of the projects, detailed descriptions, and the functions. The projects are: (1) Harnett County Summer Migrant…

  1. The Effects of DSM-5 Criteria on Number of Individuals Diagnosed with Autism Spectrum Disorder: A Systematic Review

    ERIC Educational Resources Information Center

    Smith, Isaac C.; Reichow, Brian; Volkmar, Fred R.

    2015-01-01

    A growing body of research has raised concerns about the number of individuals diagnosed with autism spectrum disorder (ASD) according to DSM-IV-TR who may no longer qualify for diagnoses under the new DSM-5 criteria, published in May 2013. The current study systematically reviews 25 articles evaluating samples according to both DSM-IV-TR and…

  2. A Taxometric Investigation of "DSM-IV" Major Depression in a Large Outpatient Sample: Interpretable Structural Results Depend on the Mode of Assessment

    ERIC Educational Resources Information Center

    Ruscio, John; Brown, Timothy A.; Ruscio, Ayelet Meron

    2009-01-01

    Most taxometric studies of depressive constructs have drawn indicators from self-report instruments that do not bear directly on the "Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV)" diagnostic construct of major depressive disorder (MDD). The present study examined the latent structure of MDD using indicator sets…

  3. Diagnostic Classification of Eating Disorders in Children and Adolescents: How Does DSM-IV-TR Compare to Empirically-Derived Categories?

    ERIC Educational Resources Information Center

    Eddy, Kamryn T.; Le Grange, Daniel; Crosby, Ross D.; Hoste, Renee Rienecke; Doyle, Angela Celio; Smyth, Angela; Herzog, David B.

    2010-01-01

    Objective: The purpose of this study was to empirically derive eating disorder phenotypes in a clinical sample of children and adolescents using latent profile analysis (LPA), and to compare these latent profile (LP) groups to the DSM-IV-TR eating disorder categories. Method: Eating disorder symptom data collected from 401 youth (aged 7 through 19…

  4. Evaluation of a research diagnostic algorithm for DSM-5 neurocognitive disorders in a population-based cohort of older adults.

    PubMed

    Eramudugolla, Ranmalee; Mortby, Moyra E; Sachdev, Perminder; Meslin, Chantal; Kumar, Rajeev; Anstey, Kaarin J

    2017-03-04

    There is little information on the application and impact of revised criteria for diagnosing dementia and mild cognitive impairment (MCI), now termed major and mild neurocognitive disorders (NCDs) in the DSM-5. We evaluate a psychometric algorithm for diagnosing DSM-5 NCDs in a community-dwelling sample, and characterize the neuropsychological and functional profile of expert-diagnosed DSM-5 NCDs relative to DSM-IV dementia and International Working Group criteria for MCI. A population-based sample of 1644 adults aged 72-78 years was assessed. Algorithmic diagnostic criteria used detailed neuropsychological data, medical history, longitudinal cognitive performance, and informant interview. Those meeting all criteria for at least one diagnosis had data reviewed by a neurologist (expert diagnosis) who achieved consensus with a psychiatrist for complex cases. The algorithm accurately classified DSM-5 major NCD (area under the curve (AUC) = 0.95, 95% confidence interval (CI) 0.92-0.97), DSM-IV dementia (AUC = 0.91, 95% CI 0.85-0.97), DSM-5 mild NCD (AUC = 0.75, 95% CI 0.70-0.80), and MCI (AUC = 0.76, 95% CI 0.72-0.81) when compared to expert diagnosis. Expert diagnosis of dementia using DSM-5 criteria overlapped with 90% of DSM-IV dementia cases, but resulted in a 127% increase in diagnosis relative to DSM-IV. Additional cases had less severe memory, language impairment, and instrumental activities of daily living (IADL) impairments compared to cases meeting DSM-IV criteria for dementia. DSM-5 mild NCD overlapped with 83% of MCI cases and resulted in a 19% increase in diagnosis. These additional cases had a subtly different neurocognitive profile to MCI cases, including poorer social cognition. DSM-5 NCD criteria can be operationalized in a psychometric algorithm in a population setting. Expert diagnosis using DSM-5 NCD criteria captured most cases with DSM-IV dementia and MCI in our sample, but included many additional cases suggesting that DSM-5 criteria are broader in their categorization.

  5. Posttraumatic stress disorder according to DSM-5 and DSM-IV diagnostic criteria: a comparison in a sample of Congolese ex-combatants

    PubMed Central

    Schaal, Susanne; Koebach, Anke; Hinkel, Harald; Elbert, Thomas

    2015-01-01

    Background Compared to DSM-IV, the criteria for diagnosing posttraumatic stress disorder (PTSD) have been modified in DSM-5. Objective The first aim of this study was to examine how these modifications impact rates of PTSD in a sample of Congolese ex-combatants. The second goal of this study was to investigate whether PTSD symptoms were associated with perpetrator-related acts or victim-related traumatic events. Method Ninety-five male ex-combatants in the eastern Democratic Republic of Congo were interviewed. Both the DSM-IV and the DSM-5 PTSD symptom criteria were assessed. Results The DSM-5 symptom criteria yielded a PTSD rate of 50% (n=47), whereas the DSM-IV symptom criteria were met by 44% (n=42). If the DSM-5 would be set as the current “gold standard,” then DSM-IV would have produced more false negatives (8%) than false positives (3%). A minority of participants (19%, n=18) indicated an event during which they were involved as a perpetrator as their most stressful event. Results of a regression analysis (R 2=0.40) showed that, after accounting for the number of types of traumatic events, perpetrated violent acts were not associated with the symptom severity of PTSD. Conclusions The findings demonstrate that more diagnostic cases were produced with the DSM-5 diagnostic rules than were dropped resulting in an increase in PTSD rates compared to the DSM-IV system. The missing association between PTSD symptoms and perpetrated violent acts might be explained by a potential fascinating and excited perception of these acts. PMID:25720994

  6. Methylphenidate disintegration from oral formulations for intravenous use by experienced substance users.

    PubMed

    Bjarnadottir, G D; Johannsson, M; Magnusson, A; Rafnar, B O; Sigurdsson, E; Steingrimsson, S; Asgrimsson, V; Snorradottir, I; Bragadottir, H; Haraldsson, H M

    2017-09-01

    Methylphenidate (MPH) is a prescription stimulant used to treat attention-deficit hyperactivity disorder. MPH is currently the preferred substance among most intravenous (i.v.) substance users in Iceland. Four types of MPH preparations were available in Iceland at the time of study: Immediate-release (IR), sustained-release (SR), osmotic controlled-release oral delivery (OROS) tablet and osmotic-controlled release (OCR). MPH OROS has previously been rated the least desirable by i.v. users and we hypothesized that this was associated with difficulty of disintegrating MPH from OROS formulation. The aim of the study was to measure the amount of MPH and the viscosity of the disintegrated solutions that were made from the four MPH formulations by four i.v.-users and non-users. A convenience sample of four i.v. substance users and 12 non-users. Non-users imitated the methods applied by experienced i.v. substance users for disintegrated MPH formulations. Both groups managed to disintegrate over 50% of MPH from IR and SR formulations but only 20% from OROS (p<0.0001). The viscosity of the disintegrated MPH was significantly higher for MPH OROS and MPH OCR and the preparation was significantly more time-consuming than for the other MPH samples. No differences were observed between users and non-users. To our knowledge, this is the first investigation of viscosity and the amount of disintegrated MPH from prescription drugs for i.v. use. The results indicate that the ease of disintegration, amount of MPH and viscosity may explain the difference in popularity for i.v. use between different MPH formulations. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The AAHKS Clinical Research Award: Intraosseous Regional Prophylaxis Provides Higher Tissue Concentrations in High BMI Patients in Total Knee Arthroplasty: A Randomized Trial.

    PubMed

    Chin, Seung Joon; Moore, Grant A; Zhang, Mei; Clarke, Henry D; Spangehl, Mark J; Young, Simon W

    2018-07-01

    Obesity is an established risk factor for periprosthetic joint infections after total knee arthroplasty (TKA). In obese patients, a larger dose of prophylactic vancomycin based on actual body weight is required to reach therapeutic concentrations. It is unclear how tissue concentrations are affected when intraosseous regional administration (IORA) is used in this population. This study compared tissue concentrations of low-dose vancomycin via IORA vs actual body weight-adjusted systemic intravenous (IV) dose in primary TKA. Twenty-two patients with a body mass index (BMI) >35 undergoing TKA were randomized into 2 groups. The IV group received 15 mg/kg (maximum of 2 g) of systemic IV vancomycin and the IORA group received 500 mg vancomycin into the tibia. Subcutaneous fat and bone samples were taken at regular intervals. Tissue antibiotic concentrations were measured using liquid chromatography coupled with tandem mass spectrometry. A blood sample was taken 1 to 2 hours after tourniquet deflation to measure systemic concentration. The mean BMI was 41.1 in the IORA group and 40.1 in the IV systemic group. The overall mean tissue concentration in subcutaneous fat was 39.3 μg/g in the IORA group and 4.4 μg/g in the IV systemic group (P < .01). Mean tissue concentrations in bones were 34.4 μg/g in the IORA group and 6.1 μg/g in the IV systemic group (P < .01). Low-dose IORA was effective in the high-BMI population group, providing tissue concentrations of vancomycin 5-9 times higher than systemic administration. IORA optimizes timing of vancomycin administration and provides high tissue antibiotic concentrations during TKA in this high-risk patient group. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Ferulic acid combined with astragaloside IV protects against vascular endothelial dysfunction in diabetic rats.

    PubMed

    Yin, Yonghui; Qi, Fanghua; Song, Zhenhua; Zhang, Bo; Teng, Jialin

    2014-08-01

    Dysfunction of the endothelium is regarded as an important factor in the pathogenesis of vascular disease in diabetes mellitus (DM). Unfortunately, prevention of the progression of vascular complications of DM remains pessimistic. Ferulic acid and astragaloside IV, isolated from traditional Chinese medicine Angelica sinensis and Radix astragali respectively, exhibit potential cardio-protective and anti-hyperglycemic properties. In the present study, we investigated the protective effects and underlying mechanism of ferulic acid and astragaloside IV against vascular endothelial dysfunction in diabetic rats. After the diabetic rat model was established using streptozotocin, sixty rats were divided into 6 groups (control, model, ferulic acid, astragaloside IV, ferulic acid + astragaloside IV, and metformin) and treated for 10 weeks. Blood samples were collected to measure levels of hemoglobin A1c (HbAlc), triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), low density lipoproteins (Ox-LDL), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and creatinine (Cr), nitric oxide (NO) and endothelial nitric oxide synthase (eNOS), and abdominal aorta tissue samples were collected for observing histological morphology changes of endothelium and detecting gene and protein expression of nuclear factor-κB (NF-κB) P65, monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor α (TNF-α). We found that ferulic acid combined with astragaloside IV was capable of improving the structure of the aortic endothelium wall, attenuating the increase of HbAlc, TG, TC, LDL-C and Ox-LDL, promoting the release of NO and eNOS, and inhibiting over-activation of MCP-1, TNF-α, and NF-κB P65, without damage to liver and kidney function. In conclusion, ferulic acid combined with astragaloside IV exhibited significant protective effects against vascular endothelial dysfunction in diabetic rats through the NF-κB pathway involving decrease of Ox-LDL, increase of NO and eNOS, and activation of NF-κB P65, MCP-1 and TNF-α.

  9. Socioeconomic status and the likelihood of antibiotic treatment for signs and symptoms of pulmonary exacerbation in children with cystic fibrosis.

    PubMed

    Schechter, Michael S; McColley, Susanna A; Regelmann, Warren; Millar, Stefanie J; Pasta, David J; Wagener, Jeffrey S; Konstan, Michael W; Morgan, Wayne J

    2011-11-01

    To determine whether socioeconomic status (SES) influences the likelihood of antibiotic treatment of pulmonary exacerbations in patients with cystic fibrosis (CF). We used data on 9895 patients ≤ 18 years old from the Epidemiologic Study of CF. After establishing an individual baseline of clinical signs and symptoms, we ascertained whether antibiotics were prescribed when new signs/symptoms suggested a pulmonary exacerbation, adjusting for sex, presence of Pseudomonas aeruginosa, the number of new signs/symptoms, and baseline disease severity. In a 12-month period, 20.0% of patients <6 years of age, 33.8% of patients 6 to 12 years of age, and 41.4% of patients 13 to 18 years of age were treated with any (oral, intravenous (IV), or inhaled) antibiotics; the percentage receiving IV antibiotics was 7.3%, 15.2%, and 20.9%, respectively. SES had little effect on treatment for pulmonary exacerbation with any antibiotics, but IV antibiotics were prescribed more frequently for patients with lower SES. SES-related disparities in CF health outcomes do not appear to be explained by differential treatment of pulmonary exacerbations. Copyright © 2011 Mosby, Inc. All rights reserved.

  10. Methods to Improve Osseointegration of Dental Implants in Low Quality (Type-IV) Bone: An Overview.

    PubMed

    Alghamdi, Hamdan S

    2018-01-13

    Nowadays, dental implants have become more common treatment for replacing missing teeth and aim to improve chewing efficiency, physical health, and esthetics. The favorable clinical performance of dental implants has been attributed to their firm osseointegration, as introduced by Brånemark in 1965. Although the survival rate of dental implants over a 10-year observation has been reported to be higher than 90% in totally edentulous jaws, the clinical outcome of implant treatment is challenged in compromised (bone) conditions, as are frequently present in elderly people. The biomechanical characteristics of bone in aged patients do not offer proper stability to implants, being similar to type-IV bone (Lekholm & Zarb classification), in which a decreased clinical fixation of implants has been clearly demonstrated. However, the search for improved osseointegration has continued forward for the new evolution of modern dental implants. This represents a continuum of developments spanning more than 20 years of research on implant related-factors including surgical techniques, implant design, and surface properties. The methods to enhance osseointegration of dental implants in low quality (type-IV) bone are described in a general manner in this review.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spangler, Lorenz R.; Most, Wm. A.

    The Waste Isolation Pilot Plant (WIPP) Hazardous Waste Facility Permit (HWFP) limits the allowable emissions of volatile organic compounds (VOCs) from contact handled (CH) transuranic (TRU) waste. The environmental Performance standard within the HWFP, Module IV, Table IV.D.1, prescribes the allowed VOC emissions from the waste to ensure protection of human health and the environment. Compliance with the performance standard to ensure control of VOC emissions is based on VOC concentrations and monitoring in the underground. One of the mechanisms used to ensure compliance with the emissions standards is measuring the VOC concentration in the headspace gas of waste containersmore » prior to disposal. Headspace gas sampling and analysis is the waste characterization activity used to determine the concentration of VOCs in the headspace of waste containers. In addition to being used to demonstrate compliance with the emissions standards of Module IV, Table IV.D.1, the results of the headspace gas sampling and analysis are used to confirm the hazardous wastes identified in the acceptable knowledge (AK) process. Headspace gas sampling and analysis has been an ongoing part of the CH TRU waste characterization program and therefore data are now available concerning its use and applicability. The information from approved Waste Stream Profile Forms (WSPFs) and the headspace gas sampling and analysis results for over 16,000 containers of CH TRU waste were considered as part of this study. The headspace gas sampling and analysis results are based on data from the WIPP Waste Information System (WWIS). These results were evaluated to determine the usefulness of headspace gas sampling and analysis for confirming AK information. The evaluation shows that the reliability of using the results of headspace gas sampling and analysis to confirm AK information can be grouped by mixed and non-mixed waste streams. In general, for mixed waste streams due to VOCs (i.e., carrying VOC-related hazardous waste numbers), there is no reliable comparison that can be made for the detection of a particular target analyte and its associated hazardous waste number(s) based on the AK information on a compound by compound basis. However, for non-mixed waste streams, the results of headspace gas sampling and analysis show a better correlation to the AK information.« less

  12. The Alcohol Use Disorder and Associated Disabilities Interview Schedule-IV (AUDADIS-IV): Reliability of New Psychiatric Diagnostic Modules and Risk Factors in a General Population Sample

    PubMed Central

    Ruan, W. June; Goldstein, Risë B.; Chou, S. Patricia; Smith, Sharon M.; Saha, Tulshi D.; Pickering, Roger P.; Dawson, Deborah A.; Huang, Boji; Stinson, Frederick S.; Grant, Bridget F.

    2008-01-01

    This study presents test-retest reliability statistics and information on internal consistency for new diagnostic modules and risk factor of alcohol, drug, and psychiatric disorders the Alcohol Use Disorder and Associated Disabilities Interview Schedule-IV (AUDADIS-IV). Test-retest statistics were derived from a random sample of 1,899 adults selected from 34,653 respondents who participated in the 2004–2005 Wave 2 National Epidemiologic Survey on Alcohol and Related Conditions (NESARC). Internal consistency of continuous scales was assessed using the entire Wave 2 NESARC. Both test and retest interviews were conducted face-to-face. Test-retest and internal consistency results for diagnoses and symptom scales associated with posttraumatic stress disorder, attention-deficit/hyperactivity disorder, and borderline, narcissistic, and schizotypal personality disorders were predominantly good (kappa > 0.63; ICC > 0.69; alpha > 0.75) and reliability for risk factor measures fell within the good to excellent range (intraclass correlations = 0.50–0.94; alpha = 0.64–0.90). The high degree of reliability found in this study suggests that new AUDADIS-IV diagnostic measures can be useful tools in research settings. The availability of highly reliable measures of risk factors of alcohol, drug, and psychiatric disorders will contribute to the validity of conclusions drawn from future research in the domains of substance use disorder and psychiatric epidemiology. PMID:17706375

  13. A rate-based transcutaneous CO2 sensor for noninvasive respiration monitoring.

    PubMed

    Chatterjee, M; Ge, X; Kostov, Y; Luu, P; Tolosa, L; Woo, H; Viscardi, R; Falk, S; Potts, R; Rao, G

    2015-05-01

    The pain and risk of infection associated with invasive blood sampling for blood gas measurements necessitate the search for reliable noninvasive techniques. In this work we developed a novel rate-based noninvasive method for a safe and fast assessment of respiratory status. A small sampler was built to collect the gases diffusing out of the skin. It was connected to a CO2 sensor through gas-impermeable tubing. During a measurement, the CO2 initially present in the sampler was first removed by purging it with nitrogen. The gases in the system were then recirculated between the sampler and the CO2 sensor, and the CO2 diffusion rate into the sampler was measured. Because the measurement is based on the initial transcutaneous diffusion rate, reaching mass transfer equilibrium and heating the skin is no longer required, thus, making it much faster and safer than traditional method. A series of designed experiments were performed to analyze the effect of the measurement parameters such as sampler size, measurement location, subject positions, and movement. After the factor analysis tests, the prototype was sent to a level IV NICU for clinical trial. The results show that the measured initial rate of increase in CO2 partial pressure is linearly correlated with the corresponding arterial blood gas measurements. The new approach can be used as a trending tool, making frequent blood sampling unnecessary for respiratory status monitoring.

  14. Night Eating Syndrome in Major Depression and Anxiety Disorders.

    PubMed

    Küçükgöncü, Suat; Beştepe, Emrem

    2014-12-01

    The purpose of this study is to investigate the prevalence and the clinical features of night eating syndrome (NES) in patients with depression and anxiety disorders. The study was conducted at Bakırköy State Hospital for Mental Health and Neurological Disorders. Three-hundred out-patients who had major depression (MD), panic disorders (PD), general anxiety disorders (GAD) and obsessive-compulsive disorders (OCD) participated in the study. The semi-structured socio-demographic form, the Structured Clinical Interview for DSM-IV Axis I Disorders (SCID-I), Night Eating Questionnaire, and NES Evaluation Questionnaire were implemented. In our sample, the prevalence of the NES was 15.7% (n=47). NES frequency was significantly higher in the patients diagnosed with major depression (MD 22%, GAD 7.8%, OCD 12.5%, PD 14%). Smoking, presence of past suicide attempts, rates of antipsychotic drugs use, and average scores of body mass index (BMI) were significantly higher in the patients who had NES. In this sample, depression, BMI, and smoking were found to be determinants of NES. This study shows that NES may be frequently observed in patients admitted to psychiatric clinics, especially in those with major depression. Evaluation of NES in psychiatric patients may help the treatment of the primary psychopathology and prevent the adverse effects, like weight gain, which may reduce the quality of life.

  15. An in vitro assessment of type, position and incidence of isthmus in human permanent molars

    PubMed Central

    de LIMA, Fernando José Camello; MONTAGNER, Francisco; JACINTO, Rogério Castilho; AMBROSANO, Glaucia Maria Bovi; GOMES, Brenda Paula Figueiredo de Almeida

    2014-01-01

    Root canal anatomical complexities, such as isthmus, may limit the action of the endodontic instruments, irrigant solutions and intracanal medications, leading to endodontic treatment failure. Objectives This in vitro study assessed the type, position and incidence of isthmus in human permanent molars. Material and Methods One hundred and twenty eight upper and lower first and second permanent molars were analyzed. The roots were embedded in transparent resin, and then split at different distances from the apex (1.0-2.5-4.0-5.5-7.0 mm). Following the sample examination in stereomicroscope, the data were submitted to chi-square statistical test at a 5% significance level. Results The highest isthmus incidence was at 7.0 mm from the root apex in all samples, except the distal root of lower molars (at 5.5 mm). In upper and lower molars, type V (complete isthmus with a continuous opening between the two main root canals) was the most common classification of isthmus (28.8%). In the mesial root of first and second mandibular molars, type IV had the highest incidence (36% and 23.9%, respectively). Conclusion It was concluded that isthmus was widely found in flat roots, with a low percentage in areas close to the apex. In upper and lower molars, these structures were most frequently found at 7 mm from the apex. PMID:25141198

  16. Depression following adult, non-penetrating traumatic brain injury: a meta-analysis examining methodological variables and sample characteristics.

    PubMed

    Osborn, A J; Mathias, J L; Fairweather-Schmidt, A K

    2014-11-01

    Depression is one of the most frequently reported psychological problems following TBI, however prevalence estimates vary widely. Methodological and sampling differences may explain some of this variability, but it is not known to what extent. Data from 99 studies examining the prevalence of clinically diagnosed depression (MDD/dysthymia) and self-reports of depression (clinically significant cases or depression scale scores) following adult, non-penetrating TBI were analysed, taking into consideration diagnostic criteria, measure, post-injury interval, and injury severity. Overall, 27% of people were diagnosed with MDD/dysthymia following TBI and 38% reported clinically significant levels of depression when assessed with self-report scales. Estimates of MDD/dysthymia varied according to diagnostic criteria (ICD-10: 14%; DSM-IV: 25%; DSM-III: 47%) and injury severity (mild: 16%; severe: 30%). When self-report measures were used, the prevalence of clinically significant cases of depression differed between scales (HADS: 32%; CES-D: 48%) method of administration (phone: 26%; mail 46%), post-injury interval (range: 33-42%), and injury severity (mild: 64%; severe: 39%). Depression is very common after TBI and has the potential to impact on recovery and quality of life. However, the diagnostic criteria, measure, time post-injury and injury severity, all impact on prevalence rates and must therefore be considered for benchmarking purposes. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  17. Identification of novel mammalian hosts and Brazilian biome geographic distribution of Trypanosoma cruzi TcIII and TcIV.

    PubMed

    Barros, Juliana Helena S; Xavier, Samanta Cristina C; Bilac, Daniele; Lima, Valdirene Santos; Dario, Maria Augusta; Jansen, Ana Maria

    2017-08-01

    Trypanosoma cruzi is a parasitic protozoan responsible for Chagas disease. Seven different Discrete Typing Units (DTUs) of T. cruzi are currently identified in nature: TcI-TcVI, and TcBat whose distribution patterns in nature, hosts/reservoirs and eco-epidemiological importance are still little known. Here, we present novel data on the geographic distribution and diversity of mammalian hosts and vectors of T. cruzi DTUs TcIII and TcIV. In this study, we analyzed 61 T. cruzi isolates obtained from 18 species of mammals (five orders) and two Hemiptera genera. Samples were collected from five Brazilian biomes (Pantanal, Caatinga, Cerrado, Atlantic Rainforest, and Amazon) previously characterized as Z3 or mixed infection (TcI-Z3) by mini-exon gene PCR. To identify TcIII and TcIV genotypes, we applied restriction fragment length polymorphism analysis to the PCR-amplified histone 3 gene. DTUs TcIII and TcIV were identified in single and mixed infections from wide dispersion throughout five Brazilian biomes studied, with TcIV being the most common. Pantanal was the biome that displayed the largest number of samples characterized as TcIII and TcIV in single and mixed infections, followed by Atlantic Rainforest and Amazon. Species from the Didelphimorphia order displayed the highest frequency of infection and were found in all five biomes. We report, for the first time, the infection of a species of the Artiodactyla order by DTU TcIII. In addition, we describe new host species: five mammals (marsupials and rodents) and two genera of Hemiptera. Our data indicate that DTUs TcIII and TcIV are more widespread and infect a larger number of mammalian species than previously thought. In addition, they are transmitted in restricted foci and cycles, but in different microhabitats and areas with distinct ecological profiles. Finally, we show that DTUs TcIII and TcIV do not present any specific association with biomes or host species. Copyright © 2017. Published by Elsevier B.V.

  18. Optimization of Advanced ACTPol Transition Edge Sensor Bolometer Operation Using R(T,I) Transition Measurements

    NASA Astrophysics Data System (ADS)

    Salatino, Maria

    2017-06-01

    In the current submm and mm cosmology experiments the focal planes are populated by kilopixel transition edge sensors (TESes). Varying incoming power load requires frequent rebiasing of the TESes through standard current-voltage (IV) acquisition. The time required to perform IVs on such large arrays and the resulting transient heating of the bath reduces the sky observation time. We explore a bias step method that significantly reduces the time required for the rebiasing process. This exploits the detectors' responses to the injection of a small square wave signal on top of the dc bias current and knowledge of the shape of the detector transition R(T,I). This method has been tested on two detector arrays of the Atacama Cosmology Telescope (ACT). In this paper, we focus on the first step of the method, the estimate of the TES %Rn.

  19. MRI and CT contrast media extravasation

    PubMed Central

    Heshmatzadeh Behzadi, Ashkan; Farooq, Zerwa; Newhouse, Jeffery H.; Prince, Martin R.

    2018-01-01

    Abstract Background: This systematic review combines data from multiple papers on contrast media extravasation to identify factors contributing to increased extravasation risk. Methods: Data were extracted from 17 papers reporting 2191 extravasations in 1,104,872 patients (0.2%) undergoing computed tomography (CT) or magnetic resonance imaging (MRI). Results: Extravasation rates were 0.045% for gadolinium-based contrast agents (GBCA) and nearly 6-fold higher, 0.26% for iodinated contrast agents. Factors associated with increased contrast media extravasations included: older age, female gender, using an existing intravenous (IV) instead of placing a new IV in radiology, in-patient status, use of automated power injection, high injection rates, catheter location, and failing to warm up the more viscous contrast media to body temperature. Conclusion: Contrast media extravasation is infrequent but nearly 6 times less frequent with GBCA for MRI compared with iodinated contrast used in CT. PMID:29489663

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stengl, Vaclav, E-mail: stengl@iic.cas.cz; Bludska, Jana; Oplustil, Frantisek

    Highlights: {yields} New nano-dispersive materials for warfare agents decontamination. {yields} 95% decontamination activities for sulphur mustard. {yields} New materials base on titanium and manganese oxides. -- Abstract: Titanium(IV)-manganese(IV) nano-dispersed oxides were prepared by a homogeneous hydrolysis of potassium permanganate and titanium(IV) oxo-sulphate with 2-chloroacetamide. Synthesised samples were characterised using Brunauer-Emmett-Teller (BET) surface area and Barrett-Joiner-Halenda porosity (BJH), X-ray diffraction (XRD), infrared spectroscopy (IR), and scanning electron microscopy (SEM). These oxides were taken for an experimental evaluation of their reactivity with sulphur mustard (HD or bis(2-chloroethyl)sulphide) and soman (GD or (3,3'-dimethylbutan-2-yl)-methylphosphonofluoridate). Mn{sup 4+} content affects the decontamination activity; with increasing Mn{supmore » 4+} content the activity increases for sulphur mustard and decreases for soman. The best decontamination activities for sulphur mustard and soman were observed for samples TiMn{sub 3}7 with 18.6 wt.% Mn and TiMn{sub 5} with 2.1 wt.% Mn, respectively.« less

  1. New analytical methodology for analysing S(IV) species at low pH solutions by one stage titration method (bichromatometry) with a clear colour change. Could potentially replace the state-of-art-method iodometry at low pH analysis due higher accuracy

    PubMed Central

    Galfi, Istvan; Virtanen, Jorma; Gasik, Michael M.

    2017-01-01

    A new, faster and more reliable analytical methodology for S(IV) species analysis at low pH solutions by bichromatometry is proposed. For decades the state of the art methodology has been iodometry that is still well justified method for neutral solutions, thus at low pH media possess various side reactions increasing inaccuracy. In contrast, the new methodology has no side reactions at low pH media, requires only one titration step and provides a clear color change if S(IV) species are present in the solution. The method is validated using model solutions with known concentrations and applied to analyses of gaseous SO2 from purged solution in low pH media samples. The results indicate that bichromatometry can accurately analyze SO2 from liquid samples having pH even below 0 relevant to metallurgical industrial processes. PMID:29145479

  2. [Autoimmune neuropsychiatric disorders associated to infection by streptococcus in the paediatric age: PANDAS].

    PubMed

    Betancourt, Y M; Jiménez-León, J C; Jiménez-Betancourt, C S; Castillo, V E

    2003-02-01

    The acronym PANDAS (Paediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus) describes the neuropsychiatric disorders resulting from an autoimmune response to an infection by streptococcus in children. The aim of this study was to clinically analyse 38 patients under the age of 16 with tics, Tourette syndrome (TS) or obsessive compulsive disorder (OCD) and their possible association to an infection caused by group A beta-haemolytic streptococcus (GABHS). We reviewed the medical records at the Instituto Neurológico in Valencia (Venezuela) over a 12 year period (1988-2000). All the patients met the inclusion criteria set out by the National Institute of Mental Health in Bethesda (1997) and the DSM-IV. Onset of the symptoms was higher in the group of schoolchildren (n=24), followed by the group of preschool children (n=8) and adolescents (n=6). Males were predominant (n=33) (86.8%). 17 patients presented chronic tics (44.7%), 13 had transitory tics (34.2%) and there were eight cases of TS (21.1%). The most frequently related comorbid disorders were: difficulties in learning (n=30) (78.9%), ADHD (n=27) (71.1%), OCD 14 (36.8%), sleep disorders (n=14) (36.8%), behavioural disorders (n=12) (31.6%), language disorders (n=11) (28.9%), psychomotor disorders (n=10) (26.3%) and nocturnal enuresis (n=7) (18.4%). Electroencephalogram patterns were abnormal in 72.4% (n=12), and the disorganised pattern was the most frequently observed (n=12) (41.4%), followed by a slow diffuse pattern (n= 7) (24.1%) and the left centro-parieto-temporal focal paroxysmal specific pattern (n=7) (24.1%). Less frequently we found unspecific generalised paroxysmal patterns, in four cases (13.8%), and asymmetrical patterns (n=1) (3.4%). The association with an infection by streptococcus was shown in two cases, which amounted to 5.2% of the sample. The obtained are similar to those reported in the literature. Only 5.2% of the cases were linked to a prior streptococcus infection.

  3. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV)

    PubMed Central

    Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao

    2016-01-01

    Zr(IV) can form phosphate and Zr(IV) (–PO32−–Zr4+–) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A520nm/A650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP. PMID:27754349

  4. Evaluation of hydrogenated resin acids as molecular markers for tire-wear debris in urban environments.

    PubMed

    Kumata, Hidetoshi; Mori, Mika; Takahashi, Sho; Takamiya, Shohei; Tsuzuki, Mikio; Uchida, Tatsuya; Fujiwara, Kitao

    2011-12-01

    To propose new molecular markers for tire-wear emissions, four dihydroresin acids, that is, 8-isopimaren-18-oic acid (I), 8-pimaren-18-oic acid (II), 13β(H)-abieten-18-oic acid (III), and 13α(H)-abiet-8-en-18-oic acid (IV), were identified and investigated for source specificities, distributions, and environmental stabilities. The absence of I-IV in natural sources and the linear correlations between dihydroresin acids with different skeletons in tires and in environmental samples demonstrated that I-IV are specific markers for synthetic rubbers. The ratio of III + IV to the sum of III + IV plus abietic acid showed the resin acids distribution between different environmental compartments receiving contributions from traffic and natural sources. The physicochemical properties and results of photolysis experiments suggested that I-IV can set lower limits for tire-wear contributions to environmental loads of particulate matter (PM) and polycyclic aromatic hydrocarbons with molecular weight ≥202. By comparing III + IV concentrations or (III+IV)/pyrene or (III+IV)/benzo[a]pyrene ratios in tires and those in environmental matrices, the contributions of tire-wear emissions to PM, pyrene, and benzo[a]pyrene were estimated to be 0.68 ± 0.54%, 6.9 ± 4.8%, and 0.37 ± 0.18% in roadside PM and 0.83 ± 0.21%, 0.88 ± 0.52%, and 0.08 ± 0.06% in rooftop PM.

  5. Overview of phase IV clinical trials for postmarket drug safety surveillance: a status report from the ClinicalTrials.gov registry.

    PubMed

    Zhang, Xinji; Zhang, Yuan; Ye, Xiaofei; Guo, Xiaojing; Zhang, Tianyi; He, Jia

    2016-11-23

    Phase IV trials are often used to investigate drug safety after approval. However, little is known about the characteristics of contemporary phase IV clinical trials and whether these studies are of sufficient quality to advance medical knowledge in pharmacovigilance. We aimed to determine the fundamental characteristics of phase IV clinical trials that evaluated drug safety using the ClinicalTrials.gov registry data. A data set of 19 359 phase IV clinical studies registered in ClinicalTrials.gov was downloaded. The characteristics of the phase IV trials focusing on safety only were compared with those evaluating both safety and efficacy. We also compared the characteristics of the phase IV trials in three major therapeutic areas (cardiovascular diseases, mental health and oncology). Multivariable logistic regression was used to evaluate factors associated with the use of blinding and randomisation. A total of 4772 phase IV trials were identified, including 330 focusing on drug safety alone and 4392 evaluating both safety and efficacy. Most of the phase IV trials evaluating drug safety (75.9%) had enrolment <300 with 96.5% <3000. Among these trials, 8.2% were terminated or withdrawn. Factors associated with the use of blinding and randomisation included the intervention model, clinical specialty and lead sponsor. Phase IV trials evaluating drug safety in the ClinicalTrials.gov registry were dominated by small trials that might not have sufficient power to detect less common adverse events. An adequate sample size should be emphasised for phase IV trials with safety surveillance as main task. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  6. Investigation of the factor structure of the Wechsler Adult Intelligence Scale--Fourth Edition (WAIS-IV): exploratory and higher order factor analyses.

    PubMed

    Canivez, Gary L; Watkins, Marley W

    2010-12-01

    The present study examined the factor structure of the Wechsler Adult Intelligence Scale--Fourth Edition (WAIS-IV; D. Wechsler, 2008a) standardization sample using exploratory factor analysis, multiple factor extraction criteria, and higher order exploratory factor analysis (J. Schmid & J. M. Leiman, 1957) not included in the WAIS-IV Technical and Interpretation Manual (D. Wechsler, 2008b). Results indicated that the WAIS-IV subtests were properly associated with the theoretically proposed first-order factors, but all but one factor-extraction criterion recommended extraction of one or two factors. Hierarchical exploratory analyses with the Schmid and Leiman procedure found that the second-order g factor accounted for large portions of total and common variance, whereas the four first-order factors accounted for small portions of total and common variance. It was concluded that the WAIS-IV provides strong measurement of general intelligence, and clinical interpretation should be primarily at that level.

  7. Engagement of groups in family medicine board maintenance of certification.

    PubMed

    Fisher, Dena M; Brenner, Christopher J; Cheren, Mark; Stange, Kurt C

    2013-01-01

    The American Board of Medical Specialties' Performance in Practice ("Part IV") portion of Maintenance of Certification (MOC) requirement provides an opportunity for practicing physicians to demonstrate quality improvement (QI) competence. However, specialty boards' certification of one physician at a time does not tap into the potential of collective effort. This article shares learning from a project to help family physicians work in groups to meet their Part IV MOC requirement. A year-long implementation and evaluation project was conducted. Initially, 348 members of a regional family physician organization were invited to participate. A second path was established through 3 health care systems and a county-wide learning collaborative. Participants were offered (1) a basic introduction to QI methods, (2) the option of an alternative Part IV MOC module using a patient experience survey to guide QI efforts, (3) practice-level improvement coaching, (4) support for collaboration and co-learning, and (5) provision of QI resources. More physicians participated through group (66) than individual (12) recruitment, for a total of 78 physicians in 20 practices. Participation occurred at 3 levels: individual, intrapractice, and interpractice. Within the 1-year time frame, intrapractice collaboration occurred most frequently. Interpractice and system-level collaboration has begun and continues to evolve. Physicians felt that they benefited from access to a practice coach and group process. Practice-level collaboration, access to a practice coach, flexibility in choosing and focusing improvement projects, tailored support, and involvement with professional affiliations can enhance the Part IV MOC process. Specialty boards are likely to discover productive opportunities from working with practices, professional organizations, and health care systems to support intra- and interpractice collaborative QI work that uses Part IV MOC requirements to motivate practice improvement.

  8. Comparison of different administration of ketamine and intravenous tramadol hydrochloride for postoperative pain relief and sedation after pediatric tonsillectomy.

    PubMed

    Yenigun, Alper; Et, Tayfun; Aytac, Sirin; Olcay, Betul

    2015-01-01

    Tonsillectomy is the oldest and most frequently performed surgical procedure practiced by ear, nose, and throat physicians. In this study, our aim was to compare the analgesic effects of peritonsillar, rectal, as well as intravenous infiltration of ketamine and intravenous tramadol hydrochloride infiltration for postoperative pain relief and sedation after tonsillectomy in children. This randomized controlled study evaluated the effects of peritonsillar, intravenous, and rectal infiltration of ketamine in children undergoing adenotonsillectomy. One hundred twenty children who were categorized under American Society of Anesthesiologists classes I to II were randomized to 4 groups of 30 members each. Group 1 received intravenous (IV) ketamine (0.5 mg/kg), group 2 received rectal ketamine (0.5 mg/kg), group 3 received local peritonsillar ketamine (2 mg/kg), and the control group received IV tramadol hydrochloride infiltration (2 mg/kg). Children's Hospital of Eastern Ontario Pain Scale scores and Wilson sedation scale were recorded at minutes 1, 15, 30, 60 as well as hours 2, 12, and 24 postoperatively. The patients were interviewed on the day after the surgery to assess the postoperative pain and sedation. All the routes of infiltration of ketamine were as effective as those of tramadol hydrochloride (P > 0.05). A statistically significant difference was observed between IV infiltrations and all groups during the assessments at hours 6 and 24. The analgesic efficacy of IV ketamine was found especially higher at hours 6 and 24 (P(6) = 0.045, P(24) = 0.011). Perioperative, low-dose IV, rectal, or peritonsillar ketamine infiltration provides efficient pain relief without any adverse effects in children who would undergo adenotonsillectomy.

  9. Pros and cons of intraperitoneal chemotherapy in the treatment of epithelial ovarian cancer.

    PubMed

    Zeimet, Alain G; Reimer, Daniel; Radl, Alice C; Reinthaller, Alexander; Schauer, Christian; Petru, Edgar; Concin, Nicole; Braun, Stephan; Marth, Christian

    2009-07-01

    Development of the pros and cons of intraperitoneal (IP) chemotherapy in the treatment of epithelial ovarian cancer based on the most prominent data published on the evolution of IP chemotherapy and on experience with this therapeutic strategy in clinical routine. The literature published on IP chemotherapy in ovarian cancer between 1970 and 2008 was identified systematically by computer-based searches in MEDLINE and the Cochrane Library. Furthermore, a preliminary analysis of data recorded during an observational nationwide multicenter study of the Austrian AGO on IP-IV chemotherapy using the GOG-172 treatment regimen was performed. The literature review unequivocally revealed a significantly greater toxicity for IP than for intravenous (IV) cisplatin-based chemotherapy. However, according to a Cochrane meta-analysis, IP-IV administration of chemotherapy is associated with a 21.6% decrease in the risk for death. In agreement with earlier reports, the most frequently mentioned side-effects in the Austria-wide observational study were long-lasting neurotoxicity, abdominal pain, fatigue, gastrointestinal and metabolic toxicities, and catheter-related complications. Most of these toxicities were identified as mirroring the toxicity profile of high-dose IV cisplatin (>or=100 mg/m(2)). In some patients, the classic IP-IV regimen with cisplatin/paclitaxel was changed to an alternative schedule comprising carboplatin AUC 5 (d1) and weekly paclitaxel 60 mg/m(2) (d1, 8, 15) completely administered via the IP route. This treatment was better tolerated and quality of life was significantly less compromised. However, neutropenia and thrombocytopenia were the limiting side-effects of this IP regimen. In cases where optimal cytoreduction with residual disease

  10. Low doses of haloperidol combined with ondansetron are not effective for prophylaxis of postoperative nausea and vomiting in susceptible patients.

    PubMed

    Veiga-Gil, Leonor; López-Olaondo, Luis; Pueyo, Javier; Callejas, Raquel; Duque, Paula; Carrascosa, Francisco

    2015-02-01

    In this observational study we reviewed the efficacy and side effects of different antiemetic combinations used in our hospital for postoperative nausea and vomiting (PONV) prophylaxis in high-risk women undergoing highly emetogenic surgery. After reviewing retrospectively the medical records of patients undergoing highly emetogenic elective surgeries under general anaesthesia, we selected 368 women whose Apfel risk score was ≥ 3 and receiving a combination of 2 antiemetics for PONV prophylaxis. We analysed the incidence of PONV at 2, 6, 12 and 24h after surgery, antiemetic rescue requirements, pattern of occurrence of PONV, side effects and level of sedation were also assessed. The main goal was complete response defined as no PONV within 24h after surgery. Ondansetron 4mg i.v. plus dexamethasone 8mg i.v. (O&Dex), haloperidol 1mg i.v. (O&Hal1), haloperidol 2mg i.v. (O&Hal2) or droperidol 1.25mg i.v. (O&Dro) were the combinations most frequently used. The complete response was better in groups O&Dex: 68.5% (CI: 58-78), O&Hal2: 64.1% (CI: 53-74) and O&Dro 63% (CI: 52-73) than in group O&Hal1: 41.3% (CI: 31-52) (p<0,01). Peak incidence of PONV occurred within the 2-6h period. The incidence of side effects was higher in group O&Hal2. In high risk patients for PONV who underwent highly emetogenic surgeries, the efficacy of low-dose haloperidol (1mg) in combination is limited. Higher doses (2mg) are more effective but its use is associated with a high incidence of side effects. Copyright © 2013 AEC. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Remote supervision of IV-tPA for acute ischemic stroke by telemedicine or telephone before transfer to a regional stroke center is feasible and safe.

    PubMed

    Pervez, Muhammad A; Silva, Gisele; Masrur, Shihab; Betensky, Rebecca A; Furie, Karen L; Hidalgo, Renzo; Lima, Fabricio; Rosenthal, Eric S; Rost, Natalia; Viswanathan, Anand; Schwamm, Lee H

    2010-01-01

    Because of a shortage of stroke specialists, many outlying or "spoke" hospitals initiate intravenous (IV) thrombolysis using telemedicine or telephone consultation before transferring patients to a regional stroke center (RSC) hub. We analyzed complications and outcomes of patients treated with IV tissue plasminogen activator (tPA) using the "drip and ship" approach compared to those treated directly at the RSC. A retrospective review of our Get With the Guidelines Stroke (GWTG-Stroke) database from 01/2003 to 03/2008 identified 296 patients who received IV tPA within 3 hours of symptom onset without catheter-based reperfusion. GWTG-Stroke definitions for symptomatic intracranial (sICH), systemic hemorrhage, discharge functional status, and destination were applied. Follow-up modified Rankin Score was recorded when available. Of 296 patients, 181 (61.1%) had tPA infusion started at an outside spoke hospital (OSH) and 115 (38.9%) at the RSC hub. OSH patients were younger with fewer severe strokes than RSC patients. Patients treated based on telestroke were more frequently octogenarians than patients treated based on a telephone consult. Mortality, sICH, and functional outcomes were not different between OSH versus RSC and telephone versus telestroke patients. Among survivors, mean length of stay was shorter for OSH patients but discharge status was similar and 75% of patients walked independently at discharge. Outcomes in OSH "drip and ship" patients treated in a hub-and-spoke network were comparable to those treated directly at an RSC. These data suggest that "drip and ship" is a safe and effective method to shorten time to treatment with IV tPA.

  12. Technical communication: new teaching model for practicing ultrasound-guided regional anesthesia techniques: no perishable food products!

    PubMed

    Liu, Yang; Glass, Nancy L; Power, Robert W

    2010-04-01

    There is a pronounced learning curve for the technique of ultrasound-guided regional anesthesia. Practicing with a simulator model has been shown to speed the acquisition of these skills for various ultrasound-guided procedures. However, commercial models for ultrasound-guided regional anesthesia may be too costly or not readily available. Models using turkey breasts or tofu blocks have the disadvantage of containing perishable food products that can be a source for infection. We describe an alternative inexpensive model that is made from nonperishable components readily available in the operating room. The materials required include 1 clean used 500-mL bag of IV fluids, a bottle of Premisorb (TYCO Healthcare Group, Mansfield, MA), and a piece of foam material approximately 0.3 cm in diameter and 5 cm in length trimmed from operating room foam pads. After filling the IV bag with tap water and inserting the foam into the IV bag from the outlet port of the IV bag, one-third of a bottle of Premisorb (approximately 15 g) is poured into the IV bag. The outlet port of the bag is then sealed by taping the rubber stopper that originally came with the bag. Premisorb, a solidifying agent frequently used to absorb irrigating fluids or blood in operating room suction canisters, produces a gel-like material in the IV bag. The foam inserted into the bag creates a relatively hyperechoic target. This gel-like substance in the bag will seal the holes created after multiple practice needle insertions, resulting in minimal leakage. The semitransparent nature of the gel allows the trainee to visualize the target directly and on the ultrasound screen. The model we describe is inexpensive and easy to make from materials readily available in the operating room with the advantages of being nonperishable, easy to carry, and reusable.

  13. 50 CFR 679.6 - Exempted fisheries.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... (iv) Experimental design (e.g., sampling procedures, the data and samples to be collected, and... Exempted fisheries. (a) General. For limited experimental purposes, the Regional Administrator may... basis of incomplete information or design flaws, the applicant will be provided an opportunity to...

  14. 50 CFR 679.6 - Exempted fisheries.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    .... (iv) Experimental design (e.g., sampling procedures, the data and samples to be collected, and... Exempted fisheries. (a) General. For limited experimental purposes, the Regional Administrator may... basis of incomplete information or design flaws, the applicant will be provided an opportunity to...

  15. 50 CFR 679.6 - Exempted fisheries.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    .... (iv) Experimental design (e.g., sampling procedures, the data and samples to be collected, and... Exempted fisheries. (a) General. For limited experimental purposes, the Regional Administrator may... basis of incomplete information or design flaws, the applicant will be provided an opportunity to...

  16. 50 CFR 679.6 - Exempted fisheries.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    .... (iv) Experimental design (e.g., sampling procedures, the data and samples to be collected, and... Exempted fisheries. (a) General. For limited experimental purposes, the Regional Administrator may... basis of incomplete information or design flaws, the applicant will be provided an opportunity to...

  17. 50 CFR 679.6 - Exempted fisheries.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .... (iv) Experimental design (e.g., sampling procedures, the data and samples to be collected, and... Exempted fisheries. (a) General. For limited experimental purposes, the Regional Administrator may... basis of incomplete information or design flaws, the applicant will be provided an opportunity to...

  18. MX Siting Investigation. Geotechnical Evaluation. Volume IV. Nevada - Utah Verification Studies, FY 79. Geotechnical Data Hamlin CDP, Nevada.

    DTIC Science & Technology

    1979-08-24

    5.0 GRAVITY DATA 6.0 BORING LOGS 7.0 TRENCH AND TEST PIT LOGS 8.0 SURFICIAL SAMPLE LOGS 9.0 LABORATORY TEST RESULTS DRAWINGS IN POCKET 1 ACTIVITY...IV ELECTRODE SPACING - AS/2 ( METERIS ) 5 10 20 40 so 80 100 400 - , - - - 200 ____ _ _ _ _ - 100 II 80 ~as 40 46 2I0 leil 110 20 40 30 60 100 200 400...DEPARTMENT OF THE AIR FORCE - SAISO 441.9 2LDm NATIONAL, INC-L2 JUL 79 AFV-18 SECTION 5.0 GRAVITY DATA- FN-TR-27-IV -EXPLANATIONS OF GRAVITY DATA

  19. Criterion validity and clinical usefulness of Attention Deficit Hyperactivity Disorder Rating Scale IV in attention deficit hyperactivity disorder (ADHD) as a function of method and age.

    PubMed

    López-Villalobos, José A; Andrés-De Llano, Jesús; López-Sánchez, María V; Rodríguez-Molinero, Luis; Garrido-Redondo, Mercedes; Sacristán-Martín, Ana M; Martínez-Rivera, María T; Alberola-López, Susana

    2017-02-01

    The aim of this research is to analyze Attention Deficit Hyperactivity Disorder Rating Scales IV (ADHD RS-IV) criteria validity and its clinical usefulness for the assessment of Attention Deficit Hyperactivity Disorder (ADHD) as a function of assessment method and age. A sample was obtained from an epidemiological study (n = 1095, 6-16 years). Clinical cases of ADHD  (ADHD-CL) were selected by dimensional ADHD RS-IV and later by clinical interview (DSM-IV). ADHD-CL cases were compared with four categorical results of ADHD RS-IV provided by parents (CATPA), teachers (CATPR), either parents or teachers (CATPAOPR) and both parents and teachers (CATPA&PR). Criterion validity and clinical usefulness of the answer modalities to ADHD RS-IV were studied. ADHD-CL rate was 6.9% in childhood, 6.2% in preadolescence and 6.9% in adolescence. Alternative methods to the clinical interview led to increased numbers of ADHD cases in all age groups analyzed, in the following sequence: CATPAOPR> CATPRO> CATPA> CATPA&PR> ADHD-CL. CATPA&PR was the procedure with the greatest validity, specificity and clinical usefulness in all three age groups, particularly in the childhood. Isolated use of ADHD RS-IV leads to an increase in ADHD cases compared to clinical interview, and varies depending on the procedure used.

  20. Origin and evolution of dengue virus type 3 in Brazil.

    PubMed

    de Araújo, Josélio Maria Galvão; Bello, Gonzalo; Romero, Hector; Nogueira, Rita Maria Ribeiro

    2012-01-01

    The incidence of dengue fever and dengue hemorrhagic fever in Brazil experienced a significant increase since the emergence of dengue virus type-3 (DENV-3) at the early 2000s. Despite the major public health concerns, there have been very few studies of the molecular epidemiology and time-scale of this DENV lineage in Brazil. In this study, we investigated the origin and dispersion dynamics of DENV-3 genotype III in Brazil by examining a large number (n=107) of E gene sequences sampled between 2001 and 2009 from diverse Brazilian regions. These Brazilian sequences were combined with 457 DENV-3 genotype III E gene sequences from 29 countries around the world. Our phylogenetic analysis reveals that there have been at least four introductions of the DENV-3 genotype III in Brazil, as signified by the presence of four phylogenetically distinct lineages. Three lineages (BR-I, BR-II, and BR-III) were probably imported from the Lesser Antilles (Caribbean), while the fourth one (BR-IV) was probably introduced from Colombia or Venezuela. While lineages BR-I and BR-II succeeded in getting established and disseminated in Brazil and other countries from the Southern Cone, lineages BR-III and BR-IV were only detected in one single individual each from the North region. The phylogeographic analysis indicates that DENV-3 lineages BR-I and BR-II were most likely introduced into Brazil through the Southeast and North regions around 1999 (95% HPD: 1998-2000) and 2001 (95% HPD: 2000-2002), respectively. These findings show that importation of DENV-3 lineages from the Caribbean islands into Brazil seems to be relatively frequent. Our study further suggests that the North and Southeast Brazilian regions were the most important hubs of introduction and spread of DENV-3 lineages and deserve an intense epidemiological surveillance.

Top