Science.gov

Sample records for fruit flies diptera

  1. Puncture resistance in 'Sharwil' avocado to oriental fruit fly and Mediterranean fruit fly (Diptera: Tephritidae) oviposition.

    PubMed

    Follett, Peter A

    2009-06-01

    The physiological basis for host antibiosis or nonpreference to a quarantine pest is often not understood. Studies are needed on the mechanisms that impart resistance to better understand how resistance might fail. Experiments were conducted to examine the infestability of 'Sharwil' avocados by oriental fruit fly, Bactrocera dorsalis (Hendel), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), after harvest and to quantify the effect of avocado skin hardness on resistance to infestation by oriental fruit fly. Infestation rate increased with decreasing fruit firmness, but fruit were generally poor hosts. Fruit with a patch of skin removed produced more flies than intact fruit, suggesting that skin puncture resistance was an important deterrent to oviposition. This study showed that fruit can be infested within 1 d after harvest, suggesting that fruit should be transferred to fruit fly-proof containers as they are harvested to minimize the risk of attack. Although risk of infestation is negatively correlated with fruit firmness, even some hard fruit may become infested. Therefore, fruit firmness cannot be used alone as an indicator to ensure fruit fly-free 'Sharwil' avocados. Measuring fruit firmness may be a useful component of a multiple component systems approach as an additional safeguard to reduce risk of infestation.

  2. Wolbachia in Anastrepha fruit flies (Diptera: Tephritidae).

    PubMed

    Coscrato, Virginia E; Braz, Antônio S K; P Perondini, André L; Selivon, Denise; Marino, Celso L

    2009-09-01

    Endosymbiotic bacteria of the genus Wolbachia are widespread among arthropods and cause a variety of reproductive abnormalities, such as cytoplasmic incompatibility, thelytokous parthenogenesis, male-killing, and host feminization. In this study, we used three sets of Wolbachia-specific primers (16S rDNA, ftsZ, and wsp) in conjunction with the polymerase chain reaction (PCR), cloning and sequencing to study the infection of fruit flies (Anastrepha spp. and Ceratitis capitata) by Wolbachia. The flies were collected at several localities in Brazil and at Guayaquil, Ecuador. All of the fruit flies studied were infected with Wolbachia supergroup A, in agreement with the high prevalence of this group in South America. Phylogenetic analysis showed that the wsp gene was the most sensitive gene for studying the relationships among Wolbachia strains. The Wolbachia sequences detected in these fruit flies were similar to those such as wMel reported for other fruit flies. These results show that the infection of Anastrepha fruit flies by Wolbachia is much more widespread than previously thought.

  3. Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida

    USDA-ARS?s Scientific Manuscript database

    Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

  4. Seasonal distributions of the western cherry fruit fly (Diptera: Tephritidae) among host and nonhost fruit trees.

    PubMed

    Yee, Wee L

    2014-01-01

    Seasonal distributions of the western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), in sweet cherry (Prunus avium (L.) L.) (major host), black hawthorn (occasional developmental host) (Crataegus douglasii Lindley), and other trees were determined in a ponderosa pine ecosystem in Washington state, USA. The hypothesis that most fly dispersal from cherry trees occurs after fruit senesce or drop was tested, with emphasis on movement to black hawthorn trees. Sweet cherry fruit developed earlier than black hawthorn, bitter cherry (common host), choke cherry, and apple fruit. Flies were usually captured first in sweet cherry trees but were caught in bitter cherry and other trees throughout the season. Peak fly capture periods in sweet cherry began around the same time or slightly earlier than in other trees. However, peak fly capture periods in black hawthorn and other nonsweet cherry trees continued after peak periods in sweet cherry ended, or relative fly numbers within sweet cherry declined more quickly than those within other trees. Larvae were reared from sweet and bitter cherry but not black hawthorn fruit. Results provide partial support for the hypothesis in that although R. indifferens commonly disperses from sweet cherry trees with fruit, it could disperse more, or more flies are retained in nonsweet cherry trees after than before sweet cherries drop. This could allow opportunities for the flies to use other fruit for larval development. Although R. indifferens infestation in black hawthorn was not detected, early season fly dispersal to this and other trees and fly presence in bitter cherry could make fly management in sweet cherry difficult.

  5. Attraction of nontarget species to fruit fly (Diptera: tephritidae) male lures and decaying fruit flies in traps in hawaii.

    PubMed

    Leblanc, Luc; Rubinoff, Daniel; Vargas, Roger I

    2009-10-01

    Synthetic male lures are commonly used to monitor and mass trap pestiferous fruit flies (Diptera: Tephritidae: Dacinae). However, there has been much dispute as to the nontarget impacts of such lures on beneficial and native insects. To evaluate nontarget attraction effects, traps baited with Cue-Lure and methyl eugenol were maintained and emptied weekly in a range of native and non-native forest and commercial orchard and backyard sites on Hawaii and Maui Islands. Lure trap captures were compared against those from unbaited control traps and traps artificially baited with decaying fruit flies to mimic the effect of accumulation of dead trapped target flies in male lure traps. Cue-Lure did not attract nontargets, and methyl eugenol attracted low but significant numbers of five species of flower-associated insects (honey bees, syrphid flies, nitidulid beetles, and endemic crambid moths) and two endemic Hawaiian species of sciarids (Diptera) and mirids (Hemiptera). Saprophagous nontargets, mostly Diptera, were abundant and diverse in traps baited with decaying flies and in male lure traps where accumulation of dead flies occurred but not in male lure traps with few or no fruit fly captures. Most of the previously published records of attraction to methyl eugenol are shown to actually be secondary attraction to decaying fruit flies. Endemic nontargets were collected in native and adjacent forest, but almost exclusively invasive species were attracted to traps placed in non-native habitats. Attraction of flower-associated species may be minimized if methyl eugenol traps are placed in trees after flowering season in orchards.

  6. Susceptibility of low-chill blueberry cultivars to Mediterranean fruit fly, oriental fruit fly, and melon fly (Diptera: Tephritidae).

    PubMed

    Follett, Peter A; Zee, Francis T; Hamasaki, Randall T; Hummer, Kim; Nakamoto, Stuart T

    2011-04-01

    No-choice tests were conducted to determine whether fruit of southern highbush blueberry, Vaccinium corymbosum L., hybrids are hosts for three invasive tephritid fruit flies in Hawaii. Fruit of various blueberry cultivars was exposed to gravid female flies of Bactrocera dorsalis Hendel (oriental fruit fly), Ceratitis capitata (Wiedemann) (Mediterranean fruit fly), or Bactrocera cucurbitae Coquillet (melon fly) in screen cages outdoors for 6 h and then held on sand in the laboratory for 2 wk for pupal development and adult emergence. Each of the 15 blueberry cultivars tested were infested by oriental fruit fly and Mediterranean fruit fly, confirming that these fruit flies will oviposit on blueberry fruit and that blueberry is a suitable host for fly development. However, there was significant cultivar variation in susceptibility to fruit fly infestation. For oriental fruit fly, 'Sapphire' fruit produced an average of 1.42 puparia per g, twice as high as that of the next most susceptible cultivar 'Emerald' (0.70 puparia per g). 'Legacy', 'Biloxi', and 'Spring High' were least susceptible to infestation, producing only 0.20-0.25 oriental fruit fly puparia per g of fruit. For Mediterranean fruit fly, 'Blue Crisp' produced 0.50 puparia per g of fruit, whereas 'Sharpblue' produced only 0.03 puparia per g of fruit. Blueberry was a marginal host for melon fly. This information will aid in development of pest management recommendations for blueberry cultivars as planting of low-chill cultivars expands to areas with subtropical and tropical fruit flies. Planting of fruit fly resistant cultivars may result in lower infestation levels and less crop loss.

  7. Survival and development of immature stages of the Mediterranean fruit fly (Diptera: Tephritidae) in citrus fruit.

    PubMed

    Papachristos, Dimitrios P; Papadopoulos, Nikos T; Nanos, George D

    2008-06-01

    We studied, under laboratory conditions, the performance of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), immature stages in intact whole fruit of three sweet orange varieties, lemon, and bitter oranges. Both citrus variety and fruit part (flavedo, albedo, and pulp) had strong effects on larval performance, smaller effects on pupae, and no effects on eggs. Fruit peel was the most critical parameter for larval development and survival, drastically affecting larval survival (inducing very high mortality rates). Among fruit regions, survival of larvae placed in flavedo was zero for all varieties tested except for bitter orange (22.5% survival), whereas survival in albedo was very low (9.8-17.4%) for all varieties except for bitter orange (76%). Survival of pupae obtained from larvae placed in the above-mentioned fruit regions was high for all varieties tested (81.1-90.7%). Fruit pulp of all citrus fruit tested was favorable for larval development. The highest survival was observed on bitter oranges, but the shortest developmental times and heaviest pupae were obtained from orange cultivars. Pulp chemical properties, such as soluble solid contents, acidity, and pH had rather small effects on larval and pupal survival and developmental time (except for juice pH on larvae developmental duration), but they had significant effects on pupal weight.

  8. Susceptibility of low-chill blueberry cultivars to oriental fruit fly, mediterranean fruit fly, and melon fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Forced infestation studies were conducted to determine if fruits of southern highbush blueberries (Vaccinium corymbosum L. hybrids) are hosts for three invasive tephritid fruit flies. Fruits of 17 blueberry cultivars were exposed to gravid female flies of Bactrocera dorsalis (Hendel) (oriental frui...

  9. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    PubMed

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  10. Host plants of Carambola fruit fly, Bactrocera carambolae Drew & Hancock(Diptera:Tephritidae);and provisional list of suitable host plants of Carambola fruit fly,(Bactrocera(Bactrocera) carambolae Drew & Hancock(Diptera:Tep

    USDA-ARS?s Scientific Manuscript database

    Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae), commonly known as the carambola fruit fly, is native to Southeast Asia, but has extended its geographic range to several countries in South America. As with other tephritid fruit fly species, establishment of B.carambolae in areas where it...

  11. Insecticidal activity of Citrus aurantium fruit, leaf, and shoot extracts against adult olive fruit flies (Diptera: Tephritidae).

    PubMed

    Siskos, E P; Konstantopoulou, M A; Mazomenos, B E; Jervis, M

    2007-08-01

    Solvent extracts of differing polarity from Citrus aurantium (L.) (Rutaceae) fruit, leaves, and shoots were evaluated for biological activity against adults of the olive fruit fly, Bactrocera oleae (Gmelin) (Diptera: Tephritidae). Using a petri dish residual exposure bioassay, we found that the petroleum ether extract from fruit alone showed insecticidal activity against the flies. The extract of the three fruit tissues (flavedo [peel], albedo, and flesh) indicated that bioactivity was limited to the flavedo, and this activity was significantly higher than that of the whole fruit extract. The most effective extract was obtained when fresh flavedo was used, whereas extracts of oven-dried flavedo were inactive. Fruit maturity also affected bioactivity; extracts of ripe fruit were more effective than those of unripe fruit. Our results suggest that C. aurantium flavedo contains secondary metabolites with insecticidal activity against B. oleae adults.

  12. Host Plant Record for the Fruit Flies, Anastrepha fumipennis and A. nascimentoi (Diptera, Tephritidae)

    PubMed Central

    Uramoto, Keiko; Martins, David S.; Lima, Rita C. A.; Zucchi, Roberto A.

    2008-01-01

    The first host plant record for Anastrepha fumipennis Lima (Diptera: Tephritidae) in Geissospermum laeve (Vell.) Baill (Apocynaceae) and for A. nascimentoi Zucchi found in Cathedra bahiensis Sleumer (Olacaceae) was determined in a host plant survey of fruit flies undertaken at the “Reserva Natural da Companhia Vale do Rio Doce”. This reserve is located in an Atlantic Rain Forest remnant area, in Linhares county, state of Espírito Santo, Brazil. The phylogenetic relationships of Anastrepha species and their hosts are discussed. The occurrence of these fruit fly species in relation to the distribution range of their host plants is also discussed. PMID:20302458

  13. Host plant record for the fruit flies, Anastrepha fumipennis and A. nascimentoi (Diptera, Tephritidae).

    PubMed

    Uramoto, Keiko; Martins, David S; Lima, Rita C A; Zucchi, Roberto A

    2008-01-01

    The first host plant record for Anastrepha fumipennis Lima (Diptera: Tephritidae) in Geissospermum laeve (Vell.) Baill (Apocynaceae) and for A. nascimentoi Zucchi found in Cathedra bahiensis Sleumer (Olacaceae) was determined in a host plant survey of fruit flies undertaken at the "Reserva Natural da Companhia Vale do Rio Doce". This reserve is located in an Atlantic Rain Forest remnant area, in Linhares county, state of Espírito Santo, Brazil. The phylogenetic relationships of Anastrepha species and their hosts are discussed. The occurrence of these fruit fly species in relation to the distribution range of their host plants is also discussed.

  14. Intraspecific larval competition in the olive fruit fly (Diptera: tephritidae).

    PubMed

    Burrack, Hannah Joy; Fornell, Angela M; Connell, Joseph H; O'Connell, Neil V; Phillips, Phil A; Vossen, Paul M; Zalom, Frank G

    2009-10-01

    Olive fruit flies [Bactrocera oleae (Gmelin)] occur at densities in California that can result in intraspecific larval competition within infested fruit. Larval B. oleae densities tracked in the field at six location were found to be highly variable and related to the proportion of fruit infested and adult densities. Egg and larval distribution within the field was generally aggregated early in the season and trended toward random and uniform as the season progressed. To determine whether B. oleae experienced fitness consequences at a range of larval densities observed in the field, olive fruits were infested with one, two, four, and six eggs, and larval and pupal developmental time, pupal weight, and pupal yield were compared. At the highest egg density, all measures of performance were negatively impacted, resulting in fewer and lighter pupae that took longer to pupate and emerge as adults, and even when only two larvae was present per olive, resulting pupae were significantly smaller. Density did not impact the sex ratio of the resulting flies or survive to adults. As field surveys showed, larval densities ranged from 1 to 11 B. oleae per fruit at some sites, and our results suggest that, at high densities, B. oleae do experience competition for larval resources. The impact of intraspecific larval competition North American in field populations of B. oleae is unknown, but the potential for competition is present.

  15. Revised irradiation doses to control melon fly, Mediterranean fruit fly, and oriental fruit fly (Diptera: Tephritidae) and a generic dose for tephritid fruit flies.

    PubMed

    Follett, Peter A; Armstrong, John W

    2004-08-01

    Currently approved irradiation quarantine treatment doses for Bactrocera cucurbitae (Coquillet), melon fly; Ceratitis capitata (Wiedemann), Mediterranean fruit fly; and Bactrocera dorsalis (Hendel), oriental fruit fly, infesting fruits and vegetables for export from Hawaii to the continental United States are 210, 225, and 250 Gy, respectively. Irradiation studies were initiated to determine whether these doses could be reduced to lower treatment costs, minimize any adverse effects on quality, and support a proposed generic irradiation dose of 150 Gy for fruit flies. Dose-response tests were conducted with late third instars of wild and laboratory strains of the three fruit fly species, both in diet and in fruit. After x-ray irradiation treatment, data were taken on adult emergence, and adult female fecundity and fertility. Melon fly was the most tolerant of the three species to irradiation, and oriental fruit fly was more tolerant than Mediterranean fruit fly. Laboratory and wild strains of each species were equally tolerant of irradiation, and larvae were more tolerant when irradiated in fruit compared with artificial diet. An irradiation dose of 150 Gy applied to 93,666 melon fly late third instars in papayas resulted in no survival to the adult stage, indicating that this dose is sufficient to provide quarantine security. Irradiation doses of 100 and 125 Gy applied to 31,920 Mediterranean fruit fly and 55,743 oriental fruit fly late third instars, respectively, also resulted in no survival to the adult stage. Results support a proposed generic irradiation quarantine treatment dose of 150 Gy for all tephritid fruit flies.

  16. Lethal and sublethal effects of chlorantraniliprole on three species of Rhagoletis fruit flies (Diptera: Tephritidae).

    PubMed

    Teixeira, Luís Af; Gut, Larry J; Wise, John C; Isaacs, Rufus

    2009-02-01

    Chlorantraniliprole formulated as a 350 g kg(-1) WG (Altacor 35WG) for management of apple maggot Rhagoletis pomonella (Walsh), blueberry maggot R. mendax Curran and cherry fruit fly R. cingulata (Loew) (Diptera: Tephritidae) was evaluated in laboratory assays and field trials. A tarsal contact toxicity bioassay showed that a surface residue of 500 mg L(-1) of chlorantraniliprole caused significantly higher mortality of male and female flies of all species compared with a control. Male apple maggot and blueberry maggot mortality was significantly higher than that for females, but there was similar mortality of male and female cherry fruit flies. An ingestion toxicity bioassay showed that 500 mg L(-1) of chlorantraniliprole in diet caused significantly higher mortality of male and female flies of all species than the control, but there were no significant differences among the sexes. Delayed egglaying by females that had ingested chlorantraniliprole was found, but there were no significant sublethal effects on either the number of eggs laid or the egg hatch. Field trials with apple maggot and cherry fruit fly showed that protection of fruit by chlorantraniliprole was comparable with that of standard broad-spectrum insecticides. The present data indicate that chlorantraniliprole has suppressant activity against Rhagoletis fruit flies, preventing fruit infestation primarily through direct lethal effects.

  17. Ionizing radiation as a phytosanitary treatment against fruit flies (Diptera: Tephritidae): efficacy in naturally versus artificially infested fruit.

    PubMed

    Hallman, Guy J; Thomas, Donald B

    2010-08-01

    Some phytosanitary irradiation treatment research against tephritid fruit flies (Diptera: Tephritidae) has used artificially infested fruit with the unstated and untested assumption that the method adequately simulated a natural situation. We compare grapefruit, Citrus paradisi Macfayden, naturally infested by Mexican fruit fly, Anastrepha ludens (Loew), via oviposition until larvae reached the late third instar versus insertion of diet-reared third instars into holes made in grapefruits 24 h before irradiation; the latter technique has been used in other studies. Both infestation techniques resulted in statistically indistinguishable results, indicating that insertion of diet-reared third instar Mexican fruit fly into holes bored into grapefruit and subsequently sealed 24 h before irradiation would adequately represent natural infestation and could be used to develop a radiation phytosanitary treatment of the insect in grapefruit when prevention of adult emergence is used as the measure of efficacy. Nevertheless, it may not be advisable to extend this conclusion to other fruit fly/fruit combinations without doing appropriate comparison studies. Dissection of puparia from nonirradiated control insects that failed to emerge as adults showed a relatively even distribution of mortality among the developmental stages within the puparium. In contrast, dissection of puparia from irradiated third instars that did not emerge as adults revealed a sharp attenuation in development from cryptocephalic to phanerocephalic pupae demonstrating this transition to be the developmental step most affected by radiation.

  18. DNA barcode variability and host plant usage of fruit flies (Diptera: Tephritidae) in Thailand.

    PubMed

    Kunprom, Chonticha; Pramual, Pairot

    2016-10-01

    The objectives of this study were to examine the genetic variation in fruit flies (Diptera: Tephritidae) in Thailand and to test the efficiency of the mitochondrial cytochrome c oxidase subunit I (COI) barcoding region for species-level identification. Twelve fruit fly species were collected from 24 host plant species of 13 families. The number of host plant species for each fruit fly species ranged between 1 and 11, with Bactrocera correcta found in the most diverse host plants. A total of 123 COI sequences were obtained from these fruit fly species. Sequences from the NCBI database were also included, for a total of 17 species analyzed. DNA barcoding identification analysis based on the best close match method revealed a good performance, with 94.4% of specimens correctly identified. However, many specimens (3.6%) had ambiguous identification, mostly due to intra- and interspecific overlap between members of the B. dorsalis complex. A phylogenetic tree based on the mitochondrial barcode sequences indicated that all species, except for the members of the B. dorsalis complex, were monophyletic with strong support. Our work supports recent calls for synonymization of these species. Divergent lineages were observed within B. correcta and B. tuberculata, and this suggested that these species need further taxonomic reexamination.

  19. Oral and Topical Toxicity of Fipronil to Melon Fly and Oriental Fruit Fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    BACKGROUND: The objective of this study was to develop basic oral and topical toxicity data for Fipronil in Solulys protein bait to wild melon fly, Bactrocera cucurbitae (Coquillett) and the oriental fruit fly, Bactrocera dorsalis (Hendel). RESULTS: For the oral study, both females and males were ...

  20. Olfactory response of the Mexican fruit fly (Diptera: Tephritidae) to Citrus aurantium volatiles.

    PubMed

    Rasgado, Milton A; Malo, Edi A; Cruz-López, Leopoldo; Rojas, Julio C; Toledo, Jorge

    2009-04-01

    We investigated the behavioral and electrophysiological responses of male and female Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), to volatiles of bitter orange fruit, Citrus aurantium L. In field cage tests, the number of A. ludens caught in Multilure traps baited with mature green bitter orange fruit was significantly higher than the number captured in traps baited with ripe yellow bitter orange fruit and control (unbaited traps). Both sexes were more attracted to mature green bitter orange fruit extracts than to controls in both flight tunnel and field cage assays. Gas chromatography-mass spectrometry analysis of the mature green bitter orange fruit volatiles identified 10 different compounds. Limonene was the most abundant volatile compound, followed by an unknown compound, tentatively identified as trans-ocimene. Linalool, beta-pinene, and methyl salicylate were found in lower proportions. Both sexes of A. ludens evoked higher antennal response to linalool, methyl salicylate, and to a blend of these four components in comparison with limonene, and beta-pinene. In flight tunnel, both sexes were more attracted and landed more often on spheres baited with the four-component blend compared with control spheres. In field cage tests, Multilure traps baited with the four-component blend captured significantly more A. ludens flies than traps baited with hydrolyzed protein or control traps.

  1. Attraction and Mortality of Oriental Fruit Flies (Diptera: Tephritidae) to SPLAT-MAT- Methyl Eugenol with Spinosad

    USDA-ARS?s Scientific Manuscript database

    Studies were conducted in Hawaii to quantify attraction and feeding responses resulting in mortality of male oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to SPLAT-MAT-methyl eugenol (ME) with spinosad in comparison with Min-U-Gel-ME with naled (Dibrom). Our approach invol...

  2. Temperature-mediated kill and oviposition of Western Cherry Fruit Fly (Diptera: Tephritidae) in the presence of Spinosad

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a quarantine pest of sweet cherry (Prunus avium (L.) L.) that is managed using insecticides, including spinosad, an organic compound that can be applied in low spray volumes. Identifying factors that can increase the...

  3. Impact of prolonged absence of low temperature on adult eclosion patterns of western cherry fruit fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    The western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the U.S.A. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in ...

  4. Thermal death kinetics of Mediterranean, Malaysian, melon, and oriental fruit fly (Diptera: Tephritidae) eggs and third instars.

    PubMed

    Armstrong, John W; Tang, Juming; Wang, Shaojin

    2009-04-01

    The late-aged egg and third-instar life stages of laboratory-reared Malaysian fruit fly, Bactrocera latifrons (Hendel); Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, B. cucurbitae Coquillett; and oriental fruit fly, B. dorsalis (Hendel), (Diptera: Tephritidae); and the third instars of wild Mediterranean fruit fly were exposed to thermal treatments. A heating block system was used to determine the thermal death kinetics of the four fruit fly species. Treatments consisted of heating the fruit fly life stages to 44, 46, 48, and 50 degrees C and holding for different times ranging from 0 to 120 min depending on the thermal mortality response and time required to obtain 100% mortality for each species and life stage. The 0.5-order kinetic model had the best fit to the survival ratio for all the treatment temperatures and was used to predict lethal times. The thermal death time (TDT) curves showed a tolerance order of Mediterranean fruit fly eggs < or = third instars at 44, 46, and 50 degrees C, third instars < or = eggs at 48 degrees C, and wild third instars < the laboratory-reared third instars. Comparison between Mediterranean fruit fly third instar thermotolerance from Hawaii and Israel showed that Israel Mediterranean fruit fly was more thermotolerant. A comparison of minimum treatment times at a given temperature required to obtain 100% mortality of laboratory-reared Malaysian, Mediterranean (Hawaii and Israel strains), melon, Mexican, and oriental fruit fly eggs or third instars and wild Mediterranean fruit fly (Hawaii strain) eggs or third instars showed that oriental fruit fly was the most thermotolerant among the third instars, and the difference in heat tolerance between third instars and eggs was negligible at 50 degrees C.

  5. Natural Field Infestation of Mangifera casturi and Mangifera lalijiwa by Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    McQuate, Grant T; Sylva, Charmaine D; Liquido, Nicanor J

    2017-01-01

    Mango, Mangifera indica (Anacardiaceae), is a crop cultivated pantropically. There are, however, many other Mangifera spp ("mango relatives") which have much more restricted distributions and are poorly known but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapped in mango breeding programs. Because of the restricted distribution of many of the Mangifera spp, there has also been limited data collected on susceptibility of their fruits to infestation by tephritid fruit flies which is important to know for concerns both for quality of production and for quarantine security of fruit exports. Here, we report on natural field infestation by the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae), of two mango relatives native to Indonesia: Mangifera casturi and Mangifera lalijiwa. Rates of infestation of fruits of these two Mangifera spp by tephritid fruit flies have not previously been reported.

  6. Natural Field Infestation of Mangifera casturi and Mangifera lalijiwa by Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    McQuate, Grant T; Sylva, Charmaine D; Liquido, Nicanor J

    2017-01-01

    Mango, Mangifera indica (Anacardiaceae), is a crop cultivated pantropically. There are, however, many other Mangifera spp (“mango relatives”) which have much more restricted distributions and are poorly known but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapped in mango breeding programs. Because of the restricted distribution of many of the Mangifera spp, there has also been limited data collected on susceptibility of their fruits to infestation by tephritid fruit flies which is important to know for concerns both for quality of production and for quarantine security of fruit exports. Here, we report on natural field infestation by the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae), of two mango relatives native to Indonesia: Mangifera casturi and Mangifera lalijiwa. Rates of infestation of fruits of these two Mangifera spp by tephritid fruit flies have not previously been reported. PMID:28890657

  7. Genetic consequences of domestication and mass rearing of pest fruit fly Bactrocera tryoni (Diptera: Tephritidae).

    PubMed

    Gilchrist, A S; Cameron, E C; Sved, J A; Meats, A W

    2012-06-01

    Tephritid fruit flies, an important pest of horticulture worldwide, are increasingly targeted for control or eradication by large-scale releases of sterile flies of the same species. For each species treated, strains must be domesticated for mass rearing to provide sufficiently large numbers of individuals for releases. Increases in productivity of domesticated tephritid strains are well documented, but there have been few systematic studies of the genetic consequences of domestication in tephritids. Here, we used nine DNA microsatellite markers to monitor changes in genetic diversity during the early generations of domestication in replicated lines of the fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). The observed changes in heterozygosity and allelic richness were compared with the expected changes in heterozygosity generated by a stochastic simulation including genetic drift but not selection. The results showed that repeatable genetic bottlenecks occur in the early generations and that selection occurs in the later generations. Furthermore, using the same simulation, we show that there is inadvertent selection for increased productivity for the entire life on a mass-rearing colony, in addition to intentional selection for increased productivity. That additional selection results from the common practice of establishing the next generation of the breeding colony from a small proportion of one day's pupae collection (the pupal raffle). That selection occurs during all generations and acts only on fecundity variation. Practical methods to counter that unavoidable loss of genetic diversity during the domestication process in B. tryoni are discussed.

  8. Assessment of fruit fly (Diptera: Tephritidae) management practices in deciduous fruit growing areas in South Africa.

    PubMed

    Manrakhan, Aruna; Addison, Pia

    2014-04-01

    Ceratitis capitata (Wiedemann) and Ceratitis rosa Karsch are important fruit fly pests of deciduous fruit in the Western Cape Province, South Africa. The main techniques used for fruit fly control in the Western Cape are the sterile insect technique (SIT) targeting C. capitata and the bait application technique (BAT). We determined the relative success of SIT by comparing adult fly-trap catches and fruit infestation in commercial orchards between three regions under SIT and two regions under BAT in the Western Cape, from 2006 to 2008. Ceratitis capitata was predominant in all regions. In commercial orchards, C. capitata catches peaked towards the end of the fruiting season (March to May) and were low between July and January. During the late season, C. capitata catches were significantly higher in two of the regions under SIT. The sterile to wild male ratio in those regions was found to be mostly <1. SIT is not being properly applied in some regions. SIT should be implemented when the pest population is low. The sterile to wild fly ratios should be increased. Alternatively, BAT should be used to lower the pest population before SIT application. Control methods should be more integrated and applied area-wide. © 2013 Society of Chemical Industry.

  9. Oviposition deterrents for the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae) from fly faeces extracts.

    PubMed

    Arredondo, J; Díaz-Fleischer, F

    2006-02-01

    After oviposition, females of the Mediterranean fruit fly Ceratitis capitata Wiedemann deposit a host-marking pheromone on the fruit surface that deters oviposition by conspecifics. Methanolic extracts of fruit fly faeces elicit a similar deterrent effect. The results of laboratory and field experiments using raw methanolic extracts of C. capitata faeces as an oviposition deterrent are reported. Laboratory bioassays revealed a significant positive relationship between concentration of faeces and the inhibition of oviposition responses by C. capitata. Treatment of halves of coffee bushes with methanolic extracts containing 0.1, 1.0 and 10 mg faeces ml(-1) resulted in a significant reduction of infestation only at the highest concentration (P=0.03). Treatment of blocks of coffee bushes with an extract of 10 mg faeces ml(-1) resulted in an 84% reduction in infestation by C. capitata in sprayed plants and a 56% reduction in adjacent untreated coffee bushes surrounding treated plots, probably due to the deterrent effect of host-marking pheromone on fly oviposition. We conclude that faeces contain oviposition deterrent substances that effectively reduce fruit infestations by C. capitata, suggesting a clear potential for the use of this infochemical in integrated management programmes targeted at this pest.

  10. Generic phytosanitary radiation treatment for tephritid fruit flies provides quarantine security for Bactrocera latifrons (Diptera: Tephritidae).

    PubMed

    Follett, Peter A; Phillips, Thomas W; Armstrong, John W; Moy, James H

    2011-10-01

    Bactrocera latifrons (Hendel) (Diptera: Tephritidae) is a quarantine pest of several solanaceous crops and tropical fruits that are treated using irradiation before export from Hawaii to the U.S. mainland. A dose of 150 Gy is approved as a generic irradiation treatment for tephritid fruit flies, but no confirmation of efficacy has been reported for B. latifrons. Dose response of B. latifrons was used to determine the most tolerant life stage and identify a dose that prevents adult emergence. Data indicated doses (plus 95% confidence limits) required to prevent adult emergence of 13.4 (10.0-29.6), 17.5 (14.4-24.8), and 88.1 (68.0-133.8) Gy for eggs, first instars and third instars, respectively. In large-scale confirmatory tests of the most radiotolerant life stage, a radiation dose of 150 Gy applied to B. latifrons late third instars in bell peppers (Capsicum annuum L.) resulted in no survival to the adult stage of 157,112 individuals, a treatment efficacy consistent with Probit 9-level mortality. The relative radiotolerance of melon fly Bactrocera cucurbitae Coquillet, and B. latifrons also was tested using a diagnostic radiation dose of 30 Gy. In diet, a mean of 6.9% of irradiated B. cucurbitae third instars developed to the adult stage, whereas no B. latifrons third instars developed to adults. In papaya, Carica papaya L., fruit, a mean of 3.3% of irradiated B. cucurbitae third instars developed to the adult stage, whereas 0.5% B. latifrons third instars developed to adults. This report supports the use of a generic radiation dose of 150 Gy in quarantine scenarios to control tephritid fruit flies on fresh commodities.

  11. Cold storage enhances the efficacy and margin of security in postharvest irradiation treatments against fruit flies (Diptera: Tephritidae).

    PubMed

    Follett, Peter A; Snook, Kirsten

    2013-10-01

    Cold storage is used to preserve fruit quality after harvest during transportation in marketing channels. Low temperature can be a stressor for insects that reduces survivorship, and cold storage may contribute to the efficacy of postharvest quarantine treatments such as irradiation against quarantine insect pests. The combined effect of irradiation and cold storage was examined in a radiation-tolerant fruit fly, Bactrocera cucurbitae Coquillet (melon fly), and a radiation-intolerant fruit fly, Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) (Diptera: Tephritidae). Third instars on diet or in papaya were treated with a sublethal radiation dose of 30 Gy and stored at 4 or 11 degrees C for 3-13 d and held for adult emergence. For both fruit fly species, survival of third instars to the adult stage generally decreased with increasing cold storage duration at 4 or 11 degrees C in diet or papaya. Survivorship differences were highly significant for the effects of substrate (diet > papaya), temperature (11 > 4 degrees C),and irradiation (0 > 30 Gy). Few Mediterranean fruit flies survived in any cold storage treatment after receiving a radiation dose of 30 Gy. No melon fly larvae survived to the adult stage after irradiation and 11 d cold storage at 4 or 11 degrees C in papayas. Cold storage enhances the efficacy and widens the margin of security in postharvest irradiation treatments. Potentially irradiation and cold storage can be used in combination to reduce the irradiation exposure requirements of quarantine treatments.

  12. High summer temperatures affect the survival and reproduction of olive fruit fly (Diptera: Tephritidae).

    PubMed

    Wang, Xin-Geng; Johnson, Marshall W; Daane, Kent M; Nadel, Hannah

    2009-10-01

    The olive fruit fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae), is an invasive pest in California. Identifying environmental constraints that affect the geographic distribution and abundance of any invasive insect pest is fundamental to its effective management. California's Central Valley, where most commercial olives are grown, is extremely hot during the summer, with maximum daily temperatures consistently >35.0 degrees C. This study examined the effects of two diurnal temperature regimens (low 18.3 degrees C, high 35.0 or 37.8 degrees C) reflecting summer conditions in the valley, and one control temperature regimen (low 18.3 degrees C, high 23.9 degrees C) on the fly's survival and reproductive success in the laboratory. The temperature regimen of 18.3-35.0 degrees C resulted in delayed egg maturation and reduced production of mature eggs compared with the control temperature regimen. Egg maturation was possible at the higher temperature regimen when females were provided with water and food, and egg-laying occurred during the cold phase of the temperature cycle. Access to olive fruit and oviposition itself further promoted egg maturation. Under exposure to the 18.3-35.0 degrees C temperature regimen, approximately 50% of eggs died, and the remainder that hatched died as first instars. No egg hatch occurred at the temperature treatment of 18.3-37.8 degrees C. We confirmed these laboratory results through field cage studies with adult B. oleae, conducted in the summer of 2007 and 2008. Under ambient summer temperatures, adult B. oleae survived for 1-2 wk, and females readily laid eggs when provided water and food. No offspring developed in midsummer of 2007, and <2% of the offspring developed to adults in summer 2008 trials. These results suggest that high summer temperatures limit the fly's abundance in California's Central Valley.

  13. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    The most common hosts for the West Indian fruit fly, Anastrepha oblique (Macquart), are fruits of the family Anacardiaceae (mangos and mombin species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, inclu...

  14. Evaluation of the efficacy of the methyl bromide fumigation schedule against Mexican fruit fly (Diptera: Tephritidae) in citrus fruit.

    PubMed

    Hallman, Guy J; Thomas, Donald B

    2011-02-01

    Methyl bromide fumigation is widely used as a phytosanitary treatment. Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), is a quarantine pest of several fruit, including citrus (Citrus spp.), exported from Texas, Mexico, and Central America. Recently, live larvae have been found with supposedly correctly fumigated citrus fruit. This research investigates the efficacy of the previously approved U.S. Department of Agriculture-Animal and Plant Health Inspection Service treatment schedule: 40 g/m3 methyl bromide at 21-29.4 degrees C for 2 h. Tolerance ofA. ludens to methyl bromide in descending order when fumigated in grapefruit (Citrus X paradisi Macfad.) is third instar > second instar > first instar > egg. Two infestation techniques were compared: insertion into fruit of third instars reared in diet and oviposition by adult A. ludens into fruit and development to the third instar. Inserted larvae were statistically more likely to survive fumigation than oviposited larvae. When fruit were held at ambient temperature, 0.23 +/- 0.12% of larvae were still observed to be moving 4 d postfumigation. Temperatures between 21.9 and 27.2 degrees C were positively related to efficacy measured as larvae moving 24 h after fumigation, pupariation, and adult emergence. Coating grapefruit with Pearl Lustr 2-3 h before fumigation did not significantly affect the proportion of third instars moving 24 h after fumigation, pupariating, or emerging as adults. In conclusion, fumigation with 40 g/m3 methyl bromide for 2 h at fruit temperatures >26.7 degrees C is not found to be inefficacious for A. ludens. Although a few larvae may be found moving >24 h postfumigation, they do not pupariate.

  15. Chemosterilant bait stations coupled with sterile insect technique: an integrated strategy to control the Mediterranean fruit fly (Diptera: Tephritidae).

    PubMed

    Navarro-Llopis, V; Vacas, S; Sanchis, J; Primo, J; Alfaro, C

    2011-10-01

    During 2008 and 2009, the efficacy of the combination of two Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), control techniques, sterile insect technique (SIT) and a chemosterilant bait station system (Adress), was tested in three crops: citrus (Citrus spp.), stone fruit (Prunus spp.), and persimmon (Diospyros spp.). Two thousand sterile males were released per ha each week in the whole trial area (50,000 ha, SIT area). For 3,600 ha, within the whole trial area, 24 Adress traps per ha were hung (SIT + Adress area). Ten SIT + Adress plots and 10 SIT plots in each of three different fruit crops were arranged to assess Mediterranean fruit fly population densities and fruit damage throughout the trial period. To evaluate the efficacy of each treatment, the male and female populations were each monitored from August 2008 to November 2009, and injured fruit was assessed before harvest. Results showed a significant reduction in the C. capitata population in plots treated with both techniques versus plots treated only with the SIT. Likewise, a corresponding reduction in the percentage of injured fruit was observed. These data indicate the compatibility of these techniques and suggest the possibility of using Adress coupled with SIT to reduce C. capitata populations in locations with high population densities, where SIT alone is not sufficiently effective to suppress fruit fly populations to below damaging levels.

  16. An overview of tropical pest species of bactrocera fruit flies (Diptera:Tephritidae) and the integration of biopesticides with other biological approaches for their management

    USDA-ARS?s Scientific Manuscript database

    Fruit flies (Diptera:Tephritidae) are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas of the world. These species are such devastating crop pests that major control and eradication prog...

  17. Chilling and host plant/site associated eclosion times of western cherry fruit fly (Diptera:Tephritidae) and a host-specific parasitoid

    USDA-ARS?s Scientific Manuscript database

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is native to bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ~100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of ad...

  18. Evaluation of lufenuron as a chemosterilant against fruit flies of the genus Anastrepha (Diptera: Tephritidae).

    PubMed

    Moya, Pilar; Flores, Salvador; Ayala, Ildefonso; Sanchis, Juan; Montoya, Pablo; Primo, Jaime

    2010-06-01

    Chemosterilisation with lufenuron bait stations is a recently developed technique that is being implemented for Ceratitis capitata Wiedemann control. The aim of this work was to evaluate the chemosterilising effect of lufenuron against four economically important Latin American fruit flies species: Anastrepha ludens (Loew.), A. obliqua Macquart, A. serpentina Wiedemann and A. striata Schiner (Diptera: Tephritidae) in order to design a similar strategy for their control. Sexually mature adults were treated by ingestion with concentrations ranging from 0.1 to 30.0 mg g(-1) of lufenuron in the diet. In addition, conspecific crosses with only one of the sexes being treated (30.0 mg g(-1)) were performed in order to appraise the contribution of each sex to the sterilising effect. In all cases, fecundity was not affected by the treatments, as opposed to fertility where all Anastrepha species studied were significantly affected, although to different extents. The conspecific crosses showed that treated males of A. ludens, A. obliqua and A. serpentina were not able to transmit the sterility to their respective untreated females. Only in the case of A. striata did crossing treated males with untreated females significantly reduced egg hatch. Although further investigations are required, the present results demonstrate that the use of lufenuron for controlling A. striata could be potentially viable.

  19. Sex-Specific Allometry of Morphometric and Reproductive Traits in Oriental Fruit Flies (Diptera: Tephritidae).

    PubMed

    Zhou, Peng; Yang, Hong; Jin, Dao Chao; He, Xiong Zhao; Wang, Qiao

    2016-02-25

    The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is a highly invasive and polyphagous pest of many horticultural crops in the world, and is currently present in Asia, Africa, and Oceania. To provide essential knowledge for quality control in mass-rearing programs for sterile insect technique against the pest, we investigated how adult body weight and hind-tibial length were correlated in each sex and how body size of each sex affected lifetime reproductive fitness. We show that body weight and hind-tibial length were significantly positively correlated in both sexes, indicating that either trait can be used as an index of body size. However, the weight-tibial length relationships were sex specific, with females gaining disproportionally more weight than males with the increase of hind-tibial length. Body size was not significantly correlated with longevity of either sex, but males lived significantly longer than females. Larger females laid significantly more eggs regardless of body size of the male partner, suggesting that male size has no effect on fecundity. However, body size of both sexes had a significant effect on fertility. We conclude that selection on body size-reproductive fitness relations operates in different directions for the two sexes of B. dorsalis, with larger females and average males having highest reproductive fitness. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Isolation and identification of bacteria associated with adult laboratory Mexican fruit flies, Anastrepha ludens (Diptera: Tephritidae).

    PubMed

    Kuzina, L V; Peloquin, J J; Vacek, D C; Miller, T A

    2001-04-01

    From the guts of new and old colonies (female and male) of Mexican fruit flies, Anastrepha ludens (Diptera: Tephritidae), we identified a total of 18 different bacterial species belonging to the family Enterobacteriaceae, Pseudomonadaceae, Vibrionaceae, Micrococcaceae, Deinococcacea, Bacillaceae, and the genus Listeria. Enterobacter, Providencia, Serratia, and Staphylococcus spp. were the most frequently isolated genera, with Citrobacter, Streptococcus, Aerococcus, and Listeria found less frequently. We found Bacillus cereus, Enterobacter sakazakii, Providencia stuartii, and Pseudomonas aeruginosa only in the new colony, Aeromonas hydrophila and Klebsiella pneumoniae spp. pneumoniae only in the old colony. We also studied resistance/sensitivity to 12 antibiotics for six bacterial isolates such as Enterobacter cloacae, E. sakazakii, K. pneumoniae spp., Providencia rettgeri, P. aeruginosa, and Bacillus cereus. Isolates on the whole were resistant to penicillin and ampicillin (five of six isolates) and sensitive to rifampin and streptomycin (six of six isolates). Antibiotic resistance profiles might be useful characteristics for distinguishing among species and strains of these bacteria, probably having ecological significance with respect to intra- and inter-specific competition within host cadavers, and could have implications for the utility of these organisms for biological control, including the alternative control strategy, paratransgenesis.

  1. Understanding long-term fruit fly (Diptera: Tephritidae) population dynamics: implications for areawide management.

    PubMed

    Aluja, Martín; Ordano, Mariano; Guillén, Larissa; Rull, Juan

    2012-06-01

    Fruit flies (Diptera: Tephritidae) are devastating agricultural pests worldwide but studies on their long-term population dynamics are sparse. Our aim was to determine the mechanisms driving long-term population dynamics as a prerequisite for ecologically based areawide pest management. The population density of three pestiferous Anastrepha species [Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), and Anastrepha serpentina (Wiedemann)] was determined in grapefruit (Citrus x paradisi Macfad.), mango (Mangifera indica L.), and sapodilla [Manilkara zapota (L.) P. Royen] orchards in central Veracruz, México, on a weekly basis over an 11-yr period. Fly populations exhibited relatively stable dynamics over time. Population dynamics were mainly driven by a direct density-dependent effect and a seasonal feedback process. We discovered direct and delayed influences that were correlated with both local (rainfall and air temperature) and global climatic variation (El Niño Southern Oscillation [ENSO] and North Atlantic Oscillation [NAO]), and detected differences among species and location of orchards with respect to the magnitude and nature (linear or nonlinear) of the observed effects, suggesting that highly mobile pest outbreaks become uncertain in response to significant climatic events at both global and local levels. That both NAO and ENSO affected Anastrepha population dynamics, coupled with the high mobility of Anastrepha adults and the discovery that when measured as rate of population change, local population fluctuations exhibited stable dynamics over time, suggests potential management scenarios for the species studied lie beyond the local scale and should be approached from an areawide perspective. Localized efforts, from individual growers will probably prove ineffective, and nonsustainable.

  2. Recapture of sterile Mediterranean fruit flies (Diptera: Tephritidae) in California's Preventative Release Program.

    PubMed

    Barry, James D; Blessinger, Todd; Morse, Joseph G

    2004-10-01

    In southern California, the sterile insect technique has been used since 1994 to prevent establishment of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). This method involves the continual mass release of sterile flies, which suppress or eliminate any introduced wild fly populations. In addition, Jackson traps baited with trimedlure are deployed throughout the preventative release region for the dual purpose of detecting wild flies and monitoring released sterile flies. Sterile fly recapture data for a 3-yr period was compared with climate and to host plant (in which traps were placed). Precipitation was negatively correlated; and temperature and relative humidity were positively correlated with fly recapture levels. The highest numbers of flies were recaptured during trapping periods associated with intermediate relative humidity and temperature, and low precipitation. Flies were recaptured throughout the entire year, in traps that had been frequently relocated to host plants with fruit. This finding suggests that these flies were capable of locating acceptable fruit in a variety of abiotic conditions. However, these data do not necessarily suggest that measurements unimportant in explaining sterile fly recapture are not of value in determining other outcomes important to the goals of sterile release programs, such as reducing the likelihood of establishment of an introduced wild Mediterranean fruit fly population. Future research might build on these results in developing more precise models useful in predicting recapture of sterile flies.

  3. Evaluation of the efficacy of the methyl bromide fumigation schedule against Mexican fruit fly (Diptera: Tephritidae) in citrus fruit

    USDA-ARS?s Scientific Manuscript database

    Methyl bromide fumigation is a major phytosanitary treatment for a wide variety of quarantine pests, including tephritid fruit flies. Mexican fruit fly, Anastrepha ludens (Loew), is a quarantine pest of a number of fruits, including citrus exported from Texas, Mexico and Central American countries....

  4. Ionizing radiation as a phytosanitary treatment against fruit flies (Diptera: Tephritidae): Efficacy in naturally versus artificially infested fruit

    USDA-ARS?s Scientific Manuscript database

    Some phytosanitary irradiation treatments against tephritid fruit flies have been developed using artificial infestation of fruit without first comparing its effect on efficacy. In this study, efficacy was compared using infestation of grapefruit with Mexican fruit fly, Anastrepha ludens (Loew), vi...

  5. Olive fruit fly (Diptera: Tephritidae) in California table olives, USA: Invasion, distribution, and management implications

    USDA-ARS?s Scientific Manuscript database

    Olive fruit fly, Bactrocera oleae (Rossi), was discovered in California in late 1998. Thereafter, intensive research was conducted to develop pest control methods in table olives. The life history of olive fruit fly was elucidated, and the distribution and abundance of the adults determined through ...

  6. Attractant-based systems as pesticide alternatives for control of tropical fruit flies (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Mass trapping and attract-and-kill bait stations are two attractant based systems that are being used or are under development as pesticide alternatives for control of a number of pest tephritid fruit flies. Results of field trials for suppression of Caribbean fruit flies in guava orchards in Florid...

  7. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    PubMed

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  8. An evaluation of alternative insecticides to diazinon for control of tephritid fruit flies (Diptera: Tephritidae) in soil.

    PubMed

    Stark, John D; Vargas, Roger

    2009-02-01

    Diazinon has been used extensively in the past as part of California eradication programs for tephritid fruit flies (Diptera: Tephritidae) as a soil drench, but it is being phased out for this purpose in the United States. Therefore, in this study, the toxicity of Platinum, Force, Admire, Regent, and Warrior was estimated after application to sand and soil as drenches for control of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), in Hawaii. Susceptibility of each species differed. In sand, the order of toxicity at LC50 based on the 95% confidence limit overlap approach for C. capitata from most toxic to least toxic was diazinon > Force = Warrior > Admire = Platinum > Regent. The order of toxicity for B. dorsalis was diazinon > Platinum = Warrior = Force > Regent = Admire. The order of toxicity for B. cucurbitae was Warrior = diazinon > Force = Regent = Platinum = Admire. Based on the dose ratio method, Warrior was not significantly different at LC50 than diazinon for B. cucurbitae only. All other insecticides were significantly different from diazinon at LC50. Studies in sand were followed by an evaluation of specific concentrations of Warrior and Force in soil collected from two sites on the island of Kauai. Average concentrations that caused at least 95% mortality in soil in all three fruit fly species were 121 g active ingredient (AI)/ha for Force and 363 g (AI)/ha for Warrior compared with 182 g (AI)/ha for diazinon. These results indicate that Force and Warrior could be used as soil treatments for control of tephritid fruit flies.

  9. Toxicological studies of organophosphate and pyrethroid insecticides for controlling the fruit fly Dacus ciliatus (Diptera: Tephritidae).

    PubMed

    Maklakov, A; Ishaaya, I; Freidberg, A; Yawetz, A; Horowitz, A R; Yarom, I

    2001-10-01

    The fruit fly Dacus ciliatus Loew is a pest of the fruits of many cucurbit species. We studied the effect of organaophosphate and pyrethroid compounds on the adult flies by using surface contact and oral administration. In contrast to other fruit flies, we found that organophosphates were ineffective against D. ciliatus. This was supported by the insignificant decrease of head acetylcholinesterase activity. All tested pyrethroids showed satisfactory killing ability, rapid and massive knockdown effect, and prevention of oviposition. Piperonyl butoxide considerably increased the toxicity of pyrethroids, which can be explained by oxidase detoxification of these compounds in D. ciliatus. It can be concluded that pyrethroids have high potential for controlling D. ciliatus.

  10. Effectiveness of a sprayable male annihilation treatment with a biopesticide against fruit flies (Diptera:Tephritidae) attacking tropical fruits

    USDA-ARS?s Scientific Manuscript database

    SPLAT-MAT Spinosad ME(aka STATIC Spinosad ME),an "attract and kill" sprayable biopesticide, was evaluated as an area wide suppression treatment against Bactrocera carambolae(Drew & Hancock),carambola fruit fly, in Brazil and Bactrocera dorsalis(Hendel),oriental fruit fly, in Hawaii. In Brazil, a sin...

  11. Loop-Mediated Isothermal Amplification Combined with PCR for Rapid Identification of the Ethiopian Fruit Fly (Diptera: Tephritidae).

    PubMed

    Sabahi, S; Fekrat, L; Zakiaghl, M; Moravej, G H

    2017-05-06

    Nowadays, with increasing trend of trans-boundary transportation of agricultural products and higher probability of introduction of many invasive species into new areas, fast and precise species diagnosis is of great significance particularly at the port of entry, where morphological identification often requires adult insect specimens especially with specialist insects. The cucumber fruit fly, Dacus ciliatus Loew (Diptera: Tephritidae), ranks as one of the most destructive agricultural pests attacking mainly fruits of Cucurbitaceae. This pest is also widespread and highly invasive; thus, it is a high priority for pest detection and quarantine programs. Although cucumber fruit fly adults can usually be identified and distinguished from the other species by morphological keys, it is often difficult or impossible to distinguish this species from the other tephritids that share host plants by using material from other stages of development. In such situations, using a quick and robust alternative species diagnostic tool would be valuable. In this study, we assessed a technique combining loop-mediated isothermal amplification (LAMP) with PCR (PCR-LAMP) for the rapid detection and discrimination of cucumber fruit fly DNA from some other common tephritid species attacking Cucurbitaceae, using material from different stages of development. The described method was species-specific and sensitive and provided a rapid diagnostic tool to detect D. ciliaus even by non-experts.

  12. Effectiveness of spinosad bait sprays (GF-120) in controlling mango-infesting fruit flies (Diptera: Tephritidae) in Benin.

    PubMed

    Vayssieres, Jean-François; Sinzogan, Antonio; Korie, Sam; Ouagoussounon, Issa; Thomas-Odjo, Agnès

    2009-04-01

    Effectiveness of GF-120 (Dow Chemical) Fruit Fly Bait containing the insecticide spinosad in controlling mango-infesting fruit flies (Diptera: Tephritidae) was assessed by comparing treated orchards with untreated orchards. Twelve mango, Mangifera indica L., plantations located in six villages (two similar orchards per village: one orchard treated and orchard untreated) scattered in the Borgou department (northern Benin) were monitored weekly with fly traps, and the fruit was sampled twice for larval infestation at the beginning and in the middle of May in both 2006 and 2007. The two main mango fruit fly pests are Ceratitis cosyra (Walker) and Bactrocera invadens Drew, Tsuruta & White, an invasive species that recently spread throughout West Africa. In both the 2006 and 2007 seasons, C. cosyra had the earliest peak of abundance, and the difference between treated and untreated orchards, in terms of mean number of flies trapped per week and per trap, was significant only in 2007. B. invadens populations quickly increased with the onset of the rains, from mid-May onward, with no significant difference between treated and untreated orchards. In 2006 and 2007, the larval infestation by B. invadens was significantly lower in plots treated with GF-120 than in untreated control plots. GF-120 provided an 81% reduction in the number of pupae per kilogram of fruit after weekly applications for 7 wk in 2006 and an 89% reduction after 10 wk of weekly applications in 2007. The possibility of integrating GF120 bait sprays in an integrated pest management package is discussed in relation to market requirements.

  13. Habitat-specific flight period in the cherry fruit fly Rhagoletis cingulata (Loew) (Diptera: Tephritidae).

    PubMed

    Teixeira, Luís A F; Isaacs, Rufus; Gut, Larry J

    2007-12-01

    Flight periods of the cherry fruit fly, Rhagoletis cingulata (Loew), were compared in the major sweet and tart cherry-growing regions of Michigan, among neglected orchards, managed orchards, and natural areas containing the ancestral host, black cherry. Traps were deployed from early June to late September 2005 and 2006. Captures indicated that cherry fruit fly has an early flight (June-July) in neglected orchards, a mid-season flight peaking immediately after harvest (June-August) in managed orchards, and an extended flight covering most of the season (June-September) in natural areas. We found that the period of fruit infestation mirrored the flight period in neglected and managed orchards. In natural areas, we found infestation late in the season only. The relative emergence periods for adults reared from pupae collected from the three habitats and maintained under the same conditions coincided with adult flight periods for each habitat. We also studied factors related to fruit availability that may have a role in shaping the flight periods. Fruit abundance decreased rapidly early in the season in neglected orchards, whereas in managed orchards, fruit left after harvest remained on the trees until late August. Measurements of fruit size and skin firmness revealed that fly activity in neglected and managed orchards began immediately after fruit increased in size and skin firmness decreased, whereas in natural areas, the flight began before fruit matured. In managed orchards, fruit harvest and insecticide sprays likely maintain the late flight period of resident fly populations by preventing the use of fruit earlier in the season. However, a significant proportion of these resident flies may still emerge before harvest and increase the risk of costly fruit infestation.

  14. Classical biological control of the olive fruit fly, Bactrocera olea (Diptera: Tephritidae), using the exotic parasitoie, Psyttalia lounsburyi (Hymenoptera: Braconidae) in France.

    USDA-ARS?s Scientific Manuscript database

    The olive fruit fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae) is an important pest of olives which is worldwide distributed and responsible for economic losses of approximately US$800 million per year. Since the 2000s both economical and environmental concerns have raised interested in clas...

  15. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  16. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: Effect of ammonium acetate, female age, and protein hunger

    USDA-ARS?s Scientific Manuscript database

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examine...

  17. Reproductive maturity of cherry fruit fly (Diptera: Tephritidae) in managed and natural habitats.

    PubMed

    Teixeira, Luís A F; Gut, Larry J; Isaacs, Rufus; Alston, Diane G

    2009-08-01

    We studied the timing of reproductive maturity of cherry fruit fly, Rhagoletis cingulata (Loew), a key pest of sweet and tart cherries in the eastern United States. To determine when cherry fruit fly females become reproductively mature in managed and natural habitats, we deployed traps in sweet and tart cherry orchards and nearby stands of the ancestral host tree, black cherry. Flies were removed from the traps and females were dissected to determine the presence of fully developed eggs. We found that capture of reproductively mature female flies occurred earlier in orchards that are not sprayed with insecticides than in sprayed orchards or in black cherry tree sites. In addition, the gap between the flights of immature and mature females in unmanaged sweet or tart cherry orchards was shorter than in managed orchards or black cherry tree sites. We also determined fruit color, size, and skin hardness to characterize the progression of fruit maturity. We found that fruit became mature earlier in sweet and tart cherry orchards than in black cherry tree sites. This study indicates that the timing of female reproductive maturity is plastic and varies among cherry fruit fly populations present in distinct habitats. Variation in the timing of reproductive maturity is related to the fruit maturity period of distinct host plant species and to orchard management.

  18. Host plant range of a fruit fly community (Diptera: Tephritidae): does fruit composition influence larval performance?

    PubMed

    Hafsi, Abir; Facon, Benoit; Ravigné, Virginie; Chiroleu, Frédéric; Quilici, Serge; Chermiti, Brahim; Duyck, Pierre-François

    2016-09-20

    Phytophagous insects differ in their degree of specialisation on host plants, and range from strictly monophagous species that can develop on only one host plant to extremely polyphagous species that can develop on hundreds of plant species in many families. Nutritional compounds in host fruits affect several larval traits that may be related to adult fitness. In this study, we determined the relationship between fruit nutrient composition and the degree of host specialisation of seven of the eight tephritid species present in La Réunion; these species are known to have very different host ranges in natura. In the laboratory, larval survival, larval developmental time, and pupal weight were assessed on 22 fruit species occurring in La Réunion. In addition, data on fruit nutritional composition were obtained from existing databases. For each tephritid, the three larval traits were significantly affected by fruit species and the effects of fruits on larval traits differed among tephritids. As expected, the polyphagous species Bactrocera zonata, Ceratitis catoirii, C. rosa, and C. capitata were able to survive on a larger range of fruits than the oligophagous species Zeugodacus cucurbitae, Dacus demmerezi, and Neoceratitis cyanescens. Pupal weight was positively correlated with larval survival and was negatively correlated with developmental time for polyphagous species. Canonical correspondence analysis of the relationship between fruit nutrient composition and tephritid survival showed that polyphagous species survived better than oligophagous ones in fruits containing higher concentrations of carbohydrate, fibre, and lipid. Nutrient composition of host fruit at least partly explains the suitability of host fruits for larvae. Completed with female preferences experiments these results will increase our understanding of factors affecting tephritid host range.

  19. Caribbean fruit fly, Anastrepha suspensa (Diptera:Tephritidae): Life history and laboratory rearing methods.

    USDA-ARS?s Scientific Manuscript database

    The Caribbean fruit fly, Anastrepha suspensa (Loew), is and agricultural pest established throughout south Florida, where it poses a threat to commercial citrus, guava, and other tropical and subtropical fruit crops. This poster outlines the protocols used at the USDA-ARS laboratory in Miami, FL, fo...

  20. Reaction orders for thermal mortality of third instars of Mexican fruit fly (Diptera: Tephritidae).

    PubMed

    Hallman, Guy J; Wang, Shaojin; Tang, Juming

    2005-12-01

    Mexican fruit fly, Anastrepha ludens (Loew), is a quarantine pest of several fruit, including citrus, avocados, and mangoes, from extreme southern Texas to Costa Rica. To provide information for modeling heat phytosanitary treatments, third instars were heated with an aluminum heating block between 44 and 50 degrees C for time intervals up to those causing 100% mortality. At 44 and 50 degrees C, 100% mortality was achieved at 100 and 2 min, respectively. Each 2 degrees C increase in temperature resulted in a three-fourths reduction in the amount of time required to achieve 100% mortality. Mortality was modeled using thermal death kinetics, and the most suitable reaction order was the 0.5th. The thermal death activation energy was 560.7 kJ/mol, which is very similar to the value found for Mediterranean fruit fly, Ceratitis capitata (Wiedemann), in a previous study, indicating similar modes of action for heat mortality. However, the Mexican fruit fly had a lower threshold for heat-induced mortality, resulting in less time at all temperatures studied to achieve 100% mortality compared with the Mediterranean fruit fly. This type of information being gathered for fruit flies could lead to the development of generic phytosanitary heat treatments, which are available for other major phytosanitary treatments, such as cold storage, methyl bromide fumigation, and ionizing irradiation.

  1. Fruit fly (Diptera: Tephritidae) host status determination: critical conceptual, methodological, and regulatory considerations.

    PubMed

    Aluja, Martín; Mangan, Robert L

    2008-01-01

    Although fruit fly host status determination/designation lies at the heart of strategic decisions on national and international trade of fruit and vegetables, all attempts thus far to define host plant status have been contentious and as a result long-standing disputes between commercial partners throughout the world have lingered over decades. Part of the problem is that too little effort has been devoted to understanding the underlying mechanisms involved in host plant use by fruit flies and that instead economic and political interests usually prevail. Here we review the most important evolutionary, biological, ecological, physiological, and behavioral aspects that drive host use by fruit flies, and then construct a flow diagram rooted in these fundamentals that outlines a series of steps and definitions to determine if a particular fruit or vegetable (and cultivars thereof) is a natural host, or a conditional (potential, artificial) host, or a nonhost. Along the way, we incorporate risk analysis considerations and propose that the underlying complexity determining host plant utilization by fruit flies requires a flexible systems approach capable of realistically dealing with fly/host/environment/geographic variability on a case-by-case basis.

  2. Host range and distribution of fruit-infesting pestiferous fruit flies (Diptera, Tephritidae) in selected areas of Central Tanzania.

    PubMed

    Mwatawala, M W; De Meyer, M; Makundi, R H; Maerere, A P

    2009-12-01

    The host range of major fruit fly pests in Central Tanzania was evaluated from October 2004 to October 2006. Samples of 48 potential hosts were collected and incubated for fruit fly emergence. Bactrocera invadens was the dominant species in incidence expressed as the ratio of infested to total number samples collected, as well as infestation rate, expressed as number of flies emerging per unit weight. Eight new host fruits are reported. Infestation by native pests, such as Ceratitis capitata and C. cosyra, was minor compared to B. invadens. Ceratitis rosa was the dominant species in temperate fruits, and Cucurbitaceae were mainly infested by Bactrocera cucurbitae, a specialized cucurbit feeder. Among commercial fruits, high infestation incidences were observed in mango and guava, but they decreased throughout the fruiting season. Low infestation rates were observed in all Citrus species and in avocado, indicating these fruits as poor hosts for the studied fruit fly pests in this region. Widespread availability and abundance of fruit species studied here ensures year-round breeding of B. invadens. Seasonal infestation differs, with mango being the most important host in October to January, while guava being important from February to August. Tropical almond showed very high incidence and infestation rate for B. invadens and might act as an important reservoir host, bridging the fruiting seasons of mango and guava. Soursop acts as an important host for C. cosyra after the mango season. Ceratitis capitata is a pest of minor importance of the commercial fruits studied in this region.

  3. Sterile insect technique and Mediterranean fruit fly (Diptera: Tephritidae): assessing the utility of aromatherapy in a Hawaiian coffee field.

    PubMed

    Shelly, Todd E; McInnis, Donald O; Rodd, Charles; Edu, James; Pahio, Elaine

    2007-04-01

    The sterile insect technique (SIT) is widely used in integrated programs against tephritid fruit fly pests, particularly the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Unfortunately, the mass-rearing procedures inherent to the SIT often lead to a reduction in the mating ability of the released males. One potential solution involves the prerelease exposure of males to particular attractants. In particular, exposure of male Mediterranean fruit flies to ginger, Zingiber officinale Roscoe, root oil (GRO) has been shown to increase mating success in laboratory and field cage trials. Here, we describe a field experiment that compares the level of egg sterility observed in two Hawaiian coffee, Coffea arabica L., plots, with GRO-exposed, sterile males released in one (treated) plot and nonexposed, sterile males released in the other (control) plot. Once per week in both plots over a 13-wk period, sterile males were released, trap captures were scored to estimate relative abundance of sterile and wild males, and coffee berries were collected and dissected in the laboratory to estimate the incidence of unhatched (sterile) eggs. Data on wild fly abundance and the natural rate of egg hatch also were collected in a remote area that received no sterile males. Despite that sterile:wild male ratios were significantly lower in the treated plot than in the control plot, the incidence of sterile eggs was significantly higher in the treated plot than in the control plot. Correspondingly, significantly higher values of Fried's competitiveness index (C) were found, on average, for treated than control sterile males. This study is the first to identify an association between the GRO "status" of sterile males and the incidence of egg sterility in the field and suggests that prerelease, GRO exposure may represent a simple and inexpensive means to increase the effectiveness of Mediterranean fruit fly SIT programs.

  4. Psyttalia cf. concolor (Hymenoptera: Braconidae) for biological control of olive fruit fly (Diptera: Tephritidae) in California.

    PubMed

    Yokoyama, Victoria Y; Rendón, Pedro A; Sivinski, John

    2008-06-01

    The larval parasitoid, Psyttalia cf. concolor (Szépligeti), reared on Mediterranean fruit fly, Ceratitis capitata (Weidemann), by the USDA-APHIS-PPQ, Guatemala City, Guatemala, was imported into California for biological control of olive fruit fly, Bactrocera oleae (Gmelin), in olives, Olea europaea L. Mean percentage parasitism of olive fruit fly third instars infesting fruit in field cages ranged from 7.0 in Grapevine to 59.7 in Santa Barbara and in free releases ranged from 0 in Grapevine to 10.6 in Santa Barbara after 4- to 6-d exposures. In the laboratory, more parasitoids developed to adults in olive fruit fly larvae that were 11-13 d old than in larvae 8-10 d old. Adult parasitoids lived significantly longer when provided with water than adults without water in environmental chambers at 5 degrees C, 85% RH; 15 degrees C, 65% RH; 25 degrees C, 25% RH; and 35 degrees C, 25% RH. Adult parasitoids lived for 48 d with honey for food and water and 32 d with food and sugar solution at 15 degrees C and 65% RH. Survival of adult parasitoids without food and water in greenhouse tests was approximately 4 d in a simulated coastal climate and 1 d in a simulated inland valley climate and was significantly increased by providing food and water. The parasitoid did not develop in the beneficial seedhead fly, Chaetorellia succinea (Costa), in yellow star thistle. The rate of parasitism of walnut husk fly, Rhagoletis completa Cresson, larvae in green walnut husks was 28.4% in laboratory no-choice tests. In choice tests, the rate of parasitism of walnut husk fly versus olive fruit fly larvae in olives was 11.5 and 24.2%, respectively.

  5. Genetic identification of an unknown Rhagoletis fruit fly (Diptera: Tephritidae) infesting Chinese crabapple: implications for apple pest management.

    PubMed

    St Jean, Gilbert; Egan, Scott P; Yee, Wee L; Feder, Jeffrey L

    2013-06-01

    The apple maggot, Rhagoletis pomonella (Walsh) (Diptera: Tephritidae), is a serious introduced quarantine pest in the apple (Malus spp.)-growing regions of central Washington and Oregon. In August 2011, seven fly larvae of unknown origin were discovered infesting fruit of an exotic Chinese crabapple, Malus spectabilis (Aiton) Borkhausen, in Kennewick, Benton County, WA. If confirmed, Chinese crabapple would have represented a new host for R. pomonella in Washington and triggered quarantine measures in a surrounding three-county region of the state. Here, we establish, based on five microsatellite loci, the identity of the crabapple-infesting larvae as the western cherry fruit fly, Rhagoletis indifferens Curran, representing a new host record for the fly. Morphological analysis of six flies reared to adulthood confirmed the genetic identification. The results demonstrate the utility of integrating rapid genetic identification methods with field surveys of economic pests, which decreased detection times by months, and avoided enacting costly quarantine measures that saved local and federal bodies > US$0.5 million in monitoring, inspection, and control costs. We discuss current ongoing efforts to develop rapid, accurate, and inexpensive on site DNA-based detection tools for R. pomonella that would have general applicability for the control of pest insects.

  6. Manipulation of the microbiota of mass-reared Mediterranean fruit flies Ceratitis capitata (Diptera: Tephritidae) improves sterile male sexual performance.

    PubMed

    Ben Ami, Eyal; Yuval, Boaz; Jurkevitch, Edouard

    2010-01-01

    The sterile insect technique (SIT) is a method of biological control whereby millions of factory reared sterile male insects are released into the field. This technique is commonly used to combat the Mediterranean fruit fly (Ceratitis capitata, Diptera: Tephritidae). Sterile medfly males are less competent in attracting and mating with wild females, a property commonly linked to the irradiation process responsible for the sterilization. As bacteria are important partners in the fly's life cycle, we used molecular analytical methods to study the community structure of the gut microbiota in irradiated male medflies. We find that the sterilizing irradiation procedure affects the gut bacterial community structure of the Mediterranean fruit fly. Although the Enterobacteriaceae family remains the dominant bacterial group present in the gut, the levels of Klebsiella species decreases significantly in the days after sterilization. In addition, we detected substantial differences in some bacterial species between the mass rearing strain Vienna 8 and the wild strain. Most notable among these are the increased levels of the potentially pathogenic species Pseudomonas in the industrial strain. Testing the hypothesis that regenerating the original microbiota community could result in enhanced competitiveness of the sterile flies, we found that the addition of the bacterial species Klebsiella oxytoca to the postirradiation diet enables colonization of these bacteria in the gut while resulting in decreased levels of the Pseudomonas sp. Feeding on diets containing bacteria significantly improved sterile male performance in copulatory tests. Further studies will determine the feasibility of bacterial amelioration in SIT operations.

  7. Effect of adult chill treatments on recovery, longevity and flight ability of Queensland fruit fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    PubMed

    Reynolds, O L; Orchard, B A

    2011-02-01

    Control of Queensland fruit fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae), populations or outbreaks may be achieved through the mass-rearing and inundative release of sterile B. tryoni. An alternative release method is to release chilled adult sterile fruit flies to decrease packaging and transport requirements and potentially improve release efficiencies. Two trials were conducted to determine the effect of chilling on the performance of two separate batches of adult B. tryoni, fed either a protein and sucrose diet or sucrose only diet. The first trial compared chill times of 0, 0.5, 2 and 4 h; the second trial compared chill times of 0, 2, 4, 8 and 24 h. Overall, there was little or no affect of chilling on the recovery, longevity and flight ability of B. tryoni chilled at 4°C. Recovery time can take up to 15 min for chilled adult flies. There was no effect of chill time on longevity although females generally had greater longevity on either diet compared with males. Propensity for flight was not adversely affected by chilling at the lower chill times in trial 1; however, in trial 2, adults fed on a protein and sucrose diet had a decreased tendency for flight as the chilling time increased. Fly body size did not affect recovery times although the smaller adult B. tryoni in trial 1 had significantly reduced longevity compared to the larger adults in trial 2. Implications of these findings for B. tryoni SIT are discussed.

  8. Genetic characterization of Bactrocera fruit flies (Diptera: Tephritidae) from Northeastern India based on DNA barcodes.

    PubMed

    Manger, Arpana; Behere, G T; Firake, D M; Sharma, Bhagawati; Deshmukh, N A; Firake, P D; Azad Thakur, N S; Ngachan, S V

    2017-07-31

    The Northeastern region of India, one of the mega biodiversity hot spots has enormous potential for the production of fruits and vegetables. Fruit flies of the genus Bactrocera Macquart are important pests of fruits and vegetables, and one of the limiting factors in successful production of these commodities. The relationship among some of the species is unclear due to their high molecular and morphological similarities. Moreover, due to the significant morphological resemblance between fruit fly species, reliable identification is very difficult task. We genetically characterized 10 fruit fly species of the genus Bactrocera by using standard DNA barcoding region of COI gene. The characterization and identification of eight species were straight forward. This study was unable to establish the molecular identity of Bactrocera sp. 2. Within the 547 bp region of partial COI gene, there were 157 variable sites of which 110 sites were parsimony informative, 153 were synonymous substitutions and 4 were non-synonymous substitutions. The estimate of genetic divergence among the ten species was in the range of 0-21.9% and the pairwise genetic distance of Bactrocera. (Bactrocera) dorsalis (Hendel) with B. (B.) carambolae was only 0.7%. Phylogenetic analysis formed separate clades for fruit and vegetable infesting fruit flies. B. (B.) aethriobasis Hardy, B. (B.) thailandica and B. (B.) tuberculata (Bezzi) have been reported for the first time from the Northeastern India. The information generated from this study would certainly have implications for pest management, taxonomy, quarantine and trade.

  9. Host susceptibility of citrus cultivars to Queensland fruit fly (Diptera: Tephritidae).

    PubMed

    Lloyd, A C; Hamacek, E L; Smith, D; Kopittke, R A; Gu, H

    2013-04-01

    Citrus crops are considered to be relatively poor hosts for Queensland fruit fly, Bactrocera tryoni (Froggatt), as for other tephritid species. Australian citrus growers and crop consultants have reported observable differences in susceptibility of different citrus cultivars under commercial growing conditions. In this study we conducted laboratory tests and field surveys to determine susceptibility to B. tryoni of six citrus cultivars [(Eureka lemon (Citrus limon (L.) Osbeck); Navel and Valencia oranges (C. sinensis (L.) Osbeck); and Imperial, Ellendale, and Murcott mandarins (C. reticulata Blanco). The host susceptibility of these citrus cultivars was quantified by a Host Susceptibility Index, which is defined as the number of adult flies produced per gram of fruit infested at a calculated rate of one egg per gram of fruit. The HSI was ranked as Murcott (0.083) > Imperial (0.052) > Navel (0.026) - Ellendale (0.020) > Valencia (0.008) > Eureka (yellow) (0.002) > Eureka (green) (0). Results of the laboratory study were in agreement with the level of field infestation in the four citrus cultivars (Eureka lemon, Imperial, Ellendale, and Murcott mandarins) that were surveyed from commercial orchards under baiting treatments against fruit flies in the Central Burnett district of Queensland. Field surveys of citrus hosts from the habitats not subject to fruit fly management showed that the numbers of fruit flies produced per gram of fruit were much lower, compared with the more susceptible noncitrus hosts, such as guava (Psidium guajava L.), cherry guava (P. littorale Raddi), mulberry (Morus nigra L.), loquat (Eriobotrya japonica (Thunb.) Lindl.), and pear (Pyrus communis L.). Therefore, the major citrus crops commercially cultivated in Australia have a relatively low susceptibility to B. tryoni, with Eureka lemons being a particularly poor host for this tephritid fruit fly.

  10. Estimation of populations and sterility induction in Anastrepha luden (Diptera: Tephritidae) fruit flies.

    PubMed

    Flores, Salvador; Montoya, Pablo; Toledo, Jorge; Enkerlin, Walther; Liedo, Pablo

    2014-08-01

    The relationship between different release densities of sterile flies and fly trap captures, expressed as flies per trap per day, in the monitoring of Anastrepha ludens (Loew) populations was evaluated in mango orchards. The induction of sterility in fertile females was evaluated using different ratios of sterile: fertile males under field cage conditions. A direct relationship between recaptured flies and densities of release sterile flies was found. However, trap efficiency, expressed as percentage of recaptured flies, decreased as the density of released flies increased. Sterility induction was positively correlated to the ratio of sterile: fertile flies. A significant difference in egg fertility among treatments was observed. The trajectory of sterility induction slowed down after a sterile: wild ratio of 30:1, which suggests that this ratio could be appropriate in an sterile insect technique program with A. ludens. Sterility induction was greater when only sterile males were released than when releasing both sterile males and females, but the differences were not significant. Our findings contribute to a better interpretation of fly captures obtained from the field trapping networks, and to an improvement in the efficiency of sterile insect technique against A. ludens fruit flies, through the implementation of more rational sterile fly release densities.

  11. Overwintering survival of olive fruit fly (Diptera: Tephritidae) and two introduced parasitoids in California.

    PubMed

    Wang, Xin-Geng; Levy, Karmit; Nadel, Hannah; Johnson, Marshall W; Blanchet, Arnaud; Argov, Yael; Pickett, Charles H; Daane, Kent M

    2013-06-01

    The overwintering survival and development of olive fruit fly, Bactrocera oleae (Rossi), and the endoparasitoids, Psyttalia humilis Silvestri and P. lounsburyi (Silvestri), were investigated at sites in California's interior valley and coastal region. In the interior valley, adult flies survived up to 4-6 mo during the winter when food was provided. Adult female flies could oviposit in late fall and early winter on nonharvested fruit and, although egg survival was low (0.23-8.50%), a portion of the overwintered cohort developed into adults the following spring; percentage of survival was negatively correlated to daily minimum temperature. P. humilis and P. lounsburyi successfully oviposited into host larvae in late fall, and their progeny developed into adults the following spring, although with a low percentage (0-11.9%) survivorship. Overwintering survival of puparia of the olive fruit fly and immature larvae of P. humilis and P. lounsburyi (inside host puparia), buried in the soil, were tested at an interior valley and coastal site. Survival of olive fruit fly ranged from 0 to 60% and was affected by the trial date and soil moisture. Overwintering survival of both the fruit fly and tested parasitoids was lower at the colder interior valley than the coastal site; P. humilis immature stages had the highest mortality levels while B. oleae pupae had the lowest mortality levels. The spring emergence pattern of the tested insects was well predicted by a degree-day model. We discuss factors potentially impeding establishment of introduced olive fruit fly parasitoids in California and elsewhere.

  12. Temperature-Mediated Kill and Oviposition of Western Cherry Fruit Fly (Diptera: Tephritidae) in the Presence of Spinosad.

    PubMed

    Yee, Wee L

    2016-02-01

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a quarantine pest of sweet cherry (Prunus avium (L.) L.) that is managed using insecticides, including spinosad, an organic compound that can be applied in low spray volumes. Identifying factors that can increase the efficacy of spinosad can be useful for improving fly control. Here, the major objective was to determine if temperature mediates kill and oviposition of R. indifferens in the presence of low spinosad coverage in the laboratory. Experiments were conducted by placing flies in cages with cherries and with a Petri dish containing 3-12 small spots of dry spinosad at 18.3, 23.9, and 29.4°C. Effects of spinosad rates were also determined. More flies were killed at 23.9 and 29.4°C than at 18.3°C by 1-7 d post exposure. More flies were killed at 29.4 than 23.9°C by 1 d post exposure. However, flies laid more eggs at these temperatures than at 18.3°C. Higher spinosad rates increased kill and decreased oviposition, but even within the highest rate, oviposition was greater at 29.4 than 18.3°C. More flies walked over 5-min observation periods at 29.4 and 23.9°C than 18.3°C, suggesting higher temperatures up to 29.4°C increase kill by increasing fly contact with spinosad as well as increase oviposition rate. Results suggest that spinosad rates in sprays used against R. indifferens should be greater at higher than lower ambient temperatures.

  13. Hosts and parasitoids of fruit flies (Diptera: Tephritoidea) in the State of Tocantins, Brazil.

    PubMed

    Bomfim, Darcy A; Uchôa-Fernandes, Manoel A; Bragança, Marcos A L

    2007-01-01

    Fruit flies were obtained from 13 species of naturally infested fruits in the central region of Tocantins State, from January to October 2005. A total of 1,753 female flies were collected that belong to 11 species: Anastrepha coronilli Carrejo & González, A. fraterculus (Wied.), A. mucronota Stone, A. obliqua (Macquart), A. sororcula Zucchi, A. striata Schiner, A. turpiniae Stone, A. zenildae Zucchi, Anastrepha sp., Ceratitis capitata (Wied.) and Neosilba sp. Also six species of parasitoids were associated to Anastrepha larvae: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szépligeti), Doryctobracon sp., Opius bellus Gahan, Opius sp. and Utetes anastrephae (Viereck).

  14. The effect of irradiation and mass rearing on the anti-predator behaviour of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    PubMed

    Rao, D; Aguilar-Argüello, S; Montoya, P; Díaz-Fleischer, F

    2014-04-01

    Fruit flies (Diptera: Tephritidae) are major pests worldwide. The sterile insect technique, where millions of flies are reared, sterilized by irradiation and then released, is one of the most successful and ecologically friendly methods of controlling populations of these pests. The mating behaviour of irradiated and non-irradiated flies has been compared in earlier studies, but there has been little attention paid to the anti-predator behaviour of mass-reared flies, especially with respect to wild flies. Tephritid flies perform a supination display to their jumping spider predators in order to deter attacks. In this study, we evaluated the possibility of using this display to determine the anti-predator capabilities of mass-reared irradiated, non-irradiated flies, and wild flies. We used an arena setup and observed bouts between jumping spiders (Phidippus audax Hentz) and male Mexican fruit flies (Anastrepha ludens Loew). We show that although all flies performed a supination display to their predator, wild flies were more likely to perform a display and were significantly more successful in avoiding attack than mass-reared flies. We suggest that this interaction can be used to develop a rapid realistic method of quality control in evaluating anti-predator abilities of mass-reared fruit flies.

  15. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  16. Antennal and behavioral responses to putrescine and ammonium bicarbonate in the Caribbean fruit fly (Diptera: tephritidae)

    USDA-ARS?s Scientific Manuscript database

    A current trapping system for Anastrepha fruit flies uses a 2-component lure that emits ammonia and putrescine, both regarded as protein cues. This study used electroantennography and flight tunnel bioassays to quantify olfactory and behavioral responses of A. suspensa to vapors from ammonium bicar...

  17. Irradiation of mangoes as a postharvest quarantine treatment for fruit flies (Diptera: Tephritidae).

    PubMed

    Bustos, María E; Enkerlin, Walther; Reyes, Jesús; Toledo, Jorge

    2004-04-01

    Mangoes infested with third instar larvae were irradiated using Co-60 gamma rays and a dose interval of 2-250 Gy to assess the irradiation dose required to prevent adult emergence of the Mexican fruit fly (Anastrepha ludens), the West Indies fruit fly (A. obliqua), the sapote fruit fly (A. serpentina), and the Mediterranean fruit fly (Ceratitis capitata). Doses of 76.9, 87.3, 91.4 and 112.7 Gy, were estimated to inhibit 99.9968% (probit 9) of adult emergence forA. obliqua, A. serpentina, A. ludens, and C. capitata, respectively. Using mangoes infested with a total of 100,000 larvae of each species, the results obtained in the laboratory were confirmed using a dose of 100 Gy for the Anastrepha species and 150 Gy for C. capitata. No adult emergence was observed for any of the four species compared with approximately 80% emergence in the controls. A dose of 150 Gy is recommended as a generic quarantine treatment against potential infestation of these species in exported mangoes. A minor decrease in the ascorbic acid content was the only adverse effects observed in irradiated mangoes.

  18. Artificial rearing of the peach fruit fly Bactrocera zonata (Diptera:Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Integration of the sterile insect technique (SIT) into the area-wide management of the peach fruit fly Bactrocera zonata (Saunders) is a promising althernative to the localized use of chemical control tactics. Implementation of the SIT requires adequate numbers of sterile male insects that are produ...

  19. Attraction and electroantennographic responses of male mediterranean fruit fly (diptera: tephritidae) to six plant essential oils

    USDA-ARS?s Scientific Manuscript database

    Volatile secondary metabolites emitted from plants (and concentrated in plant essential oils) are suspected to attract males of the Mediterranean fruit fly to their calling sites. We investigated the differential attractiveness of various natural essential oils in comparison with trimedlure to (1) s...

  20. Ovary development in two genetic strains of Caribbean fruit fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Olfactory reception and behavioral responses to semiochemicals are influenced by an insect's physiological state, including sexual maturity. For tephritid fruit flies, reliable methods are needed for assessing maturity status of field-caught adults. Previously, we developed a six-stage system to cla...

  1. Mobility of olive fruit fly (Diptera: Tephritidae) late third instars and teneral adults in test arenas

    USDA-ARS?s Scientific Manuscript database

    The mobility of olive fruit fly, Bactrocera oleae (Rossi), late third instars before pupation, teneral adults before flight, and mature adults restricted from flight was studied under mulches in greenhouse cage tests, in horizontal pipes, vertical bottles and pipes filled with sand, and by observati...

  2. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique.

    PubMed

    Hernández, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo

    2010-01-01

    We evaluated three packing systems (PARC boxes, "GT" screen towers and "MX" screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fly densities (1, 1.2 and 1.3 fly/cm²) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb® and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb® and SPCP food types, and for females with Mb® powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fly sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fly species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs.

  3. Evading plant defence: Infestation of poisonous milkweed fruits (Asclepiadaceae) by the fruit fly Dacus siliqualactis (Diptera: Tephritidae).

    PubMed

    Schneider, Michael; Wunder, Cora; Reuss, Esther; Toennes, Stefan W; Mebs, Dietrich

    2017-09-21

    To cope with toxic metabolites plants use for defence, herbivorous insects employ various adaptive strategies. For oviposition, the fruit fly Dacus siliqualactis (Tephritidae) uses milkweed plants of the genus Gomphocarpus (Asclepiadaceae) by circumventing the plant's physical (gluey latex) and chemical (toxic cadenolides) defence. With its long, telescope-like ovipositor, the fly penetrates the exo- and endocarp of the fruit and places the eggs on the unripe seeds located in the centre of the fruit. Whereas most plant parts contain high concentrations of cardenolides such as gomphoside, calotropin/calacatin and gomphogenin, only the seeds exhibit low cardenolide levels. By surmounting physical barriers (fruit membranes, latex), the fly secures a safe environment and a latex-free food source of low toxicity for the developing larvae. One amino acid substitution (Q111V) at the cardenolide binding site of the fly's Na(+), K(+)-ATPase was detected, but the significance of that substitution: reducing cardenolide sensitivity or not, is unclear. However, poisoning of the larvae by low levels of cardenolides is assumed to be prevented by non-resorption and excretion of the polar cardenolides, which cannot passively permeate the midgut membrane. This example of an insect-plant interaction demonstrates that by morphological and behavioural adaptation, a fruit fly manages to overcome even highly effective defence mechanisms of its host plant. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Reduction of Optimal Thermal Range in Aging Western Cherry Fruit Flies (Diptera: Tephritidae)

    PubMed Central

    Neven, Lisa G.

    2015-01-01

    The western cherry fruit fly is an economically important pest of sweet cherries in the western United States. The potential of this pest to establish and spread in areas in which it is not currently present has been the focus of recent research. Most published information on the thermal tolerance and optimal thermal range of this pest has focused primarily on the diapausing pupae and predictive phenology models. Microrespirometry and differential calorimetry can be useful tools in describing the thermotolerance and optimal thermal range of insects. This methodology was employed to investigate the effects of western cherry fruit fly adult age on the optimal thermal range. Newly emerged flies exhibited the widest optimal thermal range spanning from 6.6 to 42.2°C for a total range of 35.8°C during heating scans of 0.4°C/min from 2 to 50°C. This range diminished as the flies aged, with the shortest span observed with 28-d-old flies ranging from 10.5 to 37.8°C, a span of 27.2°C. Measurements of heat rate and oxygen consumption at isothermal, or static, temperatures indicated that all flies could survive exposure to 40°C for at least 20 min, and that metabolism was greatly reduced, with a concomitant reduction in oxygen consumption rate at 40 to 42°C. All flies exhibited a heat rate and oxygen consumption rate of zero when exposed to 45 and 50°C. The loss of thermotolerance in adult flies can influence its ability to establish and spread in climates where daily temperatures exceed the optimal thermal range of this species. PMID:26106089

  5. Reduction of Optimal Thermal Range in Aging Western Cherry Fruit Flies (Diptera: Tephritidae).

    PubMed

    Neven, Lisa G

    2015-01-01

    The western cherry fruit fly is an economically important pest of sweet cherries in the western United States. The potential of this pest to establish and spread in areas in which it is not currently present has been the focus of recent research. Most published information on the thermal tolerance and optimal thermal range of this pest has focused primarily on the diapausing pupae and predictive phenology models. Microrespirometry and differential calorimetry can be useful tools in describing the thermotolerance and optimal thermal range of insects. This methodology was employed to investigate the effects of western cherry fruit fly adult age on the optimal thermal range. Newly emerged flies exhibited the widest optimal thermal range spanning from 6.6 to 42.2°C for a total range of 35.8°C during heating scans of 0.4°C/min from 2 to 50°C. This range diminished as the flies aged, with the shortest span observed with 28-d-old flies ranging from 10.5 to 37.8°C, a span of 27.2°C. Measurements of heat rate and oxygen consumption at isothermal, or static, temperatures indicated that all flies could survive exposure to 40°C for at least 20 min, and that metabolism was greatly reduced, with a concomitant reduction in oxygen consumption rate at 40 to 42°C. All flies exhibited a heat rate and oxygen consumption rate of zero when exposed to 45 and 50°C. The loss of thermotolerance in adult flies can influence its ability to establish and spread in climates where daily temperatures exceed the optimal thermal range of this species. Published by Oxford University Press on behalf of the Entomological Society of America 2015. This work is written by a US Government employee and is in the public domain in the US.

  6. Response of Olive Fruit Fly (Diptera: Tephritidae) to an Attract-and-Kill Trap in Greenhouse Cage Tests

    PubMed Central

    Yokoyama, Victoria Y.

    2014-01-01

    Abstract A novel attract-and-kill trap for olive fruit fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae), was constructed with yellow corrugated plastic in an inverted cylindrical pan shape formed from a disk and collar. The trap components were tested under three greenhouse temperatures and humidities of warm, hot, and very hot for attractiveness to caged young or older adults. A greater proportion of adults regardless of age were found underneath the devices including disks, cylindrical pans, and pans with pheromone lures and test units of cylindrical pans sprayed with water, insecticidal bait spray, and with lures. The effect was related to lower temperatures on the underside compared with the top and the intolerance of the pest to heat. A circular collar added to the perimeter of the disk that formed the top of the inverted cylinder made the attract-and-kill trap more attractive to adults than the disk alone. Pheromone lures or bait sprays did not increase adult attraction, so were not needed for efficacy. The cylindrical pan was especially attractive to adults when temperatures were high by providing shelter from the heat. At very high temperatures, the pan became unattractive, possibly due to heating of the construction materials. Cylindrical pans sprayed with water on the underside attracted the highest number of adults especially at high temperatures. Greenhouse tests showed that the inverted cylindrical pan design has potential as an attract-and-kill device for olive fruit fly control. PMID:25368094

  7. Impact of Prolonged Absence of Low Temperature on Adult Eclosion Patterns of Western Cherry Fruit Fly (Diptera: Tephritidae).

    PubMed

    Neven, Lisa G; Yee, Wee L

    2017-03-25

    Western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the United States. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in tropical export markets because cold temperatures, below 5 °C, in those regions appear insufficient to complete diapause. However, it is unclear how prolonged absence of cold exposure affects diapause termination in R. indifferens. Here, we examined this question by exposing R. indifferens pupae for 40 wk to simulated temperate and tropical conditions of 23 or 26 °C, 40 or 80% RH, and a photoperiod of 16:8 or 12:12 (L:D) h. Eclosion patterns among fly groups in the four conditions did not differ. For all groups, fly eclosion from pupae not exposed to cold exhibited a bimodal distribution. The first major peak, comprising 3.2% of the total fly emergence, occurred at 1-10 wk. The second major peak, comprising the remaining 96.8%, occurred at a mode of ∼30 wk. Based on responses to no cold and cold (3 ± 1.5 °C) exposures, there were three distinct pupal diapause groups: the first eclosion group was likely nondiapausing pupae; the second eclosion group was likely diapausing pupae; a third group that remained viable but did not produce adults after 40 wk may represent prolonged dormancy pupae. We suggest that eclosion of adults after prolonged absence of cold exposure needs to be incorporated into models for potential fly establishment in warm climates.

  8. Rearing Fopius arisanus (Sonan) (Hymenoptera:Braconidae) on Mediterranean fruit fly and its introduction into Senegal against Oriental fruit fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Oriental fruit fly, Bactrocera dorsalis(Hendel)(aka B.invadens Drew, Tsuruta, and White) was first reported in Africa in 2003 and has since spread to over 27 countries. It has become a serious tree fruit pest, particularly in mango (Mangifera indica L.). Because of uncertainty as to the exact status...

  9. Pupal development and pigmentation process of a polka-dotted fruit fly, Drosophila guttifera (Insecta, Diptera).

    PubMed

    Fukutomi, Yuichi; Matsumoto, Keiji; Agata, Kiyokazu; Funayama, Noriko; Koshikawa, Shigeyuki

    2017-06-01

    Various organisms have color patterns on their body surfaces, and these color patterns are thought to contribute to physiological regulation, communication with conspecifics, and signaling with the environment. An adult fly of Drosophila guttifera (Insecta: Diptera: Drosophilidae) has melanin pigmentation patterns on its body and wings. Though D. guttifera has been used for research into color pattern formation, how its pupal development proceeds and when the pigmentation starts have not been well studied. In this study, we defined the pupal stages of D. guttifera and measured the pigment content of wing spots from the pupal period to the period after eclosion. Using a transgenic line which carries eGFP connected with an enhancer of yellow, a gene necessary for melanin synthesis, we analyzed the timing at which the yellow enhancer starts to drive eGFP. We also analyzed the distribution of Yellow-producing cells, as indicated by the expression of eGFP during pupal and young adult periods. The results suggested that Yellow-producing cells were removed from wings within 3 h after eclosion, and wing pigmentation continued without epithelial cells. Furthermore, the results of vein cutting experiments showed that the transport of melanin precursors through veins was necessary for wing pigmentation. These results showed the importance of melanin precursors transported through veins and of extracellular factors which were secreted from epithelial cells and left in the cuticle.

  10. Molecular cloning and expression of nanos in the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Ogaugwu, Christian E; Wimmer, Ernst A

    2013-01-01

    The gene nanos (nos) is a maternal-effect gene that plays an important role in posterior patterning and germ cell development in early stage embryos. nos is known from several diverse insect species, but has so far not been described for any Tephritid fruit fly. Here, we report the molecular cloning and expression pattern of the nos orthologous gene, Ccnos, in the Mediterranean fruit fly Ceratitis capitata, which is a destructive pest of high agricultural importance. CcNOS contains 398 amino acids and has a C-terminal region with two conserved CCHC zinc-binding motifs known to be essential for NOS function. Transcripts of Ccnos were confirmed by in situ hybridization to be maternally-derived and localized to the posterior pole of early stage embryos. Regulatory regions of nos have been employed in genetic engineering in some dipterans such as Drosophila and mosquitoes. Given the similarity in spatial and temporal expression between Ccnos and nos orthologs from other dipterans, its regulatory regions will be valuable to generate additional genetic tools that can be applied for engineering purposes to improve the fight against this devastating pest.

  11. Influence of irradiation on development of Caribbean fruit fly (diptera: tephritidae) larvae

    SciTech Connect

    Nation, J.L.; Milne, K.; Dykstra, T.M.

    1995-05-01

    Larvae of the Caribbean fruit fly, Anastrepha suspensa (Loew), were irradiated at hatching with 0, 5, 10, 20, 50, 75, 100 and 150 Gy doses from a Cesium-137 source and dissected for measurements of the supraesophageal ganglion (brain) and proventriculus (B/Prv) as mature third instars. Cross-sectional area of a plane through the brain and proventriculus, and simple dorsal width measurements of the two organs were evaluated as indicators of radiation exposure. Brain area, brain width, and brain/proventriculus (B/Prv) ratios were significantly different from controls in insects treated with a dose {ge}20 Gy. Detailed dissections of hatching larvae exposed to 50 Gy revealed reductions in brain growth, small and misshapen compound eye and leg imaginal disks, and a ventral nerve cord that was elongated and sinuous. Larvae irradiated on the 1st d of each of the three instars had smaller brains, with the percentage of reduction in brain size being greater the younger the larvae were at the time of exposure. Brain and proventriculus measurements and calculated B/Prv values are indicative of irradiation in Caribbean fruit fly larvae, but the procedure may not be adaptable for routine use by quarantine inspectors. 14 refs., 4 figs., 2 tabs.

  12. Comparison of Hydrolyzed Protein Baits and Various Grape Juice Products as Attractants for Anastrepha Fruit Flies (Diptera: Tephritidae).

    PubMed

    Herrera, F; Miranda, E; Gómez, E; Presa-Parra, E; Lasa, R

    2016-02-01

    Mexican fruit flies, Anastrepha ludens (Loew; Diptera: Tephritidae), have traditionally been trapped in citrus orchards in Mexico using protein hydrolysates as bait. Recently, CeraTrap(®), an enzymatic hydrolyzed protein, has emerged as an effective lure for monitoring A. ludens at the orchard level and is currently being used by growers in the region of Veracruz. Several studies have revealed that grape juice is highly attractive to A. ludens, and recent work supports its potential use for regulation purposes. In our study, the attraction of A. ludens to different grape products was evaluated in citrus orchards and in comparison to other Anastrepha species in an area composed of mango and chicozapote orchards. Attraction to grape lures was compared with CeraTrap and the standard protein Captor +borax trap. In general, CeraTrap was more attractive than different commercial grape products in several experiments. Only Jumex, a commercial grape juice, did not differ significantly from CeraTrap in the capture of A. ludens males and females in a citrus crop. However, several drawbacks were detected when using Jumex grape juice: 1) higher tendency to capture males, 2) less selectivity against non-targeted insects, 3) higher capture of beneficial lacewings, and iv) the need to re-bait weekly owing to lower stability. In the area containing mango and chicozapote, CeraTrap was more attractive than Captor + borax for Anastrepha obliqua and Anastrepha serpentina, followed by grape juice products, which were the least attractive for these fruit fly species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae).

    PubMed

    Heath, Robert R; Vazquez, Aime; Schnell, Elena Q; Villareal, Janett; Kendra, Paul E; Epsky, Nancy D

    2009-12-01

    Several species of Anastrepha and Bactrocera fruit flies (Diptera: Tephritidae) are captured in traps baited with the protein bait NuLure combined with borax (sodium tetraborate decahydrate) in an aqueous solution, typically 9% NuLure (vol:vol) with 3% borax (wt:vol). NuLure is an acid hydrolysate of corn and has an acidic pH. Addition of borax makes the solution more alkaline, and increase in alkalinity results in increase of ammonia release from the bait solution. This is a very dynamic system, with resultant pH affected by factors such as the amount of borax added, the pH of the water used for preparation, the age of the bait solution, and the development of microbial growth. Problems with borax include amount needed to increase alkalinity of NuLure solutions, which creates difficulties in disposing of spent bait in fruit fly trapping programs. Therefore, research was conducted to evaluate NaOH as an alternative method to increase alkalinity of NuLure solutions. Laboratory experiments compared effect of NaOH versus borax for pH modification on changes in pH and ammonia content of NuLure solutions over time. Although NuLure/NaOH solutions could be adjusted to a more alkaline pH than NuLure/borax solutions, borax plays a critical role in pH stability over time. However, the pH of NuLure/NaOH is stabilized when propylene glycol (10% vol:vol) was used to prepare the bait solution. The use of NaOH can provide an alternative to the use of borax to increase bait solution alkalinity.

  14. Economic and Highly Effective Trap-Lure Combination to Monitor the Mexican Fruit Fly (Diptera: Tephritidae) at the Orchard Level.

    PubMed

    Lasa, R; Herrera, F; Miranda, E; Gómez, E; Antonio, S; Aluja, M

    2015-08-01

    Monitoring population levels of the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), at the orchard level prior and during the fruit ripening period can result in significant savings in the costs of managing this pestiferous insect. Unfortunately, to date, no highly effective and economically viable trap is available to growers. To move toward this goal, trap-lure combinations were evaluated in trials performed in citrus orchards in Veracruz, Mexico. CeraTrap, an enzymatic hydrolyzed protein from pig intestinal mucose, was 3.6 times more attractive to A. ludens than the most commonly used bait of Captor (hydrolyzed protein and borax) when using Multilure traps. When several commercial traps were evaluated, the efficacy of a simple and inexpensive transparent polyethylene (PET) bottle with 10-mm lateral holes was similar to that of the costly Multilure trap when baited with CeraTrap and significantly more effective than a Multilure trap baited with Captor. PET bottles filled with Cera Trap, rebaited at 8-wk intervals, and tested in trials encompassing 72 ha of citrus groves, were significantly more effective than Multilure traps baited with Captor that need to be serviced weekly. In addition to this relevant finding, CeraTrap baited traps detected A. ludens at lower population densities and attracted a significantly higher number of flies at all densities when compared with Captor-baited traps. We conclude that CeraTrap represents a cost-effective and highly efficient bait that will enable us to pursue the goal of developing economic thresholds, a badly needed management tool for A. ludens. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Novel Bait Stations for Attract-and-Kill of Pestiferous Fruit Flies

    USDA-ARS?s Scientific Manuscript database

    A novel, visually attractive bait station was developed in Hawaii for application of insecticidal baits against oriental fruit fly, Bactrocera dorsalis (Hendel), melon fly, Bactrocera cucurbitae (Coquillett), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). The bai...

  16. Comparison of torula yeast and various grape juice products as attractants for Mexican fruit fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Early research during the 1930’s focused on attractants for the Mexican fruit fly indicated that fermentation products were effective attractants for Mexican fruit flies and other tropical Tephritidae, but that attraction to fruit components was only of academic interest. Tests reported here were ca...

  17. Quarantine security of bananas at harvest maturity against Mediterranean and Oriental fruit flies (Diptera: Tephritidae) in Hawaii.

    PubMed

    Armstrong, J W

    2001-02-01

    Culled bananas (dwarf 'Brazilian', 'Grand Nain', 'Valery', and 'Williams') sampled from packing houses on the islands of Hawaii, Kauai, Maui, Molokai, and Oahu identified specific "faults" that were at risk from oriental fruit fly, Bactrocera dorsalis (Hendel), infestation. Faults at risk included bunches with precociously ripened bananas, or bananas with tip rot, fused fingers, or damage that compromised skin integrity to permit fruit fly oviposition into fruit flesh. No Mediterranean fruit fly, Ceratitis capitata (Wiedemann), or melon fly, B. cucurbitae (Coquillett), infestations were found in culled banana samples. Field infestation tests indicated that mature green bananas were not susceptible to fruit fly infestation for up to 1 wk past the scheduled harvest date when attached to the plant or within 24 h after harvest. Recommendations for exporting mature green bananas from Hawaii without risk of fruit fly infestation are provided. The research reported herein resulted in a USDA-APHIS protocol for exporting mature green bananas from Hawaii.

  18. Quality management systems for fruit fly (Diptera: Tephritidae) sterile insect technique

    SciTech Connect

    Caceres, C.; Robinson, A.; Shelly, T.; Hendrichs, J.

    2007-03-15

    The papers presented in this issue are focused on developing and validating procedures to improve the overall quality of sterile fruit flies for use in area-wide integrated pest management (AW-IPM) programs with a sterile insect technique (SIT) component. The group was coordinated and partially funded by the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Vienna, Austria, under a five-year Coordinated Research Project (CRP) on 'Quality Assurance in Mass-Reared and Released Fruit Flies for Use in SIT Programmes'. Participants in the CRP from 16 countries came from both basic and applied fields of expertise to ensure that appropriate and relevant procedures were developed. A variety of studies was undertaken to develop protocols to assess strain compatibility and to improve colonization procedures and strain management. Specific studies addressed issues related to insect nutrition, irradiation protocols, field dispersal and survival, field cage behavior assessments, and enhancement of mating competitiveness. The main objective was to increase the efficiency of operational fruit fly programs using sterile insects and to reduce their cost. Many of the protocols developed or improved during the CRP will be incorporated into the international quality control manual for sterile tephritid fruit flies, standardizing key components of the production, sterilization, shipment, handling, and release of sterile insects. (author) [Spanish] Los articulos presentados en este numero se enfocan en el desarrollo y la validacion de procedimientos para mejorar la calidad total de moscas de las frutas esteriles para su uso en programas de manejo integrado de plagas en donde la tecnica del insecto esteril (TIE) es uno de los componentes clave. El grupo fue coordinado y parcialmente financiado por la Division Conjunta de Tecnicas Nucleares para la Alimentacion y la Agricultura de la FAO/OIEA, Viena, Austria, por un periodo de

  19. Potential increase in fruit fly (Diptera: Tephritidae) interceptions using ionizing irradiation phytosanitary treatments.

    PubMed

    Hallman, Guy J

    2008-06-01

    Irradiation postharvest phytosanitary treatments are used increasingly and show further promise because of advantages compared with other treatments. Its chief disadvantage is that, unlike all other commercially used treatments, it does not provide acute mortality, although it prevents insects from completing development or reproducing. The objective of this research was to determine to what extent irradiated egg and early instars of tephritids would develop to later instars that could be found by phytosanitary inspectors or consumers. Mexican fruit fly, Anastrepha ludens (Loew), eggs and first instars in grapefruit, Citrus paradisi Macfayden, were irradiated with 70-250 Gy and held at approximately equal to 27 degrees C until third instars completed development. The accepted minimum absorbed phytosanitary dose for this pest is 70 Gy, although higher doses may be applied under commercial conditions. The more developed a fruit fly before it was irradiated, the greater the proportion that survived to the third instar. Also, dose was inversely related to developmental success, e.g., a mean of approximately 65 and 35%, respectively, of late first instars reached the third instar when irradiated with 70 and 250 Gy. Of those, 65.1 and 23.4%, respectively, pupariated, although no adults emerged. Irradiation may result in a greater frequency of live (albeit incapable of resulting in an infestation) larvae being found than would be expected compared with other treatments that provide acute mortality. The regulatory community should be aware of this and the fact that it does not increase the risk of irradiation phytosanitary treatments resulting in an infestation of quarantine pests.

  20. Controlled-release panel traps for the Mediterranean fruit fly (Diptera: Tephritidae).

    PubMed

    Leonhardt, B A; Cunningham, R T; Chambers, D L; Avery, J W; Harte, E M

    1994-10-01

    Solid, controlled-release dispensers containing 2 g of the synthetic attractant trimedlure now are used in Jackson traps to detect the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). Panel traps consisting of trimedlure mixed in a sticky substance and spread on the surfaces of a plastic panel are used to delineate the limits of discovered insect infestations in California. We describe the development of controlled-release, polymeric panels that prolong release of trimedlure and a highly attractive analog, ceralure. Attractants were incorporated in a polyethylene matrix to form panels and in a polymer coating on cardboard panels that then were evaluated by biological and chemical assay. In addition, commercial polymer matrix panels were evaluated. Field bioassay tests conducted in Hilo, HI, using released flies and in Guatemala in a natural population showed that the polyethylene matrix panel became brittle and cracked during field exposure and that release rates of the attractants were relatively low. The coated cardboard panels were stable under field conditions and yielded high fly captures for up to 6 wk. Farma Tech commercial panels containing 12.3 and 23.4 g of trimedlure remained highly attractive throughout a 134-d test in Hawaii and appear to be a long-lasting alternative to panels coated with trimedlure in Stikem. The cost of the relatively high dose of trimedlure is offset by the prolonged active life of the panel. Commercial panels from AgriSense (10 g trimedlure and 10 g ceralure) released the attractants at a slower rate and were less attractive.

  1. Evidence for potential of managing some African fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone.

    PubMed

    Kachigamba, Donald L; Ekesi, Sunday; Ndungu, Mary W; Gitonga, Linus M; Teal, Peter E A; Torto, Baldwyn

    2012-12-01

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aqueous solutions. The objective of the study was to get insight into the potential of managing these pests using the host-marking technique. Observations were done on mango slices marked by the flies and treated with aqueous solutions of fecal matter of the flies, respectively. In both host-marking and fecal matter experiments, C. cosyra, which is the most destructive species of the four on mango, was exceptional. It only discriminated against hosts treated with its fecal matter but with lower sensitivity while C. capitata and C.fasciventris discriminated against hosts marked by it or treated with its fecal matter and with higher sensitivity. Our results provide evidence for potential of managing some of the major fruit fly species infesting mango in Africa using the host-marking pheromone of the mango fruit fly, C. cosyra.

  2. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    USDA-ARS?s Scientific Manuscript database

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  3. Threshold Concentration of Limonoids (Azamax) for Preventing Infestation by Mediterranean Fruit Fly (Diptera: Tephritidae).

    PubMed

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Forim, M R; Sá, I C G

    2015-04-01

    This study identified the threshold concentration of limonoids for the complete inhibition of oviposition of Ceratitis capitata (Wiedemann) in grapes 'Itália.' Choice and no-choice experiments with the insect were performed. The three no-choice bioassays were conducted following a completely randomized design with 18 treatments (three densities of insects [one, two, or three females]×five concentrations of limonoids and control) and 20 replicates. In a free choice bioassay, two fruits per cage (a treatment grape and a control) were provided for ovipositing. Three densities of insects (one, two, or three females) were used, with 15 replicates. Bioassays were conducted at 25±2°C, 60±10% relative humidity, and a photoperiod of 14:10 (L:D) h. The inhibition of oviposition of C. capitata was concentration dependent, with infestation occurring at lower concentrations of azadirachtin (+3-tigloylazadirachtol) and complete inhibition occurring at concentrations at or exceeding 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol), maintaining protective effects even at the most densely populated treatment (three females per fruit). When the pest had a free choice of host grapes (treatment vs. control), severe inhibition was observed at concentrations≥50 ppm azadirachtin (+14.3 ppm of 3-tigloylazadirachtol). We conclude that a threshold concentration of 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol) is capable of preventing grape infestation. This concentration is likely to provide a reliable level of protection, as the experimental population density of three females per fruit usually does not occur in the field and wild flies usually have more host options.

  4. Impact of introduction of Bactrocera dorsalis (Diptera: Tephritidae) and classical biological control releases of Fopius arisanus (Hymenoptera: Braconidae) on economically important fruit flies in French Polynesia.

    PubMed

    Vargas, Roger I; Leblanc, Luc; Putoa, Rudolph; Eitam, Avi

    2007-06-01

    Oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), was discovered on Tahiti Island in July 1996. Eradication programs were conducted from 1997 to 2001, but failed. From 1998 to 2006, B. dorsalis was recovered from 29 different host fruit from the five Society Islands: Tahiti, Moorea, Raiatea, Tahaa, and Huahine. Analysis of coinfestation patterns by B. dorsalis, Bactrocera tryoni (Froggatt), and Bactrocera kirki (Froggatt) suggested B. dorsalis had displaced these two species and become the most abundant fruit fly in coastal areas. To suppress B. dorsalis populations, a classical biological control program was initiated to introduce the natural enemy Fopius arisanus (Sonan) (Hymenoptera: Braconidae) into French Polynesia from Hawaii. Wasps were released and established on Tahiti, Moorea, Raiatea, Tahaa, and Huahine Islands. In guava, Psidium guajava L., collections for Tahiti, F. arisanus parasitism of fruit flies was 2.1, 31.8, 37.5, and 51.9% for fruit collected for 2003, 2004, 2005 and 2006, respectively. Based on guava collections in 2002 (before releases) and 2006 (after releases), there was a subsequent decrease in numbers of B. dorsalis, B. tryoni, and B. kirki fruit flies emerging (per kilogram of fruit) by 75.6, 79.3, and 97.9%, respectively. These increases in F. arisanus parasitism and decreases in infestation were similar for other host fruit. Establishment of F. arisanus is the most successful example of classical biological control of fruit flies in the Pacific area outside of Hawaii and serves as a model for introduction into South America, Africa, and China where species of the B. dorsalis complex are established.

  5. Chilling and Host Plant/Site-Associated Eclosion Times of Western Cherry Fruit Fly (Diptera: Tephritidae) and a Host-Specific Parasitoid.

    PubMed

    Yee, Wee L; Goughnour, Robert B; Hood, Glen R; Forbes, Andrew A; Feder, Jeffrey L

    2015-08-01

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is an endemic herbivore of bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ∼100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of adult R. indifferens from sweet and bitter cherry differ according to the phenology of their respective host plants and if eclosion times of the host-specific parasitoid Diachasma muliebre (Muesebeck) (Hymenoptera: Braconidae) attacking bitter and sweet cherry flies differ according to the eclosion phenology of their fly hosts. Fly pupae from sweet and bitter cherry fruit were collected from sympatric and allopatric sites in Washington state, and chilled at 5°C. Because timing of eclosion in R. indifferens depends on chill duration, eclosion time in wasps could also vary with chill duration. To account for this, fly pupae were chilled for 1, 2, 2.5, 3, 4, 6, or 8 mo. Both flies and wasps eclosed earlier with longer chill durations. Eclosion times of sweet and bitter cherry flies from a sympatric site in central Washington did not differ. However, at allopatric sites in northwestern and central Washington, bitter cherry flies eclosed later than sweet and bitter cherry flies at the sympatric site. Correspondingly, D. muliebre parasitizing a more isolated bitter cherry fly population eclosed later than D. muliebre parasitizing earlier-emerging sweet and bitter cherry fly populations. These results provide evidence for D. muliebre rapidly responding to changes in host plant shifts by R. indifferens. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  6. Response of Psyttalia humilis (Hymenoptera: Braconidae) to olive fruit fly (Diptera: Tephritidae) and conditions in California olive orchards

    USDA-ARS?s Scientific Manuscript database

    The larval parasitoid, Psyttalia cf. concolor (Szépligeti), reared on Mediterranean fruit fly, Ceratitis capitata (Weidemann), by the USDA-APHIS, PPQ, Guatemala City, Guatemala, was imported into California for biological control of olive fruit fly, Bactrocera oleae (Gmelin), in olives, Olea europae...

  7. Mexican fruit fly (Diptera: tephritidae) and the phenology of its native host plant, Yellow Chapote (Rutaceae) in Mexico

    USDA-ARS?s Scientific Manuscript database

    In northeastern Mexico, the Mexican fruit fly, Anastrepha ludens (Loew), breeds on its native host, yellow chapote, Casimiroa greggii (Wats.), which typically produces fruit in the spring. Peak populations of the fly occur in late spring or early summer when adults emerge from the generation of lar...

  8. Managing Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae), Using Spinosad-Based Protein Bait Sprays in Papaya Orchards in Hawaii

    USDA-ARS?s Scientific Manuscript database

    The efficacy of GF-120 Fruit Fly Bait was evaluated as a control of female oriental fruit fly, Bactrocera dorsalis (Hendel) in papaya orchards in Hawaii. Two important components of this study were field sanitation and mass trapping using the male-specific lure methyl eugenol. Three different spray ...

  9. Oviposition in Sweet Cherry by Reproductively Mature Western Cherry Fruit Fly (Tephritidae:Diptera) Fed Spinosad and Neonicotinoid Insecticide Baits

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a major pest of cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. Spinosad bait is applied weekly to kill flies before they develop eggs, but its effects on oviposition by flies that are reproductively mature are unknown. ...

  10. Population structure and cryptic genetic variation in the mango fruit fly, Ceratitis cosyra (Diptera, Tephritidae)

    PubMed Central

    Virgilio, Massimiliano; Delatte, Hélène; Nzogela, Yasinta Beda; Simiand, Christophe; Quilici, Serge; De Meyer, Marc; Mwatawala, Maulid

    2015-01-01

    Abstract The fruit fly Ceratitis cosyra is an important agricultural pest negatively affecting the mango crop production throughout Africa and also feeding on a variety of other wild and cultivated hosts. The occurrence of deeply divergent haplotypes, as well as extensive morphological variability, previously suggested possible cryptic speciation within Ceratitis cosyra. Here we provide the first large-scale characterisation of the population structure of Ceratitis cosyra with the main objective of verifying cryptic genetic variation. A total of 348 specimens from 13 populations were genotyped at 16 polymorphic microsatellite loci. Hardy-Weinberg equilibrium (HWE) deviations were observed in 40.4% of locus-population combinations and suggested the occurrence of genetic substructuring within populations. Discriminant Analysis of Principal Components (DAPC) showed genetic divergence between the vast majority of vouchers from Burundi and Tanzania (plus a few outliers from other African countries) and all other specimens sampled. Individual Bayesian assignments confirmed the existence of two main genotypic groups also occurring in sympatry. These data provided further support to the hypothesis that Ceratitis cosyra might include cryptic species. However, additional integrative taxonomy, possibly combining morphological, ecological and physiological approaches, is required to provide the necessary experimental support to this model. PMID:26798276

  11. Global Assessment of Seasonal Potential Distribution of Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae)

    PubMed Central

    Szyniszewska, Anna M.; Tatem, Andrew J.

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species. PMID:25375649

  12. Novel toxicity of Bacillus thuringiensis strains against the melon fruit fly, Bactrocera cucurbitae (Diptera: Tephritidae).

    PubMed

    Shishir, Md Asaduzzaman; Akter, Asma; Bodiuzzaman, Md; Hossain, M Aftab; Alam, Md Musfiqul; Khan, Shakil Ahmed; Khan, Shakila Nargis; Hoq, M Mozammel

    2015-01-01

    Bactrocera cucurbitae (melon fruit fly) is one of the most detrimental vegetable-damaging pests in Bangladesh. The toxicity of Bacillus thuringiensis (Bt) has been reported against a few genera of Bactrocera in addition to numerous other insect species. Bt strains, harbouring cry1A-type genes were, therefore, assayed in vivo against the 3(rd) instar larvae of B. cucurbitae in this study. The biotype-based prevalence of cry1 and cry1A genes was calculated to be 30.8% and 11.16%, respectively, of the test strains (n=224) while their prevalence was greatest in biotype kurstaki. Though three indigenous Bt strains from biotype kurstaki with close genetic relationship exhibited higher toxicity, maximum mortalities were recorded for Btk HD-73 (96%) and the indigenous Bt JSc1 (93%). LC50 and LC99 values were determined to be 6.81 and 8.32 for Bt JSc1, 7.30 and 7.92 for Bt SSc2, and 6.99 and 7.67 for Btk HD-73, respectively. The cause of toxicity and its variation among the strains was found to be correlated with the synergistic toxic effects of cry1, cry2, cry3 and cry9 gene products, i.e. relevant Cry proteins. The novel toxicity of the B. thuringiensis strains against B. cucurbitae revealed in the present study thus will help in developing efficient and eco-friendly control measures such as Bt biopesticides and transgenic Bt cucurbits.

  13. The current and future potential geographic range of West Indian fruit fly, Anastrepha obliqua (Diptera: Tephritidae).

    PubMed

    Fu, Liao; Li, Zhi-Hong; Huang, Guan-Sheng; Wu, Xing-Xia; Ni, Wen-Long; Qü, Wei-Wei

    2014-04-01

    The West Indian fruit fly, Anastrepha obliqua (Macquart), is one of the most important pests throughout the Americas. CLIMEX 3.0 and ArcGIS 9.3 were used to model the current and future potential geographical distribution of this pest. Under current climatic conditions, A. obliqua is predicted to be able to establish throughout much of the tropics and subtropics, including not only North and South America, where it has been reported, but also southern Asia, northeastern Australia and Sub-Saharan Africa. The main factors limiting the pest's range expansion may be cold stress. Climate change expands the potential distribution of A. obliqua poleward as cold stress boundaries recede, but the predicted distribution in northwestern Australia and northern parts of Sub-Saharan Africa will decrease because of heat stress. Considering the widely suitable range for A. obliqua globally and in China, enhanced quarantine and monitoring measures should be implemented in areas that are projected to be suitable for the establishment of the pest under current and future climatic conditions. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  14. An EST database of the Caribbean fruit fly, Anastrepha suspensa (Diptera: Tephritidae).

    PubMed

    Nirmala, Xavier; Schetelig, Marc F; Yu, Fahong; Handler, Alfred M

    2013-04-01

    Invasive tephritid fruit flies are a great threat to agriculture worldwide and warrant serious pest control measures. Molecular strategies that promote embryonic lethality in these agricultural pests are limited by the small amount of nucleotide sequence data available for tephritids. To increase the dataset for sequence mining, we generated an EST database by 454 sequencing of the caribfly, Anastrepha suspensa, a model tephritid pest. This database yielded 95,803 assembled sequences with 24% identified as independent transcripts. The percentage of caribfly sequences with hits to the closely related tephritid, Rhagoletis pomonella, transcriptome was higher (28%) than to Drosophila proteins/genes (18%) in NCBI. The database contained genes specifically expressed in embryos, genes involved in the cell death, sex-determination, and RNAi pathways, and transposable elements and microsatellites. This study significantly expands the nucleotide data available for caribflies and will be a valuable resource for gene isolation and genomic studies in tephritid insects. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Szyniszewska, Anna M; Tatem, Andrew J

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  16. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: effect of ammonium acetate, female age, and protein hunger.

    PubMed

    Piñero, J C; Mau, R F L; Vargas, R I

    2011-08-01

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources, and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examined the behavioural response of wild female oriental fruit fly (Bactrocera dorsalis (Hendel)), melon fly (B. cucurbitae (Coquillett)), and Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) to spinosad-based GF-120 NF Naturalyte Fruit Fly Bait(©) formulated to contain either 0, 1 or 2% ammonium acetate. Use of visually-attractive yellow bait stations for bait application in the field allowed for proper comparisons among bait formulations. Field cage tests were also conducted to investigate, using a comparative behavioural approach, the effects of female age and protein starvation on the subsequent response of F1 generation B. cucurbitae and B. dorsalis to the same three bait formulations that were evaluated in the field. Our field results indicate a significant positive effect of the presence, regardless of amount, of AA in GF-120 for B. dorsalis and B. cucurbitae. For C. capitata, there was a significant positive linear relationship between the relative amounts of AA in bait and female response. GF-120 with no AA was significantly more attractive to female C. capitata, but not to female B. dorsalis or B. cucurbitae, than the control treatment. Our field cage results indicate that the effects of varying amounts of AA present in GF-120 can be modulated by the physiological stage of the female flies and that the response of female B. cucurbitae to GF-120 was consistently greater than that of B. dorsalis over the various ages and levels of protein starvation regimes evaluated. Results are discussed in light of their applications for effective fruit fly suppression.

  17. Trap capture of three economically important fruit fly species (Diptera: Tephritidae): evaluation of a solid formulation containing multiple male lures in a Hawaiian coffee field.

    PubMed

    Shelly, Todd; Nishimoto, Jon; Kurashima, Rick

    2012-08-01

    Invasive fruit flies (Diptera: Tephritidae) pose a global threat to agriculture through direct damage to food crops and the accompanying trade restrictions that often result. Early detection is vital to controlling fruit flies, because it increases the probability of limiting the growth and spread of the invasive population and thus may greatly reduce the monetary costs required for eradication or suppression. Male-specific lures are an important component of fruit fly detection, and three such lures are used widely: trimedlure (TML), cue lure (CL), and methyl eugenol (ME), attractive to Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), respectively. In California, Florida, and Texas, the two Bactrocera lures are applied to separate species-specific traps as liquids (with a small amount of the insecticide naled added), whereas TML is delivered as a solid plug in another set of traps. Thus, the detection protocol involves considerable handling time as well as potential contact with a pesticide. The purpose of this study was to compare trap capture between liquid male lures and "trilure" wafers that contain TML, ME, raspberry ketone (RK, the hydroxy equivalent of CL), and the toxicant DDVP embedded within a solid matrix. Field studies were conducted in a Hawaiian coffee (Coffea arabica L.) field where the three aforementioned species co-occur, showed that the wafer captured at least as many flies as the liquid baits for all three species. This same result was obtained in comparisons using both fresh and aged (6-wk) baits. Moreover, the wafers performed as well as the single-lure traps in an ancillary experiment in which TML plugs were substituted for liquid TML. Additional experiments demonstrated explicitly that the presence of ME and RK had no effect on captures of C. capitata males and similarly that the presence of TML had no effect on the capture of B

  18. Efficacy of ground spray application of bait sprays with malathion or spinosad on Mexican fruit fly (Diptera: Tephritidae) in Texas citrus.

    PubMed

    Conway, Hugh E; Forrester, O Thomas

    2011-04-01

    An important component in the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), eradication program is bait spray application to knock down localized A. ludens infestations enhancing the sterile to wild fly ratio and increasing the effectiveness of the sterile insect release program. Efficacy tests were conducted using spray equipment that applies ultralow application rates of malathion NU-LURE or GF-120 spinosad by ground into citrus. Trapit Dome traps located in fields treated with malathion NU-LURE and GF-120 spinosad high rate caught significantly fewer flies than the control in all replications. Treatments reduced the Mexican fruit fly populations by 99.1 and 92.5% with malathion and 98.2 and 89.9% with GF-120 spinosad high rate. Traps in plots with lower rates of GF-120 reduced fly populations by 76.3 and 74.3% in winter and summer test, respectively. There was no indication of fly repulsion from either malathion or GF-120 spinosad during this test. The bait spray option using ground spray equipment to apply ultra-low rates of either malathion NU-LURE or GF-120 spinosad high rate is a viable cost effective treatment method to treat small acreages for A. ludens. For organic growers, the ground spray equipment is effective in applying GF-120 spinosad at the labeled rates.

  19. Half of the European fruit fly species barcoded (Diptera, Tephritidae); a feasibility test for molecular identification

    PubMed Central

    Smit, John; Reijnen, Bastian; Stokvis, Frank

    2013-01-01

    Abstract A feasibility test of molecular identification of European fruit flies (Diptera: Tephritidae) based on COI barcode sequences has been executed. A dataset containing 555 sequences of 135 ingroup species from three subfamilies and 42 genera and one single outgroup species has been analysed. 73.3% of all included species could be identified based on their COI barcode gene, based on similarity and distances. The low success rate is caused by singletons as well as some problematic groups: several species groups within the genus Terellia and especially the genus Urophora. With slightly more than 100 sequences – almost 20% of the total – this genus alone constitutes the larger part of the failure for molecular identification for this dataset. Deleting the singletons and Urophora results in a success-rate of 87.1% of all queries and 93.23% of the not discarded queries as correctly identified. Urophora is of special interest due to its economic importance as beneficial species for weed control, therefore it is desirable to have alternative markers for molecular identification. We demonstrate that the success of DNA barcoding for identification purposes strongly depends on the contents of the database used to BLAST against. Especially the necessity of including multiple specimens per species of geographically distinct populations and different ecologies for the understanding of the intra- versus interspecific variation is demonstrated. Furthermore thresholds and the distinction between true and false positives and negatives should not only be used to increase the reliability of the success of molecular identification but also to point out problematic groups, which should then be flagged in the reference database suggesting alternative methods for identification. PMID:24453563

  20. Evaluation of the Host Status of Mature Green Papayas 'Maradol' for the Mexican Fruit Fly (Diptera: Tephritidae).

    PubMed

    Arredondo, José; Ruiz, Lia; Díaz-Fleischer, Francisco

    2014-10-01

    The suitability of mature green 'Maradol' papaya as a host of Anastrepha ludens (Loew) was studied under field and laboratory conditions. Field tests were conducted on commercial-ripened and spot-ripened fruit in two orchards and during two seasons in the state of Chiapas. Fruits at exportation ripeness are in "commercial ripeness", while fruits that are harvested immediately preceding exportation ripeness are in "spot ripeness." The field tests consisted of forced infestation experiments that evaluated papayas at two ripeness stages: the commercial- or exportation-ripened fruit (green fruits with one or two yellow stripes) and fruit before exportation ripeness called "spot ripeness." These tests were conducted in two orchards and during two seasons in the state of Chiapas, Mexico. Laboratory trials were performed with commercial-ripened fruit only. Fruit from four different postharvest periods (3, 24, 48, and 72 h) were exposed to groups of gravid flies. No larvae emerged from the fruit that was collected in the field experiments. However, some larvae and several fertile flies were obtained from the commercial-ripened fruit 72 h postharvest but not 3, 24, and 48 h postharvest in the laboratory. The results of this study indicate that the commercially ripe fruits of papaya Maradol were resistant to or free from infestation of A. ludens flies under field conditions, though these fruits must be considered nonnatural, conditional host because they became infested in the laboratory.

  1. Seasonal Abundance of Mango Fruit Flies (Diptera: Tephritidae) and Ecological Implications for Their Management in Mango and Cashew Orchards in Benin (Centre & North).

    PubMed

    Vayssières, J-F; De Meyer, M; Ouagoussounon, I; Sinzogan, A; Adandonon, A; Korie, S; Wargui, R; Anato, F; Houngbo, H; Didier, C; De Bon, H; Goergen, G

    2015-10-01

    We report the results of a large-scale (six orchards) and long-term (5-yr) study on seasonal population fluctuations of fruit flies (Diptera Tephritidae) in mango (2005-2009) and cashew (2007-2009) orchards in the Borgou Department, Benin.During the five consecutive years of mango fruit fly monitoring, 25 tephritid species were captured including three species of Bactrocera, 11 of Ceratitis, and 11 of Dacus, which is represented by 2,138,150 specimens in mango orchards. We observed significant differences in Bactrocera dorsalis (Hendel) counts between "high" and "low" mango production years from 2005 to 2008 but not in Ceratitis cosyra (Walker) counts. The native species, C. cosyra, the most abundant species during the dry season, peaked beginning of May, while the exotic species, B. dorsalis, the most abundant species during the rainy season, peaked in June. Preliminary results underlined the role of nine species of wild hosts and seven species of cultivated ones around mango orchards that played an important role in maintaining B. dorsalis in this Sudan zone all year round. The presence of C. cosyra stretched over 9 mo.During the first 14 wk of tephritid monitoring on cashew orchards situated near mango orchards, most flies (62%) were captured in traps positioned in cashew orchards, showing the strong interest of an early fly control on cashew before the mango season. According to these results, in the Sudan zone, effective and compatible control methods as proposed by the IPM package validated by the West African Fruit Fly Initiative project against mango fruit flies are proposed for a large regional tephritid control program in same zones of West Africa. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Soil moisture and relative humidity effects during post-diapause on emergence of western cherry fruit fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a pest of sweet cherry, Prunus avium (L.) L., in western North America that is found in relatively moist and dry habitats. In this study, fly pupae from Kennewick and Roslyn in Washington state, U.S.A., were used to test the hypotheses tha...

  3. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Traps baited with synthetic food-based lures that include blends of ammonia, either as ammonium acetate or ammonium bicarbonate, and putrescine capture a number of Anastrepha and Bactrocera species fruit flies. However, for many of these species, more flies are captured in traps baited with the pro...

  4. Pupal Mortality and Adult Emergence of Western Cherry Fruit Fly (Diptera: Tephritidae) Exposed to the Fungus Muscodor albus (Xylariales: Xylariaceae)

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a major pest of sweet cherry, Prunus avium (L.) L., that is conventionally controlled using insecticides. One alternative to the use of insecticides for fly control could be fumigation of the fly’s overwintering habitat using the fungus Mus...

  5. Automated Surveillance of Fruit Flies

    PubMed Central

    Potamitis, Ilyas; Rigakis, Iraklis; Tatlas, Nicolaos-Alexandros

    2017-01-01

    Insects of the Diptera order of the Tephritidae family cause costly, annual crop losses worldwide. Monitoring traps are important components of integrated pest management programs used against fruit flies. Here we report the modification of typical, low-cost plastic traps for fruit flies by adding the necessary optoelectronic sensors to monitor the entrance of the trap in order to detect, time-stamp, GPS tag, and identify the species of incoming insects from the optoacoustic spectrum analysis of their wingbeat. We propose that the incorporation of automated streaming of insect counts, environmental parameters and GPS coordinates into informative visualization of collective behavior will finally enable better decision making across spatial and temporal scales, as well as administrative levels. The device presented is at product level of maturity as it has solved many pending issues presented in a previously reported study. PMID:28075346

  6. Automated Surveillance of Fruit Flies.

    PubMed

    Potamitis, Ilyas; Rigakis, Iraklis; Tatlas, Nicolaos-Alexandros

    2017-01-08

    Insects of the Diptera order of the Tephritidae family cause costly, annual crop losses worldwide. Monitoring traps are important components of integrated pest management programs used against fruit flies. Here we report the modification of typical, low-cost plastic traps for fruit flies by adding the necessary optoelectronic sensors to monitor the entrance of the trap in order to detect, time-stamp, GPS tag, and identify the species of incoming insects from the optoacoustic spectrum analysis of their wingbeat. We propose that the incorporation of automated streaming of insect counts, environmental parameters and GPS coordinates into informative visualization of collective behavior will finally enable better decision making across spatial and temporal scales, as well as administrative levels. The device presented is at product level of maturity as it has solved many pending issues presented in a previously reported study.

  7. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic

    USDA-ARS?s Scientific Manuscript database

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  8. Host breadth and parasitoids of fruit flies (Anastrepha spp.) (Diptera: Tephritidae) in Puerto Rico.

    PubMed

    Jenkins, David A; Goenaga, Ricardo

    2008-02-01

    Twenty fruit species representing 12 families were collected from various regions in western Puerto Rico and monitored for the emergence of Anastrepha spp. pupae. We collected 14,154 tephritid pupae from 16 fruit species representing 10 families. The relative infestations of these fruits (pupae per kilogram of fruit) were recorded. Recorded host ranges were not in complete agreement with those reported in the literature. This host-use pattern should give pause to regulators of fruit importation and exportation that base their decisions on literature from regions other than those of immediate interest to them. We recovered the braconid parasitoid Utetes anastrephae (Viereck) from tephritid pupae collected from Mangifera indica L., Spondias mombin L., Psidium guajava L., Chrysobalanus icacos L., Terminalia catappa L., and Garcinia intermedia (Pittier) Hammel. We collected one specimen of the parasitoid Doryctobracon aerolatus (Szepligeti) from the west coast (Añasco), which had not been previously reported in Puerto Rico. We present a preliminary phenology of what are probably the primary fruit hosts of the Anastrepha spp. of Puerto Rico. We also present the first report of Garcinia intermedia (Pittier) Hammel and Coffea arabica L. as reproductive hosts of A. suspensa.

  9. Comparison of torula yeast and various grape juice products as attractants for Mexican fruit fly (Diptera: Tephritidae).

    PubMed

    Mangan, Robert L; Thomas, Donald B

    2014-04-01

    Early research investigating attractants for the Mexican fruit fly, Anastrepha ludens Loew, during the 1930s indicated that fermentation products were effective attractants for Mexican fruit flies and other tropical Tephritidae, but that attraction to fruit components was only of academic interest. Tests reported here were carried out on populations of Mexican fruit flies from 2004 to 2011. Trapping experiments carried out at sites in the states Nuevo Leon and San Luis Potosi compared grape juice, reconstituted grape concentrate and powdered grape mixes, and torula yeast extract in orchards at each site. The Nuevo Leon orchard was mixed with alternate rows of pears and surrounded by alternate hosts. The San Luis Potosi site was surrounded by other orange orchards or nonhosts. Each test was run for at least 10 mo and included highest and lowest trapping periods. Results showed that grape juice captured the most total flies and had the fewest samples with zero flies. However, in the series of experiments, each product had the most captures in at least one experiment. Hydrolyzed torula was superior in one of the six experiments. In five of the tests, polyethylene glycol was tested as an additive to the grape products but never improved capture rate compared with the product without the additive. These results indicate that grape juice is superior to grape concentrate or powder and grape juice is at least equal to torula yeast hydrolysate for trapping pest populations of Mexican fruit flies in commercial citrus orchards.

  10. Efficacy of wax matrix bait stations for Mediterranean fruit flies (Diptera: Tephritidae).

    PubMed

    Epsky, Nancy D; Midgarden, David; Rendón, Pedro; Villatoro, David; Heath, Robert R

    2012-04-01

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that bait stations with spinosad and ammonium acetate remained effective for at least 31 d compared with pesticide-free controls, although there was some loss of efficacy over time. Percentage mortality for bait station strips with 2% spinosad and 1% ammonium acetate decreased from 100 +/- 0.0% on day 0 to 70 +/- 7.1% after 31 d. Ammonia concentration had little effect on percentage mortality although there was some indication that ammonia concentration affected number of flies observed on the bait stations. Bait station strips (one per cage) were more effective than controls for 6-8 wk when tests were conducted in field cages (3 m diameter x 2 m), but only 2-3 wk when tests were conducted in large (2.5 m high and 6.0 m wide and 7.5 m long) field cages. Longevity was restored when multiple bait stations (3, 6, or 12) were deployed per cage. Bait stations containing methomyl were used for field tests of efficacy for wild flies. Dipped lure bait stations, which were made by coating two edges of commercial ammonium acetate and trimethylamine lures, killed six times more flies than corn cob bait stations dipped into a Nulure/malathion solution. They also killed more flies than pesticide-free controls for 8 wk.

  11. Effects of Peganum harmala (Zygophyllaceae) seed extract on the olive fruit fly (Diptera: Tephritidae) and its larval parasitoid Psyttalia concolor (Hymenoptera: Braconidae).

    PubMed

    Rehman, Junaid Ur; Wang, Xin-Geng; Johnson, Marshall W; Daane, Kent M; Jilani, Ghulam; Khan, Mir A; Zalom, Frank G

    2009-12-01

    Peganum harmala L. (Zygophyllaceae) is an herb native to arid and semiarid regions of Central Asian deserts. This study investigated the effects of ethanol extracts of P. harmala seeds on the olive fruit fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae), i.e., adult repellency, reproductive activity, and larval growth, as well as parasitism levels by Psyttalia concolor (Szépligeti). Olive fruit treated with 2% extract reduced B. oleae oviposition. In choice tests, female B. oleae spent >99% of their time foraging on untreated fruit rather than P. harmala-treated fruit. These changes in ovipositional behavior resulted in a nearly 30-fold decrease in oviposition marks on treated fruit compared with untreated fruit during a 48 h exposure period. When female B. oleae were fed liquid diet containing 0.2% P. harmala extract, there was no effect on the number of ovipositional marks on exposed fruit, but up to 21.4% of the deposited eggs were deformed. SDS-polyacrylamide gel electrophoresis analyses of deformed eggs revealed that some protein bands were missing. Consequently, the number of offspring produced by treated females was lower than by untreated females. Neither the sex ratio nor body size of the fly's offspring were affected by adults fed diet containing 0.2% P. harmala extract. However, there was a slightly prolonged developmental time from egg to adult. Parasitism of larval B. oleae by P. concolor was not affected by infested fruit treatment with 2% P. harmala extract. P. harmala extracts as a potential control for insect pest species are discussed.

  12. Risk of introducing exotic fruit flies, Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa (Diptera: Tephritidae), into southern China.

    PubMed

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Wu, Jiajiao; Chen, Hongjun; Zhang, Runjie

    2010-08-01

    Exotic fruit flies (Ceratitis spp.) are often serious agricultural pests. Here, we used, pathway analysis and Monte Carlo simulations to assess the risk of introduction of Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch, into southern China with fruit consignments and incoming travelers. Historical data, expert opinions, relevant literature, and archives were used to set appropriate parameters in the pathway analysis. Based on the ongoing quarantine/ inspection strategies of China, as well as the interception records, we estimated the annual number of each fruit fly species entering Guangdong province undetected with commercially imported fruit, and the associated risk. We also estimated the gross number of pests arriving at Guangdong ports with incoming travelers and the associated risk. Sensitivity analysis also was performed to test the impact of parameter changes and to assess how the risk could be reduced. Results showed that the risk of introduction of the three fruit fly species into southern China with fruit consignments, which are mostly transported by ship, exists but is relatively low. In contrast, the risk of introduction with incoming travelers is high and hence deserves intensive attention. Sensitivity analysis indicated that either ensuring all shipments meet current phytosanitary requirements or increasing the proportion of fruit imports sampled for inspection could substantially reduce the risk associated with commercial imports. Sensitivity analysis also provided justification for banning importation of fresh fruit by international travelers. Thus, inspection and quarantine in conjunction with intensive detection were important mitigation measures to reduce the risk of Ceratitis spp. introduced into China.

  13. Identifying Insects with Incomplete DNA Barcode Libraries, African Fruit Flies (Diptera: Tephritidae) as a Test Case

    PubMed Central

    Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C.; Backeljau, Thierry; De Meyer, Marc

    2012-01-01

    We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods. PMID:22359600

  14. Identifying insects with incomplete DNA barcode libraries, African fruit flies (Diptera: Tephritidae) as a test case.

    PubMed

    Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C; Backeljau, Thierry; De Meyer, Marc

    2012-01-01

    We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods.

  15. Insecticide toxicity to oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae) is influenced by environmental factors.

    PubMed

    Lin, Yuying; Jin, Tao; Zeng, Ling; Lu, Yongyue

    2013-02-01

    In this study, we investigated the effects of environmental factors (temperature, dose, dietary source, and feeding density) on the insecticide tolerance of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). The results indicated that the toxicities of trichlorphon and abamectin to B. dorsalis increased with an increase in temperature. At 15-35 degrees C, the toxicity of beta-cypermethrin decreased with an increase in temperature at low doses (0.82 and 1.86 mg/L), but was similar at a high dose (4.18 mg/L). These results demonstrated that the temperature coefficient of beta-cypermethrin was related to both temperature and dosage. The insecticide sensitivity of B. dorsalis reared on different dietary sources was significantly different. Trichlorphon sensitivity of B. dorsalis fed on banana was the highest with an LC50 of 1.61 mg/L, followed by on apple, carambola, semiartificial diet, pear, mango, guava, orange, and papaya. With an increasing feeding density, the sensitivity of B. dorsalis adults to trichlorphon increased, while the sensitivities of B. dorsalis adults to abamectin and beta-cypermethrin decreased. The differences between LC50 values of insects reared at densities of 10 and 13 eggs/g of semiartificial diet to trichlorphon, abamectin and beta-cypermethrin were not significant. This result suggested that representative toxicity could be obtained by using adults developed at a feeding density between 10-13 eggs/g of semiartificial diet. Adult body weight was positively correlated with the LC50 value of trichlorphon, but was negatively correlated with the toxicities of abamectin and beta-cypermethrin. These results suggested that the effects of adult body weight on the toxicity of insecticides were different among different chemicals.

  16. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    PubMed Central

    Pimentel, R.; Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  17. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal.

    PubMed

    Pimentel, R; Lopes, D J H; Mexia, A M M; Mumford, J D

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010-2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance's sensitivity on Terceira Island.

  18. Effects of GF-120 fruit fly bait concentrations on attraction, feeding, mortality, and control of Rhagoletis indifferens (Diptera: Tephritidae).

    PubMed

    Yee, Wee L; Chapman, Peter S

    2005-10-01

    Effects of different concentrations of GF-120 NF Naturalyte Fruit Fly Bait on attraction and feeding responses, mortality, and control of the western cherry fruit fly, Rhagoletis indifferens Curran, were determined. In the laboratory, flies that had been exposed to sugar and yeast extract and then deprived of all food for 16-20 h were attracted to 40.0% GF-120, but not to 0.6 and 4.8% GF-120 (vol:vol). Nonstarved flies were not attracted to any concentration. Flies in the field were not attracted to 55.6% GF-120 on cherry leaves, and few flies fed on the bait. In the laboratory, males fed for shorter durations on and ingested lower amounts of 0.6% than 4.8 or 40.0% GF-120, but females fed equally on all concentrations. Spinosad in GF-120 was highly toxic to flies. Lethal concentrations50 (LC50 values) of spinosad for starved flies at 1-4 d were 1.5-0.7 ppm. When gravid flies were exposed to cherries treated with 0.6, 4.8, and 40.0% GF-120, mortality was greater at each higher concentration, but none prevented oviposition. Field spray tests comparing 0.6, 4.8, and 40.0% GF-120 in 225 ml of spray per cherry tree resulted in 79-94% lower larval infestations than in controls, but no differences were seen among the concentrations. Evidence from this study indicates that fresh 40.0% GF-120 was attractive in the laboratory but that flies were not attracted to fresh GF-120 from far distances within trees, suggesting that suppression of populations is caused in large part by flies finding the bait through normal movement over large areas.

  19. Adult diet and male-female contact effects on female reproductive potential in Mexican fruit fly (Anastrepha ludens Loew) (Diptera tephritidae).

    PubMed

    Mangan, Robert L

    2003-04-01

    Wild strains of fruit flies (Diptera: Tephritidae) placed into laboratory rearing conditions are subjected to selection pressures caused by the diet, cages, density of flies, and other factors. Selection that changes mating behavior of the strain may result in less effective males released in sterile insect programs. Tests were performed to examine the effects of protein in diet and adult interactions on egg production and mating during sexual maturation of the Mexican fruit fly (Anastrepha ludens Loew) in laboratory cages. Flies were offspring of wild flies collected from Chiapas or Nuevo Leon, Mexico, and reared on Valencia oranges. Experiments demonstrated effects of yeast hydrolysate protein in adult diet and pairing with males on production of mature and immature eggs, numbers of females producing eggs, and mating with females aged 15 d. Addition of protein to 4% fructose in the adult diet approximately tripled mature egg production in females maintained for the total maturation period with an equal number of males. Females that matured without males produced approximately 33% more-mature eggs when fed protein than those fed no protein. Total egg production of females matured without males and fed sugar only or sugar with protein was more than twice that of females matured with males. Tests to examine the effects of male and female diet separately on female egg production showed slightly higher egg production in females fed protein, or females paired with males fed protein, but these differences were not significant. The most definitive effects were that combining wild strain females and males in cages during maturation reduced egg production. This effect was greatest when flies were not fed protein.

  20. Effects of an African weaver ant, Oecophylla longinoda, in controlling mango fruit flies (Diptera: Tephritidae) in Benin.

    PubMed

    Van Mele, Paul; Vayssières, Jean-François; Van Tellingen, Esther; Vrolijks, Jan

    2007-06-01

    Six mango, Mangifera indica L., plantations around Parakou, northern Benin, were sampled at 2-wk intervals for fruit fly damage from early April to late May in 2005. Mean damage ranged from 1 to 24% with a weaver ant, Oecophylla longinoda (Latreille), being either abundant or absent. The fruit fly complex is made up of Ceratitis spp. and Bactrocera invadens Drew et al., a new invasive species in West Africa. In 2006, Ceratitis spp. peaked twice in the late dry season in early April and early May, whereas B. invadens populations quickly increased at the onset of the rains, from mid-May onward. Exclusion experiments conducted in 2006 with 'Eldon', 'Kent', and 'Gouverneur' confirmed that at high ant abundance levels, Oecophylla significantly reduced fruit fly infestation. Although fruit fly control methods are still at an experimental stage in this part of the world, farmers who tolerated weaver ants in their orchard were rewarded by significantly better fruit quality. Conservation biological control with predatory ants such as Oecophylla in high-value tree crops has great potential for African and Asian farmers. Implications for international research for development at the Consultative Group on International Agricultural Research level are discussed.

  1. Detection of Caribbean fruit fly [(Anastrepha suspensa Loew (Diptera: Tephritidae)]-infested grapefruit with portable gas chromatography

    USDA-ARS?s Scientific Manuscript database

    New technologies are being sought by plant protection officials to more quickly and efficiently identify concealed pests in imported commodities. The zNose portable gas chromatography unit was investigated as a tool for identifying organic volatile signatures indicative of Caribbean fruit fly infest...

  2. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures

    USDA-ARS?s Scientific Manuscript database

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  3. Performance of Psyttalia humilis (Hymenoptera: Braconidae) reared from irradiated host on olive fruit fly (Diptera: Tephritidae) in California

    USDA-ARS?s Scientific Manuscript database

    The parasitoid Psytallia humilis (Silvestri) was reared on Mediterranean fruit fly, Ceratitis capitata (Wiedemann), larvae irradiated at different doses from 0-70 Gy at the USDA, APHIS, PPQ, Moscamed biological control laboratory in San Miguel Petapa, Guatemala and shipped to the USDA, ARS, Parlier,...

  4. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    USDA-ARS?s Scientific Manuscript database

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  5. Evaluating the use of irradiated caribean fruit fly (Diptera:Tephritidae) larvae for laboratory rearing of Doryctobracon areolatus (Hymenoptera: Braconidae)

    USDA-ARS?s Scientific Manuscript database

    Mass-rearing and augmentative release of hymenopterous parasitoids has been a component of area-wide management programs for several tephritid fruit flies, including pestiferous species of the genus Anastrepha (Cancino and Montoya, in press). Laboratory rearing of Doryctobracon areolatus (Szeplige...

  6. Effects of Several Newer Insecticides and Kaolin on Oviposition and Adult Mortality in Western Cherry Fruit Fly (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Effects of newer insecticides and kaolin-based particle film (Surround™ WP Crop Protectant), on oviposition and mortality in the western cherry fruit fly, Rhagoletis indifferens Curran, were determined. In a no-choice experiment, azinphos-methyl sprayed on cherries reduced oviposition by 98.5% comp...

  7. An Evaluation of Alternative Insecticides to Diazinon for Control of Tephritid Fruit Flies (Diptera: Tephritidae) in Soil

    USDA-ARS?s Scientific Manuscript database

    Diazinon has been used extensively in the past as part of California eradication programs for tephritid fruit flies, but is being phased out for this purpose in the United States. Therefore, in this study, the toxicity of Platinum®, Force®, Admire®, Regent®, and Warrior® was estimated after applica...

  8. A safe and effective propylene glycol based capture liquid for fruit fly (Diptera: Tephritidae) traps baited with synthetic lures

    USDA-ARS?s Scientific Manuscript database

    Antifreeze is often used as the capture liquid in insect traps for its preservation and evaporation attributes. In tests reported herein, fruit fly traps using non-toxic household propylene glycol based antifreeze captured significantly more Anastrepha ludens than did traps with the automotive anti...

  9. Suitability of a liquid larval diet for rearing the Philippines fruit fly Bactrocera philippinensis (Diptera:Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    A liquid larval diet as an artificial rearing medium was successfully tested for the Philippines fruit fly Bactrocera philippinensis Drew & Hancock. The biological parameters studied were pupal weight, adult emergence and fliers, sex ratio, fecundity and fertility. The insects performed most satisfa...

  10. Attraction and electroantennogram responses of male Mediterranean fruit fly (Diptera: Tephritidae) to volatile chemicals from Persea, Litchi and Ficus wood

    USDA-ARS?s Scientific Manuscript database

    Trimedlure is the most effective male-targeted lure for the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). A similar response is elicited by plant substances that contain a-copaene, a naturally-occurring sesquiterpene. a-copaene is a complex, highly-volatile, widely-distributed plant comp...

  11. Germline transformation of the olive fruit fly, Bactrocera oleae (Rossi)(Diptera:Tephritidae) with a piggyBac transposon vector

    USDA-ARS?s Scientific Manuscript database

    The olive fruit fly, Bactrocera oleae, is a highly significant pest in olive growing countries whose control may be enhanced by the use of genetically-modified strains, especially for sterile insect technique programs. To improve and expand this technology, piggyBac-mediated germline transformation ...

  12. Tapachula-7, a new genetic sexing strain of the Mexican fruit fly (Diptera: Tephritidae): sexual compatibility and competitiveness.

    PubMed

    Orozco, Dina; Meza, J Salvador; Zepeda, Silvia; Solís, Eduardo; Quintero-Fong, J Luis

    2013-04-01

    A new genetic sexing strain of the Mexican fruit fly, Anastrepha ludens (Loew), was evaluated in tests of sexual behavior to determine its possible application using the sterile insect technique. Tests in field cages measuring time to sexual maturity, compatibility with wild flies, and competitiveness were compared between the genetic sexing strain, Tapachula-7, and the mass-reared standard bisexual strain. The results indicated that the onset of sexual maturity was similar for both laboratory strains. Males from the Tapachula-7 strain do not differ from the standard bisexual strain in compatibility and competitiveness with wild insects. The results indicate that the release of Tapachula-7 males in the field would be viable in programs that use the sterile insect technique for the control of the Mexican fruit fly.

  13. Comparison of two synthetic food-odor lures for captures of feral Mexican fruit flies (Diptera: Tephritidae) in Mexico and implications regarding use of irradiated flies to assess lure efficacy.

    PubMed

    Robacker, David C; Thomas, Donald B

    2007-08-01

    Feral Mexican fruit flies, Anastrepha ludens (Loew) (Diptera: Tephritidae), were trapped in a citrus orchard in Mexico by using two types of synthetic food-odor lures, the AFF lure (Anastrepha fruit fly lure, APTIV, Inc., Portland, OR) and the BioLure (two-component MFF lure, Suterra LLC, Inc., Bend, OR). In Multilure traps (Better World Manufacturing, Inc., Miami, FL) containing water, BioLures captured about the same numbers of flies as AFF lures. In Multilure traps containing antifreeze solution, BioLures captured 2 and 5 times more flies than AFF lures in two experiments. BioLures, and AFF lures did not differ in attractiveness when used on sticky traps (Intercept trap, APTIV, Inc.; and sticky cylinder trap). Multilure traps captured >4 times as many flies as sticky traps with the exception that captures of females did not differ between Multilure and sticky traps baited with AFF lures. The percentage of females captured in Multilure traps was greater when traps were baited with BioLures compared with AFF lures, but the reverse was true for sticky traps. Sticky cylinder traps captured a higher percentage of females than Multilure traps. The most effective trap/lure combination was the Multilure trap baited with BioLure and antifreeze. In comparison with tests of these two lures in Texas, results were similar for Multilure traps, but they differed for sticky cylinder traps in that AFF lures were consistently more attractive than BioLures in Texas, but not in Mexico.

  14. Mortality and oviposition of western cherry fruit fly (Diptera: Tephritidae) exposed to different insecticide baits for varying periods in the presence and absence of food.

    PubMed

    Yee, Wee L

    2011-02-01

    Spinosad bait is used to control western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), by killing flies before they oviposit. However, effects of different insecticide baits on management of reproductively mature flies are largely unknown. Objectives here were to determine mortality and oviposition of reproductively mature R. indifferens exposed to different insecticide baits for varying periods in the presence and absence of dried yeast extract and sucrose food. Spinosad bait (spinosad in a mix of protein, sugar, and other ingredients) was compared with acetamiprid, thiamethoxam, and imidacloprid in sucrose or Nu-Lure + sucrose bait. When flies were exposed to treatments and then offered cherries, Prunus avium (L.) L., for oviposition or when they were exposed to treatments and cherries simultaneously, both thiamethoxam bait and imidacloprid bait resulted in higher mortality and lower oviposition than spinosad bait and acetamiprid bait. Exposures to thiamethoxam bait and imidacloprid bait for six and 24 h were similarly effective, but 6-h exposures to spinosad bait and acetamiprid bait were less effective than 24-h exposures. There was little difference between sucrose and Nu-Lure + sucrose baits. When food was present, thiamethoxam bait and imidacloprid bait caused greater mortality and lower oviposition than spinosad bait and acetamiprid bait, but when food was absent, patterns were less consistent. Because of its ability to kill flies sooner after it is exposed to flies when food is present or absent, thiamethoxam or imidacloprid in sucrose or Nu-Lure bait may reduce infestations in cherries more than spinosad bait when mature R. indifferens are present in orchards.

  15. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    SciTech Connect

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  16. Green fluorescent protein (GFP)-labeling of enterobacteria associated with fruit flies (Diptera: Tephritidae) and persistence in their natural host Rhagoletis completa Cresson.

    PubMed

    Martinez-Sañudo, Isabel; Savio, Claudia; Mazzon, Luca; Girolami, Vincenzo; Ciolfi, Silvia; Marri, Laura

    2011-11-01

    Fruit flies (Diptera: Tephritidae) are a highly successful, widespread group of insects that cause economic damage in agriculture. Data available so far on the composition of the bacterial community associated with their digestive tract indicate that members of Enterobacteriaceae are the species most often isolated. Bacteria naturally occurring in insect guts may be engineered and used to study the spatial and functional interactions of microbes within the insect system and offer one route to meet the demand for novel insect pest management strategies. With this aim we introduced by conjugation the gfp gene carried by the suicide plasmid pTn5gfpmut1 into Klebsiella oxytoca and Raoultella (formerly Klebsiella ) spp. strains isolated from the oesophageal bulb of the fruit flies Ceratitis capitata (Wiedemann) and Rhagoletis completa Cresson, respectively. The GFP-encoding gene was stably maintained in two tested transgenic strains, both originally isolated from R. completa. In one case, GFP-labeled bacterial cells were used to feed larvae and adults of the original host. Genetically modified bacteria were able to colonize the gut of larvae and persisted through all larval instars to pupal stage.

  17. Bactrocera invadens (Diptera: Tephritidae), a new invasive fruit fly pest for the Afrotropical region: host plant range and distribution in West and Central Africa.

    PubMed

    Goergen, Georg; Vayssières, Jean-François; Gnanvossou, Désiré; Tindo, Maurice

    2011-08-01

    In 2003, the invasive fruit fly Bactrocera invadens Drew, Tsuruta & White (Diptera: Tephritidae) (Drew et al. 2005), of possible Sri Lankan origin, has been detected in the East and about 1 yr later in West Africa. In regular surveys in Benin and Cameroon covering 4 yr, samples from 117 plant species across 43 families have been obtained. Incubation of field-collected fruits demonstrate that in West and Central Africa (WCA) B. invadens is highly polyphagous, infesting wild and cultivated fruits of at least 46 species from 23 plant families with guava (Psidium spp.), mango (Mangifera spp.), and citrus (spp.), and the wild hosts tropical almond (Terminalia catappa L.), African wild mango (Irvingia gabonensis (Aubry-Lecomte) Baill.), and sheanut (Vitellaria paradoxa C.F.Gaertn.) showing the highest infestation index. B. invadens occurs in 22 countries of WCA with new records for Angola, Central African Republic, the Congo, DR Congo, Equatorial Guinea, Gabon, Gambia, Guinea Bissau, Mali, Mauritania, Niger, and Sierra Leone. Overall, the pest has spread across a North-South distance of ≍5,000 km representing a contiguous area of >8.3 million km(2) within WCA. B. invadens has adapted to a wide range of ecological and climatic conditions extending from low land rainforest to dry savanna. Because of its highly destructive and invasive potential, B. invadens poses a serious threat to horticulture in Africa if left uncontrolled. Moreover, the presence of this quarantine pest causes considerable restrictions on international trade of affected crops.

  18. Evidence for competitive displacement of Ceratitis cosyra by the invasive fruit fly Bactrocera invadens (Diptera: Tephritidae) on mango and mechanisms contributing to the displacement.

    PubMed

    Ekesi, Sunday; Billah, Maxwell K; Nderitu, Peterson W; Lux, Slawomir A; Rwomushana, Ivan

    2009-06-01

    Bactrocera invadens Drew, Tsuruta & White (Diptera: Tephritidae) invaded Kenya in 2003. Before the arrival of B. invadens, the indigenous fruit fly species Ceratitis cosyra (Walker) was the predominant fruit fly pest of mango (Mangifera indica L.). Within 4 yr of invasion, B. invadens has displaced C. cosyra and has become the predominant fruit fly pest of mango, constituting 98 and 88% of the total population in traps and mango fruit at Nguruman, respectively. We tested two possible mechanisms responsible for the displacement namely; resource competition by larvae within mango fruit and aggression between adult flies. Under interspecific competition, larval duration in B. invadens was significantly shorter (6.2 +/- 0.6-7.3 +/- 0.3 d) compared with C. cosyra (8.0 +/- 1.2-9.4 +/- 0.4 d). Pupal mass in C. cosyra was affected by competition and was significantly reduced (7.4 +/- 0.3-9.6 +/- 0.6 mg) under competitive interaction compared with the controls (12.1 +/- 1.5-12.8 +/- 1.1 mg). Interspecific competition also had a significant adverse effect on C. cosyra eclosion, with fewer adults emerging under co-infestation compared with the controls. Interference competition through aggressive behavior showed that fewer C. cosyra (3.1 +/- 0.8) landed on mango dome compared with the controls (14.2 +/- 1.5) when adults were mixed with B. invadens adults in Plexiglas cages. Similarly the number of times C. cosyra was observed ovipositing was significantly lower (0.2 +/- 0.2) under competitive interaction compared with the controls (6.1 +/- 1.8). Aggressive encounters in the form of lunging/ head-butting and chasing off other species from the mango dome was higher for B. invadens compared with C. cosyra. Our results suggest that exploitative competition through larval scrambling for resources and interference competition through aggressive behaviors of the invader are important mechanisms contributing to the displacement of C. cosyra by B. invadens in mango agroecosystems.

  19. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae)

    PubMed Central

    Hanssen, Benjamin L.; Jamie, Joanne F.; Jamie, Ian M.; Siderhurst, Matthew S.; Taylor, Phillip W.

    2016-01-01

    The Queensland fruit fly, Bactrocera tryoni (Froggatt) (Q-fly), is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT) and mass trapping (MT) are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl)-2-butanone) and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl) and ethers (methyl ether, trimethylsilyl ether) in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC), and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated. PMID:27196605

  20. Costly Nutritious Diets do not Necessarily Translate into Better Performance of Artificially Reared Fruit Flies (Diptera: Tephritidae)

    PubMed Central

    Pascacio-Villafán, C.; Williams, T.; Sivinski, J.; Birke, A.; Aluja, M.

    2015-01-01

    Protein, lipid, carbohydrate, and energy contents of three artificial diets (Xal2, Met1, and Met2) used for laboratory-rearing and mass-rearing the Mexican fruit fly, Anastrepha ludens (Loew), for a sterile insect technique program were measured. The larval survival, pupation, pupal weight, adult emergence, sex ratio, and flight capacity of the flies reared on each of these diets were also quantified. The diet with the highest nutrient and energy content was Xal2 followed by Met2 and Met1, but larval recovery and percent pupation was significantly higher in flies reared on either the Met1 or Met2 diets. A. ludens reared on Xal2 exhibited the highest proportion of adults capable of flight. No other response variable differed significantly among the three diets tested. This suggests that a high content of nutrients and multiple sources of protein (dried yeast and wheat germ in the case of the Xal2 diet) do not necessarily improve overall performance or fly quality. We conclude that nutritious diets for A. ludens can be modified to reduce their cost without compromising the performance of artificially reared flies. PMID:26470103

  1. Costly Nutritious Diets do not Necessarily Translate into Better Performance of Artificially Reared Fruit Flies (Diptera: Tephritidae).

    PubMed

    Pascacio-Villafán, C; Williams, T; Sivinski, J; Birke, A; Aluja, M

    2015-02-01

    Protein, lipid, carbohydrate, and energy contents of three artificial diets (Xal2, Met1, and Met2) used for laboratory-rearing and mass-rearing the Mexican fruit fly, Anastrepha ludens (Loew), for a sterile insect technique program were measured. The larval survival, pupation, pupal weight, adult emergence, sex ratio, and flight capacity of the flies reared on each of these diets were also quantified. The diet with the highest nutrient and energy content was Xal2 followed by Met2 and Met1, but larval recovery and percent pupation was significantly higher in flies reared on either the Met1 or Met2 diets. A. ludens reared on Xal2 exhibited the highest proportion of adults capable of flight. No other response variable differed significantly among the three diets tested. This suggests that a high content of nutrients and multiple sources of protein (dried yeast and wheat germ in the case of the Xal2 diet) do not necessarily improve overall performance or fly quality. We conclude that nutritious diets for A. ludens can be modified to reduce their cost without compromising the performance of artificially reared flies. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America.

  2. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    PubMed

    Park, Soo J; Morelli, Renata; Hanssen, Benjamin L; Jamie, Joanne F; Jamie, Ian M; Siderhurst, Matthew S; Taylor, Phillip W

    2016-01-01

    The Queensland fruit fly, Bactrocera tryoni (Froggatt) (Q-fly), is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT) and mass trapping (MT) are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl)-2-butanone) and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl) and ethers (methyl ether, trimethylsilyl ether) in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC), and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated.

  3. Pattern of association between endemic Hawaiian fruit flies (Diptera, Tephritidae) and their symbiotic bacteria: Evidence of cospeciation events and proposal of "Candidatus Stammerula trupaneae".

    PubMed

    Viale, E; Martinez-Sañudo, I; Brown, J M; Simonato, M; Girolami, V; Squartini, A; Bressan, A; Faccoli, M; Mazzon, L

    2015-09-01

    Several insect lineages have evolved mutualistic association with symbiotic bacteria. This is the case of some species of mealybugs, whiteflies, weevils, tsetse flies, cockroaches, termites, carpenter ants, aphids and fruit flies. Some species of Tephritinae, the most specialized subfamily of fruit flies (Diptera: Tephritidae), harbour co-evolved vertically transmitted, bacterial symbionts in their midgut, known as "Candidatus Stammerula spp.". The 25 described endemic species of Hawaiian tephritids, plus at least three undescribed species, are taxonomically distributed among three genera: the cosmopolitan genus Trupanea (21 described spp.), the endemic genus Phaeogramma (2 spp.) and the Nearctic genus Neotephritis (2 spp.). We examined the presence of symbiotic bacteria in the endemic tephritids of the Hawaiian Islands, which represent a spectacular example of adaptive radiation, and tested the concordant evolution between host and symbiont phylogenies. We detected through PCR assays the presence of specific symbiotic bacteria, designated as "Candidatus Stammerula trupaneae", from 35 individuals of 15 species. The phylogeny of the insect host was reconstructed based on two regions of the mitochondrial DNA (16S rDNA and COI-tRNALeu-COII), while the bacterial 16S rRNA was used for the symbiont analysis. Host and symbiont phylogenies were then compared and evaluated for patterns of cophylogeny and strict cospeciation. Topological congruence between Hawaiian Tephritinae and their symbiotic bacteria phylogenies suggests a limited, but significant degree of host-symbiont cospeciation. We also explored the character reconstruction of three host traits, as island location, host lineage, and host tissue attacked, based on the symbiont phylogenies under the hypothesis of cospeciation. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Captures of pest fruit flies (Diptera: Tephritidae) and nontarget insects in BioLure and torula yeast traps in Hawaii.

    PubMed

    Leblanc, Luc; Vargas, Roger I; Rubinoff, Daniel

    2010-10-01

    MultiLure traps were deployed in a Hawaiian orchard to compare the attraction of economically important fruit flies and nontarget insects to the three-component BioLure and torula yeast food lures. Either water or a 20% propylene glycol solution was used to dissolve the torula yeast or as capture fluid in BioLure traps. Torula yeast in water was more attractive than BioLure for male and female Bactrocera cucurbitae (Coquillett) and Bactrocera dorsalis (Hendel) and as attractive for Ceratitis capitata (Wiedemann), and the addition of propylene glycol significantly inhibited the attractiveness of torula yeast. The known synergistic effect of propylene glycol with BioLure, resulting in increased captures of Anastrepha flies, was not observed with Bactrocera. Nontarget Drosophilidae, Neriidae, Phoridae, Calliphoridae, Sarcophagidae, and Muscidae were more strongly attracted to BioLure, and both lures collected Chloropidae equally. As with fruit flies, propylene glycol in torula yeast significantly decreased nontarget captures. The results therefore suggest that torula yeast in water is a more effective attractant than BioLure for pest Bactrocera while minimizing nontarget captures.

  5. A receiver operating characteristic analysis approach for the assessment of the separation of female Mediterranean fruit fly (Diptera: Tephritidae) oviposition distributions.

    PubMed

    Alonzo, Todd A; Nakas, Christos T; Papadopoulos, Nikos T; Papachristos, Dimitrios P

    2009-10-01

    Average fecundity rates and survival are the main components of fitness estimates in studies comparing performance of insect populations. Reproduction is inherently age related in most insect species, and age-specific offspring production is very important in determining fitness components. However, comparison of age-specific reproduction rates are not straight forward and most studies limit analyses to comparisons of average fecundity rates and survival as the main components of the performance of insect populations. We develop a receiver operating characteristic (ROC) curve approach to compare lifetime oviposition distributions. We use empirical data of a study of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) populations, where each fly's lifetime oviposition distribution was recorded for samples studied in natural and artificial oviposition substrates. Currently, there exists no routinely used methodology for the comparison of oviposition distributions and assessment of their separation. ROC analysis is regularly used in two-sample problems in medical biostatistics when the main task is depiction and quantification of the separation of the empirical distributions from which the data arise. Adaptation of such an analysis to our data has shown that age-specific egg-laying distributions can differ, whereas average fecundity rates do not. Therefore, ROC analysis provides a method of gaining insight in the biological process of egg-laying patterns in relatively long-lived insects with many practical and theoretical implications in entomological experimentation.

  6. Olive fruit fly (Diptera: Tephritidae) in California: longevity, oviposition, and development in canning olives in the laboratory and greenhouse.

    PubMed

    Yokoyama, Victoria Y

    2012-02-01

    The biology of olive fruit fly, Bactrocera oleae (Rossi), was studied in the laboratory, greenhouse, and in canning olives, Olea europaea L., in relation to California regional climates. Adults survived in laboratory tests at constant temperatures and relative humidities of 5 degrees C and 83%; 15 degrees C and 59%; 25 degrees C and 30%; and 35 degrees C and 29% for 15, 6, 3, and 2 d without provisions of food and water and for 37, 63, 25, and 4 d with provisions, respectively. In a divided greenhouse, adults survived for 8-11 d in the warm side (36 degrees C and 31% RH daytime); and in the cool side (26 degrees C and 63% RH daytime) 10 d without provisions and 203 d with provisions. A significantly greater number of adults survived in the cool side than the warm side, and with provisions than without. First and last eggs were oviposited in olive fruit when females were 6 and 90 d old, respectively. The highest number of eggs was 55 per day in 10 olive fruit oviposited by 10 28 d-old females, with maximum egg production by 13-37 d-old females. A significantly greater number of ovipositional sites occurred in all sizes of immature green fruit when exposed to adults in cages for 5 d than 2 d. Adults emerged from fruit with a height of > or = 1.0 cm or a volume of > or = 0.2 cm3. More than seven adults per 15 fruit emerged from field infested fruit with a height of 1.1 cm and volume of 0.1 cm3. Larval length was significantly different among the first, second, and third instars and ranged from 0.7 to 1.6, 2.4-4.3, and 4.8-5.6 mm at 14 degrees C; 0.8-1.1, 1.9-2.9, and 3.9-4.4 mm at 21 degrees C, and 0.7-1.3, 2.4-2.9, and 4.4-4.8 mm at 26 degrees C, respectively. Survival of pupae to the adult stage was significantly lower at 26 degrees C than 14 degrees C or 21 degrees C. The period of adult emergence began at 38, 14, and 11 d over a period of 8, 5, and 1 d at 14, 21, and 26 degrees C, respectively. Findings were related to the occurrence and control of California

  7. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae (Cocquillett) (Diptera:Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  8. Efficacy of two synthetic food-odor lures for Mexican fruit flies (Diptera: Tephritidae) is determined by trap type.

    PubMed

    Robacker, David C; Czokajlo, Darek

    2005-10-01

    Sterile mass-reared Mexican fruit flies, Anastrepha ludens (Loew), were trapped in a citrus orchard by using multilure traps and cylindrical sticky traps baited with Advanced Pheromone Technologies Anastrepha fruit fly (AFF) lures or Suterra BioLure two-component (ammonium acetate and putrescine) MFF lures (BioLures). The cylinder trap/AFF lure combination was the best trap over the first 6 wk, the multilure trap/BioLure combination was best during weeks 6-12, and the multilure trap/AFF lure combination was best during the last 6 wk. The multilure trap/BioLure combination was best overall by 36% over the cylinder trap/AFF lure combination, and 57% over the multilure trap/AFF lure combination. Cylinder traps with BioLures were the least effective trap/lure combination throughout the experiment, capturing only half as many flies as cylinder traps with AFF lures. Captures with cylinder traps baited with either lure and multilure traps with BioLures were female biased. For the most part, both lures remained highly attractive and emitted detectable amounts of attractive components under hot field conditions for the duration of the 18-wk experiment. Total emission of ammonia was 4 times greater and 1-pyrroline at least 10 times greater from AFF lures compared with BioLures. Correlations of trap and lure performance with ammonia emission and weather were determined, but no conclusions were possible. Results indicate that BioLures would be the lure of choice in multilure or other McPhail-type traps and AFF lures would be superior with most sticky traps or kill stations that attract flies to outer (not enclosed) surfaces.

  9. Heating rate and induced thermotolerance in Mexican fruit fly (Diptera: Tephritidae) larvae, a quarantine pest of citrus and mangoes.

    PubMed

    Thomas, D B; Shellie, K C

    2000-08-01

    A bioassay and graduated temperature water baths were used to document the induction of thermotolerance in third-instar Mexican fruit fly, Anastrepha ludens (Loew). The 99% lethal time dose for larvae exposed to 44 degrees C core temperatures in artificial fruit is 61.5 min when a slow heating rate (120 min ramp) is applied, but only 41.9 min when a fast heating rate (15 min ramp) is applied. In electrophoretic profiles a heat inducible protein of molecular weight 32 kDa was detected in 76% of the larvae exposed to the slow ramp treatment, but only 42% of the larvae in the fast ramp treatment. Results from this research demonstrate that thermotolerance can be induced under conditions used to commercially disinfest fresh produce and highlight the necessity for specifying heating rates in quarantine treatment schedules.

  10. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae) and Their Phylogenetic Implications

    PubMed Central

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip; Suana, I. Wayan

    2016-01-01

    Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs), 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp) was longer than those of B. melastomatos (15,954 bp) and B. umbrosa (15,898 bp). This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa). Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8), which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3) and nad6 (NADH dehydrogenase subunit 6) genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine)-loop was absent in trnF (phenylalanine) and DHU (dihydrouracil)-loop was absent in trnS1 (serine S1). In B. umbrosa, trnN (asparagine), trnC (cysteine) and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes), with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general. PMID:26840430

  11. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae) and Their Phylogenetic Implications.

    PubMed

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip; Suana, I Wayan

    2016-01-01

    Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs), 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp) was longer than those of B. melastomatos (15,954 bp) and B. umbrosa (15,898 bp). This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa). Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8), which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3) and nad6 (NADH dehydrogenase subunit 6) genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine)-loop was absent in trnF (phenylalanine) and DHU (dihydrouracil)-loop was absent in trnS1 (serine S1). In B. umbrosa, trnN (asparagine), trnC (cysteine) and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes), with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  12. Perimeter trapping strategy to reduce Mediterranean fruit fly (Diptera: Tephritidae) damage on different host species in Israel.

    PubMed

    Cohen, H; Yuval, B

    2000-06-01

    To evaluate the perimeter trapping strategy as a control method, field tests were conducted in three different host species of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), in Israel. Dry traps baited with a three component food-based synthetic attractant that were hung in the peripheral rows of a plum, a pear, and a persimmon orchard, caught female C. capitata (up to 20.1, 1.4, and 4.1 female C. capitata per trap per day, respectively). Fruit damage, estimated at harvest, indicated a negligible percentage for the plum orchard (< 1%), 3% for the persimmon orchard (compared with 9% at an untreated neighboring plot), and no damaged fruit in the pear orchard. Finally, dissections of female C. capitata caught in dry traps on different host plant species indicate that a high percentage (range, 84-100%) contained mature eggs. The attraction of mature females to the dry traps might explain the successful results. Future research, to determine precisely how many traps should be placed and how frequently they should be serviced, is necessary before applying this strategy on a commercial basis.

  13. Seasonal Amounts of Nutrients in Western Cherry Fruit Fly (Diptera: Tephritidae) and Their Relation to Nutrient Availability on Cherry Plant Surfaces

    USDA-ARS?s Scientific Manuscript database

    Relatively little is known about the nutritional ecology of fruit flies in the genus Rhagoletis. In this study, nutrient amounts in male and female western cherry fruit fly, Rhagoletis indifferens Curran, and the availability of nitrogen and sugar on surfaces of leaves, fruit, and extrafloral necta...

  14. Dispersion of fruit flies (Diptera: Tephritidae) at high and low densities and consequences of mismatching dispersions of wild and sterile flies

    SciTech Connect

    Meats, A.

    2007-03-15

    Both wild and released (sterile) Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) and wild Bactrocera papayae (Drew and Hancock) in Australia had patchy distributions and comparisons with predictions of the negative binomial model indicated that the degree of clumping was sometimes very high, particularly at low densities during eradication. An increase of mean recapture rate of sterile B. tryoni on either of 2 trap arrays was not accompanied by a reduction in its coefficient of variation and when recapture rates were high, the percentage of traps catching zero decreased only slightly with increase in recapture rate, indicating that it is not practicable to decrease the heterogeneity of dispersion of sterile flies by increasing the number released. There was often a mismatch between the dispersion patterns of the wild and sterile flies, and the implications of this for the efficiency of the sterile insect technique (SIT) were investigated with a simulation study with the observed degrees of mismatch obtained from the monitoring data and assuming the overall ratio of sterile to wild flies to be 100:1. The simulation indicated that mismatches could result in the imposed rate of increase of wild flies being up to 3.5 times higher than that intended (i.e., 0.35 instead of 0.1). The effect of a mismatch always reduces the efficiency of SIT. The reason for this asymmetry is discussed and a comparison made with host-parasitoid and other systems. A release strategy to counter this effect is suggested. (author) [Spanish] Las moscas naturales y liberadas (esteriles) de Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) y Bactrocera papayae (Drew and Hancock) en Australia tuvieron distribuciones en parches y sus compariciones con las predicciones de un modelo binomial negativo indicaron un nivel de agregacion a veces fue muy alto, particularmente en las densidades bajas durante de eradicacion. Un aumento en el promedio de la tasa de B. tryoni esteriles recapturadas en las

  15. Development, genetic and cytogenetic analyses of genetic sexing strains of the Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae)

    PubMed Central

    2014-01-01

    Background Anastrepha ludens is among the pests that have a major impact on México's economy because it attacks fruits as citrus and mangoes. The Mexican Federal government uses integrated pest management to control A. ludens through the Programa Nacional Moscas de la Fruta [National Fruit Fly Program, SAGARPA-SENASICA]. One of the main components of this program is the sterile insect technique (SIT), which is used to control field populations of the pest by releasing sterile flies. Results To increase the efficiency of this technique, we have developed a genetic sexing strain (GSS) in which the sexing mechanism is based on a pupal colour dimorphism (brown-black) and is the result of a reciprocal translocation between the Y chromosome and the autosome bearing the black pupae (bp) locus. Ten strains producing wild-type (brown pupae) males and mutant (black pupae) females were isolated. Subsequent evaluations for several generations were performed in most of these strains. The translocation strain named Tapachula-7 showed minimal effect on survival and the best genetic stability of all ten strains. Genetic and cytogenetic analyses were performed using mitotic and polytene chromosomes and we succeeded to characterize the chromosomal structure of this reciprocal translocation and map the autosome breakpoint, despite the fact that the Y chromosome is not visible in polytene nuclei following standard staining. Conclusions We show that mitotic and polytene chromosomes can be used in cytogenetic analyses towards the development of genetic control methods in this pest species. The present work is the first report of the construction of GSS of Anastrepha ludens, with potential use in a future Moscafrut operational program. PMID:25472896

  16. Development, genetic and cytogenetic analyses of genetic sexing strains of the Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae).

    PubMed

    Zepeda-Cisneros, Cristina Silvia; Meza Hernández, José Salvador; García-Martínez, Víctor; Ibañez-Palacios, Jorge; Zacharopoulou, Antigone; Franz, Gerald

    2014-01-01

    Anastrepha ludens is among the pests that have a major impact on México's economy because it attacks fruits as citrus and mangoes. The Mexican Federal government uses integrated pest management to control A. ludens through the Programa Nacional Moscas de la Fruta [National Fruit Fly Program, SAGARPA-SENASICA]. One of the main components of this program is the sterile insect technique (SIT), which is used to control field populations of the pest by releasing sterile flies. To increase the efficiency of this technique, we have developed a genetic sexing strain (GSS) in which the sexing mechanism is based on a pupal colour dimorphism (brown-black) and is the result of a reciprocal translocation between the Y chromosome and the autosome bearing the black pupae (bp) locus. Ten strains producing wild-type (brown pupae) males and mutant (black pupae) females were isolated. Subsequent evaluations for several generations were performed in most of these strains. The translocation strain named Tapachula-7 showed minimal effect on survival and the best genetic stability of all ten strains. Genetic and cytogenetic analyses were performed using mitotic and polytene chromosomes and we succeeded to characterize the chromosomal structure of this reciprocal translocation and map the autosome breakpoint, despite the fact that the Y chromosome is not visible in polytene nuclei following standard staining. We show that mitotic and polytene chromosomes can be used in cytogenetic analyses towards the development of genetic control methods in this pest species. The present work is the first report of the construction of GSS of Anastrepha ludens, with potential use in a future Moscafrut operational program.

  17. A high-throughput detection method for invasive fruit fly (Diptera: Tephritidae) species based on microfluidic dynamic array.

    PubMed

    Jiang, Fan; Fu, Wei; Clarke, Anthony R; Schutze, Mark Kurt; Susanto, Agus; Zhu, Shuifang; Li, Zhihong

    2016-11-01

    Invasive species can be detrimental to a nation's ecology, economy and human health. Rapid and accurate diagnostics are critical to limit the establishment and spread of exotic organisms. The increasing rate of biological invasions relative to the taxonomic expertise available generates a demand for high-throughput, DNA-based diagnostics methods for identification. We designed species-specific qPCR primer and probe combinations for 27 economically important tephritidae species in six genera (Anastrepha, Bactrocera, Carpomya, Ceratitis, Dacus and Rhagoletis) based on 935 COI DNA barcode haplotypes from 181 fruit fly species publically available in BOLD, and then tested the specificity for each primer pair and probe through qPCR of 35 of those species. We then developed a standardization reaction system for detecting the 27 target species based on a microfluidic dynamic array and also applied the method to identify unknown immature samples from port interceptions and field monitoring. This method led to a specific and simultaneous detection for all 27 species in 7.5 h, using only 0.2 μL of reaction system in each reaction chamber. The approach successfully discriminated among species within complexes that had genetic similarities of up to 98.48%, while it also identified all immature samples consistent with the subsequent results of morphological examination of adults which were reared from larvae of cohorts from the same samples. We present an accurate, rapid and high-throughput innovative approach for detecting fruit flies of quarantine concern. This is a new method which has broad potential to be one of international standards for plant quarantine and invasive species detection.

  18. Is bigger better? Male body size affects wing-borne courtship signals and mating success in the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae).

    PubMed

    Benelli, Giovanni; Donati, Elisa; Romano, Donato; Ragni, Giacomo; Bonsignori, Gabriella; Stefanini, Cesare; Canale, Angelo

    2016-12-01

    Variations in male body size are known to affect inter- and intrasexual selection outcomes in a wide range of animals. In mating systems involving sexual signaling before mating, body size often acts as a key factor affecting signal strength and mate choice. We evaluated the effect of male size on courtship displays and mating success of the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae). Wing vibrations performed during successful and unsuccessful courtships by large and small males were recorded by high-speed videos and analyzed through frame-by-frame analysis. Mating success of large and small males was investigated. The effect of male-male competition on mating success was evaluated. Male body size affected both male courtship signals and mating outcomes. Successful males showed wing-borne signals with high frequencies and short interpulse intervals. Wing vibrations displayed by successful large males during copulation attempt had higher frequencies over smaller males and unsuccessful large males. In no-competition conditions, large males achieved higher mating success with respect to smaller ones. Allowing large and small males to compete for a female, large males achieve more mating success over smaller ones. Mate choice by females may be based on selection of the larger males, able to produce high-frequency wing vibrations. Such traits may be indicative of "good genes," which under sexual selection could means good social-interaction genes, or a good competitive manipulator of conspecifics. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  19. Combining field phenological observations with distribution data to model the potential distribution of the fruit fly Ceratitis rosa Karsch (Diptera: Tephritidae).

    PubMed

    de Villiers, M; Hattingh, V; Kriticos, D J

    2013-02-01

    Despite the potential for phenological and abundance data to improve the reliability of species niche models, they are seldom used. The aim of this study was to combine information on the distribution, relative abundance and seasonal phenology of Natal fruit fly, Ceratitis rosa Karsch (Diptera: Tephritidae), in South Africa to model its potential global distribution. Bucket traps, baited with Biolure, were used to trap C. rosa in different climatic regions of South Africa over a two-year period. A CLIMEX niche model of the potential global distribution of C. rosa was fitted using the collected trapping data and other distribution records from South Africa. Independent distribution records for elsewhere in Africa were reserved for model validation. The CLIMEX model results conformed well to the South African trapping data, including information on relative abundance and seasonal phenology, as well as to the pattern of presence records of the species elsewhere in Africa. The model suggests that under recent historical conditions a large part of South America, Central America, Mexico and southern USA may be climatically suitable for establishment of C. rosa. In Europe, climatically suitable habitat is restricted to coastal regions of the Mediterranean, in Asia, mostly to the southern and south eastern countries, and in Australia mostly to the wetter south and east. The independent cross-validation provided by South African relative abundance and seasonal phenology data, central African distribution data and relevant species specific biological information provides greater confidence in the modelled potential distribution of C. rosa.

  20. Sexual selection in true fruit flies (Diptera: Tephritidae): transcriptome and experimental evidences for phytochemicals increasing male competitive ability.

    PubMed

    Kumaran, Nagalingam; Prentis, Peter J; Mangalam, Kalimuthu P; Schutze, Mark K; Clarke, Anthony R

    2014-09-01

    In male tephritid fruit flies of the genus Bactrocera, feeding on secondary plant compounds (sensu lato male lures = methyl eugenol, raspberry ketone and zingerone) increases male mating success. Ingested male lures alter the male pheromonal blend, normally making it more attractive to females and this is considered the primary mechanism for the enhanced mating success. However, the male lures raspberry ketone and zingerone are known, across a diverse range of other organisms, to be involved in increasing energy metabolism. If this also occurs in Bactrocera, then this may represent an additional benefit to males as courtship is metabolically expensive and lure feeding may increase a fly's short-term energy. We tested this hypothesis by performing comparative RNA-seq analysis between zingerone-fed and unfed males of Bactrocera tryoni. We also carried out behavioural assays with zingerone- and cuelure-fed males to test whether they became more active. RNA-seq analysis revealed, in zingerone-fed flies, up-regulation of 3183 genes with homologues transcripts to those known to regulate intermale aggression, pheromone synthesis, mating and accessory gland proteins, along with significant enrichment of several energy metabolic pathways and gene ontology terms. Behavioural assays show significant increases in locomotor activity, weight reduction and successful mating after mounting; all direct/indirect measures of increased activity. These results suggest that feeding on lures leads to complex physiological changes, which result in more competitive males. These results do not negate the pheromone effect, but do strongly suggest that the phytochemical-induced sexual selection is governed by both female preference and male competitive mechanisms. © 2014 John Wiley & Sons Ltd.

  1. Production and quality assurance in the SIT Africa Mediterranean fruit fly (Diptera: Tephritidae) rearing facility in South Africa

    SciTech Connect

    Barnes, B.; Rosenberg, S.; Arnolds, L.; Johnson, J.

    2007-03-15

    A mass-rearing facility for Mediterranean fruit fly Ceratitis capitata (Wiedemann) was commissioned in Stellenbosch in 1999 to produce sterile male fruit flies for a sterile insect technique (SIT) project in commercial fruit orchards and vineyards in the Western Cape province of South Africa. The mass-rearing procedure was largely based on systems developed by the FAO/IAEA Agriculture and Biotechnology Laboratory, Seibersdorf, Austria. A number of genetic sexing strains were used to produce only males for release. Initial cramped rearing and quality management conditions were alleviated in 2001 with the construction of a new adult rearing room and quality control laboratory. In 2002 a comprehensive Quality Management System was implemented, and in 2003 an improved genetic sexing strain, VIENNA 8, was supplied by the FAO/IAEA Laboratory in Seibersdorf. For most of the first 3 years the facility was unable to supply the required number of sterile male Mediterranean fruit flies for the SIT program without importing sterile male pupae from another facility. From mid-2002, after the quality management system was implemented, both production and quality improved but remained below optimum. After the introduction of the VIENNA 8 genetic sexing strain, and together with an improvement in the climate control equipment, production stability, and quality assurance parameters improved substantially. The critical factors influencing production and quality were an inadequate rearing infrastructure, problems with the quality of the larval diet, and the initial absence of a quality management system. The results highlight the importance of effective quality management, the value of a stable and productive genetic sexing strain, and the necessity for a sound funding base for the mass-rearing facility. (author) [Spanish] La facilidad para criar en masa la mosca mediterranea de la fruta, Ceratitis capitata (Wiedemann) fue comisionada en Stellenbosch en 1999 para producir machos

  2. Evaluation of SPLAT with spinosad and methyl eugenol or cue-lure for "attract-and-kill" of oriental and melon fruit flies (Diptera: Tephritidae) in Hawaii.

    PubMed

    Vargas, Roger I; Stark, John D; Hertlein, Mark; Neto, Agenor Mafra; Coler, Reginald; Piñero, Jaime C

    2008-06-01

    Specialized Pheromone and Lure Application Technology (SPLAT) methyl eugenol (ME) and cue-lure (C-L) "attract-and-kill" sprayable formulations containing spinosad were compared with other formulations under Hawaiian weather conditions against oriental fruit fly, Bactrocera dorsalis (Hendel), and melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae), respectively. Field tests were conducted with three different dispensers (Min-U-Gel, Acti-Gel, and SPLAT) and two different insecticides (naled and spinosad). SPLAT ME with spinosad was equal in performance to the standard Min-U-Gel ME with naled formulation up to 12 wk. SPLAT C-L with spinosad was equal in performance to the standard Min-U-Gel C-L with naled formulation during weeks 7 to12, but not during weeks 1-6. In subsequent comparative trials, SPLAT ME + spinosad compared favorably with the current standard of Min-U-Gel ME + naled for up to 6 wk, and it was superior from weeks 7 to 12 in two separate tests conducted in a papaya (Carica papaya L.) orchard and a guava (Psidium guajava L.) orchard, respectively. In outdoor paired weathering tests (fresh versus weathered), C-L dispensers (SPLAT + spinosad, SPLAT + naled, and Min-U-Gel + naled) were effective up to 70 d. Weathered ME dispensers with SPLAT + spinosad compared favorably with SPLAT + naled and Min-U-Gel + naled, and they were equal to fresh dispensers for 21-28 d, depending on location. Our current studies indicate that SPLAT ME and SPLAT C-L sprayable attract-and-kill dispensers containing spinosad are a promising substitute for current liquid organophosphate insecticide formulations used for areawide suppression of B. dorsalis and B. cucurbitae in Hawaii.

  3. Analysis of Seasonal Risk for Importation of the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae), via Air Passenger Traffic Arriving in Florida and California.

    PubMed

    Szyniszewska, A M; Leppla, N C; Huang, Z; Tatem, A J

    2016-09-04

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is one of the most economically damaging pests in the world and has repeatedly invaded two major agricultural states in the United States, Florida and California, each time requiring costly eradication. The Mediterranean fruit fly gains entry primarily in infested fruit carried by airline passengers and, since Florida and California each receive about 13 million international passengers annually, the risk of Mediterranean fruit fly entering the United States is potentially very high. The risk of passengers bringing the pest into Florida or California from Mediterranean fruit fly-infested countries was determined with two novel models, one estimated seasonal variation in airline passenger number and the other defined the seasonal and spatial variability in Mediterranean fruit fly abundance. These models elucidated relationships among the risk factors for Mediterranean fruit fly introduction, such as amount of passenger traffic, routes traveled, season of travel, abundance of Mediterranean fruit fly in countries where flights departed, and risk of the pest arriving at destination airports. The risk of Mediterranean fruit fly being introduced into Florida was greatest from Colombia, Brazil, Panama, Venezuela, Argentina, and Ecuador during January-August, whereas primarily the risk to California was from Brazil, Panama, Colombia, and Italy in May-August. About three times more Mediterranean fruit flies were intercepted in passenger baggage at airports in Florida than California, although the data were compromised by a lack of systematic sampling and other limitations. Nevertheless, this study achieved the goal of analyzing available data on seasonal passenger flow and Mediterranean fruit fly population levels to determine when surveillance should be intensified at key airports in Florida and California.

  4. Quality control method to measure predator evasion in wild and mass-reared Mediterranean fruit flies (Diptera: Tephritidae)

    SciTech Connect

    Hendrichs, M.; Wornoayporn, V.; Hendrichs, J.

    2007-03-15

    Sterile male insects, mass-reared and released as part of sterile insect technique (SIT) programs, must survive long enough in the field to mature sexually and compete effectively with wild males for wild females. An often reported problem in Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) SIT programs is that numbers of released sterile males decrease rapidly in the field for various reasons, including losses to different types of predators. This is a serious issue in view that most operational programs release sterile flies at an age when they are still immature. Previous field and field-cage tests have confirmed that flies of laboratory strains are less able to evade predators than wild flies. Such tests involve, however, considerable manipulation and observation of predators and are therefore not suitable for routine measurements of predator evasion. Here we describe a simple quality control method with aspirators to measure agility in medflies and show that this parameter is related to the capacity of flies to evade predators. Although further standardization of the test is necessary to allow more accurate inter-strain comparisons, results confirm the relevance of measuring predator evasion in mass-reared medfly strains. Besides being a measure of this sterile male quality parameter, the described method could be used for the systematic selection of strains with a higher capacity for predator evasion. (author) [Spanish] Insectos machos esteriles criados en forma masiva para ser liberados en programas que utilizan la tecnica del insecto esteril (TIE), tienen que tener la capacidad de sobrevivir en el campo el tiempo necesario para poder madurar sexualmente y competir efectivamente con los machos silvestres por hembras silvestres. Un problema frecuentemente reportado por dichos programas de la mosca del Mediterraneo, Ceratitis capitata (Wiedemann), es que el numero de machos esteriles de laboratorio liberados en el campo, decrecen rapidamente por

  5. First instar larvae morphology of Opiinae (Hymenoptera: Braconidae) parasitoids of Anastrepha (Diptera: Tephritidae) fruit flies. Implications for interspecific competition.

    PubMed

    Murillo, Félix D; Liedo, Pablo; Nieto-López, María Guadalupe; Cabrera-Mireles, Héctor; Barrera, Juan F; Montoya, Pablo

    2016-05-01

    The morphology of the first instars of the Opiinae braconids Diachasmimorpha longicaudata, Doryctobracon areolatus, Doryctobracon crawfordi, Utetes anastrephae and Opius hirtus (the first is exotic, and the others are natives to Mexico), parasitoids of Anastrepha fruit flies, are described and compared. The possible implications on interspecific competition among these species are discussed. The most significant adaptations found were: (1) the mouth apparatus, where the large mandibles and fang-shaped maxillary lobes present in D. longicaudata and U. anastrephae larvae were absent in O. hirtus, D. areolatus and D. crawfordi larvae, and (2) the degree of mobility for exploration and escape, such as the lateral and caudal appendages that were only present in D. longicaudata (ventrolateral appendages in the base of the head capsule), U. anastrephae (caudal lobe with two appendages) and D. areolatus (caudal lobe with a round apex with a globular shape). The first instar larvae of the species D. longicaudata show morphological adaptations that apparently confer competitive advantages against the larvae of D. areolatus, D. crawfordi and O. hirtus. However, the first instar larvae of U. anastrephae show larger mandibles, an adaptation that could enable this species to resist competition from D. longicaudata. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Molecular characterization and functional analysis of BdFoxO gene in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Wu, Yi-Bei; Yang, Wen-Jia; Xie, Yi-Fei; Xu, Kang-Kang; Tian, Yi; Yuan, Guo-Rui; Wang, Jin-Jun

    2016-03-10

    The forkhead box O transcription factor (FoxO) is an important downstream transcription factor in the well-conserved insulin signaling pathway, which regulates the body size and development of insects. In this study, the FoxO gene (BdFoxO) was identified from the oriental fruit fly, Bactrocera dorsalis (Hendel). The open reading frame of BdFoxO (2732 bp) encoded a 910 amino acid protein, and the sequence was well conserved with other insect species. The BdFoxO was highly expressed in larvae and pupae among different development stages, and the highest tissue-specific expression level was found in the fat bodies compared to the testis, ovary, head, thorax, midgut, and Malpighian tubules of adults. Interestingly, we found BdFoxO expression was also up-regulated by starvation, but down-regulated when re-fed. Moreover, the injection of BdFoxO double-stranded RNAs into third-instar larvae significantly reduced BdFoxO transcript levels, which in turn down-regulated the expression of other four genes in the insulin signaling pathway. The silencing of BdFoxO resulted in delayed pupation, and the insect body weight increased significantly compared with that of the control. These results suggested that BdFoxO plays an important role in body size and development in B. dorsalis. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae) and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region

    PubMed Central

    Vargas, Roger I.; Piñero, Jaime C.; Leblanc, Luc

    2015-01-01

    Fruit flies (Diptera: Tephritidae) are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled) and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM) Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas. PMID:26463186

  8. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae) and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region.

    PubMed

    Vargas, Roger I; Piñero, Jaime C; Leblanc, Luc

    2015-04-03

    Fruit flies (Diptera: Tephritidae) are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled) and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM) Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas.

  9. Spatial dynamics of two oriental fruit fly (Diptera: Tephritidae) parasitoids, Fopius arisanus and Diachasmimorpha longicaudata (Hymenoptera: Braconidae), in a Guava orchard in Hawaii.

    PubMed

    Vargas, Roger I; Stark, John D; Banks, John; Leblanc, Luc; Manoukis, Nicholas C; Peck, Steven

    2013-10-01

    We examined spatial patterns of both sexes of oriental fruit fly, Bactrocera dorsalis (Hendel), and its two most abundant parasitoids, Fopius arisanus (Sonan) and Diachasmimorpha longicaudata (Ashmead) in a commercial guava (Psidium guajava L.) orchard. Oriental fruit fly spatial patterns were initially random, but became highly aggregated with host fruit ripening and the subsequent colonization of, first, F. arisanus (egg-pupal parasitoid) and, second, D. longicaudata (larval-pupal parasitoid). There was a significant positive relationship between populations of oriental fruit fly and F. arisanus during each of the F. arisanus increases, a pattern not exhibited between oriental fruit fly and D. longicaudata. Generally, highest total numbers of males and females (oriental fruit fly, F. arisanus, and D. longicaudata) occurred on or about the same date. There was a significant positive correlation between male and female populations of all three species; we measured a lag of 2-4 wk between increases of female F. arisanus and conspecific males. There was a similar trend in one of the two years for the second most abundant species, D. longicaudata, but no sign of a time lag between the sexes for oriental fruit fly. Spatially, we found a significant positive relationship between numbers of F. arisanus in blocks and the average number in adjoining blocks. We did not find the same effect for oriental fruit fly and D. longicaudata, possibly a result of lower overall numbers of the latter two species or less movement of F. arisanus within the field.

  10. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    2010-01-01

    Background Quantitative real-time reverse transcriptase PCR (RT-qPCR) has been widely used for quantification of mRNA as a way to determine key genes involved in different biological processes. For accurate gene quantification analysis, normalization of RT-qPCR data is absolutely essential. To date, normalization is most frequently achieved by the use of internal controls, often referred to as reference genes. However, several studies have shown that the reference genes used for the quantification of mRNA expression can be affected by the experimental set-up or cell type resulting in variation of the expression level of these key genes. Therefore, the evaluation of reference genes is critical for gene expression profiling, which is often neglected in gene expression studies of insects. For this purpose, ten candidate reference genes were investigated in three different tissues (midgut, Malpighian tubules, and fat body) of the oriental fruit fly, Bactrocera dorsalis (Hendel). Results Two different programs, geNorm and Normfinder, were used to analyze the data. According to geNorm, α-TUB + ACT5 are the most appropriate reference genes for gene expression profiling across the three different tissues in the female flies, while ACT3 + α-TUB are considered as the best for males. Furthermore, we evaluated the stability of the candidate reference genes to determine the sexual differences in the same tissue. In the midgut and Malpighian tubules, ACT2 + α-TUB are the best choice for both males and females. However, α-TUB + ACT1 are the best pair for fat body. Meanwhile, the results calculated by Normfinder are quite the same as the results with geNorm; α-TUB is always one of the most stable genes in each sample validated by the two programs. Conclusions In this study, we validated the suitable reference genes for gene expression profiling in different tissues of B. dorsalis. Moreover, appropriate reference genes were selected out for gene expression profiling of the

  11. Gas-exchange patterns of Mediterranean fruit fly Pupae (Diptera: Tephritidae): A tool to forecast developmental stage

    SciTech Connect

    Nestel, D.; Nemny-Lavy, E.; Alchanatis, V.

    2007-03-15

    The pattern of gas-exchange (CO{sub 2} emission) was investigated for developing Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) pupae incubated at different temperatures. This study was undertaken to explore the usefulness of gas-exchange systems in the determination of physiological age in developing pupae that are mass produced for sterile insect technique projects. The rate of CO{sub 2} emission was measured in a closed flow-through system connected to commercial infrared gas analysis equipment. Metabolic activity (rate of CO{sub 2} emission) was related to pupal eye-color, which is the current technique used to determine physiological age. Eye-color was characterized digitally with 3 variables (Hue, Saturation and Intensity), and color separated by discriminant analysis. The rate of CO{sub 2} emission throughout pupal development followed a U-shape, with high levels of emission during pupariation, pupal transformation and final pharate adult stages. Temperature affected the development time of pupae, but not the basic CO{sub 2} emission patterns during development. In all temperatures, rates of CO{sub 2} emission 1 and 2 d before adult emergence were very similar. After mid larval-adult transition (e.g., phanerocephalic pupa), digital eye-color was significantly correlated with CO{sub 2} emission. Results support the suggestion that gas-exchange should be explored further as a system to determine pupal physiological age in mass production of fruit flies. (author) [Spanish] En el presente estudio se investigaron los patrones de intercambio gaseoso (emision de CO{sub 2}) en pupas de la mosca de las frutas del Mediterraneo (Ceratitis capitata Wiedemann) incubadas a diferentes temperaturas. El estudio fue realizado con la finalidad de explorar la utilizacion de sistemas de intercambio gaseoso en la determinacion de la edad fisiologica de pupas durante su produccion masiva en proyectos de mosca esteril. La proporcion de emision de CO{sub 2} fue

  12. Sexual performance of mass reared and wild Mediterranean fruit flies (Diptera: Tephritidae) from various origins of the Madeira Islands

    SciTech Connect

    Pereira, R.; Silva, N.; Quintal, C.; Abreu, R.; Andrade, J.; Dantas, L.

    2007-03-15

    The success of Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) control programs integrating the sterile insect technique (SIT) is based on the capacity of released the sterile males to compete in the field for mates. The Islands of Madeira are composed of 2 populated islands (Madeira and Porto Santo) where the medfly is present. To evaluate the compatibility and sexual performance of sterile flies we conducted a series of field cage tests. At same time, the process of laboratory domestication was evaluated. 3 wild populations, one semi-wild strain, and 1 mass reared strain were evaluated: the wild populations of (1) Madeira Island (north coast), (2) Madeira Island (south coast), and (3) Porto Santo Island; (4) the semi-wild population after 7 to 10 generations of domestication in the laboratory (respectively, for first and second experiment); and (5) the genetic sexing strain in use at Madeira medfly facility (VIENNA 7mix2000). Field cage experiments showed that populations of all origins are mostly compatible. There were no significant differences among wild populations in sexual competitiveness. Semi-wild and mass-reared males performed significantly poorer in both experiments than wild males in achieving matings with wild females. The study indicates that there is no significant isolation among strains tested, although mating performance is reduced in mass-reared and semi-wild flies after 7 to 10 generations in the laboratory. (author) [Spanish] El exito de los programas de control de la mosca mediterranea de la fruta (Ceratitis capitata (Wiedemann) que integran la tecnica del insecto esteril (TIE) esta basado en la capacidad de machos esteriles para competir en el campo por sus parejas. Las Islas de Madeira consisten de 2 islas pobladas (Madeira y Porto Santo) donde la mosca mediterranea de la fruta esta presente. Para evaluar la compatibilidad y el funcionamiento sexual de moscas esteriles nosotros realizamos una serie de pruebas de jaula en el

  13. Mass trapping is as effective as ground bait sprays for the control of Anastrepha (Diptera: Tephritidae) fruit flies in mango orchards.

    PubMed

    Villalobos, Jorge; Flores, Salvador; Liedo, Pablo; Malo, Edi A

    2017-10-01

    Anastrepha fruit flies are considered one of the main phytosanitary problems for the fresh fruit industry in the USA, Caribbean islands and Latin America. Since 1994, the Mexican government has implemented the National Fruit Fly Program using an area-wide integrated pest management approach. In this paper, we evaluate the effectiveness of mass trapping and compare it with ground GF-120 spraying against Anastrepha obliqua and Anastrepha ludens populations in mango cv. Ataulfo orchards. Multilure® traps baited with Ceratrap® or Biolure® captured significantly more fruit flies than Captor 300 in field cage tests. Mass trapping and ground GF-120 spray significantly suppressed fruit fly populations compared with untreated plots. In Multilure traps placed in untreated plots, we captured significantly more fruit flies than in treated plots with mass trapping or GF-120 sprays. Plots treated with either mass trapping or GF-120 sprays reduced the percentage of infested fruit significantly compared with untreated plots. There was no difference between mass trapping and GF-120 ground bait spraying. Our results demonstrate that mass trapping was as effective as GF-120 ground spraying for the control of fruit flies in mango cv. Ataulfo orchards. The suppression effect of mass trapping was similar to GF-120 ground bait spraying. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  14. Weathering trials of Amulet cue-lure and Amulet methyl eugenol "attract-and-kill" stations with male melon flies and oriental fruit flies (Diptera: Tephritidae) in Hawaii.

    PubMed

    Vargas, Roger I; Stark, John D; Mackey, Bruce; Bull, Richard

    2005-10-01

    Amulet C-L (cue-lure) and Amulet ME (methyl eugenol) molded paper fiber "attract-and-kill" dispensers containing fipronil were tested under Hawaiian weather conditions against Bactrocera cucurbitae (Coquillett) (melon fly) and Bactrocera dorsalis (Hendel) (oriental fruit fly), respectively. In paired tests (fresh versus weathered), C-L dispensers were effective for at least 77 d, whereas ME dispensers were effective for at least 21 d. Thus, C-L dispensers exceeded, whereas ME dispensers did not meet the label interval replacement recommendation of 60 d. Addition of 4 ml of ME to 56-d-old ME dispensers restored attraction and kill for an additional 21 d. This result suggested the fipronil added at manufacture was still effective. By enclosing and weathering ME dispensers inside small plastic bucket traps, longevity of ME dispensers was extended up to 56 d. Fipronil ME and C-L dispensers also were compared, inside bucket traps, to other toxicants: spinosad, naled, DDVP, malathion, and permethrin. Against B. dorsalis, fipronil ME dispensers compared favorably only up to 3 wk. Against B. cucurbitae, fipronil C-L dispensers compared favorably for at least 15 wk. Our results suggest that fipronil C-L dispensers can potentially be used in Hawaii; however, fipronil ME dispensers need to be modified or protected from the effects of weathering to extend longevity and meet label specifications. Nonetheless, Amulet C-L and ME dispensers are novel prepackaged formulations containing C-L or ME and fipronil that are more convenient and safer to handle than current liquid insecticide formulations used for areawide suppression of B. dorsalis and B. cucurbitae in Hawaii.

  15. Assessment of Navel oranges, Clementine tangerines and Rutaceous fruits as hosts of Bactrocera cucurbitae and Bactrocera latifrons (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Export of Citrus spp., widely cultivated throughout the tropics and subtropics, may require risk mitigation measures if grown in areas with established tephritid fruit fly (Diptera: Tephritidae) populations capable of infesting the fruits. Two tephritid fruit fly species whose geographic ranges have...

  16. Longevity of multiple species of tephritid (Diptera) fruit fly parasitoids (Hymenoptera: Braconidae: Opiinae) provided exotic and sympatric-fruit based diets.

    PubMed

    Stuhl, Charles; Cicero, Lizette; Sivinski, John; Teal, Peter; Lapointe, Stephen; Paranhos, Beatriz Jordão; Aluja, Martín

    2011-11-01

    While adult parasitic Hymenoptera in general feed on floral and extrafloral nectars, hemipteran-honeydews and fluids from punctured hosts, Diachasmimorpha longicaudata (Ashmead), an Old World opiine braconid introduced to tropical/subtropical America for the biological control of Anastrepha spp. (Tephritidae), can survive on fruit juices as they seep from injured fruit. An ability to exploit fruit juice would allow such a parasitoid to efficiently forage for hosts and food sources simultaneously. Two New World opiines, Doryctobracon areolatus (Szepligeti) and Utetes anastrephae (Viereck), are also prominent Anastrepha parasitoids and are roughly sympatric. All three species were provided with: (1) pulp and juice diets derived from a highly domesticated Old World fruit (orange, Citrus sinensis L.) that is only recently sympatric with the Mexican flies and parasitoids and so offered little opportunity for the evolution of feeding-adaptations and (2) a less-domesticated New World fruit (guava, Psidium guajava L.), sympatric over evolutionary time with D. areolatus and U. anastrephae. Both sexes of D. longicaudata died when provided guava pulp or juice at a rate similar to a water-only control. D. areolatus and U. anastrephae, presumably adapted to the nutrient/chemical constituents of guava, also died at a similar rate. Survival of all three species on orange pulp and juice was greater than on water, and often equaled that obtained on a honey and water solution. In confirmatory experiments in Mexico, D. areolatus and U. anastrephae, as well as other tephritid parasitoids Doryctobracon crawfordi (Viereck) and Opius hirtus (Fisher), all died at a significantly higher rates when provided guava in comparison to a honey and water diet. Such a result is likely due to guavas being repellent, innutritious or toxic. D. longicaudata clearly consumed guava juice tagged with a colored dye. Dilutions of orange and guava juice resulted in shorter lifespans than dilutions of orange

  17. Seasonal amounts of nutrients in Western cherry fruit fly (Diptera: Tephritidae) and their relation to nutrient availability on cherry plant surfaces.

    PubMed

    Yee, Wee L; Chapman, Peter S

    2008-10-01

    Relatively little is known about the nutritional ecology of fruit flies in the genus Rhagoletis. In this study, nutrient amounts in male and female western cherry fruit fly, Rhagoletis indifferens Curran, and availability of nitrogen and sugar on surfaces of leaves, fruit, and extrafloral nectaries (EFNs) of sweet cherry trees, were determined from late May to late June 2005 and of sugar from EFNs from mid-May to late June 2007 in Washington state. Protein amounts in male and female flies did not differ over the season. Nitrogen was present on leaves, fruit, and EFNs during the sampling period, but amounts on leaves and fruit were lower in late May than the rest of the season. Sugar amounts in flies did not differ over the season. Sugar was present on leaf, fruit, and EFN surfaces all season, but amounts on all three were lower in late May than later in the season. Fructose and glucose were the predominant sugars on all plant surfaces, but sucrose was also present in nectar from EFNs. In outdoor and field cage experiments in 2004 and 2006, more flies survived when cherry branches with leaves and fruit were present than absent. Results suggest that R. indifferens maintains stable protein and sugar levels throughout the season because sufficient amounts of nutrients are found in cherry trees during this time and that increases in nutrient availability caused by ripening and damaged cherries later in the season do not result in increased amounts of nutrients in flies.

  18. Host plants of Melon Fly, Bactrocera cucurbitae(Coquillett)(Diptera:Tephritidae); and provisional list of suitable host plants of the Melon Fly, Bactrocera(Zeugodacus)cucurbitae(Coquillett)(Diptera:Tephritidae),Version 2.0

    USDA-ARS?s Scientific Manuscript database

    The melon fly, Bactrocera cucurbitae (Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with...

  19. Bartonella species in bat flies (Diptera: Nycteribiidae) from western Africa.

    PubMed

    Billeter, S A; Hayman, D T S; Peel, A J; Baker, K; Wood, J L N; Cunningham, A; Suu-Ire, R; Dittmar, K; Kosoy, M Y

    2012-03-01

    Bat flies are obligate ectoparasites of bats and it has been hypothesized that they may be involved in the transmission of Bartonella species between bats. A survey was conducted to identify whether Cyclopodia greefi greefi (Diptera: Nycteribiidae) collected from Ghana and 2 islands in the Gulf of Guinea harbour Bartonella. In total, 137 adult flies removed from Eidolon helvum, the straw-coloured fruit bat, were screened for the presence of Bartonella by culture and PCR analysis. Bartonella DNA was detected in 91 (66·4%) of the specimens examined and 1 strain of a Bartonella sp., initially identified in E. helvum blood from Kenya, was obtained from a bat fly collected in Ghana. This is the first study, to our knowledge, to report the identification and isolation of Bartonella in bat flies from western Africa.

  20. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications.

    PubMed

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  1. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    NASA Astrophysics Data System (ADS)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  2. Simulated field applications of insecticide soil drenches for control of Tephritid fruit flies

    USDA-ARS?s Scientific Manuscript database

    A key component in tephritid fruit fly (Diptera: Tephritidae) area-wide IPM programs has been application of insecticidal soil drenches under the drip line of host trees where fruit flies have been detected and as a regulatory treatment in the certification process for movement of nursery stock outs...

  3. Recent progress in a classical biological control program for olive fruit fly in California

    USDA-ARS?s Scientific Manuscript database

    The olive fruit fly, Bactrocera oleae (Diptera: Tephritidae), causes severe damage to olive production worldwide. Control of olive fruit fly typically relies on pesticides, and under such conditions the impact of natural enemies is relatively low. About 15 years ago, the USDA-ARS European Biologic...

  4. Breakfast of champions or kiss of death? Survival and sexual performance of protein-fed, sterile Mediterranean fruit flies (Diptera: Tephritidae)

    SciTech Connect

    Yuval, B.; Maor, M.; Levy, K.; Kaspi, R.; Taylor, P.; Shelly, T.

    2007-03-15

    The sterile insect technique (SIT) is increasingly being used around the world to control Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the Mediterranean fruit fly as part of an area-wide integrated approach. One option that may improve the effectiveness of the SIT, by increasing the sexual competitiveness of released sterile males, consists of feeding males protein during the post-teneral stage, a diet that increases sexual performance of wild males. We examine the effects of diet on the successive hurdles males must overcome in order to inseminate females, i.e., joining leks, copulating females, having their sperm stored and inhibition of female remating. In addition, we address the effects of diet on post-release foraging success, longevity, and the ability to withstand starvation. While protein feeding universally increases the sexual success of wild males, its effect on sterile males varies with strain, experimental settings, and environmental conditions. In some cases, treatments that resulted in the best sexual performance were significantly associated with increased vulnerability to starvation. However, no particular diet affected the ability of sterile males to find nutrients in the field when these where available. We suggest it may be better to release relatively short-lived flies that are highly competitive, rather than long-lived, sexually ineffective ones. (author) [Spanish] El uso de la tecnica de insecto esteril (TIE) esta aumentando alrededor del mundo para el control de Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), la mosca mediterranea de la fruta como parte de un enfoque integrado por toda el area. Una opcion que puede mejorar la eficiencia de TIE, por medio del aumento de la capacidad de los machos esteriles liberados para competir, consiste en la alimentacion de los machos con proteina durante la etapa de pos-teneral, una dieta que aumenta el desempeno sexual de los machos naturales. Nosotros examinamos los efectos de la

  5. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae)

    PubMed Central

    Haq, Ihsan ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J. B.

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8–1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8–1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8–1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8–1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  6. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    PubMed

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  7. Ammonium carbonate loss rates from lures differentially affect trap captures of Rhagoletis indifferens (Diptera: Tephritidae) and non-target flies

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherry (Prunus spp.) in western North America that can be monitored using traps baited with ammonia. However, ammonia-based attractants also attract non-target Diptera that clutter traps. Here, the hypothe...

  8. Evaluation of SPLAT with Spinosad and Methyl Eugenol or Cue-Lure for "Attract-and-Kill" of Oriental and Melon Fruit Flies (Diptera: Tephritidae) in Hawaii

    USDA-ARS?s Scientific Manuscript database

    SPLAT(TM) ME (methyl eugenol) and C-L (cue-lure) “attract and kill” sprayable formulations containing spinosad were compared to other formulations under Hawaiian weather conditions against Bactrocera dorsalis (Hendel), oriental fruit fly, and B. cucurbitae (Coquillett), melon fly, respectively. Fie...

  9. Comparison of brown sugar, hot water, and salt methods for detecting western cherry fruit fly (Diptera: Tephritidae) larvae in sweet cherry

    USDA-ARS?s Scientific Manuscript database

    Brown sugar or hot water methods have been developed to detect larvae of tephritid fruit flies in post-harvest fruit in order to maintain quarantine security. It would be useful to determine if variations of these methods can yield better results and if less expensive alternatives exist. This stud...

  10. A calendrical method for predicting generation cycles of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae), triggering citrus quarantines in south Texas

    USDA-ARS?s Scientific Manuscript database

    The Mexican fruit fly is an invasive pest of citrus and other commercial fruits that triggers quarantine restrictions when it is detected in the United States. The citrus crop in south Texas is especially vulnerable to infestations because of its proximity to the border areas of Mexico where the pe...

  11. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets

    USDA-ARS?s Scientific Manuscript database

    Background The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family ...

  12. Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

    PubMed Central

    2009-01-01

    The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits. PMID:21637665

  13. The preimaginal phases and development of Pachycrepoideus vindemmiae (Hymenoptera, Pteromalidae) on Mediterranean fruit fly, Ceratitis capitata (Diptera, Tephritidae).

    PubMed

    Tormos, José; Beitia, Francisco; Böckmann, Elias A; Asís, Josep D; Fernández, Severiano

    2009-10-01

    The development and morphology of the immature phases of Pachycrepoideus vindemmiae (Rondani, 1875) (Hymenoptera, Pteromalidae) are described from a laboratory rearing culture maintained on Ceratitis capitata (Wiedemann, 1824) (Diptera, Tephritidae) using microscopic techniques, including light and scanning electron microscopy. The surface of the chorion of the egg is granulated, and the micropyle occurs at the anterior end. The labrum of the first instar larva does not have sensilla, and the second to fourth instar larvae have setae on the head. The mature larva is characterized by the position and number of the integumental differentiations (sensilla and setae). On completion of larval development, an adecticous and exarate pupa is produced. As for the adult, the mandibles of the pupae are toothed. Five larval instars are recorded, based on statistical analyses of the sizes of the larval mandibles in combination with characters such as the number of exuviae and excretion of the meconium. Developmental time from egg to adult emergence was 18-20 days for males and 21-23 days for females at 21-26 degrees C, 55-85 relative humidity, and a 16L:8D photoperiod. The results show that the eggs and different larval instars of this parasitoid can be unambiguously identified only by scanning electron microscope.

  14. [Fruit flies (Diptera: Tephritidae) and their parasitoids (Hymenoptera: Braconidae) associated to host plants in the southern region of Bahia State].

    PubMed

    Bittencourt, M A L; da Silva, A C M; Silva, V E S; Bomfim, Z V; Guimarães, J A; de Souza Filho, M F; Araujo, E L

    2011-01-01

    The association among Anastrepha species, braconid parasitoids and host fruits in southern Bahia is recorded. Doryctobracon areolatus (Szépligeti) was associated with A. serpentina (Wied.) in Pouteria caimito, A. bahiensis Lima in Helicostylis tomentosa, A. sororcula Zucchi in Eugenia uniflora, and A. obliqua (Macquart) in Spondias purpurea. Anatrepha obliqua was unique in fruits of Averrhoa carambola, but associated with D. areolatus, Asobara anastrephae (Muesebeck) and Utetes anastrephae (Viereck). In Achras sapota, A. serpentina was associated with A. anastrephae and D. areolatus, while in Psidium guajava, A. fraterculus (Wied.) and A. sororcula were associated with D. areolatus and U. anastrephae.

  15. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    PubMed

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Development of Rhagoletis pomonella and Rhagoletis indifferens (Diptera: Tephritidae)in mango and other tropical and temperate fruit in the laboratory

    USDA-ARS?s Scientific Manuscript database

    Temperate fruit flies in the genus Rhagoletis (Diptera: Tephritidae) have narrow host ranges relative to those of tropical fruit flies, suggesting they will not attack or are incapable of developing in most novel fruit. Here we tested the hypothesis that apple maggot fly, Rhagoletis pomonella (Wals...

  17. Natural field infestation of Mangifera casturi and M.lalijiwa by oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Mango, Mangifera indica, is a crop cultivated pantropically. There are, however, many other Mangifera spp. (“mango relatives”) which have much more restricted distributions and are poorly known, but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapp...

  18. Efficacy of Chemicals for the Potential Management of the Queensland Fruit Fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    PubMed

    Reynolds, Olivia L; Osborne, Terrence J; Barchia, Idris

    2017-05-09

    This study investigated alternative in-field chemical controls against Bactrocera tryoni (Froggatt). Bioassay 1 tested the mortality of adults exposed to fruit and filter paper dipped in insecticide, and the topical application of insecticide to adults/fruit. Bioassay 2 measured the mortality of adults permitted to oviposit on fruit dipped in insecticide and aged 0, 1, 3, or 5 days, plus the production of offspring. Bioassay 3 tested infested fruit sprayed with insecticide. The field bioassay trialed the mortality of adults exposed to one- and five-day insecticide residues on peaches, and subsequent offspring. Abamectin, alpha-cypermethrin, clothianidin, dimethoate (half-label rate), emamectin benzoate, fenthion (half- and full-label rate), and trichlorfon were the most efficacious in bioassay 1, across 18 tested insecticide treatments. Overall, the LT50 value was lowest for fenthion (full-label rate), clothianidin, and alpha-cypermethrin. Fenthion, emamectin benzoate, and abamectin had the greatest effect on adult mortality and offspring production. Infested fruit treated with acetamiprid, fenthion, and thiacloprid produced no/very few offspring. Alpha-cypermethrin demonstrated good field efficacy against adults (one day post treatment: 97.2% mortality, five day post treatment: 98.8% mortality) and subsequent offspring (100% across one and five day post treatments), comparable to that of fenthion (full-label rate) (100% mortality for offspring and adults across both post treatments). Alpha-cypermethrin is a possible alternative to fenthion against B. tryoni; as a pyrethroid, it may not be desirable if adjunct biological control is imperative. Thiacloprid and Acetamiprid may be useful as a post-harvest treatment.

  19. Efficacy of Chemicals for the Potential Management of the Queensland Fruit Fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae)

    PubMed Central

    Reynolds, Olivia L.; Osborne, Terrence J.; Barchia, Idris

    2017-01-01

    This study investigated alternative in-field chemical controls against Bactrocera tryoni (Froggatt). Bioassay 1 tested the mortality of adults exposed to fruit and filter paper dipped in insecticide, and the topical application of insecticide to adults/fruit. Bioassay 2 measured the mortality of adults permitted to oviposit on fruit dipped in insecticide and aged 0, 1, 3, or 5 days, plus the production of offspring. Bioassay 3 tested infested fruit sprayed with insecticide. The field bioassay trialed the mortality of adults exposed to one- and five-day insecticide residues on peaches, and subsequent offspring. Abamectin, alpha-cypermethrin, clothianidin, dimethoate (half-label rate), emamectin benzoate, fenthion (half- and full-label rate), and trichlorfon were the most efficacious in bioassay 1, across 18 tested insecticide treatments. Overall, the LT50 value was lowest for fenthion (full-label rate), clothianidin, and alpha-cypermethrin. Fenthion, emamectin benzoate, and abamectin had the greatest effect on adult mortality and offspring production. Infested fruit treated with acetamiprid, fenthion, and thiacloprid produced no/very few offspring. Alpha-cypermethrin demonstrated good field efficacy against adults (one day post treatment: 97.2% mortality, five day post treatment: 98.8% mortality) and subsequent offspring (100% across one and five day post treatments), comparable to that of fenthion (full-label rate) (100% mortality for offspring and adults across both post treatments). Alpha-cypermethrin is a possible alternative to fenthion against B. tryoni; as a pyrethroid, it may not be desirable if adjunct biological control is imperative. Thiacloprid and Acetamiprid may be useful as a post-harvest treatment. PMID:28486404

  20. Construction, implementation and testing of an image identification system using computer vision methods for fruit flies with economic importance (Diptera: Tephritidae).

    PubMed

    Wang, Jiang-Ning; Chen, Xiao-Lin; Hou, Xin-Wen; Zhou, Li-Bing; Zhu, Chao-Dong; Ji, Li-Qiang

    2017-07-01

    Many species of Tephritidae are damaging to fruit, which might negatively impact international fruit trade. Automatic or semi-automatic identification of fruit flies are greatly needed for diagnosing causes of damage and quarantine protocols for economically relevant insects. A fruit fly image identification system named AFIS1.0 has been developed using 74 species belonging to six genera, which include the majority of pests in the Tephritidae. The system combines automated image identification and manual verification, balancing operability and accuracy. AFIS1.0 integrates image analysis and expert system into a content-based image retrieval framework. In the the automatic identification module, AFIS1.0 gives candidate identification results. Afterwards users can do manual selection based on comparing unidentified images with a subset of images corresponding to the automatic identification result. The system uses Gabor surface features in automated identification and yielded an overall classification success rate of 87% to the species level by Independent Multi-part Image Automatic Identification Test. The system is useful for users with or without specific expertise on Tephritidae in the task of rapid and effective identification of fruit flies. It makes the application of computer vision technology to fruit fly recognition much closer to production level. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. There is no magic fruit fly trap: multiple biological factors influence the response of adult Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) individuals to MultiLure traps baited with BioLure or NuLure.

    PubMed

    Díaz-Fleischer, Francisco; Arredondo, José; Flores, Salvador; Montoya, Pablo; Aluja, Martín

    2009-02-01

    Field-cage experiments were performed to determine the effectiveness of MultiLure traps (Better World MFG Inc., Fresno, CA) baited with NuLure (Miller Chemical and Fertilizer Corp., Hanover, PA) or BioLure (Suterra LLC, Inc., Bend, OR) in capturing individually marked Mexican fruit fly, Anastrepha ludens (Loew), and West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), of both sexes. Experimental treatments involved wild and laboratory-reared flies of varying ages (2-4 and 15-18 d) and dietary histories (sugar only, open fruit, open fruit plus chicken feces, and hydrolyzed protein mixed with sugar). Data were divided into two parts: total captures over a 24-h period and trap visits/landings, entrances into interior of trap ,and effective captures (i.e., drowning in liquid bait or water) over a 5-h detailed observation period (0600-1100 hours). The response to the two baits varied by fly species, gender, physiological state, age, and strain. Importantly, there were several highly significant interactions among these factors, underlining the complex nature of the response. The two baits differed in attractiveness for A. obliqua but not A. ludens. The effect of strain (wild versus laboratory flies) was significant for A. ludens but not A. obliqua. For effect of dietary history, adults of both species, irrespective of sex, were significantly less responsive to both baits when fed on a mixture of protein and sugar when compared with adults fed the other diets. Finally, we confirmed previous observations indicating that McPhail-type traps are quite inefficient. Considering the total 24-h fly tenure in the cage, and independent of bait treatment and fly type (i.e., strain, adult diet, gender and age), of a total of 2,880 A. obliqua and 2,880 A. ludens adults released into the field cages over the entire study (15 replicates), only 564 (19.6%) and 174 (6%) individuals, respectively, were effectively caught. When only considering the 5-h detailed

  2. Managing the Fruit Fly Experiment.

    ERIC Educational Resources Information Center

    Jeszenszky, Arleen W.

    1997-01-01

    Describes a sophisticated version of the fruit fly experiment for teaching concepts about genetics to biology students. Provides students with the opportunity to work with live animals over an extended period. (JRH)

  3. Managing the Fruit Fly Experiment.

    ERIC Educational Resources Information Center

    Jeszenszky, Arleen W.

    1997-01-01

    Describes a sophisticated version of the fruit fly experiment for teaching concepts about genetics to biology students. Provides students with the opportunity to work with live animals over an extended period. (JRH)

  4. Metalimnobia crane flies (Diptera: Limoniidae) from Korea.

    PubMed

    Podenas, Sigitas; Byun, Hye-Woo

    2016-06-30

    Korean species of the crane fly genus Metalimnobia Matsumura, 1911 (Diptera: Limoniidae), are taxonomically revised. Metalimnobia (Metalimnobia) channpayna new species, is described and figured, M. (M.) bifasciata (Schrank, 1781), M. (M.) quadrinotata (Meigen, 1818) and M. (M.) zetterstedti (Tjeder, 1968) are listed for the first time in Korea, new information for previously known species, M. (M.) quadrimaculata (Linnaeus, 1760) is added. Identification key for all Korean Metalimnobia species is given. Wings, male and female terminalia are illustrated for all species.

  5. Wine and vinegar-based attractants for the African fig fly (Diptera: Drosophilidae)

    USDA-ARS?s Scientific Manuscript database

    The African fig fly (AFF), Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States after first being detected in Florida in 2005. This drosophilid is a primary pest of figs in Brazil, so there were initial concern...

  6. Trapping African fig fly (Diptera: Drosophilidae) with combinations of vinegar and wine

    USDA-ARS?s Scientific Manuscript database

    The African fig fly, Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States. Tests were conducted in southern Florida that recorded the response of Z. indianus to baits that included Merlot wine, rice vinegar, et...

  7. Genetic structure and colonization history of the fruit fly Bactrocera tau (Diptera: Tephritidae) in China and Southeast Asia.

    PubMed

    Shi, W; Kerdelhué, C; Ye, H

    2014-06-01

    Bactrocera tau (Walker), a major invasive pest worldwide, was first described in Fujian (China) in 1849 and has dispersed to tropical and subtropical Asia and the South Pacific region. Few data are available on its colonization history and expansion processes. This pilot study attempted to reconstruct the colonization history and pathways of this pest in China and neighboring Southeast Asian countries based on mitochondrial DNA. Results of the study showed six genetic groups corresponding to geographical characteristics, although the pattern was relatively weak. Homogeneous genetic patterns were observed within southern and central China, and northern Vietnam. Continuous colonization from the coast of southern China to inland regions of China and northern Vietnam was suggested. Strong genetic structure was observed in western China, Thailand, and Laos. The isolation of four of the six groups was most probably attributable to major topographical barriers of western China. Yunnan acted as a contact zone of B. tau in China and neighboring Southeast Asia. The absence of isolation by distance and the overall low phylogeographic structure of B. tau suggested that long distance dispersal events and human activities could play a major role in the colonization and expansion patterns of B. tau. By analyzing the genetic diversity, gene flow, haplotype phylogeny, and demographic history of 23 fly populations, we hypothesized that B. tau could have been introduced long ago in southern China, from which it further expanded or that southern China could correspond to the native range of this species.

  8. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    PubMed

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  10. Evaluation of Cuelure and Methyl Eugenol solid lure and insecticide dispensers for fruit fly (Diptera: Tephritidae) monitoring and control in Tahiti

    USDA-ARS?s Scientific Manuscript database

    Performance of solid male lure (cuelure (C-L)/raspberry ketone (RK) - against Bactrocera tyroni (Froggatt), and methyl eugenol (ME) - against oriental fruit fly, B. dorsalis (Hendel) and insecticide formulations, were evaluated in Tahiti Island (French Polynesia), as alternatives to current monitori...

  11. Regional suppression of Bactrocera fruit flies (Diptera:Tephritidae) in the Pacific through biological control and prospects for future introductions into other areas of the world

    USDA-ARS?s Scientific Manuscript database

    Bactrocera fruit fly species are important economically throughout the Pacific. The USDA, ARS, U.S Pacific Basin Agricultural Research Center has been a world wide leader in promoting biological control of Bactrocera spp that includes classical, augmentative, conservation and IPM approaches. In Hawa...

  12. EAG and behavioral responses of the Caribbean fruit fly (Diptera:Tephritidae) to terminal diamines in a food-based lure.

    USDA-ARS?s Scientific Manuscript database

    Current monitoring programs for Anastrepha fruit flies utilize a food-based synthetic lure consisting of ammonium acetate and putrescine (1, 4 diaminobutane). Identification of additional attractant chemicals may lead to development of a more effective trapping system. This study, conducted with the...

  13. Melon fly, Bactrocera cucurbitae (Diptera: Tephritidae), infestation in host fruits in the Southwestern Islands of Japan before the initiation of Island-wide population suppression

    USDA-ARS?s Scientific Manuscript database

    Bactrocera cucurbitae (Coquillett) is a tephritid fruit fly native to the Indo-Malayan region. Its distribution, though, has extended to include Africa, temperate Asia, and a number of Pacific islands. It became established in Japan in 1919 in the Yaeyama Islands and spread north in the Southwestern...

  14. Subtropical Fruit Fly Invasions into Temperate Fruit Fly Territory in California's San Joaquin Valley

    USDA-ARS?s Scientific Manuscript database

    Subtropical fruit fly species including peach fruit fly, Bactrocera zonata (Saunders); melon fly, B. cucurbitae (Coquillett); oriental fruit fly, B. dorsalis (Hendel); and Mediterranean fruit fly, Ceratitis capitata Weidemann, have been detected in the past decade in the San Joaquin Valley of Califo...

  15. Feeding and attraction of non-target flies to spinosad-based fruit fly bait.

    PubMed

    Wang, Xin-Geng; Messing, Russell H

    2006-10-01

    A spinosad-based fruit fly bait, GF-120, has recently become a primary tool for area-wide suppression or eradication of pest tephritid fruit flies. The present study assessed the attraction and feeding of five non-target fly species to GF-120 in Hawaii. These non-target flies include three beneficial tephritid species [Eutreta xanthochaeta (Aldrich), Tetreuaresta obscuriventris (Loew), Ensina sonchi (L.)] introduced for weed biological control, an endemic Hawaiian tephritid [Trupanea dubautiae (Bryan)] (all Diptera: Tephritidae) and the cosmopolitan Drosophila melanogaster Meigen (Diptera: Drosophilidae). All five non-target fly species were susceptible to GF-120, as was the target pest Mediterranean fruit fly Ceratitis capitata (Wiedemann). Feeding on, or even brief tasting of, GF-120 killed all fly species within 2 h. When individual flies were provided with a choice of GF-120 or honey solution, there was no difference in the frequency of first food encounter by E. xanthochaeta, D. melanogaster or C. capitata. The other three non-target species approached honey more often than GF-120 in their first food encounter. Feeding times on GF-120 and honey were not significantly different for D. melanogaster and C. capitata, while the other four non-target species fed longer on honey than on GF-120. There was no significant difference in feeding time on honey versus GF-120 between males and females of each species. These results suggest that area-wide treatment using GF-120 for the purpose of eradication of pest fruit flies has potential negative impacts on these and other non-target fly species in Hawaii.

  16. Ingestion toxicity of three Lamiaceae essential oils incorporated in protein baits against the olive fruit fly, Bactrocera oleae (Rossi) (Diptera Tephritidae).

    PubMed

    Canale, Angelo; Benelli, Giovanni; Conti, Barbara; Lenzi, Gabriele; Flamini, Guido; Francini, Alessandra; Cioni, Pier Luigi

    2013-01-01

    The ingestion toxicity of three Lamiaceae essential oils (EOs) - Hyptis suaveolens, Rosmarinus officinalis and Lavandula angustifolia - incorporated in protein baits was evaluated against Bactrocera oleae, a worldwide pest of olive fruits. In laboratory conditions, all the tested EOs showed dose-dependent toxicity on B. oleae, with mortality rates ranging from 12% (EO concentration: 0.01% w:v) to 100% (EO concentration: 1.75% w:v). Semi-field results highlighted the toxicity of L. angustifolia and H. suaveolens EOs, which exerted more than 60% of flies mortality at a concentration of 1.75% (w:v). Gas Chromatography-Electron Impact Mass Spectrometry analyses of the three EOs showed that H. suaveolens EO was dominated by monoterpene and sesquiterpene hydrocarbons. Oxygenated monoterpenes were the main chemical class in R. officinalis and L. angustifolia EOs. Further research is needed to evaluate the efficacy of these EOs plus food bait against the olive fruit fly in the open field.

  17. Responses of multiple species of Tephritid (Diptera) fruit fly parasitoids (Hymenoptera:Braconidae:Opiinae) to sympatric and exotic and fruit volatiles

    USDA-ARS?s Scientific Manuscript database

    Opiine braconid parasitoids of tephritid pests have augmentative biological control potential, but there are no synthetic attractants to monitor their survival and dispersal following release. Adults feed on fruit juices and these could be sources of attractive compounds. While orange juice (Citrus ...

  18. Suppressive effects of Calendula micrantha essential oil and gibberelic acid (PGR) on repro ductive potential of the Mediterranean fruit fly Ceratitis capitata Wied. (Diptera: Tephritidae).

    PubMed

    Hussein, Karam T

    2005-08-01

    The volatile oil of Calendula micrtantha plant was extracted and the components were identified by Gc/Ms. Adulticidal efficiency of the volatile oil and gibberelic acid "plant growth promoting hormone" as well as their mixture was assessed against the Mediterranean fruit fly Ceratitis capitata. The result showed that the two compounds capable have characteristic resembling to insect juvenile hormones and have suppressive effect on reproductive potential. They induced the significant disturbances in the ovarian protein fraction and the amino acids patterns.

  19. Fruit Flies Help Human Sleep Research

    MedlinePlus

    ... Current Issue Past Issues Fruit Flies Help Human Sleep Research Past Issues / Summer 2007 Table of Contents ... Chiara Cirelli uses experimental fruit flies to study sleep. Although it may be tough to imagine a ...

  20. Rhipidia crane flies (Diptera: Limoniidae) from Korea.

    PubMed

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2016-07-07

    Korean species of the crane fly genus Rhipidia Meigen, 1818 (Diptera: Limoniidae), are taxonomically revised. Rhipidia (Rhipidia) serena, new species, is described and figured. Rhipidia (R.) longa Zhang, Li, Yang, 2014, R. (R.) maculata Meigen, 1818 and R. (R.) sejuga Zhang, Li, Yang, 2014 are recorded for the first time in Korea. Previously known species, Rhipidia (R.) septentrionis Alexander, 1913 is redescribed and illustrated. Identification key for all Korean Rhipidia species is given. Most antennae, wings, male and female terminalia of all species are illustrated for the first time.

  1. Cold Disinfestation of "Hass" Avocado (Persia americana) of Three Species of Fruit Fly (Diptera: Tephritidae)-Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra.

    PubMed

    Ware, A B; du Toit, C L N

    2017-06-01

    The avocado industry is important in South Africa, but access to certain markets is impeded by the presence of phytosanitary pests. One of the ways of securing entry to these markets is to demonstrate that a mitigating treatment will result in there being a negligible chance of accidental importation. In cold treatment comparative studies at 0 °C and 2 °C of immature stages of Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) in "Hass" avocado, the third instar of C. cosyra was shown to be the most cold tolerant. This larval life stage was used in a large-scale trial to test treatment efficacy at 2 °C, a temperature known to be the better for fruit quality. There were no survivors from the 49,795 individual fruit fly larvae subjected to the cold treatment at 2 °C for 20 d. It is argued that, although this level of assessment falls short of the Probit 9 level normally required for fruit fly, they are rarely found in avocado fruit and that the level of disinfestation obtained is more than sufficient to achieve quarantine security. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Olive fruit fly: managing an ancient pest in modern times.

    PubMed

    Daane, Kent M; Johnson, Marshall W

    2010-01-01

    Olive fruit fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae), is the major pest of commercial olives worldwide. Various aspects of its biology, ecology, management, and impact on olive production are highlighted. With the discovery of insecticidal resistance in some populations frequently treated with organophosphates, old and new control options are being investigated. The potential of biological control is examined. Surveys suggest that a small group of braconids in the Opiinae subfamily best represent the primary parasitoids attacking olive fruit fly in its native range. These species include Psyttalia lounsburyi, P. dacicida, P. concolor, P. ponerophaga, and Utetes africanus. Bracon celer, another braconid but in the Braconinae subfamily, is also reared from the fruit fly in its native range. The potential of these and other natural enemies is discussed with respect to olive fruit fly biology, commercial olive production, and biological constraints that may limit their success. We suggest that numerous species exist that should be further investigated as control agents for olive fruit fly in the many climatic regimes where the pest is found.

  3. Biological Control of Olive Fruit Fly

    USDA-ARS?s Scientific Manuscript database

    Domestication of olive fruit, Olea europaea L., produced a better host for olive fruit fly, Bactrocera oleae (Gmelin), than wild olives, but fruit domestication reduced natural enemy efficiency. Important factors for selection of natural enemies for control of olive fruit fly include climate matchi...

  4. Fruit_Flies_in_Microgravity

    NASA Image and Video Library

    2017-05-25

    Scientists study how astronauts are affected by microgravity, but with a relatively small number of human subjects available to them, they often turn to model organisms for research. Model organisms are living organisms that have a genetic makeup that is relatively well-documented and understood, and is similar to human systems. Fruit flies are reliable model organisms because their systems closely resemble that of larger organisms. They have the benefit of being small in size, well understood, and reproduce quickly so many generations can be studied in a short amount of time. Some of the things we can study using fruit flies are how microgravity affects the immune system. Will the muscle cells of the heart lose strength in microgravity? Are reproduction, lifespan and the aging process affected by microgravity? Do changes in gravity affect the basic metabolic rate and metabolism of living systems? Fruit flies offer a manageable way to study living systems in microgravity. Learn more about other model organisms and how they are being used for microgravity research, and keep up with all the science being conducted aboard your orbiting laboratory by visiting ISS Research Overview on nasa.gov http://www.twitter.com/ISS_Research

  5. Parasitism by Nycteribiidae and Streblidae Flies (Diptera) of a Malagasy Fruit Bat (Pteropodidae): Effects of Body Size and Throat Gland Development on Parasite Abundance.

    PubMed

    Rajemison, Faneva I; Noroalintseheno Lalarivoniaina, Oliva S; Goodman, Steven M

    2017-07-01

    We examined the possible effects of host body size and throat gland development on the abundance of blood-feeding nycteribiid and streblid flies parasitizing a Malagasy fruit bat, Rousettus madagascariensis G. Grandidier, 1928. Data were collected in the Parc National d'Ankarana in northern Madagascar during four visits: September 2014, 2015 (dry season), and January 2015, 2016 (wet season). Two bat fly species were identified, Eucampsipoda madagascarensis Theodor, 1955 (Nycteribiidae) and Megastrebla wenzeli (Jobling, 1952) (Streblidae). A positive correlation was found between host body size and abundance of E. madagascarensis during the four visits, suggesting that larger hosts have more parasites, and for M. wenzeli, this relationship was identified only during the wet season visits. In male hosts, body size and throat gland development are correlated with variation in E. madagascarensis abundance during the two seasons; this relationship was not found for M. wenzeli. We present some explanations for the observed patterns of bat fly abundance associated with throat gland development: increased vascularization and easier access to bloodmeals, chemical properties of gland secretions acting as attractants or perhaps being consumed, and modification of hair around the gland providing protection from bat grooming. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. The effect of dietary restriction on longevity, fecundity, and antioxidant responses in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    PubMed

    Chen, Er-Hu; Wei, Dong; Wei, Dan-Dan; Yuan, Guo-Rui; Wang, Jin-Jun

    2013-10-01

    Recent studies in fruit flies have imposed dietary restriction (DR) by diluting yeast and have reported increased lifespan as the yeast-to-sugar ratio decreased. In this study, the effects of DR on the lifespan of Bactrocera dorsalis were investigated using constant-feeding diets with different yeast:sugar ratios and an intermittent-feeding diet in which flies ate every sixth day. Antioxidant enzyme activities and the malondialdehyde concentration were also measured in virgin females under constant-feeding DR protocols to investigate their relationships with lifespan. The results showed that B. dorsalis lifespan was significantly extended by DR, and carbohydrate-enriched diet may be important for lifespan-extension. Female flies lived significantly longer than males at all dietary levels under both feeding regimes, indicating no interaction between diet and sex in determining lifespan. Antioxidant enzyme activities increased with the amount of yeast increased in the diets (0-4.76%) between starvation and DR treatments, indicating that the antioxidants may have influences in determining lifespan in B. dorsalis under starvation and DR treatments. However, antioxidants cannot keep up with increased oxidative damage induced by the high yeast diet (25%). These results revealed that the extension of lifespan by DR is evolutionarily conserved in B. dorsalis and that yeast:sugar ratios significantly modulate lifespan in this species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets.

    PubMed

    Geib, Scott M; Calla, Bernarda; Hall, Brian; Hou, Shaobin; Manoukis, Nicholas C

    2014-10-28

    The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family of flies, and can be considered an out-group to well-studied members of the family Drosophilidae. Despite their importance as pests and their relatedness to Drosophila, little information is present on B. dorsalis transcripts and proteins. The objective of this paper is to comprehensively characterize the transcripts present throughout the life history of B. dorsalis and functionally annotate and analyse these transcripts relative to the presence, expression, and function of orthologous sequences present in Drosophila melanogaster. We present a detailed transcriptome assembly of B. dorsalis from egg through adult stages containing 20,666 transcripts across 10,799 unigene components. Utilizing data available through Flybase and the modENCODE project, we compared expression patterns of these transcripts to putative orthologs in D. melanogaster in terms of timing, abundance, and function. In addition, temporal expression patterns in B. dorsalis were characterized between stages, to establish the constitutive or stage-specific expression patterns of particular transcripts. A fully annotated transcriptome assembly is made available through NCBI, in addition to corresponding expression data. Through characterizing the transcriptome of B. dorsalis through its life history and comparing the transcriptome of B. dorsalis to the model organism D. melanogaster, a database has been developed that can be used as the foundation to functional genomic research in Bactrocera flies and help identify orthologous genes between B. dorsalis and D. melanogaster. This data provides the foundation for future functional genomic research that will focus on improving our understanding of the physiology and

  8. Effects of a fruit and host-derived compound on orientation and oviposition in Utetes anastrephae, a little studied opiine braconid (Hymenoptera) parasitoid of Anastrepha spp. fruit flies (Tephritidae:Diptera)

    USDA-ARS?s Scientific Manuscript database

    Augmentative biological control of tephritid fruit flies would benefit from: 1) synthetic attractants to monitor the survival and dispersal of released parasitoids and 2) synthetic oviposition stimulants to more economical to produce parasitoid species that are now prohibitively costly to mass-rear....

  9. Commercial yellow sticky strips more attractive than yellow boards to western cherry fruit fly (Dipt., Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    Bright yellow sticky rectangles made of paper boards were previously identified as the most effective traps for capturing western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae). Thin rectangular sheets of yellow plastic allow higher light passage than yellow boards and may b...

  10. Virulence of selected entomopathogenic fungi against the olive fruit fly and their potential for biocontrol

    USDA-ARS?s Scientific Manuscript database

    The olive fruit fly, Bactrocera oleae (Diptera: Tephritidae), is the most serious pest of cultivated olives worldwide. Its recent invasion into North America, specifically California, has initiated renewed interest in management strategies for this pest. Research into classical biological control ha...

  11. Phylogeography of West Indian fruit fly, Anastrepha obliqua, inferred with mtDNA sequencing

    USDA-ARS?s Scientific Manuscript database

    Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the West Indian fruit fly, is a frugivorous pest that occasionally finds its way to commercial growing areas outside its native distribution. It inhabits areas in Mexico, Central and South America, and the Caribbean, with occasional infestations...

  12. Resolution of inter and intra-species relationships of the West Indian fruit fly Anastrepha obliqua

    USDA-ARS?s Scientific Manuscript database

    The West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), is an economically important pest that inhabits areas of South and Central America, Mexico and the Caribbean with occasional infestations in the southern United States. We examine intra-specific variation within Anastre...

  13. Vision-Mediated exploitation of a novel host plant by a tephritid fruit fly

    USDA-ARS?s Scientific Manuscript database

    Shortly after its introduction into the Hawaiian Islands around 1895, the polyphagous, invasive fruit fly Bactrocera cucurbitae (Coquillett)(Diptera:Tephritidae) was provided the opportunity to expand its host range to include a novel host, papaya (Carica papaya). It has been documented that female ...

  14. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae) in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World

    PubMed Central

    Vargas, Roger I.; Leblanc, Luc; Harris, Ernest J.; Manoukis, Nicholas C.

    2012-01-01

    Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett) in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri); similarly, establishment of Bactrocera dorsalis (Hendel) in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan), Diachasmimorpha longicaudata (Ashmead) and Fopius vandenboschi (Fullaway) were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa). Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more recent successes against Bactrocera spp. and related tephritids, and outline simple rearing and release methods to facilitate this goal. PMID:26466626

  15. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae) in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World.

    PubMed

    Vargas, Roger I; Leblanc, Luc; Harris, Ernest J; Manoukis, Nicholas C

    2012-08-10

    Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett) in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri); similarly, establishment of Bactrocera dorsalis (Hendel) in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan), Diachasmimorpha longicaudata (Ashmead) and Fopius vandenboschi (Fullaway) were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa). Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more recent successes against Bactrocera spp. and related tephritids, and outline simple rearing and release methods to facilitate this goal.

  16. Insecticidal activity of a Moroccan strain of Streptomyces phaeochromogenes LD-37 on larvae, pupae and adults of the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Samri, S E; Baz, M; Ghalbane, I; El Messoussi, S; Zitouni, A; El Meziane, A; Barakate, M

    2017-04-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata, is considered the most important fruit pest worldwide. Its management is mainly based on the use of chemical insecticides. Although these conventional pesticides are effective at high doses, they cause considerable human health and environment problems. Thus, the aim of this study was to assess insecticidal activity of Moroccan actinobacteria against C. capitata. A total of 12 preselected actinobacteria isolated from various Moroccan habitats were screened for their insecticidal activity against larvae, pupae and adults of C. capitata. Four actinobacteria isolates were significantly active against the first-instar larvae, and nine were active against the medfly adult, while no significant mortality was obtained against the third-instar larval and pupal stages. Among the selected isolates, the biological screening revealed that strain Streptomyces LD-37, which showed 99.4% similarity with Streptomyces phaeochromogenes, exhibited the maximal corrected larval mortality of 98%. Moreover, the isolates AS1 and LD-37 showed the maximum significant corrected mortality against adults of 32.5 and 28.2%, respectively. The crude extract obtained from a fermented culture of strain S. phaeochromogenes LD-37 was separated into six fractions by thin layer chromatography. Fractions F3 and F4 caused a significant corrected larval mortality of 66.7 and 53.3%, respectively; whereas the maximum reduction in adult emergence was obtained with fraction F4. This finding could be useful for utilizing S. phaeochromogenes LD-37 as an alternative to chemical insecticides in pest management of C. capitata.

  17. Male-specific Y-linked transgene markers to enhance biologically-based control of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae)

    PubMed Central

    2014-01-01

    Background Reliable marking systems are critical to the prospective field release of transgenic insect strains. This is to unambiguously distinguish released insects from wild insects in the field that are collected in field traps, and tissue-specific markers, such as those that are sperm-specific, have particular uses such as identifying wild females that have mated with released males. For tephritid fruit flies such as the Mexican fruit fly, Anastrepha ludens, polyubiquitin-regulated fluorescent protein body markers allow transgenic fly identification, and fluorescent protein genes regulated by the spermatocyte-specific β2-tubulin promoter effectively mark sperm. For sterile male release programs, both marking systems can be made male-specific by linkage to the Y chromosome. Results An A. ludens wild type strain was genetically transformed with a piggyBac vector, pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3}, having the polyubiquitin-regulated EGFP body marker, and the β2-tubulin-regulated DsRed.T3 sperm-specific marker. Autosomal insertion lines effectively expressed both markers, but a single Y-linked insertion (YEGFP strain) expressed only PUbnlsEGFP. This insertion was remobilized by transposase helper injection, which resulted in three new autosomal insertion lines that expressed both markers. This indicated that the original Y-linked Asβ2tub-DsRed.T3 marker was functional, but specifically suppressed on the Y chromosome. The PUbnlsEGFP marker remained effective however, and the YEGFP strain was used to create a sexing strain by translocating the wild type allele of the black pupae (bp+) gene onto the Y, which was then introduced into the bp- mutant strain. This allows the mechanical separation of mutant female black pupae from male brown pupae, that can be identified as adults by EGFP fluorescence. Conclusions A Y-linked insertion of the pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3} transformation vector in A. ludens resulted in male-specific expression of the EGFP

  18. Male-specific Y-linked transgene markers to enhance biologically-based control of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    PubMed

    Meza, J Salvador; Schetelig, Marc F; Zepeda-Cisneros, C Silvia; Handler, Alfred M

    2014-01-01

    Reliable marking systems are critical to the prospective field release of transgenic insect strains. This is to unambiguously distinguish released insects from wild insects in the field that are collected in field traps, and tissue-specific markers, such as those that are sperm-specific, have particular uses such as identifying wild females that have mated with released males. For tephritid fruit flies such as the Mexican fruit fly, Anastrepha ludens, polyubiquitin-regulated fluorescent protein body markers allow transgenic fly identification, and fluorescent protein genes regulated by the spermatocyte-specific β2-tubulin promoter effectively mark sperm. For sterile male release programs, both marking systems can be made male-specific by linkage to the Y chromosome. An A. ludens wild type strain was genetically transformed with a piggyBac vector, pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3}, having the polyubiquitin-regulated EGFP body marker, and the β2-tubulin-regulated DsRed.T3 sperm-specific marker. Autosomal insertion lines effectively expressed both markers, but a single Y-linked insertion (YEGFP strain) expressed only PUbnlsEGFP. This insertion was remobilized by transposase helper injection, which resulted in three new autosomal insertion lines that expressed both markers. This indicated that the original Y-linked Asβ2tub-DsRed.T3 marker was functional, but specifically suppressed on the Y chromosome. The PUbnlsEGFP marker remained effective however, and the YEGFP strain was used to create a sexing strain by translocating the wild type allele of the black pupae (bp+) gene onto the Y, which was then introduced into the bp- mutant strain. This allows the mechanical separation of mutant female black pupae from male brown pupae, that can be identified as adults by EGFP fluorescence. A Y-linked insertion of the pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3} transformation vector in A. ludens resulted in male-specific expression of the EGFP fluorescent protein marker, and was

  19. How functional genomics will impact fruit fly pest control: the example of the Mediterranean fruit fly, Ceratitis capitata

    PubMed Central

    2014-01-01

    The highly invasive agricultural insect pest Ceratitis capitata (Diptera: Tephritidae) is the most thoroughly studied tephritid fruit fly at the genetic and molecular levels. It has become a model for the analysis of fruit fly invasions and for the development of area-wide integrated pest management (AW-IPM) programmes based on the environmentally-friendly Sterile Insect Technique (SIT). Extensive transcriptome resources and the recently released genome sequence are making it possible to unravel several aspects of the medfly reproductive biology and behaviour, opening new opportunities for comparative genomics and barcoding for species identification. New genes, promotors and regulatory sequences are becoming available for the development/improvement of highly competitive sexing strains, for the monitoring of sterile males released in the field and for determining the mating status of wild females. The tools developed in this species have been transferred to other tephritids that are also the subject of SIT programmes. PMID:25471105

  20. How functional genomics will impact fruit fly pest control: the example of the Mediterranean fruit fly, Ceratitis capitata.

    PubMed

    Scolari, Francesca; Gomulski, Ludvik M; Gabrieli, Paolo; Manni, Mosè; Savini, Grazia; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The highly invasive agricultural insect pest Ceratitis capitata (Diptera: Tephritidae) is the most thoroughly studied tephritid fruit fly at the genetic and molecular levels. It has become a model for the analysis of fruit fly invasions and for the development of area-wide integrated pest management (AW-IPM) programmes based on the environmentally-friendly Sterile Insect Technique (SIT). Extensive transcriptome resources and the recently released genome sequence are making it possible to unravel several aspects of the medfly reproductive biology and behaviour, opening new opportunities for comparative genomics and barcoding for species identification. New genes, promotors and regulatory sequences are becoming available for the development/improvement of highly competitive sexing strains, for the monitoring of sterile males released in the field and for determining the mating status of wild females. The tools developed in this species have been transferred to other tephritids that are also the subject of SIT programmes.

  1. Genetic identification of an unknown Rhagoletis fruit fly infesting Chinese crabapple (Malus spectabilis): implications for apple pest management

    USDA-ARS?s Scientific Manuscript database

    The apple maggot fly, Rhagoletis pomonella (Walsh) (Diptera: Tephritidae), is a serious introduced quarantine pest in the apple-growing regions of central Washington and Oregon. In August 2011, seven fly larvae of unknown origin were discovered infesting fruit of an exotic Chinese crabapple, Malus s...

  2. Behavioral responses, rate of mortality, and oviposition of western cherry fruit fly exposed to Malathion, Zeta-cypermethrin, and Spinetoram

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of sweet and tart cherry, Prunus avium L. (L.) and P. cerasus L., respectively, in western North America. This fly is commonly controlled with spinosad bait sprays, but these sprays are ineffective against sp...

  3. Bringing back the fruit into fruit fly-bacteria interactions.

    PubMed

    Behar, A; Jurkevitch, E; Yuval, B

    2008-03-01

    Female Mediterranean fruit flies (Ceratitis capitata) oviposit in fruits, within which the larvae develop. This development is associated with rapid deterioration of the fruit, and frequently with invasion by secondary pests. Most research on the associations between medflies and microorganisms has focused on the bacteria inhabiting the digestive system of the adult fly, while the role of the fruit in mediating, amplifying or regulating the fruit fly microflora has been largely neglected. In this study, we examine the hypothesis that the host fruit plays a role in perpetuating the fly-associated bacterial community. Using direct and cultured-based approaches, we show that this community is composed in its very large majority of diazotrophic and pectinolytic Enterobacteriaceae. Our data suggest that this fly-associated enterobacterial community is vertically transmitted from the female parent to its offspring. During oviposition, bacteria are transferred to the fruit, establish and proliferate within it, causing its decay. These results show that the host fruit is indeed a central partner in the fruit fly-bacterial interaction as these transmitted bacteria are amplified by the fruit, and subsequently maintained throughout the fly's life. This enterobacterial community may contribute to the fly's nitrogen and carbon metabolism, affecting its development and ultimately, fitness.

  4. Fitness Cost Implications of PhiC31-Mediated Site-Specific Integrations in Target-Site Strains of the Mexican Fruit Fly, Anastrepha ludens (Diptera: Tephritidae)

    PubMed Central

    Meza, José S.; Díaz-Fleischer, Francisco; Sánchez-Velásquez, Lázaro R.; Zepeda-Cisneros, Cristina Silvia; Handler, Alfred M.; Schetelig, Marc F.

    2014-01-01

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understanding the fitness cost implications of these manipulations for transgenic strain applications is critical. In this study independent piggyBac-mediated attP target-sites marked with DsRed were created in several genomic positions in the Mexican fruit fly, Anastrepha ludens. Two of these strains, one having an autosomal (attP_F7) and the other a Y-linked (attP_2-M6y) integration, exhibited fitness parameters (dynamic demography and sexual competitiveness) similar to wild type flies. These strains were thus selected for targeted insertion using, for the first time in mexfly, the phiC31-integrase recombination system to insert an additional EGFP-marked transgene to determine its effect on host strain fitness. Fitness tests showed that the integration event in the int_2-M6y recombinant strain had no significant effect, while the int_F7 recombinant strain exhibited significantly lower fitness relative to the original attP_F7 target-site host strain. These results indicate that while targeted transgene integrations can be achieved without an additional fitness cost, at some genomic positions insertion of additional DNA into a previously integrated transgene can have a significant negative effect. Thus, for targeted transgene insertions fitness costs must be evaluated both previous to and subsequent to new site-specific insertions in the target-site strain. PMID:25303238

  5. Fitness cost implications of PhiC31-mediated site-specific integrations in target-site strains of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    PubMed

    Meza, José S; Díaz-Fleischer, Francisco; Sánchez-Velásquez, Lázaro R; Zepeda-Cisneros, Cristina Silvia; Handler, Alfred M; Schetelig, Marc F

    2014-01-01

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understanding the fitness cost implications of these manipulations for transgenic strain applications is critical. In this study independent piggyBac-mediated attP target-sites marked with DsRed were created in several genomic positions in the Mexican fruit fly, Anastrepha ludens. Two of these strains, one having an autosomal (attP_F7) and the other a Y-linked (attP_2-M6y) integration, exhibited fitness parameters (dynamic demography and sexual competitiveness) similar to wild type flies. These strains were thus selected for targeted insertion using, for the first time in mexfly, the phiC31-integrase recombination system to insert an additional EGFP-marked transgene to determine its effect on host strain fitness. Fitness tests showed that the integration event in the int_2-M6y recombinant strain had no significant effect, while the int_F7 recombinant strain exhibited significantly lower fitness relative to the original attP_F7 target-site host strain. These results indicate that while targeted transgene integrations can be achieved without an additional fitness cost, at some genomic positions insertion of additional DNA into a previously integrated transgene can have a significant negative effect. Thus, for targeted transgene insertions fitness costs must be evaluated both previous to and subsequent to new site-specific insertions in the target-site strain.

  6. Improving mating performance of mass-reared sterile Mediterranean fruit flies (Diptera: Tephritidae) through changes in adult holding conditions: demography and mating competitiveness

    SciTech Connect

    Liedo, P.; Salgado, S.; Oropeza, A.; Toledo, J.

    2007-03-15

    Mass rearing conditions affect the mating behavior of Mediterranean fruit flies (medflies) Ceratitis capitata (Wiedemann). We evaluated the effect of slight changes in the adult holding conditions of adult flies maintained for egg production on their mating performance. Colonization was initiated from wild flies collected as larvae from infested coffee berries (Coffea arabica L.). When pupae were close to adult emergence, they were randomly divided into 3 groups and the emerging adults were reared under the following conditions: (1) Metapa System (MS, control), consisting of 70 x 45 x 15 cm aluminum frame, mesh covered cages, with a density of 2,200 flies per cage and a 1:1 initial sex ratio; (2) Insert System (IS), with the same type of cage, and the same fly density and sex ratio as in the MS treatment, but containing twelve Plexiglas pieces (23 x 8.5 cm) to provide additional horizontal surface areas inside the cage; and (3) Sex-ratio System (SS), same as IS, but in this case the initial male: female ratio was 4:1. Three d later, newly emerged females were introduced, so the ratio became 3:1 and on the 6th d another group of newly emerged females was added to provide a 2:1 final sex ratio, at which the final density reached 1,675 flies per cage. The eggs collected from each of the 3 treatments were reared independently following standard procedures and the adults were held under the same experimental conditions. This process was repeated for over 10 to 13 generations (1 year). The experiment was repeated 3 times in 3 consecutive years, starting each replicate with a new collection of wild flies. Life tables were constructed for each treatment at the parental, 3rd, 6th, and 9th generations. Standard quality control parameters (pupation at 24 h, pupal weight, adult emergence, and flight ability), were estimated for each treatment every third generation in the third year. For the last generation each year, mating competitiveness was evaluated in field cage tests

  7. Testing for Mutagens Using Fruit Flies.

    ERIC Educational Resources Information Center

    Liebl, Eric C.

    1998-01-01

    Describes a laboratory employed in undergraduate teaching that uses fruit flies to test student-selected compounds for their ability to cause mutations. Requires no prior experience with fruit flies, incorporates a student design component, and employs both rigorous controls and statistical analyses. (DDR)

  8. Testing for Mutagens Using Fruit Flies.

    ERIC Educational Resources Information Center

    Liebl, Eric C.

    1998-01-01

    Describes a laboratory employed in undergraduate teaching that uses fruit flies to test student-selected compounds for their ability to cause mutations. Requires no prior experience with fruit flies, incorporates a student design component, and employs both rigorous controls and statistical analyses. (DDR)

  9. Genetic analysis of oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) populations based on mitochondrial cox1 and nad1 gene sequences from India and other Asian countries.

    PubMed

    Choudhary, Jaipal S; Naaz, Naiyar; Prabhakar, Chandra S; Lemtur, Moanaro

    2016-10-01

    The study examined the genetic diversity and demographic history of Bactrocera dorsalis, a destructive and polyphagous insect pest of fruit crops in diverse geographic regions of India. 19 widely dispersed populations of the fly from India and other Asian countries were analysed using partial sequences of mitochondrial cytochrome oxidase I (cox1) and NADH dehydrogenase 1 (nad1) genes to investigate genetic diversity, genetic structure, and demographic history in the region. Genetic diversity indices [number of haplotypes (H), haloptype diversity (Hd), nucleotide diversity (π) and average number of nucleotide difference (k)] of populations revealed that B. dorsalis maintains fairly high level of genetic diversity without isolation by distance among the geographic regions. Demographic analysis showed significant (negative) Tajimas' D and Fu's F S with non significant sum of squared deviations (SSD) values, which indicate the possibility of recent sudden expansion of species and is further supported through distinctively star-like distribution structure of haplotypes among populations. Thus, the results indicate that both ongoing and historical factors have played important role in determining the genetic structure and diversity of the species in India. Consequently, sterile insect technique (SIT) could be a possible management strategy of species in the regions.

  10. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-01-01

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis. PMID:23965972

  11. Molecular cloning, characterization and mRNA expression of a chitin synthase 2 gene from the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-08-19

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  12. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  13. Effect of larval host food substrate on egg load dynamics, egg size and adult female size in four species of braconid fruit fly (Diptera: Tephritidae) parasitoids.

    PubMed

    Cicero, Lizette; Sivinski, John; Rull, Juan; Aluja, Martin

    2011-11-01

    Life history theory predicts that individuals will allocate resources to different traits so as to maximize overall fitness. Because conditions experienced during early development can have strong downstream effects on adult phenotype and fitness, we investigated how four species of synovigenic, larval-pupal parasitoids that vary sharply in their degree of specialization (niche breadth) and life history (Diachasmimorpha longicaudata, Doryctobracon crawfordi, Opius hirtus and Utetes anastrephae), allocate resources acquired during the larval stage towards adult reproduction. Parasitoid larvae developed in a single host species reared on four different substrates that differed in quality. We measured parasitoid egg load at the moment of emergence and at 24 h, egg numbers over time, egg size, and also adult size. We predicted that across species the most specialized would have a lower capacity to respond to changes in host substrate quality than wasps with a broad host range, and that within species, females that emerged from hosts that developed in better quality substrates would have the most resources to invest in reproduction. Consistent with our predictions, the more specialized parasitoids were less plastic in some responses to host diet than the more generalist. However, patterns of egg load and size were variable across species. In general, there was a remarkable degree of reproductive effort-allocation constancy within parasitoid species. This may reflect more "time-limited" rather than "egg-limited" foraging strategies where the most expensive component of reproductive success is to locate and handle patchily-distributed and fruit-sequestered hosts. If so, egg costs, independent of degree of specialization, are relatively trivial and sufficient resources are available in fly larvae stemming from all of the substrates tested.

  14. Heterangaeus Alexander, 1925 crane flies (Diptera: Pediciidae) of Korea.

    PubMed

    Podenas, Sigitas; Podeniene, Virginija; Byun, Hye-Woo

    2015-08-25

    The Korean crane fly species of the genus Heterangaeus Alexander, 1925 (Diptera: Pediciidae) is taxonomically revised. H. gloriosus gloriosus (Alexander, 1924) is redescribed. A new species Heterangaeus koreanus n. sp., which is the first species of Pediciidae from South Korea, is described and illustrated.

  15. Comparative analysis of development and survival of two Natal fruit fly Ceratitis rosa Karsch (Diptera, Tephritidae) populations from Kenya and South Africa

    PubMed Central

    Tanga, Chrysantus M.; Manrakhan, Aruna; Daneel, John-Henry; Mohamed, Samira A.; Fathiya, Khamis; Ekesi, Sunday

    2015-01-01

    Abstract Comparative analysis of development and survivorship of two geographically divergent populations of the Natal fruit fly Ceratitis rosa Karsch designated as Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya and South Africa were studied at seven constant temperatures (10, 15, 20, 25, 30, 33, 35 °C). Temperature range for development and survival of both populations was 15–35 °C. The developmental duration was found to significantly decrease with increasing temperature for Ceratitis rosa R1 and Ceratitis rosa R2 from both countries. Survivorship of all the immature stages of Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya was highest over the range of 20–30 °C (87–95%) and lowest at 15 and 35 °C (61–76%). Survivorship of larvae of Ceratitis rosa R1 and Ceratitis rosa R2 from South Africa was lowest at 35 °C (22%) and 33 °C (0.33%), respectively. Results from temperature summation models showed that Ceratitis rosa R2 (egg, larva and pupa) from both countries were better adapted to low temperatures than R1, based on lower developmental threshold. Minimum larval temperature threshold for Kenyan populations were 11.27 °C and 6.34 °C (R1 and R2, respectively) compared to 8.99 °C and 7.74 °C (R1 and R2, respectively) for the South African populations. Total degree-day (DD) accumulation for the Kenyan populations were estimated at 302.75 (Ceratitis rosa R1) and 413.53 (Ceratitis rosa R2) compared to 287.35 (Ceratitis rosa R1) and 344.3 (Ceratitis rosa R2) for the South African populations. These results demonstrate that Ceratitis rosa R1 and Ceratitis rosa R2 from both countries were physiologically distinct in their response to different temperature regimes and support the existence of two genetically distinct populations of Ceratitis rosa. It also suggests the need for taxonomic revision of Ceratitis rosa, however, additional information on morphological characterization of Ceratitis rosa R1 and Ceratitis rosa R2 is needed. PMID:26798273

  16. Male and female condition influence mating performance and sexual receptivity in two tropical fruit flies (Diptera: Tephritidae) with contrasting life histories.

    PubMed

    Aluja, M; Rull, J; Sivinski, J; Trujillo, G; Pérez-Staples, D

    2009-12-01

    Recent recognition of widespread polyandry in insects has generated considerable interest in understanding why females mate multiple times and in identifying factors that affect mating rate and inhibit female remating. However, little attention has been paid to understanding the question from both a female and male perspective, particularly with respect to factors that may simultaneously influence female remating rates. Here, we report on a study aimed at ascertaining the possible interactive effects that male and female size and diet, and female access to a host could have on mating latency, probability, and duration and female refractory period using two tropical fruit fly species with contrasting life histories. Of all factors tested, adult diet played the most significant role. Both Anastrepha ludens and Anastrepha obliqua males which had constant access to protein and sucrose mated more often, had shorter copulations and induced longer refractory periods in females than males fed a low quality diet (sucrose offered every third day). Female size and the interaction with male diet determined how quickly female A. ludens mated for the first time. Smaller females mated sooner with low quality fed males than with high quality fed males while there was no difference for large females, suggesting that male choice may be at play if high quality fed males discriminate against smaller females. Copulation duration also depended on both male and female nutritional condition, and the interaction between male diet and female size and diet. Large and high quality fed females had shorter copulations regardless of male condition. Importantly, for A. ludens, female refractory period depended on male size and the nutritional condition of both males and females, which could indicate that for this species, female receptivity does not depend only on the condition of the male ejaculate. For A. obliqua refractory period was associated with the interaction between male size and diet

  17. Comparative analysis of development and survival of two Natal fruit fly Ceratitis rosa Karsch (Diptera, Tephritidae) populations from Kenya and South Africa.

    PubMed

    Tanga, Chrysantus M; Manrakhan, Aruna; Daneel, John-Henry; Mohamed, Samira A; Fathiya, Khamis; Ekesi, Sunday

    2015-01-01

    Comparative analysis of development and survivorship of two geographically divergent populations of the Natal fruit fly Ceratitis rosa Karsch designated as Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya and South Africa were studied at seven constant temperatures (10, 15, 20, 25, 30, 33, 35 °C). Temperature range for development and survival of both populations was 15-35 °C. The developmental duration was found to significantly decrease with increasing temperature for Ceratitis rosa R1 and Ceratitis rosa R2 from both countries. Survivorship of all the immature stages of Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya was highest over the range of 20-30 °C (87-95%) and lowest at 15 and 35 °C (61-76%). Survivorship of larvae of Ceratitis rosa R1 and Ceratitis rosa R2 from South Africa was lowest at 35 °C (22%) and 33 °C (0.33%), respectively. Results from temperature summation models showed that Ceratitis rosa R2 (egg, larva and pupa) from both countries were better adapted to low temperatures than R1, based on lower developmental threshold. Minimum larval temperature threshold for Kenyan populations were 11.27 °C and 6.34 °C (R1 and R2, respectively) compared to 8.99 °C and 7.74 °C (R1 and R2, respectively) for the South African populations. Total degree-day (DD) accumulation for the Kenyan populations were estimated at 302.75 (Ceratitis rosa R1) and 413.53 (Ceratitis rosa R2) compared to 287.35 (Ceratitis rosa R1) and 344.3 (Ceratitis rosa R2) for the South African populations. These results demonstrate that Ceratitis rosa R1 and Ceratitis rosa R2 from both countries were physiologically distinct in their response to different temperature regimes and support the existence of two genetically distinct populations of Ceratitis rosa. It also suggests the need for taxonomic revision of Ceratitis rosa, however, additional information on morphological characterization of Ceratitis rosa R1 and Ceratitis rosa R2 is needed.

  18. Population Dynamics, Distribution, and Species Diversity of Fruit Flies on Cucurbits in Kashmir Valley, India

    PubMed Central

    Ganie, S. A.; Khan, Z. H.; Ahangar, R. A.; Bhat, H. A.; Hussain, Barkat

    2013-01-01

    Given the economic importance of cucurbits and the losses incurred by fruit fly infestation, the population dynamics of fruit flies in cucurbit crops and the influence of abiotic parameters, such as temperature, relative humidity, rainfall, and total sunshine hours per day on the fruit fly population were studied. The study was carried out at six locations; in district Srinagar the locations were Batmaloo, Shalimar, and Dal, while in district Budgam the locations were Chadoora, Narkara, and Bugam (Jammu and Kashmir, India). Various cucurbit crops, such as cucumber, bottle gourd, ridge gourd and bitter gourd, were selected for the study. With regard to locations, mean fruit fly population was highest (6.09, 4.55, 3.87, and 3.60 flies/trap/week) at Batamaloo and Chadoora (4.73, 3.93, 2.73, and 2.73 flies/trap/week) on cucumber, bottle gourd, ridge gourd, and bitter gourd, respectively. The population of fruit flies was significantly correlated with the minimum and maximum temperature. The maximum species diversity of fruit flies was 0.511, recorded in Chadoora. Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae) was the most predominant species in both Srinagar and Budgam, followed by B. dorsalis (Hendel) and B. tau (Walker), while B. scutellaris (Bezzi) was found only in Chadoora. Results of the present investigation may be utilized in developing a sustainable pest management strategy in the agroecological system. PMID:23906383

  19. Population dynamics, distribution, and species diversity of fruit flies on cucurbits in Kashmir Valley, India.

    PubMed

    Ganie, S A; Khan, Z H; Ahangar, R A; Bhat, H A; Hussain, Barkat

    2013-01-01

    Given the economic importance of cucurbits and the losses incurred by fruit fly infestation, the population dynamics of fruit flies in cucurbit crops and the influence of abiotic parameters, such as temperature, relative humidity, rainfall, and total sunshine hours per day on the fruit fly population were studied. The study was carried out at six locations; in district Srinagar the locations were Batmaloo, Shalimar, and Dal, while in district Budgam the locations were Chadoora, Narkara, and Bugam (Jammu and Kashmir, India). Various cucurbit crops, such as cucumber, bottle gourd, ridge gourd and bitter gourd, were selected for the study. With regard to locations, mean fruit fly population was highest (6.09, 4.55, 3.87, and 3.60 flies/trap/week) at Batamaloo and Chadoora (4.73, 3.93, 2.73, and 2.73 flies/trap/week) on cucumber, bottle gourd, ridge gourd, and bitter gourd, respectively. The population of fruit flies was significantly correlated with the minimum and maximum temperature. The maximum species diversity of fruit flies was 0.511, recorded in Chadoora. Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae) was the most predominant species in both Srinagar and Budgam, followed by B. dorsalis (Hendel) and B. tau (Walker), while B. scutellaris (Bezzi) was found only in Chadoora. Results of the present investigation may be utilized in developing a sustainable pest management strategy in the agroecological system.

  20. Host plants of Solanum fruit fly, Bactrocera latifrons(Hendel)(Diptera: Tephritidae); and provisional list of suitable host plants of Bactrocera(Bactrocera)latifrons(Hendel)(Diptera: Tephritidae), Version 1.0

    USDA-ARS?s Scientific Manuscript database

    Bactrocera latifrons (Hendel)(Diptera: Tephritidae) infests many solanaceous plant species, some of which are important horticultural crop species. It has also been found to infest a number of cucurbitaceous plant species as well as a few plant species in other plant families. Bactrocera latifrons i...

  1. Area-Wide Suppression of the Mediterranean Fruit Fly, Ceratitis capitata, and the Oriental Fruit Fly, Bactrocera dorsalis, in Kamuela, Hawaii

    PubMed Central

    Vargas, Roger I.; Piñero, Jaime C.; Mau, Ronald F. L.; Jang, Eric B.; Klungness, Lester M.; McInnis, Donald O.; Harris, Ernest B.; McQuate, Grant T.; Bautista, Renato C.; Wong, Lyle

    2010-01-01

    The United States Department of Agriculture's Agricultural Research Service initiated an area-wide fruit fly management program in Hawaii in 2000. The first demonstration site was established in Kamuela, Hawaii, USA. This paper documents suppression of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in a 40 km2 area containing urban, rural and agricultural zones during a 6 year period. The suppression techniques included sanitation, GF-120 NF Naturalyte Fruit Fly Bait sprays, male annihilation, Biolure® traps, and parasitoids against C. capitata and B. dorsalis. In addition, small numbers of sterile males were released against B. dorsalis. Substantial reductions in fruit infestation levels were achieved for both species (90.7 and 60.7% for C. capitata and B. dorsalis, respectively) throughout the treatment period. Fruit fly captures in the 40 km2 treatment area were significantly lower during the 6 year period than those recorded in three non-treated areas. The strategy of combining suppression techniques in an area-wide approach is discussed. PMID:20883128

  2. Area-wide suppression of the Mediterranean fruit fly, Ceratitis capitata, and the Oriental fruit fly, Bactrocera dorsalis, in Kamuela, Hawaii.

    PubMed

    Vargas, Roger I; Piñero, Jaime C; Mau, Ronald F L; Jang, Eric B; Klungness, Lester M; McInnis, Donald O; Harris, Ernest B; McQuate, Grant T; Bautista, Renato C; Wong, Lyle

    2010-01-01

    The United States Department of Agriculture's Agricultural Research Service initiated an area-wide fruit fly management program in Hawaii in 2000. The first demonstration site was established in Kamuela, Hawaii, USA. This paper documents suppression of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in a 40 km2 area containing urban, rural and agricultural zones during a 6 year period. The suppression techniques included sanitation, GF-120 NF Naturalyte Fruit Fly Bait sprays, male annihilation, Biolure traps, and parasitoids against C. capitata and B. dorsalis. In addition, small numbers of sterile males were released against B. dorsalis. Substantial reductions in fruit infestation levels were achieved for both species (90.7 and 60.7% for C. capitata and B. dorsalis, respectively) throughout the treatment period. Fruit fly captures in the 40 km2 treatment area were significantly lower during the 6 year period than those recorded in three non-treated areas. The strategy of combining suppression techniques in an area-wide approach is discussed.

  3. Packing of Fruit Fly Parasitoids for Augmentative Releases

    PubMed Central

    Montoya, Pablo; Cancino, Jorge; Ruiz, Lía

    2012-01-01

    The successful application of Augmentative Biological Control (ABC) to control pest fruit flies (Diptera: Tephritidae) confronts two fundamental requirements: (1) the establishment of efficient mass rearing procedures for the species to be released, and (2) the development of methodologies for the packing and release of parasitoids that permit a uniform distribution and their optimal field performance under an area-wide approach. Parasitoid distributions have been performed by ground and by air with moderate results; both options face challenges that remain to be addressed. Different devices and strategies have been used for these purposes, including paper bags and the chilled adult technique, both of which are commonly used when releasing sterile flies. However, insect parasitoids have morphological and behavioral characteristics that render the application of such methodologies suboptimal. In this paper, we discuss an alternate strategy for the augmentative release of parasitoids and describe packing conditions that favor the rearing and emergence of adult parasitoids for increased field performance. We conclude that the use of ABC, including the packaging of parasitoids, requires ongoing development to ensure that this technology remains a viable and effective control technique for pest fruit flies. PMID:26466634

  4. Packing of Fruit Fly Parasitoids for Augmentative Releases.

    PubMed

    Montoya, Pablo; Cancino, Jorge; Ruiz, Lía

    2012-09-20

    The successful application of Augmentative Biological Control (ABC) to control pest fruit flies (Diptera: Tephritidae) confronts two fundamental requirements: (1) the establishment of efficient mass rearing procedures for the species to be released, and (2) the development of methodologies for the packing and release of parasitoids that permit a uniform distribution and their optimal field performance under an area-wide approach. Parasitoid distributions have been performed by ground and by air with moderate results; both options face challenges that remain to be addressed. Different devices and strategies have been used for these purposes, including paper bags and the chilled adult technique, both of which are commonly used when releasing sterile flies. However, insect parasitoids have morphological and behavioral characteristics that render the application of such methodologies suboptimal. In this paper, we discuss an alternate strategy for the augmentative release of parasitoids and describe packing conditions that favor the rearing and emergence of adult parasitoids for increased field performance. We conclude that the use of ABC, including the packaging of parasitoids, requires ongoing development to ensure that this technology remains a viable and effective control technique for pest fruit flies.

  5. Tephritid fruit fly transgenesis and applications

    USDA-ARS?s Scientific Manuscript database

    Tephritid fruit flies are among the most serious agricultural pests in the world, owing in large part to those species having broad host ranges including hundreds of fruits and vegetables. They are the largest group of insects subject to population control by a biologically-based systems, most notab...

  6. Assessment of attractiveness of plants as roosting sites for the melon fly, Bactrocera cucurbitae, and oriental fruit fly, Bactrocera dorsalis.

    PubMed

    McQuate, Grant T; Vargas, Roger I

    2007-01-01

    The use of toxic protein bait sprays to suppress melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae), populations typically involves application to vegetation bordering agricultural host areas where the adults seek shelter ("roost"). Although bait spray applications for suppression of oriental fruit fly, Bactrocera dorsalis (Hendel), populations have traditionally been applied to the host crop, rather than to crop borders, roosting by oriental fruit flies in borders of some crop species, such as papaya, Carica papaya L. (Brassicales: Caricaceae), suggests that bait spray applications to crop borders could also help in suppression of B. dorsalis populations. In order to develop improved recommendations for application of bait sprays to border plants for suppression of melon fly and oriental fruit fly populations, the relative attractiveness of a range of plant species, in a vegetative (non-flowering) stage, was tested to wild melon fly and oriental fruit fly populations established in a papaya orchard in Hawaii. A total of 20 plant species were evaluated, divided into four categories: 1) border plants, including corn, Zea mays L. (Poales: Poaceae), windbreaks and broad-leaved ornamentals, 7 species; 2) weed plants commonly found in agricultural fields in Hawaii, 6 species; 3) host crop plants, 1 species- zucchini, Cucurbita pepo L. (Violales: Curcurbitaceae), and 4) locally grown fruit trees, 6 species. Plants were established in pots and placed in an open field, in clusters encircling protein bait traps, 20 m away from the papaya orchard. Castor bean, Ricinus communis L. (Euphorbiales: Euphorbiaceae), panax, Polyscias guilfoylei (Bull) Bailey (Apiales: Araliaceae), tiger's claw, Erythnna variegata L. (Fabales: Fabaceae), and guava, Psidium guajava L. (Myrtales: Myrtaceae) were identified as preferred roosting hosts for the melon fly, and tiger's claw, panax, castor bean, Canada cocklebur, Xanthium strumarium L. (Asterales: Asteraceae), Brazilian

  7. Assessment of Attractiveness of Plants as Roosting Sites for the Melon Fly, Bactrocera cucurbitae, and Oriental Fruit Fly, Bactrocera dorsalis

    PubMed Central

    McQuate, Grant T.; Vargas, Roger I.

    2007-01-01

    The use of toxic protein bait sprays to suppress melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae), populations typically involves application to vegetation bordering agricultural host areas where the adults seek shelter (“roost”). Although bait spray applications for suppression of oriental fruit fly, Bactrocera dorsalis (Hendel), populations have traditionally been applied to the host crop, rather than to crop borders, roosting by oriental fruit flies in borders of some crop species, such as papaya, Carica papaya L. (Brassicales: Caricaceae), suggests that bait spray applications to crop borders could also help in suppression of B. dorsalis populations. In order to develop improved recommendations for application of bait sprays to border plants for suppression of melon fly and oriental fruit fly populations, the relative attractiveness of a range of plant species, in a vegetative (non-flowering) stage, was tested to wild melon fly and oriental fruit fly populations established in a papaya orchard in Hawaii. A total of 20 plant species were evaluated, divided into four categories: 1) border plants, including corn, Zea mays L. (Poales: Poaceae), windbreaks and broad-leaved ornamentals, 7 species; 2) weed plants commonly found in agricultural fields in Hawaii, 6 species; 3) host crop plants, 1 species- zucchini, Cucurbita pepo L. (Violales: Curcurbitaceae), and 4) locally grown fruit trees, 6 species. Plants were established in pots and placed in an open field, in clusters encircling protein bait traps, 20 m away from the papaya orchard. Castor bean, Ricinus communis L. (Euphorbiales: Euphorbiaceae), panax, Polyscias guilfoylei (Bull) Bailey (Apiales: Araliaceae), tiger's claw, Erythnna variegata L. (Fabales: Fabaceae), and guava, Psidium guajava L. (Myrtales: Myrtaceae) were identified as preferred roosting hosts for the melon fly, and tiger's claw, panax, castor bean, Canada cocklebur, Xanthium strumarium L. (Asterales: Asteraceae

  8. Ability of Black Soldier Fly (Diptera: Stratiomyidae) Larvae to Recycle Food Waste.

    PubMed

    Nguyen, Trinh T X; Tomberlin, Jeffery K; Vanlaerhoven, Sherah

    2015-04-01

    Accumulation of organic wastes, especially in livestock facilities, can be a potential pollution issue. The black soldier fly, Hermetia illucens L. (Diptera: Stratiomyidae), can consume a wide range of organic material and has the potential to be used in waste management. In addition, the prepupae stage of this insect can be harvested and used as a valuable nutritious feed for animal livestock. Five waste types with a wide range of organic source matter were specifically chosen to evaluate the consumption and reduction ability of black soldier fly larvae. H. illucens was able to reduce all waste types examined: 1) control poultry feed, 2) pig liver, 3) pig manure, 4) kitchen waste, 5) fruits and vegetables, and 6) rendered fish. Kitchen waste had the greatest mean rate of reduction (consumption by black soldier fly) per day and produced the longest and heaviest black soldier flies. Larvae reared on liver, manure, fruits and vegetables, and fish were approximately the same length and weight as larvae fed the control feed, although some diets produced larvae with a higher nutritional content. The black soldier fly has the ability to consume and reduce organic waste and be utilized as valuable animal feed. Exploration of the potential use of black soldier flies as an agent for waste management on a large-scale system should continue.

  9. Social attraction mediated by fruit flies' microbiome.

    PubMed

    Venu, Isvarya; Durisko, Zachary; Xu, Jianping; Dukas, Reuven

    2014-04-15

    Larval and adult fruit flies are attracted to volatiles emanating from food substrates that have been occupied by larvae. We tested whether such volatiles are emitted by the larval gut bacteria by conducting tests under bacteria-free (axenic) conditions. We also tested attraction to two bacteria species, Lactobacillus brevis, which we cultured from larvae in our lab, and L. plantarum, a common constituent of fruit flies' microbiome in other laboratory populations and in wild fruit flies. Neither larvae nor adults showed attraction to axenic food that had been occupied by axenic larvae, but both showed the previously reported attraction to standard food that had been occupied by larvae with an intact microbiome. Larvae also showed significant attraction to volatiles from axenic food and larvae to which we added only either L. brevis or L. plantarum, and volatiles from L. brevis reared on its optimal growth medium. Controlled learning experiments indicated that larvae experienced with both standard and axenic used food do not perceive either as superior, while focal larvae experienced with simulated used food, which contains burrows, perceive it as superior to unused food. Our results suggest that flies rely on microbiome-derived volatiles for long-distance attraction to suitable food patches. Under natural settings, fruits often contain harmful fungi and bacteria, and both L. brevis and L. plantarum produce compounds that suppress the growth of some antagonistic fungi and bacteria. The larval microbiome volatiles may therefore lead prospective fruit flies towards substrates with a hospitable microbial environment.

  10. Improvement of mass-rearing procedures for an olive fruit fly parasitoid – duration of exposure to hosts affects production of Psyttalia lounsburyi

    USDA-ARS?s Scientific Manuscript database

    The olive fruit fly, Bactrocera oleae (Diptera: Tephritidae), causes severe economic damage in California. Control of this fly is currently limited to pesticides. The USDA-ARS European Biological Control Laboratory in Montpellier, France established a classical biological control program nearly 15 y...

  11. Interaction between visual and olfactory cues during host finding in the tomato fruit fly Neoceratitis cyanescens.

    PubMed

    Brévault, Thierry; Quilici, Serge

    2010-03-01

    Herbivorous insects searching for a host plant need to integrate a sequence of multimodal sensory inputs. We conducted a series of no-choice experiments in a laboratory wind tunnel to examine the behavioral response of the specialist fruit fly, Neoceratitis cyanescens (Diptera: Tephritidae), to host visual and olfactory stimuli presented singly or in combination (e.g., colored fruit model with or without host fruit odor). We also studied the influence of wind flow, age, and sex on the response of flies. In two-choice experiments, we evaluated the ability of mature females to discriminate between two fruit models emitting host vs. non-host fruit odor or clean air. Neoceratitis cyanescens mature females can use independently or interactively olfactory and visual stimuli to locate their host, whereas immature females and males respond primarily to host fruit odor. In the absence of wind, mature females mainly use visual information to locate the host fruit. In wind, host fruit odor significantly increases the probability and speed of locating the host fruit. In a two-choice situation between two bright orange spheres, flies accurately detected the sphere emitting host fruit odor vs. non-host fruit odor or odorless air. Nevertheless, they preferred to land on the bright orange sphere when the sphere emitting host fruit odor was blue. Furthermore, when odor source and fruit model were spatially decoupled (90 or 180 degrees ), >50% flies that landed on the fruit model initially performed an oriented flight toward the odor source, then turned back to the fruit model while in flight or after one landing, thus suggesting visual information to be the ultimate indicator of host fruit.

  12. Integrated Management of European Cherry Fruit Fly Rhagoletis cerasi (L.): Situation in Switzerland and Europe

    PubMed Central

    Daniel, Claudia; Grunder, Jürg

    2012-01-01

    The European cherry fruit fly, Rhagoletis cerasi (L.) (Diptera: Tephritidae), is a highly destructive pest. The low tolerance for damaged fruit requires preventive insecticide treatments for a marketable crop. The phase-out of old insecticides threatens cherry production throughout the European Union (EU). Consequently, new management techniques and tools are needed. With the increasing number of dwarf tree orchards covered against rain to avoid fruit splitting, crop netting has become a viable, cost-effective method of cherry fruit fly control. Recently, a biocontrol method using the entomopathogenic fungus Beauveria bassiana has been developed for organic agriculture. However, for most situations, there is still a lack of efficient and environmentally sound insecticides to control this pest. This review summarizes the literature from over one hundred years of research on R. cerasi with focus on the biology and history of cherry fruit fly control as well as on antagonists and potential biocontrol organisms. We will present the situation of cherry fruit fly regulation in different European countries, give recommendations for cherry fruit fly control, show gaps in knowledge and identify future research opportunities. PMID:26466721

  13. Integrated Management of European Cherry Fruit Fly Rhagoletis cerasi (L.): Situation in Switzerland and Europe.

    PubMed

    Daniel, Claudia; Grunder, Jürg

    2012-10-16

    The European cherry fruit fly, Rhagoletis cerasi (L.) (Diptera: Tephritidae), is a highly destructive pest. The low tolerance for damaged fruit requires preventive insecticide treatments for a marketable crop. The phase-out of old insecticides threatens cherry production throughout the European Union (EU). Consequently, new management techniques and tools are needed. With the increasing number of dwarf tree orchards covered against rain to avoid fruit splitting, crop netting has become a viable, cost-effective method of cherry fruit fly control. Recently, a biocontrol method using the entomopathogenic fungus Beauveria bassiana has been developed for organic agriculture. However, for most situations, there is still a lack of efficient and environmentally sound insecticides to control this pest. This review summarizes the literature from over one hundred years of research on R. cerasi with focus on the biology and history of cherry fruit fly control as well as on antagonists and potential biocontrol organisms. We will present the situation of cherry fruit fly regulation in different European countries, give recommendations for cherry fruit fly control, show gaps in knowledge and identify future research opportunities.

  14. Indigenous and Invasive Fruit Fly Diversity along an Altitudinal Transect in Eastern Central Tanzania

    PubMed Central

    Geurts, Katrien; Mwatawala, Maulid; De Meyer, Marc

    2012-01-01

    The relative abundance of indigenous and invasive frugivorous fruit flies (Diptera: Tephritidae) was evaluated spatially and temporally along an altitudinal transect between 581–1650 m in the Uluguru Mountains near Morogoro, Tanzania. The polyphagous invasive fruit fly Bactrocera invadens Drew, Tsuruta, and White and the indigenous fruit fly Ceratitis rosa Karsch show a similar temporal pattern, but are largely separated spatially, with B. invadens being abundant at lower elevation and C. rosa predominant at higher elevation. The polyphagous indigenous C. cosyra (Walker) coincides with B. invadens but shows an inverse temporal pattern. The cucurbit feeders B. cucurbitae (Coquillett) and Dacus bivittatus (Bigot) show a similar temporal pattern, but the former is restricted to lower elevations. Host availability and climatic differences seem to be the determining factors to explain the differences in occurrence and abundance in time and space. PMID:22935017

  15. Distribution and abundance of Stomoxyini flies (Diptera: Muscidae) in Thailand.

    PubMed

    Changbunjong, Tanasak; Weluwanarak, Thekhawet; Ratanakorn, Parntep; Maneeon, Pattarapon; Ganpanakngan, Manoch; Apiwathnasorn, Chamnarn; Sungvornyothin, Sungsit; Sriwichai, Patchara; Sumruayphol, Suchada; Ruangsittichai, Jiraporn

    2012-11-01

    Stomoxyini flies (Diptera: Muscidae) include species of parasitic flies of medical and veterinary importance. The adult flies feed on the blood of mammals and may transmit several parasites and pathogens. We conducted an entomological survey of Stomoxyini flies from different sites in Thailand. Stomoxyini flies were collected at four major types of sites: zoos, livestock farms, wildlife conservation areas and a national park using vavoua traps between November 2010 and April 2011. A total of 3,314 Stomoxyini flies belonging to the genera Stomoxys, Haematobosca, Haematostoma and Haematobia were collected. Eight species were identified: S. calcitrans (46.6%), S. uruma (26.8%), S. pulla (4.3%), S. indicus (0.7%), S. sitiens (0.1%), H. sanguinolenta (11.2 %), H. austeni (0.5%) and H. irritans exigua (9.8%). The diversity of Stomoxyini flies in the livestock farms was higher than the other sites. Altitude correlated with the number of flies. This study provides information that may be useful for Stomoxyini flies control.

  16. Species Diversity in the Parasitoid Genus Asobara (Hymenoptera: Braconidae) from the Native Area of the Fruit Fly Pest Drosophila suzukii (Diptera: Drosophilidae)

    PubMed Central

    Guerrieri, Emilio; Giorgini, Massimo; Cascone, Pasquale; Carpenito, Simona; van Achterberg, Cees

    2016-01-01

    Drosophila suzukii (Matsumura), commonly known as Spotted Wing Drosophila (SWD), is a worldwide serious economic threat to the production of berries and stone fruits. The chemical control widely used against this pest is often not able to preventing yield losses because wild flora offers an abundance of fruits to D. suzukii where the pest is able to reproduce and from where it recolonizes neighbouring cultivated fields. Alternatively, within Integrated Pest Management protocols for D. suzukii, biological control could play a key role by reducing its populations particularly in non-cultivated habitats, thus increasing the effectiveness and reducing the side negative effects of other management strategies. Because of the scarcity and of the low efficiency of autochthonous parasitoids in the new invaded territories, in the last few years, a number of surveys started in the native area of D. suzukii to find parasitoid species to be evaluated in quarantine structures and eventually released in the field, following a classical biological control approach. This paper reports the results of these surveys carried out in South Korea and for the first time in China. Among the parasitoids collected, those belonging to the genus Asobara Foerster resulted dominant both by number and species diversity. By combining morphological characters and the mitochondrial COI gene as a molecular marker, we identified seven species of Asobara, of which two associated with D. suzukii, namely A. japonica and A leveri, and five new to science, namely Asobara brevicauda, A. elongata, A mesocauda, A unicolorata, A. triangulata. Our findings offer new opportunity to find effective parasitoids to be introduced in classical biological control programmes in the territories recently invaded by D. suzukii. PMID:26840953

  17. A new blend of white sapote fruit volatiles as potential attractant to Anastrepha ludens (Diptera: Tephritidae).

    PubMed

    González, Ricardo; Toledo, Jorge; Cruz-Lopez, Leopoldo; Virgen, Armando; Santiesteban, Antonio; Malo, Edi A

    2006-12-01

    The behavioral and electrophysiological responses of nonirradiated male and female Anastrepha ludens (Loew) (Diptera: Tephritidae), to white sapote, Casimiroa edulis Oerst. (Rutaceae), volatiles were investigated. Females flew upwind and landed more often on fruit than on artificial fruit in wind tunnel bioassays. Males flew upwind (but not landed) more frequently on fruit than on artificial fruit. Porapak Q volatile extracts of white sapote also elicited upwind flight and landing on artificial fruit for both sexes. Gas chromatography-electroantennographic detection analysis of white sapote extracts revealed that antennae of both sexes responded to eight compounds. Two peaks were unidentified because they did not separate from the solvent. Subsequent peaks were identified by gas chromatography-mass spectrometry as styrene, myrcene, 1,2,4-trimethylbenzene, 1,8-cineole, and linalool in a proportion of 50: 21: 0.5: 27: 1.5, respectively. Eight peaks were tentatively identified as beta-trans-ocimene. The number of A. ludens captured in multilure traps baited with the synthetic white sapote blend was higher than the flies captured by the multilure unbaited traps (control) in field cages. However, the number of flies captured by traps baited with the white sapote blend was not different from that of flies captured by traps baited with hydrolyzed protein. Using standard chemical ecology techniques, we found potential attractants from wild sapote fruit for monitoring and management of A. ludens population.

  18. Multiplex PCR in Determination of Opiinae Parasitoids of Fruit Flies, Bactrocera sp., Infesting Star Fruit and Guava

    PubMed Central

    Shariff, S.; Ibrahim, N. J.; Md-Zain, B. M.; Idris, A. B.; Suhana, Y.; Roff, M. N.; Yaakop, S.

    2014-01-01

    Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. PMID

  19. Multiplex PCR in determination of Opiinae parasitoids of fruit flies, Bactrocera sp., infesting star fruit and guava.

    PubMed

    Shariff, S; Ibrahim, N J; Md-Zain, B M; Idris, A B; Suhana, Y; Roff, M N; Yaakop, S

    2014-01-23

    Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. This is an

  20. Reconstructing the behavior of walking fruit flies

    NASA Astrophysics Data System (ADS)

    Berman, Gordon; Bialek, William; Shaevitz, Joshua

    2010-03-01

    Over the past century, the fruit fly Drosophila melanogaster has arisen as almost a lingua franca in the study of animal behavior, having been utilized to study questions in fields as diverse as sleep deprivation, aging, and drug abuse, amongst many others. Accordingly, much is known about what can be done to manipulate these organisms genetically, behaviorally, and physiologically. Most of the behavioral work on this system to this point has been experiments where the flies in question have been given a choice between some discrete set of pre-defined behaviors. Our aim, however, is simply to spend some time with a cadre of flies, using techniques from nonlinear dynamics, statistical physics, and machine learning in an attempt to reconstruct and gain understanding into their behavior. More specifically, we use a multi-camera set-up combined with a motion tracking stage in order to obtain long time-series of walking fruit flies moving about a glass plate. This experimental system serves as a test-bed for analytical, statistical, and computational techniques for studying animal behavior. In particular, we attempt to reconstruct the natural modes of behavior for a fruit fly through a data-driven approach in a manner inspired by recent work in C. elegans and cockroaches.

  1. Evolution: Fruit Fly Clocks on the Edge.

    PubMed

    Kyriacou, Charalambos P

    2017-03-20

    Fruit flies evolved in tropical regions under stable light-dark cycles. However, their photosensitive circadian clock had to adapt to extreme seasonal photoperiods during their colonisation of temperate regions. This was achieved by changing the neuronal expression of two key clock-related components.

  2. The fruit flies (Tephritidae) of Ontario

    USDA-ARS?s Scientific Manuscript database

    Thirteen species of Tephritidae are newly recorded from Ontario, and alternative format keys are provided to the 31 genera and 72 species of fruit fly now known from, or likely to occur, in the province. Standard dichotomous keys to genera, and simplified field keys to genera and species are provide...

  3. Improve California trap programs for detection of fruit flies

    USDA-ARS?s Scientific Manuscript database

    There are >160,000 federal and state fruit fly detection traps deployed in southern and western U.S. States and Puerto Rico. In California alone, >100,000 traps are deployed and maintained just for exotic fruit flies detection. Fruit fly detection and eradication requires deployment of large numbers...

  4. First Record of Calliephialtes sittenfeldae Associated with the Tephritid Fruit Fly Anastrepha spatulata in Mexico

    PubMed Central

    López-Ortega, Maurilio; Khalaim, Andrey I.

    2012-01-01

    This paper reports for the first time an ichneumonid parasitoid Calliephialtes sittenfeldae Gauld Ugalde-Gómez et Hanson (Hymenoptera: Ichneumonidae) associated with a dipteran host Anastrepha spatulata Stone (Diptera: Tephritidae), recovered from fruit of Schoepfia schreberi (Santalales: Olacaceae) in central Veracruz, Mexico. Large numbers of this parasitoid were collected and reared from its fruit fly host in three localities of Veracruz, Mexico. Some observations of its biology are also reported. This is a first record of C. sittenfeldae from Mexico, and the first record of this parasitoid species, its insect host, and the host plant. The male of this species is described and illustrated for the first time. PMID:22970708

  5. Melon Fly, Bactrocera cucurbitae (Diptera: Tephritidae), Infestation in Host Fruits in the Southwestern Islands of Japan Before the Initiation of Island-wide Population Suppression, as Recorded in Publications of Japanese Public Institutions

    PubMed Central

    McQuate, Grant T.; Teruya, Tadashi

    2015-01-01

    Bactrocera cucurbitae (Coquillett) is a tephritid fruit fly native to the Indo-Malayan region. Its distribution, though, has extended to include Africa, temperate Asia, and a number of Pacific islands. It became established in Japan in 1919 in the Yaeyama Islands and spread north in the Southwestern Islands of Japan. It was subsequently eradicated from these islands by an eradication program that extended from 1972 to 1993. As part of an effort to develop a worldwide database on the status of fruits as hosts of melon fly, the infestation data gathered from host fruits collected in this eradication program, before the initiation of suppression activities, are summarized here. Bactrocera cucurbitae infestation was documented in 24 plant taxa of four plant families (Caricaceae, Cucurbitaceae, Moraceae, and Solanaceae), with the following four new hosts identified: Ficus erecta Thunb., F. pumila L. (Moraceae), Solanum erianthum D. Don (Solanaceae), and Zehneria liukiuensis Jeffrey ex Walker (Cucurbitaceae). PMID:26816487

  6. Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espírito Santo, Brazil.

    PubMed

    Uramoto, K; Martins, D S; Zucchi, R A

    2008-10-01

    The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-July 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espírito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

  7. Melon Fly, Bactrocera cucurbitae (Diptera: Tephritidae), Infestation in Host Fruits in the Southwestern Islands of Japan Before the Initiation of Island-wide Population Suppression, as Recorded in Publications of Japanese Public Institutions.

    PubMed

    McQuate, Grant T; Teruya, Tadashi

    2015-01-01

    Bactrocera cucurbitae (Coquillett) is a tephritid fruit fly native to the Indo-Malayan region. Its distribution, though, has extended to include Africa, temperate Asia, and a number of Pacific islands. It became established in Japan in 1919 in the Yaeyama Islands and spread north in the Southwestern Islands of Japan. It was subsequently eradicated from these islands by an eradication program that extended from 1972 to 1993. As part of an effort to develop a worldwide database on the status of fruits as hosts of melon fly, the infestation data gathered from host fruits collected in this eradication program, before the initiation of suppression activities, are summarized here. Bactrocera cucurbitae infestation was documented in 24 plant taxa of four plant families (Caricaceae, Cucurbitaceae, Moraceae, and Solanaceae), with the following four new hosts identified: Ficus erecta Thunb., F. pumila L. (Moraceae), Solanum erianthum D. Don (Solanaceae), and Zehneria liukiuensis Jeffrey ex Walker (Cucurbitaceae).

  8. Field captures of wild melon fly (Diptera: Tephritidae) with an improved male attractant, raspberry ketone formate.

    PubMed

    Jang, Eric B; Casana-Giner, Victor; Oliver, James E

    2007-08-01

    Field-trapping evaluations of the new male attractant, formic acid 4-(3-oxobutyl) phenyl ester (raspberry ketone formate [RKF]) were conducted in Hawaii with wild populations of melon flies, Bactrocera cucurbitae Coquillett (Diptera: Tephritidae), to determine its activity in the field and to evaluate new plastic matrix formulations. All tests were compared with the standard melon fly attractant 4-(4-acetoxyphenyl) -2-butanone (cuelure [CL]), which is the attractant of choice for detection programs aimed at melon fly and other cuelure-responding Bactrocera fruit flies. Results of these tests over a range of doses on cotton wicks showed that at a 1-g dose raspberry ketone formate was 1.5-2 times more attractive compared with cuelure for up to 11 wk in the field. Lower doses applied on cotton wicks were less active, presumably due to hydrolysis of RKF to raspberry ketone. Raspberry ketone formate embedded in a plastic plug formulation also was field tested, and it was shown to be more attractive to male melon fly compared with cuelure. The use of this new attractant in control and detection programs is discussed.

  9. New genera of Australian stiletto flies (Diptera, Therevidae)

    PubMed Central

    Irwin, Michael E.; Winterton, Shaun L.

    2016-01-01

    Abstract Two new stiletto fly genera of Agapophytinae (Diptera: Therevidae) are described from Australia. Sidarena gen. n. comprises six new species (Sidarena aurantia sp. n., Sidarena flavipalpa sp. n., Sidarena geraldton sp. n., Sidarena hortorum sp. n., Sidarena macfarlandi sp. n., and Sidarena yallingup sp. n.) and is largely endemic to Western Australia. Zelothrix gen. n. is described based on two species; Zelothrix warrumbungles sp. n. is a locally abundant species in Eastern Australia, while Zelothrix yeatesi sp. n. is restricted to southwestern Western Australia. These sister genera are likely closely related to Taenogerella Winterton & Irwin and Actenomeros Winterton & Irwin. PMID:27853402

  10. Fruit Flies in Biomedical Research

    PubMed Central

    Wangler, Michael F.; Yamamoto, Shinya; Bellen, Hugo J.

    2015-01-01

    Many scientists complain that the current funding situation is dire. Indeed, there has been an overall decline in support in funding for research from the National Institutes of Health and the National Science Foundation. Within the Drosophila field, some of us question how long this funding crunch will last as it demotivates principal investigators and perhaps more importantly affects the long-term career choice of many young scientists. Yet numerous very interesting biological processes and avenues remain to be investigated in Drosophila, and probing questions can be answered fast and efficiently in flies to reveal new biological phenomena. Moreover, Drosophila is an excellent model organism for studies that have translational impact for genetic disease and for other medical implications such as vector-borne illnesses. We would like to promote a better collaboration between Drosophila geneticists/biologists and human geneticists/bioinformaticians/clinicians, as it would benefit both fields and significantly impact the research on human diseases. PMID:25624315

  11. Fruit flies and intellectual disability

    PubMed Central

    Bolduc, François V.; Tully, Tim

    2011-01-01

    Mental retardation—known more commonly nowadays as intellectual disability—is a severe neurological condition affecting up to 3% of the general population. As a result of the analysis of familial cases and recent advances in clinical genetic testing, great strides have been made in our understanding of the genetic etiologies of mental retardation. Nonetheless, no treatment is currently clinically available to patients suffering from intellectual disability. Several animal models have been used in the study of memory and cognition. Established paradigms in Drosophila have recently captured cognitive defects in fly mutants for orthologs of genes involved in human intellectual disability. We review here three protocols designed to understand the molecular genetic basis of learning and memory in Drosophila and the genes identified so far with relation to mental retardation. In addition, we explore the mental retardation genes for which evidence of neuronal dysfunction other than memory has been established in Drosophila. Finally, we summarize the findings in Drosophila for mental retardation genes for which no neuronal information is yet available. All in all, this review illustrates the impressive overlap between genes identified in human mental retardation and genes involved in physiological learning and memory. PMID:19182539

  12. The melon fruit fly, Bactrocera cucurbitae: A review of its biology and management

    PubMed Central

    Dhillon, M.K.; Singh, Ram; Naresh, J.S.; Sharma, H.C.

    2005-01-01

    The melon fruit fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae) is distributed widely in temperate, tropical, and sub-tropical regions of the world. It has been reported to damage 81 host plants and is a major pest of cucurbitaceous vegetables, particularly the bitter gourd (Momordica charantia), muskmelon (Cucumis melo), snap melon (C. melo var. momordica), and snake gourd (Trichosanthes anguina). The extent of losses vary between 30 to 100%, depending on the cucurbit species and the season. Its abundance increases when the temperatures fall below 32° C, and the relative humidity ranges between 60 to 70%. It prefers to infest young, green, soft-skinned fruits. It inserts the eggs 2 to 4 mm deep in the fruit tissues, and the maggots feed inside the fruit. Pupation occurs in the soil at 0.5 to 15 cm below the soil surface. Keeping in view the importance of the pest and crop, melon fruit fly management could be done using local area management and wide area management. The melon fruit fly can successfully be managed over a local area by bagging fruits, field sanitation, protein baits, cue-lure traps, growing fruit fly-resistant genotypes, augmentation of biocontrol agents, and soft insecticides. The wide area management program involves the coordination of different characteristics of an insect eradication program (including local area options) over an entire area within a defensible perimeter, and subsequently protected against reinvasion by quarantine controls. Although, the sterile insect technique has been successfully used in wide area approaches, this approach needs to use more sophisticated and powerful technologies in eradication programs such as insect transgenesis and geographical information systems, which could be deployed over a wide area. Various other options for the management of fruit fly are also discussed in relation to their bio-efficacy and economics for effective management of this pest. PMID:17119622

  13. Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences

    NASA Astrophysics Data System (ADS)

    Ibrahim, N. J.; Md-Zain, B. M.; Yaakop, S.

    2013-11-01

    Opiinae is among the l0 largest subfamilies under the family Braconidae. Opiines species have great potential as natural enemies against fruit fly pests. Before using them as a biological control agent, construction of the phylogenetic trees could facilitate in the molecular identification of individual species and their relationships among members of the Opiines, as well as between Opiines and their host plants. Larval specimens of tephritids were collected from four crop species at five localities throughout the Peninsular Malaysia. A total of 44 specimens of opiines had successfully emerged from the hosts, fruit fly larvae. The DNA sequences of 12S and 16S rRNA were obtained for the braconids while the mitochondrial ND1 sequences were obtained for the tephritids species through polymerase chain reaction. Maximum Parsimony and Bayesian trees were constructed by using PAUP 4.0b10 and MrBayes 3.1.2 to identify the relationships among the taxa. This study illustrates the phylogenetic relationships among parasitoid opiines collected and reared from parasitized fruit flies. The phylogenetic trees constructed based on the mitochondrial 12S and 16S rRNA sequences exhibited similar topology and sequence divergence. The opiines were divided into several clades and subclades according to the genus and species. Each clade also was supported by the similar host plants with high support values. However, their pests were not specific, except for Bactrocera cucurbitae. This study has reconfirmed the associations between Opiinae, tephritids, and host plants based on molecular data.

  14. Intraguild predation influences oviposition behavior of blow flies (Diptera: Calliphoridae).

    PubMed

    Galindo, Luciane A; Moral, Rafael A; Moretti, Thiago C; Godoy, Wesley A C; Demétrio, Clarice G B

    2016-05-01

    The objective of the present study was to determine whether blow flies (Diptera: Calliphoridae) are able to identify larvae of an intraguild predator species in the substrate and avoid laying eggs there. Blow flies oviposited in traps with different treatments: substrate only and substrate with larvae of Chrysomya albiceps (Wiedemann, 1819), Chrysomya megacephala (Fabricius, 1794), or Chrysomya putoria (Wiedemann, 1830). Ch. megacephala, Ch. putoria, and Lucilia eximia (Wiedemann, 1819) avoided laying eggs in the trap containing Ch. albiceps larvae. Cochliomyia macellaria (Fabricius, 1775) did not oviposit differently in each substrate but had overall low abundance. The prevalence of species on corpses may be influenced by the ability of the species to detect the presence of other species, mainly predators. In this sense, intraguild predation may result in misinterpretations of a crime scene and should be considered when assessing the minimum postmortem interval.

  15. The mitochondrial genome of Elodia flavipalpis Aldrich (Diptera: Tachinidae) and the evolutionary timescale of Tachinid flies.

    PubMed

    Zhao, Zhe; Su, Tian-Juan; Chesters, Douglas; Wang, Shi-di; Ho, Simon Y W; Zhu, Chao-Dong; Chen, Xiao-Lin; Zhang, Chun-Tian

    2013-01-01

    Tachinid flies are natural enemies of many lepidopteran and coleopteran pests of forests, crops, and fruit trees. In order to address the lack of genetic data in this economically important group, we sequenced the complete mitochondrial genome of the Palaearctic tachinid fly Elodia flavipalpis Aldrich, 1933. Usually found in Northern China and Japan, this species is one of the primary natural enemies of the leaf-roller moths (Tortricidae), which are major pests of various fruit trees. The 14,932-bp mitochondrial genome was typical of Diptera, with 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes. However, its control region is only 105 bp in length, which is the shortest found so far in flies. In order to estimate dipteran evolutionary relationships, we conducted a phylogenetic analysis of 58 mitochondrial genomes from 23 families. Maximum-likelihood and Bayesian methods supported the monophyly of both Tachinidae and superfamily Oestroidea. Within the subsection Calyptratae, Muscidae was inferred as the sister group to Oestroidea. Within Oestroidea, Calliphoridae and Sarcophagidae formed a sister clade to Oestridae and Tachinidae. Using a Bayesian relaxed clock calibrated with fossil data, we estimated that Tachinidae originated in the middle Eocene.

  16. The Mitochondrial Genome of Elodia flavipalpis Aldrich (Diptera: Tachinidae) and the Evolutionary Timescale of Tachinid Flies

    PubMed Central

    Zhao, Zhe; Su, Tian-juan; Chesters, Douglas; Wang, Shi-di; Ho, Simon Y. W.; Zhu, Chao-dong; Chen, Xiao-lin; Zhang, Chun-tian

    2013-01-01

    Tachinid flies are natural enemies of many lepidopteran and coleopteran pests of forests, crops, and fruit trees. In order to address the lack of genetic data in this economically important group, we sequenced the complete mitochondrial genome of the Palaearctic tachinid fly Elodia flavipalpis Aldrich, 1933. Usually found in Northern China and Japan, this species is one of the primary natural enemies of the leaf-roller moths (Tortricidae), which are major pests of various fruit trees. The 14,932-bp mitochondrial genome was typical of Diptera, with 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes. However, its control region is only 105 bp in length, which is the shortest found so far in flies. In order to estimate dipteran evolutionary relationships, we conducted a phylogenetic analysis of 58 mitochondrial genomes from 23 families. Maximum-likelihood and Bayesian methods supported the monophyly of both Tachinidae and superfamily Oestroidea. Within the subsection Calyptratae, Muscidae was inferred as the sister group to Oestroidea. Within Oestroidea, Calliphoridae and Sarcophagidae formed a sister clade to Oestridae and Tachinidae. Using a Bayesian relaxed clock calibrated with fossil data, we estimated that Tachinidae originated in the middle Eocene. PMID:23626734

  17. New Dicranoptycha Osten Sacken, 1859 Crane flies (Diptera: Limoniidae) of North and South Korea.

    PubMed

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2015-02-27

    Two new species of Dicranoptycha Osten Sacken, 1859, crane flies (Diptera, Limoniidae) from the Korean peninsula are described, illustrated and compared with already known and related species. An identification key and check-list of all Korean Dicranoptycha is presented.

  18. Development and oviposition preference of house flies and stable flies (Diptera: Muscidae) in six substrates from Florida equine facilities

    USDA-ARS?s Scientific Manuscript database

    House flies, Musca domestica L., and stable flies, Stomoxys calcitrans (L.), (Diptera: Muscidae), common pests on equine facilities, were studied in the laboratory to determine their oviposition preferences and larval development on six substrates commonly found on equine facilities. The substrates...

  19. Host status and fruit odor response of Drosophila suzukii (Diptera: Drosophilidae) to figs and mulberries.

    PubMed

    Yu, Doris; Zalom, F G; Hamby, K A

    2013-08-01

    Drosophila suzukii Matsumura (Diptera: Drosophilidae) is an agricultural pest with a wide host range. It is known to infest fruit that are still ripening on the plant, as well as rotting and damaged fruit. Our study sought to determine whether D. suzukii use mulberries (Morus spp.) and figs (Ficus carica (L.)) as hosts, as their host status was ambiguous. Accordingly, we collected 25 field-infested fruit and counted the numbers of D. suzukii emerging from them. We also sought to determine whether female D. suzukii would respond to olfactory cues from ripe figs and mulberries. As the host population has been known to impact host odor response, flies from mulberry, fig, and cherry origins were tested in "one-choice" olfactometry studies. Our results show that mulberries and figs can serve as hosts for D. suzukii and that female flies will respond to their odors. The host population did affect response to fruit odors, although further studies are necessary to determine habitat fidelity. This has implications for management of this pest, especially in backyard and mixed fruit orchard situations, which commonly occur in the current range of D. suzukii, and fig and mulberry may serve as a pest reservoir for other hosts and cultivated crops.

  20. Species composition of forensically important blow flies (Diptera: Calliphoridae) and flesh flies (Diptera: Sarcophagidae) through space and time.

    PubMed

    Fremdt, Heike; Amendt, Jens

    2014-03-01

    Weekly monitoring of forensically important flight-active blow flies (Diptera: Calliphoridae) and flesh flies (Diptera: Sarcophagidae) was performed using small baited traps. Sampling took place in two rural, one suburban and two urban habitats in and around Frankfurt (Main), Germany, lasting two years and eight months. Highest values for species richness and Chao-Shen entropy estimator for Shannon's index in both families were found at the urban sites, peaking during summer. Space-time interaction was tested and found to be significant, demonstrating the value of a statistical approach recently developed for community surveys in ecology. K-means partitioning and analysis of indicator species gave significant temporal and habitat associations of particular taxa. Calliphora vicina was an indicator species for lower temperatures without being associated with a particular habitat. Lucilia sericata was an indicator for urban sites, whereas Lucilia ampullacea and Lucilia caesar were indicators for rural sites, supplemented by the less frequent species Calliphora vomitoria. Sarcophagidae were observed during a clearly shorter period of year. Sarcophaga subvicina+Sarcophaga variegata was found to be an indicator for urban habitats during summer as well as Sarcophaga albiceps for rural habitats. A significant association of Sarcophaga caerulescens to rural habitats as well as one of Sarcophaga similis to urban habitats was observed.

  1. Sampling strategies for phlebotomine sand flies (Diptera: Psychodidae) in Europe.

    PubMed

    Alten, B; Ozbel, Y; Ergunay, K; Kasap, O E; Cull, B; Antoniou, M; Velo, E; Prudhomme, J; Molina, R; Bañuls, A-L; Schaffner, F; Hendrickx, G; Van Bortel, W; Medlock, J M

    2015-12-01

    The distribution of phlebotomine sand flies is widely reported to be changing in Europe. This can be attributed to either the discovery of sand flies in areas where they were previously overlooked (generally following an outbreak of leishmaniasis or other sand fly-related disease) or to true expansion of their range as a result of climatic or environmental changes. Routine surveillance for phlebotomines in Europe is localized, and often one of the challenges for entomologists working in non-leishmaniasis endemic countries is the lack of knowledge on how to conduct, plan and execute sampling for phlebotomines, or how to adapt on-going sampling strategies for other haematophagous diptera. This review brings together published and unpublished expert knowledge on sampling strategies for European phlebotomines of public health concern in order to provide practical advice on: how to conduct surveys; the collection and interpretation of field data; suitable techniques for the preservation of specimens obtained by different sampling methods; molecular techniques used for species identification; and the pathogens associated with sand flies and their detection methods.

  2. From fat fruit fly to human obesity.

    PubMed

    Smith, Wanli W; Thomas, Joseph; Liu, Jingnan; Li, Tianxia; Moran, Timothy H

    2014-09-01

    Obesity is a chronic metabolic disease that has become a global problem. Although a tremendous amount of effort has been spent to prevent and treat obesity, its etiology is still largely unknown and there are not yet sufficient strategies to control obesity. Recently, the fruit fly, Drosophila melanogaster, has become a useful model for studying metabolic homeostasis and obesity related disorders. The goal of this mini-review is to summarize the recent achievements of Drosophila models and to highlight the experimental protocols used in studying feeding behavior and energy homeostasis in the fly. The Drosophila models provide useful tools to understand obesity pathogenesis and to develop novel therapeutics. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. The fruit flies (Diptera: Tephritidae) described by Theodor Becker from Iran and Western China revisited in the collections of the Zoological Institute, Saint-Petersburg and Museum für Naturkunde, Berlin.

    PubMed

    Korneyev, Severyn V; Korneyev, Valery A

    2017-01-31

    The type specimens of fruit flies described by Dr. Theodor Becker based on material collected in China (Xinjiang and Xizang) and Iran by Russian expeditions directed by Petr Kozlov and Mykola Zarudny are listed and figured. They are deposited in the collection of the Zoological Institute of Russian Academy of Sciences, Saint Petersburg with some duplicates in the Museum für Naturkunde, Berlin. Current concepts of the species, their morphological characters (illustrated by photographs of type specimens), current condition, and nomenclature are discussed.

  4. DNA Barcodes for the Northern European Tachinid Flies (Diptera: Tachinidae)

    PubMed Central

    Kahanpää, Jere; Mutanen, Marko

    2016-01-01

    This data release provides COI barcodes for 366 species of parasitic flies (Diptera: Tachinidae), enabling the DNA based identification of the majority of northern European species and a large proportion of Palearctic genera, regardless of the developmental stage. The data will provide a tool for taxonomists and ecologists studying this ecologically important but challenging parasitoid family. A comparison of minimum distances between the nearest neighbors revealed the mean divergence of 5.52% that is approximately the same as observed earlier with comparable sampling in Lepidoptera, but clearly less than in Coleoptera. Full barcode-sharing was observed between 13 species pairs or triplets, equaling to 7.36% of all species. Delimitation based on Barcode Index Number (BIN) system was compared with traditional classification of species and interesting cases of possible species oversplits and cryptic diversity are discussed. Overall, DNA barcodes are effective in separating tachinid species and provide novel insight into the taxonomy of several genera. PMID:27814365

  5. Observations on Hilltopping in Thick-Headed Flies (Diptera: Conopidae)

    PubMed Central

    Mei, Maurizio; Gibson, Joel F.; Skevington, Jeffrey H.

    2010-01-01

    Direct observations of hilltopping behaviour in the thick-headed flies (Diptera: Conopidae) have only been mentioned once in the literature. Hilltop collecting, however, may be an effective way to survey these endparasitoids. The first evidence of hilltopping in species belonging to the subfamilies Myopinae and Dalmanniinae is presented and discussed. Field observations were conducted on Colle Vescovo, Italy and Mount Rigaud, Canada, and museum specimens were examined. Observations and records indicate that four species in the genera Dalmannia, Myopa, and Zodion are hilltoppers on Colle Vescovo, while three species in the genera Myopa and Physocephala are hilltoppers on three hilltops near Ottawa, Canada. Fifteen additional species of conopids have been collected on hilltops and could possibly utilize hilltops in some years as a part of their mating strategy. Detailed phenologies and observations of mating and perching behaviours are given for species in the genera Dalmannia, Myopa, Physocephala, and Zodion. The importance of hilltop habitat preservation is stressed. PMID:20578949

  6. Limonia crane flies (Diptera: Limoniidae) of Korea.

    PubMed

    Podenas, Sigitas; Podeniene, Virginija

    2017-02-09

    The Korean species of Limonia Meigen, 1803 crane flies (Diptera: Limoniidae) are taxonomically revised. Species L. annulata Lackschewitz, 1940 (Lackschewitz, Pagast, 1940), L. bidens Savchenko, 1979, L. episema Alexander, 1924, L. fusciceps fusciceps Alexander, 1924, L. juvenca Alexander, 1935, L. messaurea messaurea Mendl, 1971, L. nemoralis Savchenko, 1983 are new records for the Korean peninsula and L. pia n. sp. is described. Synonymy of L. venerabilis Alexander, 1938 with L. macrostigma (Schummel, 1829) is confirmed. L. tanakai (Alexander, 1921) is not confirmed for the Korean Peninsula. An identification key, redescriptions and illustrations of all species and both sexes of adults, if they were found in Korea, are presented. Descriptions, illustrations and habitat characteristics are given for the previously unknown larva and pupa of L. parvipennis Alexander, 1940. Distinguishing morphological characters of the last instar larvae of Korean Limonia are discussed. Keys to the known Korean Limonia larvae and pupae are compiled.

  7. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius.

  8. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. This is an open access paper. We use the Creative Commons Attribution 3.0 license that permits unrestricted use, provided that the paper is properly attributed.

  9. Effect of Metarhizium anisopliae on the Fertility and Fecundity of Two Species of Fruit Flies and Horizontal Transmission of Mycotic Infection

    PubMed Central

    Sookar, P.; Bhagwant, S.; Allymamod, M.N.

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. PMID:25201230

  10. Low Diversity Bacterial Community and the Trapping Activity of Metabolites from Cultivable Bacteria Species in the Female Reproductive System of the Oriental Fruit Fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae)

    PubMed Central

    Shi, Zhanghong; Wang, Lili; Zhang, Hongyu

    2012-01-01

    Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel), and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE), 18 operational taxonomic units (OTUs) were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly. PMID:22754363

  11. Mediterranean Fruit Fly as a Potential Vector of Bacterial Pathogens

    PubMed Central

    Sela, Shlomo; Nestel, David; Pinto, Riky; Nemny-Lavy, Esther; Bar-Joseph, Moshe

    2005-01-01

    The Mediterranean fruit fly (Ceratitis capitata) is a cosmopolitan pest of hundreds of species of commercial and wild fruits. It is considered a major economic pest of commercial fruits in the world. Adult Mediterranean fruit flies feed on all sorts of protein sources, including animal excreta, in order to develop eggs. After reaching sexual maturity and copulating, female flies lay eggs in fruit by puncturing the skin with their ovipositors and injecting batches of eggs into the wounds. In view of the increase in food-borne illnesses associated with consumption of fresh produce and unpasteurized fruit juices, we investigated the potential of Mediterranean fruit fly to serve as a vector for transmission of human pathogens to fruits. Addition of green fluorescent protein (GFP)-tagged Escherichia coli to a Mediterranean fruit fly feeding solution resulted in a dose-dependent increase in the fly's bacterial load. Flies exposed to fecal material enriched with GFP-tagged E. coli were similarly contaminated and were capable of transmitting E. coli to intact apples in a cage model system. Washing contaminated apples with tap water did not eliminate the E. coli. Flies inoculated with E. coli harbored the bacteria for up to 7 days following contamination. Fluorescence microscopy demonstrated that the majority of fluorescent bacteria were confined along the pseudotrachea in the labelum edge of the fly proboscis. Wild flies captured at various geographic locations were found to carry coliforms, and in some cases presumptive identification of E. coli was made. These findings support the hypothesis that the common Mediterranean fruit fly is a potential vector of human pathogens to fruits. PMID:16000820

  12. Cellular Potts Models of Fruit Fly Embryogenesis

    NASA Astrophysics Data System (ADS)

    Rohner, Jason; Hutson, Shane

    2006-11-01

    Biologists have extensively studied embryonic development in the fruit fly (Drosophila melangaster) as a model for morphogenesis. Our overall goal is to understand how the cellular rearrangements of morphogenesis are caused by the underlying forces between cells. To that end, we are developing means to replicate fruit fly embryogenesis (from cellular differentiation to dorsal closure) using cellular Potts models. Cells are described as collections of like ``spins''; and spin-spin interaction energies are used to describe the forces along cell boundaries. Using a four state (spin-type) model (three tissue types and the surrounding media) we have reproduced cell sorting as well as engulfment of a surface grouping of tissue. Cell sorting can be accomplished using only the spin-spin interaction energies with the volume components being used only for cell size management. We are currently attempting to replicate the experimentally determined geometry and dynamics of dorsal closure. This modeling will take advantage of software tools developed at Notre Dame for looking at cellular Potts models and packaged as CompuCell3D.

  13. Survival and fate of Salmonella enterica serovar Montevideo in adult Horn Flies (Diptera: Muscidae)

    USDA-ARS?s Scientific Manuscript database

    Contamination of cattle peripheral lymph nodes with Salmonella enterica is proposed to occur via a transdermal route of entry. If so, bacteria may be introduced to cattle by biting arthropods. Biting flies, such as horn flies (Haematobia irritans irritans (L.); Diptera: Muscidae), are intriguing ca...

  14. Fruit Fly Liquid Larval Diet Technology Transfer and Update

    USDA-ARS?s Scientific Manuscript database

    Since October 2006, USDA-ARS has been implementing a fruit fly liquid larval diet technology transfer, which has proceeded according to the following steps: (1) Recruitment of interested groups through request; (2) Establishment of the Material Transfer Agreement (MTA) with ARS; (3) Fruit fly liquid...

  15. Distribution of olive fruit fly in California based on fruit infestations since the 1998 invasion

    USDA-ARS?s Scientific Manuscript database

    Olive fruit fly, Bactrocera oleae (Rossi), was first discovered in Los Angeles, California in 1998. Eradication and containment programs were immediately initiated, but within four years the olive pest was detected throughout the state. Olive fruit fly is not tolerated in canned fruit, and the insec...

  16. A Fruitful Endeavor: Modeling ALS in the Fruit Fly

    PubMed Central

    Casci, Ian; Pandey, Udai Bhan

    2014-01-01

    For over a century Drosophila melanogaster, commonly known as the fruit fly, has been instrumental in genetics research and disease modeling. In more recent years, it has been a powerful tool for modeling and studying neurodegenerative diseases, including the devastating and fatal amyotrophic lateral sclerosis (ALS). The success of this model organism in ALS research comes from the availability of tools to manipulate gene/protein expression in a number of desired cell-types, and the subsequent recapitulation of cellular and molecular phenotypic features of the disease. Several Drosophila models have now been developed for studying the roles of ALS-associated genes in disease pathogenesis that allowed us to understand the molecular pathways that lead to motor neuron degeneration in ALS patients. Our primary goal in this review is to highlight the lessons we have learned using Drosophila models pertaining to ALS research. PMID:25289585

  17. Behavioral and Antennal Responses of Drosophila suzukii (Diptera: Drosophilidae) to Volatiles From Fruit Extracts.

    PubMed

    Abraham, John; Zhang, Aijun; Angeli, Sergio; Abubeker, Sitra; Michel, Caryn; Feng, Yan; Rodriguez-Saona, Cesar

    2015-04-01

    Native to Southeast Asia, the spotted wing drosophila, Drosophila suzukii Matsumura (Diptera: Drosophilidae), has become a serious pest of soft-skinned fruit crops since its introduction into North America and Europe in 2008. Current monitoring strategies use baits based on fermentation products; however, to date, no fruit-based volatile blends attractive to this fly have been identified. This is particularly important because females are able to cut into the epicarp of ripening fruit for oviposition. Thus, we conducted studies to: 1) investigate the behavioral responses of adult D. suzukii to volatiles from blueberry, cherry, raspberry, and strawberry fruit extracts; 2) identify the antennally active compounds from the most attractive among the tested extracts (raspberry) using gas chromatography (GC)-mass spectrometry and coupled gas chromatography -electroantennographic detection (GC-EAD); and 3) test a synthetic blend containing the EAD-active compounds identified from raspberry extract on adult attraction. In olfactometer studies, both female and male D. suzukii were attracted to all four fruit extracts. The attractiveness of the fruit extracts ranks as: raspberry ≥ strawberry > blueberry ≥ cherry. GC analyses showed that the fruit extracts emit distinct volatile compounds. In GC-EAD experiments, 11 raspberry extract volatiles consistently elicited antennal responses in D. suzukii. In choice test bioassays, a synthetic EAD-active blend attracted more D. suzukii than a blank control, but was not as attractive as the raspberry extract. To our knowledge, this is the first report of a behaviorally and antennally active blend of host fruit volatiles attractive to D. suzukii, offering promising opportunities for the development of improved monitoring and behaviourally based management tools. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Attractant for vinegar fly, Drosophila busckii, and cluster fly, Pollenia rudis (Diptera: Drosophilidae et Calliphoridae).

    PubMed

    Buda, Vincas; Radziute, Sandra; Lutovinovas, Erikas

    2009-01-01

    A field test carried out in an industrial greenhouse in Lithuania revealed the attractiveness of synthetic methyl salicylate (MeSa) to two dipteran species: the vinegar fly, Drosophila busckii (Drosophilidae), and the cluster fly, Pollenia rudis (Calliphoridae). The attractant for the former fly species was especially effective, as sticky traps containing 0.25 ml of MeSa captured (814 +/- 55) D. busckii flies/trap on average compared to (12 +/- 4) flies/trap in control traps. The mean capture of P. rudis [(42 +/- 4) flies/trap] was significantly higher in MeSa-baited traps compared to the control traps [(13 +/- 4) flies/trap]. The presence of MeSa in emissions of many fruits suitable for D. busckii feeding allows to attribute this attractant to kairomones. In case of P. rudis, MeSa should be attributed to synomones (compounds beneficial for both receiver and sender), because adult flies feeding on flowers act as pollinators. This is the first report on the field-active attractant for D. busckii and the second for P. rudis.

  19. Multiple species of scuttle flies (Diptera: Phoridae) as contaminants in forensic entomology laboratory insect colony.

    PubMed

    Zuha, R M; Jenarthanan, L X Q; Disney, R H L; Omar, B

    2015-09-01

    In forensic entomology, larval rearing usually includes the presence of biological contaminants including scuttle flies (Diptera: Phoridae). Scuttle flies are recognized as forensically important insects and have been reported causing nuisance and contamination in laboratory environments. This paper reports for the first time the finding of multiple scuttle fly species affecting colonies of third instar larvae of the Oriental latrine blowfly, Chrysomya megacephala (Fabricius) (Diptera: Calliphoridae), reared indoors at the Forensic Science Simulation Site, Universiti Kebangsaan Malaysia. Adult scuttle flies were discovered inside a rearing container after the emergence of adult C. megacephala., The scuttle fly species are Megaselia scalaris (Loew), M. spiracularis Schmitz and Puliciphora borinquenensis (Wheeler). Notes on the life history and biology of these species are discussed herein.

  20. The genetic basis for fruit odor discrimination in Rhagoletis flies and its significance for sympatric host shifts.

    PubMed

    Dambroski, Hattie R; Linn, Charles; Berlocher, Stewart H; Forbes, Andrew A; Roelofs, Wendell; Feder, Jeffrey L

    2005-09-01

    Rhagoletis pomonella (Diptera: Tephritidae) use volatile compounds emitted from the surface of ripening fruit as important chemosensory cues for recognizing and distinguishing among alternative host plants. Host choice is of evolutionary significance in Rhagoletis because these flies mate on or near the fruit of their respective host plants. Differences in host choice based on fruit odor discrimination therefore result in differential mate choice and prezygotic reproductive isolation, facilitating sympatric speciation in the absence of geographic isolation. We test for a genetic basis for host fruit odor discrimination through an analysis of F2 and backcross hybrids constructed between apple-, hawthorn-, and flowering dogwood-infesting Rhagoletis flies. We recovered a significant proportion (30-65%) of parental apple, hawthorn, and dogwood fly response phenotypes in F2 hybrids, despite the general failure of F1 hybrids to reach odor source spheres. Segregation patterns in F2 and backcross hybrids suggest that only a modest number of allelic differences at a few loci may underlie host fruit odor discrimination. In addition, a strong bias was observed for F2 and backcross flies to orient to the natal fruit blend of their maternal grandmother, implying the existence of cytonuclear gene interactions. We explore the implications of our findings for the evolutionary dynamics of sympatric host race formation and speciation.

  1. Assessment of Navel Oranges, Clementine Tangerines, and Rutaceous Fruits as Hosts of Bactrocera cucurbitae and Bactrocera latifrons (Diptera: Tephritidae)

    PubMed Central

    McQuate, Grant T.; Follett, Peter A.; Liquido, Nicanor J.; Sylva, Charmaine D.

    2015-01-01

    Export of Citrus spp. fruits may require risk mitigation measures if grown in areas with established tephritid fruit fly (Diptera: Tephritidae) populations capable of infesting the fruits. The host status of Citrus spp. fruits is unclear for two tephritid fruit fly species whose geographic ranges have expanded in recent years: melon fly, Bactrocera cucurbitae (Cocquillett), and Bactrocera latifrons (Hendel). In no choice cage infestation studies, B. latifrons oviposited into intact and punctured Washington navel oranges (Citrus sinensis [L.] Osbeck) and Clementine tangerines (C. reticulata L. var. Clementine), but eggs rarely developed to the adult stage. B. cucurbitae readily infested intact and punctured tangerines, and to a lesser extent punctured oranges, but did not infest intact oranges. Limited cage infestation and only a single literature report of field Citrus spp. infestation suggest that risk mitigation of Citrus spp. for B. latifrons is not needed. Risk mitigation options of Citrus spp. for B. cucurbitae, including heat and cold treatments and systems approaches, are discussed. PMID:26816484

  2. An annotated checklist of the horse flies, deer flies, and yellow flies (Diptera: Tabanidae) of Florida

    USDA-ARS?s Scientific Manuscript database

    The family Tabanidae includes the horse flies, deer flies, and yellow flies and is considered a significant pest of livestock throughout the United States, including Florida. Tabanids can easily become a major pest of man, especially salt marsh species which are known to readily feed on humans and o...

  3. Laboratory evaluation of novaluron for controlling larval horn flies, house flies, and stable flies (Diptera: Muscidae)

    USDA-ARS?s Scientific Manuscript database

    A granular formulation of novaluron (Novaluron 0.2G, 0.2% AI), a newer benzoylphenyl urea insecticide, was evaluated for its efficacy in controlling the larval stage of horn flies, Haematobia irritans (Linnaeus), house flies, Musca domestica Linnaeus, and stable flies, Stomoxys calcitrans (Linnaeus)...

  4. The influence of host fruit and temperature on the body size of adult Ceratitis capitata (Diptera: Tephritidae) under laboratory and field conditions.

    PubMed

    Navarro-Campos, C; Martínez-Ferrer, M T; Campos, J M; Fibla, J M; Alcaide, J; Bargues, L; Marzal, C; Garcia-Marí, F

    2011-08-01

    The adult body size of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), varies in natural conditions. Body size is an important fitness indicator in the Mediterranean fruit fly; larger individuals are more competitive at mating and have a greater dispersion capacity and fertility. Both temperature during larval development and host fruit quality have been cited as possible causes for this variation. We studied the influence of host fruit and temperature during larval development on adult body size (wing area) in the laboratory, and determined body size variation in field populations of the Mediterannean fruit fly in eastern Spain. Field flies measured had two origins: 1) flies periodically collected throughout the year in field traps from 32 citrus groves, during the period 2003-2007; and 2) flies evolved from different fruit species collected between June and December in 2003 and 2004. In the lab, wing area of male and female adults varied significantly with temperature during larval development, being larger at the lowest temperature. Adult size also was significantly different depending on the host fruit in which larvae developed. The size of the flies captured at the field, either from traps or from fruits, varied seasonally showing a gradual pattern of change along the year. The largest individuals were obtained during winter and early spring and the smallest during late summer. In field conditions, the size of the adult Mediterannean fruit fly seems apparently more related with air temperature than with host fruit. The implications of this adult size pattern on the biology of C. capitata and on the application of the sterile insect technique are discussed.

  5. Change of name for the Oriental robber fly Nyssomyia Hull, 1962 (Diptera: Asilidae, Asilinae), nec Nyssomyia Barretto, 1962 (Diptera: Psychodidae, Phlebotominae).

    PubMed

    Ibáñez-Bernal, Sergio; Fisher, Eric

    2015-08-14

    A new name for the Oriental genus Nyssomyia Hull, 1962 (Diptera: Asilidae) is proposed. Homonymy exists between this Oriental robber fly genus and the more senior Neotropical phlebotomine sand fly genus Nyssomyia Barretto, 1962 (sensu Galati 2003) (Diptera: Psychodidae), and the following replacement name is proposed: Ekkentronomyia nom. nov. for Nyssomyia Hull (nec Barretto 1962). Accordingly, a new combination is herein proposed for the only species currently included in this genus: Ekkentronomyia ochracea (Hull, 1962) comb. nov.

  6. Vision-mediated exploitation of a novel host plant by a tephritid fruit fly.

    PubMed

    Piñero, Jaime C; Souder, Steven K; Vargas, Roger I

    2017-01-01

    Shortly after its introduction into the Hawaiian Islands around 1895, the polyphagous, invasive fruit fly Bactrocera (Zeugodacus) cucurbitae (Coquillett) (Diptera: Tephritidae) was provided the opportunity to expand its host range to include a novel host, papaya (Carica papaya). It has been documented that female B. cucurbitae rely strongly on vision to locate host fruit. Given that the papaya fruit is visually conspicuous in the papaya agro-ecosystem, we hypothesized that female B. cucurbitae used vision as the main sensory modality to find and exploit the novel host fruit. Using a comparative approach that involved a series of studies under natural and semi-natural conditions in Hawaii, we assessed the ability of female B. cucurbitae to locate and oviposit in papaya fruit using the sensory modalities of olfaction and vision alone and also in combination. The results of these studies demonstrate that, under a variety of conditions, volatiles emitted by the novel host do not positively stimulate the behavior of the herbivore. Rather, vision seems to be the main mechanism driving the exploitation of the novel host. Volatiles emitted by the novel host papaya fruit did not contribute in any way to the visual response of females. Our findings highlight the remarkable role of vision in the host-location process of B. cucurbitae and provide empirical evidence for this sensory modality as a potential mechanism involved in host range expansion.

  7. Differences in Antennal Sensillae of Male and Female Peach Fruit Flies in Relation to Hosts

    PubMed Central

    Awad, Azza A.; Mohamed, Hend O.; Ali, Nashat A.

    2015-01-01

    Antennal sensillae of male and female peach fruit flies, Bactrocera zonata (Saunders) (Diptera: Tephritidae), obtained from three different host fruit species (guava, Psidium guajava L. (Myrtales: Myrtaceae); peach, Prunus persica (L.) Stokes (Rosales: Rosaceae); and orange, Citrus sinensis (L.) Osbeck (Sapindales: Rutaceae)), were studied with scanning electron microscopy. This study was carried out to describe the different types of sensillae present on the three antennal segments (scape, pedicel, and flagellum or funiculus) of both sexes of B. zonata on different host fruit. The antennal segments of females tended to be larger than those of males feeding on peach and guava fruit. On orange, both sexes were similar (no significant differences were found). The first two antennal segments, scape and pedicel, are reinforced by some bristles and have different types of sensillae, including trichoid I, II, S; basiconic II; and sensilla chaetica in different numbers on different host fruit species. Numerous microtrichia, as well as trichoid (I, II), basiconic (I), clavate, and coeloconic (I, II) sensillae were observed on the funiculus with a great variation in number and length. As a result of feeding on different hosts, differences were found between sexes and some plasticity in size, number, distribution, and position of some sensillae, including trichoid, basiconic, chaetica, and clavate on the antennae of the female B. zonata. These sensillae were significantly larger in females. Also, some morphological and morphemetric differences have been found according to their feeding on different host fruit. PMID:25688086

  8. Vision-mediated exploitation of a novel host plant by a tephritid fruit fly

    PubMed Central

    2017-01-01

    Shortly after its introduction into the Hawaiian Islands around 1895, the polyphagous, invasive fruit fly Bactrocera (Zeugodacus) cucurbitae (Coquillett) (Diptera: Tephritidae) was provided the opportunity to expand its host range to include a novel host, papaya (Carica papaya). It has been documented that female B. cucurbitae rely strongly on vision to locate host fruit. Given that the papaya fruit is visually conspicuous in the papaya agro-ecosystem, we hypothesized that female B. cucurbitae used vision as the main sensory modality to find and exploit the novel host fruit. Using a comparative approach that involved a series of studies under natural and semi-natural conditions in Hawaii, we assessed the ability of female B. cucurbitae to locate and oviposit in papaya fruit using the sensory modalities of olfaction and vision alone and also in combination. The results of these studies demonstrate that, under a variety of conditions, volatiles emitted by the novel host do not positively stimulate the behavior of the herbivore. Rather, vision seems to be the main mechanism driving the exploitation of the novel host. Volatiles emitted by the novel host papaya fruit did not contribute in any way to the visual response of females. Our findings highlight the remarkable role of vision in the host-location process of B. cucurbitae and provide empirical evidence for this sensory modality as a potential mechanism involved in host range expansion. PMID:28380069

  9. Chromosomal duplications in bacteria, fruit flies, and humans

    SciTech Connect

    Lupski, J.R.; Weinstock, G.M.; Roth, J.R.

    1996-01-01

    Tandem duplication of chromosomal segments has been recognized as a frequent mutational mechanism in several genetic model systems. In bacteria, fruit flies, and humans, duplications form by similar molecular mechanisms and appear to be important in genome evolution. 80 refs.

  10. Global Establishment Risk of Economically Important Fruit Fly Species (Tephritidae)

    PubMed Central

    Qin, Yujia; Paini, Dean R.; Wang, Cong; Fang, Yan; Li, Zhihong

    2015-01-01

    The global invasion of Tephritidae (fruit flies) attracts a great deal of attention in the field of plant quarantine and invasion biology because of their economic importance. Predicting which one in hundreds of potential invasive fruit fly species is most likely to establish in a region presents a significant challenge, but can be facilitated using a self organising map (SOM), which is able to analyse species associations to rank large numbers of species simultaneously with an index of establishment. A global presence/absence dataset including 180 economically significant fruit fly species in 118 countries was analysed using a SOM. We compare and contrast ranked lists from six countries selected from each continent, and also show that those countries geographically close were clustered together by the SOM analysis because they have similar fruit fly assemblages. These closely clustered countries therefore represent greater threats to each other as sources of invasive fruit fly species. Finally, we indicate how this SOM method could be utilized as an initial screen to support prioritizing fruit fly species for further research into their potential to invade a region. PMID:25588025

  11. Global establishment risk of economically important fruit fly species (Tephritidae).

    PubMed

    Qin, Yujia; Paini, Dean R; Wang, Cong; Fang, Yan; Li, Zhihong

    2015-01-01

    The global invasion of Tephritidae (fruit flies) attracts a great deal of attention in the field of plant quarantine and invasion biology because of their economic importance. Predicting which one in hundreds of potential invasive fruit fly species is most likely to establish in a region presents a significant challenge, but can be facilitated using a self organising map (SOM), which is able to analyse species associations to rank large numbers of species simultaneously with an index of establishment. A global presence/absence dataset including 180 economically significant fruit fly species in 118 countries was analysed using a SOM. We compare and contrast ranked lists from six countries selected from each continent, and also show that those countries geographically close were clustered together by the SOM analysis because they have similar fruit fly assemblages. These closely clustered countries therefore represent greater threats to each other as sources of invasive fruit fly species. Finally, we indicate how this SOM method could be utilized as an initial screen to support prioritizing fruit fly species for further research into their potential to invade a region.

  12. Temperature Effects on Olive Fruit Fly Infestation in the FlySim Cellular Automata Model

    NASA Astrophysics Data System (ADS)

    Bruno, Vincenzo; Baldacchini, Valerio; di Gregorio, Salvatore

    FlySim is a Cellular Automata model developed for simulating infestation of olive fruit flies (Bactrocera Oleae) on olive (Olea europaea) groves. The flies move into the groves looking for mature olives where eggs are spawn. This serious agricultural problem is mainly tackled by using chemical agents at the first signs of the infestation, but organic productions with no or few chemicals are strongly requested by the market. Oil made with infested olives is poor in quality, nor olives are suitable for selling in stores. The FlySim model simulates the diffusion of flies looking for mature olives and the growing of flies due to atmospheric conditions. Foreseeing an infestation is the best way to prevent it and to reduce the need of chemicals in agriculture. In this work we investigated the effects of temperature on olive fruit flies and resulting infestation during late spring and summer.

  13. The Temporal Pattern of Mating Behavior of the Fruit Fly, Anastrepha zenildae in the Laboratory

    PubMed Central

    de Almeida, Lucia M.; Araújo, Arrilton; Mendes, Norma H.D.; de Souza, João M.G.A.; Menezes, Alexandre A.L.

    2011-01-01

    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00–19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5–6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5–7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5–163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation. PMID:22236152

  14. Pigeon louse fly, Pseudolynchia canariensis (Diptera: Hippoboscidae), collected by dry-ice trap.

    PubMed

    Yamauchi, Takeo; Tsuda, Yoshio; Sato, Yukita; Murata, Koichi

    2011-12-01

    During a mosquito collection, a female of the pigeon louse fly, Pseudolynchia canariensis (Diptera: Hippoboscidae), was collected by a mosquito trap baited with dry ice in Ishigaki-jima, Yaeyama Islands, Japan. This is the 1st record of P. canariensis from Yaeyama Islands.

  15. Pollinating flies (Diptera): A major contribution to plant diversity and agricultural production

    USDA-ARS?s Scientific Manuscript database

    Diptera are one of the three largest and most diverse animal groups of the world. As an often neglected, but important group of pollinators, they play a significant role in agrobiodiversity and biodiversity of plants everywhere. Flies are present in almost all habitats and biomes and for many food p...

  16. Pangonius theodori a new horse fly species for science from Israel and Lebanon (Diptera: Tabanidae: Pangoniinae).

    PubMed

    Zeegers, Theo; Kravchenko, Vasiliy D; Müller, Günter C

    2013-03-01

    Pangonius theodori a new horse fly species (Diptera: Tabanidae: Pangoniinae) from northern Israel and southern Lebanon is described. The zoogeography, habitat preference and taxonomic position within the genus of the new species is discussed in detail. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Picture-winged fly (Euxesta, Chaetopsis spp.; Diptera: Ulidiidae) semiochemical investigations

    USDA-ARS?s Scientific Manuscript database

    Picture-winged flies (Euxesta, Chaetopsis spp., Diptera: Ulidiidae) are severe primary pests of sweet corn in southern Florida. Females oviposit in silks and larvae consume the silks and kernels, rendering the ear unmarketable. Growers treat their fields with numerous broad spectrum insecticide ap...

  18. A Novel Method for Tracking Individuals of Fruit Fly Swarms Flying in a Laboratory Flight Arena

    PubMed Central

    Cheng, Xi En; Qian, Zhi-Ming; Wang, Shuo Hong; Jiang, Nan; Guo, Aike; Chen, Yan Qiu

    2015-01-01

    The growing interest in studying social behaviours of swarming fruit flies, Drosophila melanogaster, has heightened the need for developing tools that provide quantitative motion data. To achieve such a goal, multi-camera three-dimensional tracking technology is the key experimental gateway. We have developed a novel tracking system for tracking hundreds of fruit flies flying in a confined cubic flight arena. In addition to the proposed tracking algorithm, this work offers additional contributions in three aspects: body detection, orientation estimation, and data validation. To demonstrate the opportunities that the proposed system offers for generating high-throughput quantitative motion data, we conducted experiments on five experimental configurations. We also performed quantitative analysis on the kinematics and the spatial structure and the motion patterns of fruit fly swarms. We found that there exists an asymptotic distance between fruit flies in swarms as the population density increases. Further, we discovered the evidence for repulsive response when the distance between fruit flies approached the asymptotic distance. Overall, the proposed tracking system presents a powerful method for studying flight behaviours of fruit flies in a three-dimensional environment. PMID:26083385

  19. A Novel Method for Tracking Individuals of Fruit Fly Swarms Flying in a Laboratory Flight Arena.

    PubMed

    Cheng, Xi En; Qian, Zhi-Ming; Wang, Shuo Hong; Jiang, Nan; Guo, Aike; Chen, Yan Qiu

    2015-01-01

    The growing interest in studying social behaviours of swarming fruit flies, Drosophila melanogaster, has heightened the need for developing tools that provide quantitative motion data. To achieve such a goal, multi-camera three-dimensional tracking technology is the key experimental gateway. We have developed a novel tracking system for tracking hundreds of fruit flies flying in a confined cubic flight arena. In addition to the proposed tracking algorithm, this work offers additional contributions in three aspects: body detection, orientation estimation, and data validation. To demonstrate the opportunities that the proposed system offers for generating high-throughput quantitative motion data, we conducted experiments on five experimental configurations. We also performed quantitative analysis on the kinematics and the spatial structure and the motion patterns of fruit fly swarms. We found that there exists an asymptotic distance between fruit flies in swarms as the population density increases. Further, we discovered the evidence for repulsive response when the distance between fruit flies approached the asymptotic distance. Overall, the proposed tracking system presents a powerful method for studying flight behaviours of fruit flies in a three-dimensional environment.

  20. USDA compendium of fruit fly host information (CoFFHI)

    USDA-ARS?s Scientific Manuscript database

    Background: Tephritid fruit flies are serious agricultural pests. Knowledge of the host status of different fruits and vegetables is needed in support of the development of systems approaches to permit crop exports as well as to readily permit quarantine regulatory officials to check on the risk of...

  1. Classical Olfactory Conditioning in the Oriental Fruit Fly, Bactrocera dorsalis

    PubMed Central

    Zeng, Xin Nian

    2015-01-01

    The oriental fruit fly, Bactrocera dorsalis, is a serious pest of fruits and vegetables. Methyl eugenol (ME), a male attractant, is used to against this fly by mass trapping. Control effect may be influenced by learning, which could modify the olfactory response of the fly to this attractant. To collect the behavioral evidence, studies on the capability of this fly for olfactory learning are necessary. We investigated olfactory learning in male flies with a classical olfactory conditioning procedure using restrained individuals under laboratory conditions. The acquisition of the proboscis extension reflex was used as the criterion for conditioning. A high conditioned response level was found in oriental fruit flies when an odor was presented in paired association with a sucrose reward but not when the odor and sucrose were presented unpaired. We also found that the conditioning performance was influenced by the odor concentration, intertrial interval, and starvation time. A slight sensitization elicited by imbibing sucrose was observed. These results indicate that oriental fruit flies have a high capacity to form an olfactory memory as a result of classical conditioning. PMID:25837420

  2. Classical olfactory conditioning in the oriental fruit fly, Bactrocera dorsalis.

    PubMed

    Liu, Jia Li; Chen, Xiao Yan; Zeng, Xin Nian

    2015-01-01

    The oriental fruit fly, Bactrocera dorsalis, is a serious pest of fruits and vegetables. Methyl eugenol (ME), a male attractant, is used to against this fly by mass trapping. Control effect may be influenced by learning, which could modify the olfactory response of the fly to this attractant. To collect the behavioral evidence, studies on the capability of this fly for olfactory learning are necessary. We investigated olfactory learning in male flies with a classical olfactory conditioning procedure using restrained individuals under laboratory conditions. The acquisition of the proboscis extension reflex was used as the criterion for conditioning. A high conditioned response level was found in oriental fruit flies when an odor was presented in paired association with a sucrose reward but not when the odor and sucrose were presented unpaired. We also found that the conditioning performance was influenced by the odor concentration, intertrial interval, and starvation time. A slight sensitization elicited by imbibing sucrose was observed. These results indicate that oriental fruit flies have a high capacity to form an olfactory memory as a result of classical conditioning.

  3. Susceptibility of Olive Fruit in Relation to Olive Fruit Fly Development and Ovipositional Period in California

    USDA-ARS?s Scientific Manuscript database

    Olive fruit fly, Bactrocera oleae (Gmelin), females oviposited their first and last eggs in olive fruit, Olea europaea L., when females were 6 and 90 d-old, respectively. The highest mean numbers of eggs per day in 10 olive fruit (55) were oviposited by 28 d-old females, and peak egg production occ...

  4. An emerging example of tritrophic coevolution between flies (Diptera: Fergusoninidae) and nematodes (Nematoda: Neotylenchidae) on Myrtaceae host plants

    USDA-ARS?s Scientific Manuscript database

    A unique obligate mutualism occurs between species of Fergusonina Malloch flies (Diptera: Fergusoninidae) and nematodes of the genus Fergusobia Currie (Nematoda: Neotylenchidae). These mutualists together form different types of galls on Myrtaceae, mainly in Australia. The galling association appear...

  5. Field evaluation of potential fruit-derived lures for Anastrepha obliqua (Diptera: Tephritidae).

    PubMed

    Toledo, Jorge; Malo, Edi A; Cruz-López, Leopoldo; Rojas, Julio C

    2009-12-01

    Previous studies have shown that a nine-component blend (ethyl butyrate, isopropyl butyrate, hexan-1-ol, propyl butyrate, isobutyl butyrate, ethyl hexanoate, isopentyl butyrate, ethyl benzoate, and ethyl octanoate) isolated from Spondias mombin L. (Anacardiaceae) fruit are attractive to both sexes of West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), in laboratory and field cage tests. In this study, we evaluated the effectiveness of traps baited with the nine-component blend in capturing wild A. obliqua in a mango, Mangifera indica L. variety Ataulfo) orchard. In addition, we tested other S. mombin-derived lures to determine whether any of these effectively mimic the nine-component blend in attracting A. obliqua. In all trials, we compared the attractiveness of the S. mombin-derived lures against hydrolyzed protein, the standard bait for monitoring A. obliqua. We found that, in some trials, there was no difference in the number of females caught by traps baited with the nine-component blend or with hydrolyzed protein. In other trials, traps baited with hydrolyzed protein captured more females than traps baited with the nine-component blend. For males, in general there were no differences in the number of flies caught by traps baited either with the nine-component blend or with hydrolyzed protein. Traps baited with other S. mombin-derived lures captured fewer A. obliqua than traps baited with hydrolyzed protein. Traps baited with S. mombin-derived lures caught fewer species of nontarget tephritid flies and nontarget insects than traps baited with hydrolyzed protein.

  6. Acetylcholinesterase genes within the Diptera: takeover and loss in true flies

    PubMed Central

    Huchard, Elise; Martinez, Michel; Alout, Haoues; Douzery, Emmanuel J.P; Lutfalla, Georges; Berthomieu, Arnaud; Berticat, Claire; Raymond, Michel; Weill, Mylène

    2006-01-01

    It has recently been reported that the synaptic acetylcholinesterase (AChE) in mosquitoes is encoded by the ace-1 gene, distinct and divergent from the ace-2 gene, which performs this function in Drosophila. This is an unprecedented situation within the Diptera order because both ace genes derive from an old duplication and are present in most insects and arthropods. Nevertheless, Drosophila possesses only the ace-2 gene. Thus, a secondary loss occurred during the evolution of Diptera, implying a vital function switch from one gene (ace-1) to the other (ace-2). We sampled 78 species, representing 50 families (27% of the Dipteran families) spread over all major subdivisions of the Diptera, and looked for ace-1 and ace-2 by systematic PCR screening to determine which taxonomic groups within the Diptera have this gene change. We show that this loss probably extends to all true flies (or Cyclorrhapha), a large monophyletic group of the Diptera. We also show that ace-2 plays a non-detectable role in the synaptic AChE in a lower Diptera species, suggesting that it has non-synaptic functions. A relative molecular evolution rate test showed that the intensity of purifying selection on ace-2 sequences is constant across the Diptera, irrespective of the presence or absence of ace-1, confirming the evolutionary importance of non-synaptic functions for this gene. We discuss the evolutionary scenarios for the takeover of ace-2 and the loss of ace-1, taking into account our limited knowledge of non-synaptic functions of ace genes and some specific adaptations of true flies. PMID:17002944

  7. Ultrastructure of the Antennal Sensillae of Male and Female Peach Fruit Fly, Bactrocera zonata

    PubMed Central

    Awad, Azza A.; Ali, Nashat A.; Mohamed, Hend O.

    2014-01-01

    Antennal morphology and funicular sensillae of male and female peach fruit flies, Bactrocera zonata (Saunders) (Diptera: Tephritidae), were studied with scanning electron microscopy (SEM). This study focused on the sensillae found on the antennal segments (scape, pedicel, and flagellum or funiculus that bears the arista) of B. zonata. Antennal segments of females tended to be larger than those of the males. The first two antennal segments, scape and pedicel, were heavily covered with microtrichia and bear bristles. Numerous microtrichia as well as trichoid (I, II), basiconic, clavate, and coeloconic sensillae were observed on the funiculus. SEM studies showed some differences in size and also in position of some sensillae on the antennae of the females of B. zonata. The sensillae found on the funiculus, such as trichoid and basiconic sensillae, were significantly larger in females. PMID:25373192

  8. A Modified Trap for Adult Sampling of Medically Important Flies (Insecta: Diptera)

    PubMed Central

    Akbarzadeh, Kamran; Rafinejad, Javad; Nozari, Jamasb; Rassi, Yavar; Sedaghat, Mohammad Mehdi; Hosseini, Mostafa

    2012-01-01

    Background: Bait-trapping appears to be a generally useful method of studying fly populations. The aim of this study was to construct a new adult flytrap by some modifications in former versions and to evaluate its applicability in a subtropical zone in southern Iran. Methods: The traps were constructed with modification by adding some equipment to a polyethylene container (18× 20× 33 cm) with lid. The fresh sheep meat was used as bait. Totally 27 adult modified traps were made and tested for their efficacies to attract adult flies. The experiment was carried out in a range of different topographic areas of Fars Province during June 2010. Results: The traps were able to attract various groups of adult flies belonging to families of: Calliphoridae, Sarcophagidae, Muscidae, and Faniidae. The species of Calliphora vicina (Diptera: Calliphoridae), Sarcophaga argyrostoma (Diptera: Sarcophagidae) and Musca domestica (Diptera: Muscidae) include the majority of the flies collected by this sheep-meat baited trap. Conclusion: This adult flytrap can be recommended for routine field sampling to study diversity and population dynamics of flies where conducting of daily collection is difficult. PMID:23378969

  9. Intra- and interspecific competition and host race formation in the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae).

    PubMed

    Feder, Jeffrey L; Reynolds, Katherine; Go, Wesley; Wang, Emma C

    1995-04-01

    Intra- and interspecific resource competition are potentially important factors affecting host plant use by phytophagous insects. In particular, escape from competitors could mediate a successful host shift by compensating for decreased feeding performance on a new plant. Here, we examine the question of host plant-dependent competition for apple (Malus pumila)- and hawthorn (Crataegus mollis)-infesting larvae of the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae) at a field site near Grant, Michigan, USA. Interspecific competition from tortricid (Cydia pomonella, Grapholita prunivora, and Grapholita packardi) and agonoxenid (subfamily Blastodacninae) caterpillars and a curculionid weevil (Conotrachelus crataegi) was much stronger for R. pomonella larvae infesting the ancestral host hawthorn than the derived host apple. Egg to pupal survivorship was estimated as 52.8% for fly larvae infesting hawthorn fruit without caterpillars and weevils compared to only 27.3% for larvae in harthorns with interspecific insects. Survivorship was essentially the same between fly larvae infesting apples in the presence (44.8%) or absence (42.6%) of interspecific insects. Intraspecific competition among maggots was also stronger in hawthorns than apples. The order or time that a larva exited a hawthorn fruit was a significant determinant of its pupal mass, with earlier emerging larvae being heavier than later emerging larvae. This was not the case for larvae in apples, as the order or time that a larva exited an apple fruit had relatively little influence on its pupal mass. Our findings suggest that decreased performance related to host plant chemistry/nutrition may restrict host range expansion and race formation in R. pomonella to those plants where biotic/ecological factors (i.e. escape from competitors and parasitoids) adequately balance the survivorship equation. This balance permits stable fly populations to persist on novel plants, setting the stage for the

  10. Development and Oviposition Preference of House Flies and Stable Flies (Diptera: Muscidae) in Six Substrates From Florida Equine Facilities.

    PubMed

    Machtinger, E T; Geden, C J; Hogsette, J A; Leppla, N C

    2014-11-01

    House flies, Musca domestica L., and stable flies, Stomoxys calcitrans (L.), (Diptera: Muscidae), common pests on equine facilities, were studied in the laboratory to determine the success and duration of larval development and oviposition preferences on six substrates commonly found on equine facilities. Substrates tested were hay soiled with urine and manure, fresh horse manure, pine shaving bedding soiled with urine and manure (<12 h old), pine shaving bedding soiled with urine and manure (aged >72 h in a manure pile), builders sand bedding soiled with urine and manure aged 3 d, and soil from an overgrazed pasture mixed with urine and manure of variable age. House fly larvae failed to develop into adults in hay, soil, and sand substrates. Stable flies preferred to oviposit on substrates with plant material and not on fresh manure. However, when eggs were added to the substrates, pupariation was maximal in fresh manure and the fresh pine shaving substrate. Stable flies developed in all six equine substrates, but development was less successful on the substrates with soil. In choice tests, fresh manure and the fresh pine shaving substrates were the most attractive for house fly oviposition. These substrates also yielded the greatest number of house fly puparia from artificially added eggs. An understanding of oviposition preferences and differential larval development of house flies and stable flies on these substrates may help develop options for reducing pest populations by effectively managing equine waste and selecting appropriate bedding materials.

  11. A protocol for storage and long-distance shipment of Mediterranean fruit fly (Diptera: Tephritidae) eggs. II. Assessment of the optimal temperature and the substrate for male-only production

    SciTech Connect

    Maman, E.; Caceres, C.

    2007-03-15

    The present study has been conducted to assess the effect and interaction of various storage substrates and conditions on eggs of the Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann). Tests were carried out with the genetic sexing strain VIENNA 8/D53, a strain that carries a temperature sensitive lethal (tsl) mutation that allows the selective killing of female zygotes. This study identifies strategies to enhance the storage and transport conditions through assessment of effect on egg, pupal and adult survival in order to facilitate the establishment of satellite mass rearing facilities for the production of male medflies. Eggs were immersed in two different substrates and stored at different temperatures and for different time periods. Findings from this study suggest that egg storage periods, and to some extent, the storage substrates have significant effects on pupal and adult survival. For 72-h storage periods, the eggs preserved in agar solution at 10 deg. C produced the most pupae. There was an inverse relationship between the concentration of dissolved oxygen in the substrate during storage and the quality and survival of the stored/transported eggs. Apparently low levels of dissolved oxygen reduce metabolic rates, allowing the storage period to be prolonged. (author) [Spanish] El presente estudio fue conducido para evaluar el efecto e interaccion de varios substratos y condiciones de almacenamiento en huevos de la mosca mediterranea de la fruta, Ceratitis capitata (Wiedemann). Las pruebas se realizaron con la cepa en la cual es posible separar los sexos geneticamente VIENNA 8/D53, la cual contiene una mutacion letal sensible a la temperatura que permite la eliminacion selectiva de los zigotos femeninos. Este estudio identifica estrategias para mejorar las condiciones de almacenamiento y transporte por medio de la evaluacion de su efecto en la supervivencia de huevos, pupas y adultos, esto para facilitar el establecimiento de laboratorios

  12. A protocol for storage and long-distance shipment of Mediterranean fruit fly (Diptera: Tephritidae) eggs. 1. Effect of temperature, embryo age , and storage time on survival and quality

    SciTech Connect

    Caceres, C.; Wornoayporn, V.; Islam, S.M.; Ahmad, S.

    2007-03-15

    The operational use of Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann), genetic sexing strains in Sterile Insect Technique applications can be maximized by developing methods for effective shipment of eggs. This would enable a central production facility to maintain the relevant mother stocks and large colonies to supply eggs to satellite centers that would mass produce only males for irradiation and release. In order to achieve this, the survival of medfly embryos of different ages was assessed after storage at 5, 10, 15, 20, and 25 deg. C in water for different periods of time. Survival was affected by all 3 variables, i.e., embryo age, water temperature, and length of storage. Storage of embryos at any temperature for 120 h resulted in almost no survival. Controlling the age of the embryo at the time of the temperature treatment is crucial for the success of this procedure. Embryos collected between 0 to 12 h after oviposition and pre-incubated at 25 deg. C for 12 h provide a suitable 72 h window for shipment when maintained between 10 to 15 deg. C. Under these conditions, no significant reductions in survival during all the developmental stages were observed. (author) [Spanish] El uso operacional de cepas de la mosca del mediterraneo Ceratitis capitata (Wiedemann) en las cuales es posible separar los sexos a traves de mecanismos geneticos para su utilizacion en la Tecnica del Insecto Esteril (TIE), puede ser maximizado con el desarrollo de metodos efectivos para el envio y transporte de huevos. Esto permite que un laboratorio de produccion centralizada mantenga las respectivas colonias responsables por la produccion de huevos para este abastecer laboratorios satelites responsables por la produccion masiva de solamente machos para subsiguiente irradiacion y liberacion. Para ser posible esta alternativa fue evaluada la supervivencia de embriones de diferentes edades despues de su almacenamiento en agua a 5, 10, 15, 20 y 25 deg. C por diferentes

  13. Two pests overlap: Drosophila suzukii (Diptera: Drosophilidae) use of fruit exposed to Halyomorpha halys (Hemiptera: Pentatomidae)

    USDA-ARS?s Scientific Manuscript database

    Spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae), and brown marmorated stink bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae) are global economic pests. Both pests may co-occur on small fruits, and we investigated whether fruit recently exposed to H. halys woul...

  14. Wolbachia in Parasitoids Attacking Native European and Introduced Eastern Cherry Fruit Flies in Europe.

    PubMed

    Schuler, Hannes; Kern, Peter; Arthofer, Wolfgang; Vogt, Heidrun; Fischer, Maximilian; Stauffer, Christian; Riegler, Markus

    2016-12-01

    The eastern cherry fruit fly, Rhagoletis cingulata Loew (Diptera: Tephritidae), is an economically important pest of cherries in North America. In 1983 it was first reported in Europe where it shares its ecological niche with the native European cherry fruit fly, Rhagoletis cerasi L. (Diptera: Tephritidae). Their coexistence in Europe led to the recent horizontal transmission of the Wolbachia strain wCer1 from R. cerasi to R. cingulata Horizontal Wolbachia transmission is mediated by either sharing of ecological niches or by interacting species such as parasitoids. Here we describe for the first time that two braconid wasps, Psyttalia rhagoleticola Sachtleben (Hymenoptera: Braconidae) and Utetes magnus Fischer (Hymenoptera: Braconidae), naturally parasitizing R. cerasi, use the invasive R. cingulata in Europe as a new host. In contrast, no parasitoids that parasitize R. cingulata in its native American range were detected in the introduced European range. Diagnostic Wolbachia PCR screening and sequence analyses demonstrated that all P. rhagoleticola individuals were infected with the newly described Wolbachia strain wRha while all U. magnus individuals were uninfected. wRha is different from wCer1 but had an Wolbachia surface protein (wsp) gene sequence that was identical to wCer2 of R. cerasi and wCin2 of R. cingulata. However, multi locus sequence typing revealed differences in all loci between wRha and the tephritid's strains. The horizontal transmission of wCer1 between the two tephritid species did not result in fixed heritable infections in the parasitoids. However, the parasitoids may have acted as a transient wCer1 vector. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America.

  15. Black soldier fly (Diptera: Stratiomyidae) colonization of pig carrion in south Georgia.

    PubMed

    Tomberlin, Jeffery K; Sheppard, D Craig; Joyce, John A

    2005-01-01

    The black soldier fly, Hermetia illucens (L.), is thought to colonize corpses 20-30 days postmortem. However, recent observations indicate this might not be true for all cases. Therefore, we conducted a study examining colonization by the black soldier fly and other Diptera on pig carrion in a plowed field in southern Georgia from 20 September through 21 February. Our data indicate black soldier flies could colonize a corpse within the first week after death. Knowing this information could prevent a serious mistake in estimating the time at which a corpse is colonized by this species. This study also represents the first record of Chrysomya rufifacies in Georgia.

  16. Flying fruit flies correct for visual sideslip depending on relative speed of forward optic flow

    PubMed Central

    Cabrera, Stephanie; Theobald, Jamie C.

    2013-01-01

    As a fly flies through its environment, static objects produce moving images on its retina, and this optic flow is essential for steering and course corrections. Different types of rotation and translation produce unique flow fields, which fly brains are wired to identify. However, a feature of optic flow unique to translational motion is that adjacent images may move across the retina at different speeds, depending on their distance from the observer. Many insects take advantage of this depth cue, called motion parallax, to determine the distance to objects. We wanted to know if differential object speeds affect the corrective responses of fruit flies when they experience unplanned course deviations. We presented tethered flying flies with optic flow and measured their corrective responses to sideways perturbations of images with different relative forward speeds. We found that flying flies attend to the relative speed of dots during forward motion, and adjust their corrective responses to sideslip deviations depending on this cue. With no other distinguishing features (such as brightness or size), flies mounted a greater response to sideways deviations that were signaled by faster moving dots in the forward flow field, those that appeared radially closer by their speeds. This is consistent with the interpretation that fruit flies attend to seemingly nearer objects, and correct more strongly when they indicate a perturbation. PMID:23847482

  17. Controlling roll perturbations in fruit flies

    PubMed Central

    Beatus, Tsevi; Guckenheimer, John M.; Cohen, Itai

    2015-01-01

    Owing to aerodynamic instabilities, stable flapping flight requires ever-present fast corrective actions. Here, we investigate how flies control perturbations along their body roll angle, which is unstable and their most sensitive degree of freedom. We glue a magnet to each fly and apply a short magnetic pulse that rolls it in mid-air. Fast video shows flies correct perturbations up to 100° within 30 ± 7 ms by applying a stroke-amplitude asymmetry that is well described by a linear proportional–integral controller. For more aggressive perturbations, we show evidence for nonlinear and hierarchical control mechanisms. Flies respond to roll perturbations within 5 ms, making this correction reflex one of the fastest in the animal kingdom. PMID:25762650

  18. Bombykol receptors in the silkworm moth and the fruit fly.

    PubMed

    Syed, Zainulabeuddin; Kopp, Artyom; Kimbrell, Deborah A; Leal, Walter S

    2010-05-18

    Male moths are endowed with odorant receptors (ORs) to detect species-specific sex pheromones with remarkable sensitivity and selectivity. We serendipitously discovered that an endogenous OR in the fruit fly, Drosophila melanogaster, is highly sensitive to the sex pheromone of the silkworm moth, bombykol. Intriguingly, the fruit fly detectors are more sensitive than the receptors of the silkworm moth, although its ecological significance is unknown. By expression in the "empty neuron" system, we identified the fruit fly bombykol-sensitive OR as DmelOR7a (= DmOR7a). The profiles of this receptor in response to bombykol in the native sensilla (ab4) or expressed in the empty neuron system (ab3 sensilla) are indistinguishable. Both WT and transgenic flies responded with high sensitivity, in a dose-dependent manner, and with rapid signal termination. In contrast, the same empty neuron expressing the moth bombykol receptor, BmorOR1, demonstrated low sensitivity and slow signal inactivation. When expressed in the trichoid sensilla T1 of the fruit fly, the neuron housing BmorOR1 responded with sensitivity comparable to that of the native trichoid sensilla in the silkworm moth. By challenging the native bombykol receptor in the fruit fly with high doses of another odorant to which the receptor responds with the highest sensitivity, we demonstrate that slow signal termination is induced by overdose of a stimulus. As opposed to the empty neuron system in the basiconic sensilla, the structural, biochemical, and/or biophysical features of the sensilla make the T1 trichoid system of the fly a better surrogate for the moth receptor.

  19. Bombykol receptors in the silkworm moth and the fruit fly

    PubMed Central

    Syed, Zainulabeuddin; Kopp, Artyom; Kimbrell, Deborah A.; Leal, Walter S.

    2010-01-01

    Male moths are endowed with odorant receptors (ORs) to detect species-specific sex pheromones with remarkable sensitivity and selectivity. We serendipitously discovered that an endogenous OR in the fruit fly, Drosophila melanogaster, is highly sensitive to the sex pheromone of the silkworm moth, bombykol. Intriguingly, the fruit fly detectors are more sensitive than the receptors of the silkworm moth, although its ecological significance is unknown. By expression in the “empty neuron” system, we identified the fruit fly bombykol-sensitive OR as DmelOR7a (= DmOR7a). The profiles of this receptor in response to bombykol in the native sensilla (ab4) or expressed in the empty neuron system (ab3 sensilla) are indistinguishable. Both WT and transgenic flies responded with high sensitivity, in a dose-dependent manner, and with rapid signal termination. In contrast, the same empty neuron expressing the moth bombykol receptor, BmorOR1, demonstrated low sensitivity and slow signal inactivation. When expressed in the trichoid sensilla T1 of the fruit fly, the neuron housing BmorOR1 responded with sensitivity comparable to that of the native trichoid sensilla in the silkworm moth. By challenging the native bombykol receptor in the fruit fly with high doses of another odorant to which the receptor responds with the highest sensitivity, we demonstrate that slow signal termination is induced by overdose of a stimulus. As opposed to the empty neuron system in the basiconic sensilla, the structural, biochemical, and/or biophysical features of the sensilla make the T1 trichoid system of the fly a better surrogate for the moth receptor. PMID:20439725

  20. Molecular Phylogeny and Identification of the Peach Fruit Fly, Bactrocera zonata, Established in Egypt

    PubMed Central

    Abd-El-Samie, Emtithal M.; El Fiky, Zaki A.

    2011-01-01

    The genetic structure of the Egyptian peach fruit fly (Bactrocera zonata (Saunders) (Diptera: Tephritidae)) population was analyzed using total RNA from adult females. A portion of mitochondrial cytochrome oxidase I (COI), 369 bp was amplified using RT-PCR, and was sequenced and analyzed to clarify the phylogenetic relationship of B. zonata established in Egypt. The data suggested that the gene shared a similarity in sequence compared to Bactrocera COI gene found in GenBank. Molecular phylogenetic analyses were performed based on nucleotide sequences in order to examine the position of the Egyptian population among many other species of fruit flies. The results indicate that four accession numbers of B. zonata (three from New Zealand and one from India) are closely related, while the Egyptian B. zonata are close to the 71 accession numbers of Bactrocera include one B. zonata from New Zealand. These two B. zonata from Egypt and New Zealand showed a close relationship in neighbor—joining analysis using the seven accession numbers of B. zonata. In addition, a theoretical restriction map of the homology portion of the COI gene was constructed using 212 restriction enzymes obtained from the restriction enzyme database to identify the Egyptian and New Zealand B. zonata. PMID:22958094

  1. Occupational allergy to fruit flies (Drosophila melanogaster) in laboratory workers.

    PubMed

    Jones, Meinir; Blair, Sue; MacNeill, Stephanie; Welch, Jennifer; Hole, Alice; Baxter, Peter; Cullinan, Paul

    2017-06-01

    Drosophila melanogaster (the 'fruit fly') is commonly used in genetic research, but there is only one report of IgE-associated allergy in exposed workers. 4 newly identified cases prompted us to examine the extent of this problem in a university laboratory. Our aim in this study is to determine the prevalence and determinants of sensitisation to fruit flies in a population of exposed workers. In a cross-sectional study, we surveyed 286 employees working in a department carrying out research involving D. melanogaster. Sensitisation was assessed by specific IgE measurement in serum and examined in relation to symptoms and to estimated exposure to fruit flies. The overall prevalence of specific sensitisation was 6% with a clear relationship to increasing frequency/intensity of exposure (p trend<0.001). Work-related eye/nose, chest or skin symptoms were reported by substantial proportions of participants but for most of these there was no evidence of specific sensitisation to fruit fly. The overall prevalence of any work-related symptoms and sensitisation was 2.4%, rising to 7.1% in those working in high exposure groups. We were able to demonstrate, for the first time, a clear exposure-response relationship between fruit fly exposure and specific sensitisation. Facilities housing fruit flies should carefully consider methods to reduce exposure levels in the workplace. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  2. Attraction of Rhagoletis indifferens (Diptera: Tephitidae) to white light in the presence and absence of ammonia

    USDA-ARS?s Scientific Manuscript database

    Attraction of tephritid fruit flies to light and its role in fly biology and management has received little attention. Here, the objective was to show that western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is attracted to white light in the presence and absence of ammo...

  3. Effect of Temperature on the Development and Survival of Immature Stages of the Carambola Fruit Fly, Bactrocera carambolae, and the Asian Papaya Fruit Fly, Bactrocera papayae, Reared On Guava Diet

    PubMed Central

    Danjuma, Solomon; Thaochan, Narit; Permkam, Surakrai; Satasook, Chutamas

    2014-01-01

    Members of the Bactrocera dorsalis Hendel (Diptera: Tephritidae) complex constitute wellrecognized destructive pests of fruits in peninsular Thailand. The development and survival of immature stages of the carambola fruit fly, Bactrocera carambolae Drew & Hancock, and the Asian papaya fruit fly, Bactrocera papayae Drew & Hancock, were compared at six constant temperatures of 15, 20, 25, 27, 30, and 35°C, 70 ± 5% relative humidity, and a photoperiod of 12:12 (L:D). The objectives were to determine the effect of temperature on the developmental stages for optimizing rearing and to understand the geographical pattern of occurrence of these fruit fly species. A strong and positive linear relationship was observed between temperature and developmental rate of immature stages of B. carambolae. Similarly, a strong and positive linear relationship was observed between temperature and developmental rate of B. papayae. A temperature summation model was used to estimate the lower threshold temperature and the thermal constant. Bactrocera papayae was significantly faster in development and higher in survival and appeared to be better adapted to low temperatures than B. carambolae, as it exhibited the lowest threshold temperatures at all immature stages. The observed differences in response to various temperatures revealed to some extent the impact of temperature on these species' distribution in peninsular Thailand and other parts of the world. PMID:25368070

  4. Effect of temperature on the development and survival of immature stages of the carambola fruit fly, Bactrocera carambolae, and the Asian papaya fruit fly, Bactrocera papayae, reared on guava diet.

    PubMed

    Danjuma, Solomon; Thaochan, Narit; Permkam, Surakrai; Satasook, Chutamas

    2014-01-01

    Members of the Bactrocera dorsalis Hendel (Diptera: Tephritidae) complex constitute well-recognized destructive pests of fruits in peninsular Thailand. The development and survival of immature stages of the carambola fruit fly, Bactrocera carambolae Drew & Hancock, and the Asian papaya fruit fly, Bactrocera papayae Drew & Hancock, were compared at six constant temperatures of 15, 20, 25, 27, 30, and 35°C, 70 ± 5% relative humidity, and a photoperiod of 12:12 (L:D). The objectives were to determine the effect of temperature on the developmental stages for optimizing rearing and to understand the geographical pattern of occurrence of these fruit fly species. A strong and positive linear relationship was observed between temperature and developmental rate of immature stages of B. carambolae. Similarly, a strong and positive linear relationship was observed between temperature and developmental rate of B. papayae. A temperature summation model was used to estimate the lower threshold temperature and the thermal constant. Bactrocera papayae was significantly faster in development and higher in survival and appeared to be better adapted to low temperatures than B. carambolae, as it exhibited the lowest threshold temperatures at all immature stages. The observed differences in response to various temperatures revealed to some extent the impact of temperature on these species' distribution in peninsular Thailand and other parts of the world.

  5. Do Fruit Ripening Volatiles Enable Resource Specialism in Polyphagous Fruit Flies?

    PubMed

    Cunningham, John Paul; Carlsson, Mikael A; Villa, Tommaso F; Dekker, Teun; Clarke, Anthony R

    2016-09-01

    Frugivorous tephritid fruit flies have lineages with high levels of host generalism. These insects use olfaction to locate fruits, but how they are able to recognize the odors of so many different host species is poorly understood. We used a series of behavioral experiments to investigate the role of fruit ripening volatiles as host cues in the Queensland fruit fly, Bactrocera tryoni (Froggatt), a polyphagous pest in Australia. Odors of mature guava (Psidium guajava) attracted female and male flies more strongly than three other ripening stages and guava pulp. We analyzed volatiles from guava odor and selected eleven compounds, all of which elicited an electrophysiological response in the antenna of female flies. Three of these, ethyl acetate, ethyl butyrate, and ethyl propionate, were released at the highest rates from the most attractive ripening stage. In behavioral trials, these three esters were not attractive individually, whereas a combination was necessary and sufficient in attracting female flies. The three-component blend was as attractive as the entire 11-component blend, which without these key volatiles was not attractive. Moreover, injecting low ranking hosts (squash and cucumber) with the three volatiles increased attraction in ovipositing female flies. These fruit flies are classed as generalists, but like many polyphagous insects they could be regarded as resource specialists, preferring specific plant reproductive stages with predictable odor cues. Exploring olfaction from this perspective could improve our understanding of host choice in polyphagous insects, and the selection of volatiles to be used as attractants in insect pest management.

  6. Dispersal of Rhagoletis cerasi in Commercial Cherry Orchards: Efficacy of Soil Covering Nets for Cherry Fruit Fly Control

    PubMed Central

    Daniel, Claudia; Baker, Brian

    2013-01-01

    Demand for organic cherries offers producers a premium price to improve their commercial viability. Organic standards require that producers find alternatives to pesticides. Soil treatments to control the European cherry fruit fly Rhagoletis cerasi (L.) (Diptera: Tephrididae) appear to be an attractive option. However, soil treatments can only be effective if the migration of flies is low, because mature flies may migrate from near-by trees for oviposition. To examine the general potential of soil treatments and to understand the dispersal and flight behaviour of R. cerasi within orchards, experiments using netting to cover the soil were conducted in two orchards with different pest pressure during two years. The netting reduced flight activity by 77% and fruit infestation by 91%. The data showed that the flies have a dispersal of less than 5 m within orchards, which is very low. The low thresholds for tolerance for infested fruit in the fresh market creates a strong economic incentive for control, therefore, soil covering is a promising strategy for controlling R. cerasi in commercial orchards. PMID:26466801

  7. Behavioral evidence for fruit odor discrimination and sympatric host races of Rhagoletis pomonella flies in the Western United States.

    PubMed

    Linn, Charles E; Yee, Wee L; Sim, Sheina B; Cha, Dong H; Powell, Thomas H Q; Goughnour, Robert B; Feder, Jeffrey L

    2012-11-01

    The recent shift of Rhagoletis pomonella (Diptera: Tephritidae) from its native host downy hawthorn, Crataegus mollis, to introduced domesticated apple, Malus domestica, in the eastern United States is a model for sympatric host race formation. However, the fly is also present in the western United States, where it may have been introduced via infested apples within the last 60 years. In addition to apple, R. pomonella also infests two hawthorns in the West, one the native black hawthorn, C. douglasii, and the other the introduced English ornamental hawthorn, C. monogyna. Here, we test for behavioral evidence of host races in the western United States. through flight tunnel assays of western R. pomonella flies to host fruit volatile blends. We report that western apple, black hawthorn, and ornamental hawthorn flies showed significantly increased levels of upwind-directed flight to their respective natal compared to nonnatal fruit volatile blends, consistent with host race status. We discuss the implications of the behavioral results for the origin(s) of western R. pomonella, including the possibility that western apple flies were not introduced, but may represent a recent shift from local hawthorn fly populations. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  8. TrackFly: virtual reality for a behavioral system analysis in free-flying fruit flies.

    PubMed

    Fry, Steven N; Rohrseitz, Nicola; Straw, Andrew D; Dickinson, Michael H

    2008-06-15

    Modern neuroscience and the interest in biomimetic control design demand increasingly sophisticated experimental techniques that can be applied in freely moving animals under realistic behavioral conditions. To explore sensorimotor flight control mechanisms in free-flying fruit flies (Drosophila melanogaster), we equipped a wind tunnel with a Virtual Reality (VR) display system based on standard digital hardware and a 3D path tracking system. We demonstrate the experimental power of this approach by example of a 'one-parameter open loop' testing paradigm. It provided (1) a straightforward measure of transient responses in presence of open loop visual stimulation; (2) high data throughput and standardized measurement conditions from process automation; and (3) simplified data analysis due to well-defined testing conditions. Being based on standard hardware and software techniques, our methods provide an affordable, easy to replicate and general solution for a broad range of behavioral applications in freely moving animals. Particular relevance for advanced behavioral research tools originates from the need to perform detailed behavioral analyses in genetically modified organisms and animal models for disease research.

  9. Survival of the House Fly (Diptera: Muscidae) on Truvia and Other Sweeteners.

    PubMed

    Fisher, Michael L; Fowler, Fallon E; Denning, Steven S; Watson, David W

    2017-07-01

    The house fly, Musca domestica L. (Diptera: Muscidae), is a disease vector of mechanically transmitted pathogens including bacteria, viruses, and protozoans. Opportunities for pathogen transmission can increase as fly longevity increases. Dietary preferences play an important role in insect longevity; therefore, we investigated house fly preferences, sucrose availability, and caloric constraints on house fly longevity. Experimental goals were: 1) to test the effects of calorie restriction on survival of house flies by manipulating concentrations of erythritol (low caloric content) and sucrose (high caloric content), and comparing commercial sweeteners of differing calorie content, 2) to identify house fly preferences for either erythritol or sucrose, and 3) to evaluate the insecticidal activity or toxicity of erythritol on house flies. Our data show that house flies may prefer high calorie options when given a choice and that house fly longevity likely increases as calorie content increases. Additionally, no significant differences in longevity were observed between the water only control (zero calories) and erythritol treatments. This suggests that decreased survival rates and death could be the result of starvation rather than insecticidal activity. This research furthers our understanding of house fly survival and sugar-feeding behavior. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Persistence and Retention of Porcine Reproductive and Respiratory Syndrome Virus in Stable Flies (Diptera: Muscidae).

    PubMed

    Rochon, K; Baker, R B; Almond, G W; Gimeno, I M; Pérez de León, A A; Watson, D W

    2015-09-01

    We investigated the acquisition of porcine reproductive and respiratory syndrome (PRRS) virus by the stable fly (Diptera: Muscidae; Stomoxys calcitrans (L.)) through a bloodmeal, and virus persistence in the digestive organs of the fly using virus isolation and quantitative reverse-transcription PCR (qRT-PCR). Stable flies were fed blood containing live virus, modified live vaccine virus, chemically inactivated virus, or no virus. Stable flies acquired PRRSV from the bloodmeal and the amount of virus in the flies declined with time, indicating virus did not replicate in fly digestive tissues. Virus RNA was recovered from the flies fed live virus up to 24 h postfeeding using virus isolation techniques and 96 h using qRT-PCR. We further examined the fate of PRRSV in the hemolymph of the flies following intrathoracic injection to bypass the midgut barrier. PRRSV was detected in intrathoracically inoculated adult stable flies for 10 d using qRT-PCR. In contrast to what we observed in the digestive tract, detectable virus quantities in the intrathoracically inoculated stable flies followed an exponential decay curve. The amount of virus decreased fourfold in the first 3 d and remained stable thereafter, up to 10 d.

  11. Differences in antennal sensillae of male and female peach fruit flies in relation to hosts.

    PubMed

    Awad, Azza A; Mohamed, Hend O; Ali, Nashat A

    2015-01-01

    Antennal sensillae of male and female peach fruit flies, Bactrocera zonata (Saunders) (Diptera: Tephritidae), obtained from three different host fruit species (guava, Psidium guajava L. (Myrtales: Myrtaceae); peach, Prunus persica (L.) Stokes (Rosales: Rosaceae); and orange, Citrus sinensis (L.) Osbeck (Sapindales: Rutaceae)), were studied with scanning electron microscopy. This study was carried out to describe the different types of sensillae present on the three antennal segments (scape, pedicel, and flagellum or funiculus) of both sexes of B. zonata on different host fruit. The antennal segments of females tended to be larger than those of males feeding on peach and guava fruit. On orange, both sexes were similar (no significant differences were found). The first two antennal segments, scape and pedicel, are reinforced by some bristles and have different types of sensillae, including trichoid I, II, S; basiconic II; and sensilla chaetica in different numbers on different host fruit species. Numerous microtrichia, as well as trichoid (I, II), basiconic (I), clavate, and coeloconic (I, II) sensillae were observed on the funiculus with a great variation in number and length. As a result of feeding on different hosts, differences were found between sexes and some plasticity in size, number, distribution, and position of some sensillae, including trichoid, basiconic, chaetica, and clavate on the antennae of the female B. zonata. These sensillae were significantly larger in females. Also, some morphological and morphemetric differences have been found according to their feeding on different host fruit. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  12. The crane flies (Diptera: Tipuloidea) of Great Smoky Mountains National Park

    USGS Publications Warehouse

    Petersen, Matthew J.; Parker, Charles R.; Bernard, Ernest

    2005-01-01

    The list of crane flies (Diptera: Ptychopteridae, Tipuloidea, Trichoceridae) known from Great Smoky Mountains National Park is updated. Sampling in association with the All Taxa Biodiversity Inventory of Great Smoky Mountains National Park resulted in the addition of 107 new Park records, bringing the current list to 250 species. This species assemblage is much richer than those of surrounding areas, although similar in composition. Total richness is estimated to be between 450 and 500 species for Great Smoky Mountains National Park.

  13. Black flies (Diptera: Simuliidae) of Turkish Thrace, with a new record for Turkey

    PubMed Central

    Çalışkan, Hakan; Şahin, Yalçın

    2015-01-01

    Abstract Background This paper includes 2742 specimens of 18 species of black flies (Diptera: Simuliidae) collected from 132 lotic sites in Turkish Thrace, the European part of Turkey, in the early summer of 2002 and 2003 and the spring of 2005 and 2006. New information All species are recorded from this region for the first time, and Metacnephia nigra (Rubtsov, 1940) is a new record for Turkey. Distributional and taxonomical remarks are given for each species. PMID:25941452

  14. House fly (Musca domestica) (Diptera: Muscidae) mortality after exposure to commercial fungal formulations in a sugar bait

    USDA-ARS?s Scientific Manuscript database

    House flies (Musca domestica L.) (Diptera: Muscidae) are major pests of livestock. Biological control is an important tool in an integrated control framework. Increased mortality in filth flies has been documented with entomopathogenic fungi, and several strains are commercially available. Three str...

  15. Activity patterns and parasitism rates of fire ant decapitating flies (Diptera:Phoridae:Pseudacteon spp.) in their native Argentina

    USDA-ARS?s Scientific Manuscript database

    Technical Abstract: This work describes the annual and daily activity patterns of two parasitoid fly communities of the fire ant S. invicta (Hymenoptera: Formicidae) in their native Argentina. Pseudacteon (Diptera: Phoridae) flies were censused monthly for one year at two sites in northwestern Corr...

  16. The distribution and life history of Axymyia Furcata Mcatee (Diptera:Axymyhdae), a wood inhabiting, semi-aquatic fly

    Treesearch

    Matthew Wihlm; Gregory Courtney

    2011-01-01

    Axymyia furcata McAtee (Diptera: Axymyhdae), is a xylophilic, semi-aquatic fly from eastern North America. As part of a comprehensive study of the fly’s distribution, life history, and phylogeography, we surveyed populations of A. furcata in the eastern United States and Canada. Collecting and rearing methods are described, and use of the niche modeling software,...

  17. An annotated checklist of the horse flies (Diptera: Tabanidae) of Lebanon with remarks on ecology and zoogeography: Pangoniinae and Chrysopsinae

    USDA-ARS?s Scientific Manuscript database

    Knowledge of the horse fly fauna (Diptera: Tabanidae) of Lebanon is fragmentary while in most neighboring countries it has been fairly well researched. Therefore USDA-CMAVE scientists and Israeli scientists worked cooperatively to survey the species of horse flies in the Lebanon. Chrysops flavipes ...

  18. BIOLOGICAL AND CULTURAL CONTROL OF OLIVE FRUIT FLY IN CALIFORNIA

    USDA-ARS?s Scientific Manuscript database

    Olive fruit fly, Bactrocera oleae (Gmelin), monitored with ChamP traps captured the highest numbers of adults in olive trees, Olea europaea, in October in an inland valley location, and in September in a coastal location. Significantly more adults were captured in Pherocon ® AM traps than ChamP tra...

  19. Update on Bait Stations for Tephritid Fruit Fly Control

    USDA-ARS?s Scientific Manuscript database

    Attract-and-kill devices, otherwise known as bait stations, are being developed and tested as alternatives to broadcast pesticide application for control of a number of pest insects. With the development of female-targeted food-based synthetic attractants for tephritid fruit flies, a number of bait...

  20. Development of new lures and bait stations for fruit flies

    USDA-ARS?s Scientific Manuscript database

    Attractants and trapping methods form the basis for effective detection, delimitation and control systems needed for pest tephritid fruit flies. Female-targeted attractants are based primarily on protein-based chemical cues in combination with visual cues. Identification of powerful attractants for ...

  1. Transcriptome of the egg parasitoid Fopius arisanus, an important biocontrol tool for Tephritid fruit fly suppression

    USDA-ARS?s Scientific Manuscript database

    Background The Braconoid wasp Fopius arisanus (Sonan) has been utilized for biological control of the Mediterranean fruit fly (Ceratitis capitata), and the oriental fruit fly (Bactrocera dorsalis), both phytophagous fruit flies pest of economic importance in Hawaii. We have sequenced and assembled t...

  2. Detection of fruit fly infestation in pickling cucumbers using a hyperspectral reflectance/transmittance imaging system

    USDA-ARS?s Scientific Manuscript database

    Fruit fly infestation can be a serious problem in pickling cucumber production. In the United States and many other countries, there is zero tolerance for fruit flies in pickled cucumber products. Currently, processors rely on manual inspection to detect and remove fruit fly-infested cucumbers, whic...

  3. Detection of Fruit Fly Infestation in Pickling Cucumbers using Hyperspectral Imaging

    USDA-ARS?s Scientific Manuscript database

    Fruit fly infestation can be a serious problem in pickling cucumber production. In the United States and many other countries, there is zero tolerance for fruit flies in pickled products. Currently, processors rely on manual inspection to detect and remove fruit fly-infested cucumbers, which is labo...

  4. Dietary wheat germ oil and age influences fatty acid compositions in adult oriental fruit flies

    USDA-ARS?s Scientific Manuscript database

    Sterile Insect Technique programs have been developed for management of several tephritid fruit fly pests. These programs are based on continous production of adult fruit flies. The high expense of mass-rearing oriental fruit flies drive research to improve the cost effectiveness of rearing programs...

  5. Detection of West Nile virus in stable flies (Diptera: Muscidae) parasitizing juvenile American white pelicans.

    PubMed

    Johnson, Gregory; Panella, Nicholas; Hale, Kristina; Komar, Nicholas

    2010-11-01

    Stable flies, Stomoxys calcitrans (L.) (Diptera: Muscidae), an economically important pest of livestock and humans, were observed parasitizing prefledged American white pelicans, Pelecanus erythrorhynchos (Pelecaniformes: Pelecanidae), in a pelican breeding colony in northeastern Montana where die-offs attributed to West Nile virus (family Flaviviridae, genus Flavivirus, WNV) have occurred since 2002. Engorged and unengorged flies were collected off nine moribund chicks. Of 29 blood-engorged flies testing positive for vertebrate DNA, all 29 contained pelican DNA. Virus isolation was performed on 60 pools (1,176 flies) of unengorged flies using Vero cell plaque assay. Eighteen pools were positive for WNV for an estimated infection rate of 18.0 per 1,000 flies. Fifty-four percent (36/67) of abdomens from blood-engorged flies tested positive for WNV. Pelican viremia levels from the blood-engorged fly abdomens revealed that at least one of the ill pelicans circulated a viremia capable of infecting Culex mosquito vectors. Stable flies may be involved in WNV transmission within the pelican breeding colony by serving as either a mechanical vector or as a source for oral infection if ingested by predators.

  6. Occurrence of blow fly species (Diptera: calliphoridae) in Phitsanulok Province, Northern Thailand.

    PubMed

    Bunchu, Nophawan; Sukontason, Kom; Sanit, Sangob; Chidburee, Polprecha; Kurahashi, Hiromu; Sukontason, Kabkaew L

    2012-12-01

    Based on the current forensic importance of blow flies (Diptera: Calliphoridae), their biological aspects have been studied increasingly worldwide. The blow fly fauna in Phitsanulok Province, Northern Thailand was studied from May 2009 to April 2010 in the residential, agricultural, mountainous and forested areas of Muang, Wat Bot, Nakhon Thai and Wang Thong districts, respectively, in order to know the occurrence of blow flies in this province. Collections were carried out monthly using commercial funnel fly traps and sweeping methods, with 1-day tainted pork viscera as bait. Identification of adult blow flies exhibited 14 634 specimens, comprising of 5 subfamilies, 14 genera and 36 species. Chrysomya megacephala (Fabricius, 1794) and Achoetandrus rufifacies (Macquart, 1843) were the most and second most abundant species trapped, respectively. These two species of carrion flies prevailed in all the types of land investigated. We calculated and compared the diversity indices, species evenness and richness, and similarity coefficients of the blow fly species in various areas. The data from this study may be used to identify the potential of forensicallyimportant fly species within Phitsanulok Province and fulfill the information on blow fly fauna in Thailand.

  7. Evolution of Lower Brachyceran Flies (Diptera) and Their Adaptive Radiation with Angiosperms

    PubMed Central

    Zhang, Qingqing; Wang, Bo

    2017-01-01

    The Diptera (true flies) is one of the most species-abundant orders of Insecta, and it is also among the most important flower-visiting insects. Dipteran fossils are abundant in the Mesozoic, especially in the Late Jurassic and Early Cretaceous. Here, we review the fossil record and early evolution of some Mesozoic lower brachyceran flies together with new records in Burmese amber, including Tabanidae, Nemestrinidae, Bombyliidae, Eremochaetidae, and Zhangsolvidae. The fossil records reveal that some flower-visiting groups had diversified during the mid-Cretaceous, consistent with the rise of angiosperms to widespread floristic dominance. These brachyceran groups played an important role in the origin of co-evolutionary relationships with basal angiosperms. Moreover, the rise of angiosperms not only improved the diversity of flower-visiting flies, but also advanced the turnover and evolution of other specialized flies. PMID:28484485

  8. Evolution of Lower Brachyceran Flies (Diptera) and Their Adaptive Radiation with Angiosperms.

    PubMed

    Zhang, Qingqing; Wang, Bo

    2017-01-01

    The Diptera (true flies) is one of the most species-abundant orders of Insecta, and it is also among the most important flower-visiting insects. Dipteran fossils are abundant in the Mesozoic, especially in the Late Jurassic and Early Cretaceous. Here, we review the fossil record and early evolution of some Mesozoic lower brachyceran flies together with new records in Burmese amber, including Tabanidae, Nemestrinidae, Bombyliidae, Eremochaetidae, and Zhangsolvidae. The fossil records reveal that some flower-visiting groups had diversified during the mid-Cretaceous, consistent with the rise of angiosperms to widespread floristic dominance. These brachyceran groups played an important role in the origin of co-evolutionary relationships with basal angiosperms. Moreover, the rise of angiosperms not only improved the diversity of flower-visiting flies, but also advanced the turnover and evolution of other specialized flies.

  9. Sarcophaga (Liosarcophaga) dux (Diptera: Sarcophagidae): A flesh fly species of medical importance.

    PubMed

    Sukontason, Kabkaew L; Sanit, Sangob; Klong-Klaew, Tunwadee; Tomberlin, Jeffery K; Sukontason, Kom

    2014-04-01

    Although tropical climate of Thailand is suitably endowed with biodiversity of insects, flies of medical importance is not well investigated. Using information from literature search, fly survey approach and specialist's experience, we review database of Sarcophaga (Liosarcophaga) dux Thomson (Diptera: Sarcophagidae), one of the priorities flesh fly species of medical importance in Thailand. This review deals with morphology, bionomics and medical involvement. Important morphological characteristics of egg, larva, puparia and adult were highlighted with illustration and/or micrographs. Search pertaining to molecular analysis used for fly identification and developmental rate of larvae were included. Medical involvement of larvae was not only myiasis-producing agent in humans and animals, but associated with human death investigations. This information will enable us to accurate identify this species and to emphasis the increase medically important scene in Thailand.

  10. Limits to the host range of the highly polyphagous tephritid fruit fly Anastrepha ludens in its natural habitat.

    PubMed

    Birke, A; Acosta, E; Aluja, M

    2015-12-01

    Anastepha ludens (Diptera: Tephritidae) is a highly polyphagous fruit fly that is able to develop in a wide range of hosts. Understanding the limits of this pest's host range could provide valuable information for pest management and plant breeding for pest resistance. Previous studies have shown that guavas (Psidium guajava (Myrtaceae) L.), are not attacked under natural conditions by A. ludens. To understand this phenomenon, guavas were exposed to natural infestation by A. ludens and to other fruit fly species that infest guavas in nature (Anastrepha striata Schiner, Anastepha fraterculus (Wiedemann), Anastepha obliqua (Macquart)). Once the susceptible phenological stage of guavas was determined, fruit infestation levels were compared between A. ludens and A. striata. Choice and non-choice tests were performed under field-cage conditions. Under field conditions, guavas were susceptible to A. striata and A. fraterculus attack all the way from when fruit was undeveloped to when fruit began to ripen. No infestation by A. ludens was recorded under natural conditions. Similar results were obtained when forced exposures were performed, indicating that unripe guavas were preferred by A. striata over ripe fruit, and that infestation rates were higher at early fruit maturity stages. Under forced oviposition conditions, A. ludens larvae were unable to develop in unripe guavas but did so in fully ripe fruit. However, A. ludens fitness parameters were dramatically affected, exhibiting reduced survival and reduced pupal weight compared to conspecifics that developed in a natural host, grapefruit. We confirm that P. guajava should not be treated as a natural host of this pestiferous species, and suggest that both behavioral aspects and the fact that larvae are unable to adequately develop in this fruit, indeed represent clear limits to A. ludens's broad host range.

  11. Effect of isometamidium chloride treatment on susceptibility of tsetse flies (Diptera: Glossinidae) to trypanosome infections.

    PubMed

    Van Den Bossche, P; Akoda, K; Djagmah, B; Marcotty, T; De Deken, R; Kubi, C; Parker, A; Van Den Abbeele, J

    2006-05-01

    Experiments were conducted to determine the effect of a single isometamidium chloride treatment of teneral tsetse flies, Glossina morsitans morsitans Westwood (Diptera: Glossinidae), on the subsequent susceptibility to an infection with Trypanosoma congolense or Trypanosoma brucei brucei. Flies were offered a first bloodmeal on sterile gamma-irradiated defibrinated bovine blood that contained either 10 or 100 microg ofisometamidium chloride/ml. Treated flies were subsequently infected with T. congolense IL 1180 or T. b. brucei AnTAR1 on day 3, 5, 10, or 20 posttreatment. To determine the effect of a single treatment with isometamidium chloride at 10 microg/ml on the fly's susceptibility to infection with isometamidium chloride-resistant trypanosome strains, treated flies were infected with one of two resistant isogenic T. congolense IL 1180 strains 3 d after the first feed. Results showed that a single isometamidium chloride treatment at 10 microg/ml blood sufficed to reduce significantly the fly's subsequent susceptibility to infection. Only 6.8% of the flies that were treated with isometamidium chloride developed a mature infection with T. congolense in the mouthparts compared with 34.3% of the control group. None of the flies that were administered isometamidium chloride and subsequently infected on day 3 or 6 with T. b. brucei developed a metacyclic infection in the salivary glands compared with 22.7% of the control flies. Likewise for the resistant T. congolense strains, a single treatment with isometamidium chloride significantly reduced the subsequent susceptibility to infection (6.5 and 33.5% of flies with metacyclic infections for treated and untreated flies, respectively). In practice and with respect to the release of sterile male flies to eradicate an isolated tsetse fly population, our results show that administering isometamidium chloride during the first bloodmeal (and before release) would significantly reduce the ability of these released males to

  12. A Sex Pheromone Receptor in the Hessian Fly Mayetiola destructor (Diptera, Cecidomyiidae)

    PubMed Central

    Andersson, Martin N.; Corcoran, Jacob A.; Zhang, Dan-Dan; Hillbur, Ylva; Newcomb, Richard D.; Löfstedt, Christer

    2016-01-01

    The Hessian fly, Mayetiola destructor Say (Diptera, Cecidomyiidae), is a pest of wheat and belongs to a group of gall-inducing herbivores. This species has a unique life history and several ecological features that differentiate it from other Diptera such as Drosophila melanogaster and blood-feeding mosquitoes. These features include a short, non-feeding adult life stage (1–2 days) and the use of a long-range sex pheromone produced and released by adult females. Sex pheromones are detected by members of the odorant receptor (OR) family within the Lepidoptera, but no receptors for similar long-range sex pheromones have been characterized from the Diptera. Previously, 122 OR genes have been annotated from the Hessian fly genome, with many of them showing sex-biased expression in the antennae. Here we have expressed, in HEK293 cells, five MdesORs that display male-biased expression in antennae, and we have identified MdesOR115 as a Hessian fly sex pheromone receptor. MdesOR115 responds primarily to the sex pheromone component (2S,8E,10E)-8,10-tridecadien-2-yl acetate, and secondarily to the corresponding Z,E-isomer. Certain sensory neuron membrane proteins (i.e., SNMP1) are important for responses of pheromone receptors in flies and moths. The Hessian fly genome is unusual in that it encodes six SNMP1 paralogs, of which five are expressed in antennae. We co-expressed each of the five antennal SNMP1 paralogs together with each of the five candidate sex pheromone receptors from the Hessian fly and found that they do not influence the response of MdesOR115, nor do they confer responsiveness in any of the non-responsive ORs to any of the sex pheromone components identified to date in the Hessian fly. Using Western blots, we detected protein expression of MdesOrco, all MdesSNMPs, and all MdesORs except for MdesOR113, potentially explaining the lack of response from this OR. In conclusion, we report the first functional characterization of an OR from the Cecidomyiidae

  13. Superparasitism in the Fruit Fly Parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) and the Implications for Mass Rearing and Augmentative Release.

    PubMed

    Montoya, Pablo; Pérez-Lachaud, Gabriela; Liedo, Pablo

    2012-09-25

    Superparasitism, a strategy in which a female lays eggs in/on a previously parasitized host, was attributed in the past to the inability of females to discriminate between parasitized and non-parasitized hosts. However, superparasitism is now accepted as an adaptive strategy under specific conditions. In fruit fly parasitoids, superparasitism has mainly been studied as concerns the new association between Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae) and the Mexican fruit fly Anastrepha ludens (Loew) (Diptera: Tephritidae), wherein this phenomenon is a common occurrence in both mass rearing and field conditions. Studies of this species have shown that moderate levels of superparasitism result in a female-biased sex ratio and that both massreared and wild females superparasitize their hosts without detrimental effects on offspring demographic parameters, including longevity and fecundity. These studies suggest that superparasitism in this species is advantageous. In this paper, we review superparasitism in D. longicaudata, discuss these findings in the context of mass rearing and field releases and address the possible implications of superparasitism in programs employing augmentative releases of parasitoids for the control of fruit fly pests.

  14. Superparasitism in the Fruit Fly Parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) and the Implications for Mass Rearing and Augmentative Release

    PubMed Central

    Montoya, Pablo; Pérez-Lachaud, Gabriela; Liedo, Pablo

    2012-01-01

    Superparasitism, a strategy in which a female lays eggs in/on a previously parasitized host, was attributed in the past to the inability of females to discriminate between parasitized and non-parasitized hosts. However, superparasitism is now accepted as an adaptive strategy under specific conditions. In fruit fly parasitoids, superparasitism has mainly been studied as concerns the new association between Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae) and the Mexican fruit fly Anastrepha ludens (Loew) (Diptera: Tephritidae), wherein this phenomenon is a common occurrence in both mass rearing and field conditions. Studies of this species have shown that moderate levels of superparasitism result in a female-biased sex ratio and that both massreared and wild females superparasitize their hosts without detrimental effects on offspring demographic parameters, including longevity and fecundity. These studies suggest that superparasitism in this species is advantageous. In this paper, we review superparasitism in D. longicaudata, discuss these findings in the context of mass rearing and field releases and address the possible implications of superparasitism in programs employing augmentative releases of parasitoids for the control of fruit fly pests. PMID:26466718

  15. Taste and pheromone perception in the fruit fly Drosophila melanogaster.

    PubMed

    Ebbs, Michelle L; Amrein, Hubert

    2007-08-01

    Taste is an essential sense for detection of nutrient-rich food and avoidance of toxic substances. The Drosophila melanogaster gustatory system provides an excellent model to study taste perception and taste-elicited behaviors. "The fly" is unique in the animal kingdom with regard to available experimental tools, which include a wide repertoire of molecular-genetic analyses (i.e., efficient production of transgenics and gene knockouts), elegant behavioral assays, and the possibility to conduct electrophysiological investigations. In addition, fruit flies, like humans, recognize sugars as a food source, but avoid bitter tasting substances that are often toxic to insects and mammals alike. This paper will present recent research progress in the field of taste and contact pheromone perception in the fruit fly. First, we shall describe the anatomical properties of the Drosophila gustatory system and survey the family of taste receptors to provide an appropriate background. We shall then review taste and pheromone perception mainly from a molecular genetic perspective that includes behavioral, electrophysiological and imaging analyses of wild type flies and flies with genetically manipulated taste cells. Finally, we shall provide an outlook of taste research in this elegant model system for the next few years.

  16. Predicting Fruit Fly's Sensing Rate From Insect Flight Simulations

    NASA Astrophysics Data System (ADS)

    Wang, Jane; Chang, Song

    2013-11-01

    Without sensory feedbacks, flies cannot fly. Exactly how sensory feedback controls work in flying insects is a complex puzzle to solve. What do insects measure in order to stabilize their flight? What kinds of neural computations and muscle activities are involved in order to correct their flight course or to turn? How often and how fast do animals adjust their wings to remain stable? To understand the algorithms used by insects to control their dynamic instability, we have developed a simulation tool to study flapping flight, where motions of the insect body and wings are coupled instantaneously. To stabilize the flight in the simulation, we construct a control algorithm that modulates wing motion based on discrete measurements of the body-pitch orientation. Our simulations give theoretical bounds both on the sensing rate and the delay time between sensing and actuation. Interpreting these findings together with experimental results on fruit flies' reaction time and sensory motor reflexes, we give a sharper bound on the sensing rate and further reason that fruit flies sense their kinematic states every wing-beat in order to stabilize their flight.

  17. Vector competence of the stable fly (Diptera: Muscidae) for West Nile virus.

    PubMed

    Doyle, Michael S; Swope, Bethany N; Hogsette, Jerome A; Burkhalter, Kristen L; Savage, Harry M; Nasci, Roger S

    2011-05-01

    In 2006-2007, stable flies, Stomoxys calcitrans (L.) (Diptera: Muscidae), were suspected of being enzootic vectors of West Nile virus (family Flaviviridae, genus Flavivirus, WNV) during a die-off of American white pelicans (Pelecanus erythrorhynchos Gmelin) (Pelecanidae) in Montana, USA. WNV-positive stable flies were observed feeding en masse on incapacitated, WNV-positive pelicans, arousing suspicions that the flies could have been involved in WNV transmission among pelicans, and perhaps to livestock and humans. We assessed biological transmission by infecting stable flies intrathoracically with WNV and testing them at 2-d intervals over 20 d. Infectious WNV was detected in fly bodies in decreasing amounts over time for only the first 6 d postinfection, an indication that WNV did not replicate within fly tissues and that stable flies cannot biologically transmit WNV. We assessed mechanical transmission using a novel technique. Specifically, we fed WNV-infected blood to individual flies by using a cotton swab (i.e., artificial donor), and at intervals of 1 min-24 h, we allowed flies to refeed on a different swab saturated with WNV-negative blood (i.e., artificial recipient). Flies mechanically transmitted viable WNV from donor to recipient swabs for up to 6 h postinfection, with the majority of the transmission events occurring within the first hour. Flies mechanically transmitted WNV RNA to recipient swabs for up to 24 h, mostly within the first 6 h. Given its predilection to feed multiple times when disturbed, these findings support the possibility that the stable fly could mechanically transmit WNV.

  18. An improved quarantine method for mangoes against the Mexican fruit fly based on high-pressure processing combined with heat.

    PubMed

    Velazquez, Gonzalo; Candelario, Hugo Ernesto; Ramírez, José A; Montoya, Pablo; Loera-Gallardo, Jesús; Vázquez, Manuel

    2010-05-01

    The Mexican fruit fly Anastrepha ludens Loew (Diptera: Tephritidae) is one of the most important insects infesting mangoes, citrus, and other fruits in Mexico and other Latin-American countries. Quarantine methods approved to destroy this insect decrease the shelf life of commodities. The objective of this study was to determine the effect of high-pressure processing using an initial temperature of 50 degrees C on the survivorship of eggs and larvae of the Mexican fruit fly. Eggs and larvae were pressurized at 25, 50, 75, 100, or 150 MPa for 0, 5, 10, or 20 min. The hatching ability of pressurized eggs of 1, 2, 3, and 4 days old and survivorship of the first, second, and third instars were registered. Further, the ability to pupate was studied in surviving third instars. The results showed that eggs were more resistant than larvae to the high-pressure processing. Treatments at 150 MPa at initial 50 degrees C for 10 min destroyed all eggs and larvae of A. ludens, indicating that this process might be useful as a quarantine method for infested mangoes or other fruits.

  19. Mexican Fruit Fly Populations in the Semi-Arid Highlands of the Sierra Madre Oriental in Northeastern Mexico.

    PubMed

    Vanoye-Eligio, V; Mora-Olivo, A; Gaona-García, G; Reyes-Zepeda, F; Rocandio-Rodríguez, M

    2017-01-04

    The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most important pests of citrus in Mexico. We report the results of an analysis of A. ludens populations that inhabit the semi-arid highlands of the Sierra Madre Oriental in northeastern Mexico. This study aimed to provide information on population fluctuation of A. ludens and how it relates to climate variables, as well as insights into habitat and native parasitoids. Population peaked in the period July-November when ripe fruits of the wild host, Casimiroa pubescens Ramírez, were available. No adults were captured the rest of the year, suggesting that high populations depend on the availability of wild host fruit. No significant relationships between population fluctuation and climatic variables were observed, except for minimum temperature. Fruit samples of citron (Citrus medica L.), pomegranate (Punica granatum L.), and C. pubescens were collected to determine degree of infestation. Infestation levels (pupae/g) ranged between 0.0006 for citron, 0.0047 for pomegranate, and 0.0240 for C. pubescens. A native parasitoid of Tephritidae, Doryctobracon crawfordii (Viereck) (Braconidae), was identified. Parasitism percentage was calculated at 12.5% on C. pubescens fruits. No parasitoids were observed on citron or pomegranate fruit samples. These results contribute to knowledge on behavior of A. ludens native to temperate environments where no commercial hosts are available. Further research on host expansion of this pest in light of scenarios of global climate change is suggested.

  20. Systematics and distribution of horse flies (Diptera: Tabanidae) of Jordan.

    PubMed

    Al-Talafha, H; Amr, Z S; Baker, M Abu; Bader, A Katbeh

    2005-06-01

    The horse fly fauna of Jordan consists of 24 species belonging to seven genera. The present study adds two new records; Tabanus unifasciatus and Tabanus lunatus. Keys and illustrations for the horse flies of Jordan are presented based on examined materials. Distribution and geographic ranges for each species is also given.

  1. Mitochondrial Single Nucleotide Polymorphisms in Ceratitis capitata (Diptera: Tephritidae) Can Distinguish Sterile, Released Flies from Wild Flies in Various Regions of the World.

    PubMed

    Parubrub, Arlene; Reyes, Ruel; Smallridge, Catherine J; Woods, Bill; Haymer, David

    2015-02-01

    In areas infested with pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), many programs rely heavily on the sterile insect technique (SIT) as a form of biological control. However, when SIT treatments are used both for control of established infestations and for occasional outbreaks, for several reasons, programs are often unable to adequately quantify the success of this approach. Chief among these are difficulties associated with reliably and rapidly determining the strain of origin of males recaptured during and after the SIT program. In this study, we describe the use of a DNA-based marker that can be used to rapidly and reliably distinguish males originating from the two sterile strains that are most widely used in SIT rearing facilities from males originating from wild strains of various regions of the world. This method uses polymerase chain reaction amplification of material from individual specimens to directly analyze DNA sequence variants found within a portion of the mitochondrial ND4 subunit 4 (ND4) gene to identify single nucleotide polymorphisms (SNPs) that are diagnostic of different strains. Specifically, the SNPs described here reliably distinguish individual flies originating from the Vienna 7 and Vienna 8 strains used for sterile release from wild flies infesting various areas including Western Australia, Guatemala, and Hawaii. The availability of such markers for determination of the strain of origin of specimens, either from whole specimens or body parts (including their sperm), has great potential to improve the ability to monitor and quantify the success of any sterile release program.

  2. Antipredator behavior of the new mass-reared unisexual strain of the Mexican Fruit Fly.

    PubMed

    González-López, G I; Rao, D; Díaz-Fleischer, F; Orozco-Dávila, D; Pérez-Staples, D

    2016-06-01

    Tephritid pests controlled through the sterile insect technique (SIT) are mass-reared and subsequently released in affected areas. Several quality parameters are currently used to test adults, but none take into account interactions with a predator. When sterile males are released in the field, they will need to avoid predators until they reach sexual maturity and survive long enough to mate with wild females. Spiders are one of the most common predators that flies may encounter in release sites. In this study, we evaluated the antipredator behavior of a mass-reared sterile unisexual strain ('Tapachula-7') of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae) against their spider predators. We sampled spiders in citrus trees to determine which families could be more common. We established the baseline activity rates of sterile Tapachula-7 (Tap-7) flies in comparison with wild flies. We also tested the behavior of the fertile and sterile bisexual strain and wild flies against hunting spiders (Family Salticidae) and orb building spiders (Family Tetragnathidae). We recorded 18 spider families, with Salticidae being the most dominant. Tap-7 flies diminished their activity in comparison with wild males at 1800 h but showed similar activity levels earlier in the day. When exposed to orb-web spiders (Leucauge venusta), Tap-7, fertile and sterile males from the bisexual strain had similar rates of survival, but Tap-7 males showed lower survival than wild males. Against hunting spiders (Phidippus audax), wild males had higher probability of defensive wing displays, but there was no difference in spider attack rates. In general, sterile Tap -7 males performed as well as males from the bisexual strain, although they had lower survival than wild males. This could be due to either mass-rearing and/or irradiation effects. We recommend the use of the defensive wing display behavior as a quality parameter and propose a rapid and effective method to evaluate fly

  3. Purification and characterization of an antimicrobial peptide, insect defensin, from immunized house fly (Diptera: Muscidae).

    PubMed

    Dang, X L; Wang, Y S; Huang, Y D; Yu, X Q; Zhang, W Q

    2010-11-01

    The house fly, Musca domestica L. (Diptera: Muscidae), is involved in phoretic movement of pathogenic agents, but it has a very efficient defense mechanism against infection. It is believed that antimicrobial peptides play a significant role in the defense system of the house fly. Here, we isolated a peptide from the immunized house fly pupae, measured its molecular mass (3987.6 Da) by matrix-assisted laser desorption ionization/time of flight-mass spectrometry, and determined its amino acid sequence by using the Procise Protein Sequencing System (Applied Biosystems, Foster City, CA). The peptide was confirmed as a member of the insect defensin family. It displayed high activity against gram-positive bacteria but lower activity against gram-negative bacteria and fungi. Reverse transcription-polymerase chain reaction showed that the house fly defensin gene was constitutively expressed in naive pupae and strongly up-regulated after immunization. House fly defensin is an amphiphilic peptide with a structure similar to that of the CSalphabeta scaffold of insect defensin A from the flesh fly, Phormia terraenovae Robineau-Desvoidy. To our knowledge, this is the first isolated and characterized house fly antimicrobial peptide, and our work may provide useful information for developing pharmacologically active antimicrobial agents.

  4. The relationship between morphological and behavioral mimicry in hover flies (Diptera: Syrphidae).

    PubMed

    Penney, Heather D; Hassall, Christopher; Skevington, Jeffrey H; Lamborn, Brent; Sherratt, Thomas N

    2014-02-01

    Palatable (Batesian) mimics of unprofitable models could use behavioral mimicry to compensate for the ease with which they can be visually discriminated or to augment an already close morphological resemblance. We evaluated these contrasting predictions by assaying the behavior of 57 field-caught species of mimetic hover flies (Diptera: Syrphidae) and quantifying their morphological similarity to a range of potential hymenopteran models. A purpose-built phylogeny for the hover flies was used to control for potential lack of independence due to shared evolutionary history. Those hover fly species that engage in behavioral mimicry (mock stinging, leg waving, wing wagging) were all large wasp mimics within the genera Spilomyia and Temnostoma. While the behavioral mimics assayed were good morphological mimics, not all good mimics were behavioral mimics. Therefore, while the behaviors may have evolved to augment good morphological mimicry, they do not advantage all good mimics.

  5. The Value of Patch-Choice Copying in Fruit Flies

    PubMed Central

    Golden, Shane; Dukas, Reuven

    2014-01-01

    Many animals copy the choices of others but the functional and mechanistic explanations for copying are still not fully resolved. We relied on novel behavioral protocols to quantify the value of patch-choice copying in fruit flies. In a titration experiment, we quantified how much nutritional value females were willing to trade for laying eggs on patches already occupied by larvae (social patches). Females were highly sensitive to nutritional quality, which was positively associated with their offspring success. Females, however, perceived social, low-nutrition patches (33% of the nutrients) as equally valuable as non-social, high-nutrition ones (100% of the nutrients). In follow-up experiments, we could not, however, either find informational benefits from copying others or detect what females' offspring may gain from developing with older larvae. Because patch-choice copying in fruit flies is a robust phenomenon in spite of potential costs due to competition, we suggest that it is beneficial in natural settings, where fruit flies encounter complex dynamics of microbial communities, which include, in addition to the preferred yeast species they feed on, numerous harmful fungi and bacteria. We suggest that microbial ecology underlies many cases of copying in nature. PMID:25375776

  6. Passive cellular microrheology in developing fruit fly embryos

    NASA Astrophysics Data System (ADS)

    Crews, Sarah; Ma, Xiaoyan; Lawrence, Stacey; Hutson, M. Shane

    2012-02-01

    The development of fruit fly (Drosophila) embryos involves spatial and temporal regulation of cellular mechanical properties. These properties can be probed in vivo using laser hole drilling experiments; however, this technique only infers relative forces. Conversion to absolute forces requires measurement of cellular viscoelastic properties. Here, we use passive microrheology of fluorescently labeled cell membranes to measure the viscoelastic properties of amnioserosa cells. These dynamic epithelial cells play an important mechanical role during two developmental stages: germ band retraction and dorsal closure. Passive microrheology in this system is confounded by active contractions in the cytoskeleton. Thus, the fruit fly embryos are transiently anesthetized with CO2, halting active cellular movements, leaving only passive Brownian motion. The power spectra of these fluctuations are well fit by a Lorentzian -- as expected for Brownian motion -- and allow us to extract cellular viscoelastic parameters at different developmental stages. These measured parameters inform previous hole-drilling experiments and provide inputs for quantitative computational models of fruit fly embryonic development.

  7. Sesamin extends the mean lifespan of fruit flies.

    PubMed

    Zuo, Yuanyuan; Peng, Cheng; Liang, Yintong; Ma, Ka Ying; Chan, Ho Yin Edwin; Huang, Yu; Chen, Zhen-Yu

    2013-04-01

    The present study investigated the anti-ageing activity of sesamin and its effect on gene expression of superoxide dismutase (SOD), catalase (CAT), methuselah (Mth) and Rpn11 in Drosophila melanogaster. Results demonstrated that 0.2 % sesamin in diet prolonged the mean lifespan of OR wild fruit flies by 12 %, accompanied by up-regulation of SOD1, SOD2, CAT and Rpn11. Sesamin at 0.2 % in diet also attenuated paraquat-induced neurodegeneration with up-regulation of SOD1, SOD2 and Rpn11 in OR wild fruit flies. Supplementation of 0.2 % sesamin in diet increased the survival time of OR wild type flies and Alzheimer flies Aβ42 33769 when they were challenged with paraquat. Furthermore, sesamin-induced increase in the activity and expression of antioxidant enzymes also suggests that the longevity promoting activity of sesamin are possibly due to its action as a hormetin by inducing oxidative stress response-mediated hormesis. It was concluded that sesamin extended the mean lifespan and alleviated the neurodegeneration in Drosophila melanogaster at least mediated by its interaction with genes SOD1, SOD2, CAT, and Rpn11, but not with gene Mth.

  8. Chromatic cues to trap the oriental fruit fly, Bactrocera dorsalis.

    PubMed

    Wu, Wen-Yen; Chen, Yu-Po; Yang, En-Cheng

    2007-05-01

    Various colors have been used as visual cues to trap insect pests. For example, yellow traps for monitoring and control of the oriental fruit fly (Bactrocera dorsalis) have been in use for a very long time. However, the chromatic cue of using color traps has never been meticulously investigated. In this study, the spectral sensitivities of the photoreceptors in the compound eyes of B. dorsalis were measured intracellularly, and the theory of receptor quantum catch was applied to study the chromatic cue of fly attracting. Responses to five wavelength categories with peak wavelengths of 370, 380, 490, and 510 nm, and one with dual peaks at 350 and 490 nm were recorded. Based on spectral sensitivities, six colored papers were chosen to test the color preference of the fly, and an additional UV preference test was done to confirm the effect of the UV stimuli. It was concluded that UV and green stimuli (spectra: 300-380 nm and 500-570 nm) would enhance the attractiveness of a colored paper to the oriental fruit fly, and blue stimuli (380-500 nm) would diminish the attractiveness.

  9. Analysis of the Olive Fruit Fly Bactrocera oleae Transcriptome and Phylogenetic Classification of the Major Detoxification Gene Families.

    PubMed

    Pavlidi, Nena; Dermauw, Wannes; Rombauts, Stephane; Chrysargyris, Antonios; Chrisargiris, Antonis; Van Leeuwen, Thomas; Vontas, John

    2013-01-01

    The olive fruit fly Bactrocera oleae has a unique ability to cope with olive flesh, and is the most destructive pest of olives worldwide. Its control has been largely based on the use of chemical insecticides, however, the selection of insecticide resistance against several insecticides has evolved. The study of detoxification mechanisms, which allow the olive fruit fly to defend against insecticides, and/or phytotoxins possibly present in the mesocarp, has been hampered by the lack of genomic information in this species. In the NCBI database less than 1,000 nucleotide sequences have been deposited, with less than 10 detoxification gene homologues in total. We used 454 pyrosequencing to produce, for the first time, a large transcriptome dataset for B. oleae. A total of 482,790 reads were assembled into 14,204 contigs. More than 60% of those contigs (8,630) were larger than 500 base pairs, and almost half of them matched with genes of the order of the Diptera. Analysis of the Gene Ontology (GO) distribution of unique contigs, suggests that, compared to other insects, the assembly is broadly representative for the B. oleae transcriptome. Furthermore, the transcriptome was found to contain 55 P450, 43 GST-, 15 CCE- and 18 ABC transporter-genes. Several of those detoxification genes, may putatively be involved in the ability of the olive fruit fly to deal with xenobiotics, such as plant phytotoxins and insecticides. In summary, our study has generated new data and genomic resources, which will substantially facilitate molecular studies in B. oleae, including elucidation of detoxification mechanisms of xenobiotic, as well as other important aspects of olive fruit fly biology.

  10. Feasibility study of utilizing simplified near infrared imaging for detecting fruit fly larvae in intact fruit

    USDA-ARS?s Scientific Manuscript database

    Following the previous research to classify intact mangoes infested with oriental fruit fly from the control ones using near infrared (NIR) spectra acquired by a spot-type handheld NIR instrument, an attempt to improve the sensitivity of the system by employing NIR imaging technology was conducted. ...

  11. First report of Zaprionus indianus (Diptera: Drosophilidae) in commercial fruits and vegetables in Pennsylvania.

    PubMed

    Joshi, Neelendra K; Biddinger, David J; Demchak, Kathleen; Deppen, Alan

    2014-01-01

    Zaprionus indianus (Gupta) (Diptera: Drosophilidae), an invasive vinegar fly, was found for the first time in Adams County, Pennsylvania, in 2011. It was found in a commercial tart cherry orchard using apple cider vinegar (ACV) traps that were monitoring another invasive vinegar fly, the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). Coincidentally, the first record of D. suzukii found in Pennsylvania was also found in this same cherry orchard only 3 months earlier as part of a spotted wing drosophila survey effort in raspberry, blackberry, grape, and tart cherry in Adams County. These same crops plus blueberry and tomato were monitored again in 2012. In this article, adult Z. indianus captures in ACV traps and other traps deployed in the aforementioned crops during 2012 season are presented and the economic importance of Z. indianus is discussed.

  12. First Report of Zaprionus indianus (Diptera: Drosophilidae) in Commercial Fruits and Vegetables in Pennsylvania

    PubMed Central

    Joshi, Neelendra K.; Biddinger, David J.; Demchak, Kathleen; Deppen, Alan

    2014-01-01

    Zaprionus indianus (Gupta) (Diptera: Drosophilidae), an invasive vinegar fly, was found for the first time in Adams County, Pennsylvania, in 2011. It was found in a commercial tart cherry orchard using apple cider vinegar (ACV) traps that were monitoring another invasive vinegar fly, the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). Coincidentally, the first record of D. suzukii found in Pennsylvania was also found in this same cherry orchard only 3 months earlier as part of a spotted wing drosophila survey effort in raspberry, blackberry, grape, and tart cherry in Adams County. These same crops plus blueberry and tomato were monitored again in 2012. In this article, adult Z. indianus captures in ACV traps and other traps deployed in the aforementioned crops during 2012 season are presented and the economic importance of Z. indianus is discussed. PMID:25434039

  13. Assessing Insecticide Susceptibility of Laboratory Lutzomyia longipalpis and Phlebotomus papatasi Sand Flies (Diptera: Psychodidae: Phlebotominae)

    PubMed Central

    Denlinger, David S.; Lozano-Fuentes, Saul; Lawyer, Phillip G.; Black, William C.; Bernhardt, Scott A.

    2015-01-01

    Chemical insecticides are effective for controlling Lutzomyia and Phlebotomus sand fly (Diptera: Psychodidae) vectors of Leishmania parasites. However, repeated use of certain insecticides has led to tolerance and resistance. The objective of this study was to determine lethal concentrations (LCs) and lethal exposure times (LTs) to assess levels of susceptibility of laboratory Lutzomyia longipalpis (Lutz and Nieva) and Phlebotomus papatasi (Scopoli) to 10 insecticides using a modified version of the World Health Organization (WHO) exposure kit assay and Centers for Disease Control and Prevention (CDC) bottle bioassay. Sand flies were exposed to insecticides coated on the interior of 0.5-gallon and 1,000-ml glass bottles. Following exposure, the flies were allowed to recover for 24 h, after which mortality was recorded. From dose–response survival curves for L. longipalpis and P. papatasi generated with the QCal software, LCs causing 50, 90, and 95% mortality were determined for each insecticide. The LCs and LTs from this study will be useful as baseline reference points for future studies using the CDC bottle bioassays to assess insecticide susceptibility of sand fly populations in the field. There is a need for a larger repository of sand fly insecticide susceptibility data from the CDC bottle bioassays, including a range of LCs and LTs for more sand fly species with more insecticides. Such a repository would be a valuable tool for vector management. PMID:26336231

  14. Environmental factors affecting early carcass attendance by four species of blow flies (Diptera: Calliphoridae) in Texas.

    PubMed

    Mohr, Rachel M; Tomberlin, Jeffery K

    2014-05-01

    As the most common primary colonizer of carrion, adult blow flies (Diptera: Calliphoridae) play an important role in initiating arthropod-mediated breakdown of soft tissue; however, their timing is highly variable. This variability complicates the estimation of precolonization intervals or periods of insect activity by forensic entomologists. In this study, the size of the adult blow fly on swine carcasses was compared with various environmental conditions including time of day, temperature, wind speed, and light levels. Four trials were conducted: two in August and September 2008, one in January 2009, and one in February-March 2010. Of the measured variables, time of day was the only consistent factor explaining the population size of blow fly on a carcass, although precipitation and high winds affected winter-active Calliphora vicina Robineau-Desvoidy. Male flies were also collected, suggesting that carcasses may play additional roles in adult blow fly ecology beyond that of a simple oviposition site. For both sexes of flies, a strong diel pattern of behavior emerged, which could be useful in estimating precolonization intervals by considering the environmental conditions at a scene, and thus forensic entomologists may be better able to estimate the likelihood of adult activity at a carcass.

  15. Comparison of Rain-Fast Bait Stations Versus Foliar Bait Sprays for Control of Oriental Fruit Fly, Bactrocera dorsalis, in Papaya Orchards in Hawaii

    PubMed Central

    Piñero, Jaime C.; Mau, Ronald F. L.; Vargas, Roger I.

    2010-01-01

    Bait stations represent an environmentally friendly attract-and-kill approach to fruit fly population suppression. Recently a novel, visually attractive, rain-fast bait station was developed in Hawaii for potential use against multiple species of pestiferous fruit flies. Here, we compared the efficacy of GF-120 NF Naturalyte Fruit Fly Bait applied either as foliar sprays or onto bait stations in reducing female oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), population density and level of fruit infestation in commercial papaya orchards in Hawaii. Trapping and infestation data were used as indicators of the effectiveness of the two bait application methods. For the first 10 weeks of the study, captures of female B. dorsalis in monitoring traps were significantly greater in control plots than in plots treated with foliar sprays or bait stations. Six weeks after the first bait spray, incidence of infestation (i.e. number of fruit with one or more B. dorsalis larvae) of quarter to half-ripe papaya fruit was reduced by 71.4% and 63.1% for plots with bait stations and foliar sprays, respectively, as compared to control plots. Twelve weeks after first spray, incidence of infestation was reduced by only 54.5% and 45.4% for plots with bait stations and foliar sprays, respectively, as compared to control plots. About 42% less GF-120 was used in orchard plots with bait stations compared to those subject to foliar sprays. The impact of field sanitation on the outcome is also discussed. The results indicate that bait stations can provide a simple, efficient, and economical method of applying insecticidal baits to control fruit flies and a safer alternative to foliar sprays. PMID:21067423

  16. A new species, new immature stages, and new synonymy in Australian Dasybasis flies (Diptera: Tabanidae: Diachlorini).

    PubMed

    Ferguson, David J; Yeates, David K

    2015-04-09

    Australian beach sand is a productive habitat for lower brachyceran fly larvae but often overlooked by collectors. We collected two species of tabanid larvae from coastal beach sand in southern New South Wales in August 2013. Both species belong to the Dasybasis macrophthalma species-group of Mackerras (1959), one a new species, and the other D. exulans (Erichson, 1842). We describe both new immature stages and the new species adult as Dasybasis rieki sp. nov. (Diptera: Tabanidae: Diachlorini). Trojan (1994b) elevated the D. macrophthalma species group to the genus Sznablius. We review the evidence for the generic status of Sznablius, and synonymize it with Dasybasis.

  17. Selected Insecticide Delivery Devices for Management of Horn Flies (Haematobia irritans) (Diptera: Muscidae) on Beef Cattle.

    PubMed

    Swiger, Sonja Lise; Payne, Richard D

    2017-01-01

    The horn fly, Haematobia irritans (L.) (Diptera: Muscidae), is one of the most important pests of the beef cattle industry. Horn fly adults are blood feeders that remain in constant contact with cattle, providing management opportunities via insecticide-impregnated ear tags. Controlling horn flies in the United States is time consuming and costly, but failure to implement management can lead to weight loss and decreased weight gain of calves and yearlings. In the past decade, new chemical combinations have been impregnated into ear tags for pest management. The objectives of this project were to 1) evaluate the efficacy of ear tags against horn fly populations and 2) determine if reduced fly density results in economic return. During 2013, data were compiled by insecticide class; treated cows averaged fly reductions of 198 (s = 38.91; n = 3) for macrocyclic lactone treatments, 175 (s = 62.74; n = 4) for pyrethroid treatments, and 174 (s = 35.28; n = 8) for organophosphate treatments compared with untreated animals (214; s = 50.38; n = 9). During 2014, mean fly reductions were 187 (s = 14.15; n = 4) for macrocyclic lactone, 147 (s = 61.41; n = 13) for pyrethroid, and 143 (s = 77.16; n = 8) for organophosphate treatments relative to the untreated (200; s = 99.83; n = 14). A novel technology, the VetGun application system, tested in 2014, resulted in fly reductions (121 ±, n = 4), but means were not statistically significant from the control (200; s = 99.83; n = 14). Treatment of cattle with ear tags significantly reduced horn fly numbers compared with untreated cattle.

  18. Survival and fate of Salmonella enterica serovar Montevideo in adult horn flies (Diptera: Muscidae).

    PubMed

    Olafson, Pia Untalan; Lohmeyer, Kimberly H; Edrington, Thomas S; Loneragan, Guy H

    2014-09-01

    Contamination of cattle peripheral lymph nodes with Salmonella enterica is proposed to occur via a transdermal route of entry. If so, bacteria may be introduced to cattle by biting arthropods. Biting flies, such as horn flies (Haematobia irritans irritans (L.)) (Diptera: Muscidae), are intriguing candidates for transmitting Salmonella to cattle because they provide a route of entry when they breach the skin barrier during blood feeding. Using a green fluorescent protein-expressing strain of Salmonella Montevideo (S. Montevideo-GFP), the current study demonstrated that horn fly grooming subsequent to tactile exposure to the bacteria resulted in acquisition of the bacteria on mouthparts as well as microbial ingestion. Consumption of a bloodmeal containing approximately 10(2), approximately 10(4), or 10(6) S. Montevideo-GFP resulted in horn fly colonization for up to 72 h postingestion (PI). Epifluorescent microscopy indicated that the bacteria were not localized to the crop but were observed within the endoperitrophic space, suggesting that regurgitation is not a primary route of transmission. S. Montevideo-GFP were cultured from excreta of 100% of flies beginning 6-7 h PI of a medium or high dose meal and > 12 h PI in excreta from 60% of flies fed the low-dose meal. Animal hides and manure pats are sources for horn flies to acquire the Salmonella and mechanically transmit them to an animal while feeding. Mean quantities of 5.65-67.5 x 10(2) CFU per fly were cultured from fly excreta passed within 1 d after feeding, suggesting the excreta can provide an additional microbial source on the animal's hide.

  19. Flesh flies (Diptera: Sarcophagidae) colonising large carcasses in Central Europe.

    PubMed

    Szpila, Krzysztof; Mądra, Anna; Jarmusz, Mateusz; Matuszewski, Szymon

    2015-06-01

    Sarcophagidae are an important element of carrion insect community. Unfortunately, results on larval and adult Sarcophagidae from forensic carrion studies are virtually absent mostly due to the taxonomic problems with species identification of females and larvae. The impact of this taxon on decomposition of large carrion has not been reliably evaluated. During several pig carcass studies in Poland, large body of data on adult and larval Sarcophagidae was collected. We determined (1) assemblages of adult flesh flies visiting pig carrion in various habitats, (2) species of flesh flies which breed in pig carcasses, and (3) temporal distribution of flesh fly larvae during decomposition. Due to species identification of complete material, including larvae, females, and males, it was possible for the first time to reliably answer several questions related to the role of Sarcophagidae in decomposition of large carrion and hence define their forensic importance. Fifteen species of flesh flies were found to visit pig carcasses, with higher diversity and abundance in grasslands as compared to forests. Sex ratio biased towards females was observed only for Sarcophaga argyrostoma, S. caerulescens, S. similis and S. carnaria species group. Gravid females and larvae were collected only in the case of S. argyrostoma, S. caerulescens, S. melanura and S. similis. Sarcophaga caerulescens and S. similis bred regularly in carcasses, while S. argyrostoma was recorded only occasionally. First instar larvae of flesh flies were recorded on carrion earlier or concurrently with first instar larvae of blowflies. Third instar larvae of S. caerulescens were usually observed before the appearance of the third instar blowfly larvae. These results contest the view that flesh flies colonise carcasses later than blowflies. Sarcophaga caerulescens is designated as a good candidate for a broad forensic use in Central European cases.

  20. Drosophila melanogaster (fruit fly) locomotion during a sounding rocket flight

    NASA Astrophysics Data System (ADS)

    Miller, Mark S.; Keller, Tony S.

    2008-05-01

    The locomotor activity of young Drosophila melanogaster (fruit fly) was studied during a Nike-Orion sounding rocket flight, which included a short-duration microgravity exposure. An infrared monitoring system was used to determine the activity level, instantaneous velocity, and continuous velocity of 240 (120 male, 120 female) fruit flies. Individual flies were placed in chambers that limit their motion to walking. Chambers were oriented both vertically and horizontally with respect to the rocket's longitudinal axis. Significant changes in Drosophila locomotion patterns were observed throughout the sounding rocket flight, including launch, microgravity exposure, payload re-entry, and after ocean impact. During the microgravity portion of the flight (3.8 min), large increases in all locomotion measurements for both sexes were observed, with some measurements doubling compared to pad (1 G) data. Initial effects of microgravity were probably delayed due to large accelerations from the payload despining immediately before entering microgravity. The results indicate that short-duration microgravity exposure has a large effect on locomotor activity for both males and females, at least for a short period of time. The locomotion increases may explain the increased male aging observed during long-duration exposure to microgravity. Studies focusing on long-duration microgravity exposure are needed to confirm these findings, and the relationship of increased aging and locomotion.

  1. NEW RECORDS OF PHLEBOTOMINE SAND FLIES (DIPTERA: PSYCHODIDAE) FROM ECUADOR.

    PubMed

    Jones, Lynn A; Cohnstaedt, Lee W; Beati, Lorenza; Terán, Rommy; León, Renato; Munstermann, Leonard E

    2010-01-01

    The number of recorded phlebotomine sand fly species in Ecuador has nearly doubled during the past 20 years as a result of surveys. In 2005, a sand fly survey of two localities, Tiputini in the Amazon rain forest and Paraiso Escondido in the Pacific coastal lowland forest, resulted in the capture of 25 species. New records for Ecuador consisted of five species from the Amazonian region and one from Paraiso Escondido. The Amazonian species were Nyssomyia richardwardi (Ready and Fraiha), Psathyromyia dreisbachi (Causey and Damasceno), Psathyromyia runoides (Fairchild and Hertig), Trichophoromyia pabloi (Barretto, Burbano and Young), and Trichopygomyia witoto (Young and Morales). The Pacific coastal lowland species was Psathyromyia punctigeniculata (Floch and Abonnenc).

  2. Antocha crane flies from Taiwan (Diptera: Limoniidae: Limoniinae).

    PubMed

    Podenas, Sigitas; Young, Chen W

    2015-11-27

    Taiwanese species of the crane fly subgenus Antocha (Antocha) Osten Sacken, 1860, are reviewed. Antocha (Antocha) taiwanensis, new species, is described and figured. Previously known species, Antocha (A.) bifida Alexander, 1924a and Antocha (A.) styx Alexander, 1930 are redescribed and illustrated. Antocha (A.) javanensis Alexander, 1915 is removed from the list of Taiwanese crane flies. Antocha (A.) gracillima Alexander, 1924b and species close to Antocha (A.) streptocera Alexander, 1949 are listed for the first time in Taiwan. Identification key for all Taiwanese Antocha species is given.

  3. Laboratory colonization of the blow flies, Chrysomya megacephala (Diptera: Calliphoridae) and Chrysomya rufifacies (Diptera: Calliphoridae)

    USDA-ARS?s Scientific Manuscript database

    Chrysomya rufifacies is a blow fly commonly found in corpses at crime scene investigations. This study was designed to develop laboratory colonization methods for Ch. rufifacies and utilize Chrysomya megacephala as its larval food source. Both fly species were collected in the wild and easily colon...

  4. New records for the horse fly fauna (Diptera: Tabanidae) of Jordan with remarks on ecology and zoogeography.

    USDA-ARS?s Scientific Manuscript database

    The horse fly fauna (Diptera: Tabanidae) of Jordan is the richest in the Levant, with 24 known species. During the 20-year project “the ecology and zoogeography of the Lepidoptera of the Near East,” USDA, Agricultural Research Service scientists in Gainesville, FL and Israeli scientists regularly c...

  5. Toxicity of fruit fly baits to beneficial insects in citrus.

    PubMed Central

    Michaud, J.P.

    2003-01-01

    Two fruit fly baits, Nu-Lure®/malathion and GF-120 (Spinosad®) were evaluated in the laboratory for non-target impacts on beneficial insects. Nu-Lure/malathion proved attractive and toxic to adults and larvae of the coccinellid species, Curinus coeruleus Mulsant, Cycloneda sanguinea L. and Harmonia axyridis Pallas, a lacewing species, Chrysoperla rufilabris Burmeister. The coccinellids Olla v-nigrum Mulsant, Scymnus sp. and nymphs of the insidious flower bug, Orius insidiosus (Say) did not succumb to Nu-Lure baits, even in no-choice situations. Nu-Lure was also attractive and lethal to adults of two aphidophagous flies; Leucopis sp. and the syrphid fly Pseudodorus clavatus (F.). Both Nu-Lure and GF-120 caused significant mortality to the parasitoid wasps, Aphytis melinus De Bach and Lysiphlebus testaceipes Cresson, within 24 h of exposure. However, GF-120 caused no significant mortality to any coccinellid in either choice or no-choice situations, despite considerable consumption of baits. Adults of P. clavatus tended to avoid GF-120, although mortality was significant in no-choice tests. Although larvae and adults of the lacewing C. rufilabris consumed GF-120, mortality was delayed; adults died 48 -96 h post-exposure and those exposed as larvae died two weeks later in the pupal stage. The Nu-Lure bait did not appear palatable to any of the insects, but the high concentration of malathion (195,000 ppm) caused rapid mortality to susceptible insects. Nu-Lure bait without malathion also caused significant mortality to flies and lacewings in cage trials. Although GF-120 bait appeared more benign overall, further research efforts are warranted to increase its selectivity for target fly species and reduce its attractiveness to parasitoids and lacewings. I conclude that the Florida “fly free zone” protocol in its current form is not compatible with an IPM approach to commercial citrus production. PMID:15841224

  6. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    PubMed

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  7. External morphology of stable fly (Diptera: Muscidae) larvae

    USDA-ARS?s Scientific Manuscript database

    Scanning electron microscopy was used to examine the external morphology of first-, second-, and third-instar stable flies (Stomoxys calcitrans (L.)). In the cephalic region, the antennae, labial lobe, and maxillary palpi are morphologically similar among instars. Antennae comprise a prominent ante...

  8. The horse and deer flies (Diptera: Tabanidae) of Rhode Island

    USGS Publications Warehouse

    Bartlett, K.; Alm, S.R.; LeBrun, R.; Ginsberg, H.

    2002-01-01

    The Tabanidae of Rhode Island were surveyed using Rhode Island canopy traps placed at 20 locations in the state during the summers of 1999 and 2000. In total, 5,120 flies were collected, which included 55 species in the genera Chrysops, Hybomitra, Tabanus, Merycomyia, and Stonemyia. Distributional and ecological information is provided for each species in Rhode Island.

  9. Phonotactic flight of the parasitoid fly Emblemasoma auditrix (Diptera: Sarcophagidae).

    PubMed

    Tron, Nanina; Lakes-Harlan, Reinhard

    2017-01-01

    The parasitoid fly Emblemasoma auditrix locates its hosts using acoustic cues from sound producing males of the cicada Okanagana rimosa. Here, we experimentally analysed the flight path of the phonotaxis from a landmark to the target, a hidden loudspeaker in the field. During flight, the fly showed only small lateral deviations. The vertical flight direction angles were initially negative (directed downwards relative to starting position), grew positive (directed upwards) in the second half of the flight, and finally flattened (directed horizontally or slightly upwards), typically resulting in a landing above the loudspeaker. This phonotactic flight pattern was largely independent from sound pressure level or target distance, but depended on the elevation of the sound source. The flight velocity was partially influenced by sound pressure level and distance, but also by elevation. The more elevated the target, the lower was the speed. The accuracy of flight increased with elevation of the target as well as the landing precision. The minimal vertical angle difference eliciting differences in behaviour was 10°. By changing the elevation of the acoustic target after take-off, we showed that the fly is able to orientate acoustically while flying.

  10. Effects of antinutrient proteins on Hessian fly (Diptera: Cecidomyiidae) larvae

    USDA-ARS?s Scientific Manuscript database

    One strategy to enhance the durability of Hessian fly resistance (R) genes in wheat is to combine them with transgenes for resistance. To identify potential transgenes for resistance a protocol for rapidly screening the proteins they encode for efficacy toward resistance is required. However, the ...

  11. Visual responses of corn silk flies (Diptera: Ulidiidae)

    USDA-ARS?s Scientific Manuscript database

    Corn silk flies are major pests impacting fresh market sweet corn production in Florida and Georgia. Control depends solely on well-times applications of insecticides to protect corn ear development. Surveillance depends on visual inspection of ears with no effective trapping methods currently ava...

  12. Distribution of sand fly (Diptera: Psychodidae) species and efficiency of capturing methods in Sanliurfa province, Turkey.

    PubMed

    Toprak, Sahin; Ozer, Nurdan

    2007-01-01

    The population dynamics of sand flies (Diptera: Psychodidae) were studied in Sanliurfa province in southeastern Turkey, in the country's largest focus of typical anthroponotic cutaneous leishmaniasis, during 2000-2002. Sand flies were collected at nine different sampling stations, located throughout the city, representing a cross section of urban and rural habitats. In total, 29,771 sand flies were collected, 45.35% of which were Phlebotomus papatasi Scopoli. In this study, the overall sand fly species diversity, relative abundance of each species, biodiversity, and similarity indices among sampling stations and efficiency of trapping methods were evaluated. Among the sampling stations, Sanliurfa city center and Suruç were shown to have the highest number of sand fly species; Harran-Akcakale and Hilvan habitats produced the largest number of individuals. The greatest similarity rates (80%) in terms of sand fly species were observed between Hilvan and city center, Harran-Akcakale and city center, Harran-Akcakale and Yenice, and Siverek and Viransehir. The lowest similarity rate (16%) was observed between Bozova-Birecik and city center. Comparison of biodiversity and similarity indices between the various sampling stations reveals the distribution of the suspected vector species and provides basic knowledge required to develop logical and effective control strategies. Among the trapping methods used, light traps showed the highest capture efficiency, above aspirators and sticky papers. It was concluded that light traps alone were sufficient to determine the sand fly fauna of the study area. It is recommended that the spatial and temporal dynamics of sand fly populations be monitored throughout the southeastern Anatolia Project (GAP) construction period, considering the potential impact the project may have on mean temperature, humidity, and human population movements.

  13. Parasites of parasites of bats: Laboulbeniales (Fungi: Ascomycota) on bat flies (Diptera: Nycteribiidae) in central Europe.

    PubMed

    Haelewaters, Danny; Pfliegler, Walter P; Szentiványi, Tamara; Földvári, Mihály; Sándor, Attila D; Barti, Levente; Camacho, Jasmin J; Gort, Gerrit; Estók, Péter; Hiller, Thomas; Dick, Carl W; Pfister, Donald H

    2017-02-21

    Bat flies (Streblidae and Nycteribiidae) are among the most specialized families of the order Diptera. Members of these two related families have an obligate ectoparasitic lifestyle on bats, and they are known disease vectors for their hosts. However, bat flies have their own ectoparasites: fungi of the order Laboulbeniales. In Europe, members of the Nycteribiidae are parasitized by four species belonging to the genus Arthrorhynchus. We carried out a systematic survey of the distribution and fungus-bat fly associations of the genus in central Europe (Hungary, Romania). We encountered the bat fly Nycteribia pedicularia and the fungus Arthrorhynchus eucampsipodae as new country records for Hungary. The following bat-bat fly associations are for the first time reported: Nycteribia kolenatii on Miniopterus schreibersii, Myotis blythii, Myotis capaccinii and Rhinolophus ferrumequinum; Penicillidia conspicua on Myotis daubentonii; and Phthiridium biarticulatum on Myotis capaccinii. Laboulbeniales infections were found on 45 of 1,494 screened bat flies (3.0%). We report two fungal species: Arthrorhynchus eucampsipodae on Nycteribia schmidlii, and A. nycteribiae on N. schmidlii, Penicillidia conspicua, and P. dufourii. Penicillidia conspicua was infected with Laboulbeniales most frequently (25%, n = 152), followed by N. schmidlii (3.1%, n = 159) and P. dufourii (2.0%, n = 102). Laboulbeniales seem to prefer female bat fly hosts to males. We think this might be due to a combination of factors: female bat flies have a longer life span, while during pregnancy female bat flies are significantly larger than males and accumulate an excess of fat reserves. Finally, ribosomal DNA sequences for A. nycteribiae are presented. We screened ectoparasitic bat flies from Hungary and Romania for the presence of ectoparasitic Laboulbeniales fungi. Arthrorhynchus eucampsipodae and A. nycteribiae were found on three species of bat flies. This study extends geographical and host

  14. Anthropic effects on sand fly (Diptera: Psychodidae) abundance and diversity in an Amazonian rural settlement, Brazil.

    PubMed

    Ramos, Walkyria Rodrigues; Medeiros, Jansen Fernandes; Julião, Genimar Rebouças; Ríos-Velásquez, Claudia María; Marialva, Eric Fabrício; Desmouliére, Sylvain J M; Luz, Sérgio Luiz Bessa; Pessoa, Felipe Arley Costa

    2014-11-01

    Sand flies (Diptera: Psychodidae) are responsible for the transmission of protozoan parasites that cause leishmaniases. They are found predominantly in forests, but some species exploit environments that have been subject to deforestation and subsequent human colonization. Studies conducted in Brazil over the past 30 years show that some species are adapting to peri-urban and urban settings. We evaluated sand fly diversity and abundance in the rural settlement of Rio Pardo, Presidente Figueiredo Municipality, Amazonas State, Brazil. Settlement households were divided into four categories. These categories were determined by the human population density and the degree of deforestation in the immediate area. We used CDC light traps to sample the area surrounding 24 households (6 households in each category). Samples were taken on six occasions during September-November 2009 and June-August 2010. A total of 3074 sand fly specimens were collected, including 1163 females and 1911 males. These were classified into 13 genera and 52 species. The greatest abundance of sand flies and the greatest richness of species were observed in areas where human population density was highest. Our results show that changes in the human occupancy and vegetation management in rural settlements may affect the population dynamics and distribution of sand fly species, thereby affecting the local transmission of cutaneous leishmaniases.

  15. The black flies (Diptera: Simuliidae) from Thua Thien Hue and Lam Dong Provinces, Vietnam.

    PubMed

    Takaoka, Hiroyuki; Sofian-Azirun, Mohd; Ya'cob, Zubaidah; Chen, Chee Dhang; Lau, Koon Weng; Pham, Xuan Da

    2015-05-21

    Surveys of pupae and larvae of black flies (Diptera: Simuliidae) were carried out in Thua Thien Hue Province of central Vietnam, and Lam Dong Province of southern Vietnam in 2014. A total of 26 species belonging to the genus Simulium were collected, consisting of eight known species, one newly recorded species, and 17 new species (of which three species of the subgenus Nevermannia were described in 2014). The remaining 14 new species (nine of the subgenus Gomphostilbia and five of the subgenus Simulium) are described here based on females, males, pupae and mature larvae. The total number of species of black flies in Vietnam is now 46. Keys to identify all 26 species recorded from the two provinces of Vietnam are given for females, males, pupae and mature larvae.

  16. Light, heat, action: neural control of fruit fly behaviour

    PubMed Central

    Owald, David; Lin, Suewei; Waddell, Scott

    2015-01-01

    The fruit fly Drosophila melanogaster has emerged as a popular model to investigate fundamental principles of neural circuit operation. The sophisticated genetics and small brain permit a cellular resolution understanding of innate and learned behavioural processes. Relatively recent genetic and technical advances provide the means to specifically and reproducibly manipulate the function of many fly neurons with temporal resolution. The same cellular precision can also be exploited to express genetically encoded reporters of neural activity and cell-signalling pathways. Combining these approaches in living behaving animals has great potential to generate a holistic view of behavioural control that transcends the usual molecular, cellular and systems boundaries. In this review, we discuss these approaches with particular emphasis on the pioneering studies and those involving learning and memory. PMID:26240426

  17. Evolution of olfactory receptor in oriental fruit fly Dacus dorsalis

    PubMed Central

    Metcalf, Robert L.; Metcalf, Esther R.; Mitchell, W. C.; Lee, Lena W. Y.

    1979-01-01

    Male oriental fruit flies (Dacus dorsalis) from colonies in Taiwan and Hawaii were evaluated for limit of response to various analogues of methyl eugenol. The results are interpreted in terms of the geometry and allosteric requirements of the antennal receptor that triggers the characteristic methyl eugenol reflex. This receptor has evolved for complementarity to all portions of the methyl eugenol molecule and responds only to ortho-substituted benzenes with adjacent oxygen atoms or isoelectronic equivalents. Substantial differences in responses of Taiwan and Hawaiian D. dorsalis suggest that perceptible evolution of the receptor protein has occurred during the past 50 years. A plausible scheme for the coevolution of dacini flies with plants containing phenylpropionoid essential oils is outlined. Images PMID:16592640

  18. Synergistic Trap Response of the False Stable Fly and Little House Fly (Diptera: Muscidae) to Acetic Acid and Ethanol, Two Principal Sugar Fermentation Volatiles.

    PubMed

    Landolt, Peter J; Cha, Dong H; Zack, Richard S

    2015-10-01

    In an initial observation, large numbers of muscoid flies (Diptera) were captured as nontarget insects in traps baited with solutions of acetic acid plus ethanol. In subsequent field experiments, numbers of false stable fly Muscina stabulans (Fallén) and little house fly Fannia canicularis (L.) trapped with the combination of acetic acid plus ethanol were significantly higher than those trapped with either chemical alone, or in unbaited traps. Flies were trapped with acetic acid and ethanol that had been formulated in the water of the drowning solution of the trap, or dispensed from polypropylene vials with holes in the vial lids for diffusion of evaporated chemical. Numbers of both species of fly captured were greater with acetic acid and ethanol in glass McPhail traps, compared to four other similar wet trap designs. This combination of chemicals may be useful as an inexpensive and not unpleasant lure for monitoring or removing these two pest fly species.

  19. BdorOBP83a-2 Mediates Responses of the Oriental Fruit Fly to Semiochemicals

    PubMed Central

    Wu, Zhongzhen; Lin, Jintian; Zhang, He; Zeng, Xinnian

    2016-01-01

    The oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae), is one of the most destructive pests throughout tropical and subtropical regions in Asia. This insect displays remarkable changes during different developmental phases in olfactory behavior between sexually immature and mated adults. The olfactory behavioral changes provide clues to examine physiological and molecular bases of olfactory perception in this insect. We comparatively analyzed behavioral and neuronal responses of B. dorsalis adults to attractant semiochemicals, and the expression profiles of antenna chemosensory genes. We found that some odorant-binding proteins (OBPs) were upregulated in mated adults in association with their behavioral and neuronal responses. Ligand-binding assays further showed that one of OBP83a orthologs, BdorOBP83a-2, binds with high affinity to attractant semiochemicals. Functional analyses confirmed that the reduction in BdorOBP83a-2 transcript abundance led to a decrease in neuronal and behavioral responses to selected attractants. This study suggests that BdorOBP83a-2 mediates behavioral responses to attractant semiochemicals and could be a potential efficient target for pest control. PMID:27761116

  20. Resolution of inter and intra-species relationships of the West Indian fruit fly Anastrepha obliqua.

    PubMed

    Scally, M; Into, F; Thomas, D B; Ruiz-Arce, R; Barr, N B; Schuenzel, E L

    2016-08-01

    The West Indian fruit fly, Anastrepha obliqua (Diptera: Tephritidae), is an economically important pest that inhabits areas of South and Central America, Mexico and the Caribbean with occasional infestations in the southern United States. We examine intra-specific relationships within A. obliqua as well as interspecific relationships to other Anastrepha species using a multi-locus data set comprising nine loci (seven nuclear, two mitochondrial) with 105 operational taxonomic units. The results based on a concatenated set of nuclear loci strongly support the monophyly of A. obliqua and most of the other species previously identified by morphology. A split between Peruvian A. obliqua samples and those from other locations was also identified. These results contrast with prior findings of relationships within A. obliqua based on mitochondrial data, as we found a marked discrepancy between nuclear and mitochondrial loci. These analyses suggest that introgression, particularly between A. obliqua and fraterculus species, may be one explanation for the discrepancy and the high mitochondrial diversity reported for A. obliqua could be the result of incomplete lineage sorting. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Epithelial self-organization in fruit fly embryogenesis

    NASA Astrophysics Data System (ADS)

    Hutson, M. Shane

    2010-03-01

    During fruit fly embryogenesis, there are several morphogenetic events in which sheets of epithelial cells expand, contract and bend due to coordinated intra- and intercellular forces. This tissue-level reshaping is accompanied by changes in the shape and arrangement of individual cells -- changes that can be measured quantitatively and dynamically using modern live-cell imaging techniques. Such data sets represent rich targets for computational modeling of self-organization; however, reproducing the observed cell- and tissue-level reshaping is not enough. The inverse problem of using cell shape changes to determine cell-level forces is ill-posed -- yielding non-unique solutions that cannot discriminate between active changes in cell shape and passive deformation. These non-unique solutions can be tested experimentally using in vivo laser-microsurgery -- i.e., cutting a targeted region of an epithelium and carefully tracking the temporal and spatial dependence of the subsequent strain relaxation. This technique uses a variety of incisions (hole, line or closed curve) to probe different aspects of epithelial mechanics: the local mesoscopic strain; the distribution of intracellular forces; changes in the cell-level power-law rheology; and the question of active versus passive deformation. I will discuss my group's work using laser-microsurgery to investigate two morphogenetic events in fruit fly embryogenesis: germband retraction and dorsal closure. In both cases, we find a substantial active mechanical role for the amnioserosa -- an epithelium that undergoes apoptosis near the end of embryogenesis and makes no part of the fly larva -- in reshaping an adjacent epithelium that becomes the larval epidermis. In these examples, self-organization of the fly embryo relies not only on self-organization of individual tissues, but also on the mechanical interactions between tissues.

  2. Effect of Simulated Dasiops inedulis (Diptera: Lonchaeidae) Injury on Yield and Fruit Quality Parameters in Yellow Passionfruit.

    PubMed

    Salamanca, Leidy; Manzano, Maria R; Baena, Diosdado; Tovar, Diego; Wyckhuys, Kris A G

    2015-02-01

    Yellow passionfruit (Passiflora edulis f. flavicarpa O. Deg.) is a tropical fruit crop that is meeting increasing demand both in local and international markets in South America. The lance fly, Dasiops inedulis (Diptera: Lonchaeidae), affects P. edulis floral buds and flowers, and is thought to cause important yield losses in this crop. In Colombia, D. inedulis are commonly controlled through calendar-based applications of chemically synthesized insecticides, and no scientific criteria exist to guide pest management. In the present study, we simulated D. inedulis injury to passionfruit plants, over the course of three production cycles. We assessed the effect of seven different categories of flower bud removal (from 0% to 79.9%) on passionfruit yield and fruit quality parameters. Removal rates above 20% caused a significant reduction in the number of flowers, while yield levels were lowest at 50-79.9% bud removal. With increasing rates of flower bud removal, we observed higher initial production of buds and lower levels of natural abortion of floral and fruiting structures. For the three consecutive harvests, maximum yield levels were 7.57±5.51 kg (mean±SD; with 0-9.9% damage), and minimum yield was 2.37±2.15 kg (60-69.9% damage) per plant. For fruit quality parameters, D. inedulis injury did not affect fruit pulp weight or the content of soluble solids (Brix). Our work provides insights into the impact of D. inedulis on yellow passionfruit production, and constitutes a basis for future integrated pest management programs for this pest. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Evaluation of imported parasitoid fitness for biocontrol of olive fruit fly in California olives

    USDA-ARS?s Scientific Manuscript database

    A parasitoid, Psyttalia humilis (Silvestri), was reared on irradiated Mediterranean fruit fly (Medfly), Ceratitis capitata (Weidemann), at the USDA, APHIS, PPQ, Moscamed biological control laboratory in San Miguel Petapa, Guatemala, and imported into California for biological control of olive fruit ...

  4. Pseudacteon calderensis, a new fly species (Diptera:Phoridae) attacking the fire ant Solenopsis interrupta (Hymenoptera:Formicidae) in northwestern Argentina

    USDA-ARS?s Scientific Manuscript database

    A new species of Pseudacteon phorid fly Pseudacteon calderis (Diptera: Phoridae) is described from females attacking worker ants of Solenopsis interrupta Santschi in Salta and Jujuy provinces, northwestern Argentina. Pseudacteon calderis differs from almost all other South American Pseudacteon speci...

  5. Implications of Rhagoletis zephyria, 1894 (Diptera: Tephritidae), captures for apple maggot surveys and fly ecology in Washington state, U.S.A

    USDA-ARS?s Scientific Manuscript database

    The apple maggot, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), is an introduced quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in Washington state, U.S.A. A morphologically similar native fly, Rhagoletis zephyria Snow, 1894, infests snowberries (Symphoricarpos spp.) ...

  6. NEW RECORDS OF PHLEBOTOMINE SAND FLIES (DIPTERA: PSYCHODIDAE) FROM ECUADOR

    PubMed Central

    Jones, Lynn A.; Cohnstaedt, Lee W.; Beati, Lorenza; Terán, Rommy; León, Renato; Munstermann, Leonard E.

    2012-01-01

    The number of recorded phlebotomine sand fly species in Ecuador has nearly doubled during the past 20 years as a result of surveys. In 2005, a sand fly survey of two localities, Tiputini in the Amazon rain forest and Paraiso Escondido in the Pacific coastal lowland forest, resulted in the capture of 25 species. New records for Ecuador consisted of five species from the Amazonian region and one from Paraiso Escondido. The Amazonian species were Nyssomyia richardwardi (Ready and Fraiha), Psathyromyia dreisbachi (Causey and Damasceno), Psathyromyia runoides (Fairchild and Hertig), Trichophoromyia pabloi (Barretto, Burbano and Young), and Trichopygomyia witoto (Young and Morales). The Pacific coastal lowland species was Psathyromyia punctigeniculata (Floch and Abonnenc). PMID:22628901

  7. Preliminary list of horse flies (Diptera, Tabanidae) of Serbia.

    PubMed

    Krčmar, Stjepan

    2011-01-01

    Thirty six species of horse flies (Tabanidae) were previously known from Serbia (Europe). The present faunistic study of horse flies (Tabanidae) has resulted in the recording of the 4 new species Atylotus fulvus (Meigen, 1804); Tabanus miki Brauer in Brauer and Bergenstamm, 1880; Tabanus unifasciatus Loew, 1858; and Heptatoma pellucens (Fabricius, 1776), in the fauna of Serbia. The genus Heptatoma Meigen, 1803 is cited for the first time in the fauna of Serbia. 40 species are currently known from Serbia, belonging to nine genera. The fauna can be considered relatively poorly studied. Most of the species belong to the Boreal-Eurasian type of fauna 23, followed by the South European group with 8 species, the Mediterranean group with 6 species, European group with 2 species and Central European group with 1 species.

  8. Preliminary list of horse flies (Diptera, Tabanidae) of Serbia

    PubMed Central

    Krčmar, Stjepan

    2011-01-01

    Abstract Thirty six species of horse flies (Tabanidae) were previously known from Serbia (Europe). The present faunistic study of horse flies (Tabanidae) has resulted in the recording of the 4 new species Atylotus fulvus (Meigen, 1804); Tabanus miki Brauer in Brauer and Bergenstamm, 1880; Tabanus unifasciatus Loew, 1858; and Heptatoma pellucens (Fabricius, 1776), in the fauna of Serbia. The genus Heptatoma Meigen, 1803 is cited for the first time in the fauna of Serbia. 40 species are currently known from Serbia, belonging to nine genera. The fauna can be considered relatively poorly studied. Most of the species belong to the Boreal-Eurasian type of fauna 23, followed by the South European group with 8 species, the Mediterranean group with 6 species, European group with 2 species and Central European group with 1 species. PMID:21998507

  9. Oviposition Substrate of the Mountain Fly Drosophila nigrosparsa (Diptera: Drosophilidae).

    PubMed

    Kinzner, Martin-Carl; Tratter, Magdalena; Bächli, Gerhard; Kirchmair, Martin; Kaufmann, Rüdiger; Arthofer, Wolfgang; Schlick-Steiner, Birgit C; Steiner, Florian M

    2016-01-01

    The survival of insect larvae often depends on the mother's choice of oviposition substrate, and thus, this choice is an essential part of an insect species' ecology. Especially species with narrow substrate preferences may suffer from changes in substrate availability triggered by, for example, climate change. Recent climate warming is affecting species directly (e.g., physiology) but also indirectly (e.g., biological interactions) leading to mismatching phenologies and distributions. However, the preferred oviposition substrate is still unknown for many drosophilid species, especially for those at higher elevations. In this study, we investigated the oviposition-substrate preference of the montane-alpine fly Drosophila nigrosparsa in rearing and multiple-choice experiments using natural substrates in the laboratory. Insect emergence from field-collected substrates was tested. More than 650 insects were reared from natural substrates, among them 152 drosophilids but no individual of D. nigrosparsa. In the multiple-choice experiments, D. nigrosparsa preferred ovipositing on mushrooms (> 93% of eggs); additionally, a few eggs were laid on berries but none on other substrates such as cow faeces, rotten plant material, and soil. The flies laid 24 times more eggs per day when mushrooms were included in the substrates than when they were excluded. We infer that D. nigrosparsa is a mushroom breeder with some variation in oviposition choice. The flies favoured some mushrooms over others, but they were not specialised on a single fungal taxon. Although it is unclear if and how climate change will affect D. nigrosparsa, our results indicate that this species will not be threatened by oviposition-substrate limitations in the near future because of the broad altitudinal distribution of the mushrooms considered here, even if the flies will have to shift upwards to withstand increasing temperatures.

  10. Oviposition Substrate of the Mountain Fly Drosophila nigrosparsa (Diptera: Drosophilidae)

    PubMed Central

    Tratter, Magdalena; Bächli, Gerhard; Kirchmair, Martin; Kaufmann, Rüdiger; Arthofer, Wolfgang; Schlick-Steiner, Birgit C.; Steiner, Florian M.

    2016-01-01

    The survival of insect larvae often depends on the mother’s choice of oviposition substrate, and thus, this choice is an essential part of an insect species’ ecology. Especially species with narrow substrate preferences may suffer from changes in substrate availability triggered by, for example, climate change. Recent climate warming is affecting species directly (e.g., physiology) but also indirectly (e.g., biological interactions) leading to mismatching phenologies and distributions. However, the preferred oviposition substrate is still unknown for many drosophilid species, especially for those at higher elevations. In this study, we investigated the oviposition-substrate preference of the montane-alpine fly Drosophila nigrosparsa in rearing and multiple-choice experiments using natural substrates in the laboratory. Insect emergence from field-collected substrates was tested. More than 650 insects were reared from natural substrates, among them 152 drosophilids but no individual of D. nigrosparsa. In the multiple-choice experiments, D. nigrosparsa preferred ovipositing on mushrooms (> 93% of eggs); additionally, a few eggs were laid on berries but none on other substrates such as cow faeces, rotten plant material, and soil. The flies laid 24 times more eggs per day when mushrooms were included in the substrates than when they were excluded. We infer that D. nigrosparsa is a mushroom breeder with some variation in oviposition choice. The flies favoured some mushrooms over others, but they were not specialised on a single fungal taxon. Although it is unclear if and how climate change will affect D. nigrosparsa, our results indicate that this species will not be threatened by oviposition-substrate limitations in the near future because of the broad altitudinal distribution of the mushrooms considered here, even if the flies will have to shift upwards to withstand increasing temperatures. PMID:27788257

  11. Rearing methods for the black soldier fly (Diptera: Stratiomyidae).

    PubMed

    Sheppard, D Craig; Tomberlin, Jeffery K; Joyce, John A; Kiser, Barbara C; Sumner, Sonya M

    2002-07-01

    The black soldier fly, Heretia illucens (L.), is a nonpest tropical and warm-temperate region insect that is useful for managing large concentrations of animal manure and other biosolids. Manure management relying on wild fly oviposition has been successful in several studies. However, confidence in this robust natural system was low and biological studies were hampered by the lack of a dependable source of eggs and larvae. Larvae had been reared easily by earlier investigators, but achieving mating had been problematic. We achieved mating reliably in a 2 by 2 by 4-m screen cage in a 7 by 9 by 5-m greenhouse where sunlight and adequate space for aerial mating were available. Mating occurred during the shortest days of winter if the sun was not obscured by clouds. Adults were provided with water, but no food was required. Techniques for egg collection and larval rearing are given. Larvae were fed a moist mixture of wheat bran, corn meal, and alfalfa meal. This culture has been maintained for 3 yr. Maintainance of a black soldier fly laboratory colony will allow for development of manure management systems in fully enclosed animal housing and in colder regions.

  12. Battery-powered, electrocuting trap for stable flies (Diptera: Muscidae).

    PubMed

    Pickens, L G

    1991-11-01

    A solar-charged, battery-powered, electrocuting grid was combined with a white plywood base to make a portable, pulsed-current, pest-electrocuting device that attracted and killed stable flies, Stomoxys calcitrans (L.), outdoors. The grid was powered once every 1-2 s by a 0.016-s pulse of 60-Hz alternating current of 4 mA and 9,500 V. Power was turned off at night by a photoresistor. The trap functioned continuously for 14 d with an unrecharged 12-V, 18A/h lawn-tractor battery and killed as many as 4,000 flies per day. Solar cells were used to charge a single 12-V battery continuously that operated 12 grids for a period of 90 d. The grid did not short circuit for any length of time even during heavy rainstorms or when large insects were killed. The incorporation of moiré patterns and the utilization of the correct size, orientation, and placement of wires made the electrocuting grid itself attractive to stable flies. The traps were spaced at distances of up to 120 m from the battery and pulse circuit. The electrocuting traps were more effective than sticky traps and avoided the problems associated with chemicals. They are well suited for use around calf pens, dog kennels, or large animal shelters.

  13. Modafinil maintains waking in the fruit fly drosophila melanogaster.

    PubMed

    Hendricks, Joan C; Kirk, David; Panckeri, Karen; Miller, Matthew S; Pack, Allan I

    2003-03-15

    Fruit flies exhibit a sleep-like rest state that shares behavioral characteristics with mammalian sleep, including a homeostatic increase in rest after deprivation by mechanical methods. We tested the effect of modafinil, a novel wake-promoting agent, to discover whether its effect is conserved. Flies fed various concentrations of modafinil were compared to groups of control flies fed diluent only. Flies were also tested for a homeostatic response to the modafinil-related rest deprivation by examining rest and activity during recovery after 48H modafinil administration, compared to rest deprivation alone and to both treatments combined. The duration and consolidation of rest, and the duration, intensity, and circadian rhythms of activity were measured. Modafinil significantly and dose-dependently decreased rest when fed at concentrations from 2.5 mg/ml to 0.3125 mg/ml. Activity intensity was not increased, and circadian timing was unchanged, although the 2.5 mg/ml dose blunted the amplitude of overt circadian locomotor rhythms. Compared to controls, the duration of rest bouts was decreased in flies fed 2.5 mg/ml, and waking was frequently interrupted by 5-min periods of immobility. A rest rebound (significant increase in rest) followed withdrawal of either 2.5mg/ml or 0.625mg/ml modafinil after 48H. When directly compared to 6H total rest deprivation, the increase after withdrawal was briefer, reminiscent of the attenuated rest rebound seen in mammals, including humans, after modafinil. However, modafinil withdrawal combined with 6H total rest deprivation significantly enhanced the rebound, suggesting that a rest debt is accumulating during modafinil. We conclude that modafinil affects states of arousal in Drosophila in the same direction as it does in mammals. This discovery provides a tool for searching for conserved molecular mechanisms by which modafinil regulates rest and waking.

  14. Functional Morphology of the Mouthparts of the Adult Mediterranean Fruit Fly, Ceratitis capitata

    PubMed Central

    Coronado-Gonzalez, Pablo A.; Vijaysegaran, S.; Robinson, Alan S.

    2008-01-01

    Food-based attractants incorporating an insecticide are an important component of area-wide control programmes for the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). This study was carried out to understand the feeding mechanism of adults of this species. Mouthparts of C. capitata are similar in general structure to those of another Tephritid genus, Bactrocera, and have specific structural modifications that determine what adult flies can ingest. The labellum has a series of fine tube-like structures, called pseudotracheae, on its inner surface. Each pseudotrachea leads from the outer margin of the labellum and ends at the prestomum to the oral opening. The pseudotracheae contain fine micropores about 0.5µm in size. During feeding, the oral opening is never exposed to the feeding substrate but the portions of the opposing labellar lobes proximal to the oral opening are flexed against each other and distal portions of the opposing labellar lobes are opened and pressed flat against the feeding substrate or surface. The prestomal spines at the base of each pseudotrachea interlock to form a barrier across the oral opening. Thus entry of large particles directly into the crop and gut through the oral opening is prevented by flexure of the opposing labellar lobes against each other and the interlocking prestomal spines across the oral opening. Only liquids and suspended particles less than 0.5µm in size are sucked through the micropores into the lumen of the pseudotracheae and then pass into the food canal and into the crop and gut. The pseudotracheae of adult C. capitata, particularly along the middle portion of the labellum, have prominent blade-like projections that Bactrocera do not have. These projections are probably an ancestral condition as they were not observed to use them to abrade the plant or feeding surface as has been reported for species in the Tephritid genus, Blepharoneura.

  15. Life table assay of field-caught Mediterranean fruit flies, Ceratitis capitata, reveals age bias

    PubMed Central

    Kouloussis, Nikos A.; Papadopoulos, Nikos T.; Müller, Hans-Georg; Wang, Jane-Ling; Mao, Meng; Katsoyannos, Byron I.; Duyck, Pierre-François; Carey, James R.

    2012-01-01

    Though traps are used widely to sample phytophagous insects for research or management purposes, and recently in aging research, possible bias stemming from differential response of individuals of various ages to traps has never been examined. In this paper, we tested the response of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) males and females of four ages (spanning from 1 to 40 days) to McPhail-type traps baited with a synthetic food attractant in field cages and found that the probability of trapping was significantly influenced by age. The type of food on which flies were maintained before testing (sugar or protein) also had a strong effect and interacted with age. In another experiment, we collected wild C. capitata adults of unknown age using 1–3 methods and then reared them in the laboratory until death. The survival schedules of these flies were subsequently used in a life table assay to infer their age at the time of capture. Results showed that on a single sampling date, males captured in traps baited with a food attractant were younger compared with males aspirated from fruiting host trees, or males captured in traps baited with a sex attractant. Likewise, females captured in food-baited traps were younger compared with aspirated females. In addition to providing the first evidence of age-dependent sampling bias for a phytophagous insect species, this paper also provides a novel approach to estimate the differences in the age composition of samples collected with different techniques. These findings are of utmost importance for several categories of insects, medically important groups notwithstanding. PMID:22844133

  16. Aggregation Behavior and a Putative Aggregation Pheromone in Sugar Beet Root Maggot Flies (Diptera: Ulidiidae)

    PubMed Central

    Emmert, Susan Y.; Tindall, Kelly; Ding, Hongjian; Boetel, Mark A.; Rajabaskar, D.; Eigenbrode, Sanford D.

    2017-01-01

    Male-biased aggregations of sugar beet root maggot, Tetanops myopaeformis (Röder) (Diptera: Ulidiidae), flies were observed on utility poles near sugar beet (Beta vulgaris L. [Chenopodiaceae]) fields in southern Idaho; this contrasts with the approximately equal sex ratio typically observed within fields. Peak observation of mating pairs coincided with peak diurnal abundance of flies. Volatiles released by individual male and female flies were sampled from 08:00 to 24:00 hours in the laboratory using solid-phase microextraction and analyzed using gas chromatography/mass spectrometry (GC/MS). Eleven compounds were uniquely detected from males. Three of these compounds (2-undecanol, 2-decanol, and sec-nonyl acetate) were detected in greater quantities during 12:00–24:00 hours than during 08:00–12:00 hours. The remaining eight compounds uniquely detected from males did not exhibit temporal trends in release. Both sexes produced 2-nonanol, but males produced substantially higher (ca. 80-fold) concentrations of this compound than females, again peaking after 12:00 hours. The temporal synchrony among male aggregation behavior, peak mating rates, and release of certain volatile compounds by males suggest that T. myopaeformis flies exhibit lekking behavior and produce an associated pheromone. Field assays using synthetic blends of the putative aggregation pheromone showed evidence of attraction in both females and males. PMID:28423428

  17. Selection for resistance to imidacloprid in the house fly (Diptera: Muscidae).

    PubMed

    Kaufman, Phillip E; Nunez, Sonia C; Geden, Christopher J; Scharf, Michael E

    2010-10-01

    The house fly, Musca domestica L. (Diptera: Muscidae), continues to be a primary pest of livestock facilities worldwide. This pest also has shown a propensity for pesticide resistance development when under high selection pressures. In this study the house fly strain FDm was created by a 20% contribution from each of five colonies collected from dairies in Florida with known imidacloprid resistance. The FDm strain was used to evaluate the level ofimidacloprid resistance after five selections near the LC70 value of each selected generation. Overall, the mean selection mortality was 72.7, with males being considerably more susceptible than females. The unselected (F0) FDm strain showed considerable susceptibility to imidacloprid after its creation, compared with the five parental strains. Between 9500 and 14,000 virgin house flies were used in each selection. After the fifth and final selection, a 331-fold increase in imidacloprid resistance at the LC70 was observed over the parental FDm strain. In parallel studies, the FDm strain showed increasing tolerance of the commercial imidacloprid product QuickBayt. These results suggest that livestock producers should use caution when choosing pesticides and consider rotating fly baits, as is encouraged with other pesticide treatment regimes on farms.

  18. DNA barcoding of human-biting black flies (Diptera: Simuliidae) in Thailand.

    PubMed

    Pramual, Pairot; Thaijarern, Jiraporn; Wongpakam, Komgrit

    2016-12-01

    Black flies (Diptera: Simuliidae) are important insect vectors and pests of humans and animals. Accurate identification, therefore, is important for control and management. In this study, we used mitochondrial cytochrome oxidase I (COI) barcoding sequences to test the efficiency of species identification for the human-biting black flies in Thailand. We used human-biting specimens because they enabled us to link information with previous studies involving the immature stages. Three black fly taxa, Simulium nodosum, S. nigrogilvum and S. doipuiense complex, were collected. The S. doipuiense complex was confirmed for the first time as having human-biting habits. The COI sequences revealed considerable genetic diversity in all three species. Comparisons to a COI sequence library of black flies in Thailand and in a public database indicated a high efficiency for specimen identification for S. nodosum and S. nigrogilvum, but this method was not successful for the S. doipuiense complex. Phylogenetic analyses revealed two divergent lineages in the S. doipuiense complex. Human-biting specimens formed a separate clade from other members of this complex. The results are consistent with the Barcoding Index Number System (BINs) analysis that found six BINs in the S. doipuiense complex. Further taxonomic work is needed to clarify the species status of these human-biting specimens. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Effectiveness of Genes for Hessian Fly (Diptera: Cecidomyiidae) Resistance in the Southeastern United States.

    PubMed

    Shukle, Richard H; Cambron, Sue E; Moniem, Hossam Abdel; Schemerhorn, Brandon J; Redding, Julie; David Buntin, G; Flanders, Kathy L; Reisig, Dominic D; Mohammadi, Mohsen

    2016-02-01

    The Hessian fly, Mayetiola destructor (Say) (Diptera: Cecidomyiidae), is the most important insect pest of wheat (Triticum aestivum L. subsp. aestivum) in the southeastern United States, and the deployment of genetically resistant wheat is the most effective control. However, the use of resistant wheat results in the selection of pest genotypes that can overcome formerly resistant wheat. We have evaluated the effectiveness of 16 resistance genes for protection of wheat from Hessian fly infestation in the southeastern United States. Results documented that while 10 of the genes evaluated could provide protection of wheat, the most highly effective genes were H12, H18, H24, H25, H26, and H33. However, H12 and H18 have been reported to be only partially effective in field evaluations, and H24, H25, and H26 may be associated with undesirable effects on agronomic traits when introgressed into elite wheat lines. Thus, the most promising new gene for Hessian fly resistance appears to be H33. These results indicate that identified highly effective resistance in wheat to the Hessian fly is a limited resource and emphasize the need to identify novel sources of resistance. Also, we recommend that the deployment of resistance in gene pyramids and the development of novel strategies for engineered resistance be considered.

  20. Susceptibility of cranberries to Drosophila suzukii (Diptera: Drosophilidae)

    USDA-ARS?s Scientific Manuscript database

    Drosophila suzukii Mastsumura (Diptera: Drosophilidae), commonly referred to as the spotted-wing drosophila, is an exotic species that has proven a troublesome pest of fruit production in the U.S. The fly targets small fruit and thus represents a concern for the U.S. cranberry industry. Two studies ...

  1. Cloning, sequence identification and expression profile analysis of α-L-fucosidase gene from the Mediterranean fruit fly Ceratitis capitata.

    PubMed

    Intra, Jari; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-04-01

    The Mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae) is one of the most destructive agricultural pests, a polyphagus insect of relevant economic importance and is widespread in many regions around the world. It is the best-studied fruit fly pest at genetic and molecular level and much has been learned on its ecology and behaviour. An α-L-fucosidase has been recently hypothesized to be involved in sperm-egg interactions in Drosophila melanogaster and in other Drosophila species. Here, a complete cDNA encoding a putative α-L-fucosidase of the medfly was amplified using the reverse polymerase chain reaction (RT-PCR) with degenerate based on the conserved coding sequence information of several insect α-L-fucosidases, cloned and sequenced (GenBank accession no. FJ177429). The coding region consisted of 1482 bp which encoded a 485-residues protein (named CcFUCA) with a predicted molecular mass of 56.1 kDa. The deduced protein sequence showed 75% amino acid identity to D. melanogaster α-L-fucosidase, and in fact the phylogenetic tree analysis revealed that CcFUCA had closer relationships with the α-L-fucosidases of drosophilid species. The tissue expression analysis indicated that CcFuca was expressed in a single transcript in all tissues, suggesting a ubiquitous localization pattern of the encoded protein. Our findings provide novel insights on a gene encoding a protein potentially involved in primary gamete interactions in C. capitata.

  2. Emergence of blueberry maggot flies (Diptera: tephritidae) from mulches and soil at various depths.

    PubMed

    Renkema, J M; Lynch, D H; Cutler, G C; Mackenzie, K; Walde, S J

    2012-04-01

    Control of blueberry maggot, Rhagoletis mendax Curran, typically is achieved with insecticides targeting adult flies before females oviposit in ripening fruit. Management strategies targeting other life stages have received less attention. We tested effects of compost or pine needle mulches on emergence of blueberry maggot flies under laboratory and field conditions. Few flies emerged from pupae that were buried under 20 cm of pine needles in all experiments, but burial in 20 cm of compost did not always result in low fly emergence. Burial of pupae in 5 cm of compost or pine needles did not reduce fly emergence compared with 1 cm in soil. Low emergence with increased mulch depth appeared to be primarily because of failure of flies to ascend to the surface after they exited puparia. Low emergence also was associated with high moisture levels causing rotten, discolored pupae, particularly in the laboratory in compost. No flies emerged from pupae buried in 1 cm of pine needles in the field. In this case no flies exited puparia, likely because high temperatures (>30°C) at the surface killed pupae. Thus, mulch application under highbush blueberries (Vaccinium corymbosum L.) after maggots drop from berries can reduce emergence success of flies from buried pupae, but the level of control will depend on mulch depth and may vary with rainfall and temperature.

  3. Reduction in Emergence of Rhagoletis indifferens (Diptera: Tephritidae) from Sweet Cherries with Different Egg and Larval Distributions Using Newer Insecticides

    USDA-ARS?s Scientific Manuscript database

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is the major insect pest of sweet cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. To reduce fly populations in unharvested fruit following the completion of commercial harvest, it is important to cont...

  4. New records of Rhagoletis species (Diptera: Tephritidae) and their host plants in western Montana, U.S.A.

    USDA-ARS?s Scientific Manuscript database

    Little information exists concerning the distribution of Rhagoletis fruit flies (Diptera: Tephritidae) in the state of Montana in the western U.S.A. In this study, the presence of and host plant use by Rhagoletis species are documented in northwestern Montana. The western cherry fruit fly, Rhagolet...

  5. DNA barcoding of tropical black flies (Diptera: Simuliidae) of Thailand.

    PubMed

    Pramual, Pairot; Adler, Peter H

    2014-03-01

    The ecological and medical importance of black flies drives the need for rapid and reliable identification of these minute, structurally uniform insects. We assessed the efficiency of DNA barcoding for species identification of tropical black flies. A total of 351 cytochrome c oxidase subunit 1 sequences were obtained from 41 species in six subgenera of the genus Simulium in Thailand. Despite high intraspecific genetic divergence (mean = 2.00%, maximum = 9.27%), DNA barcodes provided 96% correct identification. Barcodes also differentiated cytoforms of selected species complexes, albeit with varying levels of success. Perfect differentiation was achieved for two cytoforms of Simulium feuerborni, and 91% correct identification was obtained for the Simulium angulistylum complex. Low success (33%), however, was obtained for the Simulium siamense complex. The differential efficiency of DNA barcodes to discriminate cytoforms was attributed to different levels of genetic structure and demographic histories of the taxa. DNA barcode trees were largely congruent with phylogenies based on previous molecular, chromosomal and morphological analyses, but revealed inconsistencies that will require further evaluation.

  6. Developmental variation and amino acid sequences of cytochromes c of the fruit fly Drosophila melanogaster and the flesh fly Boettcherisca peregrina.

    PubMed

    Inoue, S; Inoue, H; Hiroyoshi, T; Matsubara, H; Yamanaka, T

    1986-10-01

    The amino acid sequences of cytochromes c purified from the fruit fly Drosophila melanogaster and the flesh fly Boettcherisca peregrina were determined. In contrast with the case of the housefly, isocytochromes c were not detected in these flies at any developmental stage. The sequence of fruit fly cytochrome c differed from that reported previously but was identical with that predicted from the nucleotide sequence of the fruit fly cytochrome c gene (DC4) (Limbach, K.J. & Wu, R. (1985) Nucl. Acids Res. 13, 631-644). Isocytochrome c of the fruit fly, reported to be encoded by the DC3 gene, was not detected as a functional cytochrome c molecule.

  7. A field test for host fruit odour discrimination and avoidance behaviour for Rhagoletis pomonella flies in the western United States.

    PubMed

    Sim, S B; Mattsson, M; Feder, Jasmine L; Cha, D H; Yee, W L; Goughnour, R B; Linn, C E; Feder, Jeffrey L

    2012-05-01

    Prezygotic isolation due to habitat choice is important to many models of speciation-with-gene-flow. Habitat choice is usually thought to occur through positive preferences of organisms for particular environments. However, avoidance of non-natal environments may also play a role in choice and have repercussions for post-zygotic isolation that preference does not. The recent host shift of Rhagoletis pomonella (Diptera: Tephritidae) from downy hawthorn, Crataegus mollis, to introduced apple, Malus domestica, in the eastern United States is a model for speciation-with-gene-flow. However, the fly is also present in the western United States where it was likely introduced via infested apples ≤ 60 years ago. R. pomonella now attacks two additional hawthorns in the west, the native C. douglasii (black hawthorn) and the introduced C. monogyna (English ornamental hawthorn). Flight tunnel tests have shown that western apple-, C. douglasii- and C. monogyna-origin flies all positively orient to fruit volatile blends of their respective natal hosts in flight tunnel assays. Here, we show that these laboratory differences translate to nature through field-trapping studies of flies in the state of Washington. Moreover, western R. pomonella display both positive orientation to their respective natal fruit volatiles and avoidance behaviour (negative orientation) to non-natal volatiles. Our results are consistent with the existence of behaviourally differentiated host races of R. pomonella in the west. In addition, the rapid evolution of avoidance behaviour appears to be a general phenomenon for R. pomonella during host shifts, as the eastern apple and downy hawthorn host races also are antagonized by non-natal fruit volatiles. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  8. Equipment for transporting live black fly larvae (Diptera: Simuliiae)

    USGS Publications Warehouse

    Tarshis, I.B.; Adkins, T.R.

    1971-01-01

    In studies relating to the biology and ecology of black flies, live larvae of at least 70 species of Simuliidae have been collected from their natural breeding sites and transported in containers with nonagitated water for short distances to the laboratory. One of us (Tarshis 1966) found, however, that even small numbers of simuliid larvae cannot survive in containers with nonagitated water for more than 6 hr. Additionally, when massive numbers of larvae are introduced into transport containers in which the water is not agitated, the larvae perish because they become entangled within the masses of silken threads they emit whenever disturbed (Tarshis and Neil 1970). Therefore, when transporting larvae long distances or when transporting large numbers of larvae any distance, it is essential to agitate the water in the transport containers.

  9. Measuring Drosophila (fruit fly) activity during microgravity exposure.

    PubMed

    Miller, M S; Keller, T S

    1999-07-01

    Important advances in the understanding of the aging process could be obtained through comprehension of the changes experienced by Drosophila melanogaster (fruit flies) during microgravity. Previous experiments flown on Cosmos satellites and various Space Shuttle missions have shown a significant decrease in the life span of young male Drosophila after microgravity exposure. Additionally, postflight analysis indicated an accelerated aging of the microgravity exposed male flies since they exhibited a significant decrease in mating ability and a consistently lower negative geotaxis response than the 1 g ground controls. The negative geotaxis response is the Drosophila's reaction to move opposite to the Earth's gravitational vector when disturbed in certain manners. Researchers have hypothesized that the accelerated aging, is due to an increased locomotor activity which causes a subsequent increase in mitochondrial activity. The increased mitochondrial activity, in turn, causes increased aging through accelerated damage to the mitochondrial system. An increase in locomotor activity was indicated by analyzing only a fraction (1/6th of a second) of the 15 minute video recordings of groups of Drosophila taken approximately every two days during a 14-day Space Shuttle flight. The increased locomotor activity may be related to the Drosophila's negative geotaxis response in that the flies may be reacting to the absence of normal gravity by continuously searching for the gravity vector. The aims of this study are to develop methods to accurately measure individual Drosophila activity, use these derived methods in 1 g to create a Drosophila activity baseline, and use the methods during short and long duration microgravity exposure (sounding rockets, parabolic flights, Space Shuttle, International Space Station, etc.) to examine Drosophila activity. The role of the negative geotaxis response on locomotor activity will be examined by using two strains of behaviorally selected

  10. Detection of Mango Infested with Fruit Fly Eggs and Larvae by Infrared Imaging and Discriminant Analysis

    USDA-ARS?s Scientific Manuscript database

    Fruit fly infestation causes significant loss of perishable products around the world and is an economic threat to growers, processors, and exporters. A rapid, economical, and non-destructive technique for detection of fruit fly infestation is reported based on hyperspectral imaging and discriminant...

  11. An Inquiry-Based Investigation of Modes of Inheritance Using "Flightless" Fruit Flies

    ERIC Educational Resources Information Center

    Chinnici, Joseph P.; Farland, Andrew M.

    2005-01-01

    The various strains of flightless fruit flies that were developed at the Virginia Commonwealth University (VCU) and an exercise that helps students in determining the inheritance pattern in the fru