Genetic characterization of epizootic hemorrhagic disease virus strains isolated from cattle in Israel

USDA-ARS?s Scientific Manuscript database

Epizootic hemorrhagic disease virus (EHDV), an Orbivirus not previously reported in Israel, was isolated from Israeli cattle during a “bluetongue like” disease outbreak in 2006. To ascertain the origin of this new virus, three isolates from the outbreak were fully sequenced and compared with availab...

Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity

PubMed Central

Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

2014-01-01

Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449

Molecular characterization of Lactobacillus plantarum DMDL 9010, a strain with efficient nitrite degradation capacity.

PubMed

Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

2014-01-01

Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.

The complete genome sequencing of Prevotella intermedia strain OMA14 and a subsequent fine-scale, intra-species genomic comparison reveal an unusual amplification of conjugative and mobile transposons and identify a novel Prevotella-lineage-specific repeat.

PubMed

Naito, Mariko; Ogura, Yoshitoshi; Itoh, Takehiko; Shoji, Mikio; Okamoto, Masaaki; Hayashi, Tetsuya; Nakayama, Koji

2016-02-01

Prevotella intermedia is a pathogenic bacterium involved in periodontal diseases. Here, we present the complete genome sequence of a clinical strain, OMA14, of this bacterium along with the results of comparative genome analysis with strain 17 of the same species whose genome has also been sequenced, but not fully analysed yet. The genomes of both strains consist of two circular chromosomes: the larger chromosomes are similar in size and exhibit a high overall linearity of gene organizations, whereas the smaller chromosomes show a significant size variation and have undergone remarkable genome rearrangements. Unique features of the Pre. intermedia genomes are the presence of a remarkable number of essential genes on the second chromosomes and the abundance of conjugative and mobilizable transposons (CTns and MTns). The CTns/MTns are particularly abundant in the second chromosomes, involved in its extensive genome rearrangement, and have introduced a number of strain-specific genes into each strain. We also found a novel 188-bp repeat sequence that has been highly amplified in Pre. intermedia and are specifically distributed among the Pre. intermedia-related species. These findings expand our understanding of the genetic features of Pre. intermedia and the roles of CTns and MTns in the evolution of bacteria. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

PubMed

Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

2017-10-06

Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

Bioinformatics Analysis of the Complete Genome Sequence of the Mango Tree Pathogen Pseudomonas syringae pv. syringae UMAF0158 Reveals Traits Relevant to Virulence and Epiphytic Lifestyle

PubMed Central

Arrebola, Eva; Carrión, Víctor J.; Gutiérrez-Barranquero, José Antonio; Pérez-García, Alejandro; Ramos, Cayo; Cazorla, Francisco M.; de Vicente, Antonio

2015-01-01

The genome sequence of more than 100 Pseudomonas syringae strains has been sequenced to date; however only few of them have been fully assembled, including P. syringae pv. syringae B728a. Different strains of pv. syringae cause different diseases and have different host specificities; so, UMAF0158 is a P. syringae pv. syringae strain related to B728a but instead of being a bean pathogen it causes apical necrosis of mango trees, and the two strains belong to different phylotypes of pv.syringae and clades of P. syringae. In this study we report the complete sequence and annotation of P. syringae pv. syringae UMAF0158 chromosome and plasmid pPSS158. A comparative analysis with the available sequenced genomes of other 25 P. syringae strains, both closed (the reference genomes DC3000, 1448A and B728a) and draft genomes was performed. The 5.8 Mb UMAF0158 chromosome has 59.3% GC content and comprises 5017 predicted protein-coding genes. Bioinformatics analysis revealed the presence of genes potentially implicated in the virulence and epiphytic fitness of this strain. We identified several genetic features, which are absent in B728a, that may explain the ability of UMAF0158 to colonize and infect mango trees: the mangotoxin biosynthetic operon mbo, a gene cluster for cellulose production, two different type III and two type VI secretion systems, and a particular T3SS effector repertoire. A mutant strain defective in the rhizobial-like T3SS Rhc showed no differences compared to wild-type during its interaction with host and non-host plants and worms. Here we report the first complete sequence of the chromosome of a pv. syringae strain pathogenic to a woody plant host. Our data also shed light on the genetic factors that possibly determine the pathogenic and epiphytic lifestyle of UMAF0158. This work provides the basis for further analysis on specific mechanisms that enable this strain to infect woody plants and for the functional analysis of host specificity in the P. syringae complex. PMID:26313942

Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12.

PubMed

Hayashi, T; Makino, K; Ohnishi, M; Kurokawa, K; Ishii, K; Yokoyama, K; Han, C G; Ohtsubo, E; Nakayama, K; Murata, T; Tanaka, M; Tobe, T; Iida, T; Takami, H; Honda, T; Sasakawa, C; Ogasawara, N; Yasunaga, T; Kuhara, S; Shiba, T; Hattori, M; Shinagawa, H

2001-02-28

Escherichia coli O157:H7 is a major food-borne infectious pathogen that causes diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome. Here we report the complete chromosome sequence of an O157:H7 strain isolated from the Sakai outbreak, and the results of genomic comparison with a benign laboratory strain, K-12 MG1655. The chromosome is 5.5 Mb in size, 859 Kb larger than that of K-12. We identified a 4.1-Mb sequence highly conserved between the two strains, which may represent the fundamental backbone of the E. coli chromosome. The remaining 1.4-Mb sequence comprises of O157:H7-specific sequences, most of which are horizontally transferred foreign DNAs. The predominant roles of bacteriophages in the emergence of O157:H7 is evident by the presence of 24 prophages and prophage-like elements that occupy more than half of the O157:H7-specific sequences. The O157:H7 chromosome encodes 1632 proteins and 20 tRNAs that are not present in K-12. Among these, at least 131 proteins are assumed to have virulence-related functions. Genome-wide codon usage analysis suggested that the O157:H7-specific tRNAs are involved in the efficient expression of the strain-specific genes. A complete set of the genes specific to O157:H7 presented here sheds new insight into the pathogenicity and the physiology of O157:H7, and will open a way to fully understand the molecular mechanisms underlying the O157:H7 infection.

Molecular characterization of KGH, the first human isolate of rabies virus in Korea.

PubMed

Park, Jun-Sun; Kim, Chi-Kyeong; Kim, Su Yeon; Ju, Young Ran

2013-04-01

The complete genome sequence of the KGH strain of the first human rabies virus, which was isolated from a skin biopsy of a patient with rabies, whose symptoms developed due to bites from a raccoon dog in 2001. The size of the KGH strain genome was determined to be 11,928 nucleotides (nt) with a leader sequence of 58 nt, nucleoprotein gene of 1,353 nt, phosphoprotein gene of 894 nt, matrix protein gene of 609 nt, glycoprotein gene of 1,575 nt, RNA-dependent RNA polymerase gene of 6,384 nt, and trailer region of 69 nt. Sequence similarity was compared with 39 fully sequenced rabies virus genomes currently available, and the result showed 70.6-91.6 % at the nucleotide level, and 82.8-97.9 % at the amino acid level. The deduced amino acids in the viral protein were compared with those of other rabies viruses, and various functional regions were investigated. As a result, we found that the KGH strain only had a unique amino acid substitution that was identified to be associated either with host immune response and pathogenicity in the N protein, or with a related region regulating STAT1 in the P protein, and related to pathogenicity in G protein. Based on phylogenetic analyses using the complete genome of 39 rabies viruses, the KGH strain was determined to be closely related with the NNV-RAB-H strain and transplant rabies virus serotype 1, which are Indian isolates, and was confirmed to belong to the Arctic-like 2 clade. The KGH strain was most closely related to the SKRRD0204HC and SKRRD0205HC strain when compared with Korean animal isolates, which was separated around the same time and place, and belonged to the Gangwon III subgroup.

Genomic Diversity in the Endosymbiotic Bacterium Rhizobium leguminosarum.

PubMed

Sánchez-Cañizares, Carmen; Jorrín, Beatriz; Durán, David; Nadendla, Suvarna; Albareda, Marta; Rubio-Sanz, Laura; Lanza, Mónica; González-Guerrero, Manuel; Prieto, Rosa Isabel; Brito, Belén; Giglio, Michelle G; Rey, Luis; Ruiz-Argüeso, Tomás; Palacios, José M; Imperial, Juan

2018-01-24

Rhizobium leguminosarum bv. viciae is a soil α-proteobacterium that establishes a diazotrophic symbiosis with different legumes of the Fabeae tribe. The number of genome sequences from rhizobial strains available in public databases is constantly increasing, although complete, fully annotated genome structures from rhizobial genomes are scarce. In this work, we report and analyse the complete genome of R. leguminosarum bv. viciae UPM791. Whole genome sequencing can provide new insights into the genetic features contributing to symbiotically relevant processes such as bacterial adaptation to the rhizosphere, mechanisms for efficient competition with other bacteria, and the ability to establish a complex signalling dialogue with legumes, to enter the root without triggering plant defenses, and, ultimately, to fix nitrogen within the host. Comparison of the complete genome sequences of two strains of R. leguminosarum bv. viciae , 3841 and UPM791, highlights the existence of different symbiotic plasmids and a common core chromosome. Specific genomic traits, such as plasmid content or a distinctive regulation, define differential physiological capabilities of these endosymbionts. Among them, strain UPM791 presents unique adaptations for recycling the hydrogen generated in the nitrogen fixation process.

Right ventricular strain analysis from three-dimensional echocardiography by using temporally diffeomorphic motion estimation.

PubMed

Zhang, Zhijun; Zhu, Meihua; Ashraf, Muhammad; Broberg, Craig S; Sahn, David J; Song, Xubo

2014-12-01

Quantitative analysis of right ventricle (RV) motion is important for study of the mechanism of congenital and acquired diseases. Unlike left ventricle (LV), motion estimation of RV is more difficult because of its complex shape and thin myocardium. Although attempts of finite element models on MR images and speckle tracking on echocardiography have shown promising results on RV strain analysis, these methods can be improved since the temporal smoothness of the motion is not considered. The authors have proposed a temporally diffeomorphic motion estimation method in which a spatiotemporal transformation is estimated by optimization of a registration energy functional of the velocity field in their earlier work. The proposed motion estimation method is a fully automatic process for general image sequences. The authors apply the method by combining with a semiautomatic myocardium segmentation method to the RV strain analysis of three-dimensional (3D) echocardiographic sequences of five open-chest pigs under different steady states. The authors compare the peak two-point strains derived by their method with those estimated from the sonomicrometry, the results show that they have high correlation. The motion of the right ventricular free wall is studied by using segmental strains. The baseline sequence results show that the segmental strains in their methods are consistent with results obtained by other image modalities such as MRI. The image sequences of pacing steady states show that segments with the largest strain variation coincide with the pacing sites. The high correlation of the peak two-point strains of their method and sonomicrometry under different steady states demonstrates that their RV motion estimation has high accuracy. The closeness of the segmental strain of their method to those from MRI shows the feasibility of their method in the study of RV function by using 3D echocardiography. The strain analysis of the pacing steady states shows the potential utility of their method in study on RV diseases.

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Genomes of the Mouse Collaborative Cross.

PubMed

Srivastava, Anuj; Morgan, Andrew P; Najarian, Maya L; Sarsani, Vishal Kumar; Sigmon, J Sebastian; Shorter, John R; Kashfeen, Anwica; McMullan, Rachel C; Williams, Lucy H; Giusti-Rodríguez, Paola; Ferris, Martin T; Sullivan, Patrick; Hock, Pablo; Miller, Darla R; Bell, Timothy A; McMillan, Leonard; Churchill, Gary A; de Villena, Fernando Pardo-Manuel

2017-06-01

The Collaborative Cross (CC) is a multiparent panel of recombinant inbred (RI) mouse strains derived from eight founder laboratory strains. RI panels are popular because of their long-term genetic stability, which enhances reproducibility and integration of data collected across time and conditions. Characterization of their genomes can be a community effort, reducing the burden on individual users. Here we present the genomes of the CC strains using two complementary approaches as a resource to improve power and interpretation of genetic experiments. Our study also provides a cautionary tale regarding the limitations imposed by such basic biological processes as mutation and selection. A distinct advantage of inbred panels is that genotyping only needs to be performed on the panel, not on each individual mouse. The initial CC genome data were haplotype reconstructions based on dense genotyping of the most recent common ancestors (MRCAs) of each strain followed by imputation from the genome sequence of the corresponding founder inbred strain. The MRCA resource captured segregating regions in strains that were not fully inbred, but it had limited resolution in the transition regions between founder haplotypes, and there was uncertainty about founder assignment in regions of limited diversity. Here we report the whole genome sequence of 69 CC strains generated by paired-end short reads at 30× coverage of a single male per strain. Sequencing leads to a substantial improvement in the fine structure and completeness of the genomes of the CC. Both MRCAs and sequenced samples show a significant reduction in the genome-wide haplotype frequencies from two wild-derived strains, CAST/EiJ and PWK/PhJ. In addition, analysis of the evolution of the patterns of heterozygosity indicates that selection against three wild-derived founder strains played a significant role in shaping the genomes of the CC. The sequencing resource provides the first description of tens of thousands of new genetic variants introduced by mutation and drift in the CC genomes. We estimate that new SNP mutations are accumulating in each CC strain at a rate of 2.4 ± 0.4 per gigabase per generation. The fixation of new mutations by genetic drift has introduced thousands of new variants into the CC strains. The majority of these mutations are novel compared to currently sequenced laboratory stocks and wild mice, and some are predicted to alter gene function. Approximately one-third of the CC inbred strains have acquired large deletions (>10 kb) many of which overlap known coding genes and functional elements. The sequence of these mice is a critical resource to CC users, increases threefold the number of mouse inbred strain genomes available publicly, and provides insight into the effect of mutation and drift on common resources. Copyright © 2017 Srivastava et al.

Genomes of the Mouse Collaborative Cross

PubMed Central

Srivastava, Anuj; Morgan, Andrew P.; Najarian, Maya L.; Sarsani, Vishal Kumar; Sigmon, J. Sebastian; Shorter, John R.; Kashfeen, Anwica; McMullan, Rachel C.; Williams, Lucy H.; Giusti-Rodríguez, Paola; Ferris, Martin T.; Sullivan, Patrick; Hock, Pablo; Miller, Darla R.; Bell, Timothy A.; McMillan, Leonard; Churchill, Gary A.; de Villena, Fernando Pardo-Manuel

2017-01-01

The Collaborative Cross (CC) is a multiparent panel of recombinant inbred (RI) mouse strains derived from eight founder laboratory strains. RI panels are popular because of their long-term genetic stability, which enhances reproducibility and integration of data collected across time and conditions. Characterization of their genomes can be a community effort, reducing the burden on individual users. Here we present the genomes of the CC strains using two complementary approaches as a resource to improve power and interpretation of genetic experiments. Our study also provides a cautionary tale regarding the limitations imposed by such basic biological processes as mutation and selection. A distinct advantage of inbred panels is that genotyping only needs to be performed on the panel, not on each individual mouse. The initial CC genome data were haplotype reconstructions based on dense genotyping of the most recent common ancestors (MRCAs) of each strain followed by imputation from the genome sequence of the corresponding founder inbred strain. The MRCA resource captured segregating regions in strains that were not fully inbred, but it had limited resolution in the transition regions between founder haplotypes, and there was uncertainty about founder assignment in regions of limited diversity. Here we report the whole genome sequence of 69 CC strains generated by paired-end short reads at 30× coverage of a single male per strain. Sequencing leads to a substantial improvement in the fine structure and completeness of the genomes of the CC. Both MRCAs and sequenced samples show a significant reduction in the genome-wide haplotype frequencies from two wild-derived strains, CAST/EiJ and PWK/PhJ. In addition, analysis of the evolution of the patterns of heterozygosity indicates that selection against three wild-derived founder strains played a significant role in shaping the genomes of the CC. The sequencing resource provides the first description of tens of thousands of new genetic variants introduced by mutation and drift in the CC genomes. We estimate that new SNP mutations are accumulating in each CC strain at a rate of 2.4 ± 0.4 per gigabase per generation. The fixation of new mutations by genetic drift has introduced thousands of new variants into the CC strains. The majority of these mutations are novel compared to currently sequenced laboratory stocks and wild mice, and some are predicted to alter gene function. Approximately one-third of the CC inbred strains have acquired large deletions (>10 kb) many of which overlap known coding genes and functional elements. The sequence of these mice is a critical resource to CC users, increases threefold the number of mouse inbred strain genomes available publicly, and provides insight into the effect of mutation and drift on common resources. PMID:28592495

Genome and Transcriptome Sequencing of the Ostreid herpesvirus 1 From Tomales Bay, California

NASA Astrophysics Data System (ADS)

Burge, C. A.; Langevin, S.; Closek, C. J.; Roberts, S. B.; Friedman, C. S.

2016-02-01

Mass mortalities of larval and seed bivalve molluscs attributed to the Ostreid herpesvirus 1 (OsHV-1) occur globally. OsHV-1 was fully sequenced and characterized as a member of the Family Malacoherpesviridae. Multiple strains of OsHV-1 exist and may vary in virulence, i.e. OsHV-1 µvar. For most global variants of OsHV-1, sequence data is limited to PCR-based sequencing of segments, including two recent genomes. In the United States, OsHV-1 is limited to detection in adjacent embayments in California, Tomales and Drakes bays. Limited DNA sequence data of OsHV-1 infecting oysters in Tomales Bay indicates the virus detected in Tomales Bay is similar but not identical to any one global variant of OsHV-1. In order to better understand both strain variation and virulence of OsHV-1 infecting oysters in Tomales Bay, we used genomic and transcriptomic sequencing. Meta-genomic sequencing (Illumina MiSeq) was conducted from infected oysters (n=4 per year) collected in 2003, 2007, and 2014, where full OsHV-1 genome sequences and low overall microbial diversity were achieved from highly infected oysters. Increased microbial diversity was detected in three of four samples sequenced from 2003, where qPCR based genome copy numbers of OsHV-1 were lower. Expression analysis (SOLiD RNA sequencing) of OsHV-1 genes expressed in oyster larvae at 24 hours post exposure revealed a nearly complete transcriptome, with several highly expressed genes, which are similar to recent transcriptomic analyses of other OsHV-1 variants. Taken together, our results indicate that genome and transcriptome sequencing may be powerful tools in understanding both strain variation and virulence of non-culturable marine viruses.

A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

PubMed

Namouchi, Amine; Mardassi, Helmi

2006-11-01

Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.

Optimization of algorithm of coding of genetic information of Chlamydia

NASA Astrophysics Data System (ADS)

Feodorova, Valentina A.; Ulyanov, Sergey S.; Zaytsev, Sergey S.; Saltykov, Yury V.; Ulianova, Onega V.

2018-04-01

New method of coding of genetic information using coherent optical fields is developed. Universal technique of transformation of nucleotide sequences of bacterial gene into laser speckle pattern is suggested. Reference speckle patterns of the nucleotide sequences of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci serovar I as well are generated. Algorithm of coding of gene information into speckle pattern is optimized. Fully developed speckles with Gaussian statistics for gene-based speckles have been used as criterion of optimization.

Whole-Genome Sequence of Bradyrhizobium elkanii Strain UASWS1016, a Potential Symbiotic Biofertilizer for Agriculture

PubMed Central

Crovadore, Julien; Calmin, Gautier; Chablais, Romain; Cochard, Bastien; Schulz, Torsten

2016-01-01

Bradyrhizobium elkanii UASWS1016 has been isolated from a wet oxidation sewage plant in Italy. Fully equipped for ammonia assimilation, heavy metal resistances, and aromatic compounds degradation, it carries a large type IV secretion system, specific of plant-associated microbes. Deprived of toxins, it could be considered for agricultural and environmental uses. PMID:27795259

Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data.

PubMed

Nishito, Yukari; Osana, Yasunori; Hachiya, Tsuyoshi; Popendorf, Kris; Toyoda, Atsushi; Fujiyama, Asao; Itaya, Mitsuhiro; Sakakibara, Yasubumi

2010-04-16

Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for gamma-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B. subtilis natto harbors but B. subtilis 168 lacks. Multiple genome-level comparisons among five closely related Bacillus species were also carried out. The determined genome sequence of B. subtilis natto and gene annotations are available from the Natto genome browser http://natto-genome.org/.

Genomic and Genetic Diversity within the Pseudomonas fluorescens Complex

PubMed Central

Garrido-Sanz, Daniel; Meier-Kolthoff, Jan P.; Göker, Markus; Martín, Marta; Rivilla, Rafael; Redondo-Nieto, Miguel

2016-01-01

The Pseudomonas fluorescens complex includes Pseudomonas strains that have been taxonomically assigned to more than fifty different species, many of which have been described as plant growth-promoting rhizobacteria (PGPR) with potential applications in biocontrol and biofertilization. So far the phylogeny of this complex has been analyzed according to phenotypic traits, 16S rDNA, MLSA and inferred by whole-genome analysis. However, since most of the type strains have not been fully sequenced and new species are frequently described, correlation between taxonomy and phylogenomic analysis is missing. In recent years, the genomes of a large number of strains have been sequenced, showing important genomic heterogeneity and providing information suitable for genomic studies that are important to understand the genomic and genetic diversity shown by strains of this complex. Based on MLSA and several whole-genome sequence-based analyses of 93 sequenced strains, we have divided the P. fluorescens complex into eight phylogenomic groups that agree with previous works based on type strains. Digital DDH (dDDH) identified 69 species and 75 subspecies within the 93 genomes. The eight groups corresponded to clustering with a threshold of 31.8% dDDH, in full agreement with our MLSA. The Average Nucleotide Identity (ANI) approach showed inconsistencies regarding the assignment to species and to the eight groups. The small core genome of 1,334 CDSs and the large pan-genome of 30,848 CDSs, show the large diversity and genetic heterogeneity of the P. fluorescens complex. However, a low number of strains were enough to explain most of the CDSs diversity at core and strain-specific genomic fractions. Finally, the identification and analysis of group-specific genome and the screening for distinctive characters revealed a phylogenomic distribution of traits among the groups that provided insights into biocontrol and bioremediation applications as well as their role as PGPR. PMID:26915094

Porcine Epidemic Diarrhea in Europe: In-Detail Analyses of Disease Dynamics and Molecular Epidemiology.

PubMed

Hanke, Dennis; Pohlmann, Anne; Sauter-Louis, Carola; Höper, Dirk; Stadler, Julia; Ritzmann, Mathias; Steinrigl, Adi; Schwarz, Bernd-Andreas; Akimkin, Valerij; Fux, Robert; Blome, Sandra; Beer, Martin

2017-07-06

Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV) which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.

Genomic and Transcriptomic Analysis of Escherichia coli Strains Associated with Persistent and Transient Bovine Mastitis and the Role of Colanic Acid.

PubMed

Lippolis, John D; Holman, Devin B; Brunelle, Brian W; Thacker, Tyler C; Bearson, Bradley L; Reinhardt, Timothy A; Sacco, Randy E; Casey, Thomas A

2018-01-01

Escherichia coli is a leading cause of bacterial mastitis in dairy cattle. It is most often transient in nature, causing an infection that lasts 2 to 3 days. However, E. coli has been shown to cause a persistent infection in a minority of cases. Mechanisms that allow for a persistent E. coli infection are not fully understood. The goal of this work was to determine differences between E. coli strains originally isolated from dairy cattle with transient and persistent mastitis. Using RNA sequencing, we show gene expression differences in nearly 200 genes when bacteria from the two clinical phenotypes are compared. We sequenced the genomes of the E. coli strains and report genes unique to the two phenotypes. Differences in the wca operon, which encodes colanic acid, were identified by DNA as well as RNA sequencing and differentiated the two phenotypes. Previous work demonstrated that E. coli strains that cause persistent infections were more motile than those that cause transient infections. Deletion of genes in the wca operon from a persistent-infection strain resulted in a reduction of motility as measured in swimming and swarming assays. Furthermore, colanic acid has been shown to protect bacteria from complement-mediated killing. We show that transient-infection E. coli strains were more sensitive to complement-mediated killing. The deletion of genes from the wca operon caused a persistent-infection E. coli strain to become sensitive to complement-mediated killing. This work identifies important differences between E. coli strains that cause persistent and transient mammary infections in dairy cattle. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Simultaneous isolation of emm89-type Streptococcus pyogenes strains with a wild-type or mutated covS gene from a single streptococcal toxic shock syndrome patient.

PubMed

Masuno, Katsuaki; Okada, Ryo; Zhang, Yan; Isaka, Masanori; Tatsuno, Ichiro; Shibata, Shinichiro; Hasegawa, Tadao

2014-04-01

Streptococcal toxic shock syndrome (STSS) is a re-emerging infectious disease in many developed countries. Recent studies have suggested that mutations in CovRS, a two-component regulatory system in Streptococcus pyogenes, play important roles in the pathogenesis of STSS. However, in vivo evidence of the significance of CovRS in human infections has not been fully demonstrated. We investigated five S. pyogenes strains isolated simultaneously from the pharynx, sputum, knee joint, cerebrospinal fluid and blood of a single STSS patient. All were emm89-type strains, and multilocus sequence typing (MLST) analysis revealed that the strains of pharynx and blood were isogenic. The growth rates of the strains from pharynx and sputum were faster than those of the other strains. Protein profiles of the culture supernatants of strains from the pharynx and sputum were also different from those of the other strains. Sequence analyses revealed that strains from the knee joint, cerebrospinal fluid and blood contained a single nucleotide difference in the covS coding region, resulting in one amino acid change, compared with the other strains. Introduction of a plasmid containing the covS gene from the pharynx strain to the blood strain increased the production of SpeB protein. This suggests that the one amino acid alteration in CovS was relevant to pathogenesis. This report supports the idea that mutated CovS plays important roles in vivo in the dissemination of S. pyogenes from the upper respiratory tract of human to aseptic tissues such as blood and cerebrospinal fluid.

Mycobacterium tuberculosis Whole Genome Sequences From Southern India Suggest Novel Resistance Mechanisms and the Need for Region-Specific Diagnostics.

PubMed

Manson, Abigail L; Abeel, Thomas; Galagan, James E; Sundaramurthi, Jagadish Chandrabose; Salazar, Alex; Gehrmann, Thies; Shanmugam, Siva Kumar; Palaniyandi, Kannan; Narayanan, Sujatha; Swaminathan, Soumya; Earl, Ashlee M

2017-06-01

India is home to 25% of all tuberculosis cases and the second highest number of multidrug resistant cases worldwide. However, little is known about the genetic diversity and resistance determinants of Indian Mycobacterium tuberculosis, particularly for the primary lineages found in India, lineages 1 and 3. We whole genome sequenced 223 randomly selected M. tuberculosis strains from 196 patients within the Tiruvallur and Madurai districts of Tamil Nadu in Southern India. Using comparative genomics, we examined genetic diversity, transmission patterns, and evolution of resistance. Genomic analyses revealed (11) prevalence of strains from lineages 1 and 3, (11) recent transmission of strains among patients from the same treatment centers, (11) emergence of drug resistance within patients over time, (11) resistance gained in an order typical of strains from different lineages and geographies, (11) underperformance of known resistance-conferring mutations to explain phenotypic resistance in Indian strains relative to studies focused on other geographies, and (11) the possibility that resistance arose through mutations not previously implicated in resistance, or through infections with multiple strains that confound genotype-based prediction of resistance. In addition to substantially expanding the genomic perspectives of lineages 1 and 3, sequencing and analysis of M. tuberculosis whole genomes from Southern India highlight challenges of infection control and rapid diagnosis of resistant tuberculosis using current technologies. Further studies are needed to fully explore the complement of diversity and resistance determinants within endemic M. tuberculosis populations. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

ABACAS: algorithm-based automatic contiguation of assembled sequences

PubMed Central

Assefa, Samuel; Keane, Thomas M.; Otto, Thomas D.; Newbold, Chris; Berriman, Matthew

2009-01-01

Summary: Due to the availability of new sequencing technologies, we are now increasingly interested in sequencing closely related strains of existing finished genomes. Recently a number of de novo and mapping-based assemblers have been developed to produce high quality draft genomes from new sequencing technology reads. New tools are necessary to take contigs from a draft assembly through to a fully contiguated genome sequence. ABACAS is intended as a tool to rapidly contiguate (align, order, orientate), visualize and design primers to close gaps on shotgun assembled contigs based on a reference sequence. The input to ABACAS is a set of contigs which will be aligned to the reference genome, ordered and orientated, visualized in the ACT comparative browser, and optimal primer sequences are automatically generated. Availability and Implementation: ABACAS is implemented in Perl and is freely available for download from http://abacas.sourceforge.net Contact: sa4@sanger.ac.uk PMID:19497936

Whole-Genome Sequence of Bradyrhizobium elkanii Strain UASWS1016, a Potential Symbiotic Biofertilizer for Agriculture.

PubMed

Crovadore, Julien; Calmin, Gautier; Chablais, Romain; Cochard, Bastien; Schulz, Torsten; Lefort, François

2016-10-06

Bradyrhizobium elkanii UASWS1016 has been isolated from a wet oxidation sewage plant in Italy. Fully equipped for ammonia assimilation, heavy metal resistances, and aromatic compounds degradation, it carries a large type IV secretion system, specific of plant-associated microbes. Deprived of toxins, it could be considered for agricultural and environmental uses. Copyright © 2016 Crovadore et al.

Selected Insights from Application of Whole Genome Sequencing for Outbreak Investigations

PubMed Central

Le, Vien Thi Minh; Diep, Binh An

2014-01-01

Purpose of review The advent of high-throughput whole genome sequencing has the potential to revolutionize the conduct of outbreak investigation. Because of its ultimate pathogen strain resolution, whole genome sequencing could augment traditional epidemiologic investigations of infectious disease outbreaks. Recent findings The combination of whole genome sequencing and intensive epidemiologic analysis provided new insights on the sources and transmission dynamics of large-scale epidemics caused by Escherichia coli and Vibrio cholerae, nosocomial outbreaks caused by methicillin-resistant Staphylococcus aureus, Klebsiella pneumonia, and Mycobacterium abscessus, community-centered outbreaks caused by Mycobacterium tuberculosis, and natural disaster-associated outbreak caused by environmentally acquired molds. Summary When combined with traditional epidemiologic investigation, whole genome sequencing has proven useful for elucidating sources and transmission dynamics of disease outbreaks. Development of a fully automated bioinformatics pipeline for analysis of whole genome sequence data is much needed to make this powerful tool more widely accessible. PMID:23856896

A complete high-quality MinION nanopore assembly of an extensively drug-resistant Mycobacterium tuberculosis Beijing lineage strain identifies novel variation in repetitive PE/PPE gene regions.

PubMed

Bainomugisa, Arnold; Duarte, Tania; Lavu, Evelyn; Pandey, Sushil; Coulter, Chris; Marais, Ben J; Coin, Lachlan M

2018-06-15

A better understanding of the genomic changes that facilitate the emergence and spread of drug-resistant Mycobacterium tuberculosis strains is currently required. Here, we report the use of the MinION nanopore sequencer (Oxford Nanopore Technologies) to sequence and assemble an extensively drug-resistant (XDR) isolate, which is part of a modern Beijing sub-lineage strain, prevalent in Western Province, Papua New Guinea. Using 238-fold coverage obtained from a single flow-cell, de novo assembly of nanopore reads resulted into one contiguous assembly with 99.92 % assembly accuracy. Incorporation of complementary short read sequences (Illumina) as part of consensus error correction resulted in a 4 404 064 bp genome with 99.98 % assembly accuracy. This assembly had an average nucleotide identity of 99.7 % relative to the reference genome, H37Rv. We assembled nearly all GC-rich repetitive PE/PPE family genes (166/168) and identified variants within these genes. With an estimated genotypic error rate of 5.3 % from MinION data, we demonstrated identification of variants to include the conventional drug resistance mutations, and those that contribute to the resistance phenotype (efflux pumps/transporter) and virulence. Reference-based alignment of the assembly allowed detection of deletions and insertions. MinION sequencing provided a fully annotated assembly of a transmissible XDR strain from an endemic setting and showed its utility to provide further understanding of genomic processes within Mycobacterium tuberculosis.

Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential

PubMed Central

Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela AE; Krauss, Jürgen

2014-01-01

The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro, the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential. PMID:24256717

Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential.

PubMed

Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela A E; Krauss, Jürgen

2014-01-01

The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro,the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential.

Limitations of the Mycobacterium tuberculosis reference genome H37Rv in the detection of virulence-related loci.

PubMed

O'Toole, Ronan F; Gautam, Sanjay S

2017-10-01

The genome sequence of Mycobacterium tuberculosis strain H37Rv is an important and valuable reference point in the study of M. tuberculosis phylogeny, molecular epidemiology, and drug-resistance mutations. However, it is becoming apparent that use of H37Rv as a sole reference genome in analysing clinical isolates presents some limitations to fully investigating M. tuberculosis virulence. Here, we examine the presence of single locus variants and the absence of entire genes in H37Rv with respect to strains that are responsible for cases and outbreaks of tuberculosis. We discuss how these polymorphisms may affect phenotypic properties of H37Rv including pathogenicity. Based on our observations and those of other researchers, we propose that use of a single reference genome, H37Rv, is not sufficient for the detection and characterisation of M. tuberculosis virulence-related loci. We recommend incorporation of genome sequences of other reference strains, in particular, direct clinical isolates, in such analyses in addition to H37Rv. Copyright © 2017 Elsevier Inc. All rights reserved.

Comparative genomics of multidrug resistance in Acinetobacter baumannii.

PubMed

Fournier, Pierre-Edouard; Vallenet, David; Barbe, Valérie; Audic, Stéphane; Ogata, Hiroyuki; Poirel, Laurent; Richet, Hervé; Robert, Catherine; Mangenot, Sophie; Abergel, Chantal; Nordmann, Patrice; Weissenbach, Jean; Raoult, Didier; Claverie, Jean-Michel

2006-01-01

Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island--the largest identified to date--in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance.

All five host-range variants of Xanthomonas citri carry one pthA homolog with 17.5 repeats that determines pathogenicity on citrus, but none determine host-range variation.

PubMed

Al-Saadi, Abdulwahid; Reddy, Joseph D; Duan, Yong P; Brunings, Asha M; Yuan, Qiaoping; Gabriel, Dean W

2007-08-01

Citrus canker disease is caused by five groups of Xanthomonas citri strains that are distinguished primarily by host range: three from Asia (A, A*, and A(w)) and two that form a phylogenetically distinct clade and originated in South America (B and C). Every X. citri strain carries multiple DNA fragments that hybridize with pthA, which is essential for the pathogenicity of wide-host-range X. citri group A strain 3213. DNA fragments that hybridized with pthA were cloned from a representative strain from all five groups. Each strain carried one and only one pthA homolog that functionally complemented a knockout mutation of pthA in 3213. Every complementing homolog was of identical size to pthA and carried 17.5 nearly identical, direct tandem repeats, including three new genes from narrow-host-range groups C (pthC), A(w) (pthAW), and A* (pthA*). Every noncomplementing paralog was of a different size; one of these was sequenced from group A* (pthA*-2) and was found to have an intact promoter and full-length reading frame but with 15.5 repeats. None of the complementing homologs nor any of the noncomplementing paralogs conferred avirulence to 3213 on grapefruit or suppressed avirulence of a group A* strain on grapefruit. A knockout mutation of pthC in a group C strain resulted in loss of pathogenicity on lime, but the strain was unaffected in ability to elicit an HR on grapefruit. This pthC- mutant was fully complemented by pthA, pthB, or pthC. Analysis of the predicted amino-acid sequences of all functional pthA homologs and nonfunctional paralogs indicated that the specific sequence of the 17th repeat may be essential for pathogenicity of X. citri on citrus.

Presence of broadly reactive and group-specific neutralizing epitopes on newly described isolates of Crimean-Congo hemorrhagic fever virus.

PubMed

Ahmed, Asim A; McFalls, Jeanne M; Hoffmann, Christian; Filone, Claire Marie; Stewart, Shaun M; Paragas, Jason; Khodjaev, Shabot; Shermukhamedova, Dilbar; Schmaljohn, Connie S; Doms, Robert W; Bertolotti-Ciarlet, Andrea

2005-12-01

Crimean-Congo hemorrhagic fever virus (CCHFV), a member of the genus Nairovirus of the family Bunyaviridae, causes severe disease in humans with high rates of mortality. The virus has a tripartite genome composed of a small (S), a medium (M) and a large (L) RNA segment; the M segment encodes the two viral glycoproteins, G(N) and G(C). Whilst relatively few full-length M segment sequences are available, it is apparent that both G(N) and G(C) may exhibit significant sequence diversity. It is unknown whether considerable antigenic differences exist between divergent CCHFV strains, or whether there are conserved neutralizing epitopes. The M segments derived from viral isolates of a human case of CCHF in South Africa (SPU 41/84), an infected tick (Hyalomma marginatum) in South Africa (SPU 128/81), a human case in Congo (UG 3010), an infected individual in Uzbekistan (U2-2-002) and an infected tick (Hyalomma asiaticum) in China (Hy13) were sequenced fully, and the glycoproteins were expressed. These novel sequences showed high variability in the N-terminal region of G(N) and more modest differences in the remainder of G(N) and in G(C). Phylogenetic analyses placed these newly identified strains in three of the four previously described M segment groups. Studies with a panel of mAbs specific to G(N) and G(C) indicated that there were significant antigenic differences between the M segment groups, although several neutralizing epitopes in both G(N) and G(C) were conserved among all strains examined. Thus, the genetic diversity exhibited by CCHFV strains results in significant antigenic differences that will need to be taken into consideration for vaccine development.

Comparative analysis of field-isolate and monkey-adapted Plasmodium vivax genomes.

PubMed

Chan, Ernest R; Barnwell, John W; Zimmerman, Peter A; Serre, David

2015-03-01

Significant insights into the biology of Plasmodium vivax have been gained from the ability to successfully adapt human infections to non-human primates. P. vivax strains grown in monkeys serve as a renewable source of parasites for in vitro and ex vivo experimental studies and functional assays, or for studying in vivo the relapse characteristics, mosquito species compatibilities, drug susceptibility profiles or immune responses towards potential vaccine candidates. Despite the importance of these studies, little is known as to how adaptation to a different host species may influence the genome of P. vivax. In addition, it is unclear whether these monkey-adapted strains consist of a single clonal population of parasites or if they retain the multiclonal complexity commonly observed in field isolates. Here we compare the genome sequences of seven P. vivax strains adapted to New World monkeys with those of six human clinical isolates collected directly in the field. We show that the adaptation of P. vivax parasites to monkey hosts, and their subsequent propagation, did not result in significant modifications of their genome sequence and that these monkey-adapted strains recapitulate the genomic diversity of field isolates. Our analyses also reveal that these strains are not always genetically homogeneous and should be analyzed cautiously. Overall, our study provides a framework to better leverage this important research material and fully utilize this resource for improving our understanding of P. vivax biology.

Comparative Analysis of Field-Isolate and Monkey-Adapted Plasmodium vivax Genomes

PubMed Central

Chan, Ernest R.; Barnwell, John W.; Zimmerman, Peter A.; Serre, David

2015-01-01

Significant insights into the biology of Plasmodium vivax have been gained from the ability to successfully adapt human infections to non-human primates. P. vivax strains grown in monkeys serve as a renewable source of parasites for in vitro and ex vivo experimental studies and functional assays, or for studying in vivo the relapse characteristics, mosquito species compatibilities, drug susceptibility profiles or immune responses towards potential vaccine candidates. Despite the importance of these studies, little is known as to how adaptation to a different host species may influence the genome of P. vivax. In addition, it is unclear whether these monkey-adapted strains consist of a single clonal population of parasites or if they retain the multiclonal complexity commonly observed in field isolates. Here we compare the genome sequences of seven P. vivax strains adapted to New World monkeys with those of six human clinical isolates collected directly in the field. We show that the adaptation of P. vivax parasites to monkey hosts, and their subsequent propagation, did not result in significant modifications of their genome sequence and that these monkey-adapted strains recapitulate the genomic diversity of field isolates. Our analyses also reveal that these strains are not always genetically homogeneous and should be analyzed cautiously. Overall, our study provides a framework to better leverage this important research material and fully utilize this resource for improving our understanding of P. vivax biology. PMID:25768941

Screening of bacterial strains isolated from uranium mill tailings porewaters for bioremediation purposes.

PubMed

Sánchez-Castro, Iván; Amador-García, Ahinara; Moreno-Romero, Cristina; López-Fernández, Margarita; Phrommavanh, Vannapha; Nos, Jeremy; Descostes, Michael; Merroun, Mohamed L

2017-01-01

The present work characterizes at different levels a number of bacterial strains isolated from porewaters sampled in the vicinity of two French uranium tailing repositories. The 16S rRNA gene from 33 bacterial isolates, corresponding to the different morphotypes recovered, was almost fully sequenced. The resulting sequences belonged to 13 bacterial genera comprised in the phyla Firmicutes, Actinobacteria and Proteobacteria. Further characterization at physiological level and metals/metalloid tolerance provided evidences for an appropriate selection of bacterial strains potentially useful for immobilization of uranium and other common contaminants. By using High Resolution Transmission Electron Microscope (HRTEM), this potential ability to immobilize uranium as U phosphate mineral phases was confirmed for the bacterial strains Br3 and Br5 corresponding to Arthrobacter sp. and Microbacterium oxydans, respectively. Scanning Transmission Electron Microscope- High-Angle Annular Dark-Field (STEM-HAADF) analysis showed U accumulates on the surface and within bacterial cytoplasm, in addition to the extracellular space. Energy Dispersive X-ray (EDX) element-distribution maps demonstrated the presence of U and P within these accumulates. These results indicate the potential of certain bacterial strains isolated from porewaters of U mill tailings for immobilizing uranium, likely as uranium phosphates. Some of these bacterial isolates might be considered as promising candidates in the design of uranium bioremediation strategies. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular characterization of two rare human G8P[14] rotavirus strains, detected in Italy in 2012.

PubMed

Delogu, Roberto; Ianiro, Giovanni; Morea, Anna; Chironna, Maria; Fiore, Lucia; Ruggeri, Franco M

2016-10-01

Since 2007, the Italian Rotavirus Surveillance Program (RotaNet-Italy) has monitored the diversity and distribution of genotypes identified in children hospitalized with rotavirus acute gastroenteritis. We report the genomic characterization of two rare human G8P[14] rotavirus strains, identified in two children hospitalized with acute gastroenteritis in the southern Italian region of Apulia during rotavirus strain surveillance in 2012. Both strains showed a G8-P[14]-I2-R2-C2-M2-A11-N2-T6-E2-H3 genomic constellation (DS-1-like genomic background). Phylogenetic analysis of each genome segment revealed a mixed configuration of genes of animal and zoonotic human origin, indicating that genetic reassortment events generated these unusual human strains. Eight out of 11 genes (VP1, VP2, VP3, VP6, VP7, NSP3, NSP4 and NSP5) of the Italian G8P[14] strains exhibited close identity with a Spanish sheep strain, whereas the remaining genes (VP4, NSP1 and NSP2) were more closely related to human strains. The amino acid sequences of the antigenic regions of outer capsid proteins VP4 and VP7 were compared with vaccine and field strains, showing high conservation between the amino acid sequences of Apulia G8P[14] strains and human and animal strains bearing G8 and/or P[14] proteins, and revealing many substitutions with respect to the RotaTeq™ and Rotarix™ vaccine strains. Conversely, the amino acid analysis of the four antigenic sites of VP6 revealed a high degree of conservation between the two Apulia strains and the human and animal strains analyzed. These results reinforce the potential role of interspecies transmission and reassortment in generating novel rotavirus strains that might not be fully contrasted by current vaccines. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhanced arbovirus surveillance with deep sequencing: Identification of novel rhabdoviruses and bunyaviruses in Australian mosquitoes.

PubMed

Coffey, Lark L; Page, Brady L; Greninger, Alexander L; Herring, Belinda L; Russell, Richard C; Doggett, Stephen L; Haniotis, John; Wang, Chunlin; Deng, Xutao; Delwart, Eric L

2014-01-05

Viral metagenomics characterizes known and identifies unknown viruses based on sequence similarities to any previously sequenced viral genomes. A metagenomics approach was used to identify virus sequences in Australian mosquitoes causing cytopathic effects in inoculated mammalian cell cultures. Sequence comparisons revealed strains of Liao Ning virus (Reovirus, Seadornavirus), previously detected only in China, livestock-infecting Stretch Lagoon virus (Reovirus, Orbivirus), two novel dimarhabdoviruses, named Beaumont and North Creek viruses, and two novel orthobunyaviruses, named Murrumbidgee and Salt Ash viruses. The novel virus proteomes diverged by ≥ 50% relative to their closest previously genetically characterized viral relatives. Deep sequencing also generated genomes of Warrego and Wallal viruses, orbiviruses linked to kangaroo blindness, whose genomes had not been fully characterized. This study highlights viral metagenomics in concert with traditional arbovirus surveillance to characterize known and new arboviruses in field-collected mosquitoes. Follow-up epidemiological studies are required to determine whether the novel viruses infect humans. © 2013 Elsevier Inc. All rights reserved.

Large-Scale Comparative Phenotypic and Genomic Analyses Reveal Ecological Preferences of Shewanella Species and Identify Metabolic Pathways Conserved at the Genus Level ▿ †

PubMed Central

Rodrigues, Jorge L. M.; Serres, Margrethe H.; Tiedje, James M.

2011-01-01

The use of comparative genomics for the study of different microbiological species has increased substantially as sequence technologies become more affordable. However, efforts to fully link a genotype to its phenotype remain limited to the development of one mutant at a time. In this study, we provided a high-throughput alternative to this limiting step by coupling comparative genomics to the use of phenotype arrays for five sequenced Shewanella strains. Positive phenotypes were obtained for 441 nutrients (C, N, P, and S sources), with N-based compounds being the most utilized for all strains. Many genes and pathways predicted by genome analyses were confirmed with the comparative phenotype assay, and three degradation pathways believed to be missing in Shewanella were confirmed as missing. A number of previously unknown gene products were predicted to be parts of pathways or to have a function, expanding the number of gene targets for future genetic analyses. Ecologically, the comparative high-throughput phenotype analysis provided insights into niche specialization among the five different strains. For example, Shewanella amazonensis strain SB2B, isolated from the Amazon River delta, was capable of utilizing 60 C compounds, whereas Shewanella sp. strain W3-18-1, isolated from deep marine sediment, utilized only 25 of them. In spite of the large number of nutrient sources yielding positive results, our study indicated that except for the N sources, they were not sufficiently informative to predict growth phenotypes from increasing evolutionary distances. Our results indicate the importance of phenotypic evaluation for confirming genome predictions. This strategy will accelerate the functional discovery of genes and provide an ecological framework for microbial genome sequencing projects. PMID:21642407

Molecular characterization of infectious pancreatic necrosis virus strains isolated from the three types of salmonids farmed in Chile.

PubMed

Manríquez, René A; Vera, Tamara; Villalba, Melina V; Mancilla, Alejandra; Vakharia, Vikram N; Yañez, Alejandro J; Cárcamo, Juan G

2017-01-31

The infectious pancreatic necrosis virus (IPNV) causes significant economic losses in Chilean salmon farming. For effective sanitary management, the IPNV strains present in Chile need to be fully studied, characterized, and constantly updated at the molecular level. In this study, 36 Chilean IPNV isolates collected over 6 years (2006-2011) from Salmo salar, Oncorhynchus mykiss, and Oncorhynchus kisutch were genotypically characterized. Salmonid samples were obtained from freshwater, estuary, and seawater sources from central, southern, and the extreme-south of Chile (35° to 53°S). Sequence analysis of the VP2 gene classified 10 IPNV isolates as genogroup 1 and 26 as genogroup 5. Analyses indicated a preferential, but not obligate, relationship between genogroup 5 isolates and S. salar infection. Fifteen genogroup 5 and nine genogroup 1 isolates presented VP2 gene residues associated with high virulence (i.e. Thr, Ala, and Thr at positions 217, 221, and 247, respectively). Four genogroup 5 isolates presented an oddly long VP5 deduced amino acid sequence (29.6 kDa). Analysis of the VP2 amino acid motifs associated with clinical and subclinical infections identified the clinical fingerprint in only genogroup 5 isolates; in contrast, the genogroup 1 isolates presented sequences predominantly associated with the subclinical fingerprint. Predictive analysis of VP5 showed an absence of transmembrane domains and plasma membrane tropism signals. WebLogo analysis of the VP5 BH domains revealed high identities with the marine birnavirus Y-6 and Japanese IPNV strain E1-S. Sequence analysis for putative 25 kDa proteins, coded by the ORF between VP2 and VP4, exhibited three putative nuclear localization sequences and signals of mitochondrial tropism in two isolates. This study provides important advances in updating the characterizations of IPNV strains present in Chile. The results from this study will help in identifying epidemiological links and generating specific biotechnological tools for controlling IPNV outbreaks in Chilean salmon farming.

The s29x gene of symbiotic bacteria in Amoeba proteus with a novel promoter.

PubMed

Pak, J W; Jeon, K W

1996-05-24

Gram-symbiotic bacteria (called X-bacteria), present in the xD strain of Amoeba proteus as required cell components, synthesize and export a large amount of a 29-kDa protein, S29x. S29x is exported into the host's cytoplasm across the bacterial membranes and the symbiosome membrane. The complete nucleotide (nt) sequence of the s29x gene of X-bacteria has been determined, and the promoter sequence and tsp have also been identified. The gene has a nonconventional promoter with putative nt sequences different from the known consensus sequences. When Escherichia coli cells are transformed with s29x, the gene is expressed and the product is secreted into the culture medium. Functions of S29x are not fully known, but it is suspected that S29x plays an important role in the symbiotic relationship between amoebae and X-bacteria.

Enhanced adherence of methicillin-resistant Staphylococcus pseudintermedius sequence type 71 to canine and human corneocytes

PubMed Central

2014-01-01

The recent worldwide spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) in dogs is a reason for concern due to the typical multidrug resistance patterns displayed by some MRSP lineages such as sequence type (ST) 71. The objective of this study was to compare the in vitro adherence properties between MRSP and methicillin-susceptible (MSSP) strains. Four MRSP, including a human and a canine strain belonging to ST71 and two canine non-ST71 strains, and three genetically unrelated MSSP were tested on corneocytes collected from five dogs and six humans. All strains were fully characterized with respect to genetic background and cell wall-anchored protein (CWAP) gene content. Seventy-seven strain-corneocyte combinations were tested using both exponential- and stationary-phase cultures. Negative binomial regression analysis of counts of bacterial cells adhering to corneocytes revealed that adherence was significantly influenced by host and strain genotype regardless of bacterial growth phase. The two MRSP ST71 strains showed greater adherence than MRSP non-ST71 (p < 0.0001) and MSSP (p < 0.0001). This phenotypic trait was not associated to any specific CWAP gene. In general, S. pseudintermedius adherence to canine corneocytes was significantly higher compared to human corneocytes (p < 0.0001), but the MRSP ST71 strain of human origin adhered equally well to canine and human corneocytes, suggesting that MRSP ST71 may be able to adapt to human skin. The genetic basis of the enhanced in vitro adherence of ST71 needs to be elucidated as this phenotypic trait may be associated to the epidemiological success and zoonotic potential of this epidemic MRSP clone. PMID:24957656

Vibrio parahaemolyticus isolates from southeastern Chinese coast are genetically diverse with circulation of clonal complex 3 strains since 2002.

PubMed

Yu, Ying; Hu, Weizhao; Wu, Beibei; Zhang, Peipei; Chen, Jianshun; Wang, Shuna; Fang, Weihuan

2011-11-01

Multilocus sequence typing (MLST) was used to examine the clonal relationship and genetic diversity of 71 Vibrio parahaemolyticus isolates from clinical and seafood-related sources in southeastern Chinese coast between 2002 and 2009. The tested isolates fell into 61 sequence types (STs). Of 17 clinical isolates, 7 belonged to ST3 of the pandemic clonal complex 3, with 3 strains isolated in 2002. Although there was no apparent clonal relationship found between clinical strains and those from seafood-related sources positive with pathogenic markers, there were clonal relationships between clinical strains from this study and those from environmental sources in other parts of China. Phylogenetic analysis showed that strains of 112 STs (61 STs from this study and 51 retrieved from PUBMLST database covering different continents) could be divided into four branches. The vast majority of our isolates and those from other countries were genetically diverse and clustered into two major branches of mixed distribution (of geographic origins and sample sources), whereas five STs representing six isolates split as two minor branches because of divergence of their recA genes, which had 80%-82% nucleotide identity to typical V. parahaemolyticus strains and 73.3%-76.9% identity to the CDS24 of a Vibrio sp. plasmid p23023, indicating that the recA gene might have recombined by lateral gene transfer. This was further supported by a high ratio of recombination to mutation (3.038) for recA. In conclusion, MLST with fully extractable database is a powerful system for analysis of clonal relationship for strains of a particular region in a national or global scale as well as between clinical and environmental or food-related strains.

Molecular and Epidemiological Review of Toxigenic Diphtheria Infections in England between 2007 and 2013

PubMed Central

Both, Leonard; Collins, Sarah; de Zoysa, Aruni; White, Joanne; Mandal, Sema

2014-01-01

Human infections caused by toxigenic corynebacteria occur sporadically across Europe. In this report, we undertook the epidemiological and molecular characterization of all toxigenic corynebacterium strains isolated in England between January 2007 and December 2013. Epidemiological aspects include case demographics, risk factors, clinical presentation, treatment, and outcome. Molecular characterization was performed using multilocus sequence typing (MLST) alongside traditional phenotypic methods. In total, there were 20 cases of toxigenic corynebacteria; 12 (60.0%) were caused by Corynebacterium ulcerans, where animal contact was the predominant risk factor. The remaining eight (40.0%) were caused by Corynebacterium diphtheriae strains; six were biovar mitis, which were associated with recent travel abroad. Adults 45 years and older were particularly affected (55.0%; 11/20), and typical symptoms included sore throat and fever. Respiratory diphtheria with the absence of a pharyngeal membrane was the most common presentation (50.0%; 10/20). None of the eight C. diphtheriae cases were fully immunized. Diphtheria antitoxin was issued in two (9.5%) cases; both survived. Two (9.5%) cases died, one due to a C. diphtheriae infection and one due to C. ulcerans. MLST demonstrated that the majority (87.5%; 7/8) of C. diphtheriae strains represented new sequence types (STs). By adapting several primer sequences, the MLST genes in C. ulcerans were also amplified, thereby providing the basis for extension of the MLST scheme, which is currently restricted to C. diphtheriae. Despite high population immunity, occasional toxigenic corynebacterium strains are identified in England and continued surveillance is required. PMID:25502525

Characterization of a new strain of Taura syndrome virus (TSV) from Colombian shrimp farms and the implication in the selection of TSV resistant lines.

PubMed

Aranguren, Luis Fernando; Salazar, Marcela; Tang, Kathy; Caraballo, Xenia; Lightner, Donald

2013-01-01

Prior to 2004, Colombian shrimp farming benefited from a selection program in which Penaeus vannamei stocks were developed with resistance to Taura syndrome disease (TS). However since 2004, TS reappeared as a significant disease. In 2010, an apparently new strain of TSV (designated as CO 10) was collected in Colombia. Its genome was sequenced and compared with six other fully sequenced isolates. This analysis revealed that the TSV CO 10 is closely related to the isolates from Hawaii and Venezuela. Phylogenetic analysis based on capsid protein 2 (CP2) region from 59 TSV isolates shows that the recent Colombian isolates (2006-2010) form a new cluster and differ from the previous Colombia isolates (1994-1998) by 4% in nucleotide sequence. The virulence of this CO 10 isolate was similar to a Belize TSV determined through experimental infection in P. vannamei showing 100% mortalities and similar survival curves. By RT-qPCR for TSV, the viral loads were also close in the infected shrimp from both CO 10 and Belize at the order of 1×10(10) copies per μl RNA. To develop TSV-resistant lines, the candidate shrimp should be challenged with virus strains that have been isolated most recently from the regions where they will be cultured. This study suggests that the TSV present in Colombian shrimp farms during the last 5 years is a new TSV strain with high virulence. Copyright © 2012 Elsevier Inc. All rights reserved.

Omics Analyses of Trichoderma reesei CBS999.97 and QM6a Indicate the Relevance of Female Fertility to Carbohydrate-Active Enzyme and Transporter Levels.

PubMed

Tisch, Doris; Pomraning, Kyle R; Collett, James R; Freitag, Michael; Baker, Scott E; Chen, Chia-Ling; Hsu, Paul Wei-Che; Chuang, Yu Chien; Schuster, Andre; Dattenböck, Christoph; Stappler, Eva; Sulyok, Michael; Böhmdorfer, Stefan; Oberlerchner, Josua; Wang, Ting-Fang; Schmoll, Monika

2017-11-15

The filamentous fungus Trichoderma reesei is found predominantly in the tropics but also in more temperate regions, such as Europe, and is widely known as a producer of large amounts of plant cell wall-degrading enzymes. We sequenced the genome of the sexually competent isolate CBS999.97, which is phenotypically different from the female sterile strain QM6a but can cross sexually with QM6a. Transcriptome data for growth on cellulose showed that entire carbohydrate-active enzyme (CAZyme) families are consistently differentially regulated between these strains. We evaluated backcrossed strains of both mating types, which acquired female fertility from CBS999.97 but maintained a mostly QM6a genetic background, and we could thereby distinguish between the effects of strain background and female fertility or mating type. We found clear regulatory differences associated with female fertility and female sterility, including regulation of CAZyme and transporter genes. Analysis of carbon source utilization, transcriptomes, and secondary metabolites in these strains revealed that only a few changes in gene regulation are consistently correlated with different mating types. Different strain backgrounds (QM6a versus CBS999.97) resulted in the most significant alterations in the transcriptomes and in carbon source utilization, with decreased growth of CBS999.97 on several amino acids (for example proline or alanine), which further correlated with the downregulation of genes involved in the respective pathways. In combination, our findings support a role of fertility-associated processes in physiology and gene regulation and are of high relevance for the use of sexual crossing in combining the characteristics of two compatible strains or quantitative trait locus (QTL) analysis. IMPORTANCE Trichoderma reesei is a filamentous fungus with a high potential for secretion of plant cell wall-degrading enzymes. We sequenced the genome of the fully fertile field isolate CBS999.97 and analyzed its gene regulation characteristics in comparison with the commonly used laboratory wild-type strain QM6a, which is not female fertile. Additionally, we also evaluated fully fertile strains with genotypes very close to that of QM6a in order to distinguish between strain-specific and fertility-specific characteristics. We found that QM6a and CBS999.97 clearly differ in their growth patterns on different carbon sources, CAZyme gene regulation, and secondary metabolism. Importantly, we found altered regulation of 90 genes associated with female fertility, including CAZyme genes and transporter genes, but only minor mating type-dependent differences. Hence, when using sexual crossing in research and for strain improvement, it is important to consider female fertile and female sterile strains for comparison with QM6a and to achieve optimal performance. Copyright © 2017 Tisch et al.

Comparative Genomics Study of Multi-Drug-Resistance Mechanisms in the Antibiotic-Resistant Streptococcus suis R61 Strain

PubMed Central

Zhang, Anding; Wu, Jiayan; Chen, Bo; Hua, Yafeng; Yu, Jun; Chen, Huanchun; Xiao, Jingfa; Jin, Meilin

2011-01-01

Background Streptococcus suis infections are a serious problem for both humans and pigs worldwide. The emergence and increasing prevalence of antibiotic-resistant S. suis strains pose significant clinical and societal challenges. Results In our study, we sequenced one multi-drug-resistant S. suis strain, R61, and one S. suis strain, A7, which is fully sensitive to all tested antibiotics. Comparative genomic analysis revealed that the R61 strain is phylogenetically distinct from other S. suis strains, and the genome of R61 exhibits extreme levels of evolutionary plasticity with high levels of gene gain and loss. Our results indicate that the multi-drug-resistant strain R61 has evolved three main categories of resistance. Conclusions Comparative genomic analysis of S. suis strains with diverse drug-resistant phenotypes provided evidence that horizontal gene transfer is an important evolutionary force in shaping the genome of multi-drug-resistant strain R61. In this study, we discovered novel and previously unexamined mutations that are strong candidates for conferring drug resistance. We believe that these mutations will provide crucial clues for designing new drugs against this pathogen. In addition, our work provides a clear demonstration that the use of drugs has driven the emergence of the multi-drug-resistant strain R61. PMID:21966396

Comparative genomics study of multi-drug-resistance mechanisms in the antibiotic-resistant Streptococcus suis R61 strain.

PubMed

Hu, Pan; Yang, Ming; Zhang, Anding; Wu, Jiayan; Chen, Bo; Hua, Yafeng; Yu, Jun; Chen, Huanchun; Xiao, Jingfa; Jin, Meilin

2011-01-01

Streptococcus suis infections are a serious problem for both humans and pigs worldwide. The emergence and increasing prevalence of antibiotic-resistant S. suis strains pose significant clinical and societal challenges. In our study, we sequenced one multi-drug-resistant S. suis strain, R61, and one S. suis strain, A7, which is fully sensitive to all tested antibiotics. Comparative genomic analysis revealed that the R61 strain is phylogenetically distinct from other S. suis strains, and the genome of R61 exhibits extreme levels of evolutionary plasticity with high levels of gene gain and loss. Our results indicate that the multi-drug-resistant strain R61 has evolved three main categories of resistance. Comparative genomic analysis of S. suis strains with diverse drug-resistant phenotypes provided evidence that horizontal gene transfer is an important evolutionary force in shaping the genome of multi-drug-resistant strain R61. In this study, we discovered novel and previously unexamined mutations that are strong candidates for conferring drug resistance. We believe that these mutations will provide crucial clues for designing new drugs against this pathogen. In addition, our work provides a clear demonstration that the use of drugs has driven the emergence of the multi-drug-resistant strain R61.

Simultaneous inactivation of sigma factors B and D interferes with light acclimation of the cyanobacterium Synechocystis sp. strain PCC 6803.

PubMed

Pollari, Maija; Ruotsalainen, Virpi; Rantamäki, Susanne; Tyystjärvi, Esa; Tyystjärvi, Taina

2009-06-01

In cyanobacteria, gene expression is regulated mainly at the level of transcription initiation, which is mediated by the RNA polymerase holoenzyme. The RNA polymerase core is catalytically active, while the sigma factor recognizes promoter sequences. Group 2 sigma factors are similar to the principal sigma factor but are nonessential. Group 2 sigma factors SigB and SigD are structurally the most similar sigma factors in Synechocystis sp. strain PCC 6803. Under standard growth conditions, simultaneous inactivation of sigB and sigD genes did not affect the growth, but the photosynthesis and growth of the DeltasigBD strain were slower than in the control strain at double light intensity. Light-saturated electron transfer rates and the fluorescence and thermoluminescence measurements showed that photosynthetic light reactions are fully functional in the DeltasigBD strain, but absorption and 77 K emission spectra measurements suggest that the light-harvesting system of the DeltasigBD strain does not acclimate normally to higher light intensity. Furthermore, the DeltasigBD strain is more sensitive to photoinhibition under bright light because impaired upregulation of psbA genes leads to insufficient PSII repair.

A conserved virulence plasmidic region contributes to the virulence of the multiresistant Escherichia coli meningitis strain S286 belonging to phylogenetic group C.

PubMed

Lemaître, Chloé; Mahjoub-Messai, Farah; Dupont, Damien; Caro, Valérie; Diancourt, Laure; Bingen, Edouard; Bidet, Philippe; Bonacorsi, Stéphane

2013-01-01

Recent isolation of the non-K1 Escherichia coli neonatal meningitis strain S286, belonging to phylogroup C, which is closely related to major group B1, and producing an extended-spectrum beta-lactamase, encouraged us to seek the genetic determinants responsible for its virulence. We show that S286 belongs to the sequence O type ST23O78 and harbors 4 large plasmids. The largest one, pS286colV (~120 kb), not related to resistance, contains genes characteristic of a Conserved Virulence Plasmidic (CVP) region initially identified in B2 extra-intestinal avian pathogenic E. coli (APEC) strains and in the B2 neonatal meningitis E. coli strain S88. The sequence of this CVP region has a strong homology (98%) with that of the recently sequenced plasmid pChi7122-1 of the O78 APEC strain Chi7122. A CVP plasmid-cured variant of S286 was less virulent than the wild type strain in a neonatal rat sepsis model with a significant lower level of bacteremia at 24 h (4.1 ± 1.41 versus 2.60 ± 0.16 log CFU/ml, p = 0.001) and mortality. However, the mortality in the model of adult mice was comparable between wild type and variant indicating that pS286colV is not sufficient by itself to fully explain the virulence of S286. Gene expression analysis of pS286colV in iron depleted environment was very close to that of pS88, suggesting that genes of CVP region may be expressed similarly in two very different genetic backgrounds (group C versus group B2). Screening a collection of 178 human A/B1 extraintestinal pathogenic E. coli (ExPEC) strains revealed that the CVP region is highly prevalent (23%) and MLST analysis indicated that these CVP positive strains belong to several clusters and mostly to phylogroup C. The virulence of S286 is explained in part by the presence of CVP region and this region has spread in different clusters of human A/B1 ExPEC, especially in group C.

Molecular and Genomic Characterization of Vibrio mimicus Isolated from a Frozen Shrimp Processing Facility in Mexico

PubMed Central

Guardiola-Avila, Iliana; Acedo-Felix, Evelia; Sifuentes-Romero, Itzel; Yepiz-Plascencia, Gloria; Gomez-Gil, Bruno; Noriega-Orozco, Lorena

2016-01-01

Vibrio mimicus is a gram-negative bacterium responsible for diseases in humans. Three strains of V. mimicus identified as V. mimicus 87, V. mimicus 92 and V. mimicus 93 were isolated from a shrimp processing facility in Guaymas, Sonora, Mexico. The strains were analyzed using several molecular techniques and according to the cluster analysis they were different, their similarities ranged between 51.3% and 71.6%. ERIC-PCR and RAPD (vmh390R) were the most discriminatory molecular techniques for the differentiation of these strains. The complete genomes of two strains (V. mimicus 87, renamed as CAIM 1882, and V. mimicus 92, renamed as CAIM 1883) were sequenced. The sizes of the genomes were 3.9 Mb in both strains, with 2.8 Mb in ChI and 1.1 Mb in ChII. A 12.7% difference was found in the proteome content (BLAST matrix). Several virulence genes were detected (e.g. capsular polysaccharide, an accessory colonization factor and genes involved in quorum-sensing) which were classified in 16 categories. Variations in the gene content between these genomes were observed, mainly in proteins and virulence genes (e.g., hemagglutinin, mobile elements and membrane proteins). According to these results, both strains were different, even when they came from the same source, giving an insight of the diversity of V. mimicus. The identification of various virulence genes, including a not previously reported V. mimicus gene (acfD) in ChI in all sequenced strains, supports the pathogenic potential of this species. Further analysis will help to fully understand their potential virulence, environmental impact and evolution. PMID:26730584

Molecular and Genomic Characterization of Vibrio mimicus Isolated from a Frozen Shrimp Processing Facility in Mexico.

PubMed

Guardiola-Avila, Iliana; Acedo-Felix, Evelia; Sifuentes-Romero, Itzel; Yepiz-Plascencia, Gloria; Gomez-Gil, Bruno; Noriega-Orozco, Lorena

2016-01-01

Vibrio mimicus is a gram-negative bacterium responsible for diseases in humans. Three strains of V. mimicus identified as V. mimicus 87, V. mimicus 92 and V. mimicus 93 were isolated from a shrimp processing facility in Guaymas, Sonora, Mexico. The strains were analyzed using several molecular techniques and according to the cluster analysis they were different, their similarities ranged between 51.3% and 71.6%. ERIC-PCR and RAPD (vmh390R) were the most discriminatory molecular techniques for the differentiation of these strains. The complete genomes of two strains (V. mimicus 87, renamed as CAIM 1882, and V. mimicus 92, renamed as CAIM 1883) were sequenced. The sizes of the genomes were 3.9 Mb in both strains, with 2.8 Mb in ChI and 1.1 Mb in ChII. A 12.7% difference was found in the proteome content (BLAST matrix). Several virulence genes were detected (e.g. capsular polysaccharide, an accessory colonization factor and genes involved in quorum-sensing) which were classified in 16 categories. Variations in the gene content between these genomes were observed, mainly in proteins and virulence genes (e.g., hemagglutinin, mobile elements and membrane proteins). According to these results, both strains were different, even when they came from the same source, giving an insight of the diversity of V. mimicus. The identification of various virulence genes, including a not previously reported V. mimicus gene (acfD) in ChI in all sequenced strains, supports the pathogenic potential of this species. Further analysis will help to fully understand their potential virulence, environmental impact and evolution.

The Genetics of Symbiotic Nitrogen Fixation: Comparative Genomics of 14 Rhizobia Strains by Resolution of Protein Clusters

PubMed Central

Black, Michael; Moolhuijzen, Paula; Chapman, Brett; Barrero, Roberto; Howieson, John; Hungria, Mariangela; Bellgard, Matthew

2012-01-01

The symbiotic relationship between legumes and nitrogen fixing bacteria is critical for agriculture, as it may have profound impacts on lowering costs for farmers, on land sustainability, on soil quality, and on mitigation of greenhouse gas emissions. However, despite the importance of the symbioses to the global nitrogen cycling balance, very few rhizobial genomes have been sequenced so far, although there are some ongoing efforts in sequencing elite strains. In this study, the genomes of fourteen selected strains of the order Rhizobiales, all previously fully sequenced and annotated, were compared to assess differences between the strains and to investigate the feasibility of defining a core ‘symbiome’—the essential genes required by all rhizobia for nodulation and nitrogen fixation. Comparison of these whole genomes has revealed valuable information, such as several events of lateral gene transfer, particularly in the symbiotic plasmids and genomic islands that have contributed to a better understanding of the evolution of contrasting symbioses. Unique genes were also identified, as well as omissions of symbiotic genes that were expected to be found. Protein comparisons have also allowed the identification of a variety of similarities and differences in several groups of genes, including those involved in nodulation, nitrogen fixation, production of exopolysaccharides, Type I to Type VI secretion systems, among others, and identifying some key genes that could be related to host specificity and/or a better saprophytic ability. However, while several significant differences in the type and number of proteins were observed, the evidence presented suggests no simple core symbiome exists. A more abstract systems biology concept of nitrogen fixing symbiosis may be required. The results have also highlighted that comparative genomics represents a valuable tool for capturing specificities and generalities of each genome. PMID:24704847

[Construction of the superantigen SEA transfected laryngocarcinoma cells].

PubMed

Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua

2013-04-01

To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.

Characterization of Neisseria meningitidis Isolates from Recent Outbreaks in Ethiopia and Comparison with Those Recovered during the Epidemic of 1988 to 1989

PubMed Central

Norheim, Gunnstein; Rosenqvist, Einar; Aseffa, Abraham; Yassin, Mohammed Ahmed; Mengistu, Getahun; Kassu, Afework; Fikremariam, Dereje; Tamire, Wegene; Høiby, E. Arne; Alebel, Tsegaye; Berhanu, Degu; Merid, Yarid; Harboe, Morten; Caugant, Dominique A.

2006-01-01

The objectives of this study were to collect and characterize epidemic meningococcal isolates from Ethiopia from 2002 to 2003 and to compare them to 21 strains recovered during the previous large epidemic of 1988 to 1989. Ninety-five patients in all age groups with clinical signs of meningitis and a turbid cerebrospinal fluid (CSF) sample were included in the study of isolates from 2002 to 2003. Seventy-one patients (74.7%) were confirmed as having Neisseria meningitidis either by culture (n = 40) or by porA PCR (n = 31) of their CSF. The overall case fatality rate (CFR) was 11.6%; the N. meningitidis-specific CFR was 4.2%. All 40 strains were fully susceptible to all antibiotics tested except sulfonamide, were serotyped as A:4/21:P1.20,9, and belonged to sequence type 7 (ST-7). The strains from 1988 to 1989 were also equally susceptible and were characterized as A:4/21:P1.20,9, but they belonged to ST-5. Antigenic characterization of the strains revealed differences in the repertoire of lipooligosaccharides and Opa proteins between the old and the recent strains. PCR analysis of the nine lgt genes revealed the presence of the lgtAHFG genes in both old and recent strains; lgtB was present in only some of the strains, but no correlation with sequence type was observed. Further analysis showed that in addition to their pgm alleles, the Ethiopian ST-5 and ST-7 strains also differed in their tbpB, opa, fetA, and lgtA genes. The occurrence of new antigenic structures in strains sharing the same serogroup, PorA, and PorB may help explain the replacement of ST-5 by ST-7 in the African meningitis belt. PMID:16517868

Detection and characterization of a rhabdovirus causing mortality in black bullhead catfish, Ameiurus melas.

PubMed

Bedendo, Giulia; Panzarin, Valentina; Fortin, Andrea; Zamperin, Gianpiero; Pretto, Tobia; Buratin, Alessandra; Quartesan, Rosita; Sabbion, Matteo; Salogni, Cristian; Pascoli, Francesco; Toffan, Anna

2018-07-01

This study fully describes a severe disease outbreak occurred in 2016 in black bullhead catfish farmed in Italy. Affected fish showed nervous clinical signs as well as emaciations and haemorrhagic petechiae on the skin at the fin bases, abdomen and gills. Viral isolation in cell culture allowed the subsequent identification of a rhabdovirus, tentatively named ictalurid rhabdovirus (IcRV), through electron microscopy, immunofluorescence and whole genome sequencing (WGS). The newly isolated virus, together with 14 additional viral strains stored in our repository and detected during similar mortality episodes in the period 1993-2016, was phylogenetically analysed on the basis of the nucleoprotein and the glycoprotein nucleotide and amino acid sequences. The genetic distances among Italian IcRV strains were also estimated. Our results show that all the IcRV strains belong to the genus Sprivivirus and are closely related to the tench rhabdovirus (TenRV). Italian catfish production is constantly decreasing, mainly due to viral infections, which include the newly characterized IcRV. Data presented in this work will assist to investigate the molecular epidemiology and the diffusive dynamics of this virus and to develop adequate surveillance activities. © 2018 The Authors. Journal of Fish Diseases Published by John Wiley & Sons Ltd.

Molecular Evolution of Enterovirus 68 Detected in the Philippines

PubMed Central

Imamura, Tadatsugu; Suzuki, Akira; Lupisan, Socorro; Okamoto, Michiko; Aniceto, Rapunzel; Egos, Rutchie J.; Daya, Edgardo E.; Tamaki, Raita; Saito, Mariko; Fuji, Naoko; Roy, Chandra Nath; Opinion, Jaime M.; Santo, Arlene V.; Macalalad, Noel G.; Tandoc, Amado; Sombrero, Lydia; Olveda, Remigio; Oshitani, Hitoshi

2013-01-01

Background Detection of Enterovirus 68 (EV68) has recently been increased. However, underlying evolutionary mechanism of this increasing trend is not fully understood. Methods Nasopharyngeal swabs were collected from 5,240 patients with acute respiratory infections in the Philippines from June 2009 to December 2011. EV68 was detected by polymerase chain reaction (PCR) targeting for 5′ untranslated region (5′UTR), viral protein 1 (VP1), and VP4/VP2. Phylogenetic trees were generated using the obtained sequences. Results Of the 5,240 tested samples, 12 EV68 positive cases were detected between August and December in 2011 (detection rate, 0.23%). The detection rate was higher among inpatients than outpatients (p<0.0001). Among VP1 sequences detected from 7 patients in 2011, 5 in lineage 2 were diverged from those detected in the Philippines in 2008, however, 2 in lineage 3 were not diverged from strains detected in the Philippines in 2008 but closely associated with strains detected in the United States. Combined with our previous report, EV68 occurrences were observed twice in the Philippines within the last four years. Conclusions EV68 detections might be occurring in cyclic patterns, and viruses might have been maintained in the community while some strains might have been newly introduced. PMID:24073203

Cumulative Axial and Torsional Fatigue: An Investigation of Load-Type Sequencing Effects

NASA Technical Reports Server (NTRS)

Kalluri, Sreeramesh; Bonacuse, Peter J.

2000-01-01

Cumulative fatigue behavior of a wrought cobalt-base superalloy, Haynes 188 was investigated at 538 C under various single-step sequences of axial and torsional loading conditions. Initially, fully-reversed, axial and torsional fatigue tests were conducted under strain control at 538 C on thin-walled tubular specimens to establish baseline fatigue life relationships. Subsequently, four sequences (axial/axial, torsional/torsional, axial/torsional, and torsional/axial) of two load-level fatigue tests were conducted to characterize both the load-order (high/low) and load-type sequencing effects. For the two load-level tests, summations of life fractions and the remaining fatigue lives at the second load-level were computed by the Miner's Linear Damage Rule (LDR) and a nonlinear Damage Curve Approach (DCA). In general, for all four cases predictions by LDR were unconservative. Predictions by the DCA were within a factor of two of the experimentally observed fatigue lives for a majority of the cumulative axial and torsional fatigue tests.

The expression of Helicobacter pylori tfs plasticity zone cluster is regulated by pH and adherence, and its composition is associated with differential gastric IL-8 secretion.

PubMed

Silva, Bruno; Nunes, Alexandra; Vale, Filipa F; Rocha, Raquel; Gomes, João Paulo; Dias, Ricardo; Oleastro, Mónica

2017-08-01

Helicobacter pylori virulence is associated with different clinical outcomes. The existence of an intact dupA gene from tfs4b cluster has been suggested as a predictor for duodenal ulcer development. However, the role of tfs plasticity zone clusters in the development of ulcers remains unclear. We studied several H. pylori strains to characterize the gene arrangement of tfs3 and tfs4 clusters and their impact in the inflammatory response by infected gastric cells. The genome of 14 H. pylori strains isolated from Western patients, pediatric (n=10) and adult (n=4), was fully sequenced using the Illumina platform MiSeq, in addition to eight pediatric strains previously sequenced. These strains were used to infect human gastric cells, and the secreted interleukin-8 (IL-8) was quantified by ELISA. The expression of virB2, dupA, virB8, virB10, and virB6 was assessed by quantitative PCR in adherent and nonadherent fractions of H. pylori during in vitro co-infection, at different pH values. We have found that cagA-positive H. pylori strains harboring a complete tfs plasticity zone cluster significantly induce increased production of IL-8 from gastric cells. We have also found that the region spanning from virB2 to virB10 genes constitutes an operon, whose expression is increased in the adherent fraction of bacteria during infection, as well as in both adherent and nonadherent fractions at acidic conditions. A complete tfs plasticity zone cluster is a virulence factor that may be important for the colonization of H. pylori and to the development of severe outcomes of the infection with cagA-positive strains. © 2017 John Wiley & Sons Ltd.

Inactivity periods and postural change speed can explain atypical postural change patterns of Caenorhabditis elegans mutants.

PubMed

Fukunaga, Tsukasa; Iwasaki, Wataru

2017-01-19

With rapid advances in genome sequencing and editing technologies, systematic and quantitative analysis of animal behavior is expected to be another key to facilitating data-driven behavioral genetics. The nematode Caenorhabditis elegans is a model organism in this field. Several video-tracking systems are available for automatically recording behavioral data for the nematode, but computational methods for analyzing these data are still under development. In this study, we applied the Gaussian mixture model-based binning method to time-series postural data for 322 C. elegans strains. We revealed that the occurrence patterns of the postural states and the transition patterns among these states have a relationship as expected, and such a relationship must be taken into account to identify strains with atypical behaviors that are different from those of wild type. Based on this observation, we identified several strains that exhibit atypical transition patterns that cannot be fully explained by their occurrence patterns of postural states. Surprisingly, we found that two simple factors-overall acceleration of postural movement and elimination of inactivity periods-explained the behavioral characteristics of strains with very atypical transition patterns; therefore, computational analysis of animal behavior must be accompanied by evaluation of the effects of these simple factors. Finally, we found that the npr-1 and npr-3 mutants have similar behavioral patterns that were not predictable by sequence homology, proving that our data-driven approach can reveal the functions of genes that have not yet been characterized. We propose that elimination of inactivity periods and overall acceleration of postural change speed can explain behavioral phenotypes of strains with very atypical postural transition patterns. Our methods and results constitute guidelines for effectively finding strains that show "truly" interesting behaviors and systematically uncovering novel gene functions by bioimage-informatic approaches.

Comparative Chemistry of Aspergillus oryzae (RIB40) and A. flavus (NRRL 3357)

PubMed Central

Rank, Christian; Klejnstrup, Marie Louise; Petersen, Lene Maj; Kildgaard, Sara; Frisvad, Jens Christian; Gotfredsen, Charlotte Held; Larsen, Thomas Ostenfeld

2012-01-01

Aspergillus oryzae and A. flavus are important species in industrial biotechnology and food safety and have been some of the first aspergilli to be fully genome sequenced. Bioinformatic analysis has revealed 99.5% gene homology between the two species pointing towards a large coherence in the secondary metabolite production. In this study we report on the first comparison of secondary metabolite production between the full genome sequenced strains of A. oryzae (RIB40) and A. flavus (NRRL 3357). Surprisingly, the overall chemical profiles of the two strains were mostly very different across 15 growth conditions. Contrary to previous studies we found the aflatrem precursor 13-desoxypaxilline to be a major metabolite from A. oryzae under certain growth conditions. For the first time, we additionally report A. oryzae to produce parasiticolide A and two new analogues hereof, along with four new alkaloids related to the A. flavus metabolites ditryptophenalines and miyakamides. Generally the secondary metabolite capability of A. oryzae presents several novel end products likely to result from the domestication process from A. flavus. PMID:24957367

Demonstration of mRNA editing and localization of guide RNA genes in kinetoplast-mitochondria of the plant trypanosomatid Phytomonas serpens.

PubMed

Maslov, D A; Hollar, L; Haghighat, P; Nawathean, P

1998-06-01

Maxicircle molecules of kDNA in several isolates of Phytomonas were detected by hybridization with the 12S rRNA gene probe from Leishmania tarentolae. The estimated size of maxicircles is isolate-specific and varies from 27 to 36 kb. Fully edited and polyadenylated mRNA for kinetoplast-encoded ribosomal protein S12 (RPS12) was found in the steady-state kinetoplast RNA isolated from Phytomonas serpens strain 1G. Two minicircles (1.45 kb) from this strain were also sequenced. Each minicircle contains two 120 bp conserved regions positioned 180 degrees apart, a region enriched with G and T bases and a variable region. One minicircle encodes a gRNA for the first block of editing of RPSl2 mRNA, and the other encodes a gRNA with unknown function. A gRNA gene for the second block of RPSl2 was found on a minicircle sequenced previously. On each minicircle, a gRNA gene is located in the variable region in a similar position and orientation with respect to the conserved regions.

Fibrinogen-binding and platelet-aggregation activities of a Lactobacillus salivarius septicaemia isolate are mediated by a novel fibrinogen-binding protein.

PubMed

Collins, James; van Pijkeren, Jan-Peter; Svensson, Lisbeth; Claesson, Marcus J; Sturme, Mark; Li, Yin; Cooney, Jakki C; van Sinderen, Douwe; Walker, Alan W; Parkhill, Julian; Shannon, Oonagh; O'Toole, Paul W

2012-09-01

The marketplace for probiotic foods is burgeoning, measured in billions of euro per annum. It is imperative, however, that all bacterial strains are fully assessed for human safety. The ability to bind fibrinogen is considered a potential pathogenicity trait that can lead to platelet aggregation, serious medical complications, and in some instances, death. Here we examined strains from species frequently used as probiotics for their ability to bind human fibrinogen. Only one strain (CCUG 47825), a Lactobacillus salivarius isolate from a case of septicaemia, was found to strongly adhere to fibrinogen. Furthermore, this strain was found to aggregate human platelets at a level comparable to the human pathogen Staphylococcus aureus. By sequencing the genome of CCUG 47825, we were able to identify candidate genes responsible for fibrinogen binding. Complementing the genetic analysis with traditional molecular microbiological techniques enabled the identification of the novel fibrinogen receptor, CCUG_2371. Although only strain CCUG 47825 bound fibrinogen under laboratory conditions, homologues of the novel fibrinogen binding gene CCUG_2371 are widespread among L. salivarius strains, maintaining their potential to bind fibrinogen if expressed. We highlight the fact that without a full genetic analysis of strains for human consumption, potential pathogenicity traits may go undetected. © 2012 Blackwell Publishing Ltd.

Mitogenic effect contributes to increased virulence of Streptococcus suis sequence type 7 to cause streptococcal toxic shock-like syndrome.

PubMed

Zheng, H; Ye, C; Segura, M; Gottschalk, M; Xu, J

2008-09-01

Streptococcus suis serotype 2 sequence type 7 strains emerged in 1996 and caused a streptococcal toxic shock-like syndrome in 1998 and 2005 in China. Evidence indicated that the virulence of S. suis sequence type 7 had increased, but the mechanism was unknown. The sequence type 7 strain SC84, isolated from a patient with streptococcal toxic shock-like syndrome during the Sichuan outbreak, and the sequence type 1 strain 31533, a typical highly pathogenic strain isolated from a diseased pig, were used in comparative studies. In this study we show the mechanisms underlying cytokine production differed between the two types of strains. The S. suis sequence type 7 strain SC84 possesses a stronger capacity to stimulate T cells, naive T cells and peripheral blood mononuclear cell proliferation than does S. suis sequence type 1 strain 31533. The T cell response to both strains was dependent upon the presence of antigen-presenting cells. Histo-incompatible antigen-presenting cells were sufficient to provide the accessory signals to naive T cell stimulated by the two strains, indicating that both sequence type 7 and 1 strains possess mitogens; however, the mitogenic effect was different. Therefore, we propose that the difference in the mitogenic effect of sequence type 7 strain SC84 compared with the sequence type 1 strain 31533 of S. suis may be associated with the clinical, epidemiological and microbiological difference, where the ST 7 strains have a larger mitogenic effect.

Mitogenic effect contributes to increased virulence of Streptococcus suis sequence type 7 to cause streptococcal toxic shock-like syndrome

PubMed Central

Zheng, H; Ye, C; Segura, M; Gottschalk, M; Xu, J

2008-01-01

Streptococcus suis serotype 2 sequence type 7 strains emerged in 1996 and caused a streptococcal toxic shock-like syndrome in 1998 and 2005 in China. Evidence indicated that the virulence of S. suis sequence type 7 had increased, but the mechanism was unknown. The sequence type 7 strain SC84, isolated from a patient with streptococcal toxic shock-like syndrome during the Sichuan outbreak, and the sequence type 1 strain 31533, a typical highly pathogenic strain isolated from a diseased pig, were used in comparative studies. In this study we show the mechanisms underlying cytokine production differed between the two types of strains. The S. suis sequence type 7 strain SC84 possesses a stronger capacity to stimulate T cells, naive T cells and peripheral blood mononuclear cell proliferation than does S. suis sequence type 1 strain 31533. The T cell response to both strains was dependent upon the presence of antigen-presenting cells. Histo-incompatible antigen-presenting cells were sufficient to provide the accessory signals to naive T cell stimulated by the two strains, indicating that both sequence type 7 and 1 strains possess mitogens; however, the mitogenic effect was different. Therefore, we propose that the difference in the mitogenic effect of sequence type 7 strain SC84 compared with the sequence type 1 strain 31533 of S. suis may be associated with the clinical, epidemiological and microbiological difference, where the ST 7 strains have a larger mitogenic effect. PMID:18803762

First complete genome sequence of infectious laryngotracheitis virus

PubMed Central

2011-01-01

Background Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens worldwide. To date, only one complete genomic sequence of ILTV has been reported. This sequence was generated by concatenating partial sequences from six different ILTV strains. Thus, the full genomic sequence of a single (individual) strain of ILTV has not been determined previously. This study aimed to use high throughput sequencing technology to determine the complete genomic sequence of a live attenuated vaccine strain of ILTV. Results The complete genomic sequence of the Serva vaccine strain of ILTV was determined, annotated and compared to the concatenated ILTV reference sequence. The genome size of the Serva strain was 152,628 bp, with a G + C content of 48%. A total of 80 predicted open reading frames were identified. The Serva strain had 96.5% DNA sequence identity with the concatenated ILTV sequence. Notably, the concatenated ILTV sequence was found to lack four large regions of sequence, including 528 bp and 594 bp of sequence in the UL29 and UL36 genes, respectively, and two copies of a 1,563 bp sequence in the repeat regions. Considerable differences in the size of the predicted translation products of 4 other genes (UL54, UL30, UL37 and UL38) were also identified. More than 530 single-nucleotide polymorphisms (SNPs) were identified. Most SNPs were located within three genomic regions, corresponding to sequence from the SA-2 ILTV vaccine strain in the concatenated ILTV sequence. Conclusions This is the first complete genomic sequence of an individual ILTV strain. This sequence will facilitate future comparative genomic studies of ILTV by providing an appropriate reference sequence for the sequence analysis of other ILTV strains. PMID:21501528

Telmatobacter bradus gen. nov., sp. nov., a cellulolytic facultative anaerobe from subdivision 1 of the Acidobacteria, and emended description of Acidobacterium capsulatum Kishimoto et al. 1991.

PubMed

Pankratov, Timofey A; Kirsanova, Lilia A; Kaparullina, Elena N; Kevbrin, Vadim V; Dedysh, Svetlana N

2012-02-01

A gram-negative, facultatively anaerobic, chemo-organotrophic, non-pigmented, slow-growing bacterium was isolated from acidic Sphagnum peat and designated strain TPB6017(T). Cells of this strain were long rods that multiplied by normal cell division and were motile by means of a single flagellum. Cells grew under reduced oxygen tension and under anoxic conditions and were able to ferment sugars and several polysaccharides, including amorphous and crystalline cellulose. Strain TPB6017(T) was a psychrotolerant acidophile capable of growth between pH 3.0 and 7.5 (optimum 4.5-5.0) and at 4-35 °C (optimum 20-28 °C). It was extremely sensitive to salt stress; growth was inhibited at NaCl concentrations above 0.1 % (w/v). The major fatty acids were iso-C(15 : 0) and iso-C(17 : 1)ω9c; the polar lipids were phosphatidylethanolamine and a number of phospholipids and aminophospholipids with an unknown structure. The quinone was MK-8. The DNA G+C content was 57.6 mol%. Comparative 16S rRNA gene sequence analysis revealed that strain TPB6017(T) was a member of subdivision 1 of the phylum Acidobacteria and belonged to a phylogenetic lineage defined by the acidophilic aerobic chemo-organotroph Acidobacterium capsulatum (92.3 % sequence similarity). However, cell morphology, type of flagellation, the absence of pigment, differences in fatty acid and polar lipid composition, possession of a cellulolytic capability, inability to grow under fully oxic conditions and good growth in anoxic conditions distinguished strain TPB6017(T) from A. capsulatum. Therefore, it is proposed that strain TPB6017(T) represents a novel acidobacterium species in a new genus, Telmatobacter bradus gen. nov., sp. nov.; strain TPB6017(T) ( = DSM 23630(T) = VKM B-2570(T)) is the type strain.

Mupirocin-mucin agar for selective enumeration of Bifidobacterium bifidum.

PubMed

Pechar, Radko; Rada, Vojtech; Parafati, Lucia; Musilova, Sarka; Bunesova, Vera; Vlkova, Eva; Killer, Jiri; Mrazek, Jakub; Kmet, Vladimir; Svejstil, Roman

2014-11-17

Bifidobacterium bifidum is a bacterial species exclusively found in the human intestinal tract. This species is becoming increasingly popular as a probiotic organism added to lyophilized products. In this study, porcine mucin was used as the sole carbon source for the selective enumeration of B. bifidum in probiotic food additives. Thirty-six bifidobacterial strains were cultivated in broth with mucin. Only 13 strains of B. bifidum utilized the mucin to produce acids. B. bifidum was selectively enumerated in eight probiotic food supplements using agar (MM agar) containing mupirocin (100 mg/L) and mucin (20 g/L) as the sole carbon source. MM agar was fully selective if the B. bifidum species was presented together with Bifidobacterium animalis subsp. lactis, Bifidobacterium breve, and Bifidobacterium longum subsp. longum species and with lactic acid bacteria (lactobacilli, streptococci). Isolated strains of B. bifidum were identified using biochemical, PCR, MALDI-TOF procedures and 16S rRNA gene sequencing. The novel selective medium was also suitable for the isolation of B. bifidum strains from human fecal samples. Copyright © 2014 Elsevier B.V. All rights reserved.

Genomic characterization and phylogenetic analysis of Zika virus circulating in the Americas.

PubMed

Ye, Qing; Liu, Zhong-Yu; Han, Jian-Feng; Jiang, Tao; Li, Xiao-Feng; Qin, Cheng-Feng

2016-09-01

The rapid spread and potential link with birth defects have made Zika virus (ZIKV) a global public health problem. The virus was discovered 70years ago, yet the knowledge about its genomic structure and the genetic variations associated with current ZIKV explosive epidemics remains not fully understood. In this review, the genome organization, especially conserved terminal structures of ZIKV genome were characterized and compared with other mosquito-borne flaviviruses. It is suggested that major viral proteins of ZIKV share high structural and functional similarity with other known flaviviruses as shown by sequence comparison and prediction of functional motifs in viral proteins. Phylogenetic analysis demonstrated that all ZIKV strains circulating in the America form a unique clade within the Asian lineage. Furthermore, we identified a series of conserved amino acid residues that differentiate the Asian strains including the current circulating American strains from the ancient African strains. Overall, our findings provide an overview of ZIKV genome characterization and evolutionary dynamics in the Americas and point out critical clues for future virological and epidemiological studies. Copyright © 2016 Elsevier B.V. All rights reserved.

Complete Genome Sequence of Pigmentation Negative Yersinia Pestis strain Cadman Running head: Complete Genome Sequence of Y. pestis strain Cadman

DTIC Science & Technology

2016-10-27

Institute of Infectious Diseases, Fort Detrick, Frederick, Maryland, USA 9 10 11 Running head: Complete Genome Sequence of Y. pestis strain Cadman...1 Complete Genome Sequence of Pigmentation Negative Yersinia pestis strain Cadman 1 2 3 Sean Lovetta, Kitty Chaseb, Galina Korolevaa, Gustavo...we report the genome sequence of Yersinia pestis strain Cadman, an attenuated strain 25 lacking the pgm locus. Y. pestis is the causative agent of

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Isolation and characterization of two novel ethanol-tolerant facultative-anaerobic thermophilic bacteria strains from waste compost.

PubMed

Fong, Jiunn C N; Svenson, Charles J; Nakasugi, Kenlee; Leong, Caine T C; Bowman, John P; Chen, Betty; Glenn, Dianne R; Neilan, Brett A; Rogers, Peter L

2006-10-01

In a search for potential ethanologens, waste compost was screened for ethanol-tolerant thermophilic microorganisms. Two thermophilic bacterial strains, M5EXG and M10EXG, with tolerance of 5 and 10% (v/v) ethanol, respectively, were isolated. Both isolates are facultative anaerobic, non-spore forming, non-motile, catalase-positive, oxidase-negative, Gram-negative rods that are capable of utilizing a range of carbon sources including arabinose, galactose, mannose, glucose and xylose and produce low amounts of ethanol, acetate and lactate. Growth of both isolates was observed in fully defined minimal media within the temperature range 50-80 degrees C and pH 6.0-8.0. Phylogenetic analysis of the 16S rDNA sequences revealed that both isolates clustered with members of subgroup 5 of the genus Bacillus. G+C contents and DNA-DNA relatedness of M5EXG and M10EXG revealed that they are strains belonging to Geobacillus thermoglucosidasius. However, physiological and biochemical differences were evident when isolates M5EXG and M10EXG were compared with G. thermoglucosidasius type strain (DSM 2542(T)). The new thermophilic, ethanol-tolerant strains of G. thermoglucosidasius may be candidates for ethanol production at elevated temperatures.

Tannin Degradation by a Novel Tannase Enzyme Present in Some Lactobacillus plantarum Strains

PubMed Central

Jiménez, Natalia; Esteban-Torres, María; Mancheño, José Miguel; de las Rivas, Blanca

2014-01-01

Lactobacillus plantarum is frequently isolated from the fermentation of plant material where tannins are abundant. L. plantarum strains possess tannase activity to degrade plant tannins. An L. plantarum tannase (TanBLp, formerly called TanLp1) was previously identified and biochemically characterized. In this study, we report the identification and characterization of a novel tannase (TanALp). While all 29 L. plantarum strains analyzed in the study possess the tanBLp gene, the gene tanALp was present in only four strains. Upon methyl gallate exposure, the expression of tanBLp was induced, whereas tanALp expression was not affected. TanALp showed only 27% sequence identity to TanBLp, but the residues involved in tannase activity are conserved. Optimum activity for TanALp was observed at 30°C and pH 6 in the presence of Ca2+ ions. TanALp was able to hydrolyze gallate and protocatechuate esters with a short aliphatic alcohol substituent. Moreover, TanALp was able to fully hydrolyze complex gallotannins, such as tannic acid. The presence of the extracellular TanALp tannase in some L. plantarum strains provides them an advantage for the initial degradation of complex tannins present in plant environments. PMID:24610854

Tannin degradation by a novel tannase enzyme present in some Lactobacillus plantarum strains.

PubMed

Jiménez, Natalia; Esteban-Torres, María; Mancheño, José Miguel; de Las Rivas, Blanca; Muñoz, Rosario

2014-05-01

Lactobacillus plantarum is frequently isolated from the fermentation of plant material where tannins are abundant. L. plantarum strains possess tannase activity to degrade plant tannins. An L. plantarum tannase (TanBLp, formerly called TanLp1) was previously identified and biochemically characterized. In this study, we report the identification and characterization of a novel tannase (TanALp). While all 29 L. plantarum strains analyzed in the study possess the tanBLp gene, the gene tanALp was present in only four strains. Upon methyl gallate exposure, the expression of tanBLp was induced, whereas tanALp expression was not affected. TanALp showed only 27% sequence identity to TanBLp, but the residues involved in tannase activity are conserved. Optimum activity for TanALp was observed at 30°C and pH 6 in the presence of Ca(2+) ions. TanALp was able to hydrolyze gallate and protocatechuate esters with a short aliphatic alcohol substituent. Moreover, TanALp was able to fully hydrolyze complex gallotannins, such as tannic acid. The presence of the extracellular TanALp tannase in some L. plantarum strains provides them an advantage for the initial degradation of complex tannins present in plant environments.

Rapid identification of causative species in patients with Old World leishmaniasis.

PubMed Central

Minodier, P; Piarroux, R; Gambarelli, F; Joblet, C; Dumon, H

1997-01-01

Conventional methods for the identification of species of Leishmania parasite causing infections have limitations. By using a DNA-based alternative, the present study tries to develop a new tool for this purpose. Thirty-three patients living in Marseilles (in the south of France) were suffering from visceral or cutaneous leishmaniasis. DNA of the parasite in clinical samples (bone marrow, peripheral blood, or skin) from these patients were amplified by PCR and were directly sequenced. The sequences observed were compared to these of 30 strains of the genus causing Old World leishmaniasis collected in Europe, Africa, or Asia. In the analysis of the sequences of the strains, two different sequence patterns for Leishmania infantum, one sequence for Leishmania donovani, one sequence for Leishmania major, two sequences for Leishmania tropica, and one sequence for Leishmania aethiopica were obtained. Four sequences were observed among the strains from the patients: one was similar to the sequence for the L. major strains, two were identical to the sequences for the L. infantum strains, and the last sequence was not observed within the strains but had a high degree of homology with the sequences of the L. infantum and L. donovani strains. The L. infantum strains from all immunocompetent patients had the same sequence. The L. infantum strains from immunodeficient patients suffering from visceral leishmaniasis had three different sequences. This fact might signify that some variants of L. infantum acquire pathogenicity exclusively in immunocompromised patients. To dispense with the sequencing step, a restriction assay with HaeIII was used. Some restriction patterns might support genetic exchanges in members of the genus Leishmania. PMID:9316906

Bacteriocins from Lactobacillus plantarum – production, genetic organization and mode of action

PubMed Central

Todorov, Svetoslav D.

2009-01-01

Bacteriocins are biologically active proteins or protein complexes that display a bactericidal mode of action towards usually closely related species. Numerous strains of bacteriocin producing Lactobacillus plantarum have been isolated in the last two decades from different ecological niches including meat, fish, fruits, vegetables, and milk and cereal products. Several of these plantaricins have been characterized and the aminoacid sequence determined. Different aspects of the mode of action, fermentation optimization and genetic organization of the bacteriocin operon have been studied. However, numerous of bacteriocins produced by different Lactobacillus plantarum strains have not been fully characterized. In this article, a brief overview of the classification, genetics, characterization, including mode of action and production optimization for bacteriocins from Lactic Acid Bacteria in general, and where appropriate, with focus on bacteriocins produced by Lactobacillus plantarum, is presented. PMID:24031346

Investigation of Specific Substitutions in Virulence Genes Characterizing Phenotypic Groups of Low-Virulence Field Strains of Listeria monocytogenes

PubMed Central

Roche, S. M.; Gracieux, P.; Milohanic, E.; Albert, I.; Virlogeux-Payant, I.; Témoin, S.; Grépinet, O.; Kerouanton, A.; Jacquet, C.; Cossart, P.; Velge, P.

2005-01-01

Several models have shown that virulence varies from one strain of Listeria monocytogenes to another, but little is known about the cause of low virulence. Twenty-six field L. monocytogenes strains were shown to be of low virulence in a plaque-forming assay and in a subcutaneous inoculation test in mice. Using the results of cell infection assays and phospholipase activities, the low-virulence strains were assigned to one of four groups by cluster analysis and then virulence-related genes were sequenced. Group I included 11 strains that did not enter cells and had no phospholipase activity. These strains exhibited a mutated PrfA; eight strains had a single amino acid substitution, PrfAK220T, and the other three had a truncated PrfA, PrfAΔ174-237. These genetic modifications could explain the low virulence of group I strains, since mutated PrfA proteins were inactive. Group II and III strains entered cells but did not form plaques. Group II strains had low phosphatidylcholine phospholipase C activity, whereas group III strains had low phosphatidylinositol phospholipase C activity. Several substitutions were observed for five out of six group III strains in the plcA gene and for one out of three group II strains in the plcB gene. Group IV strains poorly colonized spleens of mice and were practically indistinguishable from fully virulent strains on the basis of the above-mentioned in vitro criteria. These results demonstrate a relationship between the phenotypic classification and the genotypic modifications for at least group I and III strains and suggest a common evolution of these strains within a group. PMID:16204519

Anisotropically biaxial strain in non-polar (112-0) plane In x Ga1-x N/GaN layers investigated by X-ray reciprocal space mapping.

PubMed

Zhao, Guijuan; Li, Huijie; Wang, Lianshan; Meng, Yulin; Ji, Zesheng; Li, Fangzheng; Wei, Hongyuan; Yang, Shaoyan; Wang, Zhanguo

2017-07-03

In this study, the indium composition x as well as the anisotropically biaxial strain in non-polar a-plane In x Ga 1-x N on GaN is studied by X-ray diffraction (XRD) analysis. In accordance with XRD reciprocal lattice space mapping, with increasing indium composition, the maximum of the In x Ga 1-x N reciprocal lattice points progressively shifts from a fully compressive strained to a fully relaxed position, then to reversed tensile strained. To fully understand the strain in the ternary alloy layers, it is helpful to grow high-quality device structures using a-plane nitrides. As the layer thickness increases, the strain of In x Ga 1-x N layer releases through surface roughening and the 3D growth-mode.

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

Draft Genome Sequences for Two Metal-Reducing Pelosinus fermentans Strains Isolated from a Cr(VI)-Contaminated Site and for Type Strain R7

PubMed Central

Brown, Steven D.; Podar, Mircea; Klingeman, Dawn M.; Johnson, Courtney M.; Yang, Zamin K.; Utturkar, Sagar M.; Land, Miriam L.; Mosher, Jennifer J.; Hurt, Richard A.; Phelps, Tommy J.; Palumbo, Anthony V.; Arkin, Adam P.; Hazen, Terry C.

2012-01-01

Pelosinus fermentans 16S rRNA gene sequences have been reported from diverse geographical sites since the recent isolation of the type strain. We present the genome sequence of the P. fermentans type strain R7 (DSM 17108) and genome sequences for two new strains with different abilities to reduce iron, chromate, and uranium. PMID:22933770

Whole Genomic Analysis of Human G12P[6] and G12P[8] Rotavirus Strains that Have Emerged in Myanmar

PubMed Central

Ide, Tomihiko; Komoto, Satoshi; Higo-Moriguchi, Kyoko; Htun, Khaing Win; Myint, Yi Yi; Myat, Theingi Win; Thant, Kyaw Zin; Thu, Hlaing Myat; Win, Mo Mo; Oo, Htun Naing; Htut, Than; Wakuda, Mitsutaka; Dennis, Francis Ekow; Haga, Kei; Fujii, Yoshiki; Katayama, Kazuhiko; Rahman, Shofiqur; Nguyen, Sa Van; Umeda, Kouji; Oguma, Keiji; Tsuji, Takao; Taniguchi, Koki

2015-01-01

G12 rotaviruses are emerging rotavirus strains causing severe diarrhea in infants and young children worldwide. However, the whole genomes of only a few G12 strains have been fully sequenced and analyzed. In this study, we sequenced and characterized the complete genomes of six G12 strains (RVA/Human-tc/MMR/A14/2011/G12P[8], RVA/Human-tc/MMR/A23/2011/G12P[6], RVA/Human-tc/MMR/A25/2011/G12P[8], RVA/Human-tc/MMR/P02/2011/G12P[8], RVA/Human-tc/MMR/P39/2011/G12P[8], and RVA/Human-tc/MMR/P43/2011/G12P[8]) detected in six stool samples from children with acute gastroenteritis in Myanmar. On whole genomic analysis, all six Myanmarese G12 strains were found to have a Wa-like genetic backbone: G12-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strains A14, A25, P02, P39, and P43, and G12-P[6]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strain A23. Phylogenetic analysis showed that most genes of the six strains examined in this study were genetically related to globally circulating human G1, G3, G9, and G12 strains. Of note is that the NSP4 gene of strain A23 exhibited the closest relationship with the cognate genes of human-like bovine strains as well as human strains, suggesting the occurrence of reassortment between human and bovine strains. Furthermore, strains A14, A25, P02, P39, and P43 were very closely related to one another in all the 11 gene segments, indicating derivation of the five strains from a common origin. On the other hand, strain A23 consistently formed distinct clusters as to all the 11 gene segments, indicating a distinct origin of strain A23 from that of strains A14, A25, P02, P39, and P43. To our knowledge, this is the first report on whole genome-based characterization of G12 strains that have emerged in Myanmar. Our observations will provide important insights into the evolutionary dynamics of spreading G12 rotaviruses in Asia. PMID:25938434

Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

PubMed

Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

1995-04-01

Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

Molecular Tracking, through Processing, of Campylobacter Strains Colonizing Broiler Flocks▿

PubMed Central

Elvers, Karen T.; Morris, Victoria K.; Newell, Diane G.; Allen, Vivien M.

2011-01-01

Many of the poultry flocks produced in the United Kingdom are colonized with Campylobacter, and the intensive nature of poultry processing usually results in contaminated carcasses. In this study, a previously reported molecular oligonucleotide probe method was used to track a specific flock-colonizing strain(s) on broiler carcasses during processing in two United Kingdom commercial poultry processing plants. Five Campylobacter-positive flocks were sampled at four points along the processing line, postbleed, postpluck, prechill, and postchill, and two Campylobacter-negative flocks processed immediately after positive flocks were sampled prechill. flaA was sequenced from Campylobacter strains isolated from these flocks, and strain-specific probes were synthesized. Skin and cecal samples were plated onto selective agar to give individual colonies, which were transferred onto membranes. These were then hybridized with the strain- and genus-specific probes. For all the 5 positive flocks, there was a significant reduction in campylobacters postbleed compared to postpluck but no subsequent fall on sampling pre- and postchill, and the strain(s) predominating on the carcasses throughout processing came from the flock being processed. This indicates that strains from the abattoir environment were not a significant cause of carcass contamination in flocks with well-established campylobacter colonization. However, negative flocks that were preceded by positive flocks were contaminated by strains that did not generally originate from the predominating strains recovered from the ceca of the previous positive flocks. This suggests that the abattoir environment has a significant role in the contamination of carcasses from negative but not fully colonized flocks. PMID:21705532

Is the Marmara Sea segment of the North Anatolian Fault Creeping or loading ?

NASA Astrophysics Data System (ADS)

Klein, Emilie; Masson, Frédéric; Duputel, Zacharie; Yavasoglu, Hakan

2016-04-01

During the last century, the North Anatolian Fault has experienced a migrating Mw>7 earthquakes sequence that ruptured about 1000 km of the fault westward. The last major earthquakes occurred in 1999 in Izmit (Mw7.4) and Duzce (Mw7.2). Only the segments located directly offshore of Istanbul, in the Marmara Sea, remain unbroken in this series of events. This region represents a major issue in terms of seismic hazard with more than 13 millions inhabitants in the city of Istanbul. However, a strong controversy remains over whether the central segment of the Main Marmara Fault is locked and likely to experience a major earthquake, or not. Recent studies based on geodetic data suggest indeed that, contrary to the Prince's Island segment which is fully locked, the central segment is accommodating the strain by aseismic fault creep. So it has not the potential to generate a Mw ~7 event. These results, mostly based on relatively simple strain accumulation models over infinitely long faults, is contested by a recent seismic data study, which suggests on the contrary that this fault segment is fully locked and mature to generate such a great earthquake. In this study, we revisit the available geodetic data considering a 3D geometry of the fault, allowing to take into account the lateral variations of behavior along the fault. In particular, we evaluate if current geodetic datasets are sufficient to constrain strain accumulation and thus to conclude about the seismic hazard in the region.

Phylogenetic analyses of the genus Aeromonas based on housekeeping gene sequencing and its influence on systematics.

PubMed

Navarro, Aaron; Martínez-Murcia, Antonio

2018-04-19

The phylogenies derived from housekeeping gene sequence alignments, although mere evolutionary hypotheses, have increased our knowledge about the Aeromonas genetic diversity, providing a robust species delineation framework invaluable for reliable, easy and fast species identification. Previous classifications of Aeromonas, have been fully surpassed by recently developed phylogenetic (natural) classification obtained from the analysis of so-called "molecular chronometers". Despite ribosomal RNAs cannot split all known Aeromonas species, the conserved nature of 16S rRNA offers reliable alignments containing mosaics of sequence signatures which may serve as targets of genus-specific oligonucleotides for subsequent identification/detection tests in samples without culturing. On the contrary, some housekeeping genes coding for proteins show a much better chronometric capacity to discriminate highly related strains. Although both, species and loci, do not all evolve at exactly the same rate, published Aeromonas phylogenies were congruent to each other, indicating that, phylogenetic markers are synchronized and a concatenated multi-gene phylogeny, may be "the mirror" of the entire genomic relationships. Thanks to MLPA approaches, the discovery of new Aeromonas species and strains of rarely isolated species is today more frequent and, consequently, should be extensively promoted for isolate screening and species identification. Although, accumulated data still should be carefully catalogued to inherit a reliable database. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Role of a Ferredoxin Gene Cotranscribed with the nifHDK Operon in N2 Fixation and Nitrogenase “Switch-Off” of Azoarcus sp. Strain BH72

PubMed Central

Egener, Tanja; Martin, Dietmar E.; Sarkar, Abhijit; Reinhold-Hurek, Barbara

2001-01-01

The endophytic diazotroph Azoarcus sp. strain BH72 is capable of infecting rice roots and of expressing the nitrogenase (nif) genes there. In order to study the genetic background for nitrogen fixation in strain BH72, the structural genes of nitrogenase (nifHDK) were cloned and sequenced. The sequence analysis revealed an unusual gene organization: downstream of nifHDK, a ferredoxin gene (fdxN; 59% amino acid sequence identity to R. capsulatus FdxN) and open reading frames showing 52 and 36% amino acid sequence identity to nifY of Pseudomonas stutzeri A15 and ORF1 of Azotobacter vinelandii were located. Northern blot analysis, reverse transcriptase PCR and primer extension analysis revealed that these six genes are located on one transcript transcribed from a ς54-type promoter. Shorter transcripts sequentially missing genes of the 3′ part of the full-length mRNA were more abundantly detected. Mutational analyses suggested that FdxN is an important but not the essential electron donor for dinitrogenase reductase. An in-frame deletion of fdxN resulted in reduced growth rates (59% ± 9%) and nitrogenase activities (81%) in nitrogen-fixing pure cultures in comparison to the wild type. Nitrogenase activity was fully complemented in an fdxN mutant which carried a nifH promoter-driven fdxN gene in trans. Also, in coculture with the ascomycete Acremonium alternatum, where strain BH72 develops intracytoplasmic membrane stacks, the nitrogenase activity in the fdxN deletion mutant was decreased to 56% of the wild-type level. Surprisingly, the fdxN deletion also had an effect on the rapid “switch-off” of nitrogenase activity in response to ammonium. Wild-type strain BH72 and the deletion mutant complemented with fdxN in trans showed a rapid reversible inactivation of acetylene reduction, while the deletion mutant did not cease to reduce acetylene. In concordance with the hypothesis that changes in the redox state of NifH or electron flux towards nitrogenase may be involved in the mechanism of physiological nitrogenase switch-off, our results suggest that the ferredoxin may be a component involved in this process. PMID:11371540

Muju Virus, Harbored by Myodes regulus in Korea, Might Represent a Genetic Variant of Puumala Virus, the Prototype Arvicolid Rodent-Borne Hantavirus

PubMed Central

Lee, Jin Goo; Gu, Se Hun; Baek, Luck Ju; Shin, Ok Sarah; Park, Kwang Sook; Kim, Heung-Chul; Klein, Terry A.; Yanagihara, Richard; Song, Jin-Won

2014-01-01

The genome of Muju virus (MUJV), identified originally in the royal vole (Myodes regulus) in Korea, was fully sequenced to ascertain its genetic and phylogenetic relationship with Puumala virus (PUUV), harbored by the bank vole (My. glareolus), and a PUUV-like virus, named Hokkaido virus (HOKV), in the grey red-backed vole (My. rufocanus) in Japan. Whole genome sequence analysis of the 6544-nucleotide large (L), 3652-nucleotide medium (M) and 1831-nucleotide small (S) segments of MUJV, as well as the amino acid sequences of their gene products, indicated that MUJV strains from different capture sites might represent genetic variants of PUUV, the prototype arvicolid rodent-borne hantavirus in Europe. Distinct geographic-specific clustering of MUJV was found in different provinces in Korea, and phylogenetic analyses revealed that MUJV and HOKV share a common ancestry with PUUV. A better understanding of the taxonomic classification and pathogenic potential of MUJV must await its isolation in cell culture. PMID:24736214

Identification of IBV QX vaccine markers : Should vaccine acceptance by authorities require similar identifications for all live IBV vaccines?

PubMed

Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J

2017-10-09

IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.

Complete genome sequence of Paenibacillus riograndensis SBR5(T), a Gram-positive diazotrophic rhizobacterium.

PubMed

Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F

2015-08-10

Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

Complete Genome Sequences of Newcastle Disease Virus Strains Circulating in Chicken Populations of Indonesia

PubMed Central

Xiao, Sa; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Bharoto, Eny E.; Prajitno, Teguh Y.; Collins, Peter L.

2012-01-01

Eight highly virulent Newcastle disease virus (NDV) strains were isolated from vaccinated commercial chickens in Indonesia during outbreaks in 2009 and 2010. The complete genome sequences of two NDV strains and the sequences of the surface protein genes (F and HN) of six other strains were determined. Phylogenetic analysis classified them into two new subgroups of genotype VII in the class II cluster that were genetically distinct from vaccine strains. This is the first report of complete genome sequences of NDV strains isolated from chickens in Indonesia. PMID:22532534

Multilevel population genetic analysis of vanA and vanB Enterococcus faecium causing nosocomial outbreaks in 27 countries (1986-2012).

PubMed

Freitas, Ana R; Tedim, Ana P; Francia, Maria V; Jensen, Lars B; Novais, Carla; Peixe, Luísa; Sánchez-Valenzuela, Antonio; Sundsfjord, Arnfinn; Hegstad, Kristin; Werner, Guido; Sadowy, Ewa; Hammerum, Anette M; Garcia-Migura, Lourdes; Willems, Rob J; Baquero, Fernando; Coque, Teresa M

2016-12-01

Vancomycin-resistant Enterococcus faecium (VREfm) have been increasingly reported since the 1980s. Despite the high number of published studies about VRE epidemiology, the dynamics and evolvability of these microorganisms are still not fully understood. A multilevel population genetic analysis of VREfm outbreak strains since 1986, representing the first comprehensive characterization of plasmid content in E. faecium, was performed to provide a detailed view of potential transmissible units. From a comprehensive MeSH search, we identified VREfm strains causing hospital outbreaks (1986-2012). In total, 53 VanA and 18 VanB isolates (27 countries, 5 continents) were analysed and 82 vancomycin-susceptible E. faecium (VSEfm) were included for comparison. Clonal relatedness was established by PFGE and MLST (goeBURST/Bayesian Analysis of Population Structure, BAPS). Characterization of van transposons (PCR mapping, RFLP, sequencing), plasmids (transfer, ClaI-RFLP, PCR typing of relaxases, replication-initiation proteins and toxin-antitoxin systems, hybridization, sequencing), bacteriocins and virulence determinants (PCR, hybridization, sequencing) was performed. VREfm were mainly associated with major human lineages ST17, ST18 and ST78. VREfm and VSEfm harboured plasmids of different families [RCR, small theta plasmids, RepA_N (pRUM/pLG1) and Inc18] able to yield mosaic elements. Tn1546-vanA was mainly located on pRUM/Axe-Txe (USA) and Inc18-pIP186 (Europe) plasmids. The VanB2 type (Tn5382/Tn1549) was predominant among VanB strains (chromosome and plasmids). Both strains and plasmids contributed to the spread and persistence of vancomycin resistance among E. faecium. Horizontal gene transfer events among genetic elements from different clonal lineages (same or different species) result in chimeras with different stability and host range, complicating the surveillance of epidemic plasmids. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Phenotypic and genotypic discrepancy of Streptococcus pneumoniae strains isolated from Asian countries.

PubMed

Ko, Kwan Soo; Oh, Won Sup; Peck, Kyong Ran; Lee, Jang Ho; Lee, Nam Yong; Song, Jae-Hoon

2005-07-01

Non-typeable isolates of Streptococcus pneumoniae collected from Asian countries were characterized by optochin susceptibility test, bile solubility test, multilocus sequence typing of housekeeping genes, amplification of virulence-related genes, 16S rDNA-RsaI digestion, and 16S rDNA sequencing. Six of 54 non-typeable pneumococcal isolates showed divergence of gene sequences of recP and xpt from typical pneumococcal strains. Of these six atypical pneumococcal strains, two showed different results in optochin susceptibility or bile solubility test from typical pneumococcal strains. All six isolates showed high sequence dissimilarities of multilocus sequence typing, 16S rDNA sequences, and lytA sequences from typical S. pneumoniae strains. Data from this study suggest that classic tests such as optochin susceptibility and bile solubility tests may lead to incorrect identification of S. pneumoniae. These atypical strains may belong to different bacterial species from S. pneumoniae.

Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

PubMed Central

Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

2005-01-01

Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

Massively Parallel Sequencing Reveals the Complex Structure of an Irradiated Human Chromosome on a Mouse Background in the Tc1 Model of Down Syndrome

PubMed Central

Clayton, Stephen; Prigmore, Elena; Langley, Elizabeth; Yang, Fengtang; Maguire, Sean; Fu, Beiyuan; Rajan, Diana; Sheppard, Olivia; Scott, Carol; Hauser, Heidi; Stephens, Philip J.; Stebbings, Lucy A.; Ng, Bee Ling; Fitzgerald, Tomas; Quail, Michael A.; Banerjee, Ruby; Rothkamm, Kai; Tybulewicz, Victor L. J.; Fisher, Elizabeth M. C.; Carter, Nigel P.

2013-01-01

Down syndrome (DS) is caused by trisomy of chromosome 21 (Hsa21) and presents a complex phenotype that arises from abnormal dosage of genes on this chromosome. However, the individual dosage-sensitive genes underlying each phenotype remain largely unknown. To help dissect genotype – phenotype correlations in this complex syndrome, the first fully transchromosomic mouse model, the Tc1 mouse, which carries a copy of human chromosome 21 was produced in 2005. The Tc1 strain is trisomic for the majority of genes that cause phenotypes associated with DS, and this freely available mouse strain has become used widely to study DS, the effects of gene dosage abnormalities, and the effect on the basic biology of cells when a mouse carries a freely segregating human chromosome. Tc1 mice were created by a process that included irradiation microcell-mediated chromosome transfer of Hsa21 into recipient mouse embryonic stem cells. Here, the combination of next generation sequencing, array-CGH and fluorescence in situ hybridization technologies has enabled us to identify unsuspected rearrangements of Hsa21 in this mouse model; revealing one deletion, six duplications and more than 25 de novo structural rearrangements. Our study is not only essential for informing functional studies of the Tc1 mouse but also (1) presents for the first time a detailed sequence analysis of the effects of gamma radiation on an entire human chromosome, which gives some mechanistic insight into the effects of radiation damage on DNA, and (2) overcomes specific technical difficulties of assaying a human chromosome on a mouse background where highly conserved sequences may confound the analysis. Sequence data generated in this study is deposited in the ENA database, Study Accession number: ERP000439. PMID:23596509

Copper homeostasis in grapevine: functional characterization of the Vitis vinifera copper transporter 1.

PubMed

Martins, Viviana; Bassil, Elias; Hanana, Mohsen; Blumwald, Eduardo; Gerós, Hernâni

2014-07-01

The Vitis vinifera copper transporter 1 is capable of self-interaction and mediates intracellular copper transport. An understanding of copper homeostasis in grapevine (Vitis vinifera L.) is particularly relevant to viticulture in which copper-based fungicides are intensively used. In the present study, the Vitis vinifera copper transporter 1 (VvCTr1), belonging to the Ctr family of copper transporters, was cloned and functionally characterized. Amino acid sequence analysis showed that VvCTr1 monomers are small peptides composed of 148 amino acids with 3 transmembrane domains and several amino acid residues typical of Ctr transporters. Bimolecular fluorescence complementation (BiFC) demonstrated that Ctr monomers are self-interacting and subcellular localization studies revealed that VvCTr1 is mobilized via the trans-Golgi network, through the pre-vacuolar compartment and located to the vacuolar membrane. The heterologous expression of VvCTr1 in a yeast strain lacking all Ctr transporters fully rescued the phenotype, while a deficient complementation was observed in a strain lacking only plasma membrane-bound Ctrs. Given the common subcellular localization of VvCTr1 and AtCOPT5 and the highest amino acid sequence similarity in comparison to the remaining AtCOPT proteins, Arabidopsis copt5 plants were stably transformed with VvCTr1. The impairment in root growth observed in copt5 seedlings in copper-deficient conditions was fully rescued by VvCTr1, further supporting its involvement in intracellular copper transport. Expression studies in V. vinifera showed that VvCTr1 is mostly expressed in the root system, but transcripts were also present in leaves and stems. The functional characterization of VvCTr-mediated copper transport provides the first step towards understanding the physiological and molecular responses of grapevines to copper-based fungicides.

Bacteriocins from Lactobacillus plantarum - production, genetic organization and mode of action: produção, organização genética e modo de ação.

PubMed

Todorov, Svetoslav D

2009-04-01

Bacteriocins are biologically active proteins or protein complexes that display a bactericidal mode of action towards usually closely related species. Numerous strains of bacteriocin producing Lactobacillus plantarum have been isolated in the last two decades from different ecological niches including meat, fish, fruits, vegetables, and milk and cereal products. Several of these plantaricins have been characterized and the aminoacid sequence determined. Different aspects of the mode of action, fermentation optimization and genetic organization of the bacteriocin operon have been studied. However, numerous of bacteriocins produced by different Lactobacillus plantarum strains have not been fully characterized. In this article, a brief overview of the classification, genetics, characterization, including mode of action and production optimization for bacteriocins from Lactic Acid Bacteria in general, and where appropriate, with focus on bacteriocins produced by Lactobacillus plantarum, is presented.

Fully integrated carbon nanotube composite thin film strain sensors on flexible substrates for structural health monitoring

NASA Astrophysics Data System (ADS)

Burton, A. R.; Lynch, J. P.; Kurata, M.; Law, K. H.

2017-09-01

Multifunctional thin film materials have opened many opportunities for novel sensing strategies for structural health monitoring. While past work has established methods of optimizing multifunctional materials to exhibit sensing properties, comparatively less work has focused on their integration into fully functional sensing systems capable of being deployed in the field. This study focuses on the advancement of a scalable fabrication process for the integration of multifunctional thin films into a fully integrated sensing system. This is achieved through the development of an optimized fabrication process that can create a broad range of sensing systems using multifunctional materials. A layer-by-layer deposited multifunctional composite consisting of single walled carbon nanotubes (SWNT) in a polyvinyl alcohol and polysodium-4-styrene sulfonate matrix are incorporated with a lithography process to produce a fully integrated sensing system deposited on a flexible substrate. To illustrate the process, a strain sensing platform consisting of a patterned SWNT-composite thin film as a strain-sensitive element within an amplified Wheatstone bridge sensing circuit is presented. Strain sensing is selected because it presents many of the design and processing challenges that are core to patterning multifunctional thin film materials into sensing systems. Strain sensors fabricated on a flexible polyimide substrate are experimentally tested under cyclic loading using standard four-point bending coupons and a partial-scale steel frame assembly under lateral loading. The study reveals the material process is highly repeatable to produce fully integrated strain sensors with linearity and sensitivity exceeding 0.99 and 5 {{V}}/{ε }, respectively. The thin film strain sensors are robust and are capable of high strain measurements beyond 3000 μ {ε }.

Complete Genome Sequence of a CTX-M-15-Producing Escherichia coli Strain from the H30Rx Subclone of Sequence Type 131 from a Patient with Recurrent Urinary Tract Infections, Closely Related to a Lethal Urosepsis Isolate from the Patient’s Sister

PubMed Central

Johnson, Timothy J.; Liu, Cindy M.; Sokurenko, Evgeni; Kisiela, Dagmara I.; Paul, Sandip; Andersen, Paal; Johnson, James R.; Price, Lance B.

2016-01-01

We report here the complete genome sequence, including five plasmid sequences, of Escherichia coli sequence type 131 (ST131) strain JJ1887. The strain was isolated in 2007 in the United States from a patient with recurrent cystitis, whose caregiver sister died from urosepsis caused by a nearly identical strain. PMID:27174264

High Influenza A Virus Infection Rates in Mallards Bred for Hunting in the Camargue, South of France

PubMed Central

Champagnon, Jocelyn; Guillemain, Matthieu; Crescenzo-Chaigne, Bernadette; Renaud, François; Thomas, Frédéric; Gauthier-Clerc, Michel; van der Werf, Sylvie

2012-01-01

During the last decade, the role of wildlife in emerging pathogen transmission to domestic animals has often been pointed out. Conversely, far less attention has been paid to pathogen transmission from domestic animals to wildlife. Here, we focus on the case of game restocking, which implies the release of millions of animals worldwide each year. We conducted a 2-year study in the Camargue (Southern France) to investigate the influence of hand-reared Mallard releases on avian influenza virus dynamics in surrounding wildlife. We sampled Mallards (cloacal swabs) from several game duck facilities in 2009 and 2010 before their release. A very high (99%) infection rate caused by an H10N7 strain was detected in the game bird facility we sampled in 2009. We did not detect this strain in shot ducks we sampled, neither during the 2008/2009 nor the 2009/2010 hunting seasons. In 2010 infection rates ranged from 0 to 24% in hand-reared ducks. The 2009 H10N7 strain was fully sequenced. It results from multiple reassortment events between Eurasian low pathogenic strains. Interestingly, H10N7 strains had previously caused human infections in Egypt and Australia. The H10 and N7 segments we sequenced were clearly distinct from the Australian ones but they belonged to the same large cluster as the Egyptian ones. We did not observe any mutation linked to increased virulence, transmission to mammals, or antiviral resistance in the H10N7 strain we identified. Our results indicate that the potential role of hand-reared Mallards in influenza virus epizootics must be taken into account given the likely risk of viral exchange between game bird facilities and wild habitats, owing to duck rearing conditions. Measures implemented to limit transmission from wildlife to domestic animals as well as measures to control transmission from domestic animals to wild ones need to be equally reinforced. PMID:22952832

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

Genetic diversity and recombination of enterovirus G strains in Japanese pigs: High prevalence of strains carrying a papain-like cysteine protease sequence in the enterovirus G population.

PubMed

Tsuchiaka, Shinobu; Naoi, Yuki; Imai, Ryo; Masuda, Tsuneyuki; Ito, Mika; Akagami, Masataka; Ouchi, Yoshinao; Ishii, Kazuo; Sakaguchi, Shoichi; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Satani, Yuki; Takashima, Yasuhiro; Taniguchi, Yuji; Takasu, Masaki; Madarame, Hiroo; Sunaga, Fujiko; Aoki, Hiroshi; Makino, Shinji; Mizutani, Tetsuya; Nagai, Makoto

2018-01-01

To study the genetic diversity of enterovirus G (EV-G) among Japanese pigs, metagenomics sequencing was performed on fecal samples from pigs with or without diarrhea, collected between 2014 and 2016. Fifty-nine EV-G sequences, which were >5,000 nucleotides long, were obtained. By complete VP1 sequence analysis, Japanese EV-G isolates were classified into G1 (17 strains), G2 (four strains), G3 (22 strains), G4 (two strains), G6 (two strains), G9 (six strains), G10 (five strains), and a new genotype (one strain). Remarkably, 16 G1 and one G2 strain identified in diarrheic (23.5%; four strains) or normal (76.5%; 13 strains) fecal samples possessed a papain-like cysteine protease (PL-CP) sequence, which was recently found in the USA and Belgium in the EV-G genome, at the 2C-3A junction site. This paper presents the first report of the high prevalence of viruses carrying PL-CP in the EV-G population. Furthermore, possible inter- and intragenotype recombination events were found among EV-G strains, including G1-PL-CP strains. Our findings may advance the understanding of the molecular epidemiology and genetic evolution of EV-Gs.

Comparative analysis of response to selection with three insecticides in the dengue mosquito Aedes aegypti using mRNA sequencing

PubMed Central

2014-01-01

Background Mosquito control programmes using chemical insecticides are increasingly threatened by the development of resistance. Such resistance can be the consequence of changes in proteins targeted by insecticides (target site mediated resistance), increased insecticide biodegradation (metabolic resistance), altered transport, sequestration or other mechanisms. As opposed to target site resistance, other mechanisms are far from being fully understood. Indeed, insecticide selection often affects a large number of genes and various biological processes can hypothetically confer resistance. In this context, the aim of the present study was to use RNA sequencing (RNA-seq) for comparing transcription level and polymorphism variations associated with adaptation to chemical insecticides in the mosquito Aedes aegypti. Biological materials consisted of a parental susceptible strain together with three child strains selected across multiple generations with three insecticides from different classes: the pyrethroid permethrin, the neonicotinoid imidacloprid and the carbamate propoxur. Results After ten generations, insecticide-selected strains showed elevated resistance levels to the insecticides used for selection. RNA-seq data allowed detecting over 13,000 transcripts, of which 413 were differentially transcribed in insecticide-selected strains as compared to the susceptible strain. Among them, a significant enrichment of transcripts encoding cuticle proteins, transporters and enzymes was observed. Polymorphism analysis revealed over 2500 SNPs showing > 50% allele frequency variations in insecticide-selected strains as compared to the susceptible strain, affecting over 1000 transcripts. Comparing gene transcription and polymorphism patterns revealed marked differences among strains. While imidacloprid selection was linked to the over transcription of many genes, permethrin selection was rather linked to polymorphism variations. Focusing on detoxification enzymes revealed that permethrin selection strongly affected the polymorphism of several transcripts encoding cytochrome P450 monooxygenases likely involved in insecticide biodegradation. Conclusions The present study confirmed the power of RNA-seq for identifying concomitantly quantitative and qualitative transcriptome changes associated with insecticide resistance in mosquitoes. Our results suggest that transcriptome modifications can be selected rapidly by insecticides and affect multiple biological functions. Previously neglected by molecular screenings, polymorphism variations of detoxification enzymes may play an important role in the adaptive response of mosquitoes to insecticides. PMID:24593293

Comparative analysis of response to selection with three insecticides in the dengue mosquito Aedes aegypti using mRNA sequencing.

PubMed

David, Jean-Philippe; Faucon, Frédéric; Chandor-Proust, Alexia; Poupardin, Rodolphe; Riaz, Muhammad Asam; Bonin, Aurélie; Navratil, Vincent; Reynaud, Stéphane

2014-03-05

Mosquito control programmes using chemical insecticides are increasingly threatened by the development of resistance. Such resistance can be the consequence of changes in proteins targeted by insecticides (target site mediated resistance), increased insecticide biodegradation (metabolic resistance), altered transport, sequestration or other mechanisms. As opposed to target site resistance, other mechanisms are far from being fully understood. Indeed, insecticide selection often affects a large number of genes and various biological processes can hypothetically confer resistance. In this context, the aim of the present study was to use RNA sequencing (RNA-seq) for comparing transcription level and polymorphism variations associated with adaptation to chemical insecticides in the mosquito Aedes aegypti. Biological materials consisted of a parental susceptible strain together with three child strains selected across multiple generations with three insecticides from different classes: the pyrethroid permethrin, the neonicotinoid imidacloprid and the carbamate propoxur. After ten generations, insecticide-selected strains showed elevated resistance levels to the insecticides used for selection. RNA-seq data allowed detecting over 13,000 transcripts, of which 413 were differentially transcribed in insecticide-selected strains as compared to the susceptible strain. Among them, a significant enrichment of transcripts encoding cuticle proteins, transporters and enzymes was observed. Polymorphism analysis revealed over 2500 SNPs showing > 50% allele frequency variations in insecticide-selected strains as compared to the susceptible strain, affecting over 1000 transcripts. Comparing gene transcription and polymorphism patterns revealed marked differences among strains. While imidacloprid selection was linked to the over transcription of many genes, permethrin selection was rather linked to polymorphism variations. Focusing on detoxification enzymes revealed that permethrin selection strongly affected the polymorphism of several transcripts encoding cytochrome P450 monooxygenases likely involved in insecticide biodegradation. The present study confirmed the power of RNA-seq for identifying concomitantly quantitative and qualitative transcriptome changes associated with insecticide resistance in mosquitoes. Our results suggest that transcriptome modifications can be selected rapidly by insecticides and affect multiple biological functions. Previously neglected by molecular screenings, polymorphism variations of detoxification enzymes may play an important role in the adaptive response of mosquitoes to insecticides.

Full Genome Sequence of Egg Drop Syndrome Virus Strain FJ12025 Isolated from Muscovy Duckling.

PubMed

Fu, Guanghua; Chen, Hongmei; Huang, Yu; Cheng, Longfei; Fu, Qiuling; Shi, Shaohua; Wan, Chunhe; Chen, Cuiteng; Lin, Jiansheng

2013-08-22

Egg drop syndrome virus (EDSV) strain FJ12025 was isolated from a 9-day-old Muscovy duckling. The results of the sequence showed that the genome of strain FJ12025 is 33,213 bp in length, with a G+C content of 43.03%. When comparing the genome sequence of strain FJ12025 to that of laying duck original strain AV-127, we found 50 single-nucleotide polymorphisms (SNPs) between the two viral genome sequences. A genomic sequence comparison of FJ12025 and AV-127 will help to understand the phenotypic differences between the two viruses.

Variability of the protein sequences of lcrV between epidemic and atypical rhamnose-positive strains of Yersinia pestis.

PubMed

Anisimov, Andrey P; Panfertsev, Evgeniy A; Svetoch, Tat'yana E; Dentovskaya, Svetlana V

2007-01-01

Sequencing of lcrV genes and comparison of the deduced amino acid sequences from ten Y. pestis strains belonging mostly to the group of atypical rhamnose-positive isolates (non-pestis subspecies or pestoides group) showed that the LcrV proteins analyzed could be classified into five sequence types. This classification was based on major amino acid polymorphisms among LcrV proteins in the four "hot points" of the protein sequences. Some additional minor polymorphisms were found throughout these sequence types. The "hot points" corresponded to amino acids 18 (Lys --> Asn), 72 (Lys --> Arg), 273 (Cys --> Ser), and 324-326 (Ser-Gly-Lys --> Arg) in the LcrV sequence of the reference Y. pestis strain CO92. One possible explanation for polymorphism in amino acid sequences of LcrV among different strains is that strain-specific variation resulted from adaptation of the plague pathogen to different rodent and lagomorph hosts.

Emergence of a daptomycin-non-susceptible Enterococcus faecium strain that encodes mutations in DNA repair genes after high-dose daptomycin therapy.

PubMed

Matono, Takashi; Hayakawa, Kayoko; Hirai, Risen; Tanimura, Akira; Yamamoto, Kei; Fujiya, Yoshihiro; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Mezaki, Kazuhisa; Ohmagari, Norio; Miyoshi-Akiyama, Tohru

2016-04-01

An increasing number of reports have documented the emergence of daptomycin-nonsusceptible Enterococcus in patients during daptomycin therapy. Even though several mechanisms for daptomycin-nonsusceptibility have been suggested, the potential genetic mutations which might contribute to the daptomycin-nonsusceptibility are not fully understood. We isolated a vancomycin-susceptible, daptomycin nonsusceptible Enterococcus faecium strain from a patient with acute lymphocytic leukemia who received high-dose daptomycin therapy for E. faecium endocarditis. Whole-genome sequencing analysis revealed mutations within genes encoding DNA repair proteins MutL and RecJ of the daptomycin-nonsusceptible Enterococcus strain which might have facilitated its emergence. We identified the mutations of DNA mismatch repair genes in a clinical isolate of daptomycin nonsusceptible E. faecium which emerged in spite of high-dose daptomycin therapy. The finding implicates the possible association of DNA repair mechanism and daptomycin resistance. Careful monitoring is necessary to avoid the emergence of daptomycin non-susceptible isolates of E. faecium and particularly in cases of long-term daptomycin use or in immunocompromised patients.

Genome sequences of three strains of Aspergillus flavus for the biological control of Aflatoxin

USDA-ARS?s Scientific Manuscript database

The genomes of three strains of Aspergillus flavus with demonstrated utility for the biological control of aflatoxin were sequenced. These sequences were assembled with MIRA and annotated with Augustus using A. flavus strain 3357 (NCBI EQ963472) as a reference. Each strain had a genome of 36.3 to ...

The multilocus sequence typing network: mlst.net.

PubMed

Aanensen, David M; Spratt, Brian G

2005-07-01

The unambiguous characterization of strains of a pathogen is crucial for addressing questions relating to its epidemiology, population and evolutionary biology. Multilocus sequence typing (MLST), which defines strains from the sequences at seven house-keeping loci, has become the method of choice for molecular typing of many bacterial and fungal pathogens (and non-pathogens), and MLST schemes and strain databases are available for a growing number of prokaryotic and eukaryotic organisms. Sequence data are ideal for strain characterization as they are unambiguous, meaning strains can readily be compared between laboratories via the Internet. Laboratories undertaking MLST can quickly progress from sequencing the seven gene fragments to characterizing their strains and relating them to those submitted by others and to the population as a whole. We provide the gateway to a number of MLST schemes, each of which contain a set of tools for the initial characterization of strains, and methods for relating query strains to other strains of the species, including clustering based on differences in allelic profiles, phylogenetic trees based on concatenated sequences, and a recently developed method (eBURST) for identifying clonal complexes within a species and displaying the overall structure of the population. This network of MLST websites is available at http://www.mlst.net.

Using the overlay assay to qualitatively measure bacterial production of and sensitivity to pneumococcal bacteriocins.

PubMed

Maricic, Natalie; Dawid, Suzanne

2014-09-30

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms. We have shown that bacterially produced antimicrobial peptides (bacteriocins) dictate the outcome of these competitive interactions. All fully-sequenced pneumococcal strains harbor a bacteriocin-like peptide (blp) locus. The blp locus encodes for a range of diverse bacteriocins and all of the highly conserved components needed for their regulation, processing, and secretion. The diversity of the bacteriocins found in the bacteriocin immunity region (BIR) of the locus is a major contributor of pneumococcal competition. Along with the bacteriocins, immunity genes are found in the BIR and are needed to protect the producer cell from the effects of its own bacteriocin. The overlay assay is a quick method for examining a large number of strains for competitive interactions mediated by bacteriocins. The overlay assay also allows for the characterization of bacteriocin-specific immunity, and detection of secreted quorum sensing peptides. The assay is performed by pre-inoculating an agar plate with a strain to be tested for bacteriocin production followed by application of a soft agar overlay containing a strain to be tested for bacteriocin sensitivity. A zone of clearance surrounding the stab indicates that the overlay strain is sensitive to the bacteriocins produced by the pre-inoculated strain. If no zone of clearance is observed, either the overlay strain is immune to the bacteriocins being produced or the pre-inoculated strain does not produce bacteriocins. To determine if the blp locus is functional in a given strain, the overlay assay can be adapted to evaluate for peptide pheromone secretion by the pre-inoculated strain. In this case, a series of four lacZ-reporter strains with different pheromone specificity are used in the overlay.

Near complete genome sequence of Clostridium paradoxum strain JW-YL-7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lancaster, Andrew; Utturkar, Sagar M.; Poole, Farris

2016-05-05

Clostridium paradoxum strain JW-YL-7 is a moderately thermophilic anaerobic alkaliphile isolated from the municipal sewage treatment plant in Athens, GA. We report the near-complete genome sequence of C. paradoxum strain JW-YL-7 obtained by using PacBio DNA sequencing and Pilon for sequence assembly refinement with Illumina data.

Strain-Level Diversity of Secondary Metabolism in Streptomyces albus

PubMed Central

Seipke, Ryan F.

2015-01-01

Streptomyces spp. are robust producers of medicinally-, industrially- and agriculturally-important small molecules. Increased resistance to antibacterial agents and the lack of new antibiotics in the pipeline have led to a renaissance in natural product discovery. This endeavor has benefited from inexpensive high quality DNA sequencing technology, which has generated more than 140 genome sequences for taxonomic type strains and environmental Streptomyces spp. isolates. Many of the sequenced streptomycetes belong to the same species. For instance, Streptomyces albus has been isolated from diverse environmental niches and seven strains have been sequenced, consequently this species has been sequenced more than any other streptomycete, allowing valuable analyses of strain-level diversity in secondary metabolism. Bioinformatics analyses identified a total of 48 unique biosynthetic gene clusters harboured by Streptomyces albus strains. Eighteen of these gene clusters specify the core secondary metabolome of the species. Fourteen of the gene clusters are contained by one or more strain and are considered auxiliary, while 16 of the gene clusters encode the production of putative strain-specific secondary metabolites. Analysis of Streptomyces albus strains suggests that each strain of a Streptomyces species likely harbours at least one strain-specific biosynthetic gene cluster. Importantly, this implies that deep sequencing of a species will not exhaust gene cluster diversity and will continue to yield novelty. PMID:25635820

Genetic Relatedness among Hepatitis A Virus Strains Associated with Food-Borne Outbreaks

PubMed Central

Vaughan, Gilberto; Xia, Guoliang; Forbi, Joseph C.; Purdy, Michael A.; Rossi, Lívia Maria Gonçalves; Spradling, Philip R.; Khudyakov, Yury E.

2013-01-01

The genetic characterization of hepatitis A virus (HAV) strains is commonly accomplished by sequencing subgenomic regions, such as the VP1/P2B junction. HAV genome is not extensively variable, thus presenting opportunity for sharing sequences of subgenomic regions among genetically unrelated isolates. The degree of misrepresentation of phylogenetic relationships by subgenomic regions is especially important for tracking transmissions. Here, we analyzed whole-genome (WG) sequences of 101 HAV strains identified from 4 major multi-state, food-borne outbreaks of hepatitis A in the Unites States and from 14 non-outbreak-related HAV strains that shared identical VP1/P2B sequences with the outbreak strains. Although HAV strains with an identical VP1/P2B sequence were specific to each outbreak, WG were different, with genetic diversity reaching 0.31% (mean 0.09%). Evaluation of different subgenomic regions did not identify any other section of the HAV genome that could accurately represent phylogenetic relationships observed using WG sequences. The identification of 2–3 dominant HAV strains in 3 out of 4 outbreaks indicates contamination of the implicated food items with a heterogeneous HAV population. However, analysis of intra-host HAV variants from eight patients involved in one outbreak showed that only a single sequence variant established infection in each patient. Four non-outbreak strains were found closely related to strains from 2 outbreaks, whereas ten were genetically different from the outbreak strains. Thus, accurate tracking of HAV strains can be accomplished using HAV WG sequences, while short subgenomic regions are useful for identification of transmissions only among cases with known epidemiological association. PMID:24223112

Spontaneous Generation of Infectious Prion Disease in Transgenic Mice

PubMed Central

Castilla, Joaquín; Pintado, Belén; Gutiérrez-Adan, Alfonso; Andréoletti, Olivier; Aguilar-Calvo, Patricia; Arroba, Ana-Isabel; Parra-Arrondo, Beatriz; Ferrer, Isidro; Manzanares, Jorge; Espinosa, Juan-Carlos

2013-01-01

We generated transgenic mice expressing bovine cellular prion protein (PrPC) with a leucine substitution at codon 113 (113L). This protein is homologous to human protein with mutation 102L, and its genetic link with Gerstmann–Sträussler–Scheinker syndrome has been established. This mutation in bovine PrPC causes a fully penetrant, lethal, spongiform encephalopathy. This genetic disease was transmitted by intracerebral inoculation of brain homogenate from ill mice expressing mutant bovine PrP to mice expressing wild-type bovine PrP, which indicated de novo generation of infectious prions. Our findings demonstrate that a single amino acid change in the PrPC sequence can induce spontaneous generation of an infectious prion disease that differs from all others identified in hosts expressing the same PrPC sequence. These observations support the view that a variety of infectious prion strains might spontaneously emerge in hosts displaying random genetic PrPC mutations. PMID:24274622

Whole genome sequence of Enterobacter ludwigii type strain EN-119T, isolated from clinical specimens.

PubMed

Li, Gengmi; Hu, Zonghai; Zeng, Ping; Zhu, Bing; Wu, Lijuan

2015-04-01

Enterobacter ludwigii strain EN-119(T) is the type strain of E. ludwigii, which belongs to the E. cloacae complex (Ecc). This strain was first reported and nominated in 2005 and later been found in many hospitals. In this paper, the whole genome sequencing of this strain was carried out. The total genome size of EN-119(T) is 4952,770 bp with 4578 coding sequences, 88 tRNAs and 10 rRNAs. The genome sequence of EN-119(T) is the first whole genome sequence of E. ludwigii, which will further our understanding of Ecc. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Draft genome sequences of Streptococcus bovis strains ATCC 33317 and JB1

USDA-ARS?s Scientific Manuscript database

We report the draft genome sequences of Streptococcus bovis type strain ATTC 33317 (CVM42251) isolated from cow dung and strain JB1 (CVM42252) isolated from a cow rumen in 1977. Strains were subjected to Next Generation sequencing and the genome sizes are approximately 2 MB and 2.2 MB, respectively....

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Whole-Genome Sequencing and Comparative Genome Analysis of Bacillus subtilis Strains Isolated from Non-Salted Fermented Soybean Foods.

PubMed

Kamada, Mayumi; Hase, Sumitaka; Fujii, Kazushi; Miyake, Masato; Sato, Kengo; Kimura, Keitarou; Sakakibara, Yasubumi

2015-01-01

Bacillus subtilis is the main component in the fermentation of soybeans. To investigate the genetics of the soybean-fermenting B. subtilis strains and its relationship with the productivity of extracellular poly-γ-glutamic acid (γPGA), we sequenced the whole genome of eight B. subtilis stains isolated from non-salted fermented soybean foods in Southeast Asia. Assembled nucleotide sequences were compared with those of a natto (fermented soybean food) starter strain B. subtilis BEST195 and the laboratory standard strain B. subtilis 168 that is incapable of γPGA production. Detected variants were investigated in terms of insertion sequences, biotin synthesis, production of subtilisin NAT, and regulatory genes for γPGA synthesis, which were related to fermentation process. Comparing genome sequences, we found that the strains that produce γPGA have a deletion in a protein that constitutes the flagellar basal body, and this deletion was not found in the non-producing strains. We further identified diversity in variants of the bio operon, which is responsible for the biotin auxotrophism of the natto starter strains. Phylogenetic analysis using multilocus sequencing typing revealed that the B. subtilis strains isolated from the non-salted fermented soybeans were not clustered together, while the natto-fermenting strains were tightly clustered; this analysis also suggested that the strain isolated from "Tua Nao" of Thailand traces a different evolutionary process from other strains.

Phylogeny and strain typing of Escherichia coli, inferred from variation at mononucleotide repeat loci.

PubMed

Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M; Kashi, Yechezkel

2004-04-01

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria.

Phylogeny and Strain Typing of Escherichia coli, Inferred from Variation at Mononucleotide Repeat Loci

PubMed Central

Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M.; Kashi, Yechezkel

2004-01-01

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria. PMID:15066845

Isolation and Characterization of NDM-Positive Escherichia coli from Municipal Wastewater in Jeddah, Saudi Arabia

PubMed Central

Mantilla-Calderon, David; Jumat, Muhammad Raihan; Wang, Tiannyu; Ganesan, Pugalenthi; Al-Jassim, Nada

2016-01-01

The emergence of resistance to last-resort antibiotics is a public health concern of global scale. Besides direct person-to-person propagation, environmental pathways might contribute to the dissemination of antibiotic-resistant bacteria and antibiotic resistance genes (ARGs). Here, we describe the incidence of blaNDM-1, a gene conferring resistance to carbapenems, in the wastewater of the city of Jeddah, Saudi Arabia, over a 1-year period. blaNDM-1 was detected at concentrations ranging from 104 to 105 copies/m3 of untreated wastewater during the entire monitoring period. These results indicate the ubiquity and high incidence of blaNDM-1 in the local wastewater. To track the bacteria carrying blaNDM-1, we isolated Escherichia coli PI7, a strain of sequence type 101 (ST101), from wastewater around the Hajj event in October 2013. Genome sequencing of this strain revealed an extensive repertoire of ARGs as well as virulence and invasive traits. These traits were further confirmed by antibiotic resistance profiling and in vitro cell internalization in HeLa cell cultures. Given that this strain remains viable even after a certain duration in the sewerage, and that Jeddah lacks a robust sanitary infrastructure to fully capture all generated sewage, the presence of this bacterium in the untreated wastewater represents a potential hazard to the local public health. To the best of our knowledge, this is the first report of a blaNDM-1-positive E. coli strain isolated from a nonnosocomial environment in Saudi Arabia and may set a priority concern for the need to establish improved surveillance for carbapenem-resistant E. coli in the country and nearby regions. PMID:27324770

Genome Sequencing of Steroid Producing Bacteria Using Ion Torrent Technology and a Reference Genome.

PubMed

Sola-Landa, Alberto; Rodríguez-García, Antonio; Barreiro, Carlos; Pérez-Redondo, Rosario

2017-01-01

The Next-Generation Sequencing technology has enormously eased the bacterial genome sequencing and several tens of thousands of genomes have been sequenced during the last 10 years. Most of the genome projects are published as draft version, however, for certain applications the complete genome sequence is required.In this chapter, we describe the strategy that allowed the complete genome sequencing of Mycobacterium neoaurum NRRL B-3805, an industrial strain exploited for steroid production, using Ion Torrent sequencing reads and the genome of a close strain as the reference. This protocol can be applied to analyze the genetic variations between closely related strains; for example, to elucidate the point mutations between a parental strain and a random mutagenesis-derived mutant.

The phosphotransferase system-dependent sucrose utilization regulon in enteropathogenic Escherichia coli strains is located in a variable chromosomal region containing iap sequences.

PubMed

Treviño-Quintanilla, Luis Gerardo; Escalante, Adelfo; Caro, Alma Delia; Martínez, Alfredo; González, Ricardo; Puente, José Luis; Bolívar, Francisco; Gosset, Guillermo

2007-01-01

The capacity to utilize sucrose as a carbon and energy source (Scr(+) phenotype) is a highly variable trait among Escherichia coli strains. In this study, seven enteropathogenic E. coli (EPEC) strains from different sources were studied for their capacity to grow using sucrose. Liquid media cultures showed that all analyzed strains have the Scr(+) phenotype and two distinct groups were defined: one of five and another of two strains displaying doubling times of 67 and 125 min, respectively. The genes conferring the Scr(+) phenotype in one of the fast-growing strains (T19) were cloned and sequenced. Comparative sequence analysis revealed that this strain possesses the scr regulon genes scrKYABR, encoding phosphoenolpyruvate:phosphotransferase system-dependent sucrose transport and utilization activities. Transcript level quantification revealed sucrose-dependent induction of scrK and scrR genes in fast-growing strains, whereas no transcripts were detected in slow-growing strains. Sequence comparison analysis revealed that the scr genes in strain T19 are almost identical to those present in the scr regulon of prototype EPEC E2348/69 and in both strains, the scr genes are inserted in the chromosomal intergenic region of hypothetical genes ygcE and ygcF. Comparison of the ygcE-ygcF intergenic region sequence of strains MG1655, enterohemorrhagic EDL933, uropathogenic ECFT073 and EPEC T19-E2348/69 revealed that the number of extragenic highly repeated iap sequences corresponded to nine, four, two and none, respectively. These results show that the iap sequence-containing chromosomal ygcE-ygcF intergenic region is highly variable in E. coli. Copyright (c) 2007 S. Karger AG, Basel.

Complete Genome Sequence of Bradyrhizobium sp. Strain CCGE-LA001, Isolated from Field Nodules of the Enigmatic Wild Bean Phaseolus microcarpus

PubMed Central

Servín-Garcidueñas, Luis E.; Rogel, Marco A.; Ormeño-Orrillo, Ernesto; Zayas-del Moral, Alejandra; Sánchez, Federico

2016-01-01

We present the complete genome sequence of Bradyrhizobium sp. strain CCGE-LA001, a nitrogen-fixing bacterium isolated from nodules of Phaseolus microcarpus. Strain CCGE-LA001 represents the first sequenced bradyrhizobial strain obtained from a wild Phaseolus sp. Its genome revealed a large and novel symbiotic island. PMID:26988045

[Completed sequences analysis on the Chinese attenuated yellow fever 17D vaccine strain and the WHO standard yellow fever 17D vaccine strain].

PubMed

Li, Jing; Yu, Yong-Xin; Dong, Guan-Mu

2009-04-01

To compare the molecular characteristics of the Chinese attenuated yellow fever 17D vaccine strain and the WHO reference yellow fever 17D vaccine strain. The primers were designed according to the published nucleotide sequences of YFV 17D strains in GenBank. Total RNA of was extracted by the Trizol and reverse transcripted. The each fragments of the YFV genome were amplified by PCR and sequenced subsequently. The fragments of the 5' and 3' end of the two strains were cloned into the pGEM T-easy vector and then sequenced. The nucleotide acid and amino acid sequences of the homology to both strains were 99% with each other. No obvious nulceotide changes were found in the sequences of the entire genome of each 17D strains. Moreover, there was no obvious changes in the E protein genes. But the E173 of YF17D Tiantan, associted with the virulence, had mutantions. And the two live attenuated yellow fever 17D vaccine strains fell to the same lineage by the phylogenetic analysis. The results indicated that the two attenuated yellow fever 17D vaccine viruses accumulates mutations at a very low frequency and the genomes were relative stable.

Phylogenetic Relationship in Different Commercial Strains of Pleurotus nebrodensis Based on ITS Sequence and RAPD.

PubMed

Alam, Nuhu; Shim, Mi Ja; Lee, Min Woong; Shin, Pyeong Gyun; Yoo, Young Bok; Lee, Tae Soo

2009-09-01

The molecular phylogeny in nine different commercial cultivated strains of Pleurotus nebrodensis was studied based on their internal transcribed spacer (ITS) region and RAPD. In the sequence of ITS region of selected strains, it was revealed that the total length ranged from 592 to 614 bp. The size of ITS1 and ITS2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp, respectively. The sequence of ITS2 was more variable than ITS1 and the region of 5.8S sequences were identical. Phylogenetic tree of the ITS region sequences indicated that selected strains were classified into five clusters. The reciprocal homologies of the ITS region sequences ranged from 99 to 100%. The strains were also analyzed by RAPD with 20 arbitrary primers. Twelve primers were efficient to applying amplification of the genomic DNA. The sizes of the polymorphic fragments obtained were in the range of 200 to 2000 bp. RAPD and ITS analysis techniques were able to detect genetic variation among the tested strains. Experimental results suggested that IUM-1381, IUM-3914, IUM-1495 and AY-581431 strains were genetically very similar. Therefore, all IUM and NCBI gene bank strains of P. nebrodensis were genetically same with some variations.

[A surveillance study on CRISPR/Cas molecular biomarker in Escherichia coli].

PubMed

Liang, W J; Zhang, R G; Duan, G C; Hong, L J; Zhang, B; Xi, Y L; Yang, H Y; Chen, S Y; Lou, T Y; Zhao, Y X

2016-08-10

A new method related to molecular biomarker with CRISPR/Cas (clustered regularly interspaced short palindromic repeats-cas) in Escherichia (E.) coli was developed and used for surveillance programs. CRISPR/Cas sequence that containing 135 strains with complete sequence and 203 strains with whole genome shotgun sequence of E. coli in GenBank by BLAST and 361 strains of E. coli (including 38 strains of E. coli O157∶H7) in laboratory were identified by PCR and analyzed with the CRISPR Finder. Spacers were compared with DANMAN and the phylogenetic trees of cas gene were constructed under Clustal Ⅹ and Mega 5.1. With new perspective, a descriptive method was developed targeting on the position of CRISPR/cas in E. coli. The CRISPR1 was detected in 77.04%, 100.00% and 75.62% and the CRISPR2 was detected in 74.81%, 100.00% and 92.24% and the CRISPR3 and CRISPR4 were detected in 11.85%, 0 and 1.39% for 135 strains with complete sequence, 203 strains with whole genome shotgun sequence and 361 strains in the laboratory, respectively. One strain downloaded in GenBank with whole genome sequencing and 2 strains in the our laboratory were identified that containing four CRISPR locus. The other E. coli strain was with insertion sequence in downstream of the non-cas CRISPR1. The unique CRISPR was found in 8 strains of O55∶H7, in 180 strains of O157∶H7, in 8 strains of O157∶HNM, in 40 strains of O104∶H4, in 4 strains of O145∶H28, in all the 699 E. coli strains. The phylogenetic tree could be divided into two groups-cas with type I-E or type I-F. CRISPR/Cas might be used as a valuable molecular biomarker in epidemiological surveillance studies to identify the high virulent strains or new strains of E. coli. Phage night be related to the missing or obtaining of spacers.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Draft genome sequence of the phenazine-producing Pseudomonas fluorescens strain 2-79

USDA-ARS?s Scientific Manuscript database

Pseudomonas fluorescens strain 2-79, a natural isolate of the rhizosphere of wheat (Triticum aestivum L.), possesses antagonistic potential toward several fungal pathogens. We report the draft genome sequence of strain 2-79, which comprises 5,674 protein-coding sequences....

Persistence of Mycoplasma hyopneumoniae sequence types in spite of a control program for enzootic pneumonia in pigs.

PubMed

Overesch, Gudrun; Kuhnert, Peter

2017-09-15

Enzootic pneumonia (EP) in pigs caused by Mycoplasma (M.) hyopneumoniae has successfully been combatted in Switzerland. A control program was fully implemented in 2004 which is based on total depopulation strategies of affected fattening farms as well as partial depopulation on breeding farms. Thereby, the number of cases has dropped drastically from more than 200 in 2003 to two cases in 2013. Currently monitoring is done based on clinical observation and subsequent diagnostic of coughing pigs. Moreover, in case of more than 10% gross pathological lesions per slaughter batch laboratory confirmation for EP is compulsory. Despite these strict measures it was not possible to eliminate M. hyopneumoniae from Swiss pig production. In fact, during the last few years the number of EP cases has slightly increased. Therefore, genotyping of the involved M. hyopneumoniae strains was conducted in order to elucidate possible sources and routes of infection. All available and typeable samples from totally 22 cases during the period 2014-2016 were investigated by extended multilocus sequence typing (MLST). A total of 16 cases, including eight from 2014, five from 2015 and three from 2016 could thereby be included in the study. MLST revealed that the majority of cases in 2014/2015 were due to two major spread scenarios, i.e. two M. hyopneumoniae sequence types, each scenario involving six individual production farms in five to six different Cantons (states), respectively. Moreover, by comparison of archived sequences some sequence types were observed over ten years demonstrating their persistence over a long time and the possible partial failure of elimination measures in Switzerland. Insufficient sanitation on affected farms and subsequent animal transport of symptomless infected pigs could lead to recurrent cases. Wild boar harbor identical strains found with EP but solid data are missing to assign a role as reservoir to this wild animal. Implementing a monitoring scheme for M. hyopneumoniae in wild boar in combination with genotyping of all available samples from domestic pigs could direct responsible authorities to possible gaps and deficiencies of control measures taken for combating enzootic pneumonia. With the newly installed PubMLST database sequence types for M. hyopneumoniae are now available and allow tracing back strains on the international level. Copyright © 2017 Elsevier B.V. All rights reserved.

Skeletal muscle tensile strain dependence: hyperviscoelastic nonlinearity

PubMed Central

Wheatley, Benjamin B; Morrow, Duane A; Odegard, Gregory M; Kaufman, Kenton R; Donahue, Tammy L Haut

2015-01-01

Introduction Computational modeling of skeletal muscle requires characterization at the tissue level. While most skeletal muscle studies focus on hyperelasticity, the goal of this study was to examine and model the nonlinear behavior of both time-independent and time-dependent properties of skeletal muscle as a function of strain. Materials and Methods Nine tibialis anterior muscles from New Zealand White rabbits were subject to five consecutive stress relaxation cycles of roughly 3% strain. Individual relaxation steps were fit with a three-term linear Prony series. Prony series coefficients and relaxation ratio were assessed for strain dependence using a general linear statistical model. A fully nonlinear constitutive model was employed to capture the strain dependence of both the viscoelastic and instantaneous components. Results Instantaneous modulus (p<0.0005) and mid-range relaxation (p<0.0005) increased significantly with strain level, while relaxation at longer time periods decreased with strain (p<0.0005). Time constants and overall relaxation ratio did not change with strain level (p>0.1). Additionally, the fully nonlinear hyperviscoelastic constitutive model provided an excellent fit to experimental data, while other models which included linear components failed to capture muscle function as accurately. Conclusions Material properties of skeletal muscle are strain-dependent at the tissue level. This strain dependence can be included in computational models of skeletal muscle performance with a fully nonlinear hyperviscoelastic model. PMID:26409235

Genomic analyses of Clostridium perfringens isolates from five toxinotypes.

PubMed

Hassan, Karl A; Elbourne, Liam D H; Tetu, Sasha G; Melville, Stephen B; Rood, Julian I; Paulsen, Ian T

2015-05-01

Clostridium perfringens can be isolated from a range of environments, including soil, marine and fresh water sediments, and the gastrointestinal tracts of animals and humans. Some C. perfringens strains have attractive industrial applications, e.g., in the degradation of waste products or the production of useful chemicals. However, C. perfringens has been most studied as the causative agent of a range of enteric and soft tissue infections of varying severities in humans and animals. Host preference and disease type in C. perfringens are intimately linked to the production of key extracellular toxins and on this basis toxigenic C. perfringens strains have been classified into five toxinotypes (A-E). To date, twelve genome sequences have been generated for a diverse collection of C. perfringens isolates, including strains associated with human and animal infections, a human commensal strain, and a strain with potential industrial utility. Most of the sequenced strains are classified as toxinotype A. However, genome sequences of representative strains from each of the other four toxinotypes have also been determined. Analysis of this collection of sequences has highlighted a lack of features differentiating toxinotype A strains from the other isolates, indicating that the primary defining characteristic of toxinotype A strains is their lack of key plasmid-encoded extracellular toxin genes associated with toxinotype B to E strains. The representative B-E strains sequenced to date each harbour many unique genes. Additional genome sequences are needed to determine if these genes are characteristic of their respective toxinotypes. Copyright © 2014. Published by Elsevier Masson SAS.

Whole-Genome Sequencing and Comparative Genome Analysis of Bacillus subtilis Strains Isolated from Non-Salted Fermented Soybean Foods

PubMed Central

Kamada, Mayumi; Hase, Sumitaka; Fujii, Kazushi; Miyake, Masato; Sato, Kengo; Kimura, Keitarou; Sakakibara, Yasubumi

2015-01-01

Bacillus subtilis is the main component in the fermentation of soybeans. To investigate the genetics of the soybean-fermenting B. subtilis strains and its relationship with the productivity of extracellular poly-γ-glutamic acid (γPGA), we sequenced the whole genome of eight B. subtilis stains isolated from non-salted fermented soybean foods in Southeast Asia. Assembled nucleotide sequences were compared with those of a natto (fermented soybean food) starter strain B. subtilis BEST195 and the laboratory standard strain B. subtilis 168 that is incapable of γPGA production. Detected variants were investigated in terms of insertion sequences, biotin synthesis, production of subtilisin NAT, and regulatory genes for γPGA synthesis, which were related to fermentation process. Comparing genome sequences, we found that the strains that produce γPGA have a deletion in a protein that constitutes the flagellar basal body, and this deletion was not found in the non-producing strains. We further identified diversity in variants of the bio operon, which is responsible for the biotin auxotrophism of the natto starter strains. Phylogenetic analysis using multilocus sequencing typing revealed that the B. subtilis strains isolated from the non-salted fermented soybeans were not clustered together, while the natto-fermenting strains were tightly clustered; this analysis also suggested that the strain isolated from “Tua Nao” of Thailand traces a different evolutionary process from other strains. PMID:26505996

Complete secretion of activable bovine prochymosin by genetically engineered L forms of Proteus mirabilis.

PubMed Central

Klessen, C; Schmidt, K H; Gumpert, J; Grosse, H H; Malke, H

1989-01-01

To circumvent problems encountered in the synthesis of active chymosin in a number of bacteria and fungi, a recombinant DNA L-form expression system that directed the complete secretion of fully activable prochymosin into the extracellular culture medium was developed. The expression plasmid constructions involved the in-frame fusion of prochymosin cDNA minus codons 1 to 4 to streptococcal pyrogenic exotoxin type A gene (speA') sequences, including the speA promoter, ribosomal binding site, and signal sequence and five codons of mature SpeA. Secretion of fusion prochymosin enzymatically and immunologically indistinguishable from bovine prochymosin was achieved after transformation of two stable protoplast type L-form strains derived from Proteus mirabilis. The secreted proenzyme was converted by autocatalytic processing to chymosin showing milk-clotting activity. In controlled laboratory fermentation processes, a maximum specific rate of activable prochymosin synthesis of 0.57 x 10(-3)/h was determined from the time courses of biomass dry weight and product formation. Yields as high as 40 +/- 10 micrograms/ml were obtained in the cell-free culture fluid of strain L99 carrying a naturally altered expression plasmid of increased segregational stability. The expression-secretion system described may be generally useful for production of recombinant mammalian proteins synthesized intracellularly as aberrantly folded insoluble aggregates. Images PMID:2499253

Draft Genome Sequence of Thermus scotoductus Strain K1, Isolated from a Geothermal Spring in Karvachar, Nagorno Karabakh

PubMed Central

Saghatelyan, Ani; Poghosyan, Lianna

2015-01-01

The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. PMID:26564055

Amplicon Sequencing of the slpH Locus Permits Culture-Independent Strain Typing of Lactobacillus helveticus in Dairy Products

PubMed Central

Moser, Aline; Wüthrich, Daniel; Bruggmann, Rémy; Eugster-Meier, Elisabeth; Meile, Leo; Irmler, Stefan

2017-01-01

The advent of massive parallel sequencing technologies has opened up possibilities for the study of the bacterial diversity of ecosystems without the need for enrichment or single strain isolation. By exploiting 78 genome data-sets from Lactobacillus helveticus strains, we found that the slpH locus that encodes a putative surface layer protein displays sufficient genetic heterogeneity to be a suitable target for strain typing. Based on high-throughput slpH gene sequencing and the detection of single-base DNA sequence variations, we established a culture-independent method to assess the biodiversity of the L. helveticus strains present in fermented dairy food. When we applied the method to study the L. helveticus strain composition in 15 natural whey cultures (NWCs) that were collected at different Gruyère, a protected designation of origin (PDO) production facilities, we detected a total of 10 sequence types (STs). In addition, we monitored the development of a three-strain mix in raclette cheese for 17 weeks. PMID:28775722

Draft genome sequence of Thermoanaerobacterium sp. strain PSU-2 isolated from thermophilic hydrogen producing reactor.

PubMed

O-Thong, Sompong; Khongkliang, Peerawat; Mamimin, Chonticha; Singkhala, Apinya; Prasertsan, Poonsuk; Birkeland, Nils-Kåre

2017-06-01

Thermoanaerobacterium sp. strain PSU-2 was isolated from thermophilic hydrogen producing reactor and subjected to draft genome sequencing on 454 pyrosequencing and annotated on RAST. The draft genome sequence of strain PSU-2 contains 2,552,497 bases with an estimated G + C content of 35.2%, 2555 CDS, 8 rRNAs and 57 tRNAs. The strain had a number of genes responsible for carbohydrates metabolic, amino acids and derivatives, and protein metabolism of 17.7%, 14.39% and 9.81%, respectively. Strain PSU-2 also had gene responsible for hydrogen biosynthesis as well as the genes related to Ni-Fe hydrogenase. Comparative genomic analysis indicates strain PSU-2 shares about 94% genome sequence similarity with Thermoanaerobacterium xylanolyticum LX-11. The nucleotide sequence of this draft genome was deposited into DDBJ/ENA/GenBank under the accession MSQD00000000.

Characterization, genetic diversity, and evolutionary link of Cucumber mosaic virus strain New Delhi from India.

PubMed

Koundal, Vikas; Haq, Qazi Mohd Rizwanul; Praveen, Shelly

2011-02-01

The genome of Cucumber mosaic virus New Delhi strain (CMV-ND) from India, obtained from tomato, was completely sequenced and compared with full genome sequences of 14 known CMV strains from subgroups I and II, for their genetic diversity. Sequence analysis suggests CMV-ND shares maximum sequence identity at the nucleotide level with a CMV strain from Taiwan. Among all 15 strains of CMV, the encoded protein 2b is least conserved, whereas the coat protein (CP) is most conserved. Sequence identity values and phylogram results indicate that CMV-ND belongs to subgroup I. Based on the recombination detection program result, it appears that CMV is prone to recombination, and different RNA components of CMV-ND have evolved differently. Recombinational analysis of all 15 CMV strains detected maximum recombination breakpoints in RNA2; CP showed the least recombination sites.

Genetic variation in the 3’ untranslated region of dengue virus serotype 3 strains isolated from mosquitoes and humans in Brazil

PubMed Central

2013-01-01

Summary Background Dengue, a mosquito-borne viral infection caused by one of the four dengue virus (DENV) serotypes (DENV-1 to 4), replicate alternately on the mosquito vector and human host and are responsible for infections throughout tropical and subtropical regions of the world. In Brazil, the disease has become a major public health problem and the introduction of DENV-3 in 2000 in Rio de Janeiro (RJ) was associated with severe dengue epidemics. The potential emergence of strains associated with severe disease highlights the need for the surveillance of DENV in human host and vectors. Methods Aiming to contribute for DENV phylogenetic and vector-virus-human host studies, we sequenced the entire genome of one DENV-3 isolated from naturally infected Aedes aegypti from RJ in 2001 and characterized the 3’ UTR from strains isolated from mosquitoes and humans. Mosquitoes were pooled and submitted to virus isolation in Ae. albopictus C6/36 cells and the infecting serotype was identified by immunofluorescence using type-specific monoclonal antibody. Sequence analysis was performed using BioEdit software, the multiple alignments were performed using CLUSTAL W and the phylogenetic analysis by MEGA 5, using the Neighbor-joining method. Secondary structure prediction was performed by using the MFOLD program. Results Exclusive substitutions and a substitution leading to a stop codon on the NS5 gene were observed in the DENV-3 isolated from a naturally infected Ae. aegypti and fully sequenced. As an 8- nucleotides deletion was observed within the 11- nucleotides (nts) insertion on the variable region (VR) from the 3′UTR in this isolate, we further sequenced other DENV-3 from both mosquitoes and humans. The majority of DENV-3 from RJ analyzed were characterized by the 11-nts insertion in the VR of the 3′UTR, despite the observation of strains carrying the 8-nts deletion. The latter presented similar secondary structures, however not all strains presenting the 11-nts insertion were similar in the predicted secondary structure. Conclusions The phylogeny based on the analysis of the complete genome and 3′UTR characterized the DENV-3 isolated from both vector and human host as belonging to Genotype III (GIII), despite the differences observed on the 3’ UTR. Further studies are needed to address the role of those mutations in the transmission of the different viral populations and vector competence. PMID:23282086

Genome Sequencing and Analysis of Yersina pestis KIM D27, an Avirulent Strain Exempt from Select Agent Regulation

PubMed Central

Losada, Liliana; Varga, John J.; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C.

2011-01-01

Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes. PMID:21559501

Genome sequencing and analysis of Yersina pestis KIM D27, an avirulent strain exempt from select agent regulation.

PubMed

Losada, Liliana; Varga, John J; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C

2011-04-29

Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes.

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

Draft Genome Sequence of Ideonella sp. Strain A 288, Isolated from an Iron-Precipitating Biofilm

PubMed Central

Künzel, Sven; Szewzyk, Ulrich

2017-01-01

ABSTRACT Here, we report the draft genome sequence of the betaproteobacterium Ideonella sp. strain A_228. This isolate, obtained from a bog iron ore-containing floodplain area in Germany, provides valuable information about the genetic diversity of neutrophilic iron-depositing bacteria. The Illumina NextSeq technique was used to sequence the draft genome sequence of the strain. PMID:28818902

Pre-lithification tectonic foliation development in a clastic sedimentary sequence

NASA Astrophysics Data System (ADS)

Meere, Patrick; Mulchrone, Kieran; McCarthy, David; Timmermann, Martin; Dewey, John

2016-04-01

The current view regarding the timing of regionally developed penetrative tectonic fabrics in sedimentary rocks is that their development postdates lithification of those rocks. In this case fabric development is achieved by a number of deformation mechanisms including grain rigid body rotation, crystal-plastic deformation and pressure solution (wet diffusion). The latter is believed to be the primary mechanism responsible for shortening and the domainal structure of cleavage development commonly observed in low grade metamorphic rocks. In this study we combine field observations with strain analysis and modelling to fully characterise considerable (>50%) mid-Devonian Acadian crustal shortening in a Devonian clastic sedimentary sequence from south west Ireland. Despite these high levels of shortening and associated penetrative tectonic fabric there is a marked absence of the expected domainal cleavage structure and intra-clast deformation, which are expected with this level of deformation. In contrast to the expected deformation processes associated with conventional cleavage development, fabrics in these rocks are a product of translation, rigid body rotation and repacking of extra-formational clasts during deformation of an un-lithified clastic sedimentary sequence.

Comparative analysis of the XopD T3S effector family in plant pathogenic bacteria

PubMed Central

Kim, Jung-Gun; Taylor, Kyle W.; Mudgett, Mary Beth

2011-01-01

SUMMARY XopD is a type III effector protein that is required for Xanthomonas campestris pathovar vesicatoria (Xcv) growth in tomato. It is a modular protein consisting of an N-terminal DNA-binding domain, two EAR transcriptional repressor motifs, and a C-terminal SUMO protease. In tomato, XopD functions as a transcriptional repressor, resulting in the suppression of defense responses at late stages of infection. A survey of available genome sequences for phytopathogenic bacteria revealed that XopD homologs are limited to species within three Genera of Proteobacteria – Xanthomonas, Acidovorax, and Pseudomonas. While the EAR motif(s) and SUMO protease domain are conserved in all the XopD-like proteins, variation exists in the length and sequence identity of the N-terminal domains. Comparative analysis of the DNA sequences surrounding xopD and xopD-like genes led to revised annotation of the xopD gene. Edman degradation sequence analysis and functional complementation studies confirmed that the xopD gene from Xcv encodes a 760 amino acid protein with a longer N-terminal domain than previously predicted. None of the XopD-like proteins studied complemented Xcv ΔxopD mutant phenotypes in tomato leaves suggesting that the N-terminus of XopD defines functional specificity. Xcv ΔxopD strains expressing chimeric fusion proteins containing the N-terminus of XopD fused to the EAR motif(s) and SUMO protease domain of the XopD-like protein from Xanthomonas campestris pathovar campestris strain B100 were fully virulent in tomato demonstrating that the N-terminus of XopD controls specificity in tomato. PMID:21726373

Two Different Rickettsial Bacteria Invading Volvox carteri

PubMed Central

Kawafune, Kaoru; Hongoh, Yuichi; Hamaji, Takashi; Sakamoto, Tomoaki; Kurata, Tetsuya; Hirooka, Shunsuke; Miyagishima, Shin-ya; Nozaki, Hisayoshi

2015-01-01

Background Bacteria of the family Rickettsiaceae are principally associated with arthropods. Recently, endosymbionts of the Rickettsiaceae have been found in non-phagotrophic cells of the volvocalean green algae Carteria cerasiformis, Pleodorina japonica, and Volvox carteri. Such endosymbionts were present in only C. cerasiformis strain NIES-425 and V. carteri strain UTEX 2180, of various strains of Carteria and V. carteri examined, suggesting that rickettsial endosymbionts may have been transmitted to only a few algal strains very recently. However, in preliminary work, we detected a sequence similar to that of a rickettsial gene in the nuclear genome of V. carteri strain EVE. Methodology/Principal Findings Here we explored the origin of the rickettsial gene-like sequences in the endosymbiont-lacking V. carteri strain EVE, by performing comparative analyses on 13 strains of V. carteri. By reference to our ongoing genomic sequence of rickettsial endosymbionts in C. cerasiformis strain NIES-425 cells, we confirmed that an approximately 9-kbp DNA sequence encompassing a region similar to that of four rickettsial genes was present in the nuclear genome of V. carteri strain EVE. Phylogenetic analyses, and comparisons of the synteny of rickettsial gene-like sequences from various strains of V. carteri, indicated that the rickettsial gene-like sequences in the nuclear genome of V. carteri strain EVE were closely related to rickettsial gene sequences of P. japonica, rather than those of V. carteri strain UTEX 2180. Conclusion/Significance At least two different rickettsial organisms may have invaded the V. carteri lineage, one of which may be the direct ancestor of the endosymbiont of V. carteri strain UTEX 2180, whereas the other may be closely related to the endosymbiont of P. japonica. Endosymbiotic gene transfer from the latter rickettsial organism may have occurred in an ancestor of V. carteri. Thus, the rickettsiae may be widely associated with V. carteri, and likely have often been lost during host evolution. PMID:25671568

Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

New Genome Sequence of an Echinacea purpurea Endophyte, Arthrobacter sp. Strain EpSL27, Able To Inhibit Human-Opportunistic Pathogens

PubMed Central

Miceli, Elisangela; Presta, Luana; Maggini, Valentina; Fondi, Marco; Bosi, Emanuele; Chiellini, Carolina; Fagorzi, Camilla; Bogani, Patrizia; Di Pilato, Vincenzo; Rossolini, Gian Maria; Mengoni, Alessio; Firenzuoli, Fabio; Perrin, Elena

2017-01-01

ABSTRACT We announce here the draft genome sequence of Arthrobacter sp. strain EpSL27, isolated from the stem and leaves of the medicinal plant Echinacea purpurea and able to inhibit human-pathogenic bacterial strains. The genome sequencing of this strain may lead to the identification of genes involved in the production of antimicrobial molecules. PMID:28642378

New Genome Sequence of an Echinaceapurpurea Endophyte, Arthrobacter sp. Strain EpSL27, Able To Inhibit Human-Opportunistic Pathogens.

PubMed

Miceli, Elisangela; Presta, Luana; Maggini, Valentina; Fondi, Marco; Bosi, Emanuele; Chiellini, Carolina; Fagorzi, Camilla; Bogani, Patrizia; Di Pilato, Vincenzo; Rossolini, Gian Maria; Mengoni, Alessio; Firenzuoli, Fabio; Perrin, Elena; Fani, Renato

2017-06-22

We announce here the draft genome sequence of Arthrobacter sp. strain EpSL27, isolated from the stem and leaves of the medicinal plant Echinacea purpurea and able to inhibit human-pathogenic bacterial strains. The genome sequencing of this strain may lead to the identification of genes involved in the production of antimicrobial molecules. Copyright © 2017 Miceli et al.

Draft Genome Sequence of Thermus scotoductus Strain K1, Isolated from a Geothermal Spring in Karvachar, Nagorno Karabakh.

PubMed

Saghatelyan, Ani; Poghosyan, Lianna; Panosyan, Hovik; Birkeland, Nils-Kåre

2015-11-12

The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. Copyright © 2015 Saghatelyan et al.

Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora

PubMed Central

Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.

1999-01-01

The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008

Genome sequence and analysis of a stress-tolerant, wild-derived strain of Saccharomyces cerevisiae used in biofuels research

DOE Office of Scientific and Technical Information (OSTI.GOV)

McIlwain, Sean J.; Peris, Davis; Sardi, Maria

The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less

Genome sequence and analysis of a stress-tolerant, wild-derived strain of Saccharomyces cerevisiae used in biofuels research

DOE PAGES

McIlwain, Sean J.; Peris, Davis; Sardi, Maria; ...

2016-04-20

The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less

Sequence of the toxic shock syndrome toxin gene (tstH) borne by strains of Staphylococcus aureus isolated from patients with Kawasaki syndrome.

PubMed Central

Deresiewicz, R L; Flaxenburg, J; Leng, K; Kasper, D L

1996-01-01

To explore whether a novel staphylococcal clone or structural variant of toxic shock syndrome toxin 1 is associated with Kawasaki syndrome, six toxigenic strains of Staphylococcus aureus from Kawasaki syndrome patients were studied. The strains were divisible into two groups based on phenotypic and genotypic characteristics and are therefore unequivocally not clonal. Portions of the tstH genes of each strain were sequenced. Three were sequenced in their entirety, while the remainder were sequenced from codon 66 to codon 137 of the mature protein only. Two of the former group differed slightly in the sequences of their signal peptides relative to the sequence published for the tstH signal peptide. Those differences did not affect toxin processing or secretion. The sequenced portions of the regions encoding mature toxic shock syndrome toxin 1 were identical in all six strains and corresponded exactly to the published sequence of tstH. No evidence was found for the existence of a structural variant of tstH uniquely associated with Kawasaki syndrome. PMID:8757881

Host transcriptomic responses to pneumonic plague reveal that Yersinia pestis inhibits both the initial adaptive and innate immune responses in mice.

PubMed

Yang, Huiying; Wang, Tong; Tian, Guang; Zhang, Qingwen; Wu, Xiaohong; Xin, Youqian; Yan, Yanfeng; Tan, Yafang; Cao, Shiyang; Liu, Wanbing; Cui, Yujun; Yang, Ruifu; Du, Zongmin

2017-01-01

Pneumonic plague is the most deadly form of infection caused by Yersinia pestis and can progress extremely fast. However, our understanding on the host transcriptomic response to pneumonic plague is insufficient. Here, we used RNA-sequencing technology to analyze transcriptomic responses in mice infected with fully virulent strain 201 or EV76, a live attenuated vaccine strain lacking the pigmentation locus. Approximately 600 differentially expressed genes (DEGs) were detected in lungs from both 201- and EV76-infected mice at 12h post-infection (hpi). DEGs in lungs of 201-infected mice exceeded 2000 at 48hpi, accompanied by sustained large numbers of DEGs in the liver and spleen; however, limited numbers of DEGs were detected in those organs of EV-infected mice. Remarkably, DEGs in lungs were significantly enriched in critical immune responses pathways in EV76-infected but not 201-infected mice, including antigen processing and presentation, T cell receptor signaling among others. Pathological and bacterial load analyses confirmed the rapid systemic dissemination of 201-infection and the confined EV76-infection in lungs. Our results suggest that fully virulent Y. pestis inhibits both the innate and adaptive immune responses that are substantially stimulated in a self-limited infection, which update our holistic views on the transcriptomic response to pneumonic plague. Copyright © 2016 Elsevier GmbH. All rights reserved.

Complete Genome Sequence and Comparative Genomics of a Streptococcus pyogenes emm3 Strain M3-b isolated from a Japanese Patient with Streptococcal Toxic Shock Syndrome.

PubMed

Ogura, Kohei; Watanabe, Shinya; Kirikae, Teruo; Miyoshi-Akiyama, Tohru

2017-01-01

Epidemiologic typing of Streptococcus pyogenes (GAS) is frequently based on the genotype of the emm gene, which encodes M/Emm protein. In this study, the complete genome sequence of GAS emm3 strain M3-b, isolated from a patient with streptococcal toxic shock syndrome (STSS), was determined. This strain exhibited 99% identity with other complete genome sequences of emm3 strains MGAS315, SSI-1, and STAB902. The complete genomes of five additional strains isolated from Japanese patients with and without STSS were also sequences. Maximum-likelihood phylogenetic analysis showed that strains M3-b, M3-e, and SSI-1, all which were isolated from STSS patients, were relatively close.

The genome sequence of avian pathogenic Escherichia coli strain O1:K1:H7 shares strong similarities with human extraintestinal pathogenic E. coli genomes.

PubMed

Johnson, Timothy J; Kariyawasam, Subhashinie; Wannemuehler, Yvonne; Mangiamele, Paul; Johnson, Sara J; Doetkott, Curt; Skyberg, Jerod A; Lynne, Aaron M; Johnson, James R; Nolan, Lisa K

2007-04-01

Escherichia coli strains that cause disease outside the intestine are known as extraintestinal pathogenic E. coli (ExPEC) and include human uropathogenic E. coli (UPEC) and avian pathogenic E. coli (APEC). Regardless of host of origin, ExPEC strains share many traits. It has been suggested that these commonalities may enable APEC to cause disease in humans. Here, we begin to test the hypothesis that certain APEC strains possess potential to cause human urinary tract infection through virulence genotyping of 1,000 APEC and UPEC strains, generation of the first complete genomic sequence of an APEC (APEC O1:K1:H7) strain, and comparison of this genome to all available human ExPEC genomic sequences. The genomes of APEC O1 and three human UPEC strains were found to be remarkably similar, with only 4.5% of APEC O1's genome not found in other sequenced ExPEC genomes. Also, use of multilocus sequence typing showed that some of the sequenced human ExPEC strains were more like APEC O1 than other human ExPEC strains. This work provides evidence that at least some human and avian ExPEC strains are highly similar to one another, and it supports the possibility that a food-borne link between some APEC and UPEC strains exists. Future studies are necessary to assess the ability of APEC to overcome the hurdles necessary for such a food-borne transmission, and epidemiological studies are required to confirm that such a phenomenon actually occurs.

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Whole genome sequence analyses of Xylella fastidiosa PD strains from different geographical regions

USDA-ARS?s Scientific Manuscript database

Genome sequences were determined for two Pierce’s disease (PD) causing Xylella fastidiosa (Xf) strains, one from Florida and one from Taiwan. The Florida strain was ATCC 35879, the type of strain used as a standard reference for related taxonomy research. By contrast, the Taiwan strain used was only...

Complete Genome Sequence of the Avian Paramyxovirus Serotype 5 Strain APMV-5/budgerigar/Japan/TI/75.

PubMed

Hiono, Takahiro; Matsuno, Keita; Tuchiya, Kotaro; Lin, Zhifeng; Okamatsu, Masatoshi; Sakoda, Yoshihiro

2016-09-22

Here, we report the complete genome sequence of the avian paramyxovirus serotype 5 strain APMV-5/budgerigar/Japan/TI/75, which was determined using the Illumina MiSeq platform. The determined sequence shares 97% homology and similar genetic features with the previously known genome sequence of avian paramyxovirus serotype 5 strain APMV-5/budgerigar/Japan/Kunitachi/74. Copyright © 2016 Hiono et al.

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

PubMed

Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

2015-11-01

A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

PubMed Central

Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

2005-01-01

Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

A 12-year molecular survey of clinical herpes simplex virus type 2 isolates demonstrates the circulation of clade A and B strains in Germany.

PubMed

Schmidt-Chanasit, Jonas; Bialonski, Alexandra; Heinemann, Patrick; Ulrich, Rainer G; Günther, Stephan; Rabenau, Holger F; Doerr, Hans Wilhelm

2010-07-01

Recently two different herpes simplex virus type 2 (HSV-2) clades (A and B) were described on DNA sequence data of the glycoprotein E (gE), G (gG) and I (gI) genes. To type the circulating HSV-2 wild-type strains in Germany by a novel approach and to monitor potential changes in the molecular epidemiology between 1997 and 2008. A total of 64 clinical HSV-2 isolates were analyzed by a novel approach using the DNA sequences of the complete open reading frames of glycoprotein B (gB) and gG. Recombination analysis of the gB and gG gene sequences was performed to reveal intragenic recombinants. Based on the phylogenetic analysis of the gB coding DNA sequence 8 of 64 (12%) isolates were classified as clade A strains and 56 of 64 (88%) isolates were classified as clade B strains. Analysis of the gG coding DNA sequence classified 4 (6%) isolates as clade A strains and 60 (94%) isolates as clade B strains. In comparison, the 8 isolates classified as clade A strains using the gB sequence data were classified as clade B strains when using the gG coding DNA sequence, suggesting intergenic recombination events. Intragenic recombination events were not detected. The first molecular survey of clinical HSV-2 isolates from Germany demonstrated the circulation of clade A and B strains and of intergenic recombinants over a period of 12 years. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

PubMed

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Uncommonly isolated clinical Pseudomonas: identification and phylogenetic assignation.

PubMed

Mulet, M; Gomila, M; Ramírez, A; Cardew, S; Moore, E R B; Lalucat, J; García-Valdés, E

2017-02-01

Fifty-two Pseudomonas strains that were difficult to identify at the species level in the phenotypic routine characterizations employed by clinical microbiology laboratories were selected for genotypic-based analysis. Species level identifications were done initially by partial sequencing of the DNA dependent RNA polymerase sub-unit D gene (rpoD). Two other gene sequences, for the small sub-unit ribosonal RNA (16S rRNA) and for DNA gyrase sub-unit B (gyrB) were added in a multilocus sequence analysis (MLSA) study to confirm the species identifications. These sequences were analyzed with a collection of reference sequences from the type strains of 161 Pseudomonas species within an in-house multi-locus sequence analysis database. Whole-cell matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analyses of these strains complemented the DNA sequenced-based phylogenetic analyses and were observed to be in accordance with the results of the sequence data. Twenty-three out of 52 strains were assigned to 12 recognized species not commonly detected in clinical specimens and 29 (56 %) were considered representatives of at least ten putative new species. Most strains were distributed within the P. fluorescens and P. aeruginosa lineages. The value of rpoD sequences in species-level identifications for Pseudomonas is emphasized. The correct species identifications of clinical strains is essential for establishing the intrinsic antibiotic resistance patterns and improved treatment plans.

Full Genome Sequence of Giant Panda Rotavirus Strain CH-1

PubMed Central

Guo, Ling; Yang, Shaolin; Wang, Chengdong; Chen, Shijie; Yang, Xiaonong; Hou, Rong; Quan, Zifang; Hao, Zhongxiang

2013-01-01

We report here the complete genomic sequence of the giant panda rotavirus strain CH-1. This work is the first to document the complete genomic sequence (segments 1 to 11) of the CH-1 strain, which offers an effective platform for providing authentic research experiences to novice scientists. PMID:23469354

Complete genome sequence of salmonella enterica subsp. enterica Serovar Thompson Strain RM6836

USDA-ARS?s Scientific Manuscript database

Salmonella enterica subsp. enterica serovar Thompson (S. Thompson) strain RM6836 was isolated from lettuce in 2002. We report the complete sequence and annotation of the genome of S. Thompson strain RM6836. This is the first reported complete genome sequence for S. Thompson and will provide a point ...

High resolution identity testing of inactivated poliovirus vaccines

PubMed Central

Mee, Edward T.; Minor, Philip D.; Martin, Javier

2015-01-01

Background Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. Methods We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. Results All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Conclusion Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. PMID:26049003

Comparative Sequence Analysis of the Plasmid-Encoded Regulator of Enteropathogenic Escherichia coli Strains

PubMed Central

Okeke, Iruka N.; Borneman, Jade A.; Shin, Sooan; Mellies, Jay L.; Quinn, Laura E.; Kaper, James B.

2001-01-01

Enteropathogenic Escherichia coli (EPEC) strains that carry the EPEC adherence factor (EAF) plasmid were screened for the presence of different EAF sequences, including those of the plasmid-encoded regulator (per). Considerable variation in gene content of EAF plasmids from different strains was seen. However, bfpA, the gene encoding the structural subunit for the bundle-forming pilus, bundlin, and per genes were found in 96.8% of strains. Sequence analysis of the per operon and its promoter region from 15 representative strains revealed that it is highly conserved. Most of the variation occurs in the 5′ two-thirds of the perA gene. In contrast, the C-terminal portion of the predicted PerA protein that contains the DNA-binding helix-turn-helix motif is 100% conserved in all strains that possess a full-length gene. In a minority of strains including the O119:H2 and canine isolates and in a subset of O128:H2 and O142:H6 strains, frameshift mutations in perA leading to premature truncation and consequent inactivation of the gene were identified. Cloned perA, -B, and -C genes from these strains, unlike those from strains with a functional operon, failed to activate the LEE1 operon and bfpA transcriptional fusions or to complement a per mutant in reference strain E2348/69. Furthermore, O119, O128, and canine strains that carry inactive per operons were deficient in virulence protein expression. The context in which the perABC operon occurs on the EAF plasmid varies. The sequence upstream of the per promoter region in EPEC reference strains E2348/69 and B171-8 was present in strains belonging to most serogroups. In a subset of O119:H2, O128:H2, and O142:H6 strains and in the canine isolate, this sequence was replaced by an IS1294-homologous sequence. PMID:11500429

A Fatigue Life Prediction Method Based on Strain Intensity Factor

PubMed Central

Zhang, Wei; Liu, Huili; Wang, Qiang; He, Jingjing

2017-01-01

In this paper, a strain-intensity-factor-based method is proposed to calculate the fatigue crack growth under the fully reversed loading condition. A theoretical analysis is conducted in detail to demonstrate that the strain intensity factor is likely to be a better driving parameter correlated with the fatigue crack growth rate than the stress intensity factor (SIF), especially for some metallic materials (such as 316 austenitic stainless steel) in the low cycle fatigue region with negative stress ratios R (typically R = −1). For fully reversed cyclic loading, the constitutive relation between stress and strain should follow the cyclic stress-strain curve rather than the monotonic one (it is a nonlinear function even within the elastic region). Based on that, a transformation algorithm between the SIF and the strain intensity factor is developed, and the fatigue crack growth rate testing data of 316 austenitic stainless steel and AZ31 magnesium alloy are employed to validate the proposed model. It is clearly observed that the scatter band width of crack growth rate vs. strain intensity factor is narrower than that vs. the SIF for different load ranges (which indicates that the strain intensity factor is a better parameter than the stress intensity factor under the fully reversed load condition). It is also shown that the crack growth rate is not uniquely determined by the SIF range even under the same R, but is also influenced by the maximum loading. Additionally, the fatigue life data (strain-life curve) of smooth cylindrical specimens are also used for further comparison, where a modified Paris equation and the equivalent initial flaw size (EIFS) are involved. The results of the proposed method have a better agreement with the experimental data compared to the stress intensity factor based method. Overall, the strain intensity factor method shows a fairly good ability in calculating the fatigue crack propagation, especially for the fully reversed cyclic loading condition. PMID:28773049

Genome sequences of Alicycliphilus denitrificans strain BC and K601(T)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oosterkamp, Margreet J.; Veuskens, Teun; Plugge, Caroline M.

2011-01-01

Alicycliphilus denitrificans strain BC and A. denitrificans strain K601T degrade cyclic hydrocarbons. These strains have been isolated from a mixture of wastewater treatment plant material and benzene-polluted soil and from a wastewater treatment plant, respectively, suggesting their role in bioremediation of soil and water. Although the strains are phylogenetically closely related, there are some clear physiological differences. The hydrocarbon cyclohexanol, for example, can be degraded by strain K601T but not by strain BC. Furthermore, both strains can use nitrate and oxygen as an electron acceptor, but only strain BC can use chlorate as electron acceptor. To better understand the nitratemore » and chlorate reduction mechanisms coupled to the oxidation of cyclic compounds, the genomes of A. denitrificans strains BC and K601T were sequenced. Here, we report the complete genome sequences of A. denitrificans strains BC and K601T.« less

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros

Ensifer meliloti Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here in this paper, the features of E. meliloti Mlalz-1 are described, together with high-qualitymore » permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to Ensifer meliloti IAM 12611 T, Ensifer medicae A 321T and Ensifer numidicus ORS 1407 T, based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as E. meliloti . Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata-nodulating Ensifer strains, but ≤93% with nodC of Ensifer strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced E. meliloti strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In E. medicae strain WSM419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of E. medicae strains, which suggests genetic recombination between strain Mlalz-1 and E. medicae and the horizontal gene transfer of lpiA-acvB.« less

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain

DOE PAGES

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros; ...

2017-09-25

Ensifer meliloti Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here in this paper, the features of E. meliloti Mlalz-1 are described, together with high-qualitymore » permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to Ensifer meliloti IAM 12611 T, Ensifer medicae A 321T and Ensifer numidicus ORS 1407 T, based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as E. meliloti . Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata-nodulating Ensifer strains, but ≤93% with nodC of Ensifer strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced E. meliloti strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In E. medicae strain WSM419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of E. medicae strains, which suggests genetic recombination between strain Mlalz-1 and E. medicae and the horizontal gene transfer of lpiA-acvB.« less

Classification of Plant Associated Bacteria Using RIF, a Computationally Derived DNA Marker

PubMed Central

Schneider, Kevin L.; Marrero, Glorimar; Alvarez, Anne M.; Presting, Gernot G.

2011-01-01

A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF). Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS). Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF sequences obtained from unknown strains in both chromatogram and FASTA format. PMID:21533033

Genome sequences of Escherichia coli strains that cause persistent and transient mastitis

USDA-ARS?s Scientific Manuscript database

The genomes of two strains of Escherichia coli that cause bovine mastitis were sequenced. These strains are known to be associated with persistent and transient mastitis: strain ECA-B causes a transient infection, and ECC-M leads to a persistent infection....

Variation in genotype and higher virulence of a strain of Sporothrix schenckii causing disseminated cutaneous sporotrichosis.

PubMed

Zhang, Zhenying; Liu, Xiaoming; Lv, Xuelian; Lin, Jingrong

2011-12-01

Sporotrichosis is usually a localized, lymphocutaneous disease, but its disseminated type was rarely reported. The main objective of this study was to identify specific DNA sequence variation and virulence of a strain of Sporothrix schenckii isolated from the lesion of disseminated cutaneous sporotrichosis. We confirmed this strain to be S. schenckii by(®) tubulin and chitin synthase gene sequence analysis in addition to the routine mycological and partial ITS and NTS sequencing. We found a 10-bp deletion in the ribosomal NTS region of this strain, in reference to the sequence of control strains isolated from fixed cutaneous sporotrichosis. After inoculated into immunosuppressed mice, this strain caused more extensive system involvement and showed stronger virulence than the control strain isolated from a fixed cutaneous sporotrichosis. Our study thus suggests that different clinical manifestation of sporotrichosis may be associated with variation in genotype and virulence of the strain, independent of effects due to the immune status of the host.

Genetic diversity analysis of Leuconostoc mesenteroides from Korean vegetables and food products by multilocus sequence typing.

PubMed

Sharma, Anshul; Kaur, Jasmine; Lee, Sulhee; Park, Young-Seo

2018-06-01

In the present study, 35 Leuconostoc mesenteroides strains isolated from vegetables and food products from South Korea were studied by multilocus sequence typing (MLST) of seven housekeeping genes (atpA, groEL, gyrB, pheS, pyrG, rpoA, and uvrC). The fragment sizes of the seven amplified housekeeping genes ranged in length from 366 to 1414 bp. Sequence analysis indicated 27 different sequence types (STs) with 25 of them being represented by a single strain indicating high genetic diversity, whereas the remaining 2 were characterized by five strains each. In total, 220 polymorphic nucleotide sites were detected among seven housekeeping genes. The phylogenetic analysis based on the STs of the seven loci indicated that the 35 strains belonged to two major groups, A (28 strains) and B (7 strains). Split decomposition analysis showed that intraspecies recombination played a role in generating diversity among strains. The minimum spanning tree showed that the evolution of the STs was not correlated with food source. This study signifies that the multilocus sequence typing is a valuable tool to access the genetic diversity among L. mesenteroides strains from South Korea and can be used further to monitor the evolutionary changes.

Large-scale genomic analyses reveal the population structure and evolutionary trends of Streptococcus agalactiae strains in Brazilian fish farms.

PubMed

Barony, Gustavo M; Tavares, Guilherme C; Pereira, Felipe L; Carvalho, Alex F; Dorella, Fernanda A; Leal, Carlos A G; Figueiredo, Henrique C P

2017-10-19

Streptococcus agalactiae is a major pathogen and a hindrance on tilapia farming worldwide. The aims of this work were to analyze the genomic evolution of Brazilian strains of S. agalactiae and to establish spatial and temporal relations between strains isolated from different outbreaks of streptococcosis. A total of 39 strains were obtained from outbreaks and their whole genomes were sequenced and annotated for comparative analysis of multilocus sequence typing, genomic similarity and whole genome multilocus sequence typing (wgMLST). The Brazilian strains presented two sequence types, including a newly described ST, and a non-typeable lineage. The use of wgMLST could differentiate each strain in a single clone and was used to establish temporal and geographical correlations among strains. Bayesian phylogenomic analysis suggests that the studied Brazilian population was co-introduced in the country with their host, approximately 60 years ago. Brazilian strains of S. agalactiae were shown to be heterogeneous in their genome sequences and were distributed in different regions of the country according to their genotype, which allowed the use of wgMLST analysis to track each outbreak event individually.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

[Multilocus sequence-typing for characterization of Moscow strains of Haemophilus influenzae type b].

PubMed

Platonov, A E; Mironov, K O; Iatsyshina, S B; Koroleva, I S; Platonova, O V; Gushchin, A E; Shipulin, G A

2003-01-01

Haemophilius influenzae, type b (Hib) bacteria, were genotyped by multilocus sequence typing (MLST) using 5 loci (adk, fucK, mdh, pgi, recA). 42 Moscow Hib strains (including 38 isolates form cerebrospinal fluid of children, who had purulent meningitis in 1999-2001, and 4 strains isolated from healthy carriers of Hib), as well as 2 strains from Yekaterinburg were studied. In MLST a strain is characterized, by alleles and their combinations (an allele profile) referred to also as sequence-type (ST). 9 Sts were identified within the Russian Hib bacteria: ST-1 was found in 25 strains (57%), ST-12 was found in 8 strains (18%), ST-11 was found in 4 strains (9%) and ST-15 was found in 2 strains (4.5%); all other STs strains (13, 14, 16, 17, 51) were found in isolated cases (2.3%). A comparison of allelic profiles and of nucleotide sequences showed that 93% of Russian isolates, i.e. strain with ST-1, 11, 12, 13, 15 and 17, belong to one and the same clonal complex. 2 isolates from Norway and Sweden from among 7 foreign Hib strains studied up to now can be described as belonging to the same clonal complex; 5 Hib strains were different from the Russian ones.

Draft Genome Sequence of Sphingobium ummariense Strain RL-3, a Hexachlorocyclohexane-Degrading Bacterium

PubMed Central

Kohli, Puneet; Dua, Ankita; Sangwan, Naseer; Oldach, Phoebe; Khurana, J. P.

2013-01-01

Here, we report the draft genome sequence of the hexachlorocyclohexane (HCH)-degrading bacterium Sphingobium ummariense strain RL-3, which was isolated from the HCH dumpsite located in Lucknow, India (27°00′N and 81°09′E). The annotated draft genome sequence (4.75 Mb) of strain RL-3 consisted of 139 contigs, 4,645 coding sequences, and 65% G+C content. PMID:24233594

Hepatitis a virus genotypes and strains from an endemic area of Europe, Bulgaria 2012-2014.

PubMed

Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Cella, Eleonora; Lo Presti, Alessandra; Costantino, Angela; Chionne, Paola; Madonna, Elisabetta; Golkocheva-Markova, Elitsa; Bankova, Diljana; Ciccozzi, Massimo; Teoharov, Pavel; Ciccaglione, Anna Rita

2017-07-14

Hepatitis A virus (HAV) infection is endemic in Eastern European and Balkan region countries. In 2012, Bulgaria showed the highest rate (67.13 cases per 100,000) in Europe. Nevertheless, HAV genotypes and strains circulating in this country have never been described. The present study reports the molecular characterization of HAV from 105 patients from Bulgaria. Anti-HAV IgM positive serum samples collected in 2012-2014 from different towns and villages in Bulgaria were analysed by nested RT-PCR, sequencing of the VP1/2A region and phylogenetic analysis; the results were analysed together with patient and geographical data. Phylogenetic analysis revealed two main sequence groups corresponding to the IA (78/105, 74%) and IB (27/105, 26%) sub-genotypes. In the IA group, a major and a minor cluster were observed (62 and 16 sequences, respectively). Most sequences from the major cluster (44/62, 71%) belonged to either of two strains, termed "strain 1" and "strain 2", differing only for a single specific nucleotide; the remaining sequences (18/62, 29%) showed few (1 to 4) nucleotide variations respect to strain 1 and 2. Strain 2 is identical to the strain previously responsible for an outbreak in the Czech Republic in 2008 and a large multi-country European outbreak caused by contaminated mixed frozen berries in 2013. Most sequences of the IA minor cluster and the IB group were detected in large/medium centers (LMCs). Overall, sequences from the IA major cluster were more frequent in small centers (SCs), but strain 1 and strain 2 showed an opposite relative frequency in SCs and LMCs (strain 1 more frequent in SCs, strain 2 in LMCs). Genotype IA predominated in Bulgaria in 2012-2014 and phylogenetic analysis identified a major cluster of highly related or identical IA sequences, representing 59% of the analysed cases; these isolates were mostly detected in SCs, in which HAV shows higher endemicity than in LMCs. The distribution of viral sequences suggests the existence of some differences between the transmission routes in SCs and LMCs. Molecular characterization of an increased number of isolates from Bulgaria, regularly collected over time, will be useful to explore specific transmission routes and plan appropriate preventing measures.

Evidence for a purifying selection acting on the β-lactamase locus in epidemic clones of methicillin-resistant Staphylococcus aureus.

PubMed

Milheiriço, Catarina; Portelinha, Ana; Krippahl, Ludwig; de Lencastre, Hermínia; Oliveira, Duarte C

2011-04-15

The β-lactamase (bla) locus, which confers resistance to penicillins only, may control the transcription of mecA, the central element of methicillin resistance, which is embedded in a polymorphic heterelogous chromosomal cassette (the SCCmec element). In order to assess the eventual correlation between bla allotypes and genetic lineages, SCCmec types and/or β-lactam resistance phenotypes, the allelic variation on the bla locus was evaluated in a representative collection of 54 international epidemic methicillin-resistant Staphylococcus aureus (MRSA) clinical strains and, for comparative purposes, also in 24 diverse methicillin-susceptible S. aureus (MSSA) strains. Internal fragments of blaZ (the β-lactamase structural gene) were sequenced for all strains. A subset of strains, representative of blaZ allotypes, was further characterized by sequencing of internal fragments of the blaZ transcriptional regulators, blaI and blaR1. Thirteen allotypes for blaZ, nine for blaI and 12 for blaR1 were found. In a total of 121 unique single-nucleotide polymorphisms (SNP) detected, no frameshift mutations were identified and only one nonsense mutation within blaZ was found in a MRSA strain. On average, blaZ alleles were more polymorphic among MSSA than in MRSA (14.7 vs 11.4 SNP/allele). Overall, blaR1 was the most polymorphic gene with an average of 24.8 SNP/allele. No correlation could be established between bla allotypes and genetic lineages, SCCmec types and/or β-lactam resistance phenotypes. In order to estimate the selection pressure acting on the bla locus, the average dN/dS values were computed. In the three genes and in both collections dN/dS ratios were significantly below 1. The data strongly suggests the existence of a purifying selection to maintain the bla locus fully functional even on MRSA strains. Although, this is in agreement with the notion that in most clinical MRSA strains mecA gene is under the control of the bla regulatory genes, these findings also suggest that the apparently redundant function of blaZ gene for the MRSA resistant phenotype is still important for these strains. In addition, the data shows that the sensor-inducer blaR1 is the primary target for the accumulation of mutations in the bla locus, presumably to modulate the response to the presence of β-lactam antibiotic.

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

Complete Genome Sequences of Three Moraxella osloensis Strains Isolated from Human Skin

PubMed Central

Lim, Jae Yun; Hwang, Ingyu; Ganzorig, Munkhtsatsral; Huang, Shir-Ly; Cho, Gyu-Sung; Franz, Charles M. A. P.

2018-01-01

ABSTRACT Here, we present the complete whole-genome sequences of three Moraxella osloensis strains with octylphenol polyethoxylate-degrading abilities. These strains were isolated from human skin. PMID:29348360

Comparative Genomic Analysis and Benzene, Toluene, Ethylbenzene, and o-, m-, and p-Xylene (BTEX) Degradation Pathways of Pseudoxanthomonas spadix BD-a59

PubMed Central

Choi, Eun Jin; Jin, Hyun Mi; Lee, Seung Hyeon; Math, Renukaradhya K.; Madsen, Eugene L.

2013-01-01

Pseudoxanthomonas spadix BD-a59, isolated from gasoline-contaminated soil, has the ability to degrade all six BTEX (benzene, toluene, ethylbenzene, and o-, m-, and p-xylene) compounds. The genomic features of strain BD-a59 were analyzed bioinformatically and compared with those of another fully sequenced Pseudoxanthomonas strain, P. suwonensis 11-1, which was isolated from cotton waste compost. The genome of strain BD-a59 differed from that of strain 11-1 in many characteristics, including the number of rRNA operons, dioxygenases, monooxygenases, genomic islands (GIs), and heavy metal resistance genes. A high abundance of phage integrases and GIs and the patterns in several other genetic measures (e.g., GC content, GC skew, Karlin signature, and clustered regularly interspaced short palindromic repeat [CRISPR] gene homology) indicated that strain BD-a59's genomic architecture may have been altered through horizontal gene transfers (HGT), phage attack, and genetic reshuffling during its evolutionary history. The genes for benzene/toluene, ethylbenzene, and xylene degradations were encoded on GI-9, -13, and -21, respectively, which suggests that they may have been acquired by HGT. We used bioinformatics to predict the biodegradation pathways of the six BTEX compounds, and these pathways were proved experimentally through the analysis of the intermediates of each BTEX compound using a gas chromatograph and mass spectrometry (GC-MS). The elevated abundances of dioxygenases, monooxygenases, and rRNA operons in strain BD-a59 (relative to strain 11-1), as well as other genomic characteristics, likely confer traits that enhance ecological fitness by enabling strain BD-a59 to degrade hydrocarbons in the soil environment. PMID:23160122

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

PubMed

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-02-23

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

PubMed Central

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-01-01

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

Genomic sequence analysis of the United States infectious laryngotracheitis vaccine strains chicken embryo origin (CEO) and tissue culture origin (TCO)

USDA-ARS?s Scientific Manuscript database

The genomic sequences of low and high passages of U.S. infectious laryngotracheitis (ILT) vaccine strains chicken embryo origin (CEO) and tissue culture origin (TCO) these strains were determined using hybrid next generation sequencing in order to define relevant genomic changes associated with att...

Draft Genome Sequence of the 2-Chloro-4-Nitrophenol-Degrading Bacterium Arthrobacter sp. Strain SJCon

PubMed Central

Vikram, Surendra; Kumar, Shailesh; Vaidya, Bhumika; Pinnaka, Anil Kumar

2013-01-01

We report the 4.39-Mb draft genome sequence of the 2-chloro-4-nitrophenol-degrading bacterium Arthrobacter sp. strain SJCon, isolated from a pesticide-contaminated site. The draft genome sequence of strain SJCon will be helpful in studying the genetic pathways involved in the degradation of several aromatic compounds. PMID:23516196

Genome Sequence of the Yeast Clavispora lusitaniae Type Strain CBS 6936.

PubMed

Durrens, Pascal; Klopp, Christophe; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Dementhon, Karine; Accoceberry, Isabelle; Sherman, David J; Noël, Thierry

2017-08-03

Clavispora lusitaniae , an environmental saprophytic yeast belonging to the CTG clade of Candida , can behave occasionally as an opportunistic pathogen in humans. We report here the genome sequence of the type strain CBS 6936. Comparison with sequences of strain ATCC 42720 indicates conservation of chromosomal structure but significant nucleotide divergence. Copyright © 2017 Durrens et al.

Genome Sequence of the Yeast Clavispora lusitaniae Type Strain CBS 6936

PubMed Central

Klopp, Christophe; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Dementhon, Karine; Accoceberry, Isabelle; Sherman, David J.; Noël, Thierry

2017-01-01

ABSTRACT Clavispora lusitaniae, an environmental saprophytic yeast belonging to the CTG clade of Candida, can behave occasionally as an opportunistic pathogen in humans. We report here the genome sequence of the type strain CBS 6936. Comparison with sequences of strain ATCC 42720 indicates conservation of chromosomal structure but significant nucleotide divergence. PMID:28774979

Metagenome-Assembled Genome Sequences of Acetobacterium sp. Strain MES1 and Desulfovibrio sp. Strain MES5 from a Cathode-Associated Acetogenic Microbial Community.

PubMed

Ross, Daniel E; Marshall, Christopher W; May, Harold D; Norman, R Sean

2017-09-07

Draft genome sequences of Acetobacterium sp. strain MES1 and Desulfovibrio sp. strain MES5 were obtained from the metagenome of a cathode-associated community enriched within a microbial electrosynthesis system (MES). The draft genome sequences provide insight into the functional potential of these microorganisms within an MES and a foundation for future comparative analyses. Copyright © 2017 Ross et al.

Taxonomic evaluation of putative Streptomyces scabiei strains held in the ARS Culture Collection (NRRL) using multi-locus sequence analysis.

PubMed

Labeda, David P

2016-03-01

Multi-locus sequence analysis has been demonstrated to be a useful tool for identification of Streptomyces species and was previously applied to phylogenetically differentiate the type strains of species pathogenic on potatoes (Solanum tuberosum L.). The ARS Culture Collection (NRRL) contains 43 strains identified as Streptomyces scabiei deposited at various times since the 1950s and these were subjected to multi-locus sequence analysis utilising partial sequences of the house-keeping genes atpD, gyrB, recA, rpoB and trpB. Phylogenetic analyses confirmed the identity of 17 of these strains as Streptomyces scabiei, 9 of the strains as the potato-pathogenic species Streptomyces europaeiscabiei and 6 strains as potentially new phytopathogenic species. Of the 16 other strains, 12 were identified as members of previously described non-pathogenic Streptomyces species while the remaining 4 strains may represent heretofore unrecognised non-pathogenic species. This study demonstrated the value of this technique for the relatively rapid, simple and sensitive molecular identification of Streptomyces strains held in culture collections.

The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

PubMed

Nadin-Davis, S A; Huang, W; Wandeler, A I

1996-03-01

Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

The effect of hexose ratios on metabolite production in Saccharomyces cerevisiae strains obtained from the spontaneous fermentation of mezcal.

PubMed

Oliva Hernández, Amanda A; Taillandier, Patricia; Reséndez Pérez, Diana; Narváez Zapata, José A; Larralde Corona, Claudia Patricia

2013-04-01

Mezcal from Tamaulipas (México) is produced by spontaneous alcoholic fermentation using Agave spp. musts, which are rich in fructose. In this study eight Saccharomyces cerevisiae isolates obtained at the final stage of fermentation from a traditional mezcal winery were analysed in three semi-synthetic media. Medium M1 had a sugar content of 100 g l(-1) and a glucose/fructose (G/F) of 9:1. Medium M2 had a sugar content of 100 g l(-1) and a G/F of 1:9. Medium M3 had a sugar content of 200 g l(-1) and a G/F of 1:1. In the three types of media tested, the highest ethanol yield was obtained from the glucophilic strain LCBG-3Y5, while strain LCBG-3Y8 was highly resistant to ethanol and the most fructophilic of the mezcal strains. Strain LCBG-3Y5 produced more glycerol (4.4 g l(-1)) and acetic acid (1 g l(-1)) in M2 than in M1 (1.7 and 0.5 g l(-1), respectively), and the ethanol yields were higher for all strains in M1 except for LCBG-3Y5, -3Y8 and the Fermichamp strain. In medium M3, only the Fermichamp strain was able to fully consume the 100 g of fructose l(-1) but left a residual 32 g of glucose l(-1). Regarding the hexose transporters, a high number of amino acid polymorphisms were found in the Hxt1p sequences. Strain LCBG-3Y8 exhibited eight unique amino acid changes, followed by the Fermichamp strain with three changes. In Hxt3p, we observed nine amino acid polymorphisms unique for the Fermichamp strain and five unique changes for the mezcal strains.

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

Complete genome sequence of the Antarctic Halorubrum lacusprofundi type strain ACAM 34

DOE PAGES

Anderson, Iain J.; DasSarma, Priya; Lucas, Susan; ...

2016-09-10

Halorubrum lacusprofundi is an extreme halophile within the archaeal phylum Euryarchaeota. The type strain ACAM 34 was isolated from Deep Lake, Antarctica. H. lacusprofundi is of phylogenetic interest because it is distantly related to the haloarchaea that have previously been sequenced. It is also of interest because of its psychrotolerance. We report here the complete genome sequence of H. lacusprofundi type strain ACAM 34 and its annotation. In conclusion, this genome is part of a 2006 Joint Genome Institute Community Sequencing Program project to sequence genomes of diverse Archaea.

Complete genome sequence of the Antarctic Halorubrum lacusprofundi type strain ACAM 34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Iain J.; DasSarma, Priya; Lucas, Susan

Halorubrum lacusprofundi is an extreme halophile within the archaeal phylum Euryarchaeota. The type strain ACAM 34 was isolated from Deep Lake, Antarctica. H. lacusprofundi is of phylogenetic interest because it is distantly related to the haloarchaea that have previously been sequenced. It is also of interest because of its psychrotolerance. We report here the complete genome sequence of H. lacusprofundi type strain ACAM 34 and its annotation. In conclusion, this genome is part of a 2006 Joint Genome Institute Community Sequencing Program project to sequence genomes of diverse Archaea.

Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer.

PubMed

Wang, Ji; Ke, Yue Hua; Zhang, Yong; Huang, Ke Qiang; Wang, Lei; Shen, Xin Xin; Dong, Xiao Ping; Xu, Wen Bo; Ma, Xue Jun

2017-10-01

Knowledge of an enterovirus genome sequence is very important in epidemiological investigation to identify transmission patterns and ascertain the extent of an outbreak. The MinION sequencer is increasingly used to sequence various viral pathogens in many clinical situations because of its long reads, portability, real-time accessibility of sequenced data, and very low initial costs. However, information is lacking on MinION sequencing of enterovirus genomes. In this proof-of-concept study using Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) strains as examples, we established an amplicon-based whole genome sequencing method using MinION. We explored the accuracy, minimum sequencing time, discrimination and high-throughput sequencing ability of MinION, and compared its performance with Sanger sequencing. Within the first minute (min) of sequencing, the accuracy of MinION was 98.5% for the single EV71 strain and 94.12%-97.33% for 10 genetically-related CA16 strains. In as little as 14 min, 99% identity was reached for the single EV71 strain, and in 17 min (on average), 99% identity was achieved for 10 CA16 strains in a single run. MinION is suitable for whole genome sequencing of enteroviruses with sufficient accuracy and fine discrimination and has the potential as a fast, reliable and convenient method for routine use. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

PubMed

Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

2014-06-01

It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

Molecular Typing of Clinical Adenovirus Specimens by an Algorithm which Permits Detection of Adenovirus Coinfections and Intermediate Adenovirus Strains

PubMed Central

McCarthy, Troy; Lebeck, Mark G.; Capuano, Ana W.; Schnurr, David P.; Gray, Gregory C.

2009-01-01

Background Epidemiological data suggest that clinical outcomes of human adenovirus (HAdV) infection may be influenced by virus serotype, coinfection with multiple strains, or infection with novel intermediate strains. In this report, we propose a clinical algorithm for detecting HAdV coinfection and intermediate strains. Study Design We PCR amplified and sequenced subregions of the hexon and fiber genes of 342 HAdV positive clinical specimens obtained from 14 surveillance laboratories. Sequences were then compared with those from 52 HAdV prototypic strains. HAdV positive specimens that showed nucleotide sequence identity with a corresponding prototype strain were designated as being of that strain. When hexon and fiber gene sequences disagreed, or sequence identity was low, the specimens were further characterized by viral culture, plaque purification, repeat PCR with sequencing, and genome restriction enzyme digest analysis. Results Of the 342 HAdV-positive clinical specimens, 328 (95.9%) were single HAdV strain infections, 12 (3.5%) were coinfections, and 2 (0.6%) had intermediate strains. Coinfected specimens and intermediate HAdV strains considered together were more likely to be associated with severe illness compared to other HAdv-positive specimens (OR=3.8; 95% CI = 1.2–11.9). Conclusions The majority of severe cases of HAdV illness cases occurred among immunocompromised patients. The analytic algorithm we describe here can be used to screen clinical specimens for evidence of HAdV coinfection and novel intermediate HAdV strains. This algorithm may be especially useful in investigating HAdV outbreaks and clusters of unusually severe HAdV disease. PMID:19577957

Diversity and Antibiotic Susceptibility of Acinetobacter Strains From Milk Powder Produced in Germany

PubMed Central

Cho, Gyu-Sung; Li, Bo; Rostalsky, André; Fiedler, Gregor; Rösch, Niels; Igbinosa, Etinosa; Kabisch, Jan; Bockelmann, Wilhelm; Hammer, Philipp; Huys, Geert; Franz, Charles M. A. P.

2018-01-01

Forty-seven Acinetobacter spp. isolates from milk powder obtained from a powdered milk producer in Germany were investigated for their antibiotic resistance susceptibilities, in order to assess whether strains from food harbor multiple antibiotic resistances and whether the food route is important for dissemination of resistance genes. The strains were identified by 16S rRNA and rpoB gene sequencing, as well as by whole genome sequencing of selected isolates and their in silico DNA-DNA hybridization (DDH). Furthermore, they were genotyped by rep-PCR together with reference strains of pan-European groups I, II, and III strains of Acinetobacter baumannii. Of the 47 strains, 42 were identified as A. baumannii, 4 as Acinetobacter Pittii, and 1 as Acinetobacter calcoaceticus based on 16S rRNA gene sequencing. In silico DDH with the genome sequence data of selected strains and rpoB gene sequencing data suggested that the five non-A. baumannii strains all belonged to A. pittii, suggesting that the rpoB gene is more reliable than the 16S rRNA gene for species level identification in this genus. Rep-PCR genotyping of the A. baumannii strains showed that these could be grouped into four groups, and that some strains clustered together with reference strains of pan-European clinical group II and III strains. All strains in this study were intrinsically resistant toward chloramphenicol and oxacillin, but susceptible toward tetracycline, tobramycin, erythromycin, and ciprofloxacin. For cefotaxime, 43 strains (91.5%) were intermediate and 3 strains (6.4%) resistant, while 3 (6.4%) and 21 (44.7%) strains exhibited resistance to cefepime and streptomycin, respectively. Forty-six (97.9%) strains were susceptible to amikacin and ampicillin-sulbactam. Therefore, the strains in this study were generally not resistant to the clinically relevant antibiotics, especially tobramycin, ciprofloxacin, cefepime, and meropenem, suggesting that the food route probably poses only a low risk for multidrug resistant Acinetobacter strains or resistance genes. PMID:29636733

Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

PubMed Central

Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

2012-01-01

Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

Whole genome sequence and comparative analysis of Borrelia burgdorferi MM1

PubMed Central

Jabbari, Neda; Reddy, Panga Jaipal; Hood, Leroy

2018-01-01

Lyme disease is caused by spirochaetes of the Borrelia burgdorferi sensu lato genospecies. Complete genome assemblies are available for fewer than ten strains of Borrelia burgdorferi sensu stricto, the primary cause of Lyme disease in North America. MM1 is a sensu stricto strain originally isolated in the midwestern United States. Aside from a small number of genes, the complete genome sequence of this strain has not been reported. Here we present the complete genome sequence of MM1 in relation to other sensu stricto strains and in terms of its Multi Locus Sequence Typing. Our results indicate that MM1 is a new sequence type which contains a conserved main chromosome and 15 plasmids. Our results include the first contiguous 28.5 kb assembly of lp28-8, a linear plasmid carrying the vls antigenic variation system, from a Borrelia burgdorferi sensu stricto strain. PMID:29889842

Draft Genome Sequence of Bacillus cereus CITVM-11.1, a Strain Exhibiting Interesting Antifungal Activities.

PubMed

Caballero, Javier; Peralta, Cecilia; Molla, Antonella; Del Valle, Eleodoro E; Caballero, Primitivo; Berry, Colin; Felipe, Verónica; Yaryura, Pablo; Palma, Leopoldo

2018-01-01

Bacillus cereus is a gram-positive, spore-forming bacterium possessing an important and historical record as a human-pathogenic bacterium. However, several strains of this species exhibit interesting potential to be used as plant growth-promoting rhizobacteria. Here, we report the draft genome sequence of B. cereus strain CITVM-11.1, which consists of 37 contig sequences, accounting for 5,746,486 bp (with a GC content of 34.8%) and 5,752 predicted protein-coding sequences. Several of them could potentially be involved in plant-bacterium interactions and may contribute to the strong antagonistic activity shown by this strain against the charcoal root rot fungus, Macrophomina phaseolina. This genomic sequence also showed a number of genes that may confer this strain resistance against several polluting heavy metals and for the bioconversion of mycotoxins. © 2018 S. Karger AG, Basel.

Complete genome sequence of the hippuricase-positive Campylobacter avium type strain LMG 24591

USDA-ARS?s Scientific Manuscript database

Campylobacter avium is a hippurate-positive, thermotolerant campylobacter that has been isolated from poultry. Here we present the genome sequences of two C. avium strains isolated from broiler chickens: strains LMG 24591T (complete genome) and LMG 24592 (draft genome). The C. avium type strain geno...

Complete Genome Sequences of Lactobacillus johnsonii Strain N6.2 and Lactobacillus reuteri Strain TD1.

PubMed

Leonard, Michael T; Valladares, Ricardo B; Ardissone, Alexandria; Gonzalez, Claudio F; Lorca, Graciela L; Triplett, Eric W

2014-05-08

We report here the complete genome sequences of Lactobacillus johnsonii strain N6.2, a homofermentative lactic acid intestinal bacterium, and Lactobacillus reuteri strain TD1, a heterofermentative lactic acid intestinal bacterium, both isolated from a type 1 diabetes-resistant rat model.

Complete Genome Sequences of Three Moraxella osloensis Strains Isolated from Human Skin.

PubMed

Lim, Jae Yun; Hwang, Ingyu; Ganzorig, Munkhtsatsral; Huang, Shir-Ly; Cho, Gyu-Sung; Franz, Charles M A P; Lee, Kyoung

2018-01-18

Here, we present the complete whole-genome sequences of three Moraxella osloensis strains with octylphenol polyethoxylate-degrading abilities. These strains were isolated from human skin. Copyright © 2018 Lim et al.

Draft Genome Sequence of Thermus sp. Strain RL, Isolated from a Hot Water Spring Located atop the Himalayan Ranges at Manikaran, India

PubMed Central

Dwivedi, Vatsala; Sangwan, Naseer; Nigam, Aeshna; Garg, Nidhi; Niharika, Neha; Khurana, Paramjit; Khurana, Jitendra P.

2012-01-01

Thermus sp. strain RL was isolated from a hot water spring (90°C to 98°C) at Manikaran, Himachal Pradesh, India. Here we report the draft genome sequence (20,36,600 bp) of this strain. The draft genome sequence consists of 17 contigs and 1,986 protein-coding sequences and has an average G+C content of 68.77%. PMID:22689228

Analysis of the genome-wide variations among multiple strains of the plant pathogenic bacterium Xylella fastidiosa

PubMed Central

Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L

2006-01-01

Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851

Genetic characterization of strains of Saccharomycescerevisiae responsible for 'refermentation' in Botrytis-affected wines.

PubMed

Divol, B; Miot-Sertier, C; Lonvaud-Funel, A

2006-03-01

Saccharomyces cerevisiae is responsible for alcoholic fermentation of wines. However, some strains can also spoil sweet Botrytis-affected wines. Three 'refermentation' strains were isolated during maturation. Characterization of those strains in regards to their fingerprint, rDNA sequence and resistance to SO2, which constituted the main source of stress in Botrytis-affected wines, was carried out. Refermentation strains could be clearly discriminated by interdelta fingerprinting. However, they exhibited close relationships by karyotyping. A part of RDN1 locus sequence was examined by using PCR-RFLP and PCR-DGGE. The resistance of refermentation strains to SO2 was performed by using real time quantitative PCR focusing on SSU1 gene. Results suggested that refermentation strains were heterozygote in 26S rDNA and their ITS1-5.8S rDNA-ITS2 region sequence revealed relationships with 'flor' strains. As described in the literature for flor strain, two out of three refermentation strains constitutively developed a higher level of SSU1 expression than the reference strains, improving their putative tolerance to SO2. Therefore, refermentation strains of S. cerevisiae had developed many strategies to survive during maturing sweet wines. Singularities in rDNA sequence and SSU1 overexpression revealed a natural adaptation. Moreover, genomic relationship between flor and refermentation strains suggested that stress sources could induced selection of survivor strains.

Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence.

PubMed

Fang, Weiguo; Leng, Bo; Xiao, Yuehua; Jin, Kai; Ma, Jincheng; Fan, Yanhua; Feng, Jing; Yang, Xingyong; Zhang, Yongjun; Pei, Yan

2005-01-01

Entomopathogenic fungi can produce a series of chitinases, some of which act synergistically with proteases to degrade insect cuticle. However, chitinase involvement in insect fungus pathogenesis has not been fully characterized. In this paper, an endochitinase, Bbchit1, was purified to homogeneity from liquid cultures of Beauveria bassiana grown in a medium containing colloidal chitin. Bbchit1 had a molecular mass of about 33 kDa and pI of 5.4. Based on the N-terminal amino acid sequence, the chitinase gene, Bbchit1, and its upstream regulatory sequence were cloned. Bbchit1 was intronless, and there was a single copy in B. bassiana. Its regulatory sequence contained putative CreA/Crel carbon catabolic repressor binding domains, which was consistent with glucose suppression of Bbchit1. At the amino acid level, Bbchit1 showed significant similarity to a Streptomyces avermitilis putative endochitinase, a Streptomyces coelicolor putative chitinase, and Trichoderma harzianum endochitinase Chit36Y. However, Bbchit1 had very low levels of identity to other chitinase genes previously isolated from entomopathogenic fungi, indicating that Bbchit1 was a novel chitinase gene from an insect-pathogenic fungus. A gpd-Bbchit1 construct, in which Bbchit1 was driven by the Aspergiullus nidulans constitutive promoter, was transformed into the genome of B. bassiana, and three transformants that overproduced Bbchit1 were obtained. Insect bioassays revealed that overproduction of Bbchit1 enhanced the virulence of B. bassiana for aphids, as indicated by significantly lower 50% lethal concentrations and 50% lethal times of the transformants compared to the values for the wild-type strain.

Cloning of Beauveria bassiana Chitinase Gene Bbchit1 and Its Application To Improve Fungal Strain Virulence

PubMed Central

Fang, Weiguo; Leng, Bo; Xiao, Yuehua; Jin, Kai; Ma, Jincheng; Fan, Yanhua; Feng, Jing; Yang, Xingyong; Zhang, Yongjun; Pei, Yan

2005-01-01

Entomopathogenic fungi can produce a series of chitinases, some of which act synergistically with proteases to degrade insect cuticle. However, chitinase involvement in insect fungus pathogenesis has not been fully characterized. In this paper, an endochitinase, Bbchit1, was purified to homogeneity from liquid cultures of Beauveria bassiana grown in a medium containing colloidal chitin. Bbchit1 had a molecular mass of about 33 kDa and pI of 5.4. Based on the N-terminal amino acid sequence, the chitinase gene, Bbchit1, and its upstream regulatory sequence were cloned. Bbchit1 was intronless, and there was a single copy in B. bassiana. Its regulatory sequence contained putative CreA/Crel carbon catabolic repressor binding domains, which was consistent with glucose suppression of Bbchit1. At the amino acid level, Bbchit1 showed significant similarity to a Streptomyces avermitilis putative endochitinase, a Streptomyces coelicolor putative chitinase, and Trichoderma harzianum endochitinase Chit36Y. However, Bbchit1 had very low levels of identity to other chitinase genes previously isolated from entomopathogenic fungi, indicating that Bbchit1 was a novel chitinase gene from an insect-pathogenic fungus. A gpd-Bbchit1 construct, in which Bbchit1 was driven by the Aspergiullus nidulans constitutive promoter, was transformed into the genome of B. bassiana, and three transformants that overproduced Bbchit1 were obtained. Insect bioassays revealed that overproduction of Bbchit1 enhanced the virulence of B. bassiana for aphids, as indicated by significantly lower 50% lethal concentrations and 50% lethal times of the transformants compared to the values for the wild-type strain. PMID:15640210

Genotyping of Indian antigenic, vaccine, and field Brucella spp. using multilocus sequence typing.

PubMed

Shome, Rajeswari; Krithiga, Natesan; Shankaranarayana, Padmashree B; Jegadesan, Sankarasubramanian; Udayakumar S, Vishnu; Shome, Bibek Ranjan; Saikia, Girin Kumar; Sharma, Narendra Kumar; Chauhan, Harshad; Chandel, Bharat Singh; Jeyaprakash, Rajendhran; Rahman, Habibur

2016-03-31

Brucellosis is one of the most important zoonotic diseases that affects multiple livestock species and causes great economic losses. The highly conserved genomes of Brucella, with > 90% homology among species, makes it important to study the genetic diversity circulating in the country. A total of 26 Brucella spp. (4 reference strains and 22 field isolates) and 1 B. melitensis draft genome sequence from India (B. melitensis Bm IND1) were included for sequence typing. The field isolates were identified by biochemical tests and confirmed by both conventional and quantitative polymerase chain reaction (qPCR) targeting bcsp 31Brucella genus-specific marker. Brucella speciation and biotyping was done by Bruce ladder, probe qPCR, and AMOS PCRs, respectively, and genotyping was done by multilocus sequence typing (MLST). The MLST typing of 27 Brucella spp. revealed five distinct sequence types (STs); the B. abortus S99 reference strain and 21 B. abortus field isolates belonged to ST1. On the other hand, the vaccine strain B. abortus S19 was genotyped as ST5. Similarly, B. melitensis 16M reference strain and one B. melitensis field isolate were grouped into ST7. Another B. melitensis field isolate belonged to ST8 (draft genome sequence from India), and only B. suis 1330 reference strain was found to be ST14. The sequences revealed genetic similarity of the Indian strains to the global reference and field strains. The study highlights the usefulness of MLST for typing of field isolates and validation of reference strains used for diagnosis and vaccination against brucellosis.

Draft Genome Sequence of Microbacterium sp. Strain UCD-TDU (Phylum Actinobacteria)

PubMed Central

Bendiks, Zachary A.; Lang, Jenna M.; Darling, Aaron E.; Coil, David A.

2013-01-01

Here, we present the draft genome sequence of Microbacterium sp. strain UCD-TDU, a member of the phylum Actinobacteria. The assembly contains 3,746,321 bp (in 8 scaffolds). This strain was isolated from a residential toilet as part of an undergraduate student research project to sequence reference genomes of microbes from the built environment. PMID:23516225

Complete genomic sequences of two salmonella enterica subsp. enterica serogroup C2 (O:6,8) strains from central California

USDA-ARS?s Scientific Manuscript database

Salmonella enteric subsp. enterica strains RM11060, serotype 6,8:d:-, and RM11065, serotype 6,8:-:e,n,z15, were isolated from environmental sampling in Central California in 2009. We report the complete genome sequences and annotation of these two strains. These genomic sequences are distinct and wi...

Genome Sequence of Acinetobacter sp. Strain HA, Isolated from the Gut of the Polyphagous Insect Pest Helicoverpa armigera

PubMed Central

Malhotra, Jaya; Dua, Ankita; Saxena, Anjali; Sangwan, Naseer; Mukherjee, Udita; Pandey, Neeti; Rajagopal, Raman; Khurana, Paramjit; Khurana, Jitendra P.

2012-01-01

In this study, Acinetobacter sp. strain HA was isolated from the midgut of a fifth-instar larva of Helicoverpa armigera. Here, we report the draft genome sequence (3,125,085 bp) of this strain that consists of 102 contigs, 2,911 predicted coding sequences, and a G+C content of 41%. PMID:22933775

High resolution identity testing of inactivated poliovirus vaccines.

PubMed

Mee, Edward T; Minor, Philip D; Martin, Javier

2015-07-09

Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Job Strain, Health and Sickness Absence: Results from the Hordaland Health Study

PubMed Central

Wang, Min-Jung; Mykletun, Arnstein; Møyner, Ellen Ihlen; Øverland, Simon; Henderson, Max; Stansfeld, Stephen; Hotopf, Matthew; Harvey, Samuel B.

2014-01-01

Objectives While it is generally accepted that high job strain is associated with adverse occupational outcomes, the nature of this relationship and the causal pathways involved are not well elucidated. We aimed to assess the association between job strain and long-term sickness absence (LTSA), and investigate whether any associations could be explained by validated health measures. Methods Data from participants (n = 7346) of the Hordaland Health Study (HUSK), aged 40–47 at baseline, were analyzed using multivariate Cox regression to evaluate the association between job strain and LTSA over one year. Further analyses examined whether mental and physical health mediated any association between job strain and sickness absence. Results A positive association was found between job strain and risk of a LTSA episode, even controlling for confounding factors (HR = 1.64 (1.36–1.98); high job strain exposure accounted for a small proportion of LTSA episodes (population attributable risk 0.068). Further adjustments for physical health and mental health individually attenuated, but could not fully explain the association. In the fully adjusted model, the association between high job strain and LTSA remained significant (HR = 1.30 (1.07–1.59)). Conclusion High job strain increases the risk of LTSA. While our results suggest that one in 15 cases of LTSA could be avoided if high job strain were eliminated, we also provide evidence against simplistic causal models. The impact of job strain on future LTSA could not be fully explained by impaired health at baseline, which suggests that factors besides ill health are important in explaining the link between job strain and sickness absence. PMID:24755878

The Draft Genome Sequence of a Novel High-Efficient Butanol-Producing Bacterium Clostridium Diolis Strain WST.

PubMed

Chen, Chaoyang; Sun, Chongran; Wu, Yi-Rui

2018-03-21

A wild-type solventogenic strain Clostridium diolis WST, isolated from mangrove sediments, was characterized to produce high amount of butanol and acetone with negligible level of ethanol and acids from glucose via a unique acetone-butanol (AB) fermentation pathway. Through the genomic sequencing, the assembled draft genome of strain WST is calculated to be 5.85 Mb with a GC content of 29.69% and contains 5263 genes that contribute to the annotation of 5049 protein-coding sequences. Within these annotated genes, the butanol dehydrogenase gene (bdh) was determined to be in a higher amount from strain WST compared to other Clostridial strains, which is positively related to its high-efficient production of butanol. Therefore, we present a draft genome sequence analysis of strain WST in this article that should facilitate to further understand the solventogenic mechanism of this special microorganism.

Swine and Poultry Pathogens: the Complete Genome Sequences of Two Strains of Mycoplasma hyopneumoniae and a Strain of Mycoplasma synoviae†

PubMed Central

Vasconcelos, Ana Tereza R.; Ferreira, Henrique B.; Bizarro, Cristiano V.; Bonatto, Sandro L.; Carvalho, Marcos O.; Pinto, Paulo M.; Almeida, Darcy F.; Almeida, Luiz G. P.; Almeida, Rosana; Alves-Filho, Leonardo; Assunção, Enedina N.; Azevedo, Vasco A. C.; Bogo, Maurício R.; Brigido, Marcelo M.; Brocchi, Marcelo; Burity, Helio A.; Camargo, Anamaria A.; Camargo, Sandro S.; Carepo, Marta S.; Carraro, Dirce M.; de Mattos Cascardo, Júlio C.; Castro, Luiza A.; Cavalcanti, Gisele; Chemale, Gustavo; Collevatti, Rosane G.; Cunha, Cristina W.; Dallagiovanna, Bruno; Dambrós, Bibiana P.; Dellagostin, Odir A.; Falcão, Clarissa; Fantinatti-Garboggini, Fabiana; Felipe, Maria S. S.; Fiorentin, Laurimar; Franco, Gloria R.; Freitas, Nara S. A.; Frías, Diego; Grangeiro, Thalles B.; Grisard, Edmundo C.; Guimarães, Claudia T.; Hungria, Mariangela; Jardim, Sílvia N.; Krieger, Marco A.; Laurino, Jomar P.; Lima, Lucymara F. A.; Lopes, Maryellen I.; Loreto, Élgion L. S.; Madeira, Humberto M. F.; Manfio, Gilson P.; Maranhão, Andrea Q.; Martinkovics, Christyanne T.; Medeiros, Sílvia R. B.; Moreira, Miguel A. M.; Neiva, Márcia; Ramalho-Neto, Cicero E.; Nicolás, Marisa F.; Oliveira, Sergio C.; Paixão, Roger F. C.; Pedrosa, Fábio O.; Pena, Sérgio D. J.; Pereira, Maristela; Pereira-Ferrari, Lilian; Piffer, Itamar; Pinto, Luciano S.; Potrich, Deise P.; Salim, Anna C. M.; Santos, Fabrício R.; Schmitt, Renata; Schneider, Maria P. C.; Schrank, Augusto; Schrank, Irene S.; Schuck, Adriana F.; Seuanez, Hector N.; Silva, Denise W.; Silva, Rosane; Silva, Sérgio C.; Soares, Célia M. A.; Souza, Kelly R. L.; Souza, Rangel C.; Staats, Charley C.; Steffens, Maria B. R.; Teixeira, Santuza M. R.; Urmenyi, Turan P.; Vainstein, Marilene H.; Zuccherato, Luciana W.; Simpson, Andrew J. G.; Zaha, Arnaldo

2005-01-01

This work reports the results of analyses of three complete mycoplasma genomes, a pathogenic (7448) and a nonpathogenic (J) strain of the swine pathogen Mycoplasma hyopneumoniae and a strain of the avian pathogen Mycoplasma synoviae; the genome sizes of the three strains were 920,079 bp, 897,405 bp, and 799,476 bp, respectively. These genomes were compared with other sequenced mycoplasma genomes reported in the literature to examine several aspects of mycoplasma evolution. Strain-specific regions, including integrative and conjugal elements, and genome rearrangements and alterations in adhesin sequences were observed in the M. hyopneumoniae strains, and all of these were potentially related to pathogenicity. Genomic comparisons revealed that reduction in genome size implied loss of redundant metabolic pathways, with maintenance of alternative routes in different species. Horizontal gene transfer was consistently observed between M. synoviae and Mycoplasma gallisepticum. Our analyses indicated a likely transfer event of hemagglutinin-coding DNA sequences from M. gallisepticum to M. synoviae. PMID:16077101

Short communication: Conservation of Streptococcus uberis adhesion molecule and the sua gene in strains of Streptococcus uberis isolated from geographically diverse areas.

PubMed

Yuan, Ying; Dego, Oudessa Kerro; Chen, Xueyan; Abadin, Eurife; Chan, Shangfeng; Jory, Lauren; Kovacevic, Steven; Almeida, Raul A; Oliver, Stephen P

2014-12-01

The objective was to identify and sequence the sua gene (GenBank no. DQ232760; http://www.ncbi.nlm.nih.gov/genbank/) and detect Streptococcus uberis adhesion molecule (SUAM) expression by Western blot using serum from naturally S. uberis-infected cows in strains of S. uberis isolated in milk from cows with mastitis from geographically diverse areas of the world. All strains evaluated yielded a 4.4-kb sua-containing PCR fragment that was subsequently sequenced. Deduced SUAM AA sequences from those S. uberis strains evaluated shared >97% identity. The pepSUAM sequence located at the N terminus of SUAM was >99% identical among strains of S. uberis. Streptococcus uberis adhesion molecule expression was detected in all strains of S. uberis tested. These results suggest that sua is ubiquitous among strains of S. uberis isolated from diverse geographic locations and that SUAM is immunogenic. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Draft Genome Sequences from a Novel Clade of Bacillus cereus Sensu Lato Strains, Isolated from the International Space Station.

PubMed

Venkateswaran, Kasthuri; Checinska Sielaff, Aleksandra; Ratnayake, Shashikala; Pope, Robert K; Blank, Thomas E; Stepanov, Victor G; Fox, George E; van Tongeren, Sandra P; Torres, Clinton; Allen, Jonathan; Jaing, Crystal; Pierson, Duane; Perry, Jay; Koren, Sergey; Phillippy, Adam; Klubnik, Joy; Treangen, Todd J; Rosovitz, M J; Bergman, Nicholas H

2017-08-10

The draft genome sequences of six Bacillus strains, isolated from the International Space Station and belonging to the Bacillus anthracis - B. cereus - B. thuringiensis group, are presented here. These strains were isolated from the Japanese Experiment Module (one strain), U.S. Harmony Node 2 (three strains), and Russian Segment Zvezda Module (two strains). Copyright © 2017 Venkateswaran et al.

Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing

PubMed Central

de Gier, Camilla; Kirkham, Lea-Ann S.

2015-01-01

Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the “fuzzy species” strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. PMID:26378279

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Stochastic precision analysis of 2D cardiac strain estimation in vivo

NASA Astrophysics Data System (ADS)

Bunting, E. A.; Provost, J.; Konofagou, E. E.

2014-11-01

Ultrasonic strain imaging has been applied to echocardiography and carries great potential to be used as a tool in the clinical setting. Two-dimensional (2D) strain estimation may be useful when studying the heart due to the complex, 3D deformation of the cardiac tissue. Increasing the framerate used for motion estimation, i.e. motion estimation rate (MER), has been shown to improve the precision of the strain estimation, although maintaining the spatial resolution necessary to view the entire heart structure in a single heartbeat remains challenging at high MERs. Two previously developed methods, the temporally unequispaced acquisition sequence (TUAS) and the diverging beam sequence (DBS), have been used in the past to successfully estimate in vivo axial strain at high MERs without compromising spatial resolution. In this study, a stochastic assessment of 2D strain estimation precision is performed in vivo for both sequences at varying MERs (65, 272, 544, 815 Hz for TUAS; 250, 500, 1000, 2000 Hz for DBS). 2D incremental strains were estimated during left ventricular contraction in five healthy volunteers using a normalized cross-correlation function and a least-squares strain estimator. Both sequences were shown capable of estimating 2D incremental strains in vivo. The conditional expected value of the elastographic signal-to-noise ratio (E(SNRe|ɛ)) was used to compare strain estimation precision of both sequences at multiple MERs over a wide range of clinical strain values. The results here indicate that axial strain estimation precision is much more dependent on MER than lateral strain estimation, while lateral estimation is more affected by strain magnitude. MER should be increased at least above 544 Hz to avoid suboptimal axial strain estimation. Radial and circumferential strain estimations were influenced by the axial and lateral strain in different ways. Furthermore, the TUAS and DBS were found to be of comparable precision at similar MERs.

Genome sequence analysis of dengue virus 1 isolated in Key West, Florida.

PubMed

Shin, Dongyoung; Richards, Stephanie L; Alto, Barry W; Bettinardi, David J; Smartt, Chelsea T

2013-01-01

Dengue virus (DENV) is transmitted to humans through the bite of mosquitoes. In November 2010, a dengue outbreak was reported in Monroe County in southern Florida (FL), including greater than 20 confirmed human cases. The virus collected from the human cases was verified as DENV serotype 1 (DENV-1) and one isolate was provided for sequence analysis. RNA was extracted from the DENV-1 isolate and was used in reverse transcription polymerase chain reaction (RT-PCR) to amplify PCR fragments to sequence. Nucleic acid primers were designed to generate overlapping PCR fragments that covered the entire genome. The DENV-1 isolate found in Key West (KW), FL was sequenced for whole genome characterization. Sequence assembly, Genbank searches, and recombination analyses were performed to verify the identity of the genome sequences and to determine percent similarity to known DENV-1 sequences. We show that the KW DENV-1 strain is 99% identical to Nicaraguan and Mexican DENV-1 strains. Phylogenetic and recombination analyses suggest that the DENV-1 isolated in KW originated from Nicaragua (NI) and the KW strain may circulate in KW. Also, recombination analysis results detected recombination events in the KW strain compared to DENV-1 strains from Puerto Rico. We evaluate the relative growth of KW strain of DENV-1 compared to other dengue viruses to determine whether the underlying genetics of the strain is associated with a replicative advantage, an important consideration since local transmission of DENV may result because domestic tourism can spread DENVs.

New Ehrlichia Species Closely Related to Ehrlichia chaffeensis Isolated from Ixodes ovatus Ticks in Japan

PubMed Central

Shibata, Shin-ichiro; Kawahara, Makoto; Rikihisa, Yasuko; Fujita, Hiromi; Watanabe, Yuriko; Suto, Chiharu; Ito, Tadahiko

2000-01-01

Seven Ehrlichia strains (six HF strains and one Anan strain) that were obtained from laboratory mice by intraperitoneally inoculating homogenates of adult Ixodes ovatus collected in Japan were characterized. 16S rRNA sequences of all six HF strains were identical, and the sequences were 99.7, 98.2, and 97.7% identical to those of Anan strain, Ehrlichia chaffeensis (human monocytic ehrlichiosis agent), and E. muris, respectively. Partial GroEL amino acid sequencing also revealed that the six HF strains had identical sequences, which were 99.0, 98.5, and 97.3% identical to those of E. chaffeensis, the Anan strain, and E. canis, respectively. All HF strains were lethal to mice at higher dosages and intraperitoneal inoculation, whereas the Anan or E. muris strain induced only mild clinical signs. Light and electron microscopy of moribund mice inoculated with one of the HF strains revealed severe liver necrosis and the presence of numerous ehrlichial inclusions (morulae) in various organs. The study revealed that members of E. canis genogroup are naturally present in Ixodes ticks. HF strains that can cause severe illness in immunocompetent laboratory mice would be valuable in studying the pathogenesis and the roles of both cellular and humoral immune responses in ehrlichiosis caused by E. canis genogroup. PMID:10747103

Complete genome sequence of Pelosinus sp. strain UFO1 assembled using single-molecule real-time DNA sequencing technology

DOE PAGES

Brown, Steven D.; Utturkar, Sagar M.; Magnuson, Timothy S.; ...

2014-09-04

Pelosinus fermentans strain R7 was isolated from Russian kaolin clays as the type strain and it can reduce Fe(III) during fermentative growth (1). Draft genome sequences for P. fermentans R7 and four strains from Hanford, Washington, USA, have been published (2–4). The P. fermentans 16S rRNA sequence dominated the lactate-based enrichment cultures from three geochemically contrasting soils from the Melton Branch Watershed, Oak Ridge, Tennessee, USA (5) and also at another stimulated, uraniumcontaminated field site near Oak Ridge (6). For the current work, strain UFO1 was isolated from pristine sediments at a background field site in Oak Ridge and characterizedmore » as facilitating U(VI) reduction and precipitation with phosphate (7).« less

Complete Genome Sequence of the Quality Control Strain Staphylococcus aureus subsp. aureus ATCC 25923

PubMed Central

Treangen, Todd J.; Maybank, Rosslyn A.; Enke, Sana; Friss, Mary Beth; Diviak, Lynn F.; Karaolis, David K. R.; Koren, Sergey; Ondov, Brian; Phillippy, Adam M.; Bergman, Nicholas H.

2014-01-01

Staphylococcus aureus subsp. aureus ATCC 25923 is commonly used as a control strain for susceptibility testing to antibiotics and as a quality control strain for commercial products. We present the completed genome sequence for the strain, consisting of the chromosome and a 27.5-kb plasmid. PMID:25377701

Complete genome sequences of two atypical enteropathogenic Escherichia coli O145 environmental strains

USDA-ARS?s Scientific Manuscript database

Escherichia coli O145 strains RM14715 and RM14723 were isolated from wildlife feces near a leafy greens-growing region in Yuma, Arizona. Both strains carry a distinct genotype compared with the E. coli O145 strains isolated from Salinas Valley, California. Here we report complete genome sequences an...

Polynucleobacter meluiroseus sp. nov., a bacterium isolated from a lake located in the mountains of the Mediterranean island of Corsica.

PubMed

Pitt, Alexandra; Schmidt, Johanna; Lang, Elke; Whitman, William B; Woyke, Tanja; Hahn, Martin W

2018-06-01

Strain AP-Melu-1000-B4 was isolated from a lake located in the mountains of the Mediterranean island of Corsica (France). Phenotypic, chemotaxonomic and genomic traits were investigated. Phylogenetic analyses based on 16S rRNA gene sequencing referred the strain to the cryptic species complex PnecC within the genus Polynucleobacter. The strain encoded genes for biosynthesis of proteorhodopsin and retinal. When pelleted by centrifugation the strain showed an intense rose colouring. Major fatty acids were C16 : 1ω7c, C16 : 0, C18 : 1ω7c and summed feature 2 (C16 : 1 isoI and C14 : 0-3OH). The sequence of the 16S rRNA gene contained an indel which was not present in any previously described Polynucleobacter species. Genome sequencing revealed a genome size of 1.89 Mbp and a G+C content of 46.6 mol%. In order to resolve the phylogenetic position of the new strain within subcluster PnecC, its phylogeny was reconstructed from sequences of 319 shared genes. To represent all currently described Polynucleobacter species by whole genome sequences, three type strains were additionally sequenced. Our phylogenetic analysis revealed that strain AP-Melu-100-B4 occupied a basal position compared with previously described PnecC strains. Pairwise determined whole genome average nucleotide identity (gANI) values suggested that strain AP-Melu-1000-B4 represents a new species, for which we propose the name Polynucleobacter meluiroseus sp. nov. with the type strain AP-Melu-1000-B4 T (=DSM 103591 T =CIP 111329 T ).

Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

PubMed

Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P

2018-07-20

Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.

Complete Genome Sequence of Porcine Parvovirus N Strain Isolated from Guangxi, China

PubMed Central

Su, Qian-Lian; Li, Bin; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

2015-01-01

We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety. PMID:25573932

Molecular Typing and Epidemiology of Human Listeriosis Cases, Denmark, 2002-2012.

PubMed

Jensen, Anne Kvistholm; Björkman, Jonas T; Ethelberg, Steen; Kiil, Kristoffer; Kemp, Michael; Nielsen, Eva Møller

2016-04-01

Denmark has a high incidence of invasive listeriosis (0.9 cases/100,000 population in 2012). We analyzed patient data, clinical outcome, and trends in pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) of Listeria monocytogenes strains isolated in Denmark during 2002-2012. We performed 2-enzyme PFGE and serotyping on 559 isolates and MLST on 92 isolates and identified some correlation between molecular type and clinical outcome and patient characteristics. We found 178 different PFGE types, but isolates from 122 cases belonged to just 2 closely related PFGE types, clonal complex 8 and sequence type 8. These 2 types were the main cause of a peak in incidence of invasive listeriosis during 2005-2009, possibly representing an outbreak or the presence of a highly prevalent clone. However, current typing methods could not fully confirm these possibilities, highlighting the need for more refined discriminatory typing methods to identify outbreaks within frequently occurring L. monocytogenes PFGE types.

Molecular Typing and Epidemiology of Human Listeriosis Cases, Denmark, 2002–20121

PubMed Central

Björkman, Jonas T.; Ethelberg, Steen; Kiil, Kristoffer; Kemp, Michael; Nielsen, Eva Møller

2016-01-01

Denmark has a high incidence of invasive listeriosis (0.9 cases/100,000 population in 2012). We analyzed patient data, clinical outcome, and trends in pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) of Listeria monocytogenes strains isolated in Denmark during 2002–2012. We performed 2-enzyme PFGE and serotyping on 559 isolates and MLST on 92 isolates and identified some correlation between molecular type and clinical outcome and patient characteristics. We found 178 different PFGE types, but isolates from 122 cases belonged to just 2 closely related PFGE types, clonal complex 8 and sequence type 8. These 2 types were the main cause of a peak in incidence of invasive listeriosis during 2005–2009, possibly representing an outbreak or the presence of a highly prevalent clone. However, current typing methods could not fully confirm these possibilities, highlighting the need for more refined discriminatory typing methods to identify outbreaks within frequently occurring L. monocytogenes PFGE types. PMID:26982714

Comparative and functional genomics of the Lactococcus lactis taxon; insights into evolution and niche adaptation.

PubMed

Kelleher, Philip; Bottacini, Francesca; Mahony, Jennifer; Kilcawley, Kieran N; van Sinderen, Douwe

2017-03-29

Lactococcus lactis is among the most widely studied lactic acid bacterial species due to its long history of safe use and economic importance to the dairy industry, where it is exploited as a starter culture in cheese production. In the current study, we report on the complete sequencing of 16 L. lactis subsp. lactis and L. lactis subsp. cremoris genomes. The chromosomal features of these 16 L. lactis strains in conjunction with 14 completely sequenced, publicly available lactococcal chromosomes were assessed with particular emphasis on discerning the L. lactis subspecies division, evolution and niche adaptation. The deduced pan-genome of L. lactis was found to be closed, indicating that the representative data sets employed for this analysis are sufficient to fully describe the genetic diversity of the taxon. Niche adaptation appears to play a significant role in governing the genetic content of each L. lactis subspecies, while (differential) genome decay and redundancy in the dairy niche is also highlighted.

Genotype Specification Language.

PubMed

Wilson, Erin H; Sagawa, Shiori; Weis, James W; Schubert, Max G; Bissell, Michael; Hawthorne, Brian; Reeves, Christopher D; Dean, Jed; Platt, Darren

2016-06-17

We describe here the Genotype Specification Language (GSL), a language that facilitates the rapid design of large and complex DNA constructs used to engineer genomes. The GSL compiler implements a high-level language based on traditional genetic notation, as well as a set of low-level DNA manipulation primitives. The language allows facile incorporation of parts from a library of cloned DNA constructs and from the "natural" library of parts in fully sequenced and annotated genomes. GSL was designed to engage genetic engineers in their native language while providing a framework for higher level abstract tooling. To this end we define four language levels, Level 0 (literal DNA sequence) through Level 3, with increasing abstraction of part selection and construction paths. GSL targets an intermediate language based on DNA slices that translates efficiently into a wide range of final output formats, such as FASTA and GenBank, and includes formats that specify instructions and materials such as oligonucleotide primers to allow the physical construction of the GSL designs by individual strain engineers or an automated DNA assembly core facility.

Coxsackievirus A24 Variant Associated with Acute Haemorrhagic Conjunctivitis Cases, French Guiana, 2017.

PubMed

Enfissi, Antoine; Joffret, Marie-Line; Delaune, Déborah; Delpeyroux, Francis; Rousset, Dominique; Bessaud, Maël

2018-06-13

In 2017, numerous cases of acute haemorrhagic conjunctivitis (AHC) were reported in the Caribbean and in South America. Preliminary reports identified adenoviruses and enteroviruses in some patient samples but, until now, none of the etiologic agents have been fully characterized. We report the full-length genomic sequences of 4 coxsackievirus A24 (CV-A24) isolates collected from AHC patients in French Guiana during this outbreak (May and June 2017). These isolates are very closely related and belong to the genotype IV of CV-A24 variant, which consists of strains sampled worldwide during AHC outbreaks in the 2000s and 2010s. No recombination events were detected within the genomic sequences, indicating that members of this genotype have continuously circulated worldwide for more than 10 years without undergoing recombination with other enteroviruses. This unusual trait could be due to their ocular tropism that could impede genetic exchanges between these viruses and other enteroviruses, which replicate mainly in the gut. © 2018 S. Karger AG, Basel.

Complete genome sequence analysis of a duck circovirus from Guangxi pockmark ducks.

PubMed

Xie, Liji; Xie, Zhixun; Zhao, Guangyuan; Liu, Jiabo; Pang, Yaoshan; Deng, Xianwen; Xie, Zhiqin; Fan, Qing

2012-12-01

We report here the complete genomic sequence of a novel duck circovirus (DuCV) strain, GX1104, isolated from Guangxi pockmark ducks in Guangxi, China. The whole nucleotide sequence had the highest homology (97.2%) with the sequence of strain TC/2002 (GenBank accession number AY394721.1) and had a low homology (76.8% to 78.6%) with the sequences of other strains isolated from China, Germany, and the United States. This report will help to understand the epidemiology and molecular characteristics of Guangxi pockmark duck circovirus in southern China.

Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946

USDA-ARS?s Scientific Manuscript database

Erwinia amylovora causes the economically important disease fire blight that affects rosaceous plants, especially pear and apple. Here we report the complete genome sequence and annotation of strain ATCC 49946. The analysis of the sequence and its comparison with sequenced genomes of closely related...

Complete Genome Sequence of Carbapenem-Resistant Klebsiella pneumoniae Strain 1756, Isolated from a Pus Specimen.

PubMed

Kao, Cheng-Yen; Yan, Jing-Jou; Lin, Yu-Chun; Zheng, Po-Xing; Wu, Jiunn-Jong

2017-03-30

Carbapenem-resistant Klebsiella pneumoniae strain 1756 was isolated from a pus specimen from a Taiwanese patient. Here, the complete genome sequence of strain 1756 is presented. Copyright © 2017 Kao et al.

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain.

PubMed

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros; Velázquez, Encarna; Elia, Patrick; Tian, Rui; Ardley, Julie; Gollagher, Margaret; Seshadri, Rekha; Reddy, T B K; Ivanova, Natalia; Woyke, Tanja; Pati, Amrita; Markowitz, Victor; Baeshen, Mohamed N; Baeshen, Naseebh Nabeeh; Kyrpides, Nikos; Reeve, Wayne

2017-01-01

10.1601/nm.1335 Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata . This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here the features of 10.1601/nm.1335 Mlalz-1 are described, together with high-quality permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to 10.1601/nm.1335 10.1601/strainfinder?urlappend=%3Fid%3DIAM+12611 T , 10.1601/nm.1334 A 321 T and 10.1601/nm.17831 10.1601/strainfinder?urlappend=%3Fid%3DORS+1407 T , based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as 10.1601/nm.1335. Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata -nodulating 10.1601/nm.1328 strains, but ≤93% with nodC of 10.1601/nm.1328 strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced 10.1601/nm.1335 strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In 10.1601/nm.1334 strain 10.1601/strainfinder?urlappend=%3Fid%3DWSM+419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of 10.1601/nm.1334 strains, which suggests genetic recombination between strain Mlalz-1 and 10.1601/nm.1334 and the horizontal gene transfer of lpiA-acvB .

Draft genome sequence of Enterobacter cloacae HBY, a ST128 clinical strain co-producing KPC-2 and NDM-1 carbapenemases.

PubMed

Li, Xi; Zhu, Yongze; Shen, Mengyuan; Du, Jing; Zhang, Lei; Wang, Dairong

2018-03-01

Enterobacter cloacae is one of the major pathogens responsible for a variety of human infections. Here we report the draft genome sequence of multidrug-resistant E. cloacae strain HBY isolated from a female patient in China. Whole genomic DNA of E. cloacae strain HBY was extracted and was sequenced using an Illumina HiSeq™ 2000 platform. The generated sequence reads were assembled using CLC Genomics Workbench. The draft genome was annotated using Rapid Annotations using Subsystems Technology (RAST), and the presence of antimicrobial resistance genes was identified. The 5799439-bp genome contains various antimicrobial resistance genes conferring resistance to aminoglycosides, β-lactams, fosfomycin, macrolides, sulphonamides and fluoroquinolones. Notably, the strain was identified to carry two main carbapenemase genes (bla KPC-2 and bla NDM-1 ). The genome sequence reported in this study will provide valuable information to understand antibiotic resistance mechanisms in this strain. It is important to monitor the spread strains of Enterobacter sp. encoding both of these carbapenemase genes. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Terminal region sequence variations in variola virus DNA.

PubMed

Massung, R F; Loparev, V N; Knight, J C; Totmenin, A V; Chizhikov, V E; Parsons, J M; Safronov, P F; Gutorov, V V; Shchelkunov, S N; Esposito, J J

1996-07-15

Genome DNA terminal region sequences were determined for a Brazilian alastrim variola minor virus strain Garcia-1966 that was associated with an 0.8% case-fatality rate and African smallpox strains Congo-1970 and Somalia-1977 associated with variola major (9.6%) and minor (0.4%) mortality rates, respectively. A base sequence identity of > or = 98.8% was determined after aligning 30 kb of the left- or right-end region sequences with cognate sequences previously determined for Asian variola major strains India-1967 (31% death rate) and Bangladesh-1975 (18.5% death rate). The deduced amino acid sequences of putative proteins of > or = 65 amino acids also showed relatively high identity, although the Asian and African viruses were clearly more related to each other than to alastrim virus. Alastrim virus contained only 10 of 70 proteins that were 100% identical to homologs in Asian strains, and 7 alastrim-specific proteins were noted.

Draft genome sequence of Therminicola potens strain JR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.

'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.

Complete Genome Sequences of Two Bacillus pumilus Strains from Cuatrociénegas, Coahuila, Mexico

PubMed Central

Alcaraz, Luis D.; Aguilar-Salinas, Bernardo; Islas, Africa

2018-01-01

ABSTRACT We assembled the complete genome sequences of Bacillus pumilus strains 145 and 150a from Cuatrociénegas, Mexico. We detected genes codifying for proteins potentially involved in antagonism (bacteriocins) and defense mechanisms (abortive infection bacteriophage proteins and 4-azaleucine resistance). Both strains harbored prophage sequences. Our results provide insights into understanding the establishment of microbial interactions. PMID:29700165

Genome Sequences of Shewanella baltica and Shewanella morhuae Strains Isolated from the Gastrointestinal Tract of Freshwater Fish.

PubMed

Castillo, Daniel; Gram, Lone; Dailey, Frank E

2018-06-21

We present here the genome sequences of Shewanella baltica strain CW2 and Shewanella morhuae strain CW7, isolated from the gastrointestinal tract of Salvelinus namaycush (lean lake trout) and Coregonus clupeaformis (whitefish), respectively. These genome sequences provide insights into the niche adaptation of these specific species in freshwater systems. Copyright © 2018 Castillo et al.

Draft Genome Sequence of Lactobacillus reuteri Strain CRL 1098, an Interesting Candidate for Functional Food Development.

PubMed

Torres, Andrea C; Suárez, Nadia E; Font, Graciela; Saavedra, Lucila; Taranto, María Pía

2016-08-25

We report here the draft genome sequence of Lactobacillus reuteri strain CRL 1098. This strain represents an interesting candidate for functional food development because of its proven probiotic properties. The draft genome sequence is composed of 1,969,471 bp assembled into 45 contigs and an average G+C content of 38.8%. Copyright © 2016 Torres et al.

Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

PubMed Central

Bjourson, A J; Stone, C E; Cooper, J E

1992-01-01

A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

Genetic diversity of Babesia bovis in virulent and attenuated strains.

PubMed

Mazuz, M L; Molad, T; Fish, L; Leibovitz, B; Wolkomirsky, R; Fleiderovitz, L; Shkap, V

2012-03-01

The aim of this study was to compare the genetic diversity of the single copy Bv80 gene sequences of Babesia bovis in populations of attenuated and virulent parasites. PCR/ RT-PCR followed by cloning and sequence analyses of 4 attenuated and 4 virulent strains were performed. Multiple fragments in the range of 420 to 744 bp were amplified by PCR or RT-PCR. Cloning of the PCR fragments and sequence analyses revealed the presence of mixed subpopulations in either virulent or attenuated parasites with a total of 19 variants with 12 different sequences that differed in number and type of tandem repeats. High levels of intra- and inter-strain diversity of the Bv80 gene, with the presence of mixed populations of parasites were found in both the virulent field isolates and the attenuated vaccine strains. In addition, during the attenuation process, sequence analyses showed changes in the pattern of the parasite subpopulations. Despite high polymorphism found by sequence analyses, the patterns observed and the number of repeats, order, or motifs found could not discriminate between virulent field isolates and attenuated vaccine strains of the parasite.

Complete sequence of the genome of avian paramyxovirus type 2 (strain Yucaipa) and comparison with other paramyxoviruses

PubMed Central

Subbiah, Madhuri; Xiao, Sa; Collins, Peter L.; Samal, Siba K

2009-01-01

The complete RNA genome sequence of avian paramyxovirus (APMV) serotype 2, strain Yucaipa isolated from chicken has been determined. With genome size of 14,904 nucleotides (nt), strain Yucaipa is consistent with the “rule of six” and is the smallest virus reported to date among the members of subfamily Paramyxovirinae. The genome contains six non-overlapping genes in the order 3′-N-P/V-M-F-HN-L-5′. The genes are flanked on either side by highly-conserved transcription start and stop signals and have intergenic sequences varying in length from 3 to 23 nt. The genome contains a 55 nt leader sequence at 3′ end and a 154 nt trailer sequence at 5′ end. Alignment and phylogenetic analysis of the predicted amino acid sequences of strain Yucaipa proteins with the cognate proteins of viruses of all of the five genera of family Paramyxoviridae showed that APMV-2 strain Yucaipa is more closely related to APMV-6 than APMV-1. PMID:18603323

Complete Genomic Sequences of H3N8 Equine Influenza Virus Strains Used as Vaccine Strains in Japan

PubMed Central

Yamanaka, Takashi; Bannai, Hiroshi; Tsujimura, Koji; Kokado, Hiroshi

2018-01-01

ABSTRACT We sequenced the eight segments of influenza A virus strains A/equine/Ibaraki/1/2007 and A/equine/Yokohama/aq13/2010, which are strains of the Florida sublineage clades 1 and 2 of the H3N8 subtype equine influenza virus. These strains have been used as vaccine strains in Japan since 2016 in accordance with World Organization for Animal Health (OIE) recommendations. PMID:29567739

Aerobic and Anaerobic Transformation of cis-Dichloroethene (cis-DCE) and Vinyl Chloride (VC): Steps for Reliable Remediation

DTIC Science & Technology

2003-12-01

populations. (ii) Characterization of Dehalococeoides sp . strain FL2. The isolate, designate d Dehalococcoides sp . strain FL2, reductively...Pinellas group of the Dehalococcoides cluster, and demonstrated that strain FL2 shared an identical 165 rRNA gene sequence with Dehalococcoides sp ...strain CBDBI, a chlorobenzene-dechlorinating strain. The 165 rRNA gene sequence of Dehalococcoides sp . strain FL2 was submitted to GenBank (AF357918.2

Characterization of the genuine type 2 chromatic acclimation in the two Geminocystis cyanobacteria.

PubMed

Hirose, Yuu; Misawa, Naomi; Yonekawa, Chinatsu; Nagao, Nobuyoshi; Watanabe, Mai; Ikeuchi, Masahiko; Eki, Toshihiko

2017-08-01

Certain cyanobacteria can adjust the wavelengths of light they absorb by remodeling their photosynthetic antenna complex phycobilisome via a process called chromatic acclimation (CA). Although several types of CA have been reported, the diversity of the molecular mechanisms of CA among the cyanobacteria phylum is not fully understood. Here, we characterized the molecular process of CA of Geminocystis sp. strains National Institute of Environmental Studies (NIES)-3708 and NIES-3709. Absorption and fluorescence spectroscopy revealed that both strains dramatically alter their phycoerythrin content in response to green and red light. Whole-genome comparison revealed that the two strains share the typical phycobilisome structure consisting of a central core and peripheral rods, but they differ in the number of rod linkers of phycoerythrin and thus have differing capacity for phycoerythrin accumulation. RNA sequencing analysis suggested that the length of phycoerythrin rods in each phycobilisome is strictly regulated by the green light and red light-sensing CcaS/R system, whereas the total number of phycobilisomes is governed by the excitation-balancing system between phycobilisomes and photosystems. We reclassify the conventional CA types based on the genome information and designate CA of the two strains as genuine type 2, where components of phycoerythrin, but not rod-membrane linker of phycocyanin, are regulated by the CcaS/R system. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Sequence variations in RepMP2/3 and RepMP4 elements reveal intragenomic homologous DNA recombination events in Mycoplasma pneumoniae.

PubMed

Spuesens, Emiel B M; Oduber, Minoushka; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

2009-07-01

The gene encoding major adhesin protein P1 of Mycoplasma pneumoniae, MPN141, contains two DNA sequence stretches, designated RepMP2/3 and RepMP4, which display variation among strains. This variation allows strains to be differentiated into two major P1 genotypes (1 and 2) and several variants. Interestingly, multiple versions of the RepMP2/3 and RepMP4 elements exist at other sites within the bacterial genome. Because these versions are closely related in sequence, but not identical, it has been hypothesized that they have the capacity to recombine with their counterparts within MPN141, and thereby serve as a source of sequence variation of the P1 protein. In order to determine the variation within the RepMP2/3 and RepMP4 elements, both within the bacterial genome and among strains, we analysed the DNA sequences of all RepMP2/3 and RepMP4 elements within the genomes of 23 M. pneumoniae strains. Our data demonstrate that: (i) recombination is likely to have occurred between two RepMP2/3 elements in four of the strains, and (ii) all previously described P1 genotypes can be explained by inter-RepMP recombination events. Moreover, the difference between the two major P1 genotypes was reflected in all RepMP elements, such that subtype 1 and 2 strains can be differentiated on the basis of sequence variation in each RepMP element. This implies that subtype 1 and subtype 2 strains represent evolutionarily diverged strain lineages. Finally, a classification scheme is proposed in which the P1 genotype of M. pneumoniae isolates can be described in a sequence-based, universal fashion.

Empirical Validation of Pooled Whole Genome Population Re-Sequencing in Drosophila melanogaster

PubMed Central

Zhu, Yuan; Bergland, Alan O.; González, Josefa; Petrov, Dmitri A.

2012-01-01

The sequencing of pooled non-barcoded individuals is an inexpensive and efficient means of assessing genome-wide population allele frequencies, yet its accuracy has not been thoroughly tested. We assessed the accuracy of this approach on whole, complex eukaryotic genomes by resequencing pools of largely isogenic, individually sequenced Drosophila melanogaster strains. We called SNPs in the pooled data and estimated false positive and false negative rates using the SNPs called in individual strain as a reference. We also estimated allele frequency of the SNPs using “pooled” data and compared them with “true” frequencies taken from the estimates in the individual strains. We demonstrate that pooled sequencing provides a faithful estimate of population allele frequency with the error well approximated by binomial sampling, and is a reliable means of novel SNP discovery with low false positive rates. However, a sufficient number of strains should be used in the pooling because variation in the amount of DNA derived from individual strains is a substantial source of noise when the number of pooled strains is low. Our results and analysis confirm that pooled sequencing is a very powerful and cost-effective technique for assessing of patterns of sequence variation in populations on genome-wide scales, and is applicable to any dataset where sequencing individuals or individual cells is impossible, difficult, time consuming, or expensive. PMID:22848651

Viral forensic genomics reveals the relatedness of classic herpes simplex virus strains KOS, KOS63, and KOS79

PubMed Central

Bowen, Christopher D.; Renner, Daniel W.; Shreve, Jacob T.; Tafuri, Yolanda; Payne, Kimberly M.; Dix, Richard D.; Kinchington, Paul R.; Gatherer, Derek; Szpara, Moriah L.

2016-01-01

Herpes simplex virus 1 (HSV-1) is a widespread global pathogen, of which the strain KOS is one of the most extensively studied. Previous sequence studies revealed that KOS does not cluster with other strains of North American geographic origin, but instead clustered with Asian strains. We sequenced a historical isolate of the original KOS strain, called KOS63, along with a separately isolated strain attributed to the same source individual, termed KOS79. Genomic analyses revealed that KOS63 closely resembled other recently sequenced isolates of KOS and was of Asian origin, but that KOS79 was a genetically unrelated strain that clustered in genetic distance analyses with HSV-1 strains of North American/European origin. These data suggest that the human source of KOS63 and KOS79 could have been infected with two genetically unrelated strains of disparate geographic origins. A PCR RFLP test was developed for rapid identification of these strains. PMID:26950505

Viral forensic genomics reveals the relatedness of classic herpes simplex virus strains KOS, KOS63, and KOS79.

PubMed

Bowen, Christopher D; Renner, Daniel W; Shreve, Jacob T; Tafuri, Yolanda; Payne, Kimberly M; Dix, Richard D; Kinchington, Paul R; Gatherer, Derek; Szpara, Moriah L

2016-05-01

Herpes simplex virus 1 (HSV-1) is a widespread global pathogen, of which the strain KOS is one of the most extensively studied. Previous sequence studies revealed that KOS does not cluster with other strains of North American geographic origin, but instead clustered with Asian strains. We sequenced a historical isolate of the original KOS strain, called KOS63, along with a separately isolated strain attributed to the same source individual, termed KOS79. Genomic analyses revealed that KOS63 closely resembled other recently sequenced isolates of KOS and was of Asian origin, but that KOS79 was a genetically unrelated strain that clustered in genetic distance analyses with HSV-1 strains of North American/European origin. These data suggest that the human source of KOS63 and KOS79 could have been infected with two genetically unrelated strains of disparate geographic origins. A PCR RFLP test was developed for rapid identification of these strains. Copyright © 2016 Elsevier Inc. All rights reserved.

A Nonautochthonous U.S. Strain of Vibrio parahaemolyticus Isolated from Chesapeake Bay Oysters Caused the Outbreak in Maryland in 2010

PubMed Central

Haendiges, Julie; Jones, Jessica; Myers, Robert A.; Mitchell, Clifford S.; Butler, Erin

2016-01-01

ABSTRACT In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to the consumption of oysters. Strains isolated from both stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). However, the oysters contained other potentially pathogenic V. parahaemolyticus strains exhibiting different PFGE patterns. In order to assess the identity, genetic makeup, relatedness, and potential pathogenicity of the V. parahaemolyticus strains, we sequenced 11 such strains (2 clinical strains and 9 oyster strains). We analyzed these genomes by in silico multilocus sequence typing (MLST) and determined their phylogeny using a whole-genome MLST (wgMLST) analysis. Our in silico MLST analysis identified six different sequence types (STs) (ST8, ST676, ST810, ST811, ST34, and ST768), with both of the clinical and four of the oyster strains being identified as belonging to ST8. Using wgMLST, we showed that the ST8 strains from clinical and oyster samples were nearly indistinguishable and belonged to the same outbreak, confirming that local oysters were the source of the infections. The remaining oyster strains were genetically diverse, differing in >3,000 loci from the Maryland ST8 strains. eBURST analysis comparing these strains with strains of other STs available at the V. parahaemolyticus MLST website showed that the Maryland ST8 strains belonged to a clonal complex endemic to Asia. This indicates that the ST8 isolates from clinical and oyster sources were likely not endemic to Maryland. Finally, this study demonstrates the utility of whole-genome sequencing (WGS) and associated analyses for source-tracking investigations. IMPORTANCE Vibrio parahaemolyticus is an important foodborne pathogen and the leading cause of bacterial infections in the United States associated with the consumption of seafood. In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to oyster consumption. Strains isolated from stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). The oysters also contained other potentially pathogenic V. parahaemolyticus strains with different PFGE patterns. Since their identity, genetic makeup, relatedness, and potential pathogenicity were unknown, their genomes were determined by using next-generation sequencing. Whole-genome sequencing (WGS) analysis by whole-genome multilocus sequence typing (wgMLST) allowed (i) identification of clinical and oyster strains with matching PFGE profiles as belonging to ST8, (ii) determination of oyster strain diversity, and (iii) identification of the clinical strains as belonging to a clonal complex (CC) described only in Asia. Finally, WGS and associated analyses demonstrated their utility for trace-back investigations. PMID:26994080

A Nonautochthonous U.S. Strain of Vibrio parahaemolyticus Isolated from Chesapeake Bay Oysters Caused the Outbreak in Maryland in 2010.

PubMed

Haendiges, Julie; Jones, Jessica; Myers, Robert A; Mitchell, Clifford S; Butler, Erin; Toro, Magaly; Gonzalez-Escalona, Narjol

2016-06-01

In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to the consumption of oysters. Strains isolated from both stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). However, the oysters contained other potentially pathogenic V. parahaemolyticus strains exhibiting different PFGE patterns. In order to assess the identity, genetic makeup, relatedness, and potential pathogenicity of the V. parahaemolyticus strains, we sequenced 11 such strains (2 clinical strains and 9 oyster strains). We analyzed these genomes by in silico multilocus sequence typing (MLST) and determined their phylogeny using a whole-genome MLST (wgMLST) analysis. Our in silico MLST analysis identified six different sequence types (STs) (ST8, ST676, ST810, ST811, ST34, and ST768), with both of the clinical and four of the oyster strains being identified as belonging to ST8. Using wgMLST, we showed that the ST8 strains from clinical and oyster samples were nearly indistinguishable and belonged to the same outbreak, confirming that local oysters were the source of the infections. The remaining oyster strains were genetically diverse, differing in >3,000 loci from the Maryland ST8 strains. eBURST analysis comparing these strains with strains of other STs available at the V. parahaemolyticus MLST website showed that the Maryland ST8 strains belonged to a clonal complex endemic to Asia. This indicates that the ST8 isolates from clinical and oyster sources were likely not endemic to Maryland. Finally, this study demonstrates the utility of whole-genome sequencing (WGS) and associated analyses for source-tracking investigations. Vibrio parahaemolyticus is an important foodborne pathogen and the leading cause of bacterial infections in the United States associated with the consumption of seafood. In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to oyster consumption. Strains isolated from stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). The oysters also contained other potentially pathogenic V. parahaemolyticus strains with different PFGE patterns. Since their identity, genetic makeup, relatedness, and potential pathogenicity were unknown, their genomes were determined by using next-generation sequencing. Whole-genome sequencing (WGS) analysis by whole-genome multilocus sequence typing (wgMLST) allowed (i) identification of clinical and oyster strains with matching PFGE profiles as belonging to ST8, (ii) determination of oyster strain diversity, and (iii) identification of the clinical strains as belonging to a clonal complex (CC) described only in Asia. Finally, WGS and associated analyses demonstrated their utility for trace-back investigations. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Comparative genomic analysis of four representative plant growth-promoting rhizobacteria in Pseudomonas.

PubMed

Shen, Xuemei; Hu, Hongbo; Peng, Huasong; Wang, Wei; Zhang, Xuehong

2013-04-22

Some Pseudomonas strains function as predominant plant growth-promoting rhizobacteria (PGPR). Within this group, Pseudomonas chlororaphis and Pseudomonas fluorescens are non-pathogenic biocontrol agents, and some Pseudomonas aeruginosa and Pseudomonas stutzeri strains are PGPR. P. chlororaphis GP72 is a plant growth-promoting rhizobacterium with a fully sequenced genome. We conducted a genomic analysis comparing GP72 with three other pseudomonad PGPR: P. fluorescens Pf-5, P. aeruginosa M18, and the nitrogen-fixing strain P. stutzeri A1501. Our aim was to identify the similarities and differences among these strains using a comparative genomic approach to clarify the mechanisms of plant growth-promoting activity. The genome sizes of GP72, Pf-5, M18, and A1501 ranged from 4.6 to 7.1 M, and the number of protein-coding genes varied among the four species. Clusters of Orthologous Groups (COGs) analysis assigned functions to predicted proteins. The COGs distributions were similar among the four species. However, the percentage of genes encoding transposases and their inactivated derivatives (COG L) was 1.33% of the total genes with COGs classifications in A1501, 0.21% in GP72, 0.02% in Pf-5, and 0.11% in M18. A phylogenetic analysis indicated that GP72 and Pf-5 were the most closely related strains, consistent with the genome alignment results. Comparisons of predicted coding sequences (CDSs) between GP72 and Pf-5 revealed 3544 conserved genes. There were fewer conserved genes when GP72 CDSs were compared with those of A1501 and M18. Comparisons among the four Pseudomonas species revealed 603 conserved genes in GP72, illustrating common plant growth-promoting traits shared among these PGPR. Conserved genes were related to catabolism, transport of plant-derived compounds, stress resistance, and rhizosphere colonization. Some strain-specific CDSs were related to different kinds of biocontrol activities or plant growth promotion. The GP72 genome contained the cus operon (related to heavy metal resistance) and a gene cluster involved in type IV pilus biosynthesis, which confers adhesion ability. Comparative genomic analysis of four representative PGPR revealed some conserved regions, indicating common characteristics (metabolism of plant-derived compounds, heavy metal resistance, and rhizosphere colonization) among these pseudomonad PGPR. Genomic regions specific to each strain provide clues to its lifestyle, ecological adaptation, and physiological role in the rhizosphere.

Descriptions of Roseiarcus fermentans gen. nov., sp. nov., a bacteriochlorophyll a-containing fermentative bacterium related phylogenetically to alphaproteobacterial methanotrophs, and of the family Roseiarcaceae fam. nov.

PubMed

Kulichevskaya, Irina S; Danilova, Olga V; Tereshina, Vera M; Kevbrin, Vadim V; Dedysh, Svetlana N

2014-08-01

A light-pink-pigmented, microaerophilic bacterium was obtained from a methanotrophic consortium enriched from acidic Sphagnum peat and designated strain Pf56(T). Cells of this bacterium were Gram-negative, non-motile, thick curved rods that contained a vesicular intracytoplasmic membrane system characteristic of some purple non-sulfur alphaproteobacteria. The absorption spectrum of acetone/methanol extracts of cells grown in the light showed maxima at 363, 475, 505, 601 and 770 nm; the peaks at 363 and 770 nm are characteristic of bacteriochlorophyll a. However, in contrast to purple non-sulfur bacteria, strain Pf56(T) was unable to grow phototrophically under anoxic conditions in the light. Best growth occurred on some sugars and organic acids under micro-oxic conditions by means of fermentation. The fermentation products were propionate, acetate and hydrogen. Slow chemo-organotrophic growth was also observed under fully oxic conditions. Light stimulated growth. C1 substrates were not utilized. Strain Pf56(T) grew at pH 4.0-7.0 (optimum pH 5.5-6.5) and at 15-30 °C (optimum 22-28 °C). The major cellular fatty acids were 19 : 0 cyclo ω8c and 18 : 1ω7c; quinones were represented by ubiquinone Q-10. The G+C content of the DNA was 70.0 mol%. Strain Pf56 displays 93.6-94.7 and 92.7-93.7% 16S rRNA gene sequence similarity to members of the families Methylocystaceae and Beijerinckiaceae, respectively, and belongs to a large cluster of environmental sequences retrieved from various wetlands and forest soils in cultivation-independent studies. Phenotypic, genotypic and chemotaxonomic characteristics of strain Pf56(T) suggest that it represents a novel genus and species of bacteriochlorophyll a-containing fermentative bacteria, for which the name Roseiarcus fermentans gen. nov., sp. nov. is proposed. Strain Pf56(T) ( = DSM 24875(T) = VKM B-2876(T)) is the type strain of Roseiarcus fermentans, and is also the first characterized member of a novel family within the class Alphaproteobacteria, Roseiarcaceae fam. nov. © 2014 IUMS.

Methicillin-resistant Staphylococcus argenteus misidentified as methicillin-resistant Staphylococcus aureus emerging in western Sweden.

PubMed

Tång Hallbäck, Erika; Karami, Nahid; Adlerberth, Ingegerd; Cardew, Sofia; Ohlén, Maria; Engström Jakobsson, Hedvig; Svensson Stadler, Liselott

2018-05-17

Two strains included in a whole-genome sequencing project for methicillin-resistant Staphylococcus aureus (MRSA) were identified as non-Staphylococcus aureus when the sequences were analysed using the bioinformatics software ALEX (www.1928diagnostics.com, Gothenburg, Sweden). Sequencing of the sodA gene of these strains identified them as Staphylococcus argenteus. The collection of MRSA in western Sweden was checked for additional strains of this species. A total of 18 strains of S. argenteus isolated between 2011 and December 2017 were identified.

Draft Genome Sequences of Lactobacillus equicursoris CIP 110162T and Lactobacillus sp. Strain CRBIP 24.137, Isolated from Thoroughbred Racehorse Feces and Human Urine, Respectively.

PubMed

Cousin, Sylvie; Loux, Valentin; Ma, Laurence; Creno, Sophie; Clermont, Dominique; Bizet, Chantal; Bouchier, Christiane

2013-08-22

We report the draft genome sequences of strain Lactobacillus equicursoris CIP 110162(T), isolated from racehorse breed feces, and Lactobacillus sp. strain CRBIP 24.137, isolated from human urine; the two strains are closely related. The total lengths of the 116 and 62 scaffolds are about 2.157 and 2.358 Mb, with G+C contents of 46 and 45% and 2,279 and 2,342 coding sequences (CDSs), respectively.

Complete Genome Sequence of the Quality Control Strain Staphylococcus aureus subsp. aureus ATCC 25923.

PubMed

Treangen, Todd J; Maybank, Rosslyn A; Enke, Sana; Friss, Mary Beth; Diviak, Lynn F; Karaolis, David K R; Koren, Sergey; Ondov, Brian; Phillippy, Adam M; Bergman, Nicholas H; Rosovitz, M J

2014-11-06

Staphylococcus aureus subsp. aureus ATCC 25923 is commonly used as a control strain for susceptibility testing to antibiotics and as a quality control strain for commercial products. We present the completed genome sequence for the strain, consisting of the chromosome and a 27.5-kb plasmid. Copyright © 2014 Treangen et al.

Genome sequence of the pathogenic Herbaspirillum seropedicae strain Os34, isolated from rice roots.

PubMed

Ye, Weijun; Ye, Shuting; Liu, Jian; Chang, Siping; Chen, Mingyue; Zhu, Bo; Guo, Longbiao; An, Qianli

2012-12-01

Most Herbaspirillum seropedicae strains are beneficial endophytes to plants. In contrast, H. seropedicae strain Os34, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os34 presented here allows in-depth comparative genome analyses to understand the specific mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions.

Genome sequence of the pathogenic Herbaspirillum seropedicae strain Os45, isolated from rice roots.

PubMed

Zhu, Bo; Ye, Shuting; Chang, Siping; Chen, Mingyue; Sun, Li; An, Qianli

2012-12-01

Most Herbaspirillum seropedicae strains are beneficial to plants. In contrast, H. seropedicae strain Os45, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os45 presented here allows an in-depth comparative genome analysis to understand the subtle mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions.

Genome Sequence of the Pathogenic Herbaspirillum seropedicae Strain Os34, Isolated from Rice Roots

PubMed Central

Ye, Weijun; Ye, Shuting; Liu, Jian; Chang, Siping; Chen, Mingyue; Zhu, Bo

2012-01-01

Most Herbaspirillum seropedicae strains are beneficial endophytes to plants. In contrast, H. seropedicae strain Os34, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os34 presented here allows in-depth comparative genome analyses to understand the specific mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions. PMID:23209241

Genome Sequence of the Pathogenic Herbaspirillum seropedicae Strain Os45, Isolated from Rice Roots

PubMed Central

Zhu, Bo; Ye, Shuting; Chang, Siping; Chen, Mingyue; Sun, Li

2012-01-01

Most Herbaspirillum seropedicae strains are beneficial to plants. In contrast, H. seropedicae strain Os45, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os45 presented here allows an in-depth comparative genome analysis to understand the subtle mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions. PMID:23209242

Draft Genome Sequences of Two Aspergillus fumigatus Strains, Isolated from the International Space Station.

PubMed

Singh, Nitin Kumar; Blachowicz, Adriana; Checinska, Aleksandra; Wang, Clay; Venkateswaran, Kasthuri

2016-07-14

Draft genome sequences of Aspergillus fumigatus strains (ISSFT-021 and IF1SW-F4), opportunistic pathogens isolated from the International Space Station (ISS), were assembled to facilitate investigations of the nature of the virulence characteristics of the ISS strains to other clinical strains isolated on Earth. Copyright © 2016 Singh et al.

Complete genome sequence of porcine parvovirus N strain isolated from guangxi, china.

PubMed

Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

2015-01-08

We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety. Copyright © 2015 Su et al.

Outbreak Investigation Using High-Throughput Genome Sequencing within a Diagnostic Microbiology Laboratory

PubMed Central

Sherry, Norelle L.; Porter, Jessica L.; Seemann, Torsten; Watkins, Andrew; Stinear, Timothy P.

2013-01-01

Next-generation sequencing (NGS) of bacterial genomes has recently become more accessible and is now available to the routine diagnostic microbiology laboratory. However, questions remain regarding its feasibility, particularly with respect to data analysis in nonspecialist centers. To test the applicability of NGS to outbreak investigations, Ion Torrent sequencing was used to investigate a putative multidrug-resistant Escherichia coli outbreak in the neonatal unit of the Mercy Hospital for Women, Melbourne, Australia. Four suspected outbreak strains and a comparator strain were sequenced. Genome-wide single nucleotide polymorphism (SNP) analysis demonstrated that the four neonatal intensive care unit (NICU) strains were identical and easily differentiated from the comparator strain. Genome sequence data also determined that the NICU strains belonged to multilocus sequence type 131 and carried the blaCTX-M-15 extended-spectrum beta-lactamase. Comparison of the outbreak strains to all publicly available complete E. coli genome sequences showed that they clustered with neonatal meningitis and uropathogenic isolates. The turnaround time from a positive culture to the completion of sequencing (prior to data analysis) was 5 days, and the cost was approximately $300 per strain (for the reagents only). The main obstacles to a mainstream adoption of NGS technologies in diagnostic microbiology laboratories are currently cost (although this is decreasing), a paucity of user-friendly and clinically focused bioinformatics platforms, and a lack of genomics expertise outside the research environment. Despite these hurdles, NGS technologies provide unparalleled high-resolution genotyping in a short time frame and are likely to be widely implemented in the field of diagnostic microbiology in the next few years, particularly for epidemiological investigations (replacing current typing methods) and the characterization of resistance determinants. Clinical microbiologists need to familiarize themselves with these technologies and their applications. PMID:23408689

Insight into the Significance of Aspergillus fumigatus cyp51A Polymorphisms.

PubMed

Garcia-Rubio, Rocio; Alcazar-Fuoli, Laura; Monteiro, Maria Candida; Monzon, Sara; Cuesta, Isabel; Pelaez, Teresa; Mellado, Emilia

2018-06-01

Triazole antifungal compounds are the first treatment choice for invasive aspergillosis. However, in the last decade the rate of azole resistance among Aspergillus fumigatus strains has increased notoriously. The main resistance mechanisms are well defined and mostly related to point mutations of the azole target, 14-α sterol demethylase ( cyp51A ), with or without tandem repeat integrations in the cyp51A promoter. Furthermore, different combinations of five Cyp51A mutations (F46Y, M172V, N248T, D255E, and E427K) have been reported worldwide in about 10% of all A. fumigatus isolates tested. The azole susceptibility profile of these strains shows elevated azole MICs, although on the basis of the azole susceptibility breakpoints, these strains are not considered azole resistant. The purpose of the study was to determine whether these cyp51A polymorphisms (single nucleotide polymorphisms [SNPs]) are responsible for the azole susceptibility profile and whether they are reflected in a poorer azole treatment response in vivo that could compromise patient treatment and outcome. A mutant with a cyp51A deletion was generated and became fully susceptible to all azoles tested. Also, three cyp51A gene constructions with different combinations of SNPs were generated and reintroduced into an azole-susceptible wild-type (WT) strain (the Δ akuB KU80 strain). The alternative model host Galleria mellonella was used to compare the virulence and voriconazole response of G. mellonella larvae infected with A. fumigatus strains with WT cyp51A or cyp51A with SNPs. All strains were pathogenic in G. mellonella larvae, although they did not respond similarly to voriconazole therapeutic doses. Finally, the full genomes of these strains were sequenced and analyzed in comparison with those of A. fumigatus WT strains, revealing that they belong to different strain clusters or lineages. Copyright © 2018 American Society for Microbiology.

Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus.

PubMed

Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su

2012-02-01

New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Genetic analysis of duck circovirus in Pekin ducks from South Korea.

PubMed

Cha, S-Y; Kang, M; Cho, J-G; Jang, H-K

2013-11-01

The genetic organization of the 24 duck circovirus (DuCV) strains detected in commercial Pekin ducks from South Korea between 2011 and 2012 is described in this study. Multiple sequence alignment and phylogenetic analyses were performed on the 24 viral genome sequences as well as on 45 genome sequences available from the GenBank database. Phylogenetic analyses based on the genomic and open reading frame 2/cap sequences demonstrated that all DuCV strains belonged to genotype 1 and were designated in a subcluster under genotype 1. Analysis of the capsid protein amino acid sequences of the 24 Korean DuCV strains showed 10 substitutions compared with that of other genotype 1 strains. Our analysis showed that genotype 1 is predominant and circulating in South Korea. These present results serve as incentive to add more data to the DuCV database and provide insight to conduct further intensive study on the geographic relationships among these virus strains.

Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2010-09-01

Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Typing Clostridium difficile strains based on tandem repeat sequences

PubMed Central

2009-01-01

Background Genotyping of epidemic Clostridium difficile strains is necessary to track their emergence and spread. Portability of genotyping data is desirable to facilitate inter-laboratory comparisons and epidemiological studies. Results This report presents results from a systematic screen for variation in repetitive DNA in the genome of C. difficile. We describe two tandem repeat loci, designated 'TR6' and 'TR10', which display extensive sequence variation that may be useful for sequence-based strain typing. Based on an investigation of 154 C. difficile isolates comprising 75 ribotypes, tandem repeat sequencing demonstrated excellent concordance with widely used PCR ribotyping and equal discriminatory power. Moreover, tandem repeat sequences enabled the reconstruction of the isolates' largely clonal population structure and evolutionary history. Conclusion We conclude that sequence analysis of the two repetitive loci introduced here may be highly useful for routine typing of C. difficile. Tandem repeat sequence typing resolves phylogenetic diversity to a level equivalent to PCR ribotypes. DNA sequences may be stored in databases accessible over the internet, obviating the need for the exchange of reference strains. PMID:19133124

Draft genome sequences of two Bifidobacterium sp. from the honey bee (Apis mellifera)

USDA-ARS?s Scientific Manuscript database

We provide genome sequences for two strains of honey bee associated Bifidobacterium. Reflecting an oxygen-rich niche, both strains possessed catalase, peroxidase, superoxide-dismutase and respiratory chain enzymes indicative of oxidative metabolism. The strains show markedly different carbohydrate ...

Complete Genome Sequence of the Probiotic Lactobacillus casei Strain BL23▿

PubMed Central

Mazé, Alain; Boël, Grégory; Zúñiga, Manuel; Bourand, Alexa; Loux, Valentin; Yebra, Maria Jesus; Monedero, Vicente; Correia, Karine; Jacques, Noémie; Beaufils, Sophie; Poncet, Sandrine; Joyet, Philippe; Milohanic, Eliane; Casarégola, Serge; Auffray, Yanick; Pérez-Martínez, Gaspar; Gibrat, Jean-François; Zagorec, Monique; Francke, Christof; Hartke, Axel; Deutscher, Josef

2010-01-01

The entire genome of Lactobacillus casei BL23, a strain with probiotic properties, has been sequenced. The genomes of BL23 and the industrially used probiotic strain Shirota YIT 9029 (Yakult) seem to be very similar. PMID:20348264

Complete Genome Sequence of the Clinical Beijing-Like Strain Mycobacterium tuberculosis 323 Using the PacBio Real-Time Sequencing Platform

PubMed Central

Rodríguez, Juan Germán; Pino, Camilo; Tauch, Andreas

2015-01-01

We report here the whole-genome sequence of the multidrug-resistant Beijing-like strain Mycobacterium tuberculosis 323, isolated from a 15-year-old female patient who died shortly after the initiation of second-line drug treatment. This strain is representative of the Beijing-like isolates from Colombia, where this lineage is becoming a public health concern. PMID:25931600

Draft Genome Sequence of Pseudomonas sp. Strain B1, Isolated from a Contaminated Sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pathak, Ashish; Jaswal, Rajneesh; Stothard, Paul

ABSTRACT The draft genome sequence of Pseudomonas sp. strain B1, isolated from a contaminated soil, is reported. The genome comprises 6,706,934 bases, 6,059 coding sequences, and 70 RNAs and has a G+C content of 60.3%. A suite of biodegradative genes, many located on genomic islands, were identified from strain B1, further enhancing our understanding of the versatile pseudomonads.

Draft Genome Sequences of Six Lactobacillus pentosus Strains Isolated from Brines of Traditionally Fermented Spanish-Style Green Table Olives.

PubMed

Calero-Delgado, Beatriz; Martín-Platero, Antonio M; Pérez-Pulido, Antonio J; Benítez-Cabello, Antonio; Casimiro-Soriguer, Carlos S; Martínez-Bueno, Manuel; Arroyo-López, Francisco Noé; Rodríguez-Gómez, Francisco; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Jiménez-Díaz, Rufino

2018-05-03

Here, we report the genome sequences of six Lactobacillus pentosus strains isolated from traditional noninoculated Spanish-style green table olive brines. The total genome sizes varied between 3.77 and 4.039 Mbp. These genome sequences will assist in revealing the genes responsible for both technological and probiotic properties of these strains. Copyright © 2018 Calero-Delgado et al.

Complete genome sequencing of a multidrug-resistant and human-invasive Salmonella enterica serovar Typhimurium strain of the emerging sequence type 213 genotype

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calva, Edmundo; Silva, Claudia; Zaidi, Mussaret B.

Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 was isolated in 2005 in the state of Yucatán, Mexico, from a human systemic infection. The YU39 strain is representative of the multidrug-resistant emergent sequence type 213 (ST213) genotype. The YU39 complete genome is composed of a chromosome and seven plasmids.

Draft Genome Sequences of blaKPC-Containing Enterobacter aerogenes, Citrobacter freundii, and Citrobacter koseri Strains

PubMed Central

Hazen, Tracy H.; Mettus, Roberta T.; McElheny, Christi L.; Bowler, Sarah L.

2018-01-01

ABSTRACT We report here the draft genome sequences of four blaKPC-containing bacteria identified as Klebsiella aerogenes, Citrobacter freundii, and Citrobacter koseri. Additionally, we report the draft genome sequence of a K. aerogenes strain that did not contain a blaKPC gene but was isolated from the patient who had the blaKPC-2-containing K. aerogenes strain. PMID:29472325

Draft Genome Sequences of blaKPC-Containing Enterobacter aerogenes, Citrobacter freundii, and Citrobacter koseri Strains.

PubMed

Hazen, Tracy H; Mettus, Roberta T; McElheny, Christi L; Bowler, Sarah L; Doi, Yohei; Rasko, David A

2018-02-22

We report here the draft genome sequences of four bla KPC -containing bacteria identified as Klebsiella aerogenes , Citrobacter freundii , and Citrobacter koseri Additionally, we report the draft genome sequence of a K. aerogenes strain that did not contain a bla KPC gene but was isolated from the patient who had the bla KPC-2 -containing K. aerogenes strain. Copyright © 2018 Hazen et al.

Draft Genome Sequence of Agrobacterium sp. Strain UHFBA-218, Isolated from Rhizosphere Soil of Crown Gall-Infected Cherry Rootstock Colt

PubMed Central

Dua, Ankita; Sangwan, Naseer; Kaur, Jasvinder; Saxena, Anjali; Kohli, Puneet; Gupta, A. K.

2013-01-01

We report here the draft genome sequence of the alphaproteobacterium Agrobacterium sp. strain UHFBA-218, which was isolated from rhizosphere soil of crown gall-infected cherry rootstock Colt. The draft genome of strain UHFBA-218 consists of 112 contigs (5,425,303 bp) and 5,063 coding sequences with a G+C content of 59.8%. PMID:23723402

Complete Genome Sequences of Two Bacillus pumilus Strains from Cuatrociénegas, Coahuila, Mexico.

PubMed

Zarza, Eugenia; Alcaraz, Luis D; Aguilar-Salinas, Bernardo; Islas, Africa; Olmedo-Álvarez, Gabriela

2018-04-26

We assembled the complete genome sequences of Bacillus pumilus strains 145 and 150a from Cuatrociénegas, Mexico. We detected genes codifying for proteins potentially involved in antagonism (bacteriocins) and defense mechanisms (abortive infection bacteriophage proteins and 4-azaleucine resistance). Both strains harbored prophage sequences. Our results provide insights into understanding the establishment of microbial interactions. Copyright © 2018 Zarza et al.

Complete genome sequencing of a multidrug-resistant and human-invasive Salmonella enterica serovar Typhimurium strain of the emerging sequence type 213 genotype

DOE PAGES

Calva, Edmundo; Silva, Claudia; Zaidi, Mussaret B.; ...

2015-06-18

Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 was isolated in 2005 in the state of Yucatán, Mexico, from a human systemic infection. The YU39 strain is representative of the multidrug-resistant emergent sequence type 213 (ST213) genotype. The YU39 complete genome is composed of a chromosome and seven plasmids.

Draft Genome Sequence of Pseudomonas sp. Strain B1, Isolated from a Contaminated Sediment

DOE PAGES

Pathak, Ashish; Jaswal, Rajneesh; Stothard, Paul; ...

2018-06-21

ABSTRACT The draft genome sequence of Pseudomonas sp. strain B1, isolated from a contaminated soil, is reported. The genome comprises 6,706,934 bases, 6,059 coding sequences, and 70 RNAs and has a G+C content of 60.3%. A suite of biodegradative genes, many located on genomic islands, were identified from strain B1, further enhancing our understanding of the versatile pseudomonads.

Whole-Genome Sequencing of Lactobacillus salivarius Strains BCRC 14759 and BCRC 12574

PubMed Central

Chiu, Shih-Hau; Wang, Li-Ting; Huang, Lina

2017-01-01

ABSTRACT Lactobacillus salivarius BCRC 14759 has been identified as a high-exopolysaccharide-producing strain with potential as a probiotic or fermented dairy product. Here, we report the genome sequences of L. salivarius BCRC 14759 and the comparable strain BCRC 12574, isolated from human saliva. The PacBio RSII sequencing platform was used to obtain high-quality assemblies for characterization of this probiotic candidate. PMID:29167259

Draft Genome Sequences of Three Novel Low-Abundance Species Strains Isolated from Kefir Grain.

PubMed

Kim, Yongkyu; Blasche, Sonja; Patil, Kiran R

2017-09-28

We report here the genome sequences of three novel bacterial species strains- Bacillus kefirresidentii Opo, Rothia kefirresidentii KRP, and Streptococcus kefirresidentii YK-isolated from kefir grains collected in Germany. The draft genomes of these isolates were remarkably dissimilar (average nucleotide identities, 77.80%, 89.01%, and 92.10%, respectively) to those of the previously sequenced strains. Copyright © 2017 Kim et al.

Comparison and Evaluation of the Molecular Typing Methods for Toxigenic Vibrio cholerae in Southwest China.

PubMed

Liao, Feng; Mo, Zhishuo; Chen, Meiling; Pang, Bo; Fu, Xiaoqing; Xu, Wen; Jing, Huaiqi; Kan, Biao; Gu, Wenpeng

2018-01-01

Vibrio cholerae O1 strains taken from the repository of Yunnan province, southwest China, were abundant and special. We selected 70 typical toxigenic V. cholerae (69 O1 and one O139 serogroup strains) isolated from Yunnan province, performed the pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and MLST of virulence gene (V-MLST) methods, and evaluated the resolution abilities for typing methods. The ctxB subunit sequence analysis for all strains have shown that cholera between 1986 and 1995 was associated with mixed infections with El Tor and El Tor variants, while infections after 1996 were all caused by El Tor variant strains. Seventy V. cholerae obtained 50 PFGE patterns, with a high resolution. The strains could be divided into three groups with predominance of strains isolated during 1980s, 1990s, and 2000s, respectively, showing a good consistency with the epidemiological investigation. We also evaluated two MLST method for V. cholerae , one was used seven housekeeping genes ( adk , gyrB , metE , pntA , mdh , purM , and pyrC ), and all the isolates belonged to ST69; another was used nine housekeeping genes ( cat , chi , dnaE , gyrB , lap , pgm , recA , rstA , and gmd ). A total of seven sequence types (STs) were found by using this method for all the strains; among them, rstA gene had five alleles, recA and gmd have two alleles, and others had only one allele. The virulence gene sequence typing method ( ctxAB , tcpA , and toxR ) showed that 70 strains were divided into nine STs; among them, tcpA gene had six alleles, toxR had five alleles, while ctxAB was identical for all the strains. The latter two sequences based typing methods also had consistency with epidemiology of the strains. PFGE had a higher resolution ability compared with the sequence based typing method, and MLST used seven housekeeping genes showed the lower resolution power than nine housekeeping genes and virulence genes methods. These two sequence typing methods could distinguish some epidemiological special strains in local area.

Genome Sequence of Lactobacillus plantarum Strain UCMA 3037.

PubMed

Naz, Saima; Tareb, Raouf; Bernardeau, Marion; Vaisse, Melissa; Lucchetti-Miganeh, Celine; Rechenmann, Mathias; Vernoux, Jean-Paul

2013-05-23

Nucleic acid of the strain Lactobacillus plantarum UCMA 3037, isolated from raw milk camembert cheese in our laboratory, was sequenced. We present its draft genome sequence with the aim of studying its functional properties and relationship to the cheese ecosystem.

Genome sequence of Stachybotrys chartarum Strain 51-11

EPA Science Inventory

Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

Complete Genomic Sequences of H3N8 Equine Influenza Virus Strains Used as Vaccine Strains in Japan.

PubMed

Nemoto, Manabu; Yamanaka, Takashi; Bannai, Hiroshi; Tsujimura, Koji; Kokado, Hiroshi

2018-03-22

We sequenced the eight segments of influenza A virus strains A/equine/Ibaraki/1/2007 and A/equine/Yokohama/aq13/2010, which are strains of the Florida sublineage clades 1 and 2 of the H3N8 subtype equine influenza virus. These strains have been used as vaccine strains in Japan since 2016 in accordance with World Organization for Animal Health (OIE) recommendations. Copyright © 2018 Nemoto et al.

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

'Candidatus Phytoplasma solani', a novel taxon associated with stolbur- and bois noir-related diseases of plants.

PubMed

Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward

2013-08-01

Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.

The Origins of 168, W23, and Other Bacillus subtilis Legacy Strains▿ †

PubMed Central

Zeigler, Daniel R.; Prágai, Zoltán; Rodriguez, Sabrina; Chevreux, Bastien; Muffler, Andrea; Albert, Thomas; Bai, Renyuan; Wyss, Markus; Perkins, John B.

2008-01-01

Bacillus subtilis is both a model organism for basic research and an industrial workhorse, yet there are major gaps in our understanding of the genomic heritage and provenance of many widely used strains. We analyzed 17 legacy strains dating to the early years of B. subtilis genetics. For three—NCIB 3610T, PY79, and SMY—we performed comparative genome sequencing. For the remainder, we used conventional sequencing to sample genomic regions expected to show sequence heterogeneity. Sequence comparisons showed that 168, its siblings (122, 160, and 166), and the type strains NCIB 3610 and ATCC 6051 are highly similar and are likely descendants of the original Marburg strain, although the 168 lineage shows genetic evidence of early domestication. Strains 23, W23, and W23SR are identical in sequence to each other but only 94.6% identical to the Marburg group in the sequenced regions. Strain 23, the probable W23 parent, likely arose from a contaminant in the mutagenesis experiments that produced 168. The remaining strains are all genomic hybrids, showing one or more “W23 islands” in a 168 genomic backbone. Each traces its origin to transformations of 168 derivatives with DNA from 23 or W23. The common prototrophic lab strain PY79 possesses substantial W23 islands at its trp and sac loci, along with large deletions that have reduced its genome 4.3%. SMY, reputed to be the parent of 168, is actually a 168-W23 hybrid that likely shares a recent ancestor with PY79. These data provide greater insight into the genomic history of these B. subtilis legacy strains. PMID:18723616

Candida ruelliae sp. nov., a novel yeast species isolated from flowers of Ruellia sp. (Acanthaceae).

PubMed

Saluja, Puja; Prasad, Gandham S

2008-06-01

Two novel yeast strains designated as 16Q1 and 16Q3 were isolated from flowers of the Ruellia species of the Acanthaceae family. The D1/D2 domain and ITS sequences of these two strains were identical. Sequence analysis of the D1/D2 domain of large-subunit rRNA gene indicated their relationship to species of the Candida haemulonii cluster. However, they differ from C. haemulonii by 14% nucleotide sequence divergence, from Candida pseudohaemulonii by 16.1% and from C. haemulonii type II by 16.5%. These strains also differ in 18 physiological tests from the type strain of C. haemulonii, and 12 and 16 tests, respectively, from C. pseudohaemulonii and C. haemulonii type II. They also differ from C. haemulonii and other related species by more than 13% sequence divergence in the internal transcribed spacer region. In the SSU rRNA gene sequences, strain 16Q1 differs by 1.7% nucleotide divergence from C. haemulonii. Sporulation was not observed in pure or mixed cultures on several media examined. All these data support the assignment of these strains to a novel species; we have named them as Candida ruelliae sp. nov., and designate strain 16Q1(T)=MTCC 7739(T)=CBS10815(T) as type strain of the novel species.

Strain/species identification in metagenomes using genome-specific markers

PubMed Central

Tu, Qichao; He, Zhili; Zhou, Jizhong

2014-01-01

Shotgun metagenome sequencing has become a fast, cheap and high-throughput technology for characterizing microbial communities in complex environments and human body sites. However, accurate identification of microorganisms at the strain/species level remains extremely challenging. We present a novel k-mer-based approach, termed GSMer, that identifies genome-specific markers (GSMs) from currently sequenced microbial genomes, which were then used for strain/species-level identification in metagenomes. Using 5390 sequenced microbial genomes, 8 770 321 50-mer strain-specific and 11 736 360 species-specific GSMs were identified for 4088 strains and 2005 species (4933 strains), respectively. The GSMs were first evaluated against mock community metagenomes, recently sequenced genomes and real metagenomes from different body sites, suggesting that the identified GSMs were specific to their targeting genomes. Sensitivity evaluation against synthetic metagenomes with different coverage suggested that 50 GSMs per strain were sufficient to identify most microbial strains with ≥0.25× coverage, and 10% of selected GSMs in a database should be detected for confident positive callings. Application of GSMs identified 45 and 74 microbial strains/species significantly associated with type 2 diabetes patients and obese/lean individuals from corresponding gastrointestinal tract metagenomes, respectively. Our result agreed with previous studies but provided strain-level information. The approach can be directly applied to identify microbial strains/species from raw metagenomes, without the effort of complex data pre-processing. PMID:24523352

Characterization of a New Fully Recycled Carbon Fiber Reinforced Composite Subjected to High Strain Rate Tension

NASA Astrophysics Data System (ADS)

Meftah, H.; Tamboura, S.; Fitoussi, J.; BenDaly, H.; Tcharkhtchi, A.

2017-08-01

The aim of this study is the complete physicochemical characterization and strain rate effect multi-scale analysis of a new fully recycled carbon fiber reinforced composites for automotive crash application. Two composites made of 20% wt short recycled carbon fibers (CF) are obtained by injection molding. The morphology and the degree of dispersion of CF in the matrixes were examined using a new ultrasonic method and SEM. High strain tensile behavior up to 100 s-1 is investigated. In order to avoid perturbation due to inertial effect and wave propagation, the specimen geometry was optimized. The elastic properties appear to be insensitive to the strain rate. However, a high strain rate effect on the local visco-plasticity of the matrix and fiber/matrix interface visco-damageable behavior is emphasized. The predominant damage mechanisms evolve from generalized matrix local ductility at low strain rate regime to fiber/matrix interface debonding and fibers pull-out at high strain rate regime.

Characterization of a New Fully Recycled Carbon Fiber Reinforced Composite Subjected to High Strain Rate Tension

NASA Astrophysics Data System (ADS)

Meftah, H.; Tamboura, S.; Fitoussi, J.; BenDaly, H.; Tcharkhtchi, A.

2018-06-01

The aim of this study is the complete physicochemical characterization and strain rate effect multi-scale analysis of a new fully recycled carbon fiber reinforced composites for automotive crash application. Two composites made of 20% wt short recycled carbon fibers (CF) are obtained by injection molding. The morphology and the degree of dispersion of CF in the matrixes were examined using a new ultrasonic method and SEM. High strain tensile behavior up to 100 s-1 is investigated. In order to avoid perturbation due to inertial effect and wave propagation, the specimen geometry was optimized. The elastic properties appear to be insensitive to the strain rate. However, a high strain rate effect on the local visco-plasticity of the matrix and fiber/matrix interface visco-damageable behavior is emphasized. The predominant damage mechanisms evolve from generalized matrix local ductility at low strain rate regime to fiber/matrix interface debonding and fibers pull-out at high strain rate regime.

Mesh Deformation Based on Fully Stressed Design: The Method and Two-Dimensional Examples

NASA Technical Reports Server (NTRS)

Hsu, Su-Yuen; Chang, Chau-Lyan

2007-01-01

Mesh deformation in response to redefined boundary geometry is a frequently encountered task in shape optimization and analysis of fluid-structure interaction. We propose a simple and concise method for deforming meshes defined with three-node triangular or four-node tetrahedral elements. The mesh deformation method is suitable for large boundary movement. The approach requires two consecutive linear elastic finite-element analyses of an isotropic continuum using a prescribed displacement at the mesh boundaries. The first analysis is performed with homogeneous elastic property and the second with inhomogeneous elastic property. The fully stressed design is employed with a vanishing Poisson s ratio and a proposed form of equivalent strain (modified Tresca equivalent strain) to calculate, from the strain result of the first analysis, the element-specific Young s modulus for the second analysis. The theoretical aspect of the proposed method, its convenient numerical implementation using a typical linear elastic finite-element code in conjunction with very minor extra coding for data processing, and results for examples of large deformation of two-dimensional meshes are presented in this paper. KEY WORDS: Mesh deformation, shape optimization, fluid-structure interaction, fully stressed design, finite-element analysis, linear elasticity, strain failure, equivalent strain, Tresca failure criterion

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.

PubMed

Goris, Johan; Konstantinidis, Konstantinos T; Klappenbach, Joel A; Coenye, Tom; Vandamme, Peter; Tiedje, James M

2007-01-01

DNA-DNA hybridization (DDH) values have been used by bacterial taxonomists since the 1960s to determine relatedness between strains and are still the most important criterion in the delineation of bacterial species. Since the extent of hybridization between a pair of strains is ultimately governed by their respective genomic sequences, we examined the quantitative relationship between DDH values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. A total of 124 DDH values were determined for 28 strains for which genome sequences were available. The strains belong to six important and diverse groups of bacteria for which the intra-group 16S rRNA gene sequence identity was greater than 94 %. The results revealed a close relationship between DDH values and ANI and between DNA-DNA hybridization and the percentage of conserved DNA for each pair of strains. The recommended cut-off point of 70 % DDH for species delineation corresponded to 95 % ANI and 69 % conserved DNA. When the analysis was restricted to the protein-coding portion of the genome, 70 % DDH corresponded to 85 % conserved genes for a pair of strains. These results reveal extensive gene diversity within the current concept of "species". Examination of reciprocal values indicated that the level of experimental error associated with the DDH method is too high to reveal the subtle differences in genome size among the strains sampled. It is concluded that ANI can accurately replace DDH values for strains for which genome sequences are available.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

PubMed

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

Attenuation of an original US porcine epidemic diarrhea virus strain PC22A via serial cell culture passage.

PubMed

Lin, Chun-Ming; Hou, Yixuan; Marthaler, Douglas G; Gao, Xiang; Liu, Xinsheng; Zheng, Lanlan; Saif, Linda J; Wang, Qiuhong

2017-03-01

Although porcine epidemic diarrhea (PED) has caused huge economic losses in the pork industry worldwide, an effective live, attenuated vaccine is lacking. In this study, an original US, highly virulent PED virus (PEDV) strain PC22A was serially passaged in Vero CCL81 and Vero BI cells. The virus growth kinetics in cell culture, virulence in neonatal pigs and the whole genomic sequences of selected passages were examined. Increased virus titers and sizes of syncytia were observed at the 65th passage level (P65) and P120, respectively. Based on the severity of clinical signs, histopathological lesions and the distribution of PEDV antigens in the gut, the virulence of P100 and above, but not P95C13 (CCL81), was markedly reduced in 4-day-old, caesarian-derived, colostrum-deprived piglets. Subsequently, the attenuation of P120 and P160 was confirmed in 4-day-old, conventional suckling piglets. Compared with P120, P160 replicated less efficiently in the intestine of pigs and induced a lower rate of protection after challenge. Sequence analysis revealed that the virulent viruses [P3 and P95C13 (CCL81)] had one, one, sixteen (including an early termination of nine amino acids) and two amino acid differences in non-structure protein 1 (nsp1), nsp4, spike and membrane proteins, respectively, from the fully attenuated P160. However, the overall pattern of attenuation-related genetic changes in PC22A differed from those of the other four pairs of PEDV wild type strains and their attenuated derivatives. These results suggest that PEDV attenuation can occur through multiple molecular mechanisms. The knowledge provides insights into potential molecular mechanisms of PEDV attenuation. Copyright © 2017 Elsevier B.V. All rights reserved.

Whole-Genome Sequence Variation among Multiple Isolates of Pseudomonas aeruginosa

PubMed Central

Spencer, David H.; Kas, Arnold; Smith, Eric E.; Raymond, Christopher K.; Sims, Elizabeth H.; Hastings, Michele; Burns, Jane L.; Kaul, Rajinder; Olson, Maynard V.

2003-01-01

Whole-genome shotgun sequencing was used to study the sequence variation of three Pseudomonas aeruginosa isolates, two from clonal infections of cystic fibrosis patients and one from an aquatic environment, relative to the genomic sequence of reference strain PAO1. The majority of the PAO1 genome is represented in these strains; however, at least three prominent islands of PAO1-specific sequence are apparent. Conversely, ∼10% of the sequencing reads derived from each isolate fail to align with the PAO1 backbone. While average sequence variation among all strains is roughly 0.5%, regions of pronounced differences were evident in whole-genome scans of nucleotide diversity. We analyzed two such divergent loci, the pyoverdine and O-antigen biosynthesis regions, by complete resequencing. A thorough analysis of isolates collected over time from one of the cystic fibrosis patients revealed independent mutations resulting in the loss of O-antigen synthesis alternating with a mucoid phenotype. Overall, we conclude that most of the PAO1 genome represents a core P. aeruginosa backbone sequence while the strains addressed in this study possess additional genetic material that accounts for at least 10% of their genomes. Approximately half of these additional sequences are novel. PMID:12562802

Identification, Classification, and Phylogeny of the Pathogenic Species Exophiala jeanselmei and Related Species by Mitochondrial Cytochrome b Gene Analysis

PubMed Central

Wang, Li; Yokoyama, Koji; Miyaji, Makoto; Nishimura, Kazuko

2001-01-01

We analyzed a 402-bp sequence of the mitochondrial cytochrome b gene of 34 strains of Exophiala jeanselmei and 16 strains representing 12 related species. The strains of E. jeanselmei were classified into 20 DNA types and 17 amino acid types. The differences between these strains were found in 1 to 60 nucleotides and 1 to 17 amino acids. On the basis of the identities and similarities of nucleotide and amino acid sequences, some strains were reidentified: i.e., two strains of E. jeanselmei var. hetermorpha and one strain of E. castellanii as E. dermatitidis (including the type strain), three strains of E. jeanselmei as E. jeanselmei var. lecanii-corni (including the type strain), three strains of E. jeanselmei as E. bergeri (including the type strain), seven strains of E. jeanselmei as E. pisciphila (including the type strain), seven strains of E. jeanselmei as E. jeanselmei var. jeanselmei (including the type strain), one strain of E. jeanselmei as Fonsecaea pedrosoi (including the type strain), and one strain of E. jeanselmei as E. spinifera (including the type strain). Some E. jeanselmei strains showed distinct nucleotide and amino acid sequences. The amino-acid-based UPGMA (unweighted pair group method with the arithmetic mean) tree exhibited nearly the same topology as those of the DNA-based trees obtained by neighbor joining, maximum parsimony, and maximum likelihood methods. PMID:11724862

Genome Sequence of the Thermophile Bacillus coagulans Hammer, the Type Strain of the Species

PubMed Central

Su, Fei; Tao, Fei; Tang, Hongzhi

2012-01-01

Here we announce a 3.0-Mb assembly of the Bacillus coagulans Hammer strain, which is the type strain of the species within the genus Bacillus. Genomic analyses based on the sequence may provide insights into the phylogeny of the species and help to elucidate characteristics of the poorly studied strains of Bacillus coagulans. PMID:23105047

Genome sequence of the thermophile Bacillus coagulans Hammer, the type strain of the species.

PubMed

Su, Fei; Tao, Fei; Tang, Hongzhi; Xu, Ping

2012-11-01

Here we announce a 3.0-Mb assembly of the Bacillus coagulans Hammer strain, which is the type strain of the species within the genus Bacillus. Genomic analyses based on the sequence may provide insights into the phylogeny of the species and help to elucidate characteristics of the poorly studied strains of Bacillus coagulans.

Genome Sequence of Herbaspirillum sp. Strain GW103, a Plant Growth-Promoting Bacterium

PubMed Central

Lee, Gun Woong; Lee, Kui-Jae

2012-01-01

Herbaspirillum sp. strain GW103 was isolated from rhizosphere soil of the reed Phragmites australis on reclaimed land. Here we report the 5.05-Mb draft genome sequence of the strain, providing bioinformation about the agronomic benefits of this strain, such as multiple traits relevant to plant root colonization and plant growth promotion. PMID:22815460

Draft Genome Sequences of Two Mycobacterium bovis Strains Isolated from Beef Cattle in Paraguay

PubMed Central

Sanabria, Lidia; Lagrave, Lorena; Nishibe, Christiane; Ribas, Augusto C. A.; Zumárraga, Martín J.; Araújo, Flábio R.

2017-01-01

ABSTRACT This work reports the draft genome sequences of the Mycobacterium bovis strains M1009 and M1010, isolated from the lymph nodes of two infected cows on a beef farm in Paraguay. Comparative genomics between these strains and other regional strains may provide more insights regarding M. bovis epidemiology in South America. PMID:28705977

Molecular characterization of the probiotic strain Bacillus cereus var. toyoi NCIMB 40112 and differentiation from food poisoning strains.

PubMed

Klein, Günter

2011-07-01

Bacillus cereus var. toyoi strain NCIMB 40112 (Toyocerin), a probiotic authorized in the European Union as feed additive for swine, bovines, poultry, and rabbits, was characterized by DNA fingerprinting applying pulsed-field gel electrophoresis and multilocus sequence typing and was compared with reference strains (of clinical and environmental origins). The probiotic strain was clearly characterized by pulsed-field gel electrophoresis using the restriction enzymes Apa I and Sma I resulting in unique DNA patterns. The comparison to the clinical reference strain B. cereus DSM 4312 was done with the same restriction enzymes, and again a clear differentiation of the two strains was possible by the resulting DNA patterns. The use of the restriction enzymes Apa I and Sma I is recommended for further studies. Furthermore, multilocus sequence typing analysis revealed a sequence type (ST 111) that was different from all known STs of B. cereus strains from food poisoning incidents. Thus, a strain characterization and differentiation from food poisoning strains for the probiotic strain was possible. Copyright ©, International Association for Food Protection

Experimental investigation of strain errors in stereo-digital image correlation due to camera calibration

NASA Astrophysics Data System (ADS)

Shao, Xinxing; Zhu, Feipeng; Su, Zhilong; Dai, Xiangjun; Chen, Zhenning; He, Xiaoyuan

2018-03-01

The strain errors in stereo-digital image correlation (DIC) due to camera calibration were investigated using precisely controlled numerical experiments and real experiments. Three-dimensional rigid body motion tests were conducted to examine the effects of camera calibration on the measured results. For a fully accurate calibration, rigid body motion causes negligible strain errors. However, for inaccurately calibrated camera parameters and a short working distance, rigid body motion will lead to more than 50-μɛ strain errors, which significantly affects the measurement. In practical measurements, it is impossible to obtain a fully accurate calibration; therefore, considerable attention should be focused on attempting to avoid these types of errors, especially for high-accuracy strain measurements. It is necessary to avoid large rigid body motions in both two-dimensional DIC and stereo-DIC.

Phylogeny of the ammonia-producing ruminal bacteria Peptostreptococcus anaerobius, Clostridium sticklandii, and Clostridium aminophilum sp. nov

NASA Technical Reports Server (NTRS)

Paster, B. J.; Russell, J. B.; Yang, C. M.; Chow, J. M.; Woese, C. R.; Tanner, R.

1993-01-01

In previous studies, gram-positive bacteria which grew rapidly with peptides or an amino acid as the sole energy source were isolated from bovine rumina. Three isolates, strains C, FT (T = type strain), and SR, were considered to be ecologically important since they produced up to 20-fold more ammonia than other ammonia-producing ruminal bacteria. On the basis of phenotypic criteria, the taxonomic position of these new isolates was uncertain. In this study, the 16S rRNA sequences of these isolates and related bacteria were determined to establish the phylogenetic positions of the organisms. The sequences of strains C, FT, and SR and reference strains of Peptostreptococcus anaerobius, Clostridium sticklandii, Clostridium coccoides, Clostridium aminovalericum, Acetomaculum ruminis, Clostridium leptum, Clostridium lituseburense, Clostridium acidiurici, and Clostridium barkeri were determined by using a modified Sanger dideoxy chain termination method. Strain C, a large coccus purported to belong to the genus Peptostreptococcus, was closely related to P. anaerobius, with a level of sequence similarity of 99.6%. Strain SR, a heat-resistant, short, rod-shaped organism, was closely related to C. sticklandii, with a level of sequence similarity of 99.9%. However, strain FT, a heat-resistant, pleomorphic, rod-shaped organism, was only distantly related to some clostridial species and P. anaerobius. On the basis of the sequence data, it was clear that strain FT warranted designation as a separate species. The closest known relative of strain FT was C. coccoides (level of similarity, only 90.6%). Additional strains that are phenotypically similar to strain FT were isolated in this study.(ABSTRACT TRUNCATED AT 250 WORDS).

Genome Sequence of Stachybotrys chartarum Strain 51-11

PubMed Central

Kim, Jean; Levy, Josh

2015-01-01

The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful. PMID:26430036

Genetic Analysis of Vibrio parahaemolyticus O3:K6 Strains That Have Been Isolated in Mexico Since 1998

PubMed Central

Licea-Navarro, Alexei Fedorovish; Revilla-Castellanos, Valeria Jeanette; Wong-Chang, Irma; González-Sánchez, Ricardo

2017-01-01

Vibrio parahaemolyticus is an important human pathogen that has been isolated worldwide from clinical cases, most of which have been associated with seafood consumption. Environmental and clinical toxigenic strains of V. parahaemolyticus that were isolated in Mexico from 1998 to 2012, including those from the only outbreak that has been reported in this country, were characterized genetically to assess the presence of the O3:K6 pandemic clone, and their genetic relationship to strains that are related to the pandemic clonal complex (CC3). Pathogenic tdh+ and tdh+/trh+ strains were analyzed by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Also, the entire genome of a Mexican O3:K6 strain was sequenced. Most of the strains were tdh/ORF8-positive and corresponded to the O3:K6 serotype. By PFGE and MLST, there was very close genetic relationship between ORF8/O3:K6 strains, and very high genetic diversities from non-pandemic strains. The genetic relationship is very close among O3:K6 strains that were isolated in Mexico and sequences that were available for strains in the CC3, based on the PubMLST database. The whole-genome sequence of CICESE-170 strain had high similarity with that of the reference RIMD 2210633 strain, and harbored 7 pathogenicity islands, including the 4 that denote O3:K6 pandemic strains. These results indicate that pandemic strains that have been isolated in Mexico show very close genetic relationship among them and with those isolated worldwide. PMID:28099500

Molecular and Biochemical Analysis of the Galactose Phenotype of Dairy Streptococcus thermophilus Strains Reveals Four Different Fermentation Profiles

PubMed Central

de Vin, Filip; Rådström, Peter; Herman, Lieve; De Vuyst, Luc

2005-01-01

Lactose-limited fermentations of 49 dairy Streptococcus thermophilus strains revealed four distinct fermentation profiles with respect to galactose consumption after lactose depletion. All the strains excreted galactose into the medium during growth on lactose, except for strain IMDOST40, which also displayed extremely high galactokinase (GalK) activity. Among this strain collection eight galactose-positive phenotypes sensu stricto were found and their fermentation characteristics and Leloir enzyme activities were measured. As the gal promoter seems to play an important role in the galactose phenotype, the galR-galK intergenic region was sequenced for all strains yielding eight different nucleotide sequences (NS1 to NS8). The gal promoter played an important role in the Gal-positive phenotype but did not determine it exclusively. Although GalT and GalE activities were detected for all Gal-positive strains, GalK activity could only be detected for two out of eight Gal-positive strains. This finding suggests that the other six S. thermophilus strains metabolize galactose via an alternative route. For each type of fermentation profile obtained, a representative strain was chosen and four complete Leloir gene clusters were sequenced. It turned out that Gal-positive strains contained more amino acid differences within their gal genes than Gal-negative strains. Finally, the biodiversity regarding lactose-galactose utilization among the different S. thermophilus strains used in this study was shown by RAPD-PCR. Five Gal-positive strains that contain nucleotide sequence NS2 in their galR-galK intergenic region were closely related. PMID:16000774

Complete Genomic Sequence of “Thermofilum adornatus” Strain 1910bT, a Hyperthermophilic Anaerobic Organotrophic Crenarchaeon

PubMed Central

Dominova, I. N.; Kublanov, I. V.; Podosokorskaya, O. A.; Derbikova, K. S.; Patrushev, M. V.

2013-01-01

The complete genomic sequence of a novel hyperthermophilic crenarchaeon, strain 1910bT, was determined. The genome comprises a 1,750,259-bp circular chromosome containing single copies of 3 rRNA genes, 43 tRNA genes, and 1,896 protein-coding sequences. In silico genome-genome hybridization suggests the proposal of a novel species, “Thermofilum adornatus” strain 1910bT. PMID:24029764

Deep Sequencing-Identified Kanamycin-Resistant Paenibacillus sp. Strain KS1 Isolated from Epiphyte Tillandsia usneoides (Spanish Moss) in Central Florida, USA

PubMed Central

Govindarajan, Subramaniam S.; Qi, Feng; Li, Jian-Liang; Sahoo, Malaya K.

2017-01-01

ABSTRACT Paenibacillus sp. strain KS1 was isolated from an epiphyte, Tillandsia usneoides (Spanish moss), in central Florida, USA. Here, we report a draft genome sequence of this strain, which consists of a total of 398 contigs spanning 6,508,195 bp, with a G+C content of 46.5% and comprising 5,401 predicted coding sequences. PMID:28153888

Genome sequencing and annotation of Serratia sp. strain TEL.

PubMed

Lephoto, Tiisetso E; Gray, Vincent M

2015-12-01

We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

Complete Genome Sequencing of a Multidrug-Resistant and Human-Invasive Salmonella enterica Serovar Typhimurium Strain of the Emerging Sequence Type 213 Genotype

PubMed Central

Calva, Edmundo; Zaidi, Mussaret B.; Sanchez-Flores, Alejandro; Estrada, Karel; Silva, Genivaldo G. Z.; Soto-Jiménez, Luz M.; Wiesner, Magdalena; Fernández-Mora, Marcos; Edwards, Robert A.

2015-01-01

Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 was isolated in 2005 in the state of Yucatán, Mexico, from a human systemic infection. The YU39 strain is representative of the multidrug-resistant emergent sequence type 213 (ST213) genotype. The YU39 complete genome is composed of a chromosome and seven plasmids. PMID:26089426

Complete Genome Sequence of the Electricity-Producing “Thermincola potens” Strain JR▿

PubMed Central

Byrne-Bailey, Kathryne G.; Wrighton, Kelly C.; Melnyk, Ryan A.; Agbo, Peter; Hazen, Terry C.; Coates, John D.

2010-01-01

“Thermincola potens” strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR. PMID:20525829

Whole-Genome Sequencing of Lactobacillus salivarius Strains BCRC 14759 and BCRC 12574.

PubMed

Chiu, Shih-Hau; Chen, Chien-Chi; Wang, Li-Ting; Huang, Lina

2017-11-22

Lactobacillus salivarius BCRC 14759 has been identified as a high-exopolysaccharide-producing strain with potential as a probiotic or fermented dairy product. Here, we report the genome sequences of L. salivarius BCRC 14759 and the comparable strain BCRC 12574, isolated from human saliva. The PacBio RSII sequencing platform was used to obtain high-quality assemblies for characterization of this probiotic candidate. Copyright © 2017 Chiu et al.

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

NASA Astrophysics Data System (ADS)

Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

Complete Genome Sequence of Streptococcus pneumoniae Strain A026, a Clinical Multidrug-Resistant Isolate Carrying Tn2010

PubMed Central

Sui, Zhihai; Zhou, Wenqing; Yao, Kaihu; Liu, Li; Zhang, Gang; Yang, Yonghong

2013-01-01

Streptococcus pneumoniae is a primary cause of bacterial infection in humans. Here, we present the complete genome sequence of S. pneumoniae strain A026, which is a multidrug-resistant strain isolated from cerebrospinal fluid. PMID:24336372

Genome Sequence of Lactobacillus sakei subsp. sakei LS25, a Commercial Starter Culture Strain for Fermented Sausage.

PubMed

McLeod, Anette; Brede, Dag Anders; Rud, Ida; Axelsson, Lars

2013-07-11

Lactobacillus sakei is a lactic acid bacterium associated primarily with fermented meat and fish. Here, we present the draft genome sequence of L. sakei subsp. sakei strain LS25, a commercial starter culture strain for fermented sausage.

Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

PubMed

Boehm; Gibson; Lubzens

2000-01-01

This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

First report of the epiphytic benthic dinoflagellates Coolia canariensis and Coolia malayensis in the waters off Jeju Island, Korea: morphology and rDNA sequences.

PubMed

Jeong, Hae Jin; Yih, Wonho; Kang, Nam Seon; Lee, Sung Yeon; Yoon, Eun Young; Yoo, Yeong Du; Kim, Hyung Seop; Kim, Jong Hyeok

2012-01-01

Coolia spp. are epiphytic and benthic dinoflagellates. Herein, we report for the first time, the occurrence of Coolia canariensis and Coolia malayensis in Korean waters. The morphology of the Korean strains of C. canariensis and C. malayensis isolated from the waters off Jeju Island, Korea was similar to that of the original Canary lslands strains and Malaysian strains, respectively. We found several pores and a line of small knobs on the pore plate, and perforations within the large pores of both C. canariensis and C. malayensis. The plates of the Korean strains of C. canariensis and C. malayensis were arranged in a Kofoidian series of Po, 3', 7'', 6c, 6s, 5''', and 2'''', and Po, 3', 7'', 7c, 6-7s, 5''', and 2'''', respectively. When properly aligned, the large subunit (LSU) rDNA sequence of the Korean strain of C. canariensis was identical to that of the Biscayan strains, but it was 2-3% different from the Canary lslands strain VGO0775 and the Australian strain. In addition, the sequences of small subunit (SSU) and/or LSU rDNA from the two Korean strains of C. malayensis were < 1% different from the Malaysian strains of C. malayensis and the Florida strain CCMP1345 and New Zealand strain CAWD39 ("Coolia monotis"). In phylogenetic trees based on LSU rDNA sequences, the Korean strains of C. malayensis belonged to a clade including the Malaysian strains and these two strains. Therefore, based on genealogical analyses, we suggest that the Korean strain of C. canariensis is closely related to two Atlantic strains and the Australian strain, whereas the Korean strains of C. malayensis are related to the Malaysian strains of C. malayensis and the Florida and New Zealand strains. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

The Presence of Phage Orthologous Genes in Helicobacter pylori Correlates with the Presence of the Virulence Factors CagA and VacA.

PubMed

Kyrillos, Alexandra; Arora, Gaurav; Murray, Bradley; Rosenwald, Anne G

2016-06-01

The bacterium Helicobacter pylori is associated with ulcers and the development of gastric cancer. Several genes, including cytotoxin-associated gene A (CagA) and vacuolating cytotoxin A (VacA), are associated with increased gastric cancer risk. Some strains of H. pylori also contain sequences related to bacteriophage phiHP33; however, the significance of these phage-related sequences remains unknown. We assessed the extent to which phiHP33-related sequences are present in 335 H. pylori strains using homology searches then mapped shared genes between phiHP33 and H. pylori strains onto an existing phylogeny. One hundred and twenty-one H. pylori strains contain phage orthologous sequences, and the presence of the phage-related sequences correlates with the presence of CagA and VacA. Mapping of the phage orthologs onto a phylogeny of H. pylori is consistent with the hypothesis that these genes were acquired by horizontal gene transfer. phiHP33 phage orthologous sequences might be of significance in understanding virulence of different H. pylori strains. © 2015 John Wiley & Sons Ltd.

Evolution and genome specialization of Brucella suis biovar 2 Iberian lineages.

PubMed

Ferreira, Ana Cristina; Tenreiro, Rogério; de Sá, Maria Inácia Corrêa; Dias, Ricardo

2017-09-12

Swine brucellosis caused by B. suis biovar 2 is an emergent disease in domestic pigs in Europe. The emergence of this pathogen has been linked to the increase of extensive pig farms and the high density of infected wild boars (Sus scrofa). In Portugal and Spain, the majority of strains share specific molecular characteristics, which allowed establishing an Iberian clonal lineage. However, several strains isolated from wild boars in the North-East region of Spain are similar to strains isolated in different Central European countries. Comparative analysis of five newly fully sequenced B. suis biovar 2 strains belonging to the main circulating clones in Iberian Peninsula, with publicly available Brucella spp. genomes, revealed that strains from Iberian clonal lineage share 74% similarity with those reference genomes. Besides the 210 kb translocation event present in all biovar 2 strains, an inversion with 944 kb was presented in chromosome I of strains from the Iberian clone. At left and right crossover points, the inversion disrupted a TRAP dicarboxylate transporter, DctM subunit, and an integral membrane protein TerC. The gene dctM is well conserved in Brucella spp. except in strains from the Iberian clonal lineage. Intraspecies comparative analysis also exposed a number of biovar-, haplotype- and strain-specific insertion-deletion (INDELs) events and single nucleotide polymorphisms (SNPs) that could explain differences in virulence and host specificities. Most discriminative mutations were associated to membrane related molecules (29%) and enzymes involved in catabolism processes (20%). Molecular identification of both B. suis biovar 2 clonal lineages could be easily achieved using the target-PCR procedures established in this work for the evaluated INDELs. Whole-genome analyses supports that the B. suis biovar 2 Iberian clonal lineage evolved from the Central-European lineage and suggests that the genomic specialization of this pathogen in the Iberian Peninsula is independent of a specific genomic event(s), but instead driven by allopatric speciation, resulting in the establishment of a new ecovar.

Influence of Cyclic Straining on Fatigue, Deformation, and Fracture Behavior of High-Strength Alloy Steel

NASA Astrophysics Data System (ADS)

Manigandan, K.; Srivatsan, T. S.; Vasudevan, V. K.; Tammana, D.; Poorganji, B.

2016-01-01

In this paper, the results of a study on microstructural influences on mechanical behavior of the high-strength alloy steel Tenax™ 310 are presented and discussed. Under the influence of fully reversed strain cycling, the stress response of this alloy steel revealed softening from the onset of deformation. Cyclic strain resistance exhibited a linear trend for the variation of both elastic strain amplitude with reversals-to-failure, and plastic strain amplitude with reversals-to-failure. Fracture morphology was essentially the same at the macroscopic level over the entire range of cyclic strain amplitudes examined. However, at the fine microscopic level, this high-strength alloy steel revealed fracture to be mixed-mode with features reminiscent of "locally" ductile and brittle mechanisms. The macroscopic mechanisms governing stress response at the fine microscopic level, resultant fatigue life, and final fracture behavior are presented and discussed in light of the mutually interactive influences of intrinsic microstructural effects, deformation characteristics of the microstructural constituents during fully reversed strain cycling, cyclic strain amplitude, and resultant response stress.

Cross-reactive and strain-specific antipeptide antibodies to Pseudomonas aeruginosa PAK and PAO pili.

PubMed Central

Lee, K K; Paranchych, W; Hodges, R S

1990-01-01

Antipeptide antibodies were raised against synthetic peptides corresponding to the amino acid sequences of eight surface predicted regions of the pilin proteins from Pseudomonas aeruginosa PAK and PAO. Four of the anti-PAK peptide antisera cross-reacted with strain PAO pili, while five anti-PAO peptide antisera cross-reacted with strain PAK pili. Only one region of the two pilin proteins (region 88-97) provided strain-specific antibodies when either strain PAK or strain PAO region 88-97 peptides were used to generate antipeptide antibodies. Our results clearly showed that cross-reactive and strain-specific antibodies cannot be based solely on the degree of homology in the aligned protein sequences. The majority of synthetic peptides bound to their homologous antipilus antiserum, suggesting that linear sequences play a significant role in the immunogenic response of native pili. PMID:1974884

Complete Genome Sequence of a Novel Newcastle Disease Virus Strain Isolated from a Chicken in West Africa

PubMed Central

Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.

2012-01-01

The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417

Draft Genome Sequences of Three European Laboratory Derivatives from Enterohemorrhagic Escherichia coli O157:H7 Strain EDL933, Including Two Plasmids

PubMed Central

Fellner, Lea; Huptas, Christopher; Simon, Svenja; Mühlig, Anna; Neuhaus, Klaus

2016-01-01

Escherichia coli O157:H7 EDL933, isolated in 1982 in the United States, was the first enterohemorrhagic E. coli (EHEC) strain sequenced. Unfortunately, European labs can no longer receive the original strain. We checked three European EDL933 derivatives and found major genetic deviations (deletions, inversions) in two strains. All EDL933 strains contain the cryptic EHEC-plasmid, not reported before. PMID:27056239

Determination and analysis of the complete genome sequence of Paralichthys olivaceus rhabdovirus (PORV).

PubMed

Zhu, Ruo-Lin; Zhang, Qi-Ya

2014-04-01

Paralichthys olivaceus rhabdovirus (PORV), which is associated with high mortality rates in flounder, was isolated in China in 2005. Here, we provide an annotated sequence record of PORV, the genome of which comprises 11,182 nucleotides and contains six genes in the order 3'-N-P-M-G-NV-L-5'. Phylogenetic analysis based on glycoprotein sequences of PORV and other rhabdoviruses showed that PORV clusters with viral haemorrhagic septicemia virus (VHSV), genus Novirhabdovirus, family Rhabdoviridae. Further phylogenetic analysis of the combined amino acid sequences of six proteins of PORV and VHSV strains showed that PORV clusters with Korean strains and is closely related to Asian strains, all of which were isolated from flounder. In a comparison in which the sequences of the six proteins were combined, PORV shared the highest identity (98.3 %) with VHSV strain KJ2008 from Korea.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

PubMed

Strouhal, Michal; Mikalová, Lenka; Havlíčková, Pavla; Tenti, Paolo; Čejková, Darina; Rychlík, Ivan; Bruisten, Sylvia; Šmajs, David

2017-09-01

Treponema pallidum subsp. pertenue (TPE) is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier) and one TPE strain (Fribourg-Blanc) isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA) strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet. Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively). Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation. The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

A wide extent of inter-strain diversity in virulent and vaccine strains of alphaherpesviruses.

PubMed

Szpara, Moriah L; Tafuri, Yolanda R; Parsons, Lance; Shamim, S Rafi; Verstrepen, Kevin J; Legendre, Matthieu; Enquist, L W

2011-10-01

Alphaherpesviruses are widespread in the human population, and include herpes simplex virus 1 (HSV-1) and 2, and varicella zoster virus (VZV). These viral pathogens cause epithelial lesions, and then infect the nervous system to cause lifelong latency, reactivation, and spread. A related veterinary herpesvirus, pseudorabies (PRV), causes similar disease in livestock that result in significant economic losses. Vaccines developed for VZV and PRV serve as useful models for the development of an HSV-1 vaccine. We present full genome sequence comparisons of the PRV vaccine strain Bartha, and two virulent PRV isolates, Kaplan and Becker. These genome sequences were determined by high-throughput sequencing and assembly, and present new insights into the attenuation of a mammalian alphaherpesvirus vaccine strain. We find many previously unknown coding differences between PRV Bartha and the virulent strains, including changes to the fusion proteins gH and gB, and over forty other viral proteins. Inter-strain variation in PRV protein sequences is much closer to levels previously observed for HSV-1 than for the highly stable VZV proteome. Almost 20% of the PRV genome contains tandem short sequence repeats (SSRs), a class of nucleic acids motifs whose length-variation has been associated with changes in DNA binding site efficiency, transcriptional regulation, and protein interactions. We find SSRs throughout the herpesvirus family, and provide the first global characterization of SSRs in viruses, both within and between strains. We find SSR length variation between different isolates of PRV and HSV-1, which may provide a new mechanism for phenotypic variation between strains. Finally, we detected a small number of polymorphic bases within each plaque-purified PRV strain, and we characterize the effect of passage and plaque-purification on these polymorphisms. These data add to growing evidence that even plaque-purified stocks of stable DNA viruses exhibit limited sequence heterogeneity, which likely seeds future strain evolution.

Complete Sequence of the Intronless Mitochondrial Genome of the Saccharomyces cerevisiae Strain CW252

PubMed Central

2018-01-01

ABSTRACT The mitochondrial genomes of Saccharomyces cerevisiae strains contain up to 13 introns. An intronless recombinant genome introduced into the nuclear background of S. cerevisiae strain W303 gave the S. cerevisiae CW252 strain, which is used to model mitochondrial respiratory pathologies. The complete sequence of this mitochondrial genome was obtained using a hybrid assembling methodology. PMID:29700138

Complete Genome Sequences of Two Helicobacter pylori Strains from a Canadian Arctic Aboriginal Community

PubMed Central

Kersulyte, Dangeruta; Bertoli, M. Teresita; Tamma, Sravya; Keelan, Monika; Munday, Rachel; Geary, Janis; Veldhuyzen van Zanten, Sander; Goodman, Karen J.

2015-01-01

We report here the complete genome sequences of two Amerind Helicobacter pylori strains from Aklavik, Northwest Territories, Canada. One strain contains extra iron-cofactored urease genes and ~140 rearrangements in its chromosome relative to other described strains (typically differing from one another by <10 rearrangements), suggesting that it represents a novel lineage of H. pylori. PMID:25883278

Proposal of Vespertiliibacter pulmonis gen. nov., sp. nov. and two genomospecies as new members of the family Pasteurellaceae isolated from European bats.

PubMed

Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun

2014-07-01

Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.

Draft Genome Sequence of Bifidobacterium animalis subsp. lactis Strain CECT 8145, Able To Improve Metabolic Syndrome In Vivo.

PubMed

Chenoll, E; Codoñer, F M; Silva, A; Martinez-Blanch, J F; Martorell, P; Ramón, D; Genovés, S

2014-03-27

Bifidobacterium animalis subsp. lactis strain CECT 8145 is able to reduce body fat content and improve metabolic syndrome biomarkers. Here, we report the draft genome sequence of this strain, which may provide insights into its safety status and functional role.

Genome Sequence of Sphingomonas sp. Strain PAMC 26605, Isolated from Arctic Lichen (Ochrolechia sp.)

PubMed Central

Shin, Seung Chul; Ahn, Do Hwan; Lee, Jong Kyu; Kim, Su Jin; Hong, Soon Gyu; Kim, Eun Hye

2012-01-01

The endosymbiotic bacterium Sphingomonas sp. strain PAMC 26605 was isolated from Arctic lichens (Ochrolechia sp.) on the Svalbard Islands. Here we report the draft genome sequence of this strain, which could provide further insights into the symbiotic mechanism of lichens in extreme environments. PMID:22374946

Draft Genome Sequence of Enterococcus faecium Strain J19, Isolated from Cabbage

PubMed Central

2018-01-01

ABSTRACT Herein, we report the draft genome sequence of a newly discovered probiotic strain, Enterococcus faecium J19, which was isolated from cabbage. Strain J19 has shown antagonistic effects against the human foodborne pathogen Listeria monocytogenes in coculture and in different food matrices. PMID:29622613

Phylogeny of Neoparamoeba strains isolated from marine fish and invertebrates as inferred from SSU rDNA sequences.

PubMed

Dyková, Iva; Nowak, Barbara; Pecková, Hana; Fiala, Ivan; Crosbie, Philip; Dvoráková, Helena

2007-02-08

We characterised 9 strains selected from primary isolates referable to Paramoeba/Neoparamoeba spp. Based on ultrastructural study, 5 strains isolated from fish (amoebic gill disease [AGD]-affected Atlantic salmon and dead southern bluefin tuna), 1 strain from netting of a floating sea cage and 3 strains isolated from invertebrates (sea urchins and crab) were assigned to the genus Neoparamoeba Page, 1987. Phylogenetic analyses based on SSU rDNA sequences revealed affiliations of newly introduced and previously analysed Neoparamoeba strains. Three strains from the invertebrates and 2 out of 3 strains from gills of southern bluefin tunas were members of the N. branchiphila clade, while the remaining, fish-isolated strains, as well as the fish cage strain, clustered within the clade of N. pemaquidensis. These findings and previous reports point to the possibility that N. pemaquidensis and N. branchiphila can affect both fish and invertebrates. A new potential fish host, southern bluefin tuna, was included in the list of farmed fish endangered by N. branchiphila. The sequence of P. eilhardi (Culture Collection of Algae and Protozoa [CCAP] strain 1560/2) appeared in all analyses among sequences of strain representatives of Neoparamoeba species, in a position well supported by bootstrap value, Bremer index and Bayesian posterior probability. Our research shows that isolation of additional strains from invertebrates and further analyses of relations between molecular data and morphological characters of the genera Paramoeba and Neoparamoeba are required. This complexity needs to be considered when attempting to define molecular markers for identification of Paramoeba/Neoparamoeba species in tissues of fish and invertebrates.

Identification of three extra-chromosomal replicons in Leptospira pathogenic strain and development of new shuttle vectors.

PubMed

Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong

2015-02-15

The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.

Characterization of Novel Simian Immunodeficiency Viruses from Red-Capped Mangabeys from Nigeria (SIVrcmNG409 and -NG411)

PubMed Central

Beer, Brigitte E.; Foley, Brian T.; Kuiken, Carla L.; Tooze, Zena; Goeken, Robert M.; Brown, Charles R.; Hu, Jinjie; Claire, Marisa St.; Korber, Bette T.; Hirsch, Vanessa M.

2001-01-01

Two novel simian immunodeficiency virus (SIV) strains from wild-caught red-capped mangabeys (Cercocebus torquatus torquatus) from Nigeria were characterized. Sequence analysis of the fully sequenced SIV strain rcmNG411 (SIVrcmNG411) and gag and pol sequence of SIVrcmNG409 revealed that they were genetically most closely related to the recently characterized SIVrcm from Gabon (SIVrcmGB1). Thus, red-capped mangabeys from distant geographic locations harbor a common lineage of SIV. SIVrcmNG411 carried a vpx gene in addition to vpr, suggesting a common evolutionary ancestor with SIVsm (from sooty mangabeys). However, SIVrcm was only marginally closer to SIVsm in that region than to any of the other lentiviruses. SIVrcm showed the highest similarity in pol with SIVdrl, isolated from a drill, a primate that is phylogenetically distinct from mangabey monkeys, and clustered with other primate lentiviruses (primarily SIVcpz [from chimpanzees] and SIVagmSab [from African green monkeys]) discordantly in different regions of the genome, suggesting a history of recombination. Despite the genetic relationship to SIVcpz in the pol gene, SIVrcmNG411 did not replicate in chimpanzee peripheral blood mononuclear cells (PBMC), although two other viruses unrelated to SIVcpz, SIVmndGB1 (from mandrills) and SIVlhoest (from L'Hoest monkeys), were able to grow in chimpanzee PBMC. The CCR5 24-bp deletion previously described in red-capped mangabeys from Gabon was also observed in Nigerian red-capped mangabeys, and SIVrcmNG411, like SIVrcmGB1, used CCR2B and STRL33 as coreceptors for virus entry. SIVrcm, SIVsm, SIVmndGB1, and all four SIVlhoest isolates but not SIVsun (from sun-tailed monkeys) replicated efficiently in human PBMC, suggesting that the ability to infect the human host can vary within one lineage. PMID:11711592

Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

PubMed Central

Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

2003-01-01

A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality. PMID:12514026

Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

PubMed

Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

2003-01-01

A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

PubMed Central

Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman

2016-01-01

Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271

Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

2012-10-01

To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

PubMed Central

Pooler, M R; Ritchie, D F; Hartung, J S

1996-01-01

Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

Comparative analysis of the integument transcriptomes of the black dilute mutant and the wild-type silkworm Bombyx mori

PubMed Central

Wu, Songyuan; Tong, Xiaoling; Peng, Chenxing; Xiong, Gao; Lu, Kunpeng; hu, Hai; Tan, Duan; Li, Chunlin; Han, Minjin; Lu, Cheng; Dai, Fangyin

2016-01-01

The insect cuticle is a critical protective shell that is composed predominantly of chitin and various cuticular proteins and pigments. Indeed, insects often change their surface pigment patterns in response to selective pressures, such as threats from predators, sexual selection and environmental changes. However, the molecular mechanisms underlying the construction of the epidermis and its pigmentation patterns are not fully understood. Among Lepidoptera, the silkworm is a favorable model for color pattern research. The black dilute (bd) mutant of silkworm is the result of a spontaneous mutation; the larval body color is notably melanized. We performed integument transcriptome sequencing of the wild-type strain Dazao and the mutant strains +/bd and bd/bd. In these experiments, during an early stage of the fourth molt, a stage at which approximately 51% of genes were expressed genome wide (RPKM ≥1) in each strain. A total of 254 novel transcripts were characterized using Cuffcompare and BLAST analyses. Comparison of the transcriptome data revealed 28 differentially expressed genes (DEGs) that may contribute to bd larval melanism, including 15 cuticular protein genes that were remarkably highly expressed in the bd/bd mutant. We suggest that these significantly up-regulated cuticular proteins may promote melanism in silkworm larvae. PMID:27193628

Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent Klebsiella pneumoniae of capsular serotype K2 and ST374.

PubMed

Wang, Xiaoli; Xie, Yingzhou; Li, Gang; Liu, Jialin; Li, Xiaobin; Tian, Lijun; Sun, Jingyong; Ou, Hong-Yu; Qu, Hongping

2018-01-01

Hypervirulent K. pneumoniae variants (hvKP) have been increasingly reported worldwide, causing metastasis of severe infections such as liver abscesses and bacteremia. The capsular serotype K2 hvKP strains show diverse multi-locus sequence types (MLSTs), but with limited genetics and virulence information. In this study, we report a hypermucoviscous K. pneumoniae strain, RJF293, isolated from a human bloodstream sample in a Chinese hospital. It caused a metastatic infection and fatal septic shock in a critical patient. The microbiological features and genetic background were investigated with multiple approaches. The Strain RJF293 was determined to be multilocis sequence type (ST) 374 and serotype K2, displayed a median lethal dose (LD50) of 1.5 × 10 2 CFU in BALB/c mice and was as virulent as the ST23 K1 serotype hvKP strain NTUH-K2044 in a mouse lethality assay. Whole genome sequencing revealed that the RJF293 genome codes for 32 putative virulence factors and exhibits a unique presence/absence pattern in comparison to the other 105 completely sequenced K. pneumoniae genomes. Whole genome SNP-based phylogenetic analysis revealed that strain RJF293 formed a single clade, distant from those containing either ST66 or ST86 hvKP. Compared to the other sequenced hvKP chromosomes, RJF293 contains several strain-variable regions, including one prophage, one ICEKp1 family integrative and conjugative element and six large genomic islands. The sequencing of the first complete genome of an ST374 K2 hvKP clinical strain should reinforce our understanding of the epidemiology and virulence mechanisms of this bloodstream infection-causing hvKP with clinical significance.

Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent Klebsiella pneumoniae of capsular serotype K2 and ST374

PubMed Central

Wang, Xiaoli; Xie, Yingzhou; Li, Gang; Liu, Jialin; Li, Xiaobin; Tian, Lijun; Sun, Jingyong; Qu, Hongping

2018-01-01

ABSTRACT Hypervirulent K. pneumoniae variants (hvKP) have been increasingly reported worldwide, causing metastasis of severe infections such as liver abscesses and bacteremia. The capsular serotype K2 hvKP strains show diverse multi-locus sequence types (MLSTs), but with limited genetics and virulence information. In this study, we report a hypermucoviscous K. pneumoniae strain, RJF293, isolated from a human bloodstream sample in a Chinese hospital. It caused a metastatic infection and fatal septic shock in a critical patient. The microbiological features and genetic background were investigated with multiple approaches. The Strain RJF293 was determined to be multilocis sequence type (ST) 374 and serotype K2, displayed a median lethal dose (LD50) of 1.5 × 102 CFU in BALB/c mice and was as virulent as the ST23 K1 serotype hvKP strain NTUH-K2044 in a mouse lethality assay. Whole genome sequencing revealed that the RJF293 genome codes for 32 putative virulence factors and exhibits a unique presence/absence pattern in comparison to the other 105 completely sequenced K. pneumoniae genomes. Whole genome SNP-based phylogenetic analysis revealed that strain RJF293 formed a single clade, distant from those containing either ST66 or ST86 hvKP. Compared to the other sequenced hvKP chromosomes, RJF293 contains several strain-variable regions, including one prophage, one ICEKp1 family integrative and conjugative element and six large genomic islands. The sequencing of the first complete genome of an ST374 K2 hvKP clinical strain should reinforce our understanding of the epidemiology and virulence mechanisms of this bloodstream infection-causing hvKP with clinical significance. PMID:29338592

Comparative Analysis of the Orphan CRISPR2 Locus in 242 Enterococcus faecalis Strains

PubMed Central

Hullahalli, Karthik; Rodrigues, Marinelle; Schmidt, Brendan D.; Li, Xiang; Bhardwaj, Pooja; Palmer, Kelli L.

2015-01-01

Clustered, Regularly Interspaced Short Palindromic Repeats and their associated Cas proteins (CRISPR-Cas) provide prokaryotes with a mechanism for defense against mobile genetic elements (MGEs). A CRISPR locus is a molecular memory of MGE encounters. It contains an array of short sequences, called spacers, that generally have sequence identity to MGEs. Three different CRISPR loci have been identified among strains of the opportunistic pathogen Enterococcus faecalis. CRISPR1 and CRISPR3 are associated with the cas genes necessary for blocking MGEs, but these loci are present in only a subset of E. faecalis strains. The orphan CRISPR2 lacks cas genes and is ubiquitous in E. faecalis, although its spacer content varies from strain to strain. Because CRISPR2 is a variable locus occurring in all E. faecalis, comparative analysis of CRISPR2 sequences may provide information about the clonality of E. faecalis strains. We examined CRISPR2 sequences from 228 E. faecalis genomes in relationship to subspecies phylogenetic lineages (sequence types; STs) determined by multilocus sequence typing (MLST), and to a genome phylogeny generated for a representative 71 genomes. We found that specific CRISPR2 sequences are associated with specific STs and with specific branches on the genome tree. To explore possible applications of CRISPR2 analysis, we evaluated 14 E. faecalis bloodstream isolates using CRISPR2 analysis and MLST. CRISPR2 analysis identified two groups of clonal strains among the 14 isolates, an assessment that was confirmed by MLST. CRISPR2 analysis was also used to accurately predict the ST of a subset of isolates. We conclude that CRISPR2 analysis, while not a replacement for MLST, is an inexpensive method to assess clonality among E. faecalis isolates, and can be used in conjunction with MLST to identify recombination events occurring between STs. PMID:26398194

Complete genome sequence of duck Tembusu virus, isolated from Muscovy ducks in southern China.

PubMed

Zhu, Wanjun; Chen, Jidang; Wei, Chunya; Wang, Heng; Huang, Zhen; Zhang, Minze; Tang, Fengfeng; Xie, Jiexiong; Liang, Huanbin; Zhang, Guihong; Su, Shuo

2012-12-01

We report here the complete genomic sequence of the duck Tembusu virus (DTMUV) WJ-1 strain, isolated from Muscovy ducks. This is the first complete genome sequence of DTMUV reported in southern China. Compared with the other strains (TA, GH-2, YY5, and ZJ-407) that were previously found in eastern China, WJ-1 bears a few differences in the nucleotide and amino acid sequences. We found that there are 47 mutations of amino acids encoded by the whole open reading frame (ORF) among these five strains. The whole-genome sequence of DTMUV will help in understanding the epidemiology and molecular characteristics of duck Tembusu virus in southern China.

Draft genome sequence of Dethiobacter alkaliphilus strain AHT1T, a gram-positive sulfidogenic polyextremophile

DOE PAGES

Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex; ...

2017-09-21

Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.

Draft genome sequence of Dethiobacter alkaliphilus strain AHT1T, a gram-positive sulfidogenic polyextremophile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex

Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.

Draft Genome Sequence of Bacillus sp. GZT, a 2,4,6-Tribromophenol-Degrading Strain Isolated from the River Sludge of an Electronic Waste-Dismantling Region

PubMed Central

Liang, Zhishu; Li, Guiying; Das, Ranjit

2016-01-01

Here, we report the draft genome sequence of Bacillus sp. strain GZT, a 2,4,6-tribromophenol (TBP)-degrading bacterium previously isolated from an electronic waste-dismantling region. The draft genome sequence is 5.18 Mb and has a G+C content of 35.1%. This is the first genome report of a brominated flame retardant-degrading strain. PMID:27257197

Genome Sequence of Enterococcus mundtii EM01, Isolated from Bombyx mori Midgut and Responsible for Flacherie Disease in Silkworms Reared on an Artificial Diet.

PubMed

de Diego-Diaz, Beatriz; Treu, Laura; Campanaro, Stefano; da Silva Duarte, Vinicius; Saviane, Alessio; Cappellozza, Silvia; Squartini, Andrea

2018-01-18

The whole genome sequence of Enterococcus mundtii strain EM01 is reported here. The isolate proved to be the cause of flacherie in Bombyx mori To date, the genomes of 11 other E. mundtii strains have been sequenced. EM01 is the only strain that displayed active pathological effects on its associated animal species. Copyright © 2018 de Diego-Diaz et al.

Draft Genome Sequences of Two Salmonella enterica Serotype Infantis Strains Isolated from a Captive Western Lowland Gorilla (Gorilla gorilla gorilla) and a Cohabitant Black and White Tegu (Tupinambis merianae) in Brazil

PubMed Central

Paixão, Tatiane A.; Coura, Fernanda M.; Malta, Marcelo C. C.; Tinoco, Herlandes P.; Pessanha, Angela T.; Pereira, Felipe L.; Leal, Carlos A. G.; Heinemann, Marcos B.; Figueiredo, Henrique C. P.

2016-01-01

The draft genome sequences of two Salmonella enterica serotype Infantis isolates are reported here. One of the strains was isolated from a western lowland gorilla (Gorilla gorilla gorilla) with colitis. The second strain was isolated from a reptile that inhabited the same premises. Whole-genome sequencing demonstrated that these isolates were not clonal. PMID:26798099

Deep Sequencing-Identified Kanamycin-Resistant Paenibacillus sp. Strain KS1 Isolated from Epiphyte Tillandsia usneoides (Spanish Moss) in Central Florida, USA.

PubMed

Lata, Pushpa; Govindarajan, Subramaniam S; Qi, Feng; Li, Jian-Liang; Sahoo, Malaya K

2017-02-02

Paenibacillus sp. strain KS1 was isolated from an epiphyte, Tillandsia usneoides (Spanish moss), in central Florida, USA. Here, we report a draft genome sequence of this strain, which consists of a total of 398 contigs spanning 6,508,195 bp, with a G+C content of 46.5% and comprising 5,401 predicted coding sequences. Copyright © 2017 Lata et al.

Complete Genome Sequence of Salmonella enterica Serovar Typhimurium Strain YU15 (Sequence Type 19) Harboring the Salmonella Genomic Island 1 and Virulence Plasmid pSTV

PubMed Central

Calva, Edmundo; Puente, José L.; Zaidi, Mussaret B.

2016-01-01

The complete genome of Salmonella enterica subsp. enterica serovar Typhimurium sequence type 19 (ST19) strain YU15, isolated in Yucatán, Mexico, from a human baby stool culture, was determined using PacBio technology. The chromosome contains five intact prophages and the Salmonella genomic island 1 (SGI1). This strain carries the Salmonella virulence plasmid pSTV. PMID:27081132

Draft Genome Sequence of a Hexachlorocyclohexane-Degrading Bacterium, Sphingobium baderi Strain LL03T

PubMed Central

Kaur, Jasvinder; Verma, Helianthous; Tripathi, Charu; Khurana, J. P.

2013-01-01

Sphingobium baderi strain LL03T was isolated from hexachlorocyclohexane (HCH)-contaminated soil from Spolana, Czech Republic. Strain LL03T is a mutant that is deficient in linB and linC (genes that encode hexachlorocyclohexane haloalkane dehalogenase and dehydrogenase, respectively). The draft genome sequence of LL03T (~4.85 Mb) consists of 92 contigs and 4,914 coding sequences, with a G+C content of 63.5%. PMID:24051322

Draft Genome Sequences of Several Fungal Strains Selected for Exposure to Microgravity at the International Space Station

DOE PAGES

Singh, Nitin K.; Blachowicz, Adriana; Romsdahl, Jillian; ...

2017-04-13

Presented here are the whole-genome sequences of eight fungal strains that were selected for exposure to microgravity at the International Space Station. These baseline sequences will help to understand the observed production of novel bioactive compounds.

Draft Genome Sequences of Several Fungal Strains Selected for Exposure to Microgravity at the International Space Station

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Nitin K.; Blachowicz, Adriana; Romsdahl, Jillian

Presented here are the whole-genome sequences of eight fungal strains that were selected for exposure to microgravity at the International Space Station. These baseline sequences will help to understand the observed production of novel bioactive compounds.

Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.

PubMed

Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H

2014-05-01

Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).

Draft genome sequence for virulent and avirulent strains of Xanthomonas arboricola isolated from Prunus spp. in Spain.

PubMed

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

2016-01-01

Xanthomonas arboricola is a species in genus Xanthomonas which is mainly comprised of plant pathogens. Among the members of this taxon, X. arboricola pv. pruni, the causal agent of bacterial spot disease of stone fruits and almond, is distributed worldwide although it is considered a quarantine pathogen in the European Union. Herein, we report the draft genome sequence, the classification, the annotation and the sequence analyses of a virulent strain, IVIA 2626.1, and an avirulent strain, CITA 44, of X. arboricola associated with Prunus spp. The draft genome sequence of IVIA 2626.1 consists of 5,027,671 bp, 4,720 protein coding genes and 50 RNA encoding genes. The draft genome sequence of strain CITA 44 consists of 4,760,482 bp, 4,250 protein coding genes and 56 RNA coding genes. Initial comparative analyses reveals differences in the presence of structural and regulatory components of the type IV pilus, the type III secretion system, the type III effectors as well as variations in the number of the type IV secretion systems. The genome sequence data for these strains will facilitate the development of molecular diagnostics protocols that differentiate virulent and avirulent strains. In addition, comparative genome analysis will provide insights into the plant-pathogen interaction during the bacterial spot disease process.

Sensitive Next-Generation Sequencing Method Reveals Deep Genetic Diversity of HIV-1 in the Democratic Republic of the Congo.

PubMed

Rodgers, Mary A; Wilkinson, Eduan; Vallari, Ana; McArthur, Carole; Sthreshley, Larry; Brennan, Catherine A; Cloherty, Gavin; de Oliveira, Tulio

2017-03-15

As the epidemiological epicenter of the human immunodeficiency virus (HIV) pandemic, the Democratic Republic of the Congo (DRC) is a reservoir of circulating HIV strains exhibiting high levels of diversity and recombination. In this study, we characterized HIV specimens collected in two rural areas of the DRC between 2001 and 2003 to identify rare strains of HIV. The env gp41 region was sequenced and characterized for 172 HIV-positive specimens. The env sequences were predominantly subtype A (43.02%), but 7 other subtypes (33.14%), 20 circulating recombinant forms (CRFs; 11.63%), and 20 unclassified (11.63%) sequences were also found. Of the rare and unclassified subtypes, 18 specimens were selected for next-generation sequencing (NGS) by a modified HIV-switching mechanism at the 5' end of the RNA template (SMART) method to obtain full-genome sequences. NGS produced 14 new complete genomes, which included pure subtype C ( n = 2), D ( n = 1), F1 ( n = 1), H ( n = 3), and J ( n = 1) genomes. The two subtype C genomes and one of the subtype H genomes branched basal to their respective subtype branches but had no evidence of recombination. The remaining 6 genomes were complex recombinants of 2 or more subtypes, including subtypes A1, F, G, H, J, and K and unclassified fragments, including one subtype CRF25 isolate, which branched basal to all CRF25 references. Notably, all recombinant subtype H fragments branched basal to the H clade. Spatial-geographical analysis indicated that the diverse sequences identified here did not expand globally. The full-genome and subgenomic sequences identified in our study population significantly increase the documented diversity of the strains involved in the continually evolving HIV-1 pandemic. IMPORTANCE Very little is known about the ancestral HIV-1 strains that founded the global pandemic, and very few complete genome sequences are available from patients in the Congo Basin, where HIV-1 expanded early in the global pandemic. By sequencing a subgenomic fragment of the HIV-1 envelope from study participants in the DRC, we identified rare variants for complete genome sequencing. The basal branching of some of the complete genome sequences that we recovered suggests that these strains are more closely related to ancestral HIV-1 strains than to previously reported strains and is evidence that the local diversification of HIV in the DRC continues to outpace the diversity of global strains decades after the emergence of the pandemic. Copyright © 2017 Rodgers et al.

Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

PubMed

Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

2016-11-01

To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

Draft Genome sequence of Frankia sp. strains CN3 , an atypical, non-infective (Nod-) ineffective (Fix-) isolate from Coriaria nepalensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghodhbane-Gtari, Faten; Beauchemin, Nicholas; Bruce, David

2013-01-01

We report here the genome sequence of Frankia sp. strain CN3, which was isolated from Coriaria nepalensis. This genome sequence is the first from the fourth lineage of Frankia, that are unable to re-infect actinorhizal plants. At 10 Mb, it represents the largest Frankia genome sequenced to date.

Genome Sequence of Stachybotrys chartarum Strain 51-11.

PubMed

Betancourt, Doris A; Dean, Timothy R; Kim, Jean; Levy, Josh

2015-10-01

The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful. Copyright © 2015 Betancourt et al.

The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

PubMed

Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

2017-04-13

The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

In Silico identification of pathogenic strains of Cronobacter from Biochemical data reveals association of inositol fermentation with pathogenicity.

PubMed

Hamby, Stephen E; Joseph, Susan; Forsythe, Stephen J; Chuzhanova, Nadia

2011-09-20

Cronobacter, formerly known as Enterobacter sakazakii, is a food-borne pathogen known to cause neonatal meningitis, septicaemia and death. Current diagnostic tests for identification of Cronobacter do not differentiate between species, necessitating time consuming 16S rDNA gene sequencing or multilocus sequence typing (MLST). The organism is ubiquitous, being found in the environment and in a wide range of foods, although there is variation in pathogenicity between Cronobacter isolates and between species. Therefore to be able to differentiate between the pathogenic and non-pathogenic strains is of interest to the food industry and regulators. Here we report the use of Expectation Maximization clustering to categorise 98 strains of Cronobacter as pathogenic or non-pathogenic based on biochemical test results from standard diagnostic test kits. Pathogenicity of a strain was postulated on the basis of either pathogenic symptoms associated with strain source or corresponding MLST sequence types, allowing the clusters to be labelled as containing either pathogenic or non-pathogenic strains. The resulting clusters gave good differentiation of strains into pathogenic and non-pathogenic groups, corresponding well to isolate source and MLST sequence type. The results also revealed a potential association between pathogenicity and inositol fermentation. An investigation of the genomes of Cronobacter sakazakii and C. turicensis revealed the gene for inositol monophosphatase is associated with putative virulence factors in pathogenic strains of Cronobacter. We demonstrated a computational approach allowing existing diagnostic kits to be used to identify pathogenic strains of Cronobacter. The resulting clusters correlated well with MLST sequence types and revealed new information about the pathogenicity of Cronobacter species.

Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

PubMed

Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh; Kim, Bum-Joon

2017-01-01

Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus

PubMed Central

Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh

2017-01-01

Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated. PMID:28604829

Heterogeneity of the Epstein-Barr Virus (EBV) Major Internal Repeat Reveals Evolutionary Mechanisms of EBV and a Functional Defect in the Prototype EBV Strain B95-8.

PubMed

Ba Abdullah, Mohammed M; Palermo, Richard D; Palser, Anne L; Grayson, Nicholas E; Kellam, Paul; Correia, Samantha; Szymula, Agnieszka; White, Robert E

2017-12-01

Epstein-Barr virus (EBV) is a ubiquitous pathogen of humans that can cause several types of lymphoma and carcinoma. Like other herpesviruses, EBV has diversified through both coevolution with its host and genetic exchange between virus strains. Sequence analysis of the EBV genome is unusually challenging because of the large number and lengths of repeat regions within the virus. Here we describe the sequence assembly and analysis of the large internal repeat 1 of EBV (IR1; also known as the BamW repeats) for more than 70 strains. The diversity of the latency protein EBV nuclear antigen leader protein (EBNA-LP) resides predominantly within the exons downstream of IR1. The integrity of the putative BWRF1 open reading frame (ORF) is retained in over 80% of strains, and deletions truncating IR1 always spare BWRF1. Conserved regions include the IR1 latency promoter (Wp) and one zone upstream of and two within BWRF1. IR1 is heterogeneous in 70% of strains, and this heterogeneity arises from sequence exchange between strains as well as from spontaneous mutation, with interstrain recombination being more common in tumor-derived viruses. This genetic exchange often incorporates regions of <1 kb, and allelic gene conversion changes the frequency of small regions within the repeat but not close to the flanks. These observations suggest that IR1-and, by extension, EBV-diversifies through both recombination and breakpoint repair, while concerted evolution of IR1 is driven by gene conversion of small regions. Finally, the prototype EBV strain B95-8 contains four nonconsensus variants within a single IR1 repeat unit, including a stop codon in the EBNA-LP gene. Repairing IR1 improves EBNA-LP levels and the quality of transformation by the B95-8 bacterial artificial chromosome (BAC). IMPORTANCE Epstein-Barr virus (EBV) infects the majority of the world population but causes illness in only a small minority of people. Nevertheless, over 1% of cancers worldwide are attributable to EBV. Recent sequencing projects investigating virus diversity to see if different strains have different disease impacts have excluded regions of repeating sequence, as they are more technically challenging. Here we analyze the sequence of the largest repeat in EBV (IR1). We first characterized the variations in protein sequences encoded across IR1. In studying variations within the repeat of each strain, we identified a mutation in the main laboratory strain of EBV that impairs virus function, and we suggest that tumor-associated viruses may be more likely to contain DNA mixed from two strains. The patterns of this mixing suggest that sequences can spread between strains (and also within the repeat) by copying sequence from another strain (or repeat unit) to repair DNA damage. Copyright © 2017 Ba abdullah et al.

Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

PubMed

Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

2016-11-30

The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

Whole Genome Sequence of Two Wild-Derived Mus musculus domesticus Inbred Strains, LEWES/EiJ and ZALENDE/EiJ, with Different Diploid Numbers

PubMed Central

Morgan, Andrew P.; Didion, John P.; Doran, Anthony G.; Holt, James M.; McMillan, Leonard; Keane, Thomas M.; de Villena, Fernando Pardo-Manuel

2016-01-01

Wild-derived mouse inbred strains are becoming increasingly popular for complex traits analysis, evolutionary studies, and systems genetics. Here, we report the whole-genome sequencing of two wild-derived mouse inbred strains, LEWES/EiJ and ZALENDE/EiJ, of Mus musculus domesticus origin. These two inbred strains were selected based on their geographic origin, karyotype, and use in ongoing research. We generated 14× and 18× coverage sequence, respectively, and discovered over 1.1 million novel variants, most of which are private to one of these strains. This report expands the number of wild-derived inbred genomes in the Mus genus from six to eight. The sequence variation can be accessed via an online query tool; variant calls (VCF format) and alignments (BAM format) are available for download from a dedicated ftp site. Finally, the sequencing data have also been stored in a lossless, compressed, and indexed format using the multi-string Burrows-Wheeler transform. All data can be used without restriction. PMID:27765810

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov.

PubMed Central

Doroghazi, J. R.; Ju, K.-S.; Metcalf, W. W.

2014-01-01

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with five other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these other species, including Streptomyces almquistii NRRL B-1685T, Streptomyces flocculus NRRL B-2465T, Streptomyces gibsonii NRRL B-1335T and Streptomyces rangoonensis NRRL B-12378T are quite similar. This cluster is of particular taxonomic interest because Streptomyces albus is the type species of the genus Streptomyces. The related strains were subjected to multilocus sequence analysis (MLSA) utilizing partial sequences of the housekeeping genes atpD, gyrB, recA, rpoB and trpB and confirmation of previously reported phenotypic characteristics. The five strains formed a coherent cluster supported by a 100 % bootstrap value in phylogenetic trees generated from sequence alignments prepared by concatenating the sequences of the housekeeping genes, and identical tree topology was observed using various different tree-making algorithms. Moreover, all but one strain, S. flocculus NRRL B-2465T, exhibited identical sequences for all of the five housekeeping gene loci sequenced, but NRRL B-2465T still exhibited an MLSA evolutionary distance of 0.005 from the other strains, a value that is lower than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. These data support a proposal to reclassify S. almquistii, S. flocculus, S. gibsonii and S. rangoonensis as later heterotypic synonyms of S. albus with NRRL B-1811T as the type strain. The MLSA sequence database also demonstrated utility for quickly and conclusively confirming that numerous strains within the ARS Culture Collection had been previously misidentified as subspecies of S. albus and that Streptomyces albus subsp. pathocidicus should be redescribed as a novel species, Streptomyces pathocidini sp. nov., with the type strain NRRL B-24287T. PMID:24277863

Selective epitaxial growth properties and strain characterization of Si1- x Ge x in SiO2 trench arrays

NASA Astrophysics Data System (ADS)

Koo, Sangmo; Jang, Hyunchul; Ko, Dae-Hong

2017-04-01

In this study, we investigated the formation of a Si1- x Ge x fin structure in SiO2 trench arrays via an ultra-high-vacuum chemical-vapor deposition (UHV-CVD) selective epitaxial growth (SEG) process. Defect generation and microstructures of Si1- x Ge x fin structures with different Ge concentrations ( x = 0.2, 0.3 and 0.45) were examined. In addition, the strain evolution of a Si1- x Ge x fin structure was analyzed by using reciprocal space mapping (RSM). An (111) facet was formed from the Si1- x Ge x epi-layer and SiO2 trench wall interface to minimize the interface and the surface energy. The Si1- x Ge x fin structures were fully relaxed along the direction perpendicular to the trenches regardless of the Ge concentration. On the other hand, the fin structures were fully or partially strained along the direction parallel to the trenches depending on the Ge concentration: fully strained Si0.8Ge0.2 and Si0.7Ge0.3, and a Si0.55Ge0.45 strain-relaxed buffer. We further confirmed that the strain on the Si1- x Ge x fin structures remained stable after oxide removal and H2/N2 post-annealing.

'Candidatus pasteuria usgae' sp. nov., an obligate endoparasite of the phytoparasitic nematode Belonolaimus longicaudatus.

PubMed

Giblin-Davis, R M; Williams, D S; Bekal, S; Dickson, D W; Brito, J A; Becker, J O; Preston, J F

2003-01-01

Taxonomically relevant characteristics of a fastidiously Gram-positive, obligately endoparasitic prokaryote (strain S-1) that uses the phytoparasitic sting nematode Belonolaimus longicaudatus as its host are reviewed. 16S rDNA sequence similarity (> or = 93%) confirms its congeneric ranking with other Pasteuria species and strains from nematodes and cladocerans and corroborates morphological, morphometric and host range evidence suggesting a novel taxon. The 16S rDNA sequence of strain S-1 has greatest similarity (96%) to the 16S rDNA sequences of both Pasteuria penetrans from root-knot nematodes (Meloidogyne species) and the recently reported strain of Pasteuria isolated from the soybean cyst nematode Heterodera glycines. Because the obligately endoparasitic nature of prokaryotes in the genus Pasteuria prevents isolation of definitive type strains, strain S-1 is proposed as 'Candidatus Pasteuria usgae' sp. nov.

Lactic Acid Bacteria Isolated from Bovine Mammary Microbiota: Potential Allies against Bovine Mastitis.

PubMed

Bouchard, Damien S; Seridan, Bianca; Saraoui, Taous; Rault, Lucie; Germon, Pierre; Gonzalez-Moreno, Candelaria; Nader-Macias, Fatima M E; Baud, Damien; François, Patrice; Chuat, Victoria; Chain, Florian; Langella, Philippe; Nicoli, Jacques; Le Loir, Yves; Even, Sergine

2015-01-01

Bovine mastitis is a costly disease in dairy cattle worldwide. As of yet, the control of bovine mastitis is mostly based on prevention by thorough hygienic procedures during milking. Additional strategies include vaccination and utilization of antibiotics. Despite these measures, mastitis is not fully under control, thus prompting the need for alternative strategies. The goal of this study was to isolate autochthonous lactic acid bacteria (LAB) from bovine mammary microbiota that exhibit beneficial properties that could be used for mastitis prevention and/or treatment. Sampling of the teat canal led to the isolation of 165 isolates, among which a selection of ten non-redundant LAB strains belonging to the genera Lactobacillus and Lactococcus were further characterized with regard to several properties: surface properties (hydrophobicity, autoaggregation); inhibition potential of three main mastitis pathogens, Staphylococcus aureus, Escherichia coli and Streptococcus uberis; colonization capacities of bovine mammary epithelial cells (bMEC); and immunomodulation properties. Three strains, Lactobacillus brevis 1595 and 1597 and Lactobacillus plantarum 1610, showed high colonization capacities and a medium surface hydrophobicity. These strains are good candidates to compete with pathogens for mammary gland colonization. Moreover, nine strains exhibited anti-inflammatory properties, as illustrated by the lower IL-8 secretion by E. coli-stimulated bMEC in the presence of these LAB. Full genome sequencing of five candidate strains allowed to check for undesirable genetic elements such as antibiotic resistance genes and to identify potential bacterial determinants involved in the beneficial properties. This large screening of beneficial properties while checking for undesirable genetic markers allowed the selection of promising candidate LAB strains from bovine mammary microbiota for the prevention and/or treatment of bovine mastitis.

Complete Circular Genome Sequence of Successful ST8/SCCmecIV Community-Associated Methicillin-Resistant Staphylococcus aureus (OC8) in Russia: One-Megabase Genomic Inversion, IS256’s Spread, and Evolution of Russia ST8-IV

PubMed Central

Wan, Tsai-Wen; Higuchi, Wataru; Hung, Wei-Chun; Reva, Ivan V.; Singur, Olga A.; Gostev, Vladimir V.; Sidorenko, Sergey V.; Peryanova, Olga V.; Salmina, Alla B.; Reva, Galina V.; Teng, Lee-Jene; Yamamoto, Tatsuo

2016-01-01

ST8/SCCmecIV community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) has been a common threat, with large USA300 epidemics in the United States. The global geographical structure of ST8/SCCmecIV has not yet been fully elucidated. We herein determined the complete circular genome sequence of ST8/SCCmecIVc strain OC8 from Siberian Russia. We found that 36.0% of the genome was inverted relative to USA300. Two IS256, oppositely oriented, at IS256-enriched hot spots were implicated with the one-megabase genomic inversion (MbIN) and vSaβ split. The behavior of IS256 was flexible: its insertion site (att) sequences on the genome and junction sequences of extrachromosomal circular DNA were all divergent, albeit with fixed sizes. A similar multi-IS256 system was detected, even in prevalent ST239 healthcare-associated MRSA in Russia, suggesting IS256’s strong transmission potential and advantage in evolution. Regarding epidemiology, all ST8/SCCmecIVc strains from European, Siberian, and Far Eastern Russia, examined had MbIN, and geographical expansion accompanied divergent spa types and resistance to fluoroquinolones, chloramphenicol, and often rifampicin. Russia ST8/SCCmecIVc has been associated with life-threatening infections such as pneumonia and sepsis in both community and hospital settings. Regarding virulence, the OC8 genome carried a series of toxin and immune evasion genes, a truncated giant surface protein gene, and IS256 insertion adjacent to a pan-regulatory gene. These results suggest that unique single ST8/spa1(t008)/SCCmecIVc CA-MRSA (clade, Russia ST8-IVc) emerged in Russia, and this was followed by large geographical expansion, with MbIN as an epidemiological marker, and fluoroquinolone resistance, multiple virulence factors, and possibly a multi-IS256 system as selective advantages. PMID:27741255

Complete Circular Genome Sequence of Successful ST8/SCCmecIV Community-Associated Methicillin-Resistant Staphylococcus aureus (OC8) in Russia: One-Megabase Genomic Inversion, IS256's Spread, and Evolution of Russia ST8-IV.

PubMed

Wan, Tsai-Wen; Khokhlova, Olga E; Iwao, Yasuhisa; Higuchi, Wataru; Hung, Wei-Chun; Reva, Ivan V; Singur, Olga A; Gostev, Vladimir V; Sidorenko, Sergey V; Peryanova, Olga V; Salmina, Alla B; Reva, Galina V; Teng, Lee-Jene; Yamamoto, Tatsuo

2016-01-01

ST8/SCCmecIV community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) has been a common threat, with large USA300 epidemics in the United States. The global geographical structure of ST8/SCCmecIV has not yet been fully elucidated. We herein determined the complete circular genome sequence of ST8/SCCmecIVc strain OC8 from Siberian Russia. We found that 36.0% of the genome was inverted relative to USA300. Two IS256, oppositely oriented, at IS256-enriched hot spots were implicated with the one-megabase genomic inversion (MbIN) and vSaβ split. The behavior of IS256 was flexible: its insertion site (att) sequences on the genome and junction sequences of extrachromosomal circular DNA were all divergent, albeit with fixed sizes. A similar multi-IS256 system was detected, even in prevalent ST239 healthcare-associated MRSA in Russia, suggesting IS256's strong transmission potential and advantage in evolution. Regarding epidemiology, all ST8/SCCmecIVc strains from European, Siberian, and Far Eastern Russia, examined had MbIN, and geographical expansion accompanied divergent spa types and resistance to fluoroquinolones, chloramphenicol, and often rifampicin. Russia ST8/SCCmecIVc has been associated with life-threatening infections such as pneumonia and sepsis in both community and hospital settings. Regarding virulence, the OC8 genome carried a series of toxin and immune evasion genes, a truncated giant surface protein gene, and IS256 insertion adjacent to a pan-regulatory gene. These results suggest that unique single ST8/spa1(t008)/SCCmecIVc CA-MRSA (clade, Russia ST8-IVc) emerged in Russia, and this was followed by large geographical expansion, with MbIN as an epidemiological marker, and fluoroquinolone resistance, multiple virulence factors, and possibly a multi-IS256 system as selective advantages.

Molecular cloning of the plasma membrane H(+)-ATPase from Kluyveromyces lactis: a single nucleotide substitution in the gene confers ethidium bromide resistance and deficiency in K+ uptake.

PubMed Central

Miranda, M; Ramírez, J; Peña, A; Coria, R

1995-01-01

A Kluyveromyces lactis strain resistant to ethidium bromide and deficient in potassium uptake was isolated. Studies on the proton-pumping activity of the mutant strain showed that a decreased H(+)-ATPase specific activity was responsible for the observed phenotypes. The putative K. lactis PMA1 gene encoding the plasma membrane H(+)-ATPase was cloned by its ability to relieve the potassium transport defect of this mutant and by reversing its resistance to ethidium bromide. Its deduced amino acid sequence predicts a protein 899 residues long that is structurally colinear in its full length to H(+)-ATPases cloned from different yeasts, except for the presence of a variable N-terminal domain. By PCR-mediated amplification, we identified a transition from G to A that rendered the substitution of the fully conserved methionine at position 699 by isoleucine. We attribute to this amino acid change the low capacity of the mutant H(+)-ATPase to pump out protons. PMID:7730265

Draft Genome Sequences of Three European Laboratory Derivatives from Enterohemorrhagic Escherichia coli O157:H7 Strain EDL933, Including Two Plasmids.

PubMed

Fellner, Lea; Huptas, Christopher; Simon, Svenja; Mühlig, Anna; Scherer, Siegfried; Neuhaus, Klaus

2016-04-07

Escherichia coliO157:H7 EDL933, isolated in 1982 in the United States, was the first enterohemorrhagicE. coli(EHEC) strain sequenced. Unfortunately, European labs can no longer receive the original strain. We checked three European EDL933 derivatives and found major genetic deviations (deletions, inversions) in two strains. All EDL933 strains contain the cryptic EHEC-plasmid, not reported before. Copyright © 2016 Fellner et al.

Molecular phylogeny, population genetics, and evolution of heterocystous cyanobacteria using nifH gene sequences.

PubMed

Singh, Prashant; Singh, Satya Shila; Elster, Josef; Mishra, Arun Kumar

2013-06-01

In order to assess phylogeny, population genetics, and approximation of future course of cyanobacterial evolution based on nifH gene sequences, 41 heterocystous cyanobacterial strains collected from all over India have been used in the present study. NifH gene sequence analysis data confirm that the heterocystous cyanobacteria are monophyletic while the stigonematales show polyphyletic origin with grave intermixing. Further, analysis of nifH gene sequence data using intricate mathematical extrapolations revealed that the nucleotide diversity and recombination frequency is much greater in Nostocales than the Stigonematales. Similarly, DNA divergence studies showed significant values of divergence with greater gene conversion tracts in the unbranched (Nostocales) than the branched (Stigonematales) strains. Our data strongly support the origin of true branching cyanobacterial strains from the unbranched strains.

RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

PubMed

Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

2016-02-01

During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

ProDeGe: A computational protocol for fully automated decontamination of genomes

DOE PAGES

Tennessen, Kristin; Andersen, Evan; Clingenpeel, Scott; ...

2015-06-09

Single amplified genomes and genomes assembled from metagenomes have enabled the exploration of uncultured microorganisms at an unprecedented scale. However, both these types of products are plagued by contamination. Since these genomes are now being generated in a high-throughput manner and sequences from them are propagating into public databases to drive novel scientific discoveries, rigorous quality controls and decontamination protocols are urgently needed. Here, we present ProDeGe (Protocol for fully automated Decontamination of Genomes), the first computational protocol for fully automated decontamination of draft genomes. ProDeGe classifies sequences into two classes—clean and contaminant—using a combination of homology and feature-based methodologies.more » On average, 84% of sequence from the non-target organism is removed from the data set (specificity) and 84% of the sequence from the target organism is retained (sensitivity). Lastly, the procedure operates successfully at a rate of ~0.30 CPU core hours per megabase of sequence and can be applied to any type of genome sequence.« less

ProDeGe: A computational protocol for fully automated decontamination of genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tennessen, Kristin; Andersen, Evan; Clingenpeel, Scott

Single amplified genomes and genomes assembled from metagenomes have enabled the exploration of uncultured microorganisms at an unprecedented scale. However, both these types of products are plagued by contamination. Since these genomes are now being generated in a high-throughput manner and sequences from them are propagating into public databases to drive novel scientific discoveries, rigorous quality controls and decontamination protocols are urgently needed. Here, we present ProDeGe (Protocol for fully automated Decontamination of Genomes), the first computational protocol for fully automated decontamination of draft genomes. ProDeGe classifies sequences into two classes—clean and contaminant—using a combination of homology and feature-based methodologies.more » On average, 84% of sequence from the non-target organism is removed from the data set (specificity) and 84% of the sequence from the target organism is retained (sensitivity). Lastly, the procedure operates successfully at a rate of ~0.30 CPU core hours per megabase of sequence and can be applied to any type of genome sequence.« less

Yersinia pestis caf1 variants and the limits of plague vaccine protection.

PubMed

Quenee, Lauriane E; Cornelius, Claire A; Ciletti, Nancy A; Elli, Derek; Schneewind, Olaf

2008-05-01

Yersinia pestis, the highly virulent agent of plague, is a biological weapon. Strategies that prevent plague have been sought for centuries, and immunization with live, attenuated (nonpigmented) strains or subunit vaccines with F1 (Caf1) antigen is considered effective. We show here that immunization with live, attenuated strains generates plague-protective immunity and humoral immune responses against F1 pilus antigen and LcrV. Y. pestis variants lacking caf1 (F1 pili) are not only fully virulent in animal models of bubonic and pneumonic plague but also break through immune responses generated with live, attenuated strains or F1 subunit vaccines. In contrast, immunization with purified LcrV, a protein at the tip of type III needles, generates protective immunity against the wild-type and the fully virulent caf1 mutant strain, in agreement with the notion that LcrV can elicit vaccine protection against both types of virulent plague strains.

Fatigue data for polyether ether ketone (PEEK) under fully-reversed cyclic loading

PubMed Central

Shrestha, Rakish; Simsiriwong, Jutima; Shamsaei, Nima

2016-01-01

In this article, the data obtained from the uniaxial fully-reversed fatigue experiments conducted on polyether ether ketone (PEEK), a semi-crystalline thermoplastic, are presented. The tests were performed in either strain-controlled or load-controlled mode under various levels of loading. The data are categorized into four subsets according to the type of tests, including (1) strain-controlled fatigue tests with adjusted frequency to obtain the nominal temperature rise of the specimen surface, (2) strain-controlled fatigue tests with various frequencies, (3) load-controlled fatigue tests without step loadings, and (4) load-controlled fatigue tests with step loadings. Accompanied data for each test include the fatigue life, the maximum (peak) and minimum (valley) stress–strain responses for each cycle, and the hysteresis stress–strain responses for each collected cycle in a logarithmic increment. A brief description of the experimental method is also given. PMID:26937465

Fatigue data for polyether ether ketone (PEEK) under fully-reversed cyclic loading.

PubMed

Shrestha, Rakish; Simsiriwong, Jutima; Shamsaei, Nima

2016-03-01

In this article, the data obtained from the uniaxial fully-reversed fatigue experiments conducted on polyether ether ketone (PEEK), a semi-crystalline thermoplastic, are presented. The tests were performed in either strain-controlled or load-controlled mode under various levels of loading. The data are categorized into four subsets according to the type of tests, including (1) strain-controlled fatigue tests with adjusted frequency to obtain the nominal temperature rise of the specimen surface, (2) strain-controlled fatigue tests with various frequencies, (3) load-controlled fatigue tests without step loadings, and (4) load-controlled fatigue tests with step loadings. Accompanied data for each test include the fatigue life, the maximum (peak) and minimum (valley) stress-strain responses for each cycle, and the hysteresis stress-strain responses for each collected cycle in a logarithmic increment. A brief description of the experimental method is also given.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Morphology and molecular characterization of the epiphytic dinoflagellate Prorocentrum cf. rhathymum in temperate waters off Jeju Island, Korea

NASA Astrophysics Data System (ADS)

Lim, An Suk; Jeong, Hae Jin; Jang, Tae Young; Kang, Nam Seon; Lee, Sung Yeon; Yoo, Yeong Du; Kim, Hyung Seop

2013-03-01

Prorocentrum spp. are planktonic and/or benthic species. Benthic Prorocentrum species are of primary concern to scientists and the public because some of them are toxic. We established clonal cultures of 3 strains of Prorocentrum species that were collected from the thalli of a macroalga in the coastal waters off Jeju Island, located at the southern end of Korea. The Korean strains of P. cf. rhathymum, which are morphologically almost identical to the Virgin Island strain of P. rhathymum, were different from P. mexicanum because the former dinoflagellate has one simple collar-like spine in the periflagellar area, while the latter dinoflagellate has a 2- or 3-horned spine. In addition, the sequences of the small subunit (SSU) rDNA of the Korean strains were identical to those of the Malaysian and Floridian strains of P. rhathymum, while the sequences of the large subunit (LSU) rDNA of the Korean strains were 0.1-0.9% different from those of the Iranian and Malaysian strains of P. rhathymum. In phylogenetic trees based on the SSU rDNA sequences, the Korean strains of P. rhathymum formed a clade with the Malaysian and Floridian strains of P. rhathymum and the Vietnamese and Polynesian strains of P. mexicanum. However, in phylogenetic trees based on the LSU rDNA sequences, the Korean strains of P. rhathymum formed a clade with the Iranian strain of P. rhathymum and the Spanish and Mexican strains of P. mexicanum. Therefore, the molecular characterization of the Korean strains does not allow us to clearly classify them as P. rhathymum, nor P. mexicanum, although their morphology has so far been reported to be closer to that of P. rhathymum than P. mexicanum and thus we designated them as P. cf. rhathymum.

The effect of different screw-tightening techniques on the strain generated on an internal-connection implant superstructure. Part 2: Models created with a splinted impression technique.

PubMed

Choi, Jung-Han

2011-01-01

This study aimed to evaluate the effect of different screw-tightening sequences, torques, and methods on the strains generated on an internal-connection implant (Astra Tech) superstructure with good fit. An edentulous mandibular master model and a metal framework directly connected to four parallel implants with a passive fit to each other were fabricated. Six stone casts were made from a dental stone master model by a splinted impression technique to represent a well-fitting situation with the metal framework. Strains generated by four screw-tightening sequences (1-2-3-4, 4-3-2-1, 2-4-3-1, and 2-3-1-4), two torques (10 and 20 Ncm), and two methods (one-step and two-step) were evaluated. In the two-step method, screws were tightened to the initial torque (10 Ncm) in a predetermined screw-tightening sequence and then to the final torque (20 Ncm) in the same sequence. Strains were recorded twice by three strain gauges attached to the framework (superior face midway between abutments). Deformation data were analyzed using multiple analysis of variance at a .05 level of statistical significance. In all stone casts, strains were produced by connection of the superstructure, regardless of screw-tightening sequence, torque, and method. No statistically significant differences in superstructure strains were found based on screw-tightening sequences (range, -409.8 to -413.8 μm/m), torques (-409.7 and -399.1 μm/m), or methods (-399.1 and -410.3 μm/m). Within the limitations of this in vitro study, screw-tightening sequence, torque, and method were not critical factors for the strain generated on a well-fitting internal-connection implant superstructure by the splinted impression technique. Further studies are needed to evaluate the effect of screw-tightening techniques on the preload stress in various different clinical situations.

Draft Genome Sequences of Several Fungal Strains Selected for Exposure to Microgravity at the International Space Station

PubMed Central

Singh, Nitin K.; Blachowicz, Adriana; Romsdahl, Jillian; Wang, Clay; Torok, Tamas

2017-01-01

ABSTRACT The whole-genome sequences of eight fungal strains that were selected for exposure to microgravity at the International Space Station are presented here. These baseline sequences will help to understand the observed production of novel bioactive compounds. PMID:28408692

Draft Genome Sequence of Sphingobium sp. Strain HDIPO4, an Avid Degrader of Hexachlorocyclohexane

PubMed Central

Mukherjee, Udita; Kumar, Roshan; Mahato, Nitish Kumar; Khurana, J. P.

2013-01-01

Sphingobium sp. strain HDIPO4 was isolated from a hexachlorocyclohexane (HCH) dumpsite and degraded HCH isomers rapidly. The draft genome sequence of HDIPO4 (~4.7 Mbp) contains 143 contigs and 4,646 coding sequences with a G+C content of 65%. PMID:24051321

Genome sequence of a Providencia stuartii strain isolated from Lucilia sericata salivary glands

USDA-ARS?s Scientific Manuscript database

We present the draft genome sequence of a Providencia stuartii strain derived from salivary glands of larval Lucilia sericata; a common blow fly important to forensic, medical and veterinary science. The genome sequence will help dissect coinfections involving Providencia stuartii and Proteus mirab...

Species identification of mutans streptococci by groESL gene sequence.

PubMed

Hung, Wei-Chung; Tsai, Jui-Chang; Hsueh, Po-Ren; Chia, Jean-San; Teng, Lee-Jene

2005-09-01

The near full-length sequences of the groESL genes were determined and analysed among eight reference strains (serotypes a to h) representing five species of mutans group streptococci. The groES sequences from these reference strains revealed that there are two lengths (285 and 288 bp) in the five species. The intergenic spacer between groES and groEL appears to be a unique marker for species, with a variable size (ranging from 111 to 310 bp) and sequence. Phylogenetic analysis of groES and groEL separated the eight serotypes into two major clusters. Strains of serotypes b, c, e and f were highly related and had groES gene sequences of the same length, 288 bp, while strains of serotypes a, d, g and h were also closely related and their groES gene sequence lengths were 285 bp. The groESL sequences in clinical isolates of three serotypes of S. mutans were analysed for intraspecies polymorphism. The results showed that the groESL sequences could provide information for differentiation among species, but were unable to distinguish serotypes of the same species. Based on the determined sequences, a PCR assay was developed that could differentiate members of the mutans streptococci by amplicon size and provide an alternative way for distinguishing mutans streptococci from other viridans streptococci.

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity.

PubMed

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A; Awosika, Joy; Briska, Adam; Ptashkin, Ryan N; Wagner, Trevor; Rajanna, Chythanya; Tsang, Hsinyi; Johnson, Shannon L; Mokashi, Vishwesh P; Chain, Patrick S G; Sozhamannan, Shanmuga

2015-01-01

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, ordered restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity

DOE PAGES

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.; ...

2015-03-20

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less

Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains.

PubMed

Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

2011-02-01

Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536(T), M. massiliense CIP 108297(T), and M. bolletii CIP 108541(T)) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the clustering of strains. We found 10/120 (8.3%) isolates for which the concatenated MLSA gene sequence and rpoB sequence were discordant (e.g., M. massiliense MLSA sequence and M. abscessus rpoB sequence), suggesting the intergroup lateral transfers of rpoB. In conclusion, our study strongly supports the recent proposal that M. abscessus, M. massiliense, and M. bolletii should constitute a single species. Our findings also indicate that there has been a horizontal transfer of rpoB sequences between these subgroups, precluding the use of rpoB sequencing alone for the accurate identification of the two proposed M. abscessus subspecies.

Draft Genome Sequence of Two Strains of Xanthomonas arboricola Isolated from Prunus persica Which Are Dissimilar to Strains That Cause Bacterial Spot Disease on Prunus spp.

PubMed Central

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

2016-01-01

The draft genome sequences of two strains of Xanthomonas arboricola, isolated from asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of bacterial spot disease of stone fruits and almonds. PMID:27609931

Identification of gyrB and rpoB gene mutations and differentially expressed proteins between a novobiocin-resistant Aeromonas hydrophila catfish vaccine strain and its virulent parent strain

USDA-ARS?s Scientific Manuscript database

Sequence comparison between the full-length 2412 bp DNA gyrase subunit B (gyrB) gene of a novobiocin resistant Aeromonas hydrophila AH11NOVO vaccine strain and that of its virulent parent strain AH11P revealed 10 missense mutations. Similarly, sequence comparison between the full-length 4092 bp RNA ...

Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai.

PubMed

Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D; Paris, Daniel H; Richards, Allen L; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P J; Graves, Stephen; Stenos, John

2010-12-01

In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name "Orientia chuto," and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected.

Isolation of a Novel Orientia Species (O. chuto sp. nov.) from a Patient Infected in Dubai ▿

PubMed Central

Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D.; Paris, Daniel H.; Richards, Allen L.; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P. J.; Graves, Stephen; Stenos, John

2010-01-01

In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name “Orientia chuto,” and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected. PMID:20926708

Whole-genome sequencing and analyses identify high genetic heterogeneity, diversity and endemicity of rotavirus genotype P[6] strains circulating in Africa.

PubMed

Nyaga, Martin M; Tan, Yi; Seheri, Mapaseka L; Halpin, Rebecca A; Akopov, Asmik; Stucker, Karla M; Fedorova, Nadia B; Shrivastava, Susmita; Duncan Steele, A; Mwenda, Jason M; Pickett, Brett E; Das, Suman R; Jeffrey Mphahlele, M

2018-05-18

Rotavirus A (RVA) exhibits a wide genotype diversity globally. Little is known about the genetic composition of genotype P[6] from Africa. This study investigated possible evolutionary mechanisms leading to genetic diversity of genotype P[6] VP4 sequences. Phylogenetic analyses on 167 P[6] VP4 full-length sequences were conducted, which included six porcine-origin sequences. Of the 167 sequences, 57 were newly acquired through whole genome sequencing as part of this study. The other 110 sequences were all publicly-available global P[6] VP4 full-length sequences downloaded from GenBank. The strength of association between the phenotypic features and the phylogeny was also determined. A number of reassortment and mixed infections of RVA genotype P[6] strains were observed in this study. Phylogenetic analyses demostrated the extensive genetic diversity that exists among human P[6] strains, porcine-like strains, their concomitant clades/subclades and estimated that P[6] VP4 gene has a higher substitution rate with the mean of 1.05E-3 substitutions/site/year. Further, the phylogenetic analyses indicated that genotype P[6] strains were endemic in Africa, characterised by an extensive genetic diversity and long-time local evolution of the viruses. This was also supported by phylogeographic clustering and G-genotype clustering of the P[6] strains when Bayesian Tip-association Significance testing (BaTS) was applied, clearly supporting that the viruses evolved locally in Africa instead of spatial mixing among different regions. Overall, the results demonstrated that multiple mechanisms such as reassortment events, various mutations and possibly interspecies transmission account for the enormous diversity of genotype P[6] strains in Africa. These findings highlight the need for continued global surveillance of rotavirus diversity. Copyright © 2018 Elsevier B.V. All rights reserved.

Complete coding regions of the prototypes enterovirus B93 and C95: phylogenetic analyses of the P1 and P3 regions of EV-B and EV-C strains.

PubMed

Junttila, N; Lévêque, N; Magnius, L O; Kabue, J P; Muyembe-Tamfum, J J; Maslin, J; Lina, B; Norder, H

2015-03-01

Complete coding regions were sequenced for two new enterovirus genomes: EV-B93 previously identified by VP1 sequencing, derived from a child with acute flaccid paralysis in the Democratic Republic of Congo; and EV-C95 from a French soldier with acute gastroenteritis in Djibouti. The EV-B93 P1 had more than 30% nucleotide divergence from other EV-B types, with highest similarity to E-15 and EV-B80. The P1 nucleotide sequence of EV-C95 was most similar, 71%, to CV-A21. Complete coding regions for the new enteroviruses were compared with those of 135 EV-B and 176 EV-C strains representing all types available in GenBank. When strains from the same outbreak or strains isolated during the same year in the same geographical region were excluded, 27 of the 58 EV-B, and 16 of the 23 EV-C types were represented by more than one sequence. However, for EV-B the P3 sequences formed three clades mainly according to origin or time of isolation, irrespective of type, while for EV-C the P3 sequences segregated mainly according to disease manifestation, with most strains causing paralysis, including polioviruses, forming one clade, and strains causing respiratory illness forming another. There was no intermixing of types between these two clades, apart from two EV-C96 strains. The EV-B P3 sequences had lower inter-clade and higher intra-clade variability as compared to the EV-C sequences, which may explain why inter-clade recombinations are more frequent in EV-B. Further analysis of more isolates may shed light on the role of recombinations in the evolution of EV-B in geographical context. © 2014 Wiley Periodicals, Inc.

Pestoides F, an atypical Yersinia pestis strain from the former Soviet Union.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, Emilio; Worsham, Patricia; Bearden, S.

2007-01-01

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lack of the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout amore » comprehensive genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla(-) strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains reveals differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single approximately 7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

Pestoides F, and Atypical Yersinia pestis Strain from the Former Soviet Union

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, E; Worsham, P; Bearden, S

2007-01-05

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lacking the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout a comprehensivemore » genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla{sup -} strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains, reveals a series of differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single {approx}7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

[Comparison of genotype characteristics between the circulating mumps virus strain in Beijing area and the vaccine strain].

PubMed

Chen, Meng; Zhang, Tie-gang; Chen, Li-juan; Wu, Jiang; Yang, Jie; Zhang, Wei

2009-11-01

To compare the genetic characteristics of mumps virus strain circulating in Beijing with vaccine strain and to preliminarily analysis the reasons of vaccine ineffectiveness. The following methods were used: Isolation and identification of the mumps virus which had been circulating in Beijing, immunization history analysis, SH gene sequence analysis and comparison genotype homology with reference strains and analysis of the key amino acid sites of HN variation. In 38 mumps cases that virus had been isolated from, another seven cases were IgM negative. In 2007 and 2008, the positive rates on virus isolation, RT-PCR and IgM-decreased significantly, while the cases with immunization history had an increase. Cases without histories of vaccination had both higher positive rates on virus isolation and IgM. Thirty-eight strains belonged to F genotype virus, but vaccine strain was A genotype. The circulating viruses showed 5.6% sequence divergence on SH gene nucleotide and 16.0% - 18.1% from vaccine strain. Conservative hydrophobic amino acids on SH protein of some Beijing strains had changed. For example, there were 6 strains, from No.8: L-->F. The circulating viruses showed 2.3% sequence divergence on HN protein amino acid sequences and 4.2% - 5.3% from vaccine strain. Amino acids sites, which deciding the ability of cross-neutralization of the Beijing strains and vaccine strains were different. At the 354 and 356 sites, all the Beijing strains were different from the vaccine strains. The N-glycosylation sites on HN of Beijing strains were also different from those on vaccine strains. Locations 464 - 466 appeared to be NCS on Beijing strain, but locations 464 - 466 were NCR on the vaccine strains. Another 18 unknown function amino acids sites of all Beijing strains were different from those on vaccine strains. In recent years, genotype F became the main genotype of circulating strains in Beijing without genotype variation, but larger difference was found between them. There was a big difference between SH and HN protein of Beijing strains and vaccine strain, which might explain the ineffectiveness of the vaccine.

Draft Genome Sequences of Two Salmonella enterica Serotype Infantis Strains Isolated from a Captive Western Lowland Gorilla (Gorilla gorilla gorilla) and a Cohabitant Black and White Tegu (Tupinambis merianae) in Brazil.

PubMed

Paixão, Tatiane A; Coura, Fernanda M; Malta, Marcelo C C; Tinoco, Herlandes P; Pessanha, Angela T; Pereira, Felipe L; Leal, Carlos A G; Heinemann, Marcos B; Figueiredo, Henrique C P; Santos, Renato L

2016-01-21

The draft genome sequences of two Salmonella enterica serotype Infantis isolates are reported here. One of the strains was isolated from a western lowland gorilla (Gorilla gorilla gorilla) with colitis. The second strain was isolated from a reptile that inhabited the same premises. Whole-genome sequencing demonstrated that these isolates were not clonal. Copyright © 2016 Paixão et al.

Genome sequence of a Proteus mirabilis strain isolated from the salivary glands of larval Lucilia sericata

USDA-ARS?s Scientific Manuscript database

We announced a draft genome sequence of a Proteus mirabilis strain derived from Lucilia sericata salivary glands. This strain is demonstrated to attract and induce oviposition by L. sericata, a common blow fly important to medicine, agriculture, and forensics. The genome will help to dissect inter...

Draft Genome Sequence of Mycobacterium chimaera Type Strain Fl-0169

EPA Science Inventory

We report the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169T, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, though Fl-016...

Draft Genome Sequence of Komagataeibacter intermedius Strain AF2, a Producer of Cellulose, Isolated from Kombucha Tea

PubMed Central

dos Santos, Renato Augusto Corrêa; Berretta, Andresa Aparecida; Barud, Hernane da Silva; Ribeiro, Sidney José Lima; González-García, Laura Natalia; Zucchi, Tiago Domingues

2015-01-01

Here, we present the draft genome sequence of Komagataeibacter intermedius strain AF2, which was isolated from Kombucha tea and is capable of producing cellulose, although at lower levels compared to another bacterium from the same environment, K. rhaeticus strain AF1. PMID:26634755

Genome Sequence of Janthinobacterium sp. Strain PAMC 25724, Isolated from Alpine Glacier Cryoconite

PubMed Central

Kim, Su Jin; Shin, Seung Chul; Hong, Soon Gyu; Lee, Yung Mi; Lee, Hyoungseok; Lee, Jungeun

2012-01-01

The draft genome of Janthinobacterium sp. strain PAMC 25724, which is a violacein-producing psychrotolerant bacterium, was determined. The strain was isolated from glacier cryoconite of the Alps mountain permafrost region. The sequence will allow identification and characterization of the genetic determination of its cold-adaptive properties. PMID:22461541

Complete Genome Sequence of Kluyveromyces lactis Strain GG799, a Common Yeast Host for Heterologous Protein Expression

PubMed Central

Chuzel, Léa; Ganatra, Mehul B.; Schermerhorn, Kelly M.; Gardner, Andrew F.; Anton, Brian P.

2017-01-01

ABSTRACT We report the genome sequence of the dairy yeast Kluyveromyces lactis strain GG799 obtained using the Pacific Biosciences RS II platform. K. lactis strain GG799 is a common host for the expression of proteins at both laboratory and industrial scales. PMID:28751387

Genome Sequence of Sphingomonas sp. Strain PAMC 26621, an Arctic-Lichen-Associated Bacterium Isolated from a Cetraria sp.

PubMed Central

Lee, Hyoungseok; Shin, Seung Chul; Lee, Jungeun; Kim, Su Jin; Kim, Bum-Keun; Hong, Soon Gyu; Kim, Eun Hye

2012-01-01

The lichen-associated bacterial strain Sphingomonas sp. PAMC 26621 was isolated from an Arctic lichen Cetraria sp. on Svalbard Islands. Here we report the draft genome sequence of this strain, which could provide novel insights into the molecular principles of lichen-microbe interactions. PMID:22582384

Genome sequence of Chinese porcine parvovirus strain PPV2010.

PubMed

Cui, Jin; Wang, Xin; Ren, Yudong; Cui, Shangjin; Li, Guangxing; Ren, Xiaofeng

2012-02-01

Porcine parvovirus (PPV) isolate PPV2010 has recently emerged in China. Herein, we analyze the complete genome sequence of PPV2010. Our results indicate that the genome of PPV2010 bears mixed characteristics of virulent PPV and vaccine strains. Importantly, PPV2010 has the potential to be a naturally attenuated candidate vaccine strain.

Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran.

PubMed

Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V

2009-09-01

To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.

The Complete Sequence of a West Nile Virus Lineage 2 Strain Detected in a Hyalomma marginatum marginatum Tick Collected from a Song Thrush (Turdus philomelos) in Eastern Romania in 2013 Revealed Closest Genetic Relationship to Strain Volgograd 2007

PubMed Central

Kolodziejek, Jolanta; Marinov, Mihai; Kiss, Botond J.; Alexe, Vasile; Nowotny, Norbert

2014-01-01

In this study the first complete sequence of the West Nile virus (WNV) lineage 2 strain currently circulating in Romania was determined. The virus was detected in a Hyalomma marginatum marginatum tick collected from a juvenile song thrush (Turdus philomelos) in the Romanian Danube Delta close to the city of Tulcea, end of August 2013. Our finding emphasizes the role of ticks in introduction and maintenance of WNV infections. Sequence analyses revealed close genetic relationship of the Romanian WNV strain to strain Reb_Volgograd_07_H, which was isolated from human brain tissue during an outbreak of West Nile neuroinvasive disease (WNND) in Russia in 2007. In 2010 the Eastern European lineage 2 WNV caused an outbreak of human WNND in Romania. Partial sequences from subsequent years demonstrated that this WNV strain became endemic in Eastern Europe and has been causing outbreaks of varying sizes in southern Russia since 2007 and in Romania since 2010. PMID:25279973

Complete genome sequence of "Thiodictyon syntrophicum" sp. nov. strain Cad16T, a photolithoautotrophic purple sulfur bacterium isolated from the alpine meromictic Lake Cadagno.

PubMed

Luedin, Samuel M; Pothier, Joël F; Danza, Francesco; Storelli, Nicola; Frigaard, Niels-Ulrik; Wittwer, Matthias; Tonolla, Mauro

2018-01-01

" Thiodictyon syntrophicum" sp. nov. strain Cad16 T is a photoautotrophic purple sulfur bacterium belonging to the family of Chromatiaceae in the class of Gammaproteobacteria . The type strain Cad16 T was isolated from the chemocline of the alpine meromictic Lake Cadagno in Switzerland. Strain Cad16 T represents a key species within this sulfur-driven bacterial ecosystem with respect to carbon fixation. The 7.74-Mbp genome of strain Cad16 T has been sequenced and annotated. It encodes 6237 predicted protein sequences and 59 RNA sequences. Phylogenetic comparison based on 16S rRNA revealed that Thiodictyon elegans strain DSM 232 T the most closely related species. Genes involved in sulfur oxidation, central carbon metabolism and transmembrane transport were found. Noteworthy, clusters of genes encoding the photosynthetic machinery and pigment biosynthesis are found on the 0.48 Mb plasmid pTs485. We provide a detailed insight into the Cad16 T genome and analyze it in the context of the microbial ecosystem of Lake Cadagno.

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

PubMed

Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L

2015-01-01

Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

Genetic Diversity among Clostridium botulinum Strains Harboring bont/A2 and bont/A3 Genes

PubMed Central

Raphael, Brian H.; Joseph, Lavin A.; Meno, Sarah R.; Fernández, Rafael A.; Maslanka, Susan E.

2012-01-01

Clostridium botulinum type A strains are known to be genetically diverse and widespread throughout the world. Genetic diversity studies have focused mainly on strains harboring one type A botulinum toxin gene, bont/A1, although all reported bont/A gene variants have been associated with botulism cases. Our study provides insight into the genetic diversity of C. botulinum type A strains, which contain bont/A2 (n = 42) and bont/A3 (n = 4) genes, isolated from diverse samples and geographic origins. Genetic diversity was assessed by using bont nucleotide sequencing, content analysis of the bont gene clusters, multilocus sequence typing (MLST), and pulsed-field gel electrophoresis (PFGE). Sequences of bont genes obtained in this study showed 99.9 to 100% identity with other bont/A2 or bont/A3 gene sequences available in public databases. The neurotoxin gene clusters of the subtype A2 and A3 strains analyzed in this study were similar in gene content. C. botulinum strains harboring bont/A2 and bont/A3 genes were divided into six and two MLST profiles, respectively. Four groups of strains shared a similarity of at least 95% by PFGE; the largest group included 21 out of 46 strains. The strains analyzed in this study showed relatively limited genetic diversity using either MLST or PFGE. PMID:23042179

Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level.

PubMed

Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E; Irmler, Stefan; Ahrens, Christian H

2018-01-01

Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus -to our knowledge-identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus . Notably, the functional Clusters of Orthologous Groups of proteins categories "cell wall/membrane biogenesis" and "defense mechanisms" were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level.

Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level

PubMed Central

Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R.; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E.; Irmler, Stefan; Ahrens, Christian H.

2018-01-01

Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus—to our knowledge—identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus. Notably, the functional Clusters of Orthologous Groups of proteins categories “cell wall/membrane biogenesis” and “defense mechanisms” were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level. PMID:29441050

Genetic evolution of Mycoplasma capricolum subsp. capripneumoniae strains and molecular epidemiology of contagious caprine pleuropneumonia by sequencing of locus H2.

PubMed

Lorenzon, S; Wesonga, H; Ygesu, Laikemariam; Tekleghiorgis, Tesfaalem; Maikano, Y; Angaya, M; Hendrikx, P; Thiaucourt, F

2002-03-01

Contagious caprine pleuropneumonia (CCPP) is a major threat to goat farming in developing countries. Its exact distribution is not well known, despite the fact that new diagnostic tools such as PCR and competitive ELISA are now available. The authors developed a study of the molecular epidemiology of the disease, based on the amplification of a 2400 bp long fragment containing two duplicated gene coding for a putative membrane protein. The sequence of this fragment, obtained on 19 Mycoplasma capricolum subsp. capripneumoniae (Mccp) strains from various geographical locations, gave 11 polymorphic positions. The three mutations found on gene H2prim were silent and did not appear to induce any amino acid modifications in the putative translated protein. The second gene may be a pseudogene not translated in vivo, as it bore a deletion of the ATG codon found in the other members of the "Mycoplasma mycoides cluster" and as the six mutations evidenced in the Mccp strains would induce modifications in the translated amino acids. In addition, an Mccp strain isolated in the United Arab Emirates showed a deletion of the whole pseudogene, a further indication that this gene is not compulsory for mycoplasma growth. Four lineages were defined, based on the nucleotide sequence. These correlated relatively well with the geographical origin of the strains: North, Central or East Africa. The strain of Turkish origin had a sequence similar to that found in North African strains, while strains isolated in Oman had sequences similar to those of North or East African strains. The latter is possibly due to the regular import of goats of various origins. Similar molecular epidemiology tools have been developed by sequencing the two operons of the 16S rRNA gene or by AFLP. All these various techniques give complementary results. One (16S rRNA) offers the likelihood of a finer identification of strains circulating in a region, another (H2) of determining the geographical origin of the strains. These tools can make a very useful contribution to understanding the epidemiology of CCPP.

Full-Genome Sequence of Infectious Laryngotracheitis Virus (Gallid Alphaherpesvirus 1) Strain VFAR-043, Isolated in Peru

PubMed Central

Bendezu Eguis, Jorge; Montesinos, Ricardo; Fernández-Díaz, Manolo

2018-01-01

ABSTRACT We report here the first genome sequence of infectious laryngotracheitis virus isolated in Peru from tracheal tissues of layer chickens. The genome showed 99.98% identity to the J2 strain genome sequence. Single nucleotide polymorphisms were detected in five gene-coding sequences related to vaccine development, virus attachment, and viral immune evasion. PMID:29519822

Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

PubMed Central

2012-01-01

Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP) is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs). Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb). Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565) further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences. PMID:22409516

Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

PubMed

Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

2017-08-01

Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

PubMed

Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

1997-10-01

We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

Complete Genome Sequence and Comparative Analysis of the Fish Pathogen Lactococcus garvieae

PubMed Central

Oshima, Kenshiro; Yoshizaki, Mariko; Kawanishi, Michiko; Nakaya, Kohei; Suzuki, Takehito; Miyauchi, Eiji; Ishii, Yasuo; Tanabe, Soichi; Murakami, Masaru; Hattori, Masahira

2011-01-01

Lactococcus garvieae causes fatal haemorrhagic septicaemia in fish such as yellowtail. The comparative analysis of genomes of a virulent strain Lg2 and a non-virulent strain ATCC 49156 of L. garvieae revealed that the two strains shared a high degree of sequence identity, but Lg2 had a 16.5-kb capsule gene cluster that is absent in ATCC 49156. The capsule gene cluster was composed of 15 genes, of which eight genes are highly conserved with those in exopolysaccharide biosynthesis gene cluster often found in Lactococcus lactis strains. Sequence analysis of the capsule gene cluster in the less virulent strain L. garvieae Lg2-S, Lg2-derived strain, showed that two conserved genes were disrupted by a single base pair deletion, respectively. These results strongly suggest that the capsule is crucial for virulence of Lg2. The capsule gene cluster of Lg2 may be a genomic island from several features such as the presence of insertion sequences flanked on both ends, different GC content from the chromosomal average, integration into the locus syntenic to other lactococcal genome sequences, and distribution in human gut microbiomes. The analysis also predicted other potential virulence factors such as haemolysin. The present study provides new insights into understanding of the virulence mechanisms of L. garvieae in fish. PMID:21829716

Draft Genome Sequences of Mycobacterium setense Type Strain DSM-45070 and the Nonpathogenic Strain Manresensis, Isolated from the Bank of the Cardener River in Manresa, Catalonia, Spain

PubMed Central

Vilaplana, Cristina; Velasco, Juan; Pluvinet, Raquel; Santín, Sheila; Prat, Cristina; Julián, Esther; Alcaide, Fernando; Comas, Iñaki; Sumoy, Lauro; Cardona, Pere-Joan

2015-01-01

We present here the draft genome sequences of two Mycobacterium setense strains. One of them corresponds to the M. setense type strain DSM-45070, originally isolated from a patient with a posttraumatic chronic skin abscess. The other one corresponds to the nonpathogenic M. setense strain Manresensis, isolated from the Cardener River crossing Manresa, Catalonia, Spain. A comparative genomic analysis shows a smaller genome size and fewer genes in M. setense strain Manresensis relative to those of the type strain, and it shows the genome segments unique to each strain. PMID:25657273

Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.

PubMed

Iguchi, Atsushi; Shirai, Hiroki; Seto, Kazuko; Ooka, Tadasuke; Ogura, Yoshitoshi; Hayashi, Tetsuya; Osawa, Kayo; Osawa, Ro

2011-01-01

Most Escherichia coli O157-serogroup strains are classified as enterohemorrhagic E. coli (EHEC), which is known as an important food-borne pathogen for humans. They usually produce Shiga toxin (Stx) 1 and/or Stx2, and express H7-flagella antigen (or nonmotile). However, O157 strains that do not produce Stxs and express H antigens different from H7 are sometimes isolated from clinical and other sources. Multilocus sequence analysis revealed that these 21 O157:non-H7 strains tested in this study belong to multiple evolutionary lineages different from that of EHEC O157:H7 strains, suggesting a wide distribution of the gene set encoding the O157-antigen biosynthesis in multiple lineages. To gain insight into the gene organization and the sequence similarity of the O157-antigen biosynthesis gene clusters, we conducted genomic comparisons of the chromosomal regions (about 59 kb in each strain) covering the O-antigen gene cluster and its flanking regions between six O157:H7/non-H7 strains. Gene organization of the O157-antigen gene cluster was identical among O157:H7/non-H7 strains, but was divided into two distinct types at the nucleotide sequence level. Interestingly, distribution of the two types did not clearly follow the evolutionary lineages of the strains, suggesting that horizontal gene transfer of both types of O157-antigen gene clusters has occurred independently among E. coli strains. Additionally, detailed sequence comparison revealed that some positions of the repetitive extragenic palindromic (REP) sequences in the regions flanking the O-antigen gene clusters were coincident with possible recombination points. From these results, we conclude that the horizontal transfer of the O157-antigen gene clusters induced the emergence of multiple O157 lineages within E. coli and speculate that REP sequences may involve one of the driving forces for exchange and evolution of O-antigen loci.

Sequence-based genotyping clarifies conflicting historical morphometric and biological data for 5 Eimeria species infecting turkeys.

PubMed

El-Sherry, S; Ogedengbe, M E; Hafeez, M A; Sayf-Al-Din, M; Gad, N; Barta, J R

2015-02-01

Unlike with Eimeria species infecting chickens, specific identification and nomenclature of Eimeria species infecting turkeys is complicated, and in the absence of molecular data, imprecise. In an attempt to reconcile contradictory data reported on oocyst morphometrics and biological descriptions of various Eimeria species infecting turkey, we established single oocyst derived lines of 5 important Eimeria species infecting turkeys, Eimeria meleagrimitis (USMN08-01 strain), Eimeria adenoeides (Guelph strain), Eimeria gallopavonis (Weybridge strain), Eimeria meleagridis (USAR97-01 strain), and Eimeria dispersa (Briston strain). Short portions (514 bp) of mitochondrial cytochrome c oxidase subunit I gene (mt COI) from each were amplified and sequenced. Comparison of these sequences showed sufficient species-specific sequence variation to recommend these short mt COI sequences as species-specific markers. Uniformity of oocyst features (dimensions and oocyst structure) of each pure line was observed. Additional morphological features of the oocysts of these species are described as useful for the microscopic differentiation of these Eimeria species. Combined molecular and morphometric data on these single species lines compared with the original species descriptions and more recent data have helped to clarify some confusing, and sometimes conflicting, features associated with these Eimeria spp. For example, these new data suggest that the KCH and KR strains of E. adenoeides reported previously represent 2 distinct species, E. adenoeides and E. meleagridis, respectively. Likewise, analysis of the Weybridge strain of E. adenoeides, which has long been used as a reference strain in various studies conducted on the pathogenicity of E. adenoeides, indicates that this coccidium is actually a strain of E. gallopavonis. We highly recommend mt COI sequence-based genotyping be incorporated into all studies using Eimeria spp. of turkeys to confirm species identifications and so that any resulting data can be associated correctly with a single named Eimeria species. © 2015 Poultry Science Association Inc.

First Report of a Fatal Case Associated with EV-D68 Infection in Hong Kong and Emergence of an Interclade Recombinant in China Revealed by Genome Analysis.

PubMed

Yip, Cyril C Y; Lo, Janice Y C; Sridhar, Siddharth; Lung, David C; Luk, Shik; Chan, Kwok-Hung; Chan, Jasper F W; Cheng, Vincent C C; Woo, Patrick C Y; Yuen, Kwok-Yung; Lau, Susanna K P

2017-05-16

A fatal case associated with enterovirus D68 (EV-D68) infection affecting a 10-year-old boy was reported in Hong Kong in 2014. To examine if a new strain has emerged in Hong Kong, we sequenced the partial genome of the EV-D68 strain identified from the fatal case and the complete VP1, and partial 5'UTR and 2C sequences of nine additional EV-D68 strains isolated from patients in Hong Kong. Sequence analysis indicated that a cluster of strains including the previously recognized A2 strains should belong to a separate clade, clade D, which is further divided into subclades D1 and D2. Among the 10 EV-D68 strains, 7 (including the fatal case) belonged to the previously described, newly emerged subclade B3, 2 belonged to subclade B1, and 1 belonged to subclade D1. Three EV-D68 strains, each from subclades B1, B3, and D1, were selected for complete genome sequencing and recombination analysis. While no evidence of recombination was noted among local strains, interclade recombination was identified in subclade D2 strains detected in mainland China in 2008 with VP2 acquired from clade A. This study supports the reclassification of subclade A2 into clade D1, and demonstrates interclade recombination between clades A and D2 in EV-D68 strains from China.

Complete Genome Sequences of Six Strains of the Genus Methylobacterium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marx, Christopher J; Bringel, Francoise O.; Christoserdova, Ludmila

The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.

Complete genome sequences of six strains of the genus methylobacterium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marx, Christopher J; Bringel, Francoise O.; Christoserdova, Ludmila

The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.

Recombination of Globally Circulating Varicella-Zoster Virus

PubMed Central

Depledge, Daniel P.; Kundu, Samit; Atkinson, Claire; Brown, Julianne; Haque, Tanzina; Hussaini, Yusuf; MacMahon, Eithne; Molyneaux, Pamela; Papaevangelou, Vassiliki; Sengupta, Nitu; Koay, Evelyn S. C.; Tang, Julian W.; Underhill, Gillian S.; Grahn, Anna; Studahl, Marie; Breuer, Judith; Bergström, Tomas

2015-01-01

ABSTRACT Varicella-zoster virus (VZV) is a human herpesvirus, which during primary infection typically causes varicella (chicken pox) and establishes lifelong latency in sensory and autonomic ganglia. Later in life, the virus may reactivate to cause herpes zoster (HZ; also known as shingles). To prevent these diseases, a live-attenuated heterogeneous vaccine preparation, vOka, is used routinely in many countries worldwide. Recent studies of another alphaherpesvirus, infectious laryngotracheitis virus, demonstrate that live-attenuated vaccine strains can recombine in vivo, creating virulent progeny. These findings raised concerns about using attenuated herpesvirus vaccines under conditions that favor recombination. To investigate whether VZV may undergo recombination, which is a prerequisite for VZV vaccination to create such conditions, we here analyzed 115 complete VZV genomes. Our results demonstrate that recombination occurs frequently for VZV. It thus seems that VZV is fully capable of recombination if given the opportunity, which may have important implications for continued VZV vaccination. Although no interclade vaccine-wild-type recombinant strains were found, intraclade recombinants were frequently detected in clade 2, which harbors the vaccine strains, suggesting that the vaccine strains have already been involved in recombination events, either in vivo or in vitro during passages in cell culture. Finally, previous partial and complete genomic studies have described strains that do not cluster phylogenetically to any of the five established clades. The additional VZV strains sequenced here, in combination with those previously published, have enabled us to formally define a novel sixth VZV clade. IMPORTANCE Although genetic recombination has been demonstrated to frequently occur for other human alphaherpesviruses, herpes simplex viruses 1 and 2, only a few ancient and isolated recent recombination events have hitherto been demonstrated for VZV. In the present study, we demonstrate that VZV also frequently undergoes genetic recombination, including strains belonging to the clade containing the vOKA strain. PMID:25926648

Biofilm Formation Potential of Heat-Resistant Escherichia coli Dairy Isolates and the Complete Genome of Multidrug-Resistant, Heat-Resistant Strain FAM21845

PubMed Central

Schmid, Michael; Kulli, Sandra; Schneeberger, Kerstin; Naskova, Javorka; Knøchel, Susanne; Ahrens, Christian H.

2017-01-01

ABSTRACT We tested the biofilm formation potential of 30 heat-resistant and 6 heat-sensitive Escherichia coli dairy isolates. Production of curli and cellulose, static biofilm formation on polystyrene (PS) and stainless steel surfaces, biofilm formation under dynamic conditions (Bioflux), and initial adhesion rates (IAR) were evaluated. Biofilm formation varied greatly between strains, media, and assays. Our results highlight the importance of the experimental setup in determining biofilm formation under conditions of interest, as correlation between different assays was often not a given. The heat-resistant, multidrug-resistant (MDR) strain FAM21845 showed the strongest biofilm formation on PS and the highest IAR and was the only strain that formed significant biofilms on stainless steel under conditions relevant to the dairy industry, and it was therefore fully sequenced. Its chromosome is 4.9 Mb long, and it harbors a total of five plasmids (147.2, 54.2, 5.8, 2.5, and 1.9 kb). The strain carries a broad range of genes relevant to antimicrobial resistance and biofilm formation, including some on its two large conjugative plasmids, as demonstrated in plate mating assays. IMPORTANCE In biofilms, cells are embedded in an extracellular matrix that protects them from stresses, such as UV radiation, osmotic shock, desiccation, antibiotics, and predation. Biofilm formation is a major bacterial persistence factor of great concern in the clinic and the food industry. Many tested strains formed strong biofilms, and especially strains such as the heat-resistant, MDR strain FAM21845 may pose a serious issue for food production. Strong biofilm formation combined with diverse resistances (some encoded on conjugative plasmids) may allow for increased persistence, coselection, and possible transfer of these resistance factors. Horizontal gene transfer may conceivably occur in the food production setting or the gastrointestinal tract after consumption. PMID:28550056

Biofilm Formation Potential of Heat-Resistant Escherichia coli Dairy Isolates and the Complete Genome of Multidrug-Resistant, Heat-Resistant Strain FAM21845.

PubMed

Marti, Roger; Schmid, Michael; Kulli, Sandra; Schneeberger, Kerstin; Naskova, Javorka; Knøchel, Susanne; Ahrens, Christian H; Hummerjohann, Jörg

2017-08-01

We tested the biofilm formation potential of 30 heat-resistant and 6 heat-sensitive Escherichia coli dairy isolates. Production of curli and cellulose, static biofilm formation on polystyrene (PS) and stainless steel surfaces, biofilm formation under dynamic conditions (Bioflux), and initial adhesion rates (IAR) were evaluated. Biofilm formation varied greatly between strains, media, and assays. Our results highlight the importance of the experimental setup in determining biofilm formation under conditions of interest, as correlation between different assays was often not a given. The heat-resistant, multidrug-resistant (MDR) strain FAM21845 showed the strongest biofilm formation on PS and the highest IAR and was the only strain that formed significant biofilms on stainless steel under conditions relevant to the dairy industry, and it was therefore fully sequenced. Its chromosome is 4.9 Mb long, and it harbors a total of five plasmids (147.2, 54.2, 5.8, 2.5, and 1.9 kb). The strain carries a broad range of genes relevant to antimicrobial resistance and biofilm formation, including some on its two large conjugative plasmids, as demonstrated in plate mating assays. IMPORTANCE In biofilms, cells are embedded in an extracellular matrix that protects them from stresses, such as UV radiation, osmotic shock, desiccation, antibiotics, and predation. Biofilm formation is a major bacterial persistence factor of great concern in the clinic and the food industry. Many tested strains formed strong biofilms, and especially strains such as the heat-resistant, MDR strain FAM21845 may pose a serious issue for food production. Strong biofilm formation combined with diverse resistances (some encoded on conjugative plasmids) may allow for increased persistence, coselection, and possible transfer of these resistance factors. Horizontal gene transfer may conceivably occur in the food production setting or the gastrointestinal tract after consumption. Copyright © 2017 Marti et al.

Draft genome sequence of Escherichia coli ST977: A clinical multidrug-resistant strain harbouring blaNDM-3 isolated from a bloodstream infection.

PubMed

Li, Xi; Sun, Long; Zhu, Yongze; Shen, Mengyuan; Tu, Yuexing

2018-04-14

The emergence of carbapenem-resistant Escherichia coli has become a serious challenge to manage in the clinic because of multidrug resistance. Here we report the draft genome sequence of NDM-3-producing E. coli strain NT1 isolated from a bloodstream infection in China. Whole genomic DNA of E. coli strain NT1 was extracted and was sequenced using an Illumina HiSeq™ X Ten platform. The generated sequence reads were assembled using CLC Genomics Workbench. The draft genome was annotated using Rapid Annotation using Subsystem Technology (RAST). Bioinformatics analysis was further performed. The genome size was calculated at 5,353 620bp, with 5297 protein-coding sequences and the presence of genes conferring resistance to aminoglycosides, β-lactams, quinolones, macrolides, phenicols, sulphonamides, tetracycline and trimethoprim. In addition, genes encoding virulence factors were also identified. To our knowledge, this is the first report of an E. coli strain producing NDM-3 isolated from a human bloodstream infection. The genome sequence will provide valuable information to understand antibiotic resistance mechanisms and pathogenic mechanisms in this strain. Close surveillance is urgently needed to monitor the spread of NDM-3-producing isolates. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Comparative Analysis of the First Complete Enterococcus faecium Genome

PubMed Central

Lam, Margaret M. C.; Seemann, Torsten; Bulach, Dieter M.; Gladman, Simon L.; Chen, Honglei; Haring, Volker; Moore, Robert J.; Ballard, Susan; Grayson, M. Lindsay; Johnson, Paul D. R.; Howden, Benjamin P.

2012-01-01

Vancomycin-resistant enterococci (VRE) are one of the leading causes of nosocomial infections in health care facilities around the globe. In particular, infections caused by vancomycin-resistant Enterococcus faecium are becoming increasingly common. Comparative and functional genomic studies of E. faecium isolates have so far been limited owing to the lack of a fully assembled E. faecium genome sequence. Here we address this issue and report the complete 3.0-Mb genome sequence of the multilocus sequence type 17 vancomycin-resistant Enterococcus faecium strain Aus0004, isolated from the bloodstream of a patient in Melbourne, Australia, in 1998. The genome comprises a 2.9-Mb circular chromosome and three circular plasmids. The chromosome harbors putative E. faecium virulence factors such as enterococcal surface protein, hemolysin, and collagen-binding adhesin. Aus0004 has a very large accessory genome (38%) that includes three prophage and two genomic islands absent among 22 other E. faecium genomes. One of the prophage was present as inverted 50-kb repeats that appear to have facilitated a 683-kb chromosomal inversion across the replication terminus, resulting in a striking replichore imbalance. Other distinctive features include 76 insertion sequence elements and a single chromosomal copy of Tn1549 containing the vanB vancomycin resistance element. A complete E. faecium genome will be a useful resource to assist our understanding of this emerging nosocomial pathogen. PMID:22366422

Distribution of Bartonella henselae Variants in Patients, Reservoir Hosts and Vectors in Spain

PubMed Central

Gil, Horacio; Escudero, Raquel; Pons, Inmaculada; Rodríguez-Vargas, Manuela; García-Esteban, Coral; Rodríguez-Moreno, Isabel; García-Amil, Cristina; Lobo, Bruno; Valcárcel, Félix; Pérez, Azucena; Jiménez, Santos; Jado, Isabel; Juste, Ramón; Segura, Ferrán; Anda, Pedro

2013-01-01

We have studied the diversity of B. henselae circulating in patients, reservoir hosts and vectors in Spain. In total, we have fully characterized 53 clinical samples from 46 patients, as well as 78 B. henselae isolates obtained from 35 cats from La Rioja and Catalonia (northeastern Spain), four positive cat blood samples from which no isolates were obtained, and three positive fleas by Multiple Locus Sequence Typing and Multiple Locus Variable Number Tandem Repeats Analysis. This study represents the largest series of human cases characterized with these methods, with 10 different sequence types and 41 MLVA profiles. Two of the sequence types and 35 of the profiles were not described previously. Most of the B. henselae variants belonged to ST5. Also, we have identified a common profile (72) which is well distributed in Spain and was found to persist over time. Indeed, this profile seems to be the origin from which most of the variants identified in this study have been generated. In addition, ST5, ST6 and ST9 were found associated with felines, whereas ST1, ST5 and ST8 were the most frequent sequence types found infecting humans. Interestingly, some of the feline associated variants never found on patients were located in a separate clade, which could represent a group of strains less pathogenic for humans. PMID:23874563

Occurrence of trans monounsaturated and polyunsaturated fatty acids in Colwellia psychrerythraea strain 34H.

PubMed

Hashimoto, Mikako; Orikasa, Yoshitake; Hayashi, Hidenori; Watanabe, Kentaro; Yoshida, Kiyohito; Okuyama, Hidetoshi

2015-07-01

Colwellia psychrerythraea strain 34H is an obligately psychrophilic bacterium that has been used as a model cold-adapted microorganism because of its psychrophilic growth profile, significant production of cold-active enzymes, and cryoprotectant extracellular polysaccharide substances. However, its fatty acid components, particularly trans unsaturated fatty acids and long-chain polyunsaturated fatty acids (LC-PUFAs), have not been fully investigated. In this study, we biochemically identified Δ9-trans hexadecenoic acid [16:1(9t)] and LC-PUFAs such as docosahexaenoic acid. These results are comparable with the fact that the strain 34H genome sequence includes pfa and cti genes that are responsible for the biosynthesis of LC-PUFAs and trans unsaturated fatty acids, respectively. Strain 34H cells grown under static conditions at 5 °C had higher levels of 16:1(9t) than those grown under shaken conditions, and this change was accompanied by an antiparallel decrease in the levels of Δ9-cis hexadecenoic acid [16:1(9c)], suggesting that the cis-to-trans isomerization reaction of 16:1(9c) is activated under static (microanaerobic) culture conditions, that is, the enzyme could be activated by the decreased dissolved oxygen concentration of cultures. On the other hand, the levels of LC-PUFAs were too low (less than 3% of the total), even for cells grown at 5 °C, to evaluate their cold-adaptive function in this bacterium. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genome sequence of Frateuria aurantia type strain (Kondô 67T), a xanthomonade isolated from Lilium auratium Lindl.

PubMed Central

Anderson, Iain; Teshima, Huzuki; Nolan, Matt; Lapidus, Alla; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Rohde, Manfred; Lang, Elke; Detter, John C.; Göker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

2013-01-01

Frateuria aurantia (ex Kondô and Ameyama 1958) Swings et al. 1980 is a member of the bispecific genus Frateuria in the family Xanthomonadaceae, which is already heavily targeted for non-type strain genome sequencing. Strain Kondô 67T was initially (1958) identified as a member of ‘Acetobacter aurantius’, a name that was not considered for the approved list. Kondô 67T was therefore later designated as the type strain of the newly proposed acetogenic species Frateuria aurantia. The strain is of interest because of its triterpenoids (hopane family). F. aurantia Kondô 67T is the first member of the genus Frateura whose genome sequence has been deciphered, and here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,603,458-bp long chromosome with its 3,200 protein-coding and 88 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:24501647

Genome sequence of Frateuria aurantia type strain (Kondô 67T), a xanthomonade isolated from Lilium auratium Lindl.

DOE PAGES

Anderson, Iain; Teshima, Huzuki; Nolan, Matt; ...

2013-10-16

Frateuria aurantia (ex Kondô and Ameyama 1958) Swings et al. 1980 is a member of the bispecific genus Frateuria in the family Xanthomonadaceae, which is already heavily targeted for non-type strain genome sequencing. Strain Kondô 67 T was initially (1958) identified as a member of ‘Acetobacter aurantius’, a name that was not considered for the approved list. Kondô 67 T was therefore later designated as the type strain of the newly proposed acetogenic species Frateuria aurantia. The strain is of interest because of its triterpenoids (hopane family). F. aurantia Kondô 67 T is the first member of the genus Frateuramore » whose genome sequence has been deciphered, and here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,603,458-bp long chromosome with its 3,200 protein-coding and 88 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less

Permanent draft genome sequence of the gliding predator Saprospira grandis strain Sa g1 (= HR1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mavromatis, K; Chertkov, Olga; Lapidus, Alla L.

2012-01-01

Saprospira grandis Gross et al. 1911 is a member of the Saprospiraceae, a family in the class 'Sphingobacteria' that remains poorly characterized at the genomic level. The species is known for preying on other marine bacteria via 'ixotrophy'. S. grandis strain Sa g1 was isolated from decaying crab carapace in France and was selected for genome sequencing because of its isolated location in the tree of life. Only one type strain genome has been published so far from the Saprospiraceae, while the sequence of strain Sa g1 represents the second genome to be published from a non-type strain of S.more » grandis. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,495,250 bp long Improved-High-Quality draft of the genome with its 3,536 protein-coding and 62 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less

Genetic characterization of human herpesvirus type 1: Full-length genome sequence of strain obtained from an encephalitis case from India.

PubMed

Bondre, Vijay P; Sankararaman, Vasudha; Andhare, Vijaysinh; Tupekar, Manisha; Sapkal, Gajanan N

2016-11-01

Human herpes simplex virus 1 (HSV-1) is the most common cause of sporadic encephalitis in humans that contributes to >10 per cent of the encephalitis cases occurring worldwide. Availability of limited full genome sequences from a small number of isolates resulted in poor understanding of host and viral factors responsible for variable clinical outcome. In this study genetic relationship, extent and source of recombination using full-length genome sequence derived from a newly isolated HSV-1 isolate was studied in comparison with those sampled from patients with varied clinical outcome. Full genome sequence of HSV-1 isolated from cerebrospinal fluid (CSF) of a patient with acute encephalitis syndrome (AES) by inoculation in baby hamster kidney-21 (BHK-21) cells was determined using next-generation sequencing (NGS) technology. Phylogenetic analysis of the newly generated sequence in comparison with 33 additional full-length genomes defined genetic relationship with worldwide distributed strains. The bootscan and similarity plot analysis defined recombination crossovers and similarities between newly isolated Indian HSV-1 with six Asian and a total of 34 worldwide isolated strains. Mapping of 376,332 reads amplified from HSV-1 DNA by NGS generated full-length genome of 151,024 bp from newly isolated Indian HSV-1. Phylogenetic analysis classified worldwide distributed strains into three major evolutionary lineages correlating to their geographic distribution. Lineage 1 containing strains were isolated from America and Europe; lineage 2 contained all the strains from Asian countries along with the North American KOS and RE strains whereas the South African isolates were distributed into two groups under lineage 3. Recombination analysis confirmed events of recombination in Indian HSV-1 genome resulting from mixing of different strains evolved in Asian countries. Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections.

Genetic characterization of human herpesvirus type 1: Full-length genome sequence of strain obtained from an encephalitis case from India

PubMed Central

Bondre, Vijay P.; Sankararaman, Vasudha; Andhare, Vijaysinh; Tupekar, Manisha; Sapkal, Gajanan N.

2016-01-01

Background & objectives: Human herpes simplex virus 1 (HSV-1) is the most common cause of sporadic encephalitis in humans that contributes to >10 per cent of the encephalitis cases occurring worldwide. Availability of limited full genome sequences from a small number of isolates resulted in poor understanding of host and viral factors responsible for variable clinical outcome. In this study genetic relationship, extent and source of recombination using full-length genome sequence derived from a newly isolated HSV-1 isolate was studied in comparison with those sampled from patients with varied clinical outcome. Methods: Full genome sequence of HSV-1 isolated from cerebrospinal fluid (CSF) of a patient with acute encephalitis syndrome (AES) by inoculation in baby hamster kidney-21 (BHK-21) cells was determined using next-generation sequencing (NGS) technology. Phylogenetic analysis of the newly generated sequence in comparison with 33 additional full-length genomes defined genetic relationship with worldwide distributed strains. The bootscan and similarity plot analysis defined recombination crossovers and similarities between newly isolated Indian HSV-1 with six Asian and a total of 34 worldwide isolated strains. Results: Mapping of 376,332 reads amplified from HSV-1 DNA by NGS generated full-length genome of 151,024 bp from newly isolated Indian HSV-1. Phylogenetic analysis classified worldwide distributed strains into three major evolutionary lineages correlating to their geographic distribution. Lineage 1 containing strains were isolated from America and Europe; lineage 2 contained all the strains from Asian countries along with the North American KOS and RE strains whereas the South African isolates were distributed into two groups under lineage 3. Recombination analysis confirmed events of recombination in Indian HSV-1 genome resulting from mixing of different strains evolved in Asian countries. Interpretation & conclusions: Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections. PMID:28361829

Complete genome sequence of Streptococcus mutans GS-5, a serotype c strain.

PubMed

Biswas, Saswati; Biswas, Indranil

2012-09-01

Streptococcus mutans, a principal causative agent of dental caries, is considered to be the most cariogenic among all oral streptococci. Of the four S. mutans serotypes (c, e, f, and k), serotype c strains predominate in the oral cavity. Here, we present the complete genome sequence of S. mutans GS-5, a serotype c strain originally isolated from human carious lesions, which is extensively used as a laboratory strain worldwide.

Complete Genome Sequence of Acinetobacter baumannii CIP 70.10, a Susceptible Reference Strain for Comparative Genome Analyses.

PubMed

Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Pühler, Alfred; Poirel, Laurent; Schlüter, Andreas

2015-07-30

The complete genome sequence for the reference strain Acinetobacter baumannii CIP 70.10 (ATCC 15151) was established. The strain was isolated in France in 1970, is susceptible to most antimicrobial compounds, and is therefore of importance for comparative genome analyses with clinical multidrug-resistant (MDR) A. baumannii strains to study resistance development and acquisition in this emerging human pathogen. Copyright © 2015 Krahn et al.

Sequence and expression of two cry8 genes from Bacillus thuringiensis INTA Fr7-4, a native strain from Argentina.

PubMed

Navas, Laura E; Berretta, Marcelo F; Pérez, Melisa P; Amadio, Ariel F; Ortiz, Elio M; Sauka, Diego H; Benintende, Graciela B; Zandomeni, Rubén O

2014-01-01

We found and characterized two cry8 genes from the Bacillus thuringiensis strain INTA Fr7-4 isolated in Argentina. These genes, cry8Kb3 and cry8Pa3, are located in a tandem array within a 13,200-bp DNA segment sequenced from a preparation of total DNA. They encode 1,169- and 1,176-amino-acid proteins, respectively. Both genes were cloned with their promoter sequences and the proteins were expressed separately in an acrystalliferous strain of B. thuringiensis leading to the formation of ovoid crystals in the recombinant strains. The toxicity against larvae of Anthonomus grandis Bh. (Coleoptera: Curculionidae) of a spore-crystal suspension from the recombinant strain containing cry8Pa3 was similar to that of the parent strain INTA Fr7-4. © 2014 S. Karger AG, Basel.

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Comprehensive Insights in the Mycobacterium avium subsp. paratuberculosis Genome Using New WGS Data of Sheep Strain JIII-386 from Germany

PubMed Central

Möbius, Petra; Hölzer, Martin; Felder, Marius; Nordsiek, Gabriele; Groth, Marco; Köhler, Heike; Reichwald, Kathrin; Platzer, Matthias; Marz, Manja

2015-01-01

Mycobacterium avium (M. a.) subsp. paratuberculosis (MAP)—the etiologic agent of Johne’s disease—affects cattle, sheep, and other ruminants worldwide. To decipher phenotypic differences among sheep and cattle strains (belonging to MAP-S [Type-I/III], respectively, MAP-C [Type-II]), comparative genome analysis needs data from diverse isolates originating from different geographic regions of the world. This study presents the so far best assembled genome of a MAP-S-strain: Sheep isolate JIII-386 from Germany. One newly sequenced cattle isolate (JII-1961, Germany), four published MAP strains of MAP-C and MAP-S from the United States and Australia, and M. a. subsp. hominissuis (MAH) strain 104 were used for assembly improvement and comparisons. All genomes were annotated by BacProt and results compared with NCBI (National Center for Biotechnology Information) annotation. Corresponding protein-coding sequences (CDSs) were detected, but also CDSs that were exclusively determined by either NCBI or BacProt. A new Shine–Dalgarno sequence motif (5′-AGCTGG-3′) was extracted. Novel CDSs including PE-PGRS family protein genes and about 80 noncoding RNAs exhibiting high sequence conservation are presented. Previously found genetic differences between MAP-types are partially revised. Four of ten assumed MAP-S-specific large sequence polymorphism regions (LSPSs) are still present in MAP-C strains; new LSPSs were identified. Independently of the regional origin of the strains, the number of individual CDSs and single nucleotide variants confirms the strong similarity of MAP-C strains and shows higher diversity among MAP-S strains. This study gives ambiguous results regarding the hypothesis that MAP-S is the evolutionary intermediate between MAH and MAP-C, but it clearly shows a higher similarity of MAP to MAH than to Mycobacterium intracellulare. PMID:26384038

[Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].

PubMed

Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu

2002-12-01

Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.

Complete Genome Sequence of Magnetospirillum gryphiswaldense MSR-1

PubMed Central

Wang, Xu; Wang, Qing; Zhang, Weijia; Wang, Yinjia; Li, Li; Wen, Tong; Zhang, Tongwei; Zhang, Yang; Xu, Jun; Hu, Junying; Li, Shuqi; Liu, Lingzi; Liu, Jinxin; Jiang, Wei; Tian, Jiesheng; Wang, Lei; Li, Jilun

2014-01-01

We report the complete genomic sequence of Magnetospirillum gryphiswaldense MSR-1 (DSM 6361), a type strain of the genus Magnetospirillum belonging to the Alphaproteobacteria. Compared to the reported draft sequence, extensive rearrangements and differences were found, indicating high genomic flexibility and “domestication” by accelerated evolution of the strain upon repeated passaging. PMID:24625872

Genomics sequence analysis of the United States infectious laryngotracheitis vaccine strains chicken embryo origin (CEO) and tissue culture origin (TCO)

USDA-ARS?s Scientific Manuscript database

The genomic sequences of low and high passages of the United States infectious laryngotracheitis (ILT) vaccine strains CEO and TCO were determined using hybrid next generation sequencing in order to define genomic changes associated with attenuation and reversion to virulence. Phylogenetic analysis ...

Genome Sequences for Five Strains of the Emerging Pathogen Haemophilus haemolyticus

PubMed Central

Jordan, I. King; Conley, Andrew B.; Antonov, Ivan V.; Arthur, Robert A.; Cook, Erin D.; Cooper, Guy P.; Jones, Bernard L.; Knipe, Kristen M.; Lee, Kevin J.; Liu, Xing; Mitchell, Gabriel J.; Pande, Pushkar R.; Petit, Robert A.; Qin, Shaopu; Rajan, Vani N.; Sarda, Shruti; Sebastian, Aswathy; Tang, Shiyuyun; Thapliyal, Racchit; Varghese, Neha J.; Ye, Tianjun; Katz, Lee S.; Wang, Xin; Rowe, Lori; Frace, Michael; Mayer, Leonard W.

2011-01-01

We report the first whole-genome sequences for five strains, two carried and three pathogenic, of the emerging pathogen Haemophilus haemolyticus. Preliminary analyses indicate that these genome sequences encode markers that distinguish H. haemolyticus from its closest Haemophilus relatives and provide clues to the identity of its virulence factors. PMID:21952546

Complete genome sequence of a divergent strain of Japanese yam mosaic virus from China

USDA-ARS?s Scientific Manuscript database

A novel strain of Japanese yam mosaic virus (JYMV-CN) was identified in a yam plant with foliar mottle symptoms in China. The complete genomic sequence of JYMV-CN was determined. Its genomic sequence of 9701 nucleotides encodes a polyprotein of 3247 amino acids. Its organization was virtually identi...

Draft Genome Sequences of Several Fungal Strains Selected for Exposure to Microgravity at the International Space Station.

PubMed

Singh, Nitin K; Blachowicz, Adriana; Romsdahl, Jillian; Wang, Clay; Torok, Tamas; Venkateswaran, Kasthuri

2017-04-13

The whole-genome sequences of eight fungal strains that were selected for exposure to microgravity at the International Space Station are presented here. These baseline sequences will help to understand the observed production of novel bioactive compounds. Copyright © 2017 Singh et al.

Draft Genome Sequence of Saccharomyces cerevisiae Barra Grande (BG-1), a Brazilian Industrial Bioethanol-Producing Strain

PubMed Central

Coutouné, Natalia; Mulato, Aline Tieppo Nogueira

2017-01-01

ABSTRACT Here, we present the draft genome sequence of Saccharomyces cerevisiae BG-1, a Brazilian industrial strain widely used for bioethanol production from sugarcane. The 11.7-Mb genome sequence consists of 216 scaffolds and harbors 5,607 predicted protein-coding genes. PMID:28360170

Complete genome sequences of two strains of the meat spoilage bacterium Brochothrix thermosphacta isolated from ground chicken

USDA-ARS?s Scientific Manuscript database

Brochothrix thermosphacta is an important meat spoilage bacterium. Here we report the genome sequences of two strains of B. thermosphacta isolated from ground chicken. The genome sequences were determined using long-read PacBio single-molecule real-time (SMRT©) technology and are the first complete ...

Complete Genome Sequence of the Probiotic Strain Lactobacillus salivarius LPM01

PubMed Central

Codoñer, Francisco M.; Martinez-Blanch, Juan F.; Acevedo-Piérart, Marcelo; Ormeño, M. Loreto; Ramón, Daniel

2016-01-01

Lactobacillus salivarius LPM01 (DSM 22150) is a probiotic strain able to improve health status in immunocompromised people. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insights into its functional activity and safety assessment. PMID:27881545

Short, interspersed, and repetitive DNA sequences in Spiroplasma species.

PubMed

Nur, I; LeBlanc, D J; Tully, J G

1987-03-01

Small fragments of DNA from an 8-kbp plasmid, pRA1, from a plant pathogenic strain of Spiroplasma citri were shown previously to be present in the chromosomal DNA of at least two species of Spiroplasma. We describe here the shot-gun cloning of chromosomal DNA from S. citri Maroc and the identification of two distinct sequences exhibiting homology to pRA1. Further subcloning experiments provided specific molecular probes for the identification of these two sequences in chromosomal DNA from three distinct plant pathogenic species of Spiroplasma. The results of Southern blot hybridization indicated that each of the pRA1-associated sequences is present as multiple copies in short, dispersed, and repetitive sequences in the chromosomes of these three strains. None of the sequences was detectable in chromosomal DNA from an additional nine Spiroplasma strains examined.

The new modern era of yeast genomics: community sequencing and the resulting annotation of multiple Saccharomyces cerevisiae strains at the Saccharomyces Genome Database

PubMed Central

Engel, Stacia R.; Cherry, J. Michael

2013-01-01

The first completed eukaryotic genome sequence was that of the yeast Saccharomyces cerevisiae, and the Saccharomyces Genome Database (SGD; http://www.yeastgenome.org/) is the original model organism database. SGD remains the authoritative community resource for the S. cerevisiae reference genome sequence and its annotation, and continues to provide comprehensive biological information correlated with S. cerevisiae genes and their products. A diverse set of yeast strains have been sequenced to explore commercial and laboratory applications, and a brief history of those strains is provided. The publication of these new genomes has motivated the creation of new tools, and SGD will annotate and provide comparative analyses of these sequences, correlating changes with variations in strain phenotypes and protein function. We are entering a new era at SGD, as we incorporate these new sequences and make them accessible to the scientific community, all in an effort to continue in our mission of educating researchers and facilitating discovery. Database URL: http://www.yeastgenome.org/ PMID:23487186