21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... as a source of iron in foods for special dietary use, when the use is consistent with good nutrition...

Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition

PubMed Central

Sciacovelli, Marco; Gonçalves, Emanuel; Isaac Johnson, Timothy; Roberto Zecchini, Vincent; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Vercauteren Drubbel, Alizee; Julian Theobald, Sebastian; Abbo, Sandra; Tran, Maxine; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Richard Maher, Eamonn; Henry Maxwell, Patrick; Saez-Rodriguez, Julio; Frezza, Christian

2016-01-01

Mutations of the tricarboxylic acid cycle (TCA cycle) enzyme fumarate hydratase (FH) cause Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)1. FH-deficient renal cancers are highly aggressive and metastasise even when small, leading to an abysmal clinical outcome2. Fumarate, a small molecule metabolite that accumulates in FH-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite3. Fumarate was shown to inhibit α-ketoglutarate (aKG)-dependent dioxygenases involved in DNA and histone demethylation4,5. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of FH and the subsequent accumulation of fumarate elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis6. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster6 miR-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of FH-proficient cells with cell-permeable fumarate. Loss of FH is associated with suppression of miR-200 and EMT signature in renal cancer patients, and is associated with poor clinical outcome. These results imply that loss of FH and fumarate accumulation contribute to the aggressive features of FH-deficient tumours. PMID:27580029

Production of fumaric acid by immobilized Rhizopus arrhizus RH 7-13-9# on loofah fiber in a stirred-tank reactor.

PubMed

Liu, Huan; Zhao, Shijie; Jin, Yuhan; Yue, Xuemin; Deng, Li; Wang, Fang; Tan, Tianwei

2017-11-01

Fumaric acid is an important building-block chemical. The production of fumaric acid by fermentation is possible. Loofah fiber is a natural, biodegradable, renewable polymer material with highly sophisticated and pore structure. This work investigated a new immobilization method using loofah fiber as carrier to produce fumaric acid in a stirred-tank reactor. Compared with other carriers, loofah fiber was proven to be efficiently and successfully used in the reactor. After the optimization process, 20g addition of loofah fiber and 400rpm agitation speed were chosen as the most suitable process conditions. 30.3g/L fumaric acid in the broth as well as 19.16g fumaric acid in the precipitation of solid was achieved, while the yield from glucose reached 0.211g/g. Three batches of fermentation using the same loofah fiber carrier were conducted successfully, which meant it provided a new method to produce fumaric acid in a stirred-tank reactor. Copyright © 2017. Published by Elsevier Ltd.

Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

PubMed Central

2012-01-01

Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

Fumaric Acid Production from Alkali-Pretreated Corncob by Fed-Batch Simultaneous Saccharification and Fermentation Combined with Separated Hydrolysis and Fermentation at High Solids Loading.

PubMed

Li, Xin; Zhou, Jin; Ouyang, Shuiping; Ouyang, Jia; Yong, Qiang

2017-02-01

Production of fumaric acid from alkali-pretreated corncob (APC) at high solids loading was investigated using a combination of separated hydrolysis and fermentation (SHF) and fed-batch simultaneous saccharification and fermentation (SSF) by Rhizopus oryzae. Four different fermentation modes were tested to maximize fumaric acid concentration at high solids loading. The highest concentration of 41.32 g/L fumaric acid was obtained from 20 % (w/v) APC at 38 °C in the combined SHF and fed-batch SSF process, compared with 19.13 g/L fumaric acid in batch SSF alone. The results indicated that a combination of SHF and fed-batch SSF significantly improved production of fumaric acid from lignocellulose by R. oryzae than that achieved with batch SSF at high solids loading.

Effect of sodium lauryl sulfate-fumaric Acid coupled addition on the in vitro rumen fermentation with special regard to methanogenesis.

PubMed

Abdl-Rahman, M A; Sawiress, F A R; Abd El-Aty, A M

2010-01-01

The aim of the current study was to evaluate the effect of sodium lauryl sulfate-fumaric acid coupled addition on in vitro methangenesis and rumen fermentation. Evaluation was carried out using in vitro gas production technique. Ruminal contents were collected from five steers immediately after slaughtering and used for preparation of inoculums of mixed rumen microorganisms. Rumen fluid was then mixed with the basal diet of steers and used to generate four treatments, negative control (no additives), sodium lauryl sulfate (SLS) treated, fumaric acid treated, and SLS-fumaric acid coupled addition treated. The results revealed that, relative to control, efficiency in reduction of methanogenesis was as follows: coupled addition > SLS-addition > fumaric acid addition. Both SLS-addition and SLS-fumaric acid coupled addition demonstrated a decremental effect on ammonia nitrogen (NH(3)-N), total short chain volatile fatty acids (SCVFAs) concentrations and the amount of substrate degraded, and an increment effect on microbial mass and microbial yield (Y(ATP)). Nevertheless, fumaric acid did not alter any of the previously mentioned parameters but induced a decremental effect on NH(3)-N. Furthermore, both fumaric acid and SLS-fumaric acid coupled addition increased propionate at the expense of acetate and butyrate, while, defaunation increased acetate at the expense of propionate and butyrate. The pH value was decreased by all treatments relative to control, while, cellulase activity did not differ by different treatments. The current study can be promising strategies for suppressing ruminal methane emissions and improving ruminants feed efficiency.

Effect of Sodium Lauryl Sulfate-Fumaric Acid Coupled Addition on the In Vitro Rumen Fermentation with Special Regard to Methanogenesis

PubMed Central

Abdl-Rahman, M. A.; Sawiress, F. A. R.; Abd El-Aty, A. M.

2010-01-01

The aim of the current study was to evaluate the effect of sodium lauryl sulfate-fumaric acid coupled addition on in vitro methangenesis and rumen fermentation. Evaluation was carried out using in vitro gas production technique. Ruminal contents were collected from five steers immediately after slaughtering and used for preparation of inoculums of mixed rumen microorganisms. Rumen fluid was then mixed with the basal diet of steers and used to generate four treatments, negative control (no additives), sodium lauryl sulfate (SLS) treated, fumaric acid treated, and SLS-fumaric acid coupled addition treated. The results revealed that, relative to control, efficiency in reduction of methanogenesis was as follows: coupled addition > SLS-addition > fumaric acid addition. Both SLS-addition and SLS-fumaric acid coupled addition demonstrated a decremental effect on ammonia nitrogen (NH3–N), total short chain volatile fatty acids (SCVFAs) concentrations and the amount of substrate degraded, and an increment effect on microbial mass and microbial yield (YATP). Nevertheless, fumaric acid did not alter any of the previously mentioned parameters but induced a decremental effect on NH3–N. Furthermore, both fumaric acid and SLS-fumaric acid coupled addition increased propionate at the expense of acetate and butyrate, while, defaunation increased acetate at the expense of propionate and butyrate. The pH value was decreased by all treatments relative to control, while, cellulase activity did not differ by different treatments. The current study can be promising strategies for suppressing ruminal methane emissions and improving ruminants feed efficiency. PMID:20445794

Reactive transport model for bioremediation of nitrate using fumarate in groundwater system: verification and field application

NASA Astrophysics Data System (ADS)

Lee, S.; Yeo, I. W.; Yeum, Y.; Kim, Y.

2016-12-01

Previous studies showed that groundwater of rural areas in Korea is often contaminated with nitrate highly exceeding the drinking water standard of 10 mg/L (NO3-N), which poses a major threat in human and livestock health. In-situ bioremediation method has been developed to reduce high nitrate-nitrogen concentration in groundwater using slowly released encapsulated carbon source. Collaborative research of this study revealed that fumarate was found to be a very effective carbon source in terms of cost and nitrate reduction against formate, propionate, and lactate. For reactive transport modeling of the bioremediation of nitrate using fumarate, the BTEX module of RT3D incorporated in GMS, a commercial groundwater modeling software developed by AQUAVEO, was adopted, where BTEX was replaced with fumarate as a carbon source. Column tests were carried out to determine transport and reaction parameters for numerical modeling such as dispersity and first order degradation rate of nitrate by fumarate. The calibration of the numerical model against column tests strongly indicated that nitrate, known to be not reactive in groundwater system, appeared to be retarded due to sorption by fumarate. The calibrated model was tested for field-scale application to the composting facility in Gimje, Korea. The numerical results showed that the model could simulate the nitrate reduction by fumarate in field scale groundwater system. The reactive transport model for nitrate can be used as a tool for optimum design of in-situ nitrate bioremediation system, such as released depth and amount of fumarate and the spacing of wells that encapsulated fumarate is released through.

Methods for the synthesis of olefins and derivatives

DOEpatents

Burk, Mark J; Pharkya, Priti; Van Dien, Stephen J; Burgard, Anthony P; Schilling, Christophe H

2013-06-04

The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.

Methods for the synthesis of olefins and derivatives

DOEpatents

Burk, Mark J [San Diego, CA; Pharkya, Priti [San Diego, CA; Van Dien, Stephen J [Encinitas, CA; Burgard, Anthony P [Bellefonte, PA; Schilling, Christophe H [San Diego, CA

2011-09-27

The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.

Methods for synthesis of olefins and derivatives

DOEpatents

Burk, Mark J.; Pharkya, Priti; Van Dien, Stephen J.; Burgard, Anthony P.; Schilling, Christophe H.

2016-06-14

The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.

Management Strategies to Facilitate Optimal Outcomes for Patients Treated with Delayed-release Dimethyl Fumarate.

PubMed

Mayer, Lori; Fink, Mary Kay; Sammarco, Carrie; Laing, Lisa

2018-04-01

Delayed-release dimethyl fumarate is an oral disease-modifying therapy that has demonstrated significant efficacy in adults with relapsing-remitting multiple sclerosis. Incidences of flushing and gastrointestinal adverse events are common in the first month after delayed-release dimethyl fumarate initiation. Our objective was to propose mitigation strategies for adverse events related to initiation of delayed-release dimethyl fumarate in the treatment of patients with multiple sclerosis. Studies of individually developed mitigation strategies and chart reviews were evaluated. Those results, as well as mitigation protocols developed at multiple sclerosis care centers, are summarized. Key steps to optimize the effectiveness of delayed-release dimethyl fumarate treatment include education prior to and at the time of delayed-release dimethyl fumarate initiation, initiation dose protocol gradually increasing to maintenance dose, dietary suggestions for co-administration with food, gastrointestinal symptom management with over-the-counter medications, flushing symptom management with aspirin, and temporary dose reduction. Using the available evidence from clinical trials and evaluations of post-marketing studies, these strategies to manage gastrointestinal and flushing symptoms can be effective and helpful to the patient when initiating delayed-release dimethyl fumarate.

Utilization of Electrically Reduced Neutral Red by Actinobacillus succinogenes: Physiological Function of Neutral Red in Membrane-Driven Fumarate Reduction and Energy Conservation

PubMed Central

Park, D. H.; Zeikus, J. G.

1999-01-01

Neutral red (NR) functioned as an electronophore or electron channel enabling either cells or membranes purified from Actinobacillus succinogenes to drive electron transfer and proton translocation by coupling fumarate reduction to succinate production. Electrically reduced NR, unlike methyl or benzyl viologen, bound to cell membranes, was not toxic, and chemically reduced NAD. The cell membrane of A. succinogenes contained high levels of benzyl viologen-linked hydrogenase (12.2 U), fumarate reductase (13.1 U), and diaphorase (109.7 U) activities. Fumarate reductase (24.5 U) displayed the highest activity with NR as the electron carrier, whereas hydrogenase (1.1 U) and diaphorase (0.8 U) did not. Proton translocation by whole cells was dependent on either electrically reduced NR or H2 as the electron donor and on the fumarate concentration. During the growth of Actinobacillus on glucose plus electrically reduced NR in an electrochemical bioreactor system versus on glucose alone, electrically reduced NR enhanced glucose consumption, growth, and succinate production by about 20% while it decreased acetate production by about 50%. The rate of fumarate reduction to succinate by purified membranes was twofold higher with electrically reduced NR than with hydrogen as the electron donor. The addition of 2-(n-heptyl)-4-hydroxyquinoline N-oxide to whole cells or purified membranes inhibited succinate production from H2 plus fumarate but not from electrically reduced NR plus fumarate. Thus, NR appears to replace the function of menaquinone in the fumarate reductase complex, and it enables A. succinogenes to utilize electricity as a significant source of metabolic reducing power. PMID:10198002

Design of simulated moving bed for separation of fumaric acid with a little fronting phenomenon.

PubMed

Choi, Jae-Hwan; Kang, Mun-Seok; Lee, Chung-Gi; Wang, Nien-Hwa Linda; Mun, Sungyong

2017-03-31

The production of fumaric acid through a biotechnological pathway has grown in importance because of its potential value in related industries. This has sparked an interest in developing an economically-efficient process for separation of fumaric acid (product of interest) from acetic acid (by-product). This study aimed to develop a simulated moving bed (SMB) chromatographic process for such separation in a systematic way. As a first step for this work, commercially available adsorbents were screened for their applicability to the considered separation, which revealed that an Amberchrom-CG71C resin had a sufficient potential to become an adsorbent of the targeted SMB. Using this adsorbent, the intrinsic parameters of fumaric and acetic acids were determined and then applied to optimizing the SMB process under consideration. The optimized SMB process was tested experimentally, from which the yield of fumaric-acid product was found to become lower than expected in the design. An investigation about the reason for such problem revealed that it was attributed to a fronting phenomenon occurring in the solute band of fumaric acid. To resolve this issue, the extent of the fronting was evaluated quantitatively using an experimental axial dispersion coefficient for fumaric acid, which was then considered in the design of the SMB of interest. The SMB experimental results showed that the SMB design based on the consideration of the fumaric-acid fronting could guarantee the attainment of both high purity (>99%) and high yield (>99%) for fumaric-acid product under the desorbent consumption of 2.6 and the throughput of 0.36L/L/h. Copyright © 2017 Elsevier B.V. All rights reserved.

21 CFR 520.2455 - Tiamulin.

Code of Federal Regulations, 2011 CFR

2011-04-01

...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

21 CFR 520.2455 - Tiamulin.

Code of Federal Regulations, 2014 CFR

2014-04-01

...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

21 CFR 520.2455 - Tiamulin.

Code of Federal Regulations, 2012 CFR

2012-04-01

...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

21 CFR 520.82a - Aminopropazine fumarate tablets.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Aminopropazine fumarate tablets. (a) Specifications. The drug is in tablet form. Each tablet contains...

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... sulfate equivalent to 50 milligrams of neomycin base. (b) Sponsor. See No. 000061 in § 510.600(c) of this...

Dielectric Properties of Iron- and Sodium-Fumarate

NASA Astrophysics Data System (ADS)

Skuban, Sonja J.; Džomić, Tanja; Kapor, Agneš

2007-04-01

The behaviour of dielectric parameters such as relative dielectric constant (ɛ'), relative loss factor (V'') and ac conductivity of well known pharmaceutical materials Fe(II)-fumarate and sodium-fumarate have been studied as a function of temperature (range 303 K to 483 K) and frequency (range 0.1 Hz to 100 kHz).

Preservation of acidified cucumbers with a combination of fumaric acid and cinnamaldehyde that target lactic acid bacteria and yeasts

USDA-ARS?s Scientific Manuscript database

The naturally occurring compound, fumaric acid, was evaluated as a potential preservative for the long-term storage of cucumbers. Fumaric acid inhibited growth of lactic acid bacteria (LAB) in an acidified cucumber juice medium model system resembling conditions that could allow preservation of cucu...

Continuous production of succinic acid by a fumarate-reducing bacterium immobilized in a hollow-fiber bioreactor.

PubMed

Wee, Young-Jung; Yun, Jong-Sun; Kang, Kui-Hyun; Ryu, Hwa-Won

2002-01-01

Enterococcus faecalis RKY1, a fumarate-reducing bacterium, was immobilized in an asymmetric hollow-fiber bioreactor (HFBR) for the continuous production of succinic acid. The cells were inoculated into the shell side of the HFBR, which was operated in transverse mode. Since the pH values in the HFBR declined during continuous operation to about 5.7, it was necessary to change the feed pH from 7.0 to 8.0 after 24 h of operation in order to enhance production of succinic acid. During continuous operation with a medium containing fumarate and glycerol, the productivity of succinate was 3.0-10.9 g/(L x h) with an initial concentration of 30 g/L of fumarate, 4.9-14.9 g/(L x h) with 50 g/L of fumarate, and 7.2-17.1 g/(L x h) with 80 g/L of fumarate for dilution rates between 0.1 and 0.4 h(-1). The maximum productivity of succinate obtained by the HFBR (17.1 g of succinate/[L x h]) was 1.7 times higher than that of the batch bioconversions (9.9 g of succinate/ [L x h]) with 80 g/L of fumarate. Furthermore, the long-term stability of the HFBR was demonstrated with a continuously efficient production of succinate for more than 15 d (360 h).

BG 12: BG 00012, BG 12/Oral Fumarate, FAG-201, second-generation fumarate derivative--Fumapharm/Biogen Idec.

PubMed

2005-01-01

Fumapharm AG has developed a second-generation fumarate (fumaric acid) derivative, BG 12 [BG 00012, FAG-201, BG 12/Oral Fumarate], for the oral treatment of psoriasis. Biogen Idec is currently evaluating the product in clinical trials as an oral treatment for multiple sclerosis (phase II) and psoriasis (phase III) trials.BG 12 has an immunomodulatory mechanism of action. It seems that this product has been developed to reduce the adverse effects associated with a first-generation product containing fumaric acid esters (mixed dimethylfumarate and monoethylfumarate salts), Fumaderm. Fumaderm was approved in Germany in August 1994 and is currently the leading oral systemic therapy for moderate-to-severe psoriasis in Germany. One of the problems associated with Fumaderm capsules has been its gastrointestinal adverse effects (including diarrhoea and nausea). In September 2003, Biogen (now Biogen Idec) licensed exclusive worldwide rights (excluding Germany) from Fumapharm to develop and market BG 12. Biogen plans to collaborate with Fumapharm to accelerate phase III development for psoriasis and the registration programme worldwide. Financial terms of the agreement were not disclosed. Development plans for BG 12 include other autoimmune and inflammatory disorders, such as multiple sclerosis. In November 2003, Biogen and IDEC Pharmaceuticals merged to form Biogen Idec. Fumapharm completed phase II trials of this second-generation fumarate derivative for psoriasis prior to licensing of the product to Biogen, also with positive results.

Effect of bicarbonate concentration on aerobic growth of campylobacter in a fumarate-pyruvate medium

USDA-ARS?s Scientific Manuscript database

The purpose of the present study was to examine the effect of sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in a fumarate-pyruvate medium. Fumarate-pyruvate broth medium was supplemented with 0.00 to 0.10% NaHCO3 and inoculated with Campylobacter coli 33559, Campyloba...

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... administered at a dosage level of one to two tablets per 10 pounds of body weight twice daily for 3 days.1 (3...

Study of Vitamins and Dietary Supplements Containing Ferrous Fumarate and Ferrous Sulfate Using Moessbauer Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshtrakh, M. I.; Novikov, E. G.; Semionkin, V. A.

2010-07-13

A study of several samples of vitamins and dietary supplements containing ferrous fumarate and ferrous sulfate was carried out using Moessbauer spectroscopy with a high velocity resolution. A presence of ferrous and ferric impurities was revealed. Small variations of Moessbauer hyperfine parameters were found for both ferrous fumarates and ferrous sulfates in the investigated medicines.

GiFRD encodes a protein involved in anaerobic growth in the arbuscular mycorrhizal fungus Glomus intraradices.

PubMed

Sędzielewska, Kinga A; Vetter, Katja; Bode, Rüdiger; Baronian, Keith; Watzke, Roland; Kunze, Gotthard

2012-04-01

Fumarate reductase is a protein involved in the maintenance of redox balance during oxygen deficiency. This enzyme irreversibly catalyzes the reduction of fumarate to succinate and requires flavin cofactors as electron donors. Two examples are the soluble mitochondrial and the cytosolic fumarate reductases of Saccharomyces cerevisiae encoded by the OSM1 and FRDS1 genes, respectively. This work reports the identification and characterization of the gene encoding cytosolic fumarate reductase enzyme in the arbuscular mycorrhizal fungus, Glomus intraradices and the establishment of its physiological role. Using a yeast expression system, we demonstrate that G. intraradices GiFRD encodes a protein that has fumarate reductase activity which can functionally substitute for the S. cerevisiae fumarate reductases. Additionally, we showed that GiFRD transformants are not affected by presence of salt in medium, indicating that the presence of this gene has no effect on yeast behavior under osmotic stress. The fact that GiFRD expression and enzymatic activity was present only in asymbiotic stage confirmed existence of at least one anaerobic metabolic pathway in this phase of fungus life cycle. This suggests that the AMF behave as facultative anaerobes in the asymbiotic stage. Copyright © 2012 Elsevier Inc. All rights reserved.

Fumarate-Mediated Persistence of Escherichia coli against Antibiotics

PubMed Central

Kim, Jun-Seob; Cho, Da-Hyeong; Heo, Paul; Jung, Suk-Chae; Park, Myungseo; Oh, Eun-Joong; Sung, Jaeyun; Kim, Pan-Jun; Lee, Suk-Chan; Lee, Dae-Hee; Lee, Sarah; Lee, Choong Hwan; Shin, Dongwoo

2016-01-01

Bacterial persisters are a small fraction of quiescent cells that survive in the presence of lethal concentrations of antibiotics. They can regrow to give rise to a new population that has the same vulnerability to the antibiotics as did the parental population. Although formation of bacterial persisters in the presence of various antibiotics has been documented, the molecular mechanisms by which these persisters tolerate the antibiotics are still controversial. We found that amplification of the fumarate reductase operon (FRD) in Escherichia coli led to a higher frequency of persister formation. The persister frequency of E. coli was increased when the cells contained elevated levels of intracellular fumarate. Genetic perturbations of the electron transport chain (ETC), a metabolite supplementation assay, and even the toxin-antitoxin-related hipA7 mutation indicated that surplus fumarate markedly elevated the E. coli persister frequency. An E. coli strain lacking succinate dehydrogenase (SDH), thereby showing a lower intracellular fumarate concentration, was killed ∼1,000-fold more effectively than the wild-type strain in the stationary phase. It appears that SDH and FRD represent a paired system that gives rise to and maintains E. coli persisters by producing and utilizing fumarate, respectively. PMID:26810657

Crystallographic studies of the binding of ligands to the dicarboxylate site of Complex II, and the identity of the ligand in the "oxaloacetate-inhibited" state.

PubMed

Huang, Li-Shar; Shen, John T; Wang, Andy C; Berry, Edward A

2006-01-01

Mitochondrial Complex II (succinate:ubiquinone oxidoreductase) is purified in a partially inactivated state, which can be activated by removal of tightly bound oxaloacetate (E.B. Kearney, et al., Biochem. Biophys. Res. Commun. 49 1115-1121). We crystallized Complex II in the presence of oxaloacetate or with the endogenous inhibitor bound. The structure showed a ligand essentially identical to the "malate-like intermediate" found in Shewanella Flavocytochrome c crystallized with fumarate (P. Taylor, et al., Nat. Struct. Biol. 6 1108-1112) Crystallization of Complex II in the presence of excess fumarate also gave the malate-like intermediate or a mixture of that and fumarate at the active site. In order to more conveniently monitor the occupation state of the dicarboxylate site, we are developing a library of UV/Vis spectral effects induced by binding different ligands to the site. Treatment with fumarate results in rapid development of the fumarate difference spectrum and then a very slow conversion into a species spectrally similar to the OAA-liganded complex. Complex II is known to be capable of oxidizing malate to the enol form of oxaloacetate (Y.O. Belikova, et al., Biochim. Biophys. Acta 936 1-9). The observations above suggest it may also be capable of interconverting fumarate and malate. It may be useful for understanding the mechanism and regulation of the enzyme to identify the malate-like intermediate and its pathway of formation from oxaloacetate or fumarate.

Fumaric acid production using renewable resources from biodiesel and cane sugar production processes.

PubMed

Papadaki, Aikaterini; Papapostolou, Harris; Alexandri, Maria; Kopsahelis, Nikolaos; Papanikolaou, Seraphim; de Castro, Aline Machado; Freire, Denise M G; Koutinas, Apostolis A

2018-04-13

The microbial production of fumaric acid by Rhizopus arrhizus NRRL 2582 has been evaluated using soybean cake from biodiesel production processes and very high polarity (VHP) sugar from sugarcane mills. Soybean cake was converted into a nutrient-rich hydrolysate via a two-stage bioprocess involving crude enzyme production via solid state fermentations (SSF) of either Aspergillus oryzae or R. arrhizus cultivated on soybean cake followed by enzymatic hydrolysis of soybean cake. The soybean cake hydrolysate produced using crude enzymes derived via SSF of R. arrhizus was supplemented with VHP sugar and evaluated using different initial free amino nitrogen (FAN) concentrations (100, 200, and 400 mg/L) in fed-batch cultures for fumaric acid production. The highest fumaric acid concentration (27.3 g/L) and yield (0.7 g/g of total consumed sugars) were achieved when the initial FAN concentration was 200 mg/L. The combination of VHP sugar with soybean cake hydrolysate derived from crude enzymes produced by SSF of A. oryzae at 200 mg/L initial FAN concentration led to the production of 40 g/L fumaric acid with a yield of 0.86 g/g of total consumed sugars. The utilization of sugarcane molasses led to low fumaric acid production by R. arrhizus, probably due to the presence of various minerals and phenolic compounds. The promising results achieved through the valorization of VHP sugar and soybean cake suggest that a focused study on molasses pretreatment could lead to enhanced fumaric acid production.

pH-Dependent Uptake of Fumaric Acid in Saccharomyces cerevisiae under Anaerobic Conditions

PubMed Central

Jamalzadeh, Elaheh; Verheijen, Peter J. T.; Heijnen, Joseph J.

2012-01-01

Microbial production of C4 dicarboxylic acids from renewable resources has gained renewed interest. The yeast Saccharomyces cerevisiae is known as a robust microorganism and is able to grow at low pH, which makes it a suitable candidate for biological production of organic acids. However, a successful metabolic engineering approach for overproduction of organic acids requires an incorporation of a proper exporter to increase the productivity. Moreover, low-pH fermentations, which are desirable for facilitating the downstream processing, may cause back diffusion of the undissociated acid into the cells with simultaneous active export, thereby creating an ATP-dissipating futile cycle. In this work, we have studied the uptake of fumaric acid in S. cerevisiae in carbon-limited chemostat cultures under anaerobic conditions. The effect of the presence of fumaric acid at different pH values (3 to 5) has been investigated in order to obtain more knowledge about possible uptake mechanisms. The experimental results showed that at a cultivation pH of 5.0 and an external fumaric acid concentration of approximately 0.8 mmol · liter−1, the fumaric acid uptake rate was unexpectedly high and could not be explained by diffusion of the undissociated form across the plasma membrane alone. This could indicate the presence of protein-mediated import. At decreasing pH levels, the fumaric acid uptake rate was found to increase asymptotically to a maximum level. Although this observation is in accordance with protein-mediated import, the presence of a metabolic bottleneck for fumaric acid conversion under anaerobic conditions could not be excluded. PMID:22113915

Mitochondrial fumarate reductase as a target of chemotherapy: from parasites to cancer cells.

PubMed

Sakai, Chika; Tomitsuka, Eriko; Esumi, Hiroyasu; Harada, Shigeharu; Kita, Kiyoshi

2012-05-01

Recent research on respiratory chain of the parasitic helminth, Ascaris suum has shown that the mitochondrial NADH-fumarate reductase system (fumarate respiration), which is composed of complex I (NADH-rhodoquinone reductase), rhodoquinone and complex II (rhodoquinol-fumarate reductase) plays an important role in the anaerobic energy metabolism of adult parasites inhabiting hosts. The enzymes in these parasite-specific pathways are potential target for chemotherapy. We isolated a novel compound, nafuredin, from Aspergillus niger, which inhibits NADH-fumarate reductase in helminth mitochondria at nM order. It competes for the quinone-binding site in complex I and shows high selective toxicity to the helminth enzyme. Moreover, nafuredin exerts anthelmintic activity against Haemonchus contortus in in vivo trials with sheep indicating that mitochondrial complex I is a promising target for chemotherapy. In addition to complex I, complex II is a good target because its catalytic direction is reverse of succinate-ubiquionone reductase in the host complex II. Furthermore, we found atpenin and flutolanil strongly and specifically inhibit mitochondrial complex II. Interestingly, fumarate respiration was found not only in the parasites but also in some types of human cancer cells. Analysis of the mitochondria from the cancer cells identified an anthelminthic as a specific inhibitor of the fumarate respiration. Role of isoforms of human complex II in the hypoxic condition of cancer cells and fetal tissues is a challenge. This article is part of a Special Issue entitled Biochemistry of Mitochondria, Life and Intervention 2010. Copyright © 2011 Elsevier B.V. All rights reserved.

Analysis of mechanisms for memory enhancement using novel and potent 5-HT1A receptor ligands.

PubMed

Pittalà, Valeria; Siracusa, Maria A; Salerno, Loredana; Romeo, Giuseppe; Modica, Maria N; Madjid, Nather; Ogren, Sven Ove

2015-08-01

In light of the involvement of serotonergic 5-HT1A receptors in the mediation of the memory of aversive events, the potent and selective 5-HT1A receptor antagonists, MC18 fumarate and VP08/34 fumarate, were tested in the passive avoidance task (PA), a rodent model of instrumental conditioning. Either alone or in combination with the prototypical agonist 8-OH-DPAT, MC18 fumarate at doses (0.1, 0.3 and 1mg/kg given 15min prior to training) exerted a dose-dependent facilitation of PA memory retention. When administered 15min prior to 8-OH-DPAT (0.3 and 1mg/kg), MC18 fumarate at a dose of 0.3mg/kg, enhanced significantly the impairment of PA retention caused by 8-OH-DPAT (1mg/kg). However, VP08/34 fumarate given at the same doses exerted no statistically effect on PA retention memory. Furthermore, VP08/34 fumarate given 15min prior to 8-OH-DPAT (0.3 and 1mg/kg) only slightly enhanced the PA impairment induced by 8-OH-DPAT. In conclusion, the profile of MC18 fumarate is intriguing since it behaves in a manner which differs from both full receptor antagonists such as NAD-299 or partial receptor agonists. The results also illustrate the importance of subtle receptor interaction and probably ligand efficacy in determining the actions of two almost identical 5-HT1A receptor ligands in cognitive function such as instrumental learning. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

Synthesis of Poly(Propylene Fumarate)

PubMed Central

Kasper, F. Kurtis; Tanahashi, Kazuhiro; Fisher, John P.; Mikos, Antonios G.

2010-01-01

This protocol describes the synthesis of 500 – 4000 Da poly(propylene fumarate) by a two-step reaction of diethyl fumarate and propylene glycol through a bis(hydroxypropyl) fumarate diester intermediate. Purified PPF can be covalently crosslinked to form degradable polymer networks, which have been widely explored for biomedical applications. The properties of crosslinked PPF networks depend upon the molecular properties of the constituent polymer, such as the molecular weight. The purity of the reactants and the exclusion of water from the reaction system are of utmost importance in the generation of high-molecular-weight PPF products. Additionally, the reaction time and temperature influence the molecular weight of the PPF product. The expected time required to complete this protocol is 3 d. PMID:19325548

A Na+-coupled C4-dicarboxylate transporter (Asuc_0304) and aerobic growth of Actinobacillus succinogenes on C4-dicarboxylates.

PubMed

Rhie, Mi Na; Yoon, Hyo Eun; Oh, Hye Yun; Zedler, Sandra; Unden, Gottfried; Kim, Ok Bin

2014-07-01

Actinobacillus succinogenes, which is known to produce large amounts of succinate during fermentation of hexoses, was able to grow on C4-dicarboxylates such as fumarate under aerobic and anaerobic conditions. Anaerobic growth on fumarate was stimulated by glycerol and the major product was succinate, indicating the involvement of fumarate respiration similar to succinate production from glucose. The aerobic growth on C4-dicarboxylates and the transport proteins involved were studied. Fumarate was oxidized to acetate. The genome of A. succinogenes encodes six proteins with similarity to secondary C4-dicarboxylate transporters, including transporters of the Dcu (C4-dicarboxylate uptake), DcuC (C4-dicarboxylate uptake C), DASS (divalent anion : sodium symporter) and TDT (tellurite resistance dicarboxylate transporter) family. From the cloned genes, Asuc_0304 of the DASS family protein was able to restore aerobic growth on C4-dicarboxylates in a C4-dicarboxylate-transport-negative Escherichia coli strain. The strain regained succinate or fumarate uptake, which was dependent on the electrochemical proton potential and the presence of Na(+). The transport had an optimum pH ~7, indicating transport of the dianionic C4-dicarboxylates. Transport competition experiments suggested substrate specificity for fumarate and succinate. The transport characteristics for C4-dicarboxylate uptake by cells of aerobically grown A. succinogenes were similar to those of Asuc_0304 expressed in E. coli, suggesting that Asuc_0304 has an important role in aerobic fumarate uptake in A. succinogenes. Asuc_0304 has sequence similarity to bacterial Na(+)-dicarboxylate cotransporters and contains the carboxylate-binding signature. Asuc_0304 was named SdcA (sodium-coupled C4-dicarboxylate transporter from A. succinogenes). © 2014 The Authors.

Osm1 facilitates the transfer of electrons from Erv1 to fumarate in the redox-regulated import pathway in the mitochondrial intermembrane space

PubMed Central

Neal, Sonya E.; Dabir, Deepa V.; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M.

2017-01-01

Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c, but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. PMID:28814504

Growth of Campylobacter incubated aerobically in fumarate-pyruvate media or media supplemented with dairy, meat, or soy extracts and peptones.

PubMed

Hinton, Arthur

2016-09-01

The ability of Campylobacter to grow aerobically in media supplemented with fumarate-pyruvate or with dairy, meat, or soy extracts or peptones was examined. Optical densities (OD) of Campylobacter cultured in basal media, media supplemented with fumarate-pyruvate or with 1.0, 2.5, 5.0, or 7.5% beef extract was measured. Growth was also compared in media supplemented with other extracts or peptones. Finally, cfu/mL of Campylobacter recovered from basal media or media supplemented with fumarate-pyruvate, casamino acids, beef extract, soytone, or beef extract and soytone was determined. Results indicated that OD of cultures grown in media supplemented with fumarate-pyruvate or with 5.0 or 7.5% beef extract were higher than OD of isolates grown in basal media or media supplemented with lower concentrations of beef extract. Highest OD were produced by isolates grown in media supplemented with beef extract, peptone from meat, polypeptone, proteose peptone, or soytone. Also, more cfu/mL were recovered from media with fumarate-pyruvate, beef extract, soytone, or beef extract-soytone than from basal media or media with casamino acids. Findings indicate that media supplemented with organic acids, vitamins, and minerals and media supplemented with extracts or peptones containing these metabolites can support aerobic growth of Campylobacter. Published by Elsevier Ltd.

Evaluation of the binding interaction between bovine serum albumin and dimethyl fumarate, an anti-inflammatory drug by multispectroscopic methods

NASA Astrophysics Data System (ADS)

Jattinagoudar, Laxmi; Meti, Manjunath; Nandibewoor, Sharanappa; Chimatadar, Shivamurti

2016-03-01

The information of the quenching reaction of bovine serum albumin with dimethyl fumarate is obtained by multi-spectroscopic methods. The number of binding sites, n and binding constants, KA were determined at different temperatures. The effect of increasing temperature on Stern-Volmer quenching constants (KD) indicates that a dynamic quenching mechanism is involved in the interaction. The analysis of thermodynamic quantities namely, ∆H° and ∆S° suggested hydrophobic forces playing a major role in the interaction between dimethyl fumarate and bovine serum albumin. The binding site of dimethyl fumarate on bovine serum albumin was determined by displacement studies, using the site probes viz., warfarin, ibuprofen and digitoxin. The determination of magnitude of the distance of approach for molecular interactions between dimethyl fumarate and bovine serum albumin is calculated according to the theory of Förster energy transfer. The CD, 3D fluorescence spectra, synchronous fluorescence measurements and FT-IR spectral results were indicative of the change in secondary structure of the protein. The influence of some of the metal ions on the binding interaction was also studied.

Omics-based approaches reveal phospholipids remodeling of Rhizopus oryzae responding to furfural stress for fumaric acid-production from xylose.

PubMed

Pan, Xinrong; Liu, Huanhuan; Liu, Jiao; Wang, Cheng; Wen, Jianping

2016-12-01

In order to relieve the toxicity of furfural on Rhizopus oryzae fermentation, the molecular mechanism of R. oryzae responding to furfural stress for fumaric acid-production was investigated by omics-based approaches. In metabolomics analysis, 29 metabolites including amino acid, sugars, polyols and fatty acids showed significant changes for maintaining the basic cell metabolism at the cost of lowering fumaric acid production. To further uncover the survival mechanism, lipidomics was carried out, revealing that phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol and polyunsaturated acyl chains might be closely correlated with R. oryzae's adapting to furfural stress. Based on the above omics analysis, lecithin, inositol and soybean oil were exogenously supplemented separately with an optimized concentration in the presence of furfural, which increased fumaric acid titer from 5.78g/L to 10.03g/L, 10.05g/L and 12.13g/L (increased by 73.5%, 73.8% and 110%, respectively). These findings provide a methodological guidance for hemicellulose-fumaric acid development. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification, characterization, and high-performance liquid chromatography quantification of process-related impurities in vonoprazan fumarate.

PubMed

Liu, Lei; Cao, Na; Ma, Xingling; Xiong, Kaihe; Sun, Lili; Zou, Qiaogen

2016-04-01

High-performance liquid chromatography analysis of vonoprazan fumarate, a novel proton pump inhibitor drug revealed six impurities. These were identified by liquid chromatography with mass spectrometry. Further, the structures of the impurities were confirmed by synthesis followed by characterization by mass spectrometry, NMR spectroscopy, and infrared spectroscopy. On the basis of these data and knowledge of the synthetic scheme of vonoprazan fumarate, the previously unknown impurity was identified as 1-[5-(2-fluorophenyl)-1-(pyridin-3-ylsulfonyl)-1H-pyrrol-3-yl]-N-methyldimethylamine, which is a new compound. The possible mechanisms by which these impurities were formed were also discussed. A high-performance liquid chromatography method was optimized in order to separate, selectively detect, and quantify all process-related impurities of vonoprazan fumarate. The presented method has been validated in terms of linearity, limits of detection, and quantification, and response factors and, therefore, is highly suitable for routine analysis of vonoprazan fumarate related substances as well as stability studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of irradiation and fumaric acid treatment on the inactivation of Listeria monocytogenes and Salmonella typhimurium inoculated on sliced ham

NASA Astrophysics Data System (ADS)

Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin

2011-11-01

To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham.

Studies on biodegradable and crosslinkable poly(castor oil fumarate)/poly(propylene fumarate) composite adhesive as a potential injectable biomaterial.

PubMed

Mitha, M K; Jayabalan, M

2009-12-01

Biodegradable hydroxyl terminated-poly(castor oil fumarate) (HT-PCF) and poly(propylene fumarate) (HT-PPF) resins were synthesized as an injectable and in situ-cross linkable polyester resins for orthopedic applications. An injectable adhesive formulation containing this resin blend, N-vinyl pyrrolidone (NVP), hydroxy apatite, free radical initiator and accelerator was developed. The Composite adhesives containing the ratio of resin blend and NVP, 2.1:1.5, 2.1:1.2 and 2.1:1.0 set fast with tolerable exothermic temperature as a three dimensionally cross linked toughened material. Crosslink density and mechanical properties of the crosslinked composite increase with increase of NVP. The present crosslinked composite has hydrophilic character and cytocompatibility with L929 fibroblast cells.

Dimethyl Fumarate

MedlinePlus

... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a condition in which ... day. Take dimethyl fumarate at around the same times every day. Follow the directions on your prescription ...

The synthesis and the spectroscopic, thermal, and structural properties of the M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) clathrate (M = Co, Ni, Cd and Hg)

NASA Astrophysics Data System (ADS)

Kartal, Zeki; Yavuz, Abdülkerim

2018-03-01

In this study, the clathrates of fumarate-tetracyanonickel-dioxane, given by the formula M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) (M = Co, Ni, Cd and Hg), have been obtained for the first time through chemical methods. These clathrates have been characterized by elemental, thermal, FT-IR, and FT-Raman spectroscopies. The parameters of structures of clathrates have been determined by X-ray powder diffraction. The thermal behaviors of these clathrates have been also investigated by thermo-gravimetric analysis (TGA), differential thermal analysis (DTA), and derivative thermal gravimetric analysis (DTG) in the range of 20-900 °C. X-ray powder diffraction data have been recorded at ambient temperature in the 2θ range 5-50°. The FT-IR and FT-Raman spectra of clathrates have been recorded in the region of 4000-400 cm-1 and 4000-100 cm-1, respectively. The results of the spectral and thermal analyses of the newly synthesized clathrates of fumarate-tetracyanonickel-dioxane suggest that these clathrates are new examples of the Hofmann-type dioxane clathrates. In our study, the Hofmann-type dioxane clathrates, which are formed by bounding electrons of oxygen-donor atoms of fumarate ion ligand molecule to transition metal atoms, consist of the corrugated |M-Ni(CN)4|∞ polymeric layers, which are held in parallel through the chain of (-M-fumarate-M-).

Structural investigation of the cocrystal formed between 5-fluorocytosine and fumaric acid based on vibrational spectroscopic technique

NASA Astrophysics Data System (ADS)

Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan

2017-05-01

The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91 THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87 THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation.

Carotenoids, but not vitamin A, improve iron uptake and ferritin synthesis by Caco-2 cells from ferrous fumarate and NaFe-EDTA.

PubMed

García-Casal, María N; Leets, Irene

2014-04-01

Due to the high prevalence of iron and vitamin A deficiencies and to the controversy about the role of vitamin A and carotenoids in iron absorption, the objectives of this study were to evaluate the following: (1) the effect of a molar excess of vitamin A as well as the role of tannic acid on iron uptake by Caco-2 cells; (2) iron uptake and ferritin synthesis in presence of carotenoids without pro-vitamin A activity: lycopene, lutein, and zeaxantin; and (3) iron uptake and ferritin synthesis from ferrous fumarate and NaFe-EDTA. Cells were incubated 1 h at 37 °C in PBS pH 5.5, containing (59) Fe and different iron compounds. Vitamin A, ferrous fumarate, β-carotene, lycopene, lutein, zeaxantin, and tannic acid were added to evaluate uptake. Ferritin synthesis was measured 24 h after uptake experiments. Vitamin A had no effect on iron uptake by Caco-2 cells, and was significantly lower from NaFe-EDTA than from ferrous fumarate (15.2 ± 2.5 compared with 52.5 ± 8.3 pmol Fe/mg cell protein, respectively). Carotenoids increase uptake up to 50% from fumarate and up to 300% from NaFe-EDTA, since absorption from this compound is low when administered alone. We conclude the following: (1) There was no effect of vitamin A on iron uptake and ferritin synthesis by Caco-2cells. (2) Carotenoids significantly increased iron uptake from ferrous fumarate and NaFe-EDTA, and were capable of partially overcoming the inhibition produced by tannic acid. (3) Iron uptake by Caco-2 cell from NaFe-EDTA was significantly lower compared to other iron compounds, although carotenoids increased and tannic acid inhibited iron uptake comparably to ferrous fumarate. © 2014 Institute of Food Technologists®

Cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate and intramuscular interferon-β1a in relapsing-remitting multiple sclerosis.

PubMed

Zhang, Xinke; Hay, Joel W; Niu, Xiaoli

2015-01-01

The aim of the study was to compare the cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate, and intramuscular (IM) interferon (IFN)-β(1a) as first-line therapies in the treatment of patients with relapsing-remitting multiple sclerosis (RRMS). A Markov model was developed to evaluate the cost effectiveness of disease-modifying drugs (DMDs) from a US societal perspective. The time horizon in the base case was 5 years. The primary outcome was incremental net monetary benefit (INMB), and the secondary outcome was incremental cost-effectiveness ratio (ICER). The base case INMB willingness-to-pay (WTP) threshold was assumed to be US$150,000 per quality-adjusted life year (QALY), and the costs were in 2012 US dollars. One-way sensitivity analyses and probabilistic sensitivity analysis were conducted to test the robustness of the model results. Dimethyl fumarate dominated all other therapies over the range of WTPs, from US$0 to US$180,000. Compared with IM IFN-β(1a), at a WTP of US$150,000, INMBs were estimated at US$36,567, US$49,780, and US$80,611 for fingolimod, teriflunomide, and dimethyl fumarate, respectively. The ICER of fingolimod versus teriflunomide was US$3,201,672. One-way sensitivity analyses demonstrated the model results were sensitive to the acquisition costs of DMDs and the time horizon, but in most scenarios, cost-effectiveness rankings remained stable. Probabilistic sensitivity analysis showed that for more than 90% of the simulations, dimethyl fumarate was the optimal therapy across all WTP values. The three oral therapies were favored in the cost-effectiveness analysis. Of the four DMDs, dimethyl fumarate was a dominant therapy to manage RRMS. Apart from dimethyl fumarate, teriflunomide was the most cost-effective therapy compared with IM IFN-β(1a), with an ICER of US$7,115.

Structural investigation of the cocrystal formed between 5-fluorocytosine and fumaric acid based on vibrational spectroscopic technique.

PubMed

Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan

2017-05-05

The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.

Insights into the glycyl radical enzyme active site of benzylsuccinate synthase: a computational study.

PubMed

Bharadwaj, Vivek S; Dean, Anthony M; Maupin, C Mark

2013-08-21

The fumarate addition reaction, catalyzed by the enzyme benzylsuccinate synthase (BSS), is considered to be one of the most intriguing and energetically challenging reactions in biology. BSS belongs to the glycyl radical enzyme family and catalyzes the fumarate addition reaction, which enables microorganisms to utilize hydrocarbons as an energy source under anaerobic conditions. Unfortunately, the extreme sensitivity of the glycyl radical to oxygen has hampered the structural and kinetic characterization of BSS, thereby limiting our knowledge on this enzyme. To enhance our molecular-level understanding of BSS, a computational approach involving homology modeling, docking studies, and molecular dynamics (MD) simulations has been used to deduce the structure of BSS's catalytic subunit (BSSα) and illuminate the molecular basis for the fumarate addition reaction. We have identified two conserved and distinct binding pockets at the BSSα active site: a hydrophobic pocket for toluene binding and a polar pocket for fumaric acid binding. Subsequent dynamical and energetic evaluations have identified Glu509, Ser827, Leu390, and Phe384 as active site residues critical for substrate binding. The orientation of substrates at the active site observed in MD simulations is consistent with experimental observations of the syn addition of toluene to fumaric acid. It is also found that substrate binding tightens the active site and restricts the conformational flexibility of the thiyl radical, leading to hydrogen transfer distances conducive to the proposed reaction mechanism. The stability of substrates at the active site and the occurrence of feasible radical transfer distances between the thiyl radical, substrates, and the active site glycine indicate a substrate-assisted radical transfer pathway governing fumarate addition.

Conversion of the sensor kinase DcuS of Escherichia coli of the DcuB/DcuS sensor complex to the C4 -dicarboxylate responsive form by the transporter DcuB.

PubMed

Wörner, Sebastian; Strecker, Alexander; Monzel, Christian; Zeltner, Matthias; Witan, Julian; Ebert-Jung, Andrea; Unden, Gottfried

2016-12-01

The sensor kinase DcuS of Escherichia coli co-operates under aerobic conditions with the C 4 -dicarboxylate transporter DctA to form the DctA/DcuS sensor complex. Under anaerobic conditions C 4 -dicarboxylate transport in fumarate respiration is catalyzed by C 4 -dicarboxylate/fumarate antiporter DcuB. (i) DcuB interacted with DcuS as demonstrated by a bacterial two-hybrid system (BACTH) and by co-chromatography of the solubilized membrane-proteins (mHPINE assay). (ii) In the DcuB/DcuS complex only DcuS served as the sensor since mutations in the substrate site of DcuS changed substrate specificity of sensing, and substrates maleate or 3-nitropropionate induced DcuS response without affecting the fumarate site of DcuB. (iii) The half-maximal concentration for induction of DcuS by fumarate (1 to 2 mM) and the corresponding K m for transport (50 µM) differ by a factor of 20 to 40. Therefore, the fumarate sites are different in transport and sensing. (iv) Increasing levels of DcuB converted DcuS from the permanent ON (DcuB deficient) state to the fumarate responsive form. Overall, the data show that DcuS and DcuB form a DcuB/DcuS complex representing the C 4 -dicarboxylate responsive form, and that the sensory site of the complex is located in DcuS whereas DcuB is required for converting DcuS to the sensory competent state. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Osm1 facilitates the transfer of electrons from Erv1 to fumarate in the redox-regulated import pathway in the mitochondrial intermembrane space.

PubMed

Neal, Sonya E; Dabir, Deepa V; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M

2017-10-15

Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c , but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. © 2017 Neal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Pyruvate Formate-Lyase Is Essential for Fumarate-Independent Anaerobic Glycerol Utilization in the Enterococcus faecalis Strain W11

PubMed Central

Ikegami, Yuki

2014-01-01

Although anaerobic glycerol metabolism in Enterococcus faecalis requires exogenous fumarate for NADH oxidation, E. faecalis strain W11 can metabolize glycerol in the absence of oxygen without exogenous fumarate. In this study, metabolic end product analyses and reporter assays probing the expression of enzymes involved in pyruvate metabolism were performed to investigate this fumarate-independent anaerobic metabolism of glycerol in W11. Under aerobic conditions, the metabolic end products of W11 cultured with glycerol were similar to those of W11 cultured with glucose. However, when W11 was cultured anaerobically, most of the glucose was converted to l-lactate, but glycerol was converted to ethanol and formate. During anaerobic culture with glycerol, the expression of the l-lactate dehydrogenase and pyruvate dehydrogenase E1αβ genes in W11 was downregulated, whereas the expression of the pyruvate formate-lyase (Pfl) and aldehyde/alcohol dehydrogenase genes was upregulated. These changes in the expression levels caused the change in the composition of end products. A pflB gene disruptant (Δpfl mutant) of W11 could barely utilize glycerol under anaerobic conditions, but the growth of the Δpfl mutant cultured with either glucose or dihydroxyacetone (DHA) under anaerobic conditions was the same as that of W11. Glucose metabolism and DHA generates one NADH molecule per pyruvate molecule, whereas glycerol metabolism in the dehydrogenation pathway generates two NADH molecules per pyruvate molecule. These findings demonstrate that NADH generated from anaerobic glycerol metabolism in the absence of fumarate is oxidized through the Pfl-ethanol fermentation pathway. Thus, Pfl is essential to avoid the accumulation of excess NADH during fumarate-independent anaerobic glycerol metabolism. PMID:24769696

Catalytically important flavin linked through a phosphoester bond in a eukaryotic fumarate reductase.

PubMed

Serebryakova, Marina V; Bertsova, Yulia V; Sokolov, Svyatoslav S; Kolesnikov, Alexander A; Baykov, Alexander A; Bogachev, Alexander V

2018-06-01

One of the three domains of kinetoplastid NADH:fumarate oxidoreductase (FRD) is homologous to bacterial flavin transferase that catalyzes transfer of FMN residue from FAD to threonine in flavoproteins. Leptomonas pyrrhocoris FRD produced in yeast cells, which lack flavin transferase gene in their proteome, reduces fumarate in the presence of NADH and contains an FMN residue covalently linked to a Ser9 residue. The conserved flavinylation motif of FRD, D 3 (g/s)x(s/t)(s/g)AS 9 , is similar to the Dxx(s/t)gAT motif recognized by flavin transferase in prokaryotic proteins. Ser9 replacement abolished the flavinylation and fumarate reductase activity of FRD. These findings suggest that the flavinylation is important for the activity of FRD and that this post-translational modification is carried out by the own flavin transferase domain. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Geometric Restraint Drives On- and Off-pathway Catalysis by the Escherichia coli Menaquinol:Fumarate Reductase*

PubMed Central

Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni; Luna-Chávez, César; Davis, Tyler A.; Sarwar, Maruf; Ham, Amy J.; McDonald, W. Hayes; Yankovskaya, Victoria; Stern, Harry A.; Johnston, Jeffrey N.; Maklashina, Elena; Cecchini, Gary; Iverson, Tina M.

2011-01-01

Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of the C2–C3 double bond of activated fumarate parallel to the C(4a)–N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR. PMID:21098488

Fumaric Acid Esters Do Not Reduce Inflammatory NF-κB/p65 Nuclear Translocation, ICAM-1 Expression and T-Cell Adhesiveness of Human Brain Microvascular Endothelial Cells.

PubMed

Haarmann, Axel; Nehen, Mathias; Deiß, Annika; Buttmann, Mathias

2015-08-13

Dimethyl fumarate (DMF) is approved for disease-modifying treatment of patients with relapsing-remitting multiple sclerosis. Animal experiments suggested that part of its therapeutic effect is due to a reduction of T-cell infiltration of the central nervous system (CNS) by uncertain mechanisms. Here we evaluated whether DMF and its primary metabolite monomethyl fumarate (MMF) modulate pro-inflammatory intracellular signaling and T-cell adhesiveness of nonimmortalized single donor human brain microvascular endothelial cells at low passages. Neither DMF nor MMF at concentrations of 10 or 50 µM blocked the IL-1β-induced nuclear translocation of NF-κB/p65, whereas the higher concentration of DMF inhibited the nuclear entry of p65 in human umbilical vein endothelium cultured in parallel. DMF and MMF also did not alter the IL-1β-stimulated activation of p38 MAPK in brain endothelium. Furthermore, neither DMF nor MMF reduced the basal or IL-1β-inducible expression of ICAM-1. In accordance, both fumaric acid esters did not reduce the adhesion of activated Jurkat T cells to brain endothelium under basal or inflammatory conditions. Therefore, brain endothelial cells probably do not directly mediate a potential blocking effect of fumaric acid esters on the inflammatory infiltration of the CNS by T cells.

Rumen microbial response in production of CLA and methane to safflower oil in association with fish oil or/and fumarate.

PubMed

Li, Xiang Z; Long, Rui J; Yan, Chang G; Lee, Hong G; Kim, Young J; Song, Man K

2011-06-01

Supplementation effect of fish oil and/or fumarate on production of conjugated linoleic acid (CLA) and methane by rumen microbes was examined when incubated with safflower oil. One hundred and twenty milligrams of safflower oil (SO), safflower oil with 24 mg fish oil (SOFO), safflower oil with 24 mmol/L fumarate (SOFA), or safflower oil with 24 mg fish oil and 24 mmol/L fumarate (SOFOFA) were added to the 90 mL culture solution. The culture solution was also made without any supplements (control). The SOFA and SOFOFA increased pH and propionate (C3) compared to other treatments from 3 h incubation time. An accumulated amount of total methane (CH(4) ) for 12 h incubation was decreased by all the supplements compared to control. The concentrations of c9,t11CLA for all the incubation times were increased in the treatments of SOFO, SOFA and SOFOFA compared to SO. The highest concentration of c9,t11CLA was observed from SOFOFA among all the treatments at all incubation times. Overall data indicate that supplementation of combined fumarate and/or fish oil when incubated with safflower oil could depress CH(4) generation and increase production of C(3) and CLA under the condition of current in vitro study. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

Budesonide + formoterol fumarate dihydrate for the treatment of asthma.

PubMed

Wolthers, Ole D

2016-01-01

One of the most widely used fixed combinations in asthma management is dry powder budesonide+formoterol fumarate dihydrate which is commercially available as Symbicort Turbuhaler(®) (and generic products), Easyhaler Bufomix(®) and DuoRespSpiromax(®) inhaler. The aim of this paper was to review the fixed dry powder combination of inhaled budesonide+formoterol fumarate dihydrate for asthma treatment in adolescents and adults. A literature search using relevant search terms, reference lists for reviews and meta-analyses was performed. In symptomatic adolescent and adult patients with asthma maintenance and reliever therapy with a single-inhaler fixed combination of dry powder budesonide+formoterol fumarate dihydrate is an evidenced option. The combination treatment is convenient to patients. It reduces the number of exacerbations requiring treatment with oral corticosteroids. In some patients the strategy may also reduce the total intake of inhaled corticosteroids over time. Whether important outcome measures of asthma treatment, such as hospital admission and emergency room visit rates, may be reduced is less well documented since the published studies may have been influenced by publication bias. Non-pharmaceutical company-sponsored research evaluating such measures is needed. There is no evidence for the use of single inhaler fixed combinations of inhaled corticosteroids+long-acting β(2)-agonists in children (<12 years of age), and budesonide+formoterol fumarate dihydrate should not be prescribed to the age group.

Influence of the composition of the cellulolytic flora on the development of hydrogenotrophic microorganisms, hydrogen utilization, and methane production in the rumens of gnotobiotically reared lambs.

PubMed

Chaucheyras-Durand, Frédérique; Masséglia, Sébastien; Fonty, Gérard; Forano, Evelyne

2010-12-01

We investigated the influence of the composition of the fibrolytic microbial community on the development and activities of hydrogen-utilizing microorganisms in the rumens of gnotobiotically reared lambs. Two groups of lambs were reared. The first group was inoculated with Fibrobacter succinogenes, a non-H(2)-producing species, as the main cellulolytic organism, and the second group was inoculated with Ruminococcus albus, Ruminococcus flavefaciens, and anaerobic fungi that produce hydrogen. The development of hydrogenotrophic bacterial communities, i.e., acetogens, fumarate and sulfate reducers, was monitored in the absence of methanogens and after inoculation of methanogens. Hydrogen production and utilization and methane production were measured in rumen content samples incubated in vitro in the presence of exogenous hydrogen (supplemented with fumarate or not supplemented with fumarate) or in the presence of ground alfalfa hay as a degradable substrate. Our results show that methane production was clearly reduced when the dominant fibrolytic species was a non-H(2)-producing species, such as Fibrobacter succinogenes, without significantly impairing fiber degradation and fermentations in the rumen. The addition of fumarate to the rumen contents stimulated H(2) utilization only by the ruminal microbiota inoculated with F. succinogenes, suggesting that these communities could play an important role in fumarate reduction in vivo.

Preparation of hydrolytic liquid from dried distiller's grains with solubles and fumaric acid fermentation by Rhizopus arrhizus RH 7-13.

PubMed

Liu, Huan; Yue, Xuemin; Jin, Yuhan; Wang, Meng; Deng, Li; Wang, Fang; Tan, Tianwei

2017-10-01

Fumaric acid production from lignocellulosic materials is an alternative chemicals production system. This work investigated the suitable conditions for hydrolysis of dried distiller's grains with solubles (DDGS). The hydrolytic liquid was subsequently used for the production of fumaric acid. After optimizing the hydrolysis conditions, the most suitable concentration of H 2 SO 4 (2%), hydrolysis temperature (120 °C), hydrolysis time (100min) and solid/liquid ratio (1:10) were obtained. The yield of monosaccharides reached 258 mg/g DDGS and 15.88 g/L glucose, 7.53 g/L xylose and 2.35 g/L arabinose were obtained in unprocessed hydrolytic liquid. The furfural inhibitor in the hydrolytic liquid was also detected and the yield of it was reducing progressively in the pretreatment process. The ferment ability of the hydrolytic liquid from DDGS was tested through the process of fumaric acid production by Rhizopus arrhizus RH 7-13. The unprocessed hydrolytic liquid was not appropriate for the fermentation process. The yield of fumaric acid from the concentrated processed hydrolytic liquid reached 18.93 g/L, which was close to the yield of fermenting 80 g/L glucose. This result indicated that the commonly used carbon resource glucose could to some extent be replaced by processed hydrolytic liquid. Copyright © 2017 Elsevier Ltd. All rights reserved.

Geometric Restraint Drives On- and Off-pathway Catalysis by the Escherichia coli Menaquinol:Fumarate Reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni

2012-01-05

Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of themore » C2-C3 double bond of activated fumarate parallel to the C(4a)-N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR.« less

21 CFR 522.84 - Beta-aminopropionitrile fumarate.

Code of Federal Regulations, 2010 CFR

2010-04-01

... use in breeding animals since the effects on fertility, pregnancy, or fetal health have not been... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Beta-aminopropionitrile fumarate. 522.84 Section 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...

Stress Studies of Tenofovir Disoproxil Fumarate by HPTLC in Bulk Drug and Pharmaceutical Formulation

PubMed Central

Havele, Shweta; Dhaneshwar, Sunil R.

2012-01-01

A stability-indicating high-performance thin-layer chromatographic (HPTLC) method for determination of tenofovir disoproxil fumarate in bulk drug and in tablet has been developed and validated. The mobile phase selected was chloroform : methanol (9.0 : 1.0, v/v) with ultraviolet (UV) detection at 260 nm. The retention factor was found to be 0.49 ± 0.03 with correlation coefficients of 0.9994 in the range 300–1500 ng/spot and with an accuracy of 99.25%. Method had the potential to determine tenofovir disoproxil fumarate from tablet without any interference, and it was a stability-indicating one. PMID:22606065

Aerobic growth of campylobacter in media supplemented with a-ketoglutaric, lactic, and/or fumaric acids

USDA-ARS?s Scientific Manuscript database

A study was conducted to examine the ability of Campylobacter spp. to grow aerobically in media supplemented with selected organic acids. Basal broth media composed of tryptose, yeast extract, and a mineral-vitamin solution was supplemented with a-ketoglutaric, lactic, and/or fumaric acids. The fina...

21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

21 CFR 520.82a - Aminopropazine fumarate tablets.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...

21 CFR 520.82a - Aminopropazine fumarate tablets.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...

21 CFR 520.82a - Aminopropazine fumarate tablets.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...

21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

Complex effect of lignocellulosic biomass pretreatment with 1-butyl-3-methylimidazolium chloride ionic liquid on various aspects of ethanol and fumaric acid production by immobilized cells within SSF.

PubMed

Dotsenko, Anna S; Dotsenko, Gleb S; Senko, Olga V; Stepanov, Nikolay A; Lyagin, Ilya V; Efremenko, Elena N; Gusakov, Alexander V; Zorov, Ivan N; Rubtsova, Ekaterina A

2018-02-01

The pretreatment of softwood and hardwood samples (spruce and hornbeam wood) with 1-butyl-3-methylimidazolium chloride ([Bmim]Cl) was undertaken for further simultaneous enzymatic saccharification of renewable non-food lignocellulosic biomass and microbial fermentation of obtained sugars to ethanol and fumaric acid. A multienzyme cocktail based on cellulases and yeast or fungus cells producing ethanol and fumaric acid were the main objects of [Bmim]Cl influence studies. A complex effect of lignocellulosic biomass pretreatment with [Bmim]Cl on various aspects of the process (both action of cellulases and microbial conversion of hydrolysates to target products) was revealed. Positive effects of the pretreatment with [Bmim]Cl included decreasing the lignin content in the biomass, and increasing the effectiveness of enzymatic hydrolysis and microbial transformation of pretreated biomass. Immobilized cells of both yeasts and fungi possessed improved productive characteristics in the biotransformation of biomass pretreated with [Bmim]Cl to ethanol and fumaric acid. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Determination of dimethyl fumarate in bakery food by d-SPE-HPLC-PDA].

PubMed

Yang, Jie; Luo, Mengtian; Feng, Di; Miao, Hong; Song, Shufeng; Zhao, Yunfeng

2015-05-01

To establish a simple and rapid pretreatment method with dispersive solid phase extraction ( d-SPE) by HPLC for determination of dimethyl fumarate in bakery foods. Dimethyl fumarate in samples was ultrasonically extracted by methanol, and cleaned up with d-SPE. Then, it was separated on C18 chromatographic column (4.6 mm x 25 mm, 5 μm) with a mixture of methanol--0.03 mol/L sodium acetate and 0.008 mol/L tetrabutyl ammonium bromide (40: 60, V/V) as mobile phase. The photodiode array detector was used in the determination under λ = 220 nm. In the linear range of 0.1 -25 μg/ml, the correlation coefficients was r > 0.999, and the average recoveries of the spiked samples were in the range of 82.8% - 107.5% with relative standard deviations (RSD) in the range of 3.30% - 7.30% (n = 6). The limit of detection ( LOD) was 0.4 mg/kg, and the limit of quantification was 1.0 mg/kg. The method is simple, rapid, sensitive and accurate, and suitable for determine dimethyl fumarate in bakery foods.

A spectroscopic and surface microhardness study of enamel exposed to beverages supplemented with ferrous fumarate and ferrous sulfate. A randomized in vitro trial.

PubMed

Xavier, Arun M; Rai, Kavita; Hegde, Amitha M; Shetty, Suchetha

2016-06-01

To compare the efficacy between supplementing ferrous fumarate and ferrous sulfate to carbonated beverages by recording the in vitro mineral loss and surface microhardness (SMH) changes in human enamel. 120 enamel blocks each (from primary and permanent teeth) were uniformly prepared and the initial SMH was recorded. These enamel specimens were equally divided (n = 60) for their respective beverage treatment in Group 1 (2 mmol/L ferrous sulfate) and Group 2 (2 mmol/L ferrous fumarate). Each group was further divided into three subgroups as Coca-Cola, Sprite and mineral water (n= 10). The specimens were subjected to three repetitive cycles of respective treatment for a 5-minute incubation period, equally interspaced by 5-minute storage in artificial saliva. The calcium and phosphate released after each cycle were analyzed spectrophotometrically and the final SMH recorded. The results were tested using student's t-test, one-way ANOVA and Wilcoxon signed rank test (P < 0.05). The spectrophotometric assessment of calcium and phosphate withdrawal found more loss with the supplementation of 2 mmol/L ferrous sulfate than ferrous fumarate (P < 0.005). Similarly, the mean surface microhardness reduction was less with the supplementation of 2 mmol/L ferrous fumarate than with ferrous sulfate (P < 0.005). Statistical comparisons revealed the maximum surface microhardness and mineral loss with primary enamel and the maximum loss produced in all groups by Coca-Cola (P < 0.005).

Identification of Protein Succination as a Novel Modification of Tubulin

PubMed Central

Piroli, Gerardo G.; Manuel, Allison M.; Walla, Michael D.; Jepson, Matthew J.; Brock, Jonathan W.C.; Rajesh, Mathur P.; Tanis, Ross M.; Cotham, William E.; Frizzell, Norma

2015-01-01

Protein succination is a stable post-translational modification that occurs when fumarate reacts with cysteine residues to generate S-(2-succino)cysteine (2SC). We demonstrate that both alpha (α) and beta (β) tubulin are increasingly modified by succination in 3T3-L1 adipocytes and in the adipose tissue of db/db mice. Incubation of purified tubulin from porcine brain with fumarate (50 mM) or the pharmacological compound dimethylfumarate (DMF, 500 μM) inhibited polymerization up to 35% and 59%, respectively. Using mass spectrometry we identified Cys347α, Cys376α, Cys12β and Cys303β as sites of succination in porcine brain tubulin and the relative abundance of succination at these cysteines increased in association with fumarate concentration. The increase in succination after incubation with fumarate altered tubulin recognition by an anti-α-tubulin antibody. Succinated tubulin in adipocytes cultured in high glucose vs. normal glucose also had reduced reactivity with the anti-αtubulin antibody; suggesting that succination may interfere with tubulin:protein interactions. DMF reacted rapidly with 11 of the 20 cysteines in the αβ tubulin dimer, decreased the number of free sulfhydryls and inhibited the proliferation of 3T3-L1 fibroblasts. Our data suggests that inhibition of tubulin polymerization is an important, undocumented mechanism of action of DMF. Taken together, our results demonstrate that succination is a novel post-translational modification of tubulin and suggest that extensive modification by fumarate, either physiologically or pharmacologically, may alter microtubule dynamics. PMID:24909641

Crystallographic Studies of the Binding of Ligands to theDicarboxylate Site of Complex II, and the Identity of the Ligand in the'Oxaloacetate-Inhibited' State

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Li-Shar; Shen, John T.; Wang, Andy C.

2006-07-01

Mitochondrial Complex II (succinate:ubiquinoneoxidoreductase) is purified in a partially innactivated state, which canbe activated by removal of tightly bound oxaloacetate (Kearney, E.B. etal. Biochem Biophys Res Commun 49, 1115-1121). We crystallized Complex IIin the presence of oxaloacetate or with the endogenous inhibitor bound.The structure showed a ligand essentially identical to the "malate-likeintermediate" found in Shewanella Flavocytochrome c crystallized withfumarate (Taylor, P., et al. Nat Struct Biol 6, 1108-1112.)Crystallization of Complex II in the presence of excess fumarate alsogave the malate-like intermediate or a mixture of that and fumarate atthe active site. In order to more conveniently monitor the occupationstate ofmore » the dicarboxylate site, we are developing a library of UV/Visspectral effects induced by binding different ligands to the site.Treatment with fumarate results in rapid development of the fumaratedifference spectrum and then a very slow conversion into a speciesspectrally similar to the OAA liganded complex. Complex II is known to becapable of oxidizing malate to the enol form of oxaloacetate (Belikova,Y.O., et al. Biochim Biophys Acta 936, 1-9). The observations abovesuggest it may also be capable of interconverting fumarate and malate. Itmay be useful for understanding the mechanism and regulation of theenzyme to identify the malate-like intermediate and its pathway offormation from oxaloacetate or fumarate.« less

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...

Two Approaches to the Synthesis of Dimethyl Fumarate That Demonstrate Fundamental Principles of Organic Chemistry

ERIC Educational Resources Information Center

Love, Brian E.; Bennett, Lisa J.

2017-01-01

Two experiments are described which lead to the preparation of dimethyl fumarate, a compound currently used in the treatment of multiple sclerosis. Preparation of a compound with "real-world" applications is believed to increase student interest in the experiment. One experiment involves the isomerization of dimethyl maleate to the…

Simultaneous Production and Recovery of Fumaric Acid from Immobilized Rhizopus oryzae with a Rotary Biofilm Contactor and an Adsorption Column

PubMed Central

Cao, N.; Du, J.; Gong, C. S.; Tsao, G. T.

1996-01-01

An integrated system of simultaneous fermentation-adsorption for the production and recovery of fumaric acid from glucose by Rhizopus oryzae was investigated. The system was constructed such that growing Rhizopus mycelia were self-immobilized on the plastic discs of a rotary biofilm contactor during the nitrogen-rich growth phase. During the nongrowth, production phase, the biofilm was alternately exposed to liquid medium and air upon rotation of the discs in the horizontal fermentation vessel. The product of fermentation, fumaric acid, was removed simultaneously and continuously by a coupled adsorption column, thereby moderating inhibition, enhancing the fermentation rate, and sustaining cell viability. Another beneficial effect of the removal of fumaric acid is release of hydroxyl ions from a polyvinyl pyridine adsorbent into the circulating fermentation broth. This moderates the decrease in pH that would otherwise occur. Polyvinyl pyridine and IRA-900 gave the highest loading for this type of fermentation. This fermentation system is capable of producing fumaric acid with an average yield of 85 g/liter from 100 g of glucose per liter within 20 h under repetitive fed-batch cycles. On a weight yield basis, 91% of the theoretical maximum was obtained with a productivity of 4.25 g/liter/h. This is in contrast to stirred-tank fermentation supplemented with calcium carbonate, whose average weight yield was 65% after 72 h with a productivity of 0.9 g/liter/h. The immobilized reactor was operated repetitively for 2 weeks without loss of biological activity. PMID:16535381

Stimulation of Erwinia sp. fumarase and aspartase synthesis by changing medium components.

PubMed

Bagdasaryan, Z N; Aleksanyan, G A; Mirzoyan, A M; Roseiro, J C; Bagdasaryan, S N

2005-05-01

The optimal concentrations of nutrient medium components, aeration conditions, and pH providing for maximum biomass yields, as well as fumarase and L-aspartase activities, during submerged cultivation of Erwinia sp. were determined. The data showed that different concentrations of carbon source (molasses) and pH of the nutrient medium were required to reach the maximum fumarase and L-aspartase activities. Calculations performed by application of the additive lattice model suggested that the combination of these optimized factors would result in 3.2-, 3.4-, and 3.8-fold increases as compared to the experimental means in Erwinia sp. biomass, and L-aspartase and fumarase activities, respectively. The conditions of the fumaric acid biotransformations into L-malic and L-aspartic acids were optimized on the basis of intact Erwinia sp. cells, a fumarase and L-aspartase producer. In the cases of fumarate transformation into L-malic acid and of fumarate transformation into L-aspartic acids, fumarase and L-aspartase activities increased 1.5- and 1.7-fold, respectively. The experimental data were consistent with these estimates to 80% accuracy. In comparison with the additive lattice model, the application of polynomial nonlinear model allowed the between-factor relations to be considered and analyzed, which resulted in 1.1-, 1.27-, and 1.1-fold increases in Erwinia sp. biomass and fumarase and L-aspartase activities for the case of cultivation. In the case of fumarate transformation into L-malic acid, this model demonstrated a 1.7-fold increase in fumarase activity, whereas during fumarate transformation into L-aspartic acid no significant change in aspartase activity was observed.

Development of an Amperometric Biosensor Platform for the Combined Determination of L-Malic, Fumaric, and L-Aspartic Acid.

PubMed

Röhlen, Désirée L; Pilas, Johanna; Schöning, Michael J; Selmer, Thorsten

2017-10-01

Three amperometric biosensors have been developed for the detection of L-malic acid, fumaric acid, and L -aspartic acid, all based on the combination of a malate-specific dehydrogenase (MDH, EC 1.1.1.37) and diaphorase (DIA, EC 1.8.1.4). The stepwise expansion of the malate platform with the enzymes fumarate hydratase (FH, EC 4.2.1.2) and aspartate ammonia-lyase (ASPA, EC 4.3.1.1) resulted in multi-enzyme reaction cascades and, thus, augmentation of the substrate spectrum of the sensors. Electrochemical measurements were carried out in presence of the cofactor β-nicotinamide adenine dinucleotide (NAD + ) and the redox mediator hexacyanoferrate (III) (HCFIII). The amperometric detection is mediated by oxidation of hexacyanoferrate (II) (HCFII) at an applied potential of + 0.3 V vs. Ag/AgCl. For each biosensor, optimum working conditions were defined by adjustment of cofactor concentrations, buffer pH, and immobilization procedure. Under these improved conditions, amperometric responses were linear up to 3.0 mM for L-malate and fumarate, respectively, with a corresponding sensitivity of 0.7 μA mM -1 (L-malate biosensor) and 0.4 μA mM -1 (fumarate biosensor). The L-aspartate detection system displayed a linear range of 1.0-10.0 mM with a sensitivity of 0.09 μA mM -1 . The sensor characteristics suggest that the developed platform provides a promising method for the detection and differentiation of the three substrates.

High-level production of recombinant trypsin in transgenic rice cell culture through utilization of an alternative carbon source and recycling system.

PubMed

Kim, Nan-Sun; Yu, Hwa-Young; Chung, Nguyen-Duc; Kwon, Tae-Ho; Yang, Moon-Sik

2014-09-01

Productivity of recombinant bovine trypsin using a rice amylase 3D promoter has been studied in transgenic rice suspension culture. Alternative carbon sources were added to rice cell suspension cultures in order to improve the production of recombinant bovine trypsin. It was demonstrated that addition of alternative carbon sources such as succinic acid, fumaric acid and malic acid in the culture medium could increase the productivity of recombinant bovine trypsin 3.8-4.3-fold compared to those in the control medium without carbon sources. The highest accumulated trypsin reached 68.2 mg/L on day 5 in the culture medium with 40 mM fumaric acid. The feasibility of repeated use of the cells for recombinant trypsin production was tested in transgenic rice cell suspension culture with the culture medium containing the combination of variable sucrose concentration and 40 mM fumaric acid. Among the used combinations, the combination of 1% sucrose and 40 mM fumaric acid resulted in a yield of up to 53 mg/L five days after incubation. It also increased 31% (W/W) of dry cell weight and improved 43% of cell viability compared to that in control medium without sucrose. Based on these data, recycling of the trypsin production process with repeated 1% sucrose and 40 mM fumaric acid supplying-harvesting cycles was developed in flask scale culture. Recombinant bovine trypsin could be stably produced with a yield of up to 53-39 mg/L per cycle during five recycling cycles. Copyright © 2014 Elsevier Inc. All rights reserved.

Application of acetate, lactate, and fumarate as electron donors in microbial fuel cell

NASA Astrophysics Data System (ADS)

Vasyliv, Oresta M.; Bilyy, Oleksandr I.; Ferensovych, Yaroslav P.; Hnatush, Svitlana O.

2013-09-01

Microbial fuel cells (MFCs) are devices that use bacteria as the catalysts to oxidize organic and inorganic matter and generate current. Up to now, several classes of extracellular electron transfer mechanisms have been elucidated for various microorganisms. Shewanellaceae and Geobacteraceae families include the most of model exoelectrogenic microorganisms. Desulfuromonas acetoxidans bacterium inhabits aquatic sedimental sulfur-containing environments and is philogenetically close to representatives of Geobacteraceae family. Two chamber microbial fuel cell (0.3 l volume) was constructed with application of D. acetoxidans IMV B-7384 as anode biocatalyst. Acetic, lactic and fumaric acids were separately applied as organic electron donors for bacterial growth in constructed MFC. Bacterial cultivation in MFC was held during twenty days. Lactate oxidation caused electric power production with the highest value up to 0.071 mW on 64 hour of D. acetoxidans IMV B-7384 growth. Addition of acetic and fumaric acids into bacterial growth medium caused maximal power production up to 0.075 and 0.074 mW respectively on the 40 hour of their growth. Increasing of incubation time up to twentieth day caused decrease of generated electric power till 0.018 mW, 0.042 mW and 0.047 mW under usage of lactic, acetic and fumaric acids respectively by investigated bacteria. Power generation by D. acetoxidans IMV B-7384 was more stabile and durable under application of acetic and fumaric acids as electron donors in constructed MFC, than under addition of lactic acid in the same concentration into the growth medium.

Preservation of acidified cucumbers with a natural preservative combination of fumaric acid and allyl isothiocyanate that target lactic acid bacteria and yeasts

USDA-ARS?s Scientific Manuscript database

Without the addition of preservative compounds cucumbers acidified with 150 mM acetic acid with pH adjusted to 3.5 typically undergo fermentation by lactic acid bacteria. Fumaric acid (20 mM) inhibited growth of Lactobacillus plantarum and the lactic acid bacteria present on fresh cucumbers, but sp...

Nafuredin, a novel inhibitor of NADH-fumarate reductase, produced by Aspergillus niger FT-0554.

PubMed

Ui, H; Shiomi, K; Yamaguchi, Y; Masuma, R; Nagamitsu, T; Takano, D; Sunazuka, T; Namikoshi, M; Omura, S

2001-03-01

A novel compound, nafuredin, was isolated as an inhibitor of anaerobic electron transport (NADH-fumarate reductase). It was obtained from culture broth of Aspergillus niger FT-0554 isolated from a marine sponge. The structure was elucidated as an epoxy-delta-lactone with an attached methylated olefinic side chain on the basis of spectral analysis.

Fumaric acid: an overlooked form of fixed carbon in Arabidopsis and other plant species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chia, D.W.; Yoder, T.J.; Reiter, W.D.

2000-10-01

Photoassimilates are used by plants for production of energy, as carbon skeletons and in transport of fixed carbon between different plant organs. Many studies have been devoted to characterizing the factors that. regulate photoassimilate concentrations in different plant species. Most studies examining photoassimilate concentrations in C{sub 3} plants have focused on analyzing starch and soluble sugars. However, work presented here demonstrates that a number of C{sub 3} plants, including the popular model organism Arabidopsis thaliana (L.) Heynh., and agriculturally important plants, such as soybean [Glycine ma (L.) Merr.], contain significant quantities of furnaric acid. In fact, furnaric acid can accumulatemore » to levels of several mg per g fresh weight in A-abidopsis leaves, often exceeding starch and soluble sugar levels. Furnaric acid is a component of the tricarboxylic acid cycle and, like starch and soluble sugars, can be metabolized to yield energy and carbon skeletons for production of other compounds. Fumaric acid concentrations increase with plant age and light intensity in Arabidopsis leaves. Arabidopsis phloem exudates contain significant quantities of fumaric acid, raising the possibility that fumaric acid may function in carbon transport.« less

Solid-state cocrystal formation between acyclovir and fumaric acid: Terahertz and Raman vibrational spectroscopic studies.

PubMed

Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong

2017-11-05

The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8C7N1H27 and the carboxyl group COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.

Solid-state cocrystal formation between acyclovir and fumaric acid: Terahertz and Raman vibrational spectroscopic studies

NASA Astrophysics Data System (ADS)

Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong

2017-11-01

The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10 THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8dbnd C7sbnd N1sbnd H27 and the carboxyl group sbnd COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34 THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation.

Role of HCA₂ (GPR109A) in nicotinic acid and fumaric acid ester-induced effects on the skin.

PubMed

Hanson, Julien; Gille, Andreas; Offermanns, Stefan

2012-10-01

Nicotinic acid (NA) and fumaric acid esters (FAE) such as monomethyl fumarate or dimethyl fumarate are drugs that elicit a cutaneous reaction called flushing as a side effect. NA is used to reduce progression of atherosclerosis through its anti-dyslipidemic activity and lipid-independent mechanisms involving immune cells, whereas FAE are used to treat psoriasis via largely unknown mechanisms. Both, NA and FAE, induce flushing by the activation of the G-protein-coupled receptor (GPCR) Hydroxy-carboxylic acid receptor 2 (HCA₂, GPR109A) in cells of the epidermis. While the wanted effects of NA are at least in part also mediated by HCA₂, it is currently not clear whether this receptor is also involved in the anti-psoriatic effects of FAE. The HCA₂-mediated flushing response to these drugs involves the formation of prostaglandins D₂ and E₂ by Langerhans cells and keratinocytes via COX-1 in Langerhans cells and COX-2 in keratinocytes. This review summarizes recent progress in the understanding of the mechanisms underlying HCA₂-mediated flushing, describes strategies to mitigate it and discusses the potential link between flushing, HCA₂ and the anti-psoriatic effects of FAE. Copyright © 2012 Elsevier Inc. All rights reserved.

Vitamin D3 supplementation increases spine bone mineral density in adolescents and young adults with HIV infection being treated with tenofovir disoproxil fumarate: a randomized, placebo controlled trial

USDA-ARS?s Scientific Manuscript database

Background: Tenofovir disoproxil fumarate (TDF) decreases bone mineral density (BMD). We hypothesized vitamin D3 (VITD3) would increase BMD in adolescents/young adults receiving TDF. Methods: Randomized double-blind placebo-controlled trial of directly observed VITD3 50,000 IU vs. placebo every 4 ...

Role of dimethyl fumarate in oxidative stress of multiple sclerosis: A review.

PubMed

Suneetha, A; Raja Rajeswari, K

2016-04-15

Multiple sclerosis (MS) is a chronic inflammatory disease of the CNS affecting both white and grey matter. Inflammation and oxidative stress are also thought to promote tissue damage in multiple sclerosis. Recent data point at an important role of anti-oxidative pathways for tissue protection in chronic MS, particularly involving the transcription factor nuclear factor (erythroid-derived 2)-related factor 2 (Nrf2). Thus, novel therapeutics enhancing cellular resistance to free radicals could prove useful for MS treatment. Oxidative stress and anti-oxidative pathways are important players in MS pathophysiology and constitute a promising target for future MS therapy with dimethyl fumarate. The clinical utility of DMF in multiple sclerosis is being explored through phase III trials with BG-12, which is an oral therapeutic agent. Currently a wide research is going on to find out the exact mechanism of DMF, till date it is not clear. Based on strong signals of nephrotoxicity in non-humans and the theoretical risk of renal cell cancer from intracellular accumulation of fumarate, post-marketing study of a large population of patients will be necessary to fully assess the long-term safety of dimethyl fumarate. The current treatment goals are to shorten the duration and severity of relapses, prolong the time between relapses, and delay progression of disability. In this regard, dimethyl fumarate offers a promising alternative to orally administered fingolimod (GILENYA) or teriflunomide (AUBAGIO), which are currently marketed in the United States under FDA-mandated Risk Evaluation and Mitigation Strategy (REMS) programs because of serious safety concerns. More clinical experience with all three agents will be necessary to differentiate the tolerability of long-term therapy for patients diagnosed with multiple sclerosis. This write-up provides the detailed information of dimethyl fumarate in treating the neuro disease, multiple sclerosis and its mechanism involved via oxidative stress pathway. The rapid screening methods are also need to be developed to estimate DMF in biological samples to perform and proceed for further investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

Cost-Effectiveness of Treatments for Relapsing Remitting Multiple Sclerosis: A French Societal Perspective.

PubMed

Chevalier, Julie; Chamoux, Catherine; Hammès, Florence; Chicoye, Annie

2016-01-01

The paper aimed to estimate the incremental cost-effectiveness ratio (ICER) at the public published price for delayed-release dimethyl fumarate versus relevant Multiple Sclerosis disease-modifying therapies available in France in June 2015. The economic model was adapted to the French setting in accordance with the Haute Autorité de Santé guidelines using a model previously developed for NICE. A cohort of Relapsing Remitting Multiple Sclerosis patients was simulated over a 30-year time horizon. Twenty one health states were taken into account: Kurtzke Expanded Disability Status Scale (EDSS) 0-9 for Relapsing Remitting Multiple Sclerosis patients, EDSS 0-9 for Secondary Progressive Multiple Sclerosis patients, and death. Estimates of relative treatment efficacy were determined using a mixed-treatment comparison. Probabilities of events were derived from the dimethyl fumarate pivotal clinical trials and the London Ontario Dataset. Costs and utilities were extracted from the published literature from both the payer and societal perspectives. Univariate and probabilistic sensitivity analyses were performed to assess the robustness of the model results. From both perspectives, dimethyl fumarate and interferon beta-1a (IFN beta-1a) 44 mcg were the two optimal treatments, as the other treatments (IFN beta-1a 30 mcg, IFN beta-1b 250 mcg, teriflunomide, glatiramer acetate, fingolimod) were dominated on the efficiency frontier. From the societal perspective, dimethyl fumarate versus IFN beta-1a 44 mcg incurred an incremental cost of €3,684 and an incremental quality-adjusted life year (QALY) of 0.281, corresponding to an ICER of €13,110/QALY. Despite no reference threshold for France, dimethyl fumarate can be considered as a cost-effective option as it is on the efficiency frontier.

Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

PubMed Central

Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

2012-01-01

ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

Anaerobic respiration of Escherichia coli in the mouse intestine.

PubMed

Jones, Shari A; Gibson, Terri; Maltby, Rosalie C; Chowdhury, Fatema Z; Stewart, Valley; Cohen, Paul S; Conway, Tyrrell

2011-10-01

The intestine is inhabited by a large microbial community consisting primarily of anaerobes and, to a lesser extent, facultative anaerobes, such as Escherichia coli, which we have shown requires aerobic respiration to compete successfully in the mouse intestine (S. A. Jones et al., Infect. Immun. 75:4891-4899, 2007). If facultative anaerobes efficiently lower oxygen availability in the intestine, then their sustained growth must also depend on anaerobic metabolism. In support of this idea, mutants lacking nitrate reductase or fumarate reductase have extreme colonization defects. Here, we further explore the role of anaerobic respiration in colonization using the streptomycin-treated mouse model. We found that respiratory electron flow is primarily via the naphthoquinones, which pass electrons to cytochrome bd oxidase and the anaerobic terminal reductases. We found that E. coli uses nitrate and fumarate in the intestine, but not nitrite, dimethyl sulfoxide, or trimethylamine N-oxide. Competitive colonizations revealed that cytochrome bd oxidase is more advantageous than nitrate reductase or fumarate reductase. Strains lacking nitrate reductase outcompeted fumarate reductase mutants once the nitrate concentration in cecal mucus reached submillimolar levels, indicating that fumarate is the more important anaerobic electron acceptor in the intestine because nitrate is limiting. Since nitrate is highest in the absence of E. coli, we conclude that E. coli is the only bacterium in the streptomycin-treated mouse large intestine that respires nitrate. Lastly, we demonstrated that a mutant lacking the NarXL regulator (activator of the NarG system), but not a mutant lacking the NarP-NarQ regulator, has a colonization defect, consistent with the advantage provided by NarG. The emerging picture is one in which gene regulation is tuned to balance expression of the terminal reductases that E. coli uses to maximize its competitiveness and achieve the highest possible population in the intestine.

Recent advances in the biomedical applications of fumaric acid and its ester derivatives: The multifaceted alternative therapeutics.

PubMed

Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

2016-04-01

Several lines of evidence have demonstrated the potential biomedical applications of fumaric acid (FA) and its ester derivatives against many human disease conditions. Fumaric acid esters (FAEs) have been licensed for the systemic treatment of the immune-mediated disease psoriasis. Biogen Idec Inc. announced about the safety and efficacy of the formulation FAE (BG-12) for treating RRMS (relapsing-remitting multiple sclerosis). Another FAE formulation DMF (dimethyl fumarate) was found to be capable of reduction in inflammatory cardiac conditions, such as autoimmune myocarditis and ischemia and reperfusion. DMF has also been reported to be effective as a potential neuroprotectant against the HIV-associated neurocognitive disorders (HAND). Many in vivo studies carried out on rat and mice models indicated inhibitory effects of fumaric acid on carcinogenesis of different origins. Moreover, FAEs has emerged as an important matrix ingredient in the fabrication of biodegradable scaffolds for tissue engineering applications. Drug delivery vehicles composed of FAEs have shown promising results in delivering some leading drug molecules. Apart from these specific applications and findings, many more studies on FAEs have revealed new therapeutic potentials with the scope of clinical applications. However, until now, this scattered vital information has not been written into a collective account and analyzed for minute details. The aim of this paper is to review the advancement made in the biomedical application of FA and FAEs and to focus on the clinical investigation and molecular interpretation of the beneficial effects of FA and FAEs. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Time Course-Dependent Methanogenic Crude Oil Biodegradation: Dynamics of Fumarate Addition Metabolites, Biodegradative Genes, and Microbial Community Composition

PubMed Central

Toth, Courtney R. A.; Gieg, Lisa M.

2018-01-01

Biodegradation of crude oil in subsurface petroleum reservoirs has adversely impacted most of the world's oil, converting this resource to heavier forms that are of lower quality and more challenging to recover. Oil degradation in deep reservoir environments has been attributed to methanogenesis over geological time, yet our understanding of the processes and organisms mediating oil transformation in the absence of electron acceptors remains incomplete. Here, we sought to identify hydrocarbon activation mechanisms and reservoir-associated microorganisms that may have helped shape the formation of biodegraded oil by incubating oilfield produced water in the presence of light (°API = 32) or heavy crude oil (°API = 16). Over the course of 17 months, we conducted routine analytical (GC, GC-MS) and molecular (PCR/qPCR of assA and bssA genes, 16S rRNA gene sequencing) surveys to assess microbial community composition and activity changes over time. Over the incubation period, we detected the formation of transient hydrocarbon metabolites indicative of alkane and alkylbenzene addition to fumarate, corresponding with increases in methane production and fumarate addition gene abundance. Chemical and gene-based evidence of hydrocarbon biodegradation under methanogenic conditions was supported by the enrichment of hydrocarbon fermenters known to catalyze fumarate addition reactions (e.g., Desulfotomaculum, Smithella), along with syntrophic bacteria (Syntrophus), methanogenic archaea, and several candidate phyla (e.g., “Atribacteria”, “Cloacimonetes”). Our results reveal that fumarate addition is a possible mechanism for catalyzing the methanogenic biodegradation of susceptible saturates and aromatic hydrocarbons in crude oil, and we propose the roles of community members and candidate phyla in our cultures that may be involved in hydrocarbon transformation to methane in crude oil systems. PMID:29354103

Respiration-linked proton translocation coupled to anaerobic reduction of manganese(IV) and iron(III) in Shewanella putrefaciens MR-1.

PubMed Central

Myers, C R; Nealson, K H

1990-01-01

An oxidant pulse technique, with lactate as the electron donor, was used to study respiration-linked proton translocation in the manganese- and iron-reducing bacterium Shewanella putrefaciens MR-1. Cells grown anaerobically with fumarate or nitrate as the electron acceptor translocated protons in response to manganese (IV), fumarate, or oxygen. Cells grown anaerobically with fumarate also translocated protons in response to iron(III) and thiosulfate, whereas those grown with nitrate did not. Aerobically grown cells translocated protons only in response to oxygen. Proton translocation with all electron acceptors was abolished in the presence of the protonophore carbonyl cyanide m-chlorophenylhydrazone (20 microM) and was partially to completely inhibited by the electron transport inhibitor 2-n-heptyl-4-hydroxyquinoline N-oxide (50 microM). PMID:2172208

Crystallization of mitochondrial rhodoquinol-fumarate reductase from the parasitic nematode Ascaris suum with the specific inhibitor flutolanil

PubMed Central

Osanai, Arihiro; Harada, Shigeharu; Sakamoto, Kimitoshi; Shimizu, Hironari; Inaoka, Daniel Ken; Kita, Kiyoshi

2009-01-01

In adult Ascaris suum (roundworm) mitochondrial membrane-bound complex II acts as a rhodoquinol-fumarate reductase, which is the reverse reaction to that of mammalian complex II (succinate-ubiquinone reductase). The adult A. suum rhodoquinol-fumarate reductase was crystallized in the presence of octaethyleneglycol monododecyl ether and n-dodecyl-β-d-maltopyranoside in a 3:2 weight ratio. The crystals belonged to the orthorhombic space group P212121, with unit-cell parameters a = 123.75, b = 129.08, c = 221.12 Å, and diffracted to 2.8 Å resolution using synchrotron radiation. The presence of two molecules in the asymmetric unit (120 kDa × 2) gives a crystal volume per protein mass (V M) of 3.6 Å3 Da−1. PMID:19724139

Multi-organ sarcoidosis treatment with fumaric acid esters: a case report and review of the literature.

PubMed

Zouboulis, Christos C; Lippert, Undine; Karagiannidis, Ioannis

2014-01-01

Sarcoidosis is a rare, systemic disease that is characterized by the formation of granulomas in various organs, including the skin. As the etiology remains unknown, the treatment of sarcoidosis is challenging. We present a 47-year-old female patient with progressive, multi-organ sarcoidosis who had a complete clinical improvement of the skin lesions, a moderate reduction in pulmonary opacities on chest X-ray, a marked subjective improvement in general status and pulmonary efficiency and a marked reduction in serum angiotensin-converting enzyme and soluble interleukin-2 receptor after 6 months of therapy with fumaric acid esters. The present case and similar reports in the literature highlight the probable efficacy of fumaric acid esters in the treatment of sarcoidosis and other non-infectious, granulomatous diseases. © 2014 S. Karger AG, Basel.

Cutaneous and uterine leiomyomatosis and ovarian cystadenoma associated with deficiency of fumarate hydratase

PubMed Central

Hüller, Cornelia; Grunow, Norbert; Nadler, Torsten; Bär, Michael

2011-01-01

We report on an exceedingly rare case of cutaneous and uterine leiomyomatosis in a 58-year-old Caucasian woman associated with ovarian cystadenoma and complete deletion of the fumarate hydratase gene. All patients and their family members with verified mutation have to be regularly screened for associated neoplasms, in particular papillary renal cell carcinoma (HLRCC, hereditary leiomyomatosis and renal cell cancer). PMID:24396716

Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques

NASA Astrophysics Data System (ADS)

Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

2016-01-01

As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques.

In vitro and in vivo evaluation of ketotifen fumarate-loaded silicone hydrogel contact lenses for ocular drug delivery.

PubMed

Xu, Jinku; Li, Xinsong; Sun, Fuqian

2011-02-01

The purpose of this work was to evaluate the usefulness of silicone hydrogel contact lenses loaded with ketotifen fumarate for ocular drug delivery. First, silicone contact lenses were prepared by photopolymerization of bitelechelic methacrylated polydimethylsiloxanes macromonomer, 3-methacryloxypropyltris(trimethylsiloxy)silane, and N,N-dimethylacrylamide using ethylene glycol dimethacrylate as a cross-linker and Darocur 1173 as an initiator followed by surface plasma treatment. Then, the silicone hydrogel matrices of the contact lenses were characterized by equilibrium swelling ratio (ESR), tensile tests, ion permeability, and surface contact angle. Finally, the contact lenses were loaded with ketotifen fumarate by pre-soaking in drug solution to evaluate drug loading capacity, in vitro and in vivo release behavior of the silicone contact lenses. The results showed that ESR and ion permeability increase, and the surface contact angle and tensile strength decreased with the increase of DMA component in the silicone hydrogel. The drug loading and in vitro releases were dependent on the hydrogel composition of hydrophilic/hydrophobic phase of the contact lenses. In rabbit eyes, the pre-soaked contact lenses sustained ketotifen fumarate release for more than 24 h, which leads to a more stable drug concentration and a longer mean retention time in tear fluid than that of eye drops of 0.05%.

Pharmacokinetics of Dolutegravir When Administered With Mineral Supplements in Healthy Adult Subjects

PubMed Central

Song, Ivy; Borland, Julie; Arya, Niki; Wynne, Brian; Piscitelli, Stephen

2015-01-01

All commercially available integrase inhibitors are 2-metal binders and may be affected by co-administration with metal cations. The purpose of this study was to evaluate the effect of calcium and iron supplements on dolutegravir pharmacokinetics and strategies (dose separation and food) to attenuate the effects if significant reductions in dolutegravir exposure were observed. This was an open-label, crossover study that randomized 24 healthy subjects into 1 of 2 cohorts to receive 4 treatments: (1) dolutegravir alone, fasting; (2) dolutegravir with calcium carbonate or ferrous fumarate, fasting; (3) dolutegravir with calcium carbonate or ferrous fumarate with a moderate-fat meal; (4) dolutegravir administered 2 hours before calcium carbonate or ferrous fumarate, fasting. Plasma dolutegravir AUC(0–∞), Cmax, and C24 were reduced by 39%, 37%, and 39%, respectively, when co-administered with calcium carbonate while fasting and were reduced by 54%, 57%, and 56%, respectively, when co-administered with ferrous fumarate while fasting. Dolutegravir administration 2 hours before calcium or iron supplement administration (fasted), as well as administration with a meal, counteracted the effect. Dolutegravir and calcium or iron supplements can be co-administered if taken with a meal. Under fasted conditions, dolutegravir should be administered 2 hours before or 6 hours after calcium or iron supplements. PMID:25449994

Shoe contact dermatitis from dimethyl fumarate: clinical manifestations, patch test results, chemical analysis, and source of exposure.

PubMed

Giménez-Arnau, Ana; Silvestre, Juan Francisco; Mercader, Pedro; De la Cuadra, Jesus; Ballester, Isabel; Gallardo, Fernando; Pujol, Ramón M; Zimerson, Erik; Bruze, Magnus

2009-11-01

The methyl ester form of fumaric acid named dimethyl fumarate (DMF) is an effective mould-growth inhibitor. Its irritating and sensitizing properties were demonstrated in animal models. Recently, DMF has been identified as responsible for furniture contact dermatitis in Europe. To describe the clinical manifestations, patch test results, shoe chemical analysis, and source of exposure to DMF-induced shoe contact dermatitis. Patients with suspected shoe contact dermatitis were studied in compliance with the Declaration of Helsinki. Patch test results obtained with their own shoe and the European baseline series, acrylates and fumaric acid esters (FAE), were recorded according to international guidelines. The content of DMF in shoes was analysed with gas chromatography and mass spectrometry. Acute, immediate irritant contact dermatitis and non-immunological contact urticaria were observed in eight adults and two children, respectively. All the adult patients studied developed a delayed sensitization demonstrated by a positive patch testing to DMF < or = 0.1% in pet. Cross-reactivity with other FAEs and acrylates was observed. At least 12 different shoe brands were investigated. The chemical analysis from the available shoes showed the presence of DMF. DMF in shoes was responsible for severe contact dermatitis. Global preventive measures for avoiding contact with DMF are necessary.

Decline in bone mass with tenofovir disoproxil fumarate/emtricitabine is associated with hormonal changes in the absence of renal impairment when used by HIV uninfected adolescent boys and young men for HIV pre-exposure

USDA-ARS?s Scientific Manuscript database

Background. We aimed to define the relative importance of renal and endocrine changes in tenofovir disoproxil fumarate (TDF)-related bone toxicity. Methods. In a study of daily TDF/emtricitabine (FTC) pre-exposure prophylaxis (PrEP) in HIV uninfected young men who have sex with men, we measured ch...

The effect of change in pH on the solubility of iron bis-glycinate chelate and other iron compounds.

PubMed

García-Casal, M N; Layrisse, M

2001-03-01

The effect of a pH change from 2 to 6 was tested on the solubility of ferrous sulfate, ferrous fumarate, iron bis-glycine chelate (Ferrochel) and sodium-iron ethylenediaminetetraacetic acid (NaFeEDTA). It was found that at pH 2 ferrous sulfate, Ferrochel and NaFeEDTA were completely soluble and only 75% of iron from ferrous fumarate was soluble. When pH was raised to 6, iron from amino acid chelate and NaFeEDTA remained completely soluble while solubility from ferrous sulfate and ferrous fumarate decreased 64 and 74%, respectively compared to the amount of iron initially soluble at pH 2. These results suggest that iron solubility from iron bis-glycine chelate and NaFeEDTA is not affected by pH changes within the ranges tested, probably because iron remained associated to the respective compounds.

Poly(fumaric-co-sebacic anhydride). A degradation study as evaluated by FTIR, DSC, GPC and X-ray diffraction.

PubMed

Santos, C A; Freedman, B D; Leach, K J; Press, D L; Scarpulla, M; Mathiowitz, E

1999-06-28

The degradation of three poly(fumaric-co-sebacic anhydride) [P(FA:SA)] copolymers is examined in a composition of microspheres made by the hot melt encapsulation process. The emergence of low molecular weight oligomers occurs during degradation of the copolymer microspheres, as evidenced by a variety of characterization methods. Characterization was conducted to determine the extent of degradation of the polyanhydride microspheres using Fourier-transform infrared spectroscopy (FTIR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC) and X-ray diffraction. It is demonstrated that degradation of P(FA:SA) is greatly accelerated at basic pH, yet there is little difference between degradation in neutral and acidic buffers. A good correlation exists between the results of each characterization method, which allows a better understanding of the degradation process and the resulting formation of low molecular weight oligomers in poly(fumaric-co-sebacic anhydride).

An Iterative O-Methyltransferase Catalyzes 1,11-Dimethylation of Aspergillus fumigatus Fumaric Acid Amides.

PubMed

Kalb, Daniel; Heinekamp, Thorsten; Schieferdecker, Sebastian; Nett, Markus; Brakhage, Axel A; Hoffmeister, Dirk

2016-10-04

S-adenosyl-l-methionine (SAM)-dependent methyltransfer is a common biosynthetic strategy to modify natural products. We investigated the previously uncharacterized Aspergillus fumigatus methyltransferase FtpM, which is encoded next to the bimodular fumaric acid amide synthetase FtpA. Structure elucidation of two new A. fumigatus natural products, the 1,11-dimethyl esters of fumaryl-l-tyrosine and fumaryl-l-phenylalanine, together with ftpM gene disruption suggested that FtpM catalyzes iterative methylation. Final evidence that a single enzyme repeatedly acts on fumaric acid amides came from an in vitro biochemical investigation with recombinantly produced FtpM. Size-exclusion chromatography indicated that this methyltransferase is active as a dimer. As ftpA and ftpM homologues are found clustered in other fungi, we expect our work will help to identify and annotate natural product biosynthesis genes in various species. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Efficient aspartic acid production by a psychrophile-based simple biocatalyst.

PubMed

Tajima, Takahisa; Hamada, Mai; Nakashimada, Yutaka; Kato, Junichi

2015-10-01

We previously constructed a Psychrophile-based Simple bioCatalyst (PSCat) reaction system, in which psychrophilic metabolic enzymes are inactivated by heat treatment, and used it here to study the conversion of aspartic acid from fumaric acid mediated by the activity of aspartate ammonia-lyase (aspartase). In Escherichia coli, the biosynthesis of aspartic acid competes with that of L-malic acid produced from fumaric acid by fumarase. In this study, E. coli aspartase was expressed in psychrophilic Shewanella livingstonensis Ac10 heat treated at 50 °C for 15 min. The resultant PSCat could convert fumaric acid to aspartic acid without the formation of L-malic acid because of heat inactivation of psychrophilic fumarase activity. Furthermore, alginate-immobilized PSCat produced high yields of aspartic acid and could be re-used nine times. The results of our study suggest that PSCat can be applied in biotechnological production as a new approach to increase the yield of target compounds.

Pharmacokinetics and food interaction of a novel prodrug of tenofovir, tenofovir dipivoxil fumarate, in healthy volunteers.

PubMed

Lu, C; Jia, Y; Chen, L; Ding, Y; Yang, J; Chen, M; Song, Y; Sun, X; Wen, A

2013-04-01

Tenofovir dipivoxil fumarate is a novel ester prodrug of tenofovir, a specific anti-hepatitis B virus (HBV) drug candidate. The pharmacokinetic properties and the effects of food intake on tenofovir dipivoxil have not yet been reported in healthy adults. The aim of this study was to evaluate the pharmacokinetic properties and food interaction of tenofovir dipivoxil in healthy Chinese volunteers. Pharmacokinetic studies included an ascending single dose of 150, 300, 600 mg and multiple doses of 300 mg. Food interaction was evaluated following a single oral dose of tenofovir dipivoxil fumarate 300 mg administered with a high-fat and high-energy standard breakfast or after a 12-h fast. Pharmacokinetic parameters of tenofovir given in each treatment period were calculated using non-compartmental analysis. After a single dose of 150, 300 and 600 mg, the main pharmacokinetic parameters for tenofovir were as follows: Cmax 209·6, 456·7, 989·8 ng/mL; AUClast 1744·9, 2663·5, 6010·2 ng h/mL, respectively. After multiple doses of 300 mg, the main pharmacokinetic parameters for tenofovir were Cmax 523·4 ng/mL, AUClast 4152·4 ng h/mL. After a single dose of 300 mg with a high-fat and high-energy standard breakfast, the main pharmacokinetic parameters for tenofovir were Cmax 448·5 ng/mL, AUClast 3286·8 ng h/mL. The plasma Cmax and AUC of tenofovir showed significance difference between a single dose of 300 mg and the accordingly multiple doses (P < 0·05). A standard high-fat meal enhanced mean AUClast values of tenofovir (relative AUClast  = 125·8%; 90% CI 114·5, 136·2); however, food did not show any significant on Cmax (relative Cmax  = 103·4%; 90% CI 94·6, 112·6). Oral tenofovir dipivoxil fumarate produced predictable and dose-proportional plasma tenofovir pharmacokinetics. The accumulation ratio was 1·51, suggesting tenofovir dipivoxil fumarate displayed accumulation after repeated administration. The bioavailability of tenofovir dipivoxil fumarate was increased by approximately 25% as measured by AUClast after a single dose when taken with food, compared with fasting. © 2012 Blackwell Publishing Ltd.

Sensorial evaluation of nutritional supplements (PROGRESA) enriched with 3 different forms of iron in a rural Mexican community.

PubMed

Morales, J; Vargas, F; Cassís, L; Sánchez, E; Villalpando, S

2008-01-01

As part of the efforts to reduce iron deficiency anemia (IDA), the Mexican Federal program PROGRESA distributes complementary foods to toddlers and pregnant women living in extreme poverty. Complementary foods were originally fortified with hydrogen-reduced iron, which proved a limited efficacy. The supplement was reformulated to provide higher iron bioavailability. This investigation aims to assess the sensory changes and the acceptance of new versions of the complementary foods fortified with either reduced iron, ferrous fumarate, or ferrous sulfate, stored at room temperature for 2, 4, and 6 mo. Complementary foods were presented without flavor (plain) or flavored with either chocolate or vanilla. The complementary foods were evaluated in toddlers and their mothers using a hedonic scale. The percentage of overall acceptance for the baby foods was higher in toddlers (80% to 88%) than in their mothers (63% to 68%). The complementary foods with a better acceptance were those fortified with reduced iron (63% to 68%) and ferrous fumarate (61% to 80%) independently of the flavoring added. The acceptance of the beverage intended for women was better for those fortified with reduced iron (52% to 63%) or ferrous fumarate (44% to 63%) in their vanilla-flavored version. For women, the most accepted sources of iron were reduced iron (50% to 60%) and ferrous fumarate (50% to 58%).

Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques.

PubMed

Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

2016-01-15

As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques. Copyright © 2015 Elsevier B.V. All rights reserved.

Simultaneous Determination of Formoterol Fumarate and Budesonide Epimers in Metered Dose Inhaler Using Ion-Pair Chromatography.

PubMed

Salem, Y A; Shaldam, M A; El-Sherbiny, D T; El-Wasseef, D R; El-Ashry, S M

2017-11-01

A simple, accurate and valid ion-pairing chromatographic method was developed for the simultaneous determination of formoterol fumarate (FF) and budesonide (BUD) epimers in metered dose inhaler. The separation was performed on C-18 column using mobile phase consisting of acetonitrile:0.05 M sodium acetate buffer (40:60% v/v) containing 0.03% sodium dodecyl sulfate adjusted to pH 3.1 using increasing volumes of either TEA or orthophosphoric acid isocratically eluted at 1.0 mL/min. Quantitation was achieved with UV detection at 214 nm. The retention times were 3.22, 6.41 and 6.91 min for formoterol fumarate, budesonide epimers B and A, respectively. The linearity range was 0.05-5.0 μg/mL for formoterol fumarate and 0.5-50.0 μg/mL for budesonide. The method was validated for, linearity; lower limit of quantification, lower limit of detection accuracy and precision. The proposed method is rapid (7 min), reproducible (RSD < 2.0%) and achieves satisfactory resolution between FF and BUD B (resolution factor = 12.07). The mean recoveries of the analytes in metered dose inhaler (99.97 and 99.83% for FF and BUD, respectively) were satisfactory. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Production of Plant Phthalate and its Hydrogenated Derivative from Bio-Based Platform Chemicals.

PubMed

Lu, Rui; Lu, Fang; Si, Xiaoqin; Jiang, Huifang; Huang, Qianqian; Yu, Weiqiang; Kong, Xiangtao; Xu, Jie

2018-04-06

Direct transformation of bio-based platform chemicals into aromatic dicarboxylic acids and their derivatives, which are widely used for the manufacture of polymers, is of significant importance for the sustainable development of the plastics industry. However, limited successful chemical processes have been reported. This study concerns a sustainable route for the production of phthalate and its hydrogenated derivative from bio-based malic acid and erythritol. The key Diels-Alder reaction is applied to build a substituted cyclohexene structure. The dehydration reaction of malic acid affords fumaric acid with 96.6 % yield, which could be used as the dienophile, and 1,3-butadiene generated in situ through erythritol deoxydehydration serves as the diene. Starting from erythritol and dibutyl fumarate, a 74.3 % yield of dibutyl trans-4-cyclohexene-1,2-dicarboxylate is obtained. The palladium-catalyzed dehydrogenation of the cycloadduct gives a 77.8 % yield of dibutyl phthalate. Dibutyl trans-cyclohexane-1,2-dicarboxylate could be formed in nearly 100 % yield under mild conditions by hydrogenation of the cycloadduct. Furthermore, fumaric acid and fumarate, with trans configurations, were found to be better dienophiles for this Diels-Alder reaction than maleic acid and maleate, with cis configuration, based on the experimental and computational results. This new route will pave the way for the production of environmental friendly plastic materials from plants. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Using organic acids to control subacute ruminal acidosis and fermentation in feedlot cattle fed a high-grain diet.

PubMed

Vyas, D; Beauchemin, K A; Koenig, K M

2015-08-01

The objective of this study was to determine whether supplementing organic acids can prevent incidences of subacute ruminal acidosis (SARA) in beef heifers fed a diet consisting of 8% barley silage and 92% barley grain-based concentrate (DM basis). Ten ruminally cannulated Hereford crossbred heifers (484 ± 25 kg BW) were used in a replicated 5 × 5 Latin square design with 14-d periods including 10 d for dietary adaptation and 4 d for measurements. Dietary treatments included no supplementation (Control), low fumaric acid (61 g/d), high fumaric acid (125 g/d), low malic acid (59 g/d), and high malic acid (134 g/d). Organic acid supplementation had no effect on DMI ( = 0.77). Similarly, no effects were observed on mean ( = 0.74), minimum ( = 0.64), and maximum ( = 0.27) ruminal pH measured continuously for 48 h. Moreover, area under the curve for pH thresholds 6.2 ( = 0.97), 5.8 ( = 0.66), 5.5 ( = 0.55), and 5.2 ( = 0.93) was similar for all treatments. However, malic acid supplementation lowered the amount of time that ruminal pH was <6.2 compared with the Control ( = 0.02) and fumaric acid treatments ( < 0.01). No effects were observed on total VFA concentrations with organic acid supplementation ( = 0.98) compared with the Control, but greater total VFA concentrations were observed with fumaric acid compared with the malic acid treatments ( = 0.02). The population of total culturable bacteria 3 h after feeding was reduced with supplemental malic acid compared with the Control ( = 0.03) and fumaric acid treatments ( = 0.03). However, no effects were observed with organic acid supplementation on lactic acid-utilizing bacteria ( = 0.59). In conclusion, under the conditions of the present study, organic acid supplementation did not have any significant effects on ruminal fermentation parameters compared with the Control and were not effective in preventing SARA in beef cattle fed high-grain diets.

Development and application of an exchange model for anisotropic water diffusion in the microporous MOF aluminum fumarate

NASA Astrophysics Data System (ADS)

Splith, Tobias; Fröhlich, Dominik; Henninger, Stefan K.; Stallmach, Frank

2018-06-01

Diffusion of water in aluminum fumarate was studied by means of pulsed field gradient (PFG) nuclear magnetic resonance (NMR). Due to water molecules exchanging between the intracrystalline anisotropic pore space and the isotropic intercrystalline void space the model of intracrystalline anisotropic diffusion fails to describe the experimental PFG NMR data at high observation times. Therefore, the two-site exchange model developed by Kärger is extended to the case of exchange between an anisotropic and an isotropic site. This extended exchange model is solved by numerical integration. It describes the experimental data very well and yields values for the intracrystalline diffusion coefficient and the mean residence times of the respective sites. Further PFG NMR studies were performed with coatings consisting of small aluminum fumarate crystals, which are used in adsorptive heat transformation applications. The diffusion coefficients of water in the small crystal coating are compared to the values expected from the extended two-site exchange model and from the model of long-range diffusion.

Immobilization of Escherichia coli Cells Containing Aspartase Activity with Polyurethane and Its Application for l-Aspartic Acid Production

PubMed Central

Fusee, Murray C.; Swann, Wayne E.; Calton, Gary J.

1981-01-01

Whole cells of Escherichia coli containing aspartase activity were immobilized by mixing a cell suspension with a liquid isocyanate-capped polyurethane prepolymer (Hypol). The immobilized cell preparation was used to convert ammonium fumarate to l-aspartic acid. Properties of the immobilized E. coli cells containing aspartase were investigated with a batch reactor. A 1.67-fold increase in the l-aspartic acid production rate was observed at 37°C as compared to 25°C operating temperature. The pH optimum was broad, ranging from 8.5 to 9.2. Increasing the concentration of ammonium fumarate to 1.5 M from 1.0 M negatively affected the reaction rate. l-Aspartic acid was produced at an average rate of 2.18 × 10−4 mol/min per g (wet weight) of immobilized E. coli cells with a 37°C substrate solution consisting of 1.0 M ammonium fumarate with 1 mM Mg2+ (pH 9.0). PMID:16345865

Survey of dimethyl fumarate in desiccant products during 2009 in Italy.

PubMed

Stefanelli, Patrizia; Girolimetti, Silvana; Santilio, Angela; Dommarco, Roberto

2011-04-01

Dimethyl fumarate (DMFu) is a substance with remarkable hygroscopicity and fungicidal power, which has recently showed to be a strong sensitizer to humans. The use of DMFu in little desiccant pouches, for e.g. in handbags or footwear boxes, might result in the contamination of leather products, with the subsequent exposure to consumers by contact. In 2009, 153 samples of desiccant material were collected from leather manufactures all over Italy and analyzed for DMFu. Results proved to fall in a wide range (0.14-7145 mg/kg).

Iron bioavailability in corn-masa tortillas is improved by the addition of disodium EDTA.

PubMed

Walter, Tomás; Pizarro, Fernando; Olivares, Manuel

2003-10-01

Corn-masa flour flat bread tortillas are the main staple of Mexican and Central American populations. Due to high concentrations of inhibitors of iron absorption, the bioavailability from this matrix is unknown. We wanted to determine the most suitable fortificant that would efficaciously improve iron bioavailability. In tortillas prepared with commercial precooked, lime-treated, corn-masa flour, we examined the in vitro solubility of the following forms of iron: native iron with and without Na2EDTA, elemental reduced iron plus Na2EDTA, ferrous fumarate with and without Na2EDTA, bisglycine iron, ferrous sulfate and NaFeEDTA. We also examined the in vivo bioavailability in humans with double radioiron erythrocyte incorporation of ferrous fumarate with and without Na2EDTA, bisglycine iron, NaFeEDTA and native iron plus Na2EDTA, beans and rice. In vitro, solubility ranged from 1% in iron forms without Na2EDTA to 19.4% for NaFeEDTA. Forms of iron with Na2EDTA had intermediate values. In vivo radioiron studies showed that iron forms without Na2EDTA also had low bioavailability (< or =1%). NaFeEDTA had the highest bioavailability (5.3%). The bioavailability of all iron forms improved significantly when tested with Na2EDTA (<0.05). Adding Na2EDTA to ferrous fumarate increased bioavailability from 0.87% to 2.9% (P < 0.001). We conclude that NaFeEDTA is the form of iron best absorbed, but alternatively, ferrous fumarate plus Na2EDTA comprises a feasible option as a fortificant.

Design of oral agents for the management of multiple sclerosis: benefit and risk assessment for dimethyl fumarate

PubMed Central

Nicholas, Jacqueline Ann; Boster, Aaron Lee; Imitola, Jaime; O’Connell, Colleen; Racke, Michael Karl

2014-01-01

Dimethyl fumarate (DMF) is the most recent oral disease-modifying therapy approved by the US Food and Drug Administration and is indicated for the treatment of relapsing forms of multiple sclerosis (MS). Prior to approval for use in MS, DMF and its active metabolite, monomethyl fumarate, had been used for decades as two of the fumaric acid esters in Fumaderm®, a medication used in Europe for the treatment of psoriasis. The unique mechanism of action of DMF remains under evaluation; however, it has been shown to act through multiple pathways leading to shifts away from the Th1 proinflammatory response to the less inflammatory Th2 response. Preliminary data suggest that DMF may induce neuroprotective effects in central nervous system white matter, although further studies are needed to demonstrate these effects on inflammatory demyelination. The DMF Phase III clinical trials demonstrated its efficacy with regard to a reduction in the annualized relapse rate and reductions in new or enlarging T2 lesions and numbers of gadolinium-enhancing lesions on magnetic resonance imaging. DMF has a well-defined safety profile, given the experience with its use in the treatment of psoriasis, and more recently from the DMF clinical trials program and post-marketing era for treatment of MS. The safety profile and oral mode of administration of DMF place it as an attractive first-line therapy option for the treatment of relapsing forms of MS. Long-term observational studies will be needed to determine the effects of DMF on progression of disability in MS. PMID:25045248

Quality of life outcomes with BG-12 (dimethyl fumarate) in patients with relapsing-remitting multiple sclerosis: the DEFINE study.

PubMed

Kappos, Ludwig; Gold, Ralf; Arnold, Douglas L; Bar-Or, Amit; Giovannoni, Gavin; Selmaj, Krzysztof; Sarda, Sujata P; Agarwal, Sonalee; Zhang, Annie; Sheikh, Sarah I; Seidman, Emily; Dawson, Katherine T

2014-02-01

Oral BG-12 (dimethyl fumarate), approved for the treatment of the relapsing forms of MS, has demonstrated clinical efficacy with an acceptable safety profile in the Phase III "Determination of the Efficacy and Safety of Oral Fumarate in Relapsing-Remitting Multiple Sclerosis (RRMS)" (DEFINE) and "Comparator and an Oral Fumarate in RRMS" (CONFIRM) studies. To evaluate the health-related quality of life (HRQoL) impairment that is associated with RRMS and to assess the effects of BG-12 on HRQoL in the DEFINE study. Patients with RRMS were randomized to BG-12 240 mg twice (BID) or three times (TID) daily, or placebo, for 2 years. HRQoL was assessed by the Short Form-36 (SF-36), global assessment of well-being visual analog scale and the EuroQol-5D. In the 1237 patients from DEFINE, HRQoL impairment was greatest in patients who had higher disability scores and in those who had experienced relapse. Change in SF-36 physical component summary scores during 2 years' treatment significantly favored BG-12 over placebo (both doses: p < 0.001). We saw similar benefits in other measures of functioning and general well-being as early as Week 24. These benefits were maintained during the study. Our results add to evidence for a negative impact of RRMS on HRQoL and they demonstrate the benefits of BG-12 on HRQoL measures, which coupled with significant clinical efficacy, further support its use as a new treatment for RRMS.

Water Adsorption on Various Metal Organic Framework

NASA Astrophysics Data System (ADS)

Teo, H. W. B.; Chakraborty, A.

2017-12-01

In this paper, Metal Organic Framework (MOF) undergoes N2 and water adsorption experiment to observe how the material properties affects the water sorption performance. The achieved N2 isotherms is used to estimate the BET surface area, pore volume and, most importantly, the pore size distribution of the adsorbent material. It is noted that Aluminium Fumarate and CAU-10 has pore distribution of about 6Å while MIL-101(Cr) has 16 Å. The water adsorption isotherms at 25°C shows MIL-101(Cr) has a long hydrophobic length from relative pressure of 0 ≤ P/Ps ≤ 0.4 with a maximum water uptake of 1kg/kg sorbent. Alkali metal ions doped MIL-101(Cr) reduced the hydrophobic length and maximum water uptake of original MIL-101(Cr). Aluminium Fumarate and CAU-10 has lower water uptake, but the hydrophobic length of both materials is within relative pressure of P/Ps ≤ 0.2. The kinetic behaviour of doped MIL-101(Cr), Aluminium Fumarate and CAU-10 are faster than MIL-101(Cr).

A Soluble NADH-Dependent Fumarate Reductase in the Reductive Tricarboxylic Acid Cycle of Hydrogenobacter thermophilus TK-6▿

PubMed Central

Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo

2008-01-01

Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle. PMID:18757546

A soluble NADH-dependent fumarate reductase in the reductive tricarboxylic acid cycle of Hydrogenobacter thermophilus TK-6.

PubMed

Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo

2008-11-01

Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle.

Studies on Poly(propylene fumarate-co-caprolactone diol) Thermoset Composites towards the Development of Biodegradable Bone Fixation Devices

PubMed Central

Jayabalan, M.

2009-01-01

The effect of reinforcement in the cross-linked poly(propylene fumarate-co-caprolactone diol) thermoset composites based on Kevlar fibres and hydroxyapatite was studied. Cross-linked poly(propylene fumarate-co-caprolactone diol) was also studied without any reinforcement for comparison. The reinforcing fibre acts as a barrier for the curing reaction leading to longer setting time and lesser cross-link density. The fibre and HA reinforced composites have almost the same compressive strength. Nonreinforced material undergoes greater degree of swelling. Among the reinforced materials, the hydroxyapatite reinforced composite has a much higher swelling percentage than the fibre reinforced one. The studies on in vitro degradation of the cured materials reveal hydrolytic degradation in Ringer's solution and PBS medium during aging. All the three materials are found to swell initially in Ringer's solution and PBS medium during aging and then undergo gradual degradation. Compression properties of these cross-linked composites increase with aging; HA reinforced composite has the highest compressive strength and compressive modulus, whereas the aged fibre-reinforced composite has the least compressive strength and modulus. PMID:20126578

Polypropylene fumarate/phloroglucinol triglycidyl methacrylate blend for use as partially biodegradable orthopaedic cement.

PubMed

Jayabalan, M; Thomas, V; Rajesh, P N

2001-10-01

Polypropylene fumarate/phloroglucinol triglycidyl methacrylate oligomeric blend-based bone cement was studied. Higher the percentage of phloroglucinol triglycidyl methacrylate, lesser the setting time. An optimum setting time could be arrived with 50:50 blend composition of the two oligomers. Composite cement of 50:50 blend prepared with hydroxyapatite granules of particle size 125 microm binds bovine rib bones. The tensile strength of this adhesive bond was found to be 1.11 kPa. The thermal studies suggest the onset of cross-linking reaction in the cured blend if the blend is heated. The absence of softening endotherm in the cured blend shows the thermosetting-like amorphous nature of blend system, which may restrict the changes in creep properties. The in vitro biodegradation studies reveal possible association of calcium ions with negatively charged units of degrading polymer chain resulting in slow down of degradation. Relatively slow degradation was observed in Ringer's solution. The study reveals the potential use of polypropylene fumarate/phloroglucinol triglycidyl methacrylate as partially degradable polymeric cement for orthopaedic applications.

Studies on Poly(propylene fumarate-co-caprolactone diol) Thermoset Composites towards the Development of Biodegradable Bone Fixation Devices.

PubMed

Jayabalan, M

2009-01-01

The effect of reinforcement in the cross-linked poly(propylene fumarate-co-caprolactone diol) thermoset composites based on Kevlar fibres and hydroxyapatite was studied. Cross-linked poly(propylene fumarate-co-caprolactone diol) was also studied without any reinforcement for comparison. The reinforcing fibre acts as a barrier for the curing reaction leading to longer setting time and lesser cross-link density. The fibre and HA reinforced composites have almost the same compressive strength. Nonreinforced material undergoes greater degree of swelling. Among the reinforced materials, the hydroxyapatite reinforced composite has a much higher swelling percentage than the fibre reinforced one. The studies on in vitro degradation of the cured materials reveal hydrolytic degradation in Ringer's solution and PBS medium during aging. All the three materials are found to swell initially in Ringer's solution and PBS medium during aging and then undergo gradual degradation. Compression properties of these cross-linked composites increase with aging; HA reinforced composite has the highest compressive strength and compressive modulus, whereas the aged fibre-reinforced composite has the least compressive strength and modulus.

Combined metabolomic and correlation networks analyses reveal fumarase insufficiency altered amino acid metabolism.

PubMed

Hou, Entai; Li, Xian; Liu, Zerong; Zhang, Fuchang; Tian, Zhongmin

2018-04-01

Fumarase catalyzes the interconversion of fumarate and l-malate in the tricarboxylic acid cycle. Fumarase insufficiencies were associated with increased levels of fumarate, decreased levels of malate and exacerbated salt-induced hypertension. To gain insights into the metabolism profiles induced by fumarase insufficiency and identify key regulatory metabolites, we applied a GC-MS based metabolomics platform coupled with a network approach to analyze fumarase insufficient human umbilical vein endothelial cells (HUVEC) and negative controls. A total of 24 altered metabolites involved in seven metabolic pathways were identified as significantly altered, and enriched for the biological module of amino acids metabolism. In addition, Pearson correlation network analysis revealed that fumaric acid, l-malic acid, l-aspartic acid, glycine and l-glutamic acid were hub metabolites according to Pagerank based on their three centrality indices. Alanine aminotransferase and glutamate dehydrogenase activities increased significantly in fumarase deficiency HUVEC. These results confirmed that fumarase insufficiency altered amino acid metabolism. The combination of metabolomics and network methods would provide another perspective on expounding the molecular mechanism at metabolomics level. Copyright © 2017 John Wiley & Sons, Ltd.

Metabolic flexibility of a prospective bioremediator: Desulfitobacterium hafniense Y51 challenged in chemostats.

PubMed

Marozava, Sviatlana; Vargas-López, Raquel; Tian, Ye; Merl-Pham, Juliane; Braster, Martin; Meckenstock, Rainer U; Smidt, Hauke; Röling, Wilfred F M; Westerhoff, Hans V

2018-06-19

Desulfitobacterium hafniense Y51 has been widely used in investigations of perchloroethylene (PCE) biodegradation, but limited information exists on its other physiological capabilities. We investigated how D. hafniense Y51 confronts the debilitating limitations of not having enough electron donor (lactate), or electron acceptor (fumarate) during cultivation in chemostats. The residual concentrations of the substrates supplied in excess were much lower than expected. Transcriptomics, proteomics, and fluxomics were integrated to investigate how this phenomenon was regulated. Through diverse regulation at both transcriptional and translational levels, strain Y51 turned to fermenting the excess lactate and disproportionating the excess fumarate under fumarate- and lactate-limiting conditions, respectively. Genes and proteins related to the utilization of a variety of alternative electron donors and acceptors absent from the medium were induced, apparently involving the Wood-Ljungdahl pathway. Through this metabolic flexibility, D. hafniense Y51 may be able to switch between different metabolic capabilities under limiting conditions. This article is protected by copyright. All rights reserved. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

Efficacy, safety, bone and metabolic effects of HIV nucleoside reverse transcriptase inhibitor BMS-986001 (AI467003): a phase 2b randomised, controlled, partly blinded trial.

PubMed

Gupta, Samir K; McComsey, Grace A; Lombaard, John; Echevarría, Juan; Orrell, Catherine; Avihingsanon, Anchalee; Osiyemi, Olayemi; Santoscoy, Mario; Ray, Neelanjana; Stock, David A; Joshi, Samit R; Hanna, George J; Lataillade, Max

2016-01-01

BMS-986001 is a thymidine analogue nucleoside reverse transcriptase inhibitor (NRTI) designed to maintain in-vitro antiviral activity while minimising off-target effects. We assessed the efficacy and safety of BMS-986001 versus tenofovir disoproxil fumarate in treatment-naive patients with HIV-1. In this phase 2b, randomised, active-controlled trial (AI467003), we recruited treatment-naive (no current or previous exposure to an antiretroviral drug for >1 week) adults (aged at least 18 years) with HIV-1 from 47 sites across Asia, Australia, Europe, North America, South Africa, and South America. Patients with plasma HIV-1 RNA greater than 5000 copies per mL and CD4 counts greater than 200 cells per μL were randomly assigned (2:2:2:3) to receive BMS-986001 100 mg, 200 mg, or 400 mg once a day or to receive tenofovir disoproxil fumarate 300 mg once a day; each allocation was given with efavirenz 600 mg once a day and lamivudine 300 mg once a day. Both patients and investigators were masked to BMS-986001 dose (achieved with similar looking placebo tablets), but not allocation up to and including week 48. The primary endpoints were the proportion of patients with plasma HIV-1 RNA less than 50 copies per mL and safety events (serious adverse events and adverse events leading to discontinuation) through week 24; the main analysis was with a modified intention-to-treat population. Resistance analysis was a secondary endpoint, and additional safety parameters were exploratory endpoints. This trial is registered with ClinicalTrials.gov, number NCT01489046, and the European Clinical Trials Database, number EudraCT 2011-003329-89. Patients were recruited between Jan 25, 2012, and Oct 3, 2012; 757 patients were assessed for eligibility and 301 were randomly assigned to receive either BMS-986001 once a day (67 patients to 100 mg, 67 to 200 mg, and 66 to 400 mg) or tenofovir disoproxil fumarate (n=101). 297 patients received at least one dose of study drug. At week 24, 57 (88%) of 65 patients for whom there were data in the 100 mg group, 54 (81%) of 67 in the 200 mg group, 62 (94%) of 66 in the 400 mg group achieved HIV-1 RNA less than 50 copies per mL, compared with 88 (89%) of 99 in the tenofovir disoproxil fumarate group (modified intention-to-treat population). BMS-986001 was generally well tolerated through week 48. Two patients had BMS-986001-related serious adverse events (atypical drug eruption and thrombocytopenia) and two in the tenofovir disoproxil fumarate group had study drug-related serious adverse events (potential drug-induced liver injury and depression or lipodystrophy) that led to discontinuation. NRTI resistance-associated mutations were reported in four (2%) of 198 patients, and non-NRTI mutations in 17 (9%) of 198 patients receiving BMS-986001 versus none of 99 and one (1%) of 99 patients receiving tenofovir disoproxil fumarate, respectively. Compared with tenofovir disoproxil fumarate, individuals in the BMS-986001 groups showed a smaller decrease in lumbar spine and hip bone mineral density but greater accumulation of limb and trunk fat, subcutaneous and visceral adipose tissue, and increased total cholesterol. BMS-986001 had similar efficacy to that of tenofovir disoproxil fumarate and was associated with a smaller decrease in bone mineral density; however, greater resistance and gains in both peripheral and central fat accumulation were recorded for the investigational drug. Bristol-Myers Squibb has discontinued its involvement in the development of BMS-986001, and future decisions on development will be made by Oncolys BioPharma. Bristol-Myers Squibb. Copyright © 2016 Elsevier Ltd. All rights reserved.

Tenofovir-induced kidney injury.

PubMed

Gitman, Michael D; Hirschwerk, David; Baskin, Cindy H; Singhal, Pravin C

2007-03-01

Tenofovir disoproxil fumarate is a nucleotide reverse transcriptase inhibitor with activity against both HIV and the hepatitis B virus. It has had minimal nephrotoxic effects in early clinical trials, but as clinical use has widened, case reports describing tenofovir-induced renal tubular damage, Fanconi's syndrome and diabetes insipidus have been described. The authors review the pharmacokinetics, mechanism of action and clinical uses of tenofovir disoproxil fumarate. The large clinical trials, as well as the case reports of tenofovir-induced kidney injury, are also reviewed. The potential mechanism of renal damage is discussed and recommendations for evaluation and treatment of tenofovir-induced kidney injury are given.

Mechanical energy storage performance of an aluminum fumarate metal–organic framework† †Electronic supplementary information (ESI) available: Experimental procedures, X-ray diffraction, and molecular simulation. See DOI: 10.1039/c5sc02794b

PubMed Central

Vanduyfhuys, Louis; Alvarez, Elsa; Rodriguez, Julien; Itié, Jean-Paul; Fabry, Paul; Guillou, Nathalie; Devic, Thomas; Beurroies, Isabelle; Llewellyn, Philip L.; Van Speybroeck, Veronique; Serre, Christian; Maurin, Guillaume

2016-01-01

The aluminum fumarate MOF A520 or MIL-53–FA is revealed to be a promising material for mechanical energy-related applications with performances in terms of work and heat energies which surpass those of any porous solids reported so far. Complementary experimental and computational tools are deployed to finely characterize and understand the pressure-induced structural transition at the origin of these unprecedented levels of performance. PMID:29861993

Therapeutic effects of oral dimethyl fumarate on stroke induced by middle cerebral artery occlusion: An animal experimental study.

PubMed

Safari, Anahid; Fazeli, Mehdi; Namavar, Mohammad Reza; Tanideh, Nader; Jafari, Peyman; Borhani-Haghighi, Afshin

2017-01-01

Dimethyl fumarate (DMF) has immune-modulatory and neuro-protective characteristics that can be used for treatment of acute ischemic stroke. To investigate the therapeutic effects of DMF on histological and functional recovery of rats after transient middle cerebral artery (MCA) occlusion. 22 Sprague-Dawley male rats weighing 275-300 g were randomized into three groups by block randomization. In the sham group (n = 7), the neck was opened, but neither MCA was occluded, nor any drug was administered.The control group (n = 7) was treated with vehicle (methocel) by gavage for 14 days after MCA occlusion. In the DMF-treated group (n = 8), treatment was performed with 15 mg/kg body weight dimethyl fumarate twice a day for 14 days after MCA occlusion. Transient occlusion of the right MCA was performed by intraluminal thread method in the DMF-treated and the control group. Neurological deficit score (NDS), pole test, and adhesive removal test were performed before the surgery, and on post-operative Days 0, 3, 5, 7, 10, and 14. After the final behaviour test, the animals' brains were perfused and removed. Brains were frozen and sectioned serially and coronally using a cryostat. Infract volume and brain volume were estimated by stereology. The percentage of infarct volume was significantly lower in DMF-treated animals (5.76%) than in the control group (22.39%) (P < 0.0001). Regarding behavioural tests, the DMF-treated group showed better function in NDS on Days 7 (P = 0.041) and 10 (P = 0.046), but not in pole and adhesive removal tests. There was no significant correlation between behavioural tests and histological results. Dimethyl fumarate could be beneficial as a potential neuroprotective agent in the treatment of stroke.

Modeling of the Reaction Mechanism of Enzymatic Radical C–C Coupling by Benzylsuccinate Synthase

PubMed Central

Szaleniec, Maciej; Heider, Johann

2016-01-01

Molecular modeling techniques and density functional theory calculations were performed to study the mechanism of enzymatic radical C–C coupling catalyzed by benzylsuccinate synthase (BSS). BSS has been identified as a glycyl radical enzyme that catalyzes the enantiospecific fumarate addition to toluene initiating its anaerobic metabolism in the denitrifying bacterium Thauera aromatica, and this reaction represents the general mechanism of toluene degradation in all known anaerobic degraders. In this work docking calculations, classical molecular dynamics (MD) simulations, and DFT+D2 cluster modeling was employed to address the following questions: (i) What mechanistic details of the BSS reaction yield the most probable molecular model? (ii) What is the molecular basis of enantiospecificity of BSS? (iii) Is the proposed mechanism consistent with experimental observations, such as an inversion of the stereochemistry of the benzylic protons, syn addition of toluene to fumarate, exclusive production of (R)-benzylsuccinate as a product and a kinetic isotope effect (KIE) ranging between 2 and 4? The quantum mechanics (QM) modeling confirms that the previously proposed hypothetical mechanism is the most probable among several variants considered, although C–H activation and not C–C coupling turns out to be the rate limiting step. The enantiospecificity of the enzyme seems to be enforced by a thermodynamic preference for binding of fumarate in the pro(R) orientation and reverse preference of benzyl radical attack on fumarate in pro(S) pathway which results with prohibitively high energy barrier of the radical quenching. Finally, the proposed mechanism agrees with most of the experimental observations, although the calculated intrinsic KIE from the model (6.5) is still higher than the experimentally observed values (4.0) which suggests that both C–H activation and radical quenching may jointly be involved in the kinetic control of the reaction. PMID:27070573

Structural and biochemical analyses reveal insights into covalent flavinylation of the Escherichia coli Complex II homolog quinol:fumarate reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Starbird, C. A.; Maklashina, Elena; Sharma, Pankaj

The Escherichia coli Complex II homolog quinol:fumarate reductase (QFR, FrdABCD) catalyzes the interconversion of fumarate and succinate at a covalently attached FAD within the FrdA subunit. The SdhE assembly factor enhances covalent flavinylation of Complex II homologs, but the mechanisms underlying the covalent attachment of FAD remain to be fully elucidated. Here, we explored the mechanisms of covalent flavinylation of the E. coli QFR FrdA subunit. Using a ΔsdhE E. coli strain, we show that the requirement for the assembly factor depends on the cellular redox environment. We next identified residues important for the covalent attachment and selected the FrdAE245more » residue, which contributes to proton shuttling during fumarate reduction, for detailed biophysical and structural characterization. We found that QFR complexes containing FrdAE245Q have a structure similar to that of the WT flavoprotein, but lack detectable substrate binding and turnover. In the context of the isolated FrdA subunit, the anticipated assembly intermediate during covalent flavinylation, FrdAE245 variants had stability similar to that of WT FrdA, contained noncovalent FAD, and displayed a reduced capacity to interact with SdhE. However, small-angle X-ray scattering (SAXS) analysis of WT FrdA cross-linked to SdhE suggested that the FrdAE245 residue is unlikely to contribute directly to the FrdA-SdhE protein-protein interface. We also found that no auxiliary factor is absolutely required for flavinylation, indicating that the covalent flavinylation is autocatalytic. We propose that multiple factors, including the SdhE assembly factor and bound dicarboxylates, stimulate covalent flavinylation by preorganizing the active site to stabilize the quinone-methide intermediate.« less

Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.

PubMed

Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

2010-10-01

Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.

Use of microencapsulated iron(II) fumarate sprinkles to prevent recurrence of anaemia in infants and young children at high risk.

PubMed Central

Zlotkin, Stanley; Antwi, Kojo Yeboah; Schauer, Claudia; Yeung, George

2003-01-01

OBJECTIVE: To compare the effectiveness of microencapsulated iron(II) fumarate sprinkles (with and without vitamin A), iron(II) sulfate drops, and placebo sprinkles in preventing recurrence of anaemia and to determine the long-term haematological outcomes in children at high risk of recurrence of anaemia 12 months after the end of supplementation. METHODS: A prospective, randomized, placebo-controlled design was used to study 437 Ghanaian children aged 8-20 months who were not anaemic (haemoglobin > or = 100 g/l). Four groups were given microencapsulated iron(II) fumarate sprinkles, microencapsulated iron(II) fumarate sprinkles with vitamin A, iron(II) sulfate drops or placebo sprinkles daily for six months. Primary outcome measures were change in haemoglobin and anaemic status at baseline and study end. Non-anaemic children at the end of the supplementation period were reassessed 12 months after supplementation ended. FINDINGS: Overall, 324 children completed the supplementation period. Among the four groups, no significant changes were seen in mean haemoglobin, ferritin or serum retinol values from baseline to the end of the supplementation period. During the trial, 82.4% (267/324) of children maintained their non-anaemic status. Sprinkles were well accepted without complications. At 12 months post-supplementation, 77.1% (162/210) of children with no intervention remained non-anaemic. This proportion was similar for children among the four groups. CONCLUSION: In most children previously treated for anaemia, further supplementation was not needed to maintain their non-anaemic status. These results may have important implications for community intervention programmes in which initial high-dose treatment is needed because of a high prevalence of anaemia. PMID:12756979

Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway.

PubMed

Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J; Corey, Joseph M; Lundy, Steven K; Mao-Draayer, Yang

2015-06-17

Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS).

Genomic, proteomic, and biochemical analysis of the organohalide respiratory pathway in Desulfitobacterium dehalogenans.

PubMed

Kruse, Thomas; van de Pas, Bram A; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M; van der Oost, John; Smidt, Hauke; Stams, Alfons J M

2015-03-01

Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1(T) consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Genomic, Proteomic, and Biochemical Analysis of the Organohalide Respiratory Pathway in Desulfitobacterium dehalogenans

PubMed Central

van de Pas, Bram A.; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R.; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M.; van der Oost, John; Smidt, Hauke

2014-01-01

Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1T consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. PMID:25512312

Combination Therapy of Etanercept and Fumarates versus Etanercept Monotherapy in Psoriasis: A Randomized Exploratory Study

PubMed Central

van Bezooijen, Ji Sun; Balak, Deepak M.W.; van Doorn, Martijn B.A.; Looman, Caspar W.N.; Schreurs, Marco W.J.; Koch, Birgit C.P.; van Gelder, Teun; Prens, Errol P.

2016-01-01

Background Biologics are a safe and efficacious therapy for psoriasis. The drug survival of biologics may be disappointing, primarily due to loss of efficacy. Therefore, safe combination treatments are sought to improve their clinical response. Objective To assess the efficacy, safety and tolerability of the combination therapy of etanercept with fumarates versus etanercept monotherapy. Methods Thirty-three patients with psoriasis were randomized 1:1 to receive etanercept combined with fumarates or etanercept monotherapy. The primary outcome measure was the difference in PASI-75 response after 24 weeks; additionally, a longitudinal analysis was performed. An important secondary outcome measure was the proportion of patients with a Physician Global Assessment (PGA) of clear or almost clear. Adverse events were collected throughout the study. Results In the combination therapy group, 78% (14 out of 18 patients) reached PASI-75 at week 24 versus 57% (8 out of 14 patients) in the monotherapy group (p = 0.27). The longitudinal analysis showed a PASI reduction of 5.97% per week for the combination therapy group and of 4.76% for the monotherapy group (p = 0.11). In the combination therapy group, 94% (17 out of 18 patients) of patients had a PGA of clear/almost clear versus 64% (9 out of 14 patients) in the monotherapy group (p = 0.064). The incidence of mild gastrointestinal complaints was higher in the combination group than in the monotherapy group. Conclusion Using the PGA, combination therapy showed a trend towards faster improvement in the first 24 weeks. The difference in the PASI score between the two groups was not statistically significant. Addition of fumarates to etanercept for 48 weeks appeared safe with an acceptable tolerability. PMID:27576483

Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway

PubMed Central

Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J.; Corey, Joseph M.; Lundy, Steven K.; Mao-Draayer, Yang

2015-01-01

Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS). PMID:26090715

Metabolically based liver damage pathophysiology in patients with urea cycle disorders - A new hypothesis.

PubMed

Ivanovski, Ivan; Ješić, Miloš; Ivanovski, Ana; Garavelli, Livia; Ivanovski, Petar

2017-11-28

The underlying pathophysiology of liver dysfunction in urea cycle disorders (UCDs) is still largely elusive. There is some evidence that the accumulation of urea cycle (UC) intermediates are toxic for hepatocyte mitochondria. It is possible that liver injury is directly caused by the toxicity of ammonia. The rarity of UCDs, the lack of checking of iron level in these patients, superficial knowledge of UC and an underestimation of the metabolic role of fumaric acid, are the main reasons that are responsible for the incomprehension of the mechanism of liver injury in patients suffering from UCDs. Owing to our routine clinical practice to screen for iron overload in severely ill neonates, with the focus on the newborns suffering from acute liver failure, we report a case of citrullinemia with neonatal liver failure and high blood parameters of iron overload. We hypothesize that the key is in the decreased-deficient fumaric acid production in the course of UC in UCDs that causes several sequentially intertwined metabolic disturbances with final result of liver iron overload. The presented hypothesis could be easily tested by examining the patients suffering from UCDs, for liver iron overload. This could be easily performed in countries with a high population and comprehensive national register for inborn errors of metabolism. Providing the hypothesis is correct, neonatal liver damage in patients having UCD can be prevented by the supplementation of pregnant women with fumaric or succinic acid, prepared in the form of iron supplementation pills. After birth, liver damage in patients having UCDs can be prevented by supplementation of these patients with zinc fumarate or zinc succinylate, as well.

Studies on potential effects of fumaric acid on rumen microbial fermentation, methane production and microbial community.

PubMed

Riede, Susanne; Boguhn, Jeannette; Breves, Gerhard

2013-01-01

The greenhouse gas methane (CH4) contributes substantially to global climate change. As a potential approach to decrease ruminal methanogenesis, the effects of different dosages of fumaric acid (FA) on ruminal microbial metabolism and on the microbial community (archaea, bacteria) were studied using a rumen simulation technique (RUSITEC). FA acts as alternative hydrogen acceptor diverting 2H from methanogenesis of archaea towards propionate formation of bacteria. Three identical trials were conducted with 12 fermentation vessels over a period of 14 days. In each trial, four fermentation vessels were assigned to one of the three treatment groups differing in FA dosage: low fumaric acid (LFA), high fumaric acid (HFA) and without FA (control). FA was continuously infused with the buffer. Grass silage and concentrate served as substrate. FA led to decreases in pH and to higher production rates of total short chain fatty acids (SCFA) mediated by increases in propionate for LFA of 1.69 mmol d(-1) and in propionate and acetate production for HFA of 4.49 and 1.10 mmol d(-1), respectively. Concentrations of NH3-N, microbial crude protein synthesis, their efficiency, degradation of crude nutrients and detergent fibre fraction were unchanged. Total gas and CH4 production were not affected by FA. Effects of FA on structure of microbial community by means of single strand conformation polymorphism (SSCP) analyses could not be detected. Given the observed increase in propionate production and the unaffected CH4 production it can be supposed that the availability of reduction equivalents like 2H was not limited by the addition of FA in this study. It has to be concluded from the present study that the application of FA is not an appropriate approach to decrease the ruminal CH4 production.

Dry cereals fortified with electrolytic iron or ferrous fumarate are equally effective in breast-fed infants.

PubMed

Ziegler, Ekhard E; Fomon, Samuel J; Nelson, Steven E; Jeter, Janice M; Theuer, Richard C

2011-02-01

Precooked, instant (dry) infant cereals in the US are fortified with electrolytic iron, a source of low reactivity and suspected low bioavailability. Iron from ferrous fumarate is presumed to be more available. In this study, we compared a dry infant rice cereal (Cereal L) fortified with electrolytic iron (54.5 mg iron/100 g cereal) to a similar cereal (Cereal M) fortified with ferrous fumarate (52.2 mg Fe/100 g) for efficacy in maintaining iron status and preventing iron deficiency (ID) in breast-fed infants. Ascorbic acid was included in both cereals. In this prospective, randomized double-blind trial, exclusively breast-fed infants were enrolled at 1 mo and iron status was determined periodically. At 4 mo, 3 infants had ID anemia and were excluded. Ninety-five infants were randomized at 4 mo, and 69 (36 Cereal L, 33 Cereal M) completed the intervention at 9 mo. From 4 to 9 mo, they consumed daily one of the study cereals. With each cereal, 2 infants had mild ID, a prevalence of 4.2%, but no infant developed ID anemia. There were no differences in iron status between study groups. Iron intake from the study cereals was (mean ± SD) 1.21 ± 0.31 mg⋅kg(-1)⋅d(-1) from Cereal L and 1.07 ± 0.40 mg⋅kg(-1)⋅d(-1) from Cereal M. Eleven infants had low birth iron endowment (plasma ferritin < 55 μg/L at 2 mo) and 54% of these infants had ID with or without anemia by 4 mo. We conclude that electrolytic iron and ferrous fumarate were equally efficacious as fortificants of this infant cereal.

Gastro-protective and Anti-stress Efficacies of Monomethyl Fumarate and a Fumaria indica Extract in Chronically Stressed Rats.

PubMed

Shakya, Anshul; Soni, Upendra Kumar; Rai, Geeta; Chatterjee, Shyam Sunder; Kumar, Vikas

2016-05-01

Results of the very first experiments conducted to evaluate therapeutic potentials of a fumarate containing Fumaria indica extract and of fairly low daily oral doses of monomethyl fumarate for prevention of chronic unavoidable foot-shock stress-induced gastric ulcers, and possible involvement of diverse neuro-hormonal and oxidative process in their stress response desensitizing effects are reported and discussed in this article. Preventive effects of 21 daily oral 60, 120, and 240 mg/kg doses of a standardized 50 % methanolic F. indica extract (MFI) and 1.25, 2.50, and 5.00 mg/kg/day of pure monomethyl fumarate (MMF) were compared in rats subjected to one hour daily unavoidable foot-shocks. A pharmaceutically well-standardized Withania somnifera (WS) root extract was used as a reference herbal anti-stress agent in all experiments. Effects of the treatments on stress-induced alterations in body weight, adrenal and spleen weights, gastric ulcer and ulcer index, weight of glandular stomach, protective mucosal glycoprotein content, cellular proliferation, oxidative stress on stomach fundus, and brain tissues of male rats were quantified. Other parameters quantified were plasma corticosterone levels, brain monoamine levels, and expressions of the cytokines TNF-α, IL-10, and IL-1β in blood and brain of stressed and treated rats. Most but not every observed stress-induced anomalies were suppressed or completely prevented by both MFI and pure MMF treatments in dose-dependent manner. Qualitatively, the observed activity profiles of both of them were similar to those of WS dose tested. These results reveal that both MFI and MMF are potent gastro-protective agents against chronic unavoidable stress-induced ulcers and strongly suggest that they act as regulators or modulators of monoamine, corticosterone, and cytokine homeostasis.

[Preparation and application on compound excipient of sodium stearyl fumarate and plasdone S-630].

PubMed

Jiang, Yan-Rong; Zhang, Zhen-Hai; Jia, Xiao-Bin

2013-01-01

The compound excipient containing sodium stearyl fumarate and plasdone S-630 was prepared by applying spray drying method. The basic physical properties of compound excipient were studied by solubility test, scanning electron microscope, differential scanning calorimeter, X-ray diffraction and Fourier transform infra-red spectroscopy. The effect of compound excipient on moisture absorption and ferulic acid in vitro dissolution of spray drying power of angelica were investigated. The results showed that the chemical constituents of compound excipient did not change before and after spray drying. The water soluble compound excipient can improve significantly moisture absorption and has application prospect.

FUM2, a Cytosolic Fumarase, Is Essential for Acclimation to Low Temperature in Arabidopsis thaliana1[OPEN

PubMed Central

Dyson, Beth C.; Miller, Matthew A.E.; Feil, Regina; Rattray, Nicholas; Bowsher, Caroline G.

2016-01-01

Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the cold-tolerant model species Arabidopsis (Arabidopsis thaliana). A nontargeted metabolomic approach, using gas chromatography-mass spectrometry, identifies fumarate as a key component of the cold response in this species. Plants of T-DNA insertion mutants, lacking FUM2, show marked differences in their response to cold, with contrasting responses both in terms of metabolite concentrations and gene expression. The fum2 plants accumulated higher concentrations of phosphorylated sugar intermediates and of starch and malate. Transcripts for proteins involved in photosynthesis were markedly down-regulated in fum2.2 but not in wild-type Columbia-0. Plants of fum2 show a complete loss of the ability to acclimate photosynthesis to low temperature. We conclude that fumarate accumulation plays an essential role in low temperature sensing in Arabidopsis, either indirectly modulating metabolic or redox signals or possibly being itself directly involved in cold sensing. PMID:27440755

Molecular docking and molecular dynamics simulations of fumarate hydratase and its mutant H235N complexed with pyromellitic acid and citrate.

PubMed

Subasri, S; Chaudhary, Santosh Kumar; Sekar, K; Kesherwani, Manish; Velmurugan, D

2017-12-01

Fumarase catalyzes the reversible, stereospecific hydration/dehydration of fumarate to L-malate during the Kreb's cycle. In the crystal structure of the tetrameric fumarase, it was found that some of the active site residues S145, T147, N188 G364 and H235 had water-mediated hydrogen bonding interactions with pyromellitic acid and citrate which help to the protonation state for the conversion of fumarate to malate. When His 235 is mutated with Asn (H235N), water-mediated interactions were lost due to the shifting of active site water molecule by 0.7 Å away. Molecular dynamics (MD) simulations were also carried out by NAMD and analyzed using Assisted Model Building with Energy Refinement (AMBER) program to better understand the conformational stability and other aspects during the binding of pyromellitic acid and citrate with native and mutant FH. The role of hydrogen bonds and hydrophobic interactions was also analyzed. The present study confirms that the H235N mutation has a major effect on the catalytic activity of fumarase which is evident from the biochemical studies.

UV and γ-ray resistance of poly(N-methylmaleimide-alt-isobutene) and poly(diisopropyl fumarate) as transparent polymer films

NASA Astrophysics Data System (ADS)

Imaizumi, Ryota; Furuta, Masakazu; Okamura, Haruyuki; Matsumoto, Akikazu

2017-09-01

UV and γ-ray resistance of transparent polymers obtained by radical polymerization of maleic and fumaric acid derivatives, i.e., an alternating copolymer of N-methylmaleimide and isobutene (PMI) and poly(diisopropyl fumarate) (PDiPF), was investigated. Transmittance in UV and visible regions of these polymers were examined after UV irradiation and compared with the results for poly(methyl methacrylate) (PMMA) and polycarbonate (PC) as conventional transparent polymers. The order of stability toward UV irradiation was PMMA≈PDiPF>PMI>>PC, deduced from changes in the transmittance of 380 nm light. Tensile mechanical properties, such as elastic modulus, maximum strength, and elongation values of PMI, PDiPF, and PMMA were also investigated after UV and γ-radiation. UV irradiation induced the side chain scission of PMI and PDiPF via Norrish I type reaction as well as crosslinking by combination between formed polymer radicals, leading to deterioration in their optical and mechanical properties. γ-radiation induced significant changes in molecular weight and mechanical properties of the polymers. In conclusion, PMI exhibited unchanged mechanical properties and PDiPF maintained its high transparency under various irradiation conditions.

The Complex Conductivity Signature of Geobacter Species in Geological Media

NASA Astrophysics Data System (ADS)

Brown, I.; Atekwana, E. A.; Sarkisova, S.; Achang, M.

2013-12-01

The Complex Conductivity (CC) technique is a promising biogeophysical approach for sensing microbially-induced changes in geological media because of its low-invasive character and sufficient sensitivity to enhanced microbial activity in the near subsurface. Geobacter species have been shown to play important roles in the bioremediation of groundwater contaminated with petroleum and landfill leachate. This capability is based on the ability of Geobacter species to reduce Fe(III) by transferring of electrons from the reduced equivalents to Fe(III) rich minerals through respiration chain and special metallic-like conductors - pili. Only the cultivation of Geobacter species on Fe(III) oxides specifically express pili biosynthesis. Moreover, mutants that cannot produce pili are unable to reduce Fe(III) oxides. However, little is known about the contribution of these molecular conductors (nanowires) to the generation of complex conductivity signatures in geological media. Here, we present the results about the modulation of CC signatures in geological media by Geobacter sulfurreducens (G.s.). Cultures of wild strain G.s. and its pilA(-) mutant were anaerobically cultivated in the presence of the pair of such donors and acceptors of electrons: acetate - fumarate, and acetate - magnetite under anaerobic conditions. Each culture was injected in CC sample holders filled either with N2-CO2 mix (planktonic variant) or with this gases mix and glass beads, d=1 mm, (porous medium variant). Both strains of G.s. proliferated well in a medium supplemented with acetate-fumarate. However, pilA(-) mutant did not multiply in a medium supplemented with ox-red pair yeast extract - magnetite. This observation confirmed that only wild pilA(+) strain is capable of the dissimilatory reduction of Fe(III) within magnetite molecule. The measurement of CC responses from planktonic culture of G.s. wild strain grown with acetate-fumarate did not show linear correlation with their magnitudes but were substantially different from CC responses in sterile medium and pilA(-) mutant planktonic culture. Complex conductivity responses in planktonic cultures of both pilA(+) and pilA(-) strains grown with acetate-fumarate pair were significantly different from magnitudes of φ and σ' in a sterile medium. No notable difference between CC signatures from planktonic cultures of both pilA(+) and pilA(-) strains grown with acetate-fumarate was found. This result has been anticipated because the cultivation of G.s. with ox-red pair acetate-fumarate does not induce the pili biosynthesis. In contrast, the presence of the cells of G.s. pilA(+) strain grown with magnetite in both planktonic and porous media notable shifted to the right of the relaxation peaks of both φ and σ'. Our results taking together suggest that only Geobacter cells administrating Fe(III) dissimilatory reduction and possessing pili can modulate CC responses from subsurface porous media. More experiments and techniques, including different types of microscopy, will be conducted to confirm these observations.

Absolute configuration of a chiral CHD group via neutron diffraction: confirmation of the absolute stereochemistry of the enzymatic formation of malic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bau, R.; Brewer, I.; Chiang, M.Y.

Neutron diffraction has been used to monitor the absolute stereochemistry of an enzymatic reaction. (-)(2S)malic-3-d acid was prepared by the action of fumarase on fumaric acid in D/sub 2/O. After a large number of cations were screened, it was found that (+)(R)..cap alpha..-phenylethylamine forms the large crystals necessary for a neutron diffraction analysis. The subsequent structure determination showed that (+)(R)..cap alpha..-phenylethylammonium (-)(2S)malate-3-d has an absolute configuration of R at the CHD site. This result confirms the absolute stereochemistry of fumarate-to-malate transformation as catalyzed by the enzyme fumarase.

Decursin and decursinol angelate selectively inhibit NADH-fumarate reductase of Ascaris suum.

PubMed

Shiomi, Kazuro; Hatano, Hiroko; Morimoto, Hiromi; Ui, Hideaki; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tomoda, Hiroshi; Lee, Eun Woo; Heo, Tae Ryeon; Kawagishi, Hirokazu; Omura, Satoshi

2007-11-01

NADH-fumarate reductase (NFRD) is a key enzyme in many anaerobic helminths. Decursin and decursinol angelate have been isolated from the roots of ANGELICA GIGAS Nakai (Apiaceae) as NFRD inhibitors. They inhibited ASCARIS SUUM NFRD with IC (50) values of 1.1 and 2.7 microM, respectively. Their target is the electron transport enzyme complex I. Since the inhibitory activities of decursin against bovine heart complexes are weak, it is a selective inhibitor of the nematode complex I. In contrast, decursinol angelate moderately inhibits bovine heart complexes II and III. Decursinol inhibits A. SUUM NFRD to a similar extent, but its target is complex II. It also inhibits bovine heart complexes II and III.

Tenofovir Disoproxil Fumarate Fails to Prevent HIV Acquisition or the Establishment of a Viral Reservoir: Two Case Reports.

PubMed

Fox, Julie; Brady, Michael; Alexander, Hannah; Davies, Olubanke; Robinson, Nicola; Pace, Mathew; Else, Laura; Cason, John; Khoo, Saye; Back, David; Fidler, Sarah; Frater, John

2016-03-01

The use of antiretrovirals as pre-exposure prophylaxis (PrEP) is highly efficacious in HIV prevention. The World Health Organization recently recommended Truvada(®) (Gilead Sciences, Inc.) or tenofovir disoproxil fumarate (TDF) for high-risk individuals, with limited data for single-agent TDF PrEP in men who have sex with men (MSM). We report two cases of TDF PrEP failure in MSM who had received long-term TDF for hepatitis B infection and had therapeutic levels of drug immediately after HIV acquisition. Rapid antiretroviral intensification at diagnosis of acute HIV infection failed to limit immune dysfunction or prevent the establishment of a viral reservoir.

Overexpression of NADH-dependent fumarate reductase improves D-xylose fermentation in recombinant Saccharomyces cerevisiae.

PubMed

Salusjärvi, Laura; Kaunisto, Sanna; Holmström, Sami; Vehkomäki, Maija-Leena; Koivuranta, Kari; Pitkänen, Juha-Pekka; Ruohonen, Laura

2013-12-01

Deviation from optimal levels and ratios of redox cofactors NAD(H) and NADP(H) is common when microbes are metabolically engineered. The resulting redox imbalance often reduces the rate of substrate utilization as well as biomass and product formation. An example is the metabolism of D-xylose by recombinant Saccharomyces cerevisiae strains expressing xylose reductase and xylitol dehydrogenase encoding genes from Scheffersomyces stipitis. This pathway requires both NADPH and NAD(+). The effect of overexpressing the glycosomal NADH-dependent fumarate reductase (FRD) of Trypanosoma brucei in D-xylose-utilizing S. cerevisiae alone and together with an endogenous, cytosol directed NADH-kinase (POS5Δ17) was studied as one possible solution to overcome this imbalance. Expression of FRD and FRD + POS5Δ17 resulted in 60 and 23 % increase in ethanol yield, respectively, on D-xylose under anaerobic conditions. At the same time, xylitol yield decreased in the FRD strain suggesting an improvement in redox balance. We show that fumarate reductase of T. brucei can provide an important source of NAD(+) in yeast under anaerobic conditions, and can be useful for metabolic engineering strategies where the redox cofactors need to be balanced. The effects of FRD and NADH-kinase on aerobic and anaerobic D-xylose and D-glucose metabolism are discussed.

Dimethyl fumarate modulation of immune and antioxidant responses: application to HIV therapy

PubMed Central

Gill, Alexander J.; Kolson, Dennis L.

2013-01-01

The persistence of chronic immune activation and oxidative stress in human immunodeficiency virus (HIV)-infected, antiretroviral drug-treated individuals are major obstacles to fully preventing HIV disease progression. The immune modulator and antioxidant dimethyl fumarate (DMF) is effective in treating immune-mediated diseases and it also has potential applications to limiting HIV disease progression. Among the relevant effects of DMF and its active metabolite monomethyl fumarate (MMF) are induction of a Th1 → Th2 lymphocyte shift, inhibition of pro-inflammatory cytokine signaling, inhibition of NF-κB nuclear translocation, inhibition of dendritic cell maturation, suppression of lymphocyte and endothelial cell adhesion molecule expression, and induction of the Nrf2-dependent antioxidant response element (ARE) and effector genes. Associated with these effects are reduced lymphocyte and monocyte infiltration into psoriatic skin lesions in humans and immune-mediated demyelinating brain lesions in rodents, which confirms potent systemic and central nervous system (CNS) effects. In addition, DMF and MMF limit HIV infection in macrophages in vitro, albeit by unknown mechanisms. Finally, DMF and MMF also suppress neurotoxin production from HIV-infected macrophages, which drives CNS neurodegeneration. Thus, DMF might protect against systemic and CNS complications in HIV infection through its effective suppression of immune activation, oxidative stress, HIV replication, and macrophage-associated neuronal injury. PMID:23971529

Economic impact of the new oral treatments for multiple sclerosis.

PubMed

Álvarez Ayuso, L; Rodríguez Marrodán, B; Blasco Quílez, M R; García-Merino, J A; Sánchez Guerrero, A

2018-01-11

Multiple sclerosis (MS) is a chronic disease affecting the central nervous system and is characterised by inflammation, demyelination, gliosis, and axonal damage. The introduction of dimethyl fumarate and teriflunomide has led to an increase in the number of alternative first-line therapies for MS. The objective of this study was to evaluate the economic impact of the incorporation of new oral therapies at the reference unit (CSUR) at Hospital Universitario Puerta de Hierro Majadahonda. We performed a retrospective observational study including patients diagnosed with MS, who underwent treatment with disease-modifying drugs in 2015 and were followed up for a minimum mean time of one year. Data were collected from patients' electronic clinical histories and the pharmacy service's programme for dispensing drugs to outpatients. Evaluating the cost of changing 125 patients' treatment from other drugs to dimethyl fumarate and teriflunomide, and comparing this with the cost that would have resulted from maintaining their previous treatment, demonstrated a total saving of €169,107.31 over the study period. In addition to contributing new therapeutic alternatives, dimethyl fumarate and teriflunomide produced an economic saving in MS treatment at our hospital. Copyright © 2017 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

The Succinated Proteome of FH-Mutant Tumours

PubMed Central

Yang, Ming; Ternette, Nicola; Su, Huizhong; Dabiri, Raliat; Kessler, Benedikt M.; Adam, Julie; Teh, Bin Tean; Pollard, Patrick J.

2014-01-01

Inherited mutations in the Krebs cycle enzyme fumarate hydratase (FH) predispose to hereditary leiomyomatosis and renal cell cancer (HLRCC). Loss of FH activity in HLRCC tumours causes accumulation of the Krebs cycle intermediate fumarate to high levels, which may act as an oncometabolite through various, but not necessarily mutually exclusive, mechanisms. One such mechanism, succination, is an irreversible non-enzymatic modification of cysteine residues by fumarate, to form S-(2-succino)cysteine (2SC). Previous studies have demonstrated that succination of proteins including glyceraldehyde 3-phosphate dehydrogenase (GAPDH), kelch-like ECH-associated protein 1 (KEAP1) and mitochondrial aconitase (ACO2) can have profound effects on cellular metabolism. Furthermore, immunostaining for 2SC is a sensitive and specific biomarker for HLRCC tumours. Here, we performed a proteomic screen on an FH-mutant tumour and two HLRCC-derived cancer cell lines and identified 60 proteins where one or more cysteine residues were succinated; 10 of which were succinated at cysteine residues either predicted, or experimentally proven, to be functionally significant. Bioinformatic enrichment analyses identified most succinated targets to be involved in redox signaling. To our knowledge, this is the first proteomic-based succination screen performed in human tumours and cancer-derived cells and has identified novel 2SC targets that may be relevant to the pathogenesis of HLRCC. PMID:25105836

Insights into the Anaerobic Biodegradation Pathway of n-Alkanes in Oil Reservoirs by Detection of Signature Metabolites

PubMed Central

Bian, Xin-Yu; Maurice Mbadinga, Serge; Liu, Yi-Fan; Yang, Shi-Zhong; Liu, Jin-Feng; Ye, Ru-Qiang; Gu, Ji-Dong; Mu, Bo-Zhong

2015-01-01

Anaerobic degradation of alkanes in hydrocarbon-rich environments has been documented and different degradation strategies proposed, of which the most encountered one is fumarate addition mechanism, generating alkylsuccinates as specific biomarkers. However, little is known about the mechanisms of anaerobic degradation of alkanes in oil reservoirs, due to low concentrations of signature metabolites and lack of mass spectral characteristics to allow identification. In this work, we used a multidisciplinary approach combining metabolite profiling and selective gene assays to establish the biodegradation mechanism of alkanes in oil reservoirs. A total of twelve production fluids from three different oil reservoirs were collected and treated with alkali; organic acids were extracted, derivatized with ethanol to form ethyl esters and determined using GC-MS analysis. Collectively, signature metabolite alkylsuccinates of parent compounds from C1 to C8 together with their (putative) downstream metabolites were detected from these samples. Additionally, metabolites indicative of the anaerobic degradation of mono- and poly-aromatic hydrocarbons (2-benzylsuccinate, naphthoate, 5,6,7,8-tetrahydro-naphthoate) were also observed. The detection of alkylsuccinates and genes encoding for alkylsuccinate synthase shows that anaerobic degradation of alkanes via fumarate addition occurs in oil reservoirs. This work provides strong evidence on the in situ anaerobic biodegradation mechanisms of hydrocarbons by fumarate addition. PMID:25966798

Addition of fumaric acid and sodium benzoate as an alternative method to achieve a 5-log reduction of Escherichia coli O157:H7 populations in apple cider.

PubMed

Comes, Justin E; Beelman, Robert B

2002-03-01

A study was conducted to develop a preservative treatment capable of the Food and Drug Administration-mandated 5-log reduction of Escherichia coli O157:H7 populations in apple cider. Unpreserved apple cider was treated with generally recognized as safe acidulants and preservatives before inoculation with E. coli O157:H7 in test tubes and subjected to mild heat treatments (25, 35, and 45 degrees C) followed by refrigerated storage (4 degrees C). Fumaric acid had significant (P < 0.05) bactericidal effect when added to cider at 0.10% (wt/vol) and adjusted to pH 3.3, but citric and malic acid had no effect. Strong linear correlation (R2 = 0.96) between increasing undissociated fumaric acid concentrations and increasing log reductions of E. coli O157:H7 in apple cider indicated the undissociated acid to be the bactericidal form. The treatment that achieved the 5-log reduction in three commercial ciders was the addition of fumaric acid (0.15%, wt/vol) and sodium benzoate (0.05%, wt/vol) followed by holding at 25 degrees C for 6 h before 24 h of refrigeration at 4 degrees C. Subsequent experiments revealed that the same preservatives added to cider in flasks resulted in a more than 5-log reduction in less than 5 and 2 h when held at 25 and 35 degrees C, respectively. The treatment also significantly (P < 0.05) reduced total aerobic counts in commercial ciders to populations less than those of pasteurized and raw ciders from the same source (after 5 and 21 days of refrigerated storage at 4 degrees C, respectively). Sensory evaluation of the same ciders revealed that consumers found the preservative-treated cider to be acceptable.

The complex allosteric and redox regulation of the fumarate hydratase and malate dehydratase reactions of Arabidopsis thaliana Fumarase 1 and 2 gives clues for understanding the massive accumulation of fumarate.

PubMed

Zubimendi, Juan P; Martinatto, Andrea; Valacco, Maria P; Moreno, Silvia; Andreo, Carlos S; Drincovich, María F; Tronconi, Marcos A

2018-06-01

Arabidopsis thaliana possesses two fumarase genes (FUM), AtFUM1 (At2g47510) encoding for the mitochondrial Krebs cycle-associated enzyme and AtFUM2 (At5g50950) for the cytosolic isoform required for fumarate massive accumulation. Here, the comprehensive biochemical studies of AtFUM1 and AtFUM2 shows that they are active enzymes with similar kinetic parameters but differential regulation. For both enzymes, fumarate hydratase (FH) activity is favored over the malate dehydratase (MD) activity; however, MD is the most regulated activity with several allosteric activators. Oxalacetate, glutamine, and/or asparagine are modulators causing the MD reaction to become preferred over the FH reaction. Activity profiles as a function of pH suggest a suboptimal FUM activity in Arabidopsis cells; moreover, the direction of the FUM reaction is sensitive to pH changes. Under mild oxidation conditions, AtFUMs form high mass molecular aggregates, which present both FUM activities decreased to a different extent. The biochemical properties of oxidized AtFUMs (oxAtFUMs) were completely reversed by NADPH-supplied Arabidopsis leaf extracts, suggesting that the AtFUMs redox regulation can be accomplished in vivo. Mass spectrometry analyses indicate the presence of an active site-associated intermolecular disulfide bridge in oxAtFUMs. Finally, a phylogenetic approach points out that other plant species may also possess cytosolic FUM2 enzymes mainly encoded by paralogous genes, indicating that the evolutionary history of this trait has been drawn through a process of parallel evolution. Overall, according to our results, a multilevel regulatory pattern of FUM activities emerges, supporting the role of this enzyme as a carbon flow monitoring point through the organic acid metabolism in plants. © 2018 Federation of European Biochemical Societies.

Bioproduction of L-Aspartic Acid and Cinnamic Acid by L-Aspartate Ammonia Lyase from Pseudomonas aeruginosa PAO1.

PubMed

Patel, Arti T; Akhani, Rekha C; Patel, Manisha J; Dedania, Samir R; Patel, Darshan H

2017-06-01

Aspartase (L-aspartate ammonia lyase, EC 4.3.1.1) catalyses the reversible amination and deamination of L-aspartic acid to fumaric acid which can be used to produce important biochemical. In this study, we have explored the characteristics of aspartase from Pseudomonas aeruginosa PAO1 (PA-AspA). To overproduce PA-AspA, the 1425-bp gene was introduced in Escherichia coli BL21 and purified. A 51.0-kDa protein was observed as a homogenous purified protein on SDS-PAGE. The enzyme was optimally active at pH 8.0 and 35 °C. PA-AspA has retained 56% activity after 7 days of incubation at 35 °C, which displays the hyperthermostablility characteristics of the enzyme. PA-AspA is activated in the presence of metal ions and Mg2+ is found to be most effective. Among the substrates tested for specificity of PA-AspA, L-phenylalanine (38.35 ± 2.68) showed the highest specific activity followed by L-aspartic acid (31.21 ± 3.31) and fumarate (5.42 ± 2.94). K m values for L-phenylalanine, L-aspartic acid and fumarate were 1.71 mM, 0.346 μM and 2 M, respectively. The catalytic efficiency (k cat /K m ) for L-aspartic acid (14.18 s -1  mM -1 ) was higher than that for L-phenylalanine (4.65 s -1  mM -1 ). For bioconversion, from an initial concentration of 1000 mM of fumarate and 30 mM of L-phenylalanine, PA-AspA was found to convert 395.31 μM L-aspartic acid and 3.47 mM cinnamic acid, respectively.

Azo polymeric micelles designed for colon-targeted dimethyl fumarate delivery for colon cancer therapy.

PubMed

Ma, Zhen-Gang; Ma, Rui; Xiao, Xiao-Lin; Zhang, Yong-Hui; Zhang, Xin-Zi; Hu, Nan; Gao, Jin-Lai; Zheng, Yu-Feng; Dong, De-Li; Sun, Zhi-Jie

2016-10-15

Colon-targeted drug delivery and circumventing drug resistance are extremely important for colon cancer chemotherapy. Our previous work found that dimethyl fumarate (DMF), the approved drug by the FDA for the treatment of multiple sclerosis, exhibited anti-tumor activity on colon cancer cells. Based on the pharmacological properties of DMF and azo bond in olsalazine chemical structure, we designed azo polymeric micelles for colon-targeted dimethyl fumarate delivery for colon cancer therapy. We synthesized the star-shape amphiphilic polymer with azo bond and fabricated the DMF-loaded azo polymeric micelles. The four-arm polymer star-PCL-azo-mPEG (sPCEG-azo) (constituted by star-shape PCL (polycaprolactone) and mPEG (methoxypolyethylene glycols)-olsalazine) showed self-assembly ability. The average diameter and polydispersity index of the DMF-loaded sPCEG-azo polymeric micelles were 153.6nm and 0.195, respectively. In vitro drug release study showed that the cumulative release of DMF from the DMF-loaded sPCEG-azo polymeric micelles was no more than 20% in rat gastric fluid within 10h, whereas in the rat colonic fluids, the cumulative release of DMF reached 60% in the initial 2h and 100% within 10h, indicating that the DMF-loaded sPCEG-azo polymeric micelles had excellent colon-targeted property. The DMF-loaded sPCEG-azo polymeric micelles had no significant cytotoxicity on colon cancer cells in phosphate buffered solution (PBS) and rat gastric fluid. In rat colonic fluid, the micelles showed significant cytotoxic effect on colon cancer cells. The blank sPCEG-azo polymeric micelles (without DMF) showed no cytotoxic effect on colon cancer cells in rat colonic fluids. In conclusion, the DMF-loaded sPCEG-azo polymeric micelles show colon-targeted DMF release and anti-tumor activity, providing a novel approach potential for colon cancer therapy. Colon-targeted drug delivery and circumventing drug resistance are extremely important for colon cancer chemotherapy. Our previous work found that dimethyl fumarate (DMF), the approved drug by the FDA for the treatment of multiple sclerosis, exhibited anti-tumor activities on colon cancer cells (Br J Pharmacol. 2015 172(15):3929-43.). Based on the pharmacological properties of DMF and azo bond in olsalazine chemical structure, we designed azo polymeric micelles for colon-targeted dimethyl fumarate delivery for colon cancer therapy. We found that the DMF-loaded sPCEG-azo polymeric micelles showed colon-targeted DMF release and anti-tumor activities, providing a novel approach potential for colon cancer therapy. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Escherichia coli mutant with altered respiratory control of the frd operon.

PubMed Central

Iuchi, S; Kuritzkes, D R; Lin, E C

1985-01-01

In wild-type Escherichia coli, fumarate reductase encoded by the frd operon is inducible by its substrate in the absence of molecular oxygen and nitrate. Synthesis of this enzyme under permissive conditions requires the fnr+ gene product, which is believed to be a pleiotropic regulatory protein that activates transcription. A spontaneous mutant was isolated in which the expression of the frd operon no longer depended on the presence of fumarate or the fnr+ gene product. Aerobic repression of the operon was abolished, but nitrate repression remained intact. Transductional analysis showed that the mutation was closely linked to the frd locus. The mutant phenotype strongly suggests that repression by molecular oxygen and nitrate is mediated by different mechanisms. PMID:3882660

In vitro sensitivities to antimicrobial drugs of ureaplasmas isolated from the bovine respiratory tract, genital tract and eye.

PubMed

Kishima, M; Hashimoto, K

1979-09-01

The sensitivity to 18 antimicrobial drugs was examined for 66 strains of Ureaplasma sp isolated from respiratory tracts of calves suffering from enzootic pneumonia, urinary tracts of bulls and eyes of cows suffering from infectious bovine kerato-conjunctivitis. Furamizole, tiamulin fumarate, erythromycin lactobionate, malidomycin C, doxycycline hydrochloride, kitasamycin tartrate, tylosin tartrate, T-2636C, tetracycline hydrochloride, oxytetracycline hydrochloride, chlortetracycline hydrochloride, oleandomycin phosphate, furazolidone, spiramycin adipate, chloramphenicol and thiophenicol showed strong inhibiting activity on all the test strains. Among them, furamizole, tiamulin fumarate and erythromycin lactobionate were most active. Kanamycin sulphate showed weak activity on all the strains tested. The differences in origin of the test strains did not affect their sensitivity to any of the drugs.

Synthesis and characterization of biodegradable poly (ethylene glycol) and poly (caprolactone diol) end capped poly (propylene fumarate) cross linked amphiphilic hydrogel as tissue engineering scaffold material.

PubMed

Krishna, Lekshmi; Jayabalan, Muthu

2009-12-01

Biodegradable poly (caprolactone diol-co-propylene fumarate-co-ethylene glycol) amphiphilic polymer with poly (ethylene glycol) and poly (caprolactone diol) chain ends (PCL-PPF-PEG) was prepared. PCL-PPF-PEG undergoes fast setting with acrylamide (aqueous solution) by free radical polymerization and produces a crosslinked hydrogel. The cross linked and freeze-dried amphiphilic material has porous and interconnected network. It undergoes higher degree of swelling and water absorption to form hydrogel with hydrophilic and hydrophobic domains at the surface and appreciable tensile strength. The present hydrogel is compatible with L929 fibroblast cells. PCL-PPF-PEG/acrylamide hydrogel is a candidate scaffold material for tissue engineering applications.

Uranium(VI) Reduction by Anaeromyxobacter dehalogenans Strain 2CP-C

PubMed Central

Wu, Qingzhong; Sanford, Robert A.; Löffler, Frank E.

2006-01-01

Previous studies demonstrated growth of Anaeromyxobacter dehalogenans strain 2CP-C with acetate or hydrogen as the electron donor and Fe(III), nitrate, nitrite, fumarate, oxygen, or ortho-substituted halophenols as electron acceptors. In this study, we explored and characterized U(VI) reduction by strain 2CP-C. Cell suspensions of fumarate-grown 2CP-C cells reduced U(VI) to U(IV). More-detailed growth studies demonstrated that hydrogen was the required electron donor for U(VI) reduction and could not be replaced by acetate. The addition of nitrate to U(VI)-reducing cultures resulted in a transitory increase in U(VI) concentration, apparently caused by the reoxidation of reduced U(IV), but U(VI) reduction resumed following the consumption of N-oxyanions. Inhibition of U(VI) reduction occurred in cultures amended with Fe(III) citrate, or citrate. In the presence of amorphous Fe(III) oxide, U(VI) reduction proceeded to completion but the U(VI) reduction rates decreased threefold compared to control cultures. Fumarate and 2-chlorophenol had no inhibitory effects on U(VI) reduction, and both electron acceptors were consumed concomitantly with U(VI). Since cocontaminants (e.g., nitrate, halogenated compounds) and bioavailable ferric iron are often encountered at uranium-impacted sites, the metabolic versatility makes Anaeromyxobacter dehalogenans a promising model organism for studying the complex interaction of multiple electron acceptors in U(VI) reduction and immobilization. PMID:16672509

Evaluation of Potential Drug–Drug Interaction Between Delayed‐Release Dimethyl Fumarate and a Commonly Used Oral Contraceptive (Norgestimate/Ethinyl Estradiol) in Healthy Women

PubMed Central

Nestorov, Ivan; Zhao, Guolin; Meka, Venkata; Leahy, Mark; Kam, Jeanelle; Sheikh, Sarah I.

2017-01-01

Abstract Delayed‐release dimethyl fumarate (DMF) is an oral therapy for relapsing multiple sclerosis with anti‐inflammatory and neuroprotective properties. This 2‐period crossover study was conducted to evaluate the potential for drug–drug interaction between DMF (240 mg twice daily) and a combined oral contraceptive (OC; norgestimate 250 μg, ethinyl estradiol 35 μg). Forty‐six healthy women were enrolled; 32 completed the study. After the lead‐in period (OC alone), 41 eligible participants were randomized 1:1 to sequence 1 (OC and DMF coadministration in period 1; OC alone in period 2) or sequence 2 (regimens reversed). Mean concentration profiles of plasma norelgestromin (primary metabolite of norgestimate) and ethinyl estradiol were superimposable following OC alone and OC coadministered with DMF, with 90% confidence intervals of geometric mean ratios for area under the plasma concentration–time curve over the dosing interval and peak plasma concentration contained within the 0.8–1.25 range. Low serum progesterone levels during combined treatment confirmed suppression of ovulation. The pharmacokinetics of DMF (measured via its primary active metabolite, monomethyl fumarate) were consistent with historical data when DMF was administered alone. No new safety concerns were identified. These results suggest that norgestimate/ethinyl estradiol–based OCs may be used with DMF without dose modification. PMID:28783872

Footwear contact dermatitis from dimethyl fumarate.

PubMed

Švecová, Danka; Šimaljakova, Maria; Doležalová, Anna

2013-07-01

Dimethyl fumarate (DMF) is an effective inhibitor of mold growth. In very low concentrations, DMF is a potent sensitizer that can cause severe allergic contact dermatitis (ACD). It has been identified as the agent responsible for furniture contact dermatitis in Europe. The aim of this study was to evaluate patients in Slovakia with footwear ACD associated with DMF, with regard to clinical manifestations, patch test results, and results of chemical analysis of their footwear. Nine patients with suspected footwear contact dermatitis underwent patch testing with the following allergens: samples of their own footwear, commercial DMF, the European baseline, shoe screening, textile and leather dye screening, and industrial biocides series. The results were recorded according to international guidelines. The content of DMF in footwear and anti-mold sachets was analyzed using gas chromatography and mass spectrometry. Acute ACD was observed in nine Caucasian female patients. All patients developed delayed sensitization, as demonstrated by positive patch testing using textile footwear lining. Seven patients were patch tested with 0.1% DMF, and all seven were positive. Chemical analysis of available footwear showed that DMF was present in very high concentrations (25-80 mg/Kg). Dimethyl fumarate is a new footwear allergen and was responsible for severe ACD in our patients. To avoid an increase in the number of cases, the already approved European preventive measures should be accepted and commonly employed. © 2013 The International Society of Dermatology.

21 CFR 177.2420 - Polyester resins, cross-linked.

Code of Federal Regulations, 2011 CFR

2011-04-01

... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use Only... this section: (1) Acids: Adipic. Fatty acids, and dimers thereof, from natural sources. Fumaric...

21 CFR 177.2420 - Polyester resins, cross-linked.

Code of Federal Regulations, 2010 CFR

2010-04-01

... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use Only... this section: (1) Acids: Adipic. Fatty acids, and dimers thereof, from natural sources. Fumaric...

The succinate dehydrogenase assembly factor, SdhE, is required for the flavinylation and activation of fumarate reductase in bacteria.

PubMed

McNeil, Matthew B; Hampton, Hannah G; Hards, Kiel J; Watson, Bridget N J; Cook, Gregory M; Fineran, Peter C

2014-01-31

The activity of the respiratory enzyme fumarate reductase (FRD) is dependent on the covalent attachment of the redox cofactor flavin adenine dinucleotide (FAD). We demonstrate that the FAD assembly factor SdhE, which flavinylates and activates the respiratory enzyme succinate dehydrogenase (SDH), is also required for the complete activation and flavinylation of FRD. SdhE interacted with, and flavinylated, the flavoprotein subunit FrdA, whilst mutations in a conserved RGxxE motif impaired the complete flavinylation and activation of FRD. These results are of widespread relevance because SDH and FRD play an important role in cellular energetics and are required for virulence in many important bacterial pathogens. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Reactivity of vinyl ethers and vinyl ribosides in UV-initiated free radical copolymerization with acceptor monomers.

PubMed

Pichavant, Loic; Guillermain, Céline; Coqueret, Xavier

2010-09-13

The reactivity of various vinyl ethers and vinyloxy derivatives of ribose in the presence of diethyl fumarate or diethyl maleate was investigated for evaluating the potential of donor-acceptor-type copolymerization applied to unsaturated monomers derived from renewable feedstock. The photochemically induced polymerization of model monomer blends in the bulk state was monitored by infrared spectroscopy. The method allowed us to examine the influence of monomer pair structure on the kinetic profiles. The simultaneous consumption of both monomers was observed, supporting an alternating copolymerization mechanism. A lower reactivity of the blends containing maleates compared with fumarates was confirmed. The obtained kinetic data revealed a general correlation between the initial polymerization rate and the Hansen parameter δ(H) associated with the H-bonding aptitude of the donor monomer.

Development of Room Temperature Stable Formulation of Formoterol Fumarate/Beclomethasone HFA pMDI

PubMed Central

Purohit, D.; Trehan, A.; Arora, V.

2009-01-01

The primary aim of present investigation was to develop and formulate room temperature stable formulation of formoterol fumarate and beclomethasone dipropionate with extra fine part size of hydrofluoroalkane pressurized metered dose inhalers. Particle size distribution of hydrofluoroalkane pressurized metered dose inhalers was evaluated using Twin Stage Glass Impinger and Anderson Cascade Impactor. A tetrafluoroethane and/or heptafluoropropane were evaluated for preparation of hydrofluoroalkane pressurized metered dose inhalers. The fine particle fractions delivered from hydrofluoroalkane propellant suspension pressurized metered dose inhalers can be predicted on the basis of formulation parameters and is dependent of metering chamber of valve and orifice size of actuators. The results presented in investigation showed the importance of formulation excipients with formulation of pressurized metered dose inhalers viz, canister, valve and actuators used in formulations.

77 FR 15110 - Antiviral Drugs Advisory Committee; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-14

.../phone line to learn about possible modifications before coming to the meeting. Agenda: The committee.../tenofovir disoproxil fumarate) Tablet, submitted by Gilead Sciences, Inc. The supplemental application...

FDA-Approved HIV Medicines

MedlinePlus

... bictegravir sodium / emtricitabine / tenofovir alafenamide fumarate, BIC / FTC / TAF) Biktarvy February 7, 2018 darunavir and cobicistat (darunavir ... elvitegravir / cobicistat / emtricitabine / tenofovir alafenamide, EVG / COBI / FTC / TAF) Genvoya November 5, 2015 elvitegravir, cobicistat, emtricitabine, and ...

Identification and characterization of a novel fumarase gene by metagenome expression cloning from marine microorganisms

PubMed Central

2010-01-01

Background Fumarase catalyzes the reversible hydration of fumarate to L-malate and is a key enzyme in the tricarboxylic acid (TCA) cycle and in amino acid metabolism. Fumarase is also used for the industrial production of L-malate from the substrate fumarate. Thermostable and high-activity fumarases from organisms that inhabit extreme environments may have great potential in industry, biotechnology, and basic research. The marine environment is highly complex and considered one of the main reservoirs of microbial diversity on the planet. However, most of the microorganisms are inaccessible in nature and are not easily cultivated in the laboratory. Metagenomic approaches provide a powerful tool to isolate and identify enzymes with novel biocatalytic activities for various biotechnological applications. Results A plasmid metagenomic library was constructed from uncultivated marine microorganisms within marine water samples. Through sequence-based screening of the DNA library, a gene encoding a novel fumarase (named FumF) was isolated. Amino acid sequence analysis revealed that the FumF protein shared the greatest homology with Class II fumarate hydratases from Bacteroides sp. 2_1_33B and Parabacteroides distasonis ATCC 8503 (26% identical and 43% similar). The putative fumarase gene was subcloned into pETBlue-2 vector and expressed in E. coli BL21(DE3)pLysS. The recombinant protein was purified to homogeneity. Functional characterization by high performance liquid chromatography confirmed that the recombinant FumF protein catalyzed the hydration of fumarate to form L-malate. The maximum activity for FumF protein occurred at pH 8.5 and 55°C in 5 mM Mg2+. The enzyme showed higher affinity and catalytic efficiency under optimal reaction conditions: Km= 0.48 mM, Vmax = 827 μM/min/mg, and kcat/Km = 1900 mM/s. Conclusions We isolated a novel fumarase gene, fumF, from a sequence-based screen of a plasmid metagenomic library from uncultivated marine microorganisms. The properties of FumF protein may be ideal for the industrial production of L-malate under higher temperature conditions. The identification of FumF underscores the potential of marine metagenome screening for novel biomolecules. PMID:21092234

Rapid quantification of iron content in fish sauce and soy sauce: a promising tool for monitoring fortification programs.

PubMed

Laillou, Arnaud; Icard-Vernière, Christèle; Rochette, Isabelle; Picq, Christian; Berger, Jacques; Sambath, Pol; Mouquet-Rivier, Claire

2013-06-01

In a number of Southeast Asian countries and China, fish sauce and soy sauce produced at the industrial level are fortified with iron. Unfortunately, the food producers and regulatory agencies implementing fortification programs do not always have the capacity to monitor the programs on an ongoing basis. To assess a new portable device for the quantitative measurement of iron content of fortified sauces that could be used to control fortification levels. The linearity, detection limits, and inter- and intraassay variability of this device were assessed on fish sauce and soy sauce fortified with ferrous sulfate, ferrous fumarate, and sodium iron ethylenediaminetetraacetate (NaFeEDTA); the accuracy of the results was determined by comparing them with the results obtained by atomic absorption spectrophotometry. Measurements required a minimum incubation time of 1 hour for iron sulfate or iron fumarate and 24 hours for NaFeEDTA. Linearity of the results ranged from 2 to 10 mg iron/L for ferrous sulfate or ferrous fumarate and from 1 to 10 mg iron/L for NaFeEDTA, implying the need for proper dilution, as the iron contents of fortified sauce are usually in the range of 150 to 1,000 mg/L. Depending on incubation time, iron compounds, and sauces, the coefficient of variation (CV) of intraassay precision was between 1.5% and 7.6% and the CV of interassay precision was between 2.9% and 7.4%. Comparison with results from atomic absorption spectrophotometry showed high agreement between both methods, with R = 0.926 and R = 0.935 for incubation times of 1 hour and 24 hours, respectively. The Bland-Altman plots showed limits of agreement between the two methods of +/- 70 mg/L in the range of fortification levels tested (100 to 500 mg/L). CONCLUSIONS; This device offers a viable method for field monitoring of iron fortification of soy and fish sauces after incubation times of 1 hour for ferrous sulfate or ferrous fumarate and 24 hours for NaFeEDTA.

Dihydrolipoyl dehydrogenase as a potential UVB target in skin epidermis; using an integrated approach of label-free quantitative proteomics and targeted metabolite analysis.

PubMed

Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou

2015-03-18

Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.

Brief Report: Long-Term (96-Week) Efficacy and Safety After Switching From Tenofovir Disoproxil Fumarate to Tenofovir Alafenamide in HIV-Infected, Virologically Suppressed Adults

PubMed Central

Raffi, François; Orkin, Chloe; Clarke, Amanda; Slama, Laurence; Gallant, Joel; Daar, Eric; Henry, Keith; Santana-Bagur, Jorge; Stein, David K.; Bellos, Nicholaos; Scarsella, Anthony; Yan, Mingjin; Abram, Michael E.; Cheng, Andrew

2017-01-01

Abstract: In a double-blind, phase 3 trial, 663 HIV-infected, virologically suppressed adults were randomized to switch to tenofovir alafenamide (TAF; n = 333) vs. remain on tenofovir disoproxil fumarate (TDF; n = 330), each coformulated with emtricitabine (FTC), while continuing their third agent (boosted protease inhibitor or unboosted third agent). At week 96, 88.6% on FTC/TAF and 89.1% on FTC/TDF had HIV-1 RNA <50 copies per milliliter [adjusted difference −0.5% (95% confidence interval: −5.3 to 4.4%)]. Proteinuria, albuminuria, proximal renal tubular function, and bone mineral density improved after switching to TAF- from TDF-containing regimens. These longer-term data support FTC/TAF as a safe, well-tolerated, and durable nucleotide reverse transcriptase inhibitor backbone. PMID:28272164

The RavA-ViaA Chaperone-Like System Interacts with and Modulates the Activity of the Fumarate Reductase Respiratory Complex.

PubMed

Wong, Keith S; Bhandari, Vaibhav; Janga, Sarath Chandra; Houry, Walid A

2017-01-20

Regulatory ATPase variant A (RavA) is a MoxR AAA+ protein that functions together with a partner protein that we termed VWA interacting with AAA+ ATPase (ViaA) containing a von Willebrand Factor A domain. However, the functional role of RavA-ViaA in the cell is not yet well established. Here, we show that RavA-ViaA are functionally associated with anaerobic respiration in Escherichia coli through interactions with the fumarate reductase (Frd) electron transport complex. Expression analysis of ravA and viaA genes showed that both proteins are co-expressed with multiple anaerobic respiratory genes, many of which are regulated by the anaerobic transcriptional regulator Fnr. Consistently, the expression of both ravA and viaA was found to be dependent on Fnr in cells grown under oxygen-limiting condition. ViaA was found to physically interact with FrdA, the flavin-containing subunit of the Frd complex. Both RavA and the Fe-S-containing subunit of the Frd complex, FrdB, regulate this interaction. Importantly, Frd activity was observed to increase in the absence of RavA and ViaA. This indicates that RavA and ViaA modulate the activity of the Frd complex, signifying a potential regulatory chaperone-like function for RavA-ViaA during bacterial anaerobic respiration with fumarate as the terminal electron acceptor. Copyright © 2016 Elsevier Ltd. All rights reserved.

Progressive multifocal leukoencephalopathy in patients treated with fumaric acid esters: a review of 19 cases.

PubMed

Gieselbach, Robbert-Jan; Muller-Hansma, Annemarie H; Wijburg, Martijn T; de Bruin-Weller, Marjolein S; van Oosten, Bob W; Nieuwkamp, Dennis J; Coenjaerts, Frank E; Wattjes, Mike P; Murk, Jean-Luc

2017-06-01

Progressive multifocal leukoencephalopathy (PML) is a rare and potentially fatal condition caused by a brain infection with JC polyomavirus (JCV). PML develops almost exclusively in immunocompromised patients and has recently been associated with use of fumaric acid esters (FAEs), or fumarates. We reviewed the literature and the Dutch and European pharmacovigilance databases in order to identify all available FAE-associated PML cases and distinguish possible common features among these patients. A total of 19 PML cases associated with FAE use were identified. Five cases were associated with FAE use for multiple sclerosis and 14 for psoriasis. Ten patients were male and nine were female. The median age at PML diagnosis was 59 years. The median duration of FAE therapy to PML symptom onset or appearance of first PML lesion on brain imaging was 31 months (range 6-110). In all cases a certain degree of lymphocytopenia was reported. The median duration of lymphocytopenia to PML symptom onset was 23 months (range 6-72). The median lymphocyte count at PML diagnosis was 414 cells/µL. CD4 and CD8 counts were reported in ten cases, with median cell count of 137 and 39 cells/µL, respectively. Three patients died (16% mortality). The association between occurrence of PML in patients with low CD4 and CD8 counts is reminiscent of PML cases in the HIV population and suggests that loss of T cells is the most important risk factor.

The averted infections ratio: a novel measure of effectiveness of experimental HIV pre-exposure prophylaxis agents.

PubMed

Dunn, David T; Glidden, David V; Stirrup, Oliver T; McCormack, Sheena

2018-06-01

Tenofovir disoproxil fumarate combined with emtricitabine is a highly effective oral pre-exposure prophylaxis (PrEP) agent for preventing the acquisition of HIV. This effectiveness has consequences for the design and analysis of trials assessing experimental PrEP regimens, which now generally include an active-control tenofovir disoproxil fumarate plus emtricitabine group, rather than a placebo group, as a comparator. Herein, we describe major problems in the interpretation of the primary measure of effectiveness proposed for these trials, namely the ratio of HIV incidence in the experimental agent group to that in the active-control group. We argue that valid interpretation requires an assumption about one of two parameters: either the incidence among trial participants had they not received PrEP or the effectiveness of tenofovir disoproxil fumarate plus emtricitabine within the trial. However, neither parameter is directly observed because of the absence of a no-treatment group, thus requiring the use of external evidence or subjective judgment. We propose an alternative measure of effectiveness based on the concept of averted infections, which incorporates one of these parameters. The measure is simple to interpret, has clinical and public health relevance, and is a natural preservation-of-effect criterion for assessing statistical non-inferiority. Its adoption could also allow the use of smaller sample sizes, currently a major barrier to the assessment of experimental PrEP regimens. Copyright © 2018 Elsevier Ltd. All rights reserved.

Evaluation of Potential Drug-Drug Interaction Between Delayed-Release Dimethyl Fumarate and a Commonly Used Oral Contraceptive (Norgestimate/Ethinyl Estradiol) in Healthy Women.

PubMed

Zhu, Bing; Nestorov, Ivan; Zhao, Guolin; Meka, Venkata; Leahy, Mark; Kam, Jeanelle; Sheikh, Sarah I

2017-11-01

Delayed-release dimethyl fumarate (DMF) is an oral therapy for relapsing multiple sclerosis with anti-inflammatory and neuroprotective properties. This 2-period crossover study was conducted to evaluate the potential for drug-drug interaction between DMF (240 mg twice daily) and a combined oral contraceptive (OC; norgestimate 250 μg, ethinyl estradiol 35 μg). Forty-six healthy women were enrolled; 32 completed the study. After the lead-in period (OC alone), 41 eligible participants were randomized 1:1 to sequence 1 (OC and DMF coadministration in period 1; OC alone in period 2) or sequence 2 (regimens reversed). Mean concentration profiles of plasma norelgestromin (primary metabolite of norgestimate) and ethinyl estradiol were superimposable following OC alone and OC coadministered with DMF, with 90% confidence intervals of geometric mean ratios for area under the plasma concentration-time curve over the dosing interval and peak plasma concentration contained within the 0.8-1.25 range. Low serum progesterone levels during combined treatment confirmed suppression of ovulation. The pharmacokinetics of DMF (measured via its primary active metabolite, monomethyl fumarate) were consistent with historical data when DMF was administered alone. No new safety concerns were identified. These results suggest that norgestimate/ethinyl estradiol-based OCs may be used with DMF without dose modification. © 2017, The Authors. Clinical Pharmacology in Drug Development Published by Wiley Periodicals, Inc. on behalf of The American College of Clinical Pharmacology.

Direct measurement of backflux between oxaloacetate and fumarate following pyruvate carboxylation.

PubMed

Brekke, Eva; Walls, Anne B; Nørfeldt, Lasse; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

2012-01-01

Pyruvate carboxylation (PC) is thought to be the major anaplerotic reaction for the tricarboxylic acid cycle and is necessary for de novo synthesis of amino acid neurotransmitters. In the brain, the main enzyme involved is pyruvate carboxylase, which is predominantly located in astrocytes. Carboxylation leads to the formation of oxaloacetate, which condenses with acetyl coenzyme A to form citrate. However, oxaloacetate may also be converted to malate and fumarate before being regenerated. This pathway is termed the oxaloacetate-fumarate-flux or backflux. Carbon isotope-based methods for quantification of activity of PC lead to underestimation when backflux is not taken into account and critical errors have been made in the interpretation of results from metabolic studies. This study was conducted to establish the degree of backflux after PC in cerebellar and neocortical astrocytes. Astrocyte cultures from cerebellum or neocortex were incubated with either [3-(13) C] or [2-(13) C]glucose, and extracts were analyzed using mass spectrometry or nuclear magnetic resonance spectroscopy. Substantial PC compared with pyruvate dehydrogenase activity was observed, and extensive backflux was demonstrated in both types of astrocytes. The extent of backflux varied between the metabolites, reaffirming that metabolism is highly compartmentalized. By applying our calculations to published data, we demonstrate the existence of backflux in vivo in cat, rat, mouse, and human brain. Thus, backflux should be taken into account when calculating the magnitude of PC to allow for a more precise evaluation of cerebral metabolism. Copyright © 2011 Wiley Periodicals, Inc.

Smoking and Asthma (For Teens)

MedlinePlus

... Staying Safe Videos for Educators Search English Español Smoking and Asthma KidsHealth / For Teens / Smoking and Asthma Print en español Fumar y el asma Does Smoking Make Asthma Worse? Yes. If you have asthma, ...

The bacterial flagellar switch complex is getting more complex

PubMed Central

Cohen-Ben-Lulu, Galit N; Francis, Noreen R; Shimoni, Eyal; Noy, Dror; Davidov, Yaacov; Prasad, Krishna; Sagi, Yael; Cecchini, Gary; Johnstone, Rose M; Eisenbach, Michael

2008-01-01

The mechanism of function of the bacterial flagellar switch, which determines the direction of flagellar rotation and is essential for chemotaxis, has remained an enigma for many years. Here we show that the switch complex associates with the membrane-bound respiratory protein fumarate reductase (FRD). We provide evidence that FRD binds to preparations of isolated switch complexes, forms a 1:1 complex with the switch protein FliG, and that this interaction is required for both flagellar assembly and switching the direction of flagellar rotation. We further show that fumarate, known to be a clockwise/switch factor, affects the direction of flagellar rotation through FRD. These results not only uncover a new component important for switching and flagellar assembly, but they also reveal that FRD, an enzyme known to be primarily expressed and functional under anaerobic conditions in Escherichia coli, nonetheless, has important, unexpected functions under aerobic conditions. PMID:18337747

Initiation of Anaerobic Degradation of p-Cresol by Formation of 4-Hydroxybenzylsuccinate in Desulfobacterium cetonicum

PubMed Central

Müller, Jochen A.; Galushko, Alexander S.; Kappler, Andreas; Schink, Bernhard

2001-01-01

The anaerobic bacterium Desulfobacterium cetonicum oxidized p-cresol completely to CO2 with sulfate as the electron acceptor. During growth, 4-hydroxybenzylsuccinate accumulated in the medium. This finding indicated that the methyl group of p-cresol is activated by addition to fumarate, analogous to anaerobic toluene, m-xylene, and m-cresol degradation. In cell extracts, the formation of 4-hydroxybenzylsuccinate from p-cresol and fumarate was detected at an initial rate of 0.57 nmol min−1 (mg of protein)−1. This activity was specific for extracts of p-cresol-grown cells. 4-Hydroxybenzylsuccinate was degraded further to 4-hydroxybenzoyl-coenzyme A (CoA), most likely via β-oxidation. 4-Hydroxybenzoyl-CoA was reductively dehydroxylated to benzoyl-CoA. There was no evidence of degradation of p-cresol via methyl group oxidation by p-cresol-methylhydroxylase in this bacterium. PMID:11133971

The putative interplay between DJ-1/NRF2 and Dimethyl Fumarate: A potentially important pharmacological target.

PubMed

Vavougios, George; Zarogiannis, Sotirios G; Doskas, Triantafylos

2018-04-01

Recent research has outlined that Dimethyl Fumarate (DMF) functions as a gene regulator via multiple pathways, critical among which is the NRF2 cytoprotective cascade. PARK7/DJ-1 is a multifunctional protein that acts as a redox sensor and effector of multiple cytoprotective pathways, including NRF2. Specifically, it prevents the association of NRF2 with its inhibitor KEAP1, allowing NRF2 to enter the nucleus and mediate cytoprotective and antioxidant cascades. It is our hypothesis that while the NRF2-KEAP1 inhibitory complex is reported the main pharmacological target for DMF's NRF dependent functions, no study to date has explored the effects of DMF on DJ-1's expression, and vice-versa, the possibility of a regulatory inadequacy in the upstream, oxidant-responsive DJ-1 activator of the NRF2 cascade. Copyright © 2018 Elsevier B.V. All rights reserved.

[Current immunotherapy of multiple sclerosis].

PubMed

Paul, F; Ruprecht, K

2015-08-01

Following the introduction of interferon beta 1b as the first immunomodulatory therapy for multiple sclerosis (MS) in 1993, there are currently nine substances or substance classes approved for the treatment of MS (i.e. alemtuzumab, azathioprine, dimethyl fumarate, fingolimod, glatiramer acetate, interferon beta, mitoxantrone, natalizumab and teriflunomide). Major developments during the last 5 years include the approval of orally administered medications (i.e. fingolimod, teriflunomide and dimethyl fumarate), a monoclonal antibody (alemtuzumab), as well as glatiramer acetate with an administration frequency three times a week and a pegylated formulation of interferon beta 1a. The broadened therapeutic options enable a more differentiated and individualized therapy of MS; however, evidence-based data for therapeutic decision-making relevant in clinical practice are not always available. Rare but potentially severe and even life-threatening side effects of immunotherapies for MS require continuous pharmacovigilance and adherence to risk management plans.

A Role for Cytosolic Fumarate Hydratase in Urea Cycle Metabolism and Renal Neoplasia

PubMed Central

Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O’Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A.; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J.; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J.

2013-01-01

Summary The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. PMID:23643539

A role for cytosolic fumarate hydratase in urea cycle metabolism and renal neoplasia.

PubMed

Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O'Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J

2013-05-30

The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Unsuspected task for an old team: succinate, fumarate and other Krebs cycle acids in metabolic remodeling.

PubMed

Bénit, Paule; Letouzé, Eric; Rak, Malgorzata; Aubry, Laetitia; Burnichon, Nelly; Favier, Judith; Gimenez-Roqueplo, Anne-Paule; Rustin, Pierre

2014-08-01

Seventy years from the formalization of the Krebs cycle as the central metabolic turntable sustaining the cell respiratory process, key functions of several of its intermediates, especially succinate and fumarate, have been recently uncovered. The presumably immutable organization of the cycle has been challenged by a number of observations, and the variable subcellular location of a number of its constitutive protein components is now well recognized, although yet unexplained. Nonetheless, the most striking observations have been made in the recent period while investigating human diseases, especially a set of specific cancers, revealing the crucial role of Krebs cycle intermediates as factors affecting genes methylation and thus cell remodeling. We review here the recent advances and persisting incognita about the role of Krebs cycle acids in diverse aspects of cellular life and human pathology. Copyright © 2014 Elsevier B.V. All rights reserved.

The Epi-TAF for Tenofovir Disoproxil Fumarate?

PubMed

Walensky, Rochelle P; Horn, Tim H; Paltiel, A David

2016-04-01

Approximately 84% of human immunodeficiency virus (HIV)-infected US residents on antiretroviral therapy currently receive some form of tenofovir disoproxil fumarate (TDF) as part of their HIV treatment regimen. The TDF analogue tenofovir alafenamide (TAF) has demonstrated equal efficacy but with decreased renal injury and bone mineral density loss compared with TDF. We examine how much more society ought to be willing to pay for TAF over TDF, in exchange for its improved toxicity profile. Using cost-effectiveness methods, we find that current conditions warrant an annual premium of up to $1000 over the average wholesale price (AWP) of TDF. Once generic coformulations of tenofovir/lamivudine become accessible, however, the appropriate premium for TAF will likely merit a downward adjustment, using generic TDF-based costs as the benchmark. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Studies on biodegradation of crosslinked hydroxy terminated-poly(proplyene fumarate) and formation of scaffold for orthopedic applications.

PubMed

Shalumon, K T; Jayabalan, M

2009-12-01

Biodegradation of crosslinked-hydroxy terminated-poly(proplyene fumarate) (X-HTPPF) has been studied in simulated physiological media to assess the formation of porous scaffold structure for bone growth and remodeling in load bearing orthopedic applications. Variation in crosslink density and surface hydrophilicity of X-HTPPF are observed due to non-stoichiometric mass of reacting partners. These variations influence absorption of the medium and biodegradation during aging. Though the initial absorption of medium is relatively higher with the crosslinked polymer (PNVP1) having 63.6% HT-PPF and 36.4% comonomer n-vinyl pyrrolidone (NVP) during the initial period of aging, the weight loss due to subsequent degradation with time is relatively lesser. PNVP1 undergo slow degradation with formation of fibril structure on the surface. The present crosslinked material PNVP1 is a candidate for the load bearing orthopedic applications.

H2 S Sensors: Fumarate-Based fcu-MOF Thin Film Grown on a Capacitive Interdigitated Electrode.

PubMed

Yassine, Omar; Shekhah, Osama; Assen, Ayalew H; Belmabkhout, Youssef; Salama, Khaled N; Eddaoudi, Mohamed

2016-12-19

Herein we report the fabrication of an advanced sensor for the detection of hydrogen sulfide (H 2 S) at room temperature, using thin films of rare-earth metal (RE)-based metal-organic framework (MOF) with underlying fcu topology. This unique MOF-based sensor is made via the in situ growth of fumarate-based fcu-MOF (fum-fcu-MOF) thin film on a capacitive interdigitated electrode. The sensor showed a remarkable detection sensitivity for H 2 S at concentrations down to 100 ppb, with the lower detection limit around 5 ppb. The fum-fcu-MOF sensor exhibits a highly desirable detection selectivity towards H 2 S vs. CH 4 , NO 2 , H 2 , and C 7 H 8 as well as an outstanding H 2 S sensing stability as compared to other reported MOFs. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Differential cytochrome content and reductase activity in Geospirillum barnesii strain SeS3

USGS Publications Warehouse

Stolz, J.F.; Gugliuzza, T.; Switzer, Blum J.; Oremland, R.; Martinez, Murillo F.

1997-01-01

The protein composition, cytochrome content, and reductase activity in the dissimilatory selenate-reducing bacterium Geospirillum barnesii strain SeS3, grown with thiosulfate, nitrate, selenate, or fumarate as the terminal electron acceptor, was investigated. Comparison of seven high-molecular-mass membrane proteins (105.3, 90.3, 82.6, 70.2, 67.4, 61.1, and 57.3 kDa) by SDS-PAGE showed that their detection was dependent on the terminal electron acceptor used. Membrane fractions from cells grown on thiosulfate contained a 70.2-kDa c-type cytochrome with absorbance maxima at 552, 522, and 421 nm. A 61.1-kDa c-type cytochrome with absorption maxima at 552, 523, and 423 nm was seen in membrane fractions from cells grown on nitrate. No c-type cytochromes were detected in membrane fractions of either selenate- or fumarate-grown cells. Difference spectra, however, revealed the presence of a cytochrome b554 (absorption maxima at 554, 523, and 422 nm) in membrane fractions from selenate-grown cells and a cytochrome b556 (absorption maxima at 556, 520, and 416 nm) in membrane fractions from fumarate-grown cells. Analysis of reductase activity in the different membrane fractions showed variability in substrate specificity. However, enzyme activity was greatest for the substrate on which the cells had been grown (e.g., membranes from nitrate-grown cells exhibited the greatest activity with nitrate). These results show that protein composition, cytochrome content, and reductase activity are dependent on the terminal electron acceptor used for growth.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2009-04-01

(+)-Dapoxetine hydrochloride, [(123)I]-BZA, 9-Aminocamptothecin; Abacavir sulfate/lamivudine, Adalimumab, Adefovir dipivoxil, Alemtuzumab, Alvocidib hydrochloride, Ambrisentan, Amsilarotene, Anacetrapib, Anakinra, Apricitabine, Aripiprazole, Arsenic trioxide, Atazanavir sulfate, Atazanavir/ritonavir, Atrasentan, Azacitidine; Banoxantrone, Bazedoxifene acetate, Bevacizumab, Bexarotene, Biphasic insulin aspart, Bortezomib, Bosentan, Bromfenac; Cachectin, Calcipotriol/betamethasone dipropionate, Canakinumab, Carfilzomib, CAT-354, CCX-282, Certolizumab pegol, Cetuximab, Choline fenofibrate, Clevudine, Clofarabine, CNTO-328, Corifollitropin alfa, Crofelemer; Daptomycin, Darbepoetin alfa, Darunavir, Dasatinib, Decitabine, Deferasirox, Denosumab, Duloxetine hydrochloride, Dutasteride; Emtricitabine, Enfuvirtide, Entecavir, Epoetin zeta, Erlotinib hydrochloride, Escitalopram oxalate, Eslicarbazepine acetate, Eszopiclone, Etravirine, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Farglitazar, Febuxostat, Fosamprenavir calcium, FX-06; Gabapentin enacarbil, Gefitinib; HIVIS DNA; Imatinib mesylate, INCB- 18424, Indacaterol, Inotuzumab ozogamicin, Insulin detemir; JNJ-26854165; Lacosamide, Landiolol, Laromustine, Lenalidomide, Liposomal doxorubicin, L-NAME, Lopinavir, Lopinavir/ritonavir, Lumiracoxib; Maraviroc, Mepolizumab, Methoxy polyethylene glycol- epoetin-beta, Miglustat, MK-0493, MVA-CMDR, Mycophenolic acid sodium salt; Natalizumab, Nepafenac, Neratinib, Neridronic acid, Nesiritide, Nilotinib hydrochloride monohydrate; Olmesartan medoxomil, Omacetaxine mepesuccinate, Omalizumab; Paclitaxel poliglumex, Palifermin, Patupilone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, PHA-848125, Pitavastatin calcium, Posaconazole, Povidone-iodine liposome complex, Prasugrel, Pregabalin, Prucalopride; Raltegravir potassium, Retigabine, Revaprazan hydrochloride, rhFSH, Rilpivirine, Rivaroxaban, Romidepsin, Rosuvastatin calcium, RWJ-676070; SAR-109659, Sitagliptin phosphate monohydrate, Sorafenib, Stavudine/Lamivudine/Nevirapine, Sunitinib malate; Tadalafil, Telaprevir, Telbivudine, Tenofovir disoproxil fumarate, Tenofovir disoproxil fumarate/emtricitabine, Tenofovir disoproxil fumarate/emtricitabine/efavirenz, Teriparatide, Tigecycline, Tiotropium bromide, Tipifarnib, Tipranavir, Tocilizumab, Trifluridine/TPI; UP-780; Vandetanib, Vardenafil hydrochloride hydrate, Vatalanib succinate, Vitespen, Vorinostat; Yttrium 90 (90Y) ibritumomab tiuxetan; Zoledronic acid monohydrate. Copyright 2009 Prous Science, S.A.U. or its licensors. All rights reserved.

Atypical Antipsychotics and the Risk of Hyperlipidemia: A Sequence Symmetry Analysis.

PubMed

Takeuchi, Yoshinori; Kajiyama, Kazuhiro; Ishiguro, Chieko; Uyama, Yoshiaki

2015-07-01

Although hyperlipidemia is a well known adverse event of atypical antipsychotic (AAP) medication, there are few studies that have quantitatively compared the risks of various AAPs. Our aim was to comparatively evaluate the risk of hyperlipidemia associated with the use of AAPs approved in Japan through a consecutive epidemiological study. We conducted a sequence symmetry analysis (SSA) using health insurance claims data to analyze the following nine AAPs approved for use in Japan: risperidone, paliperidone, perospirone hydrochloride hydrate, blonanserin, clozapine, olanzapine, quetiapine fumarate, aripiprazole, and zotepine. Exposed cases were identified from drug dispensing records as those who had been administered both AAPs and antihyperlipidemic drugs. The adjusted sequence ratio (ASR) and 95 % confidence interval (CI) for each individual AAP and for all AAPs were calculated while controlling for time trends in dispensing patterns. Olanzapine was significantly associated with increased hyperlipidemia occurrence (ASR 1.56; 95 % CI 1.25-1.95). The ASRs obtained for risperidone (1.01; 95 % CI 0.80-1.27), perospirone hydrochloride hydrate (0.93; 95 % CI 0.63-1.39), blonanserin (0.83; 95 % CI 0.52-1.33), quetiapine fumarate (0.93; 95 % CI 0.73-1.18), and aripiprazole (1.02; 95 % CI 0.82-1.26) were approximately 1.0. Unstable estimates (wide CIs) were obtained for paliperidone and zotepine due to the small sample sizes. Among the AAPs used in Japan, only olanzapine was found to have an elevated risk of hyperlipidemia. In contrast, risperidone, perospirone hydrochloride hydrate, blonanserin, quetiapine fumarate, and aripiprazole had relatively low risks.

Fixed dose darunavir boosted with cobicistat combined with emtricitabine and tenofovir alafenamide fumarate.

PubMed

Cevik, Muge; Orkin, Chloe

2018-07-01

In an era when virological efficacy approaches 100%, novel antiretroviral (ARV) therapies must deliver better tolerability, safety, and convenient coformulated regimens. We review the phase II and III clinical data on the fixed dose combination (FDC) darunavir (DRV) 800mg / cobicistat (COBI/C) 150 mg / emtricitabine (F/FTC) 200 mg / tenofovir alafenamide fumarate (TAF) 10mg (D/C/F/TAF) for the treatment of HIV-1 infection. In an exploratory phase II study, D/C/F/TAF FDC demonstrated similar virological efficacy to darunavir/cobicistat FDC + F /tenofovir disoproxil fumarate (TDF) FDC in treatment-naive HIV-1-infected individuals with favorable bone and renal outcomes. These findings led to two subsequent international phase III double-blind randomized controlled trials; AMBER and EMERALD. In the (treatment naïve) AMBER study, D/C/F/TAF FDC was noninferior to component regimen F/TDF + darunavir/cobicistat with favorable bone and renal outcomes at week 48. In the EMERALD study (switch study for virologically suppressed patients), D/C/F/TAF showed noninferior efficacy to F/TDF and boosted protease inhibitor (bPI) regimen at week 48 also with favorable renal and bone outcomes. No virological failure was observed, and no resistance to TDF or darunavir emerged in either study. In clinical trials, D/C/F/TAF FDC demonstrated excellent, noninferior virological efficacy, maintained a high genetic barrier and conferred the additional safety benefits of TAF. As the first one pill, once daily, protease inhibitor-based regimen, D/C/F/TAF FDC offers a new option for the treatment of HIV infection.

Oxidoreductases Involved in Cell Carbon Synthesis of Methanobacterium thermoautotrophicum

PubMed Central

Zeikus, J. G.; Fuchs, G.; Kenealy, W.; Thauer, R. K.

1977-01-01

Cell-free extracts of Methanobacterium thermoautotrophicum were found to contain high activities of the following oxidoreductases (at 60°C): pyruvate dehydrogenase (coenzyme A acetylating), 275 nmol/min per mg of protein; α-ketoglutarate dehydrogenase (coenzyme A acylating), 100 nmol/min per mg; fumarate reductase, 360 nmol/min per mg; malate dehydrogenase, 240 nmol/min per mg; and glyceraldehyde-3-phosphate dehydrogenase, 100 nmol/min per mg. The kinetic properties (apparent Vmax and KM values), pH optimum, temperature dependence of the rate, and specificity for electron acceptors/donors of the different oxidoreductases were examined. Pyruvate dehydrogenase and α-ketoglutarate dehydrogenase were shown to be two separate enzymes specific for factor 420 rather than for nicotinamide adenine dinucleotide (NAD), NADP, or ferredoxin as the electron acceptor. Both activities catalyzed the reduction of methyl viologen with the respective α-ketoacid and a coenzyme A-dependent exchange between the carboxyl group of the α-ketoacid and CO2. The data indicate that the two enzymes are similar to pyruvate synthase and α-ketoglutarate synthase, respectively. Fumarate reductase was found in the soluble cell fraction. This enzyme activity coupled with reduced benzyl viologen as the electron donor, but reduced factor 420, NADH, or NADPH was not effective. The cells did not contain menaquinone, thus excluding this compound as the physiological electron donor for fumarate reduction. NAD was the preferred coenzyme for malate dehydrogenase, whereas NADP was preferred for glyceraldehyde-3-phosphate dehydrogenase. The organism also possessed a factor 420-dependent hydrogenase and a factor 420-linked NADP reductase. The involvement of the described oxidoreductases in cell carbon synthesis is discussed. PMID:914779

Salmonella enterica serovar Typhimurium mutants unable to convert malate to pyruvate and oxaloacetate are avirulent and immunogenic in BALB/c mice.

PubMed

Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S

2009-04-01

Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.

Ligament Tissue Engineering Using a Novel Porous Polycaprolactone Fumarate Scaffold and Adipose Tissue-Derived Mesenchymal Stem Cells Grown in Platelet Lysate.

PubMed

Wagner, Eric R; Bravo, Dalibel; Dadsetan, Mahrokh; Riester, Scott M; Chase, Steven; Westendorf, Jennifer J; Dietz, Allan B; van Wijnen, Andre J; Yaszemski, Michael J; Kakar, Sanjeev

2015-11-01

Surgical reconstruction of intra-articular ligament injuries is hampered by the poor regenerative potential of the tissue. We hypothesized that a novel composite polymer "neoligament" seeded with progenitor cells and growth factors would be effective in regenerating native ligamentous tissue. We synthesized a fumarate-derivative of polycaprolactone fumarate (PCLF) to create macro-porous scaffolds to allow cell-cell communication and nutrient flow. Clinical grade human adipose tissue-derived human mesenchymal stem cells (AMSCs) were cultured in 5% human platelet lysate (PL) and seeded on scaffolds using a dynamic bioreactor. Cell growth, viability, and differentiation were examined using metabolic assays and immunostaining for ligament-related markers (e.g., glycosaminoglycans [GAGs], alkaline phosphatase [ALP], collagens, and tenascin-C). AMSCs seeded on three-dimensional (3D) PCLF scaffolds remain viable for at least 2 weeks with proliferating cells filling the pores. AMSC proliferation rates increased in PL compared to fetal bovine serum (FBS) (p < 0.05). Cells had a low baseline expression of ALP and GAG, but increased expression of total collagen when induced by the ligament and tenogenic growth factor fibroblast growth factor 2 (FGF-2), especially when cultured in the presence of PL (p < 0.01) instead of FBS (p < 0.05). FGF-2 and PL also significantly increased immunostaining of tenascin-C and collagen at 2 and 4 weeks compared with human fibroblasts. Our results demonstrate that AMSCs proliferate and eventually produce a collagen-rich extracellular matrix on porous PCLF scaffolds. This novel scaffold has potential in stem cell engineering and ligament regeneration.

Effect of the prefermentative addition of five enological tannins on anthocyanins and color in red wines.

PubMed

Liu, Yan-Xia; Liang, Na-Na; Wang, Jun; Pan, Qiu-Hong; Duan, Chang-Qing

2013-01-01

The effects of prefermentation addition of 5 exogenous tannins with different-origin anthocyanins and color characteristics were investigated in "Cabernet Sauvignon wines" at the end of alcoholic fermentation and the end of malolactic fermentation, and after 6 mo and 9 mo of bottle aging, respectively. The results showed that the application of GSKT2 could significantly retard the degradation of most anthocyanins in the process of alcoholic fermentation and the decrease of some pyranoanthocyanins during the subsequent 3 stages, thus causing more yellowness of wine in comparison with the control. Three other condensed tannins, GSKT1, QUET, and GSET, had a positive impact only on several anthocyanin components. Four condensed tannins all contributed to more redness, suggesting that the action mechanism might be to protect wine against oxidation or contribute to form copigmented anthocyanidins, or polymeric pigments. The application of FOLT (hydrolysable tannin) did not produce any influence on wine redness even after 9 mo of bottle aging. This work provides some reasons for the reasonable application of tannin additives. The prefermentative application of condensed tannins overall could protect some pigment components from degradation and enhance wine redness. Tannin additives with different origins have different effectiveness. The tannin additive obtained from grape skins, like GSKT2, could produce significant promotion on both redness and yellowness in wine. The prefermentation addition of hydroxylase tannin like FOLT seems not to have a significant effect on wine color. © 2012 Institute of Food Technologists®

Improved Understanding of Microbial Iron and Sulfate Reduction Through a Combination of Bottom-up and Top-down Functional Proteomics Assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, Ruth

Our overall goal was to improve the understanding of microbial iron and sulfate reduction by evaluating a diverse iron and sulfate reducing organisms utilizing a multi-omics approach combining “top-down” and “bottom-up” omics methodologies. We initiated one of the first combined comparative genomics, shotgun proteomics, RTqPCR, and heterologous expression studies in pursuit of our project objectives. Within the first year of this project, we created a new bioinformatics tool for ortholog identification (“SPOCS”). SPOCS is described in our publication, Curtis et al., 2013. Using this tool we were able to identify conserved orthologous groups across diverse iron and sulfate reducing microorganismsmore » from Firmicutes, gamma-proteobacteria and delta-proteobacteria. For six iron and sulfate reducers we also performed shotgun proteomics (“bottom-up” proteomics including accurate mass and time (AMT) tag and iTRAQ approaches). Cultures include Gram (-) and Gram (+) microbes. Gram (-) were: Geobacter sulfureducens (grown on iron citrate and fumarate), Geobacter bemidjiensis (grown on iron citrate and fumarate), Shewanella oneidiensis (grown on iron citrate and fumarate) and Anaeromyxobacter dehalogenans (grown on iron citrate and fumarate). Although all cultures grew on insoluble iron, the iron precipitates interfered with protein extraction and analysis; which remains a major challenge for researchers in disparate study systems. Among the Gram (-) organisms studied, Anaeromyxobacter dehalogenans remains the most poorly characterized. Yet, it is arguably the most versatile organisms we studied. In this work we have used comparative proteomics to hypothesize which two of the dozens of predicted c-type cytochromes within Anaeromyxobacter dehalogenans may be directly involved in soluble iron reduction. Unfortunately, heterologous expression of these Anaeromyxobacter dehalogenans ctype cytochromes led to poor protein production and/or formation of inclusion bodies, even when we co-expressed several genes known to be important for assembly of cytochrome holoenzymes. We confirmed the proteomics trends at the RNA level by designing specific primer sets for hypothesized iron reductases in Anaeromyxobacter dehalogenans, and performed Reverse Transcription-qPCR. AD_0127 was 20 fold upregulated only on iron citrate conditions. AD_0127 is described as a hypothetical protein, but Pfam predicts it to be C554 type cytochrome having a possible role in nitrification (Wang et al., in preparation).« less

Cytotoxicity of Paclitaxel in biodegradable self-assembled core-shell poly(lactide-co-glycolide ethylene oxide fumarate) nanoparticles.

PubMed

He, Xuezhong; Ma, Junyu; Mercado, Angel E; Xu, Weijie; Jabbari, Esmaiel

2008-07-01

Biodegradable core-shell polymeric nanoparticles (NPs), with a hydrophobic core and hydrophilic shell, are developed for surfactant-free encapsulation and delivery of Paclitaxel to tumor cells. Poly (lactide-co-glycolide fumarate) (PLGF) and Poly (lactide-fumarate) (PLAF) were synthesized by condensation polymerization of ultra-low molecular weight poly(L: -lactide-co-glycolide) (ULMW PLGA) with fumaryl chloride (FuCl). Similarly, poly(lactide-co-ethylene oxide fumarate) (PLEOF) macromer was synthesized by reacting ultra-low molecular weight poly(L: -lactide) (ULMW PLA) and PEG with FuCl. The blend PLGF/PLEOF and PLAF/PLEOF macromers were self-assembled into NPs by dialysis. The NPs were characterized with respect to particle size distribution, morphology, and loading efficiency. The physical state and miscibility of Paclitaxel in NPs were characterized by differential scanning calorimetry. Tumor cell uptake and cytotoxicity of Paclitaxel loaded NPs were measured by incubation with HCT116 human colon carcinoma cells. The distribution of NPs in vivo was assessed with Apc(Min/+)mouse using infrared imaging. PLEOF macromer, due to its amphiphilic nature, acted as a surface active agent in the process of self-assembly which produced core-shell NPs with PLGF/PLAF and PLEOF macromers as the core and shell, respectively. The encapsulation efficiency ranged from 70 to 56% and it was independent of the macromer but decreased with increasing concentration of Paclitaxel. Most of the PLGF and PLAF NPs degraded in 15 and 28 days, respectively, which demonstrated that the release was dominated by hydrolytic degradation and erosion of the matrix. As the concentration of Paclitaxel was increased from 0 to 10, and 40 mug/ml, the viability of HCT116 cells incubated with free Paclitaxel decreased from 100 to 65 and 40%, respectively, while those encapsulated in PLGF/PLEOF NPs decreased from 93 to 54 and 28%. Groups with Paclitaxel loaded NPs had higher cytotoxicity compared to Paclitaxel directly added to the media at the same concentration. NPs acted as reservoirs to protect the drug from epimerization and hydrolysis while providing a sustained dose of Paclitaxel with time. Infrared image of the Apc(Min/+) mouse injected with NPs showed significantly higher concentration of NPs in the intestinal tissue.

PA-1, a Versatile Anaerobe Obtained in Pure Culture, Catabolizes Benzenoids and Other Compounds in Syntrophy with Hydrogenotrophs, and P-2 plus Wolinella sp. Degrades Benzenoids

PubMed Central

Barik, Sudhakar; Brulla, W. J.; Bryant, M. P.

1985-01-01

Methanogenic enrichments catabolizing 13 mM phenylacetate or 4 mM phenol were established at 37°C, using a 10% inoculum from a municipal anaerobic digester. By using agar roll tubes of the basal medium plus 0.1% yeast extract-25 mM fumarate, a hydrogenotrophic lawn of Wolinella succinogenes and phenol or phenylacetate, strains P-2 and PA-1, respectively, were isolated in coculture with W. succinogenes. With the lawn deleted, PA-1 was isolated in pure culture. Strain P-2 is apparently a new species of anaerobic, motile, gram-negative, spindle-shaped, small rod that as yet has been grown only in coculture with W. succinogenes. It used phenol, hydrocinnamate, benzoate, and phenylacetate as energy sources. Product recovery by the coculture, per mole of phenol and 4.4 mol of fumarate used, included 2.03, 0.12, 0.08, and 3.23 mol, respectively, of acetate, propionate, butyrate, and succinate. Carbon recovery was 75% and H recovery was 80%, although CO2 and a few other possible products were not determined. That P-2 is an obligate proton-reducing acetogen and possible pathways for its degradation of phenol are discussed. Strain PA-1 is apparently a new species of anaerobic, motile, relatively small, gram-negative rod. It utilized compounds such as phenylacetate, hydrocinnamate, benzoate, phenol, resorcinol, gallate, 4-aminophenol, 2-aminobenzoate, pyruvate, Casamino Acids, and aspartate as energy sources in coculture with W. succinogenes. Per mole of phenylacetate and 1.44 mol of fumarate used, 1.04, 0.53, and 0.78 mol of acetate, propionate, and succinate, respectively, were recovered from the coculture. Only about 50% of the carbon and H were recovered. In coculture with Methanospirillum hungatei, 0.96 mol of acetate and 0.25 mol of methane were recovered per mol of pyruvate used; 0.90 mol of acetate and 0.33 mol of methane, per mol of fumarate used; 0.93 mol of acetate and 0.54 mol of methane, per mol of aspartate used; and 1.71 mol of acetate and 0.57 mol of methane, per mol of glucose used. Carbon and H recoveries, assuming CO2 and ammonia were produced in stoichiometric amounts, were 97 and 98% for pyruvate, 72.5 and 82% for fumarate, 96.5 and 98% for aspartate, and 61.8 and 76% for glucose. No explanation such as contamination could be found for the fact that the coculture PA-1 plus Wolinella sp. did not use glucose; after growth with M. hungatei on pyruvate, however, the latter coculture used glucose. The PA-1 pure culture produced 0.86 mol of propionate per mol of succinate used during growth. PA-1 produced a small amount of H2. Strain PA-1 is the most versatile anaerobic bacterium yet known that catabolizes monobenzenoids in the absence of electron acceptors such as sulfate or nitrate. PMID:16346852

Vivek S. Bharadwaj | NREL

Science.gov Websites

Interests Vivek's interests broadly span across protein structure and dynamics, reaction mechanisms, and energetics and kinetics from first principles Protein structure prediction and docking Education PhD structure on the fumarate addition mechanism - a gas-phase ab initio study," Physical Chemistry

Bis(PheOH) maleic acid amide-fumaric acid amide photoizomerization induces microsphere-to-gel fiber morphological transition: the photoinduced gelation system.

PubMed

Frkanec, Leo; Jokić, Milan; Makarević, Janja; Wolsperger, Kristina; Zinić, Mladen

2002-08-21

The photoinduced gelation system based on 1 (non-gelling) to 2 (gelling) molecular photoisomerization in water results by microspheres (1) to gel fibers (2) transformation at the supramolecular level.

Gateways to clinical trials.

PubMed

Bayes, M; Rabasseda, X; Prous, J R

2006-01-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs:(R)-Flurbiprofen, 90Yttrium-DOTA-huJ591; ABT-510, ACP-103, Ad5-FGF4, adalimumab, ademetionine, AG-7352, alemtuzumab, Amb a 1 ISS-DNA, anakinra, apaziquone, aprepitant, aripiprazole, atazanavir sulfate; BAL-8557, bevacizumab, BMS-188797, bortezomib, bosentan, brivudine; Calcipotriol/betamethasone dipropionate, cannabidiol, caspofungin acetate, catumaxomab, CERE-120, cetuximab, ciclesonide, cilomilast, cizolirtine citrate, Cypher, cystemustine; Dalbavancin, darifenacin hydrobromide, dasatinib, deferasirox, denosumab, desmoteplase, dihydrexidine, dimethyl fumarate, dutasteride, DW-166HC; Eculizumab, enfuvirtide, entecavir, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, eszopiclone, etoricoxib, everolimus; Fallypride, febuxostat, fenretinide, fesoterodine, fingolimod hydrochloride; Gabapentin enacarbil, gefitinib; hMaxi-K, human papillomavirus vaccine, HYAL-CT1101; Imatinib mesylate, indiplon, inolimomab, ISAtx-247; J591; Lacosamide, landiolol, lasofoxifene tartrate, lestaurtinib, lidocaine/prilocaine, linezolid, lixivaptan, lonafarnib, lopinavir, lopinavir/ritonavir, lumiracoxib; Natalizumab, nesiritide; OC-108, omalizumab, onercept, OSC; Palifermin, palonosetron hydrochloride, parathyroid hormone (human recombinant), parecoxib sodium, PD-MAGE-3 vaccine, PEG-filgrastim, peginterferon alfa-2a, peginterferon alfa-2b, pegsunercept, pelitinib, pitavastatin calcium, plerixafor hydrochloride, posaconazole, prasterone sulfate, pregabalin; Ramelteon, ranelic acid distrontium salt, rasburicase, rosuvastatin calcium, rotigotine, RSD-1235, rufinamide, rupatadine fumarate; Sarizotan hydrochloride, SHL-749, sirolimus-eluting stent, solifenacin succinate, sunitinib malate; Tadalafil, talampanel, tasidotin hydrochloride, Taxus, tegaserod maleate, telavancin hydrochloride, tenofovir disoproxil fumarate, tiotropium bromide, tocilizumab, tositumomab, treprostinil sodium, tridolgosir hydrochloride, TTS-CD3; Ularitide; Valdecoxib, Val-Tyr sardine peptidase, vardenafil hydrochloride hydrate, voriconazole; Yttrium (90Y) edotreotide, Yttrium 90 (90Y) ibritumomab tiuxetan; Zileuton, zucapsaicin.

Expression profiling in progressive stages of fumarate-hydratase deficiency: the contribution of metabolic changes to tumorigenesis.

PubMed

Ashrafian, Houman; O'Flaherty, Linda; Adam, Julie; Steeples, Violetta; Chung, Yuen-Li; East, Phil; Vanharanta, Sakari; Lehtonen, Heli; Nye, Emma; Hatipoglu, Emine; Miranda, Melroy; Howarth, Kimberley; Shukla, Deepa; Troy, Helen; Griffiths, John; Spencer-Dene, Bradley; Yusuf, Mohammed; Volpi, Emanuela; Maxwell, Patrick H; Stamp, Gordon; Poulsom, Richard; Pugh, Christopher W; Costa, Barbara; Bardella, Chiara; Di Renzo, Maria Flavia; Kotlikoff, Michael I; Launonen, Virpi; Aaltonen, Lauri; El-Bahrawy, Mona; Tomlinson, Ian; Pollard, Patrick J

2010-11-15

Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is caused by mutations in the Krebs cycle enzyme fumarate hydratase (FH). It has been proposed that "pseudohypoxic" stabilization of hypoxia-inducible factor-α (HIF-α) by fumarate accumulation contributes to tumorigenesis in HLRCC. We hypothesized that an additional direct consequence of FH deficiency is the establishment of a biosynthetic milieu. To investigate this hypothesis, we isolated primary mouse embryonic fibroblast (MEF) lines from Fh1-deficient mice. As predicted, these MEFs upregulated Hif-1α and HIF target genes directly as a result of FH deficiency. In addition, detailed metabolic assessment of these MEFs confirmed their dependence on glycolysis, and an elevated rate of lactate efflux, associated with the upregulation of glycolytic enzymes known to be associated with tumorigenesis. Correspondingly, Fh1-deficient benign murine renal cysts and an advanced human HLRCC-related renal cell carcinoma manifested a prominent and progressive increase in the expression of HIF-α target genes and in genes known to be relevant to tumorigenesis and metastasis. In accord with our hypothesis, in a variety of different FH-deficient tissues, including a novel murine model of Fh1-deficient smooth muscle, we show a striking and progressive upregulation of a tumorigenic metabolic profile, as manifested by increased PKM2 and LDHA protein. Based on the models assessed herein, we infer that that FH deficiency compels cells to adopt an early, reversible, and progressive protumorigenic metabolic milieu that is reminiscent of that driving the Warburg effect. Targets identified in these novel and diverse FH-deficient models represent excellent potential candidates for further mechanistic investigation and therapeutic metabolic manipulation in tumors. Copyright © 2010 AACR.

Potentiometric determination of ketotifen fumarate in pharmaceutical preparations and urine using carbon paste and PVC membrane selective electrodes.

PubMed

Frag, Eman Y Z; Mohamed, Gehad G; Khalil, Mohamed M; Hwehy, Mohammad M A

2011-01-01

This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10(-7) to 10(-2) mol L(-1). The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade(-1) for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0-6.0 and 2.0-7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method.

Comparison of home fortification with two iron formulations among Kenyan children: Rationale and design of a placebo-controlled non-inferiority trial.

PubMed

Teshome, Emily M; Otieno, Walter; Terwel, Sofie R; Osoti, Victor; Demir, Ayşe Y; Andango, Pauline E A; Prentice, Andrew M; Verhoef, Hans

2017-09-01

Home fortification powders containing iron and other micronutrients have been recommended by World Health Organisation to prevent iron deficiency anaemia in areas of high prevalence. There is evidence, however, that home fortification at this iron dose may cause gastrointestinal adverse events including diarrhoea. Providing a low dose of highly absorbable iron (3 mg iron as NaFeEDTA) may be safer because the decreased amount of iron in the gut lumen can possibly reduce the burden of these adverse effects whilst resulting in similar or higher amounts of absorbed iron. To show non-inferiority of home fortification with 3 mg iron as NaFeEDTA compared with 12.5 mg iron as encapsulated ferrous fumarate, with haemoglobin response as the primary outcome. 338 Kenyan children aged 12-36 months will be randomly allocated to daily home fortification with either: a) 3 mg iron as NaFeEDTA (experimental treatment), b) 12.5 mg iron as encapsulated ferrous fumarate (reference), or c) placebo. At baseline, after 30 days of intervention and within 100 days post-intervention, blood samples will be assessed for primary outcome (haemoglobin concentration), iron status markers, Plasmodium parasitaemia and inflammation markers. Urine and stool samples will be assessed for hepcidin concentrations and inflammation, respectively. Adherence will be assessed by self-reporting, sachet counts and by an electronic monitoring device. If daily home fortification with a low dose of iron (3 mg NaFeEDTA) has similar or superior efficacy to a high dose (12.5 mg ferrous fumarate) then it would be the preferred choice for treatment of iron deficiency anaemia in children.

Potentiometric Determination of Ketotifen Fumarate in Pharmaceutical Preparations and Urine Using Carbon Paste and PVC Membrane Selective Electrodes

PubMed Central

Frag, Eman Y. Z.; Mohamed, Gehad G.; Khalil, Mohamed M.; Hwehy, Mohammad M. A.

2011-01-01

This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10−7 to 10−2 mol L−1. The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade−1 for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0–6.0 and 2.0–7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method. PMID:22013443

Differentiation of DctA and DcuS function in the DctA/DcuS sensor complex of Escherichia coli: function of DctA as an activity switch and of DcuS as the C4-dicarboxylate sensor.

PubMed

Steinmetz, Philipp Aloysius; Wörner, Sebastian; Unden, Gottfried

2014-10-01

The C4-dicarboxylate responsiveness of the sensor kinase DcuS is only provided in concert with C4-dicarboxylate transporters DctA or DcuB. The individual roles of DctA and DcuS for the function of the DctA/DcuS sensor complex were analysed. (i) Variant DctA(S380D) in the C4-dicarboxylate site of DctA conferred C4-dicarboxylate sensitivity to DcuS in the DctA/DcuS complex, but was deficient for transport and for growth on C4-dicarboxylates. Consequently transport activity of DctA is not required for its function in the sensor complex. (ii) Effectors like fumarate induced expression of DctA/DcuS-dependent reporter genes (dcuB-lacZ) and served as substrates of DctA, whereas citrate served only as an inducer of dcuB-lacZ without affecting DctA function. (iii) Induction of dcuB-lacZ by fumarate required 33-fold higher concentrations than for transport by DctA (Km  = 30 μM), demonstrating the existence of different fumarate sites for both processes. (iv) In titration experiments with increasing dctA expression levels, the effect of DctA on the C4-dicarboxylate sensitivity of DcuS was concentration dependent. The data uniformly show that C4-dicarboxylate sensing by DctA/DcuS resides in DcuS, and that DctA serves as an activity switch. Shifting of DcuS from the constitutive ON to the C4-dicarboxylate responsive state, required presence of DctA but not transport by DctA. © 2014 John Wiley & Sons Ltd.

Three transcription regulators of the Nss family mediate the adaptive response induced by nitrate, nitric oxide or nitrous oxide in Wolinella succinogenes.

PubMed

Kern, Melanie; Simon, Jörg

2016-09-01

Sensing potential nitrogen-containing respiratory substrates such as nitrate, nitrite, hydroxylamine, nitric oxide (NO) or nitrous oxide (N2 O) in the environment and subsequent upregulation of corresponding catabolic enzymes is essential for many microbial cells. The molecular mechanisms of such adaptive responses are, however, highly diverse in different species. Here, induction of periplasmic nitrate reductase (Nap), cytochrome c nitrite reductase (Nrf) and cytochrome c N2 O reductase (cNos) was investigated in cells of the Epsilonproteobacterium Wolinella succinogenes grown either by fumarate, nitrate or N2 O respiration. Furthermore, fumarate respiration in the presence of various nitrogen compounds or NO-releasing chemicals was examined. Upregulation of each of the Nap, Nrf and cNos enzyme systems was found in response to the presence of nitrate, NO-releasers or N2 O, and the cells were shown to employ three transcription regulators of the Crp-Fnr superfamily (homologues of Campylobacter jejuni NssR), designated NssA, NssB and NssC, to mediate the upregulation of Nap, Nrf and cNos. Analysis of single nss mutants revealed that NssA controls production of the Nap and Nrf systems in fumarate-grown cells, while NssB was required to induce the Nap, Nrf and cNos systems specifically in response to NO-generators. NssC was indispensable for cNos production under any tested condition. The data indicate dedicated signal transduction routes responsive to nitrate, NO and N2 O and imply the presence of an N2 O-sensing mechanism. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Tolerability of extended-release quetiapine fumarate compared with immediate-release quetiapine fumarate in older patients with Alzheimer's disease with symptoms of psychosis and/or agitation: a randomised, double-blind, parallel-group study.

PubMed

De Deyn, Peter Paul; Eriksson, Hans; Svensson, Hanna

2012-03-01

The objective of this study was to assess the safety and tolerability of extended-release quetiapine fumarate (quetiapine XR) compared with quetiapine immediate-release (quetiapine IR) in older patients with Alzheimer's disease with symptoms of psychosis and/or agitation. This was a 6-week, double-blind, double-dummy, randomised study. Of the 109 patients screened, 100 were randomised to receive quetiapine XR (n = 68) or quetiapine IR (n = 32), at doses of 50 and 25 mg/day, respectively. Treatment was escalated to 100 mg/day by Day 4. At Day 8, a flexible-dose (50-300 mg/day) period began when dose adjustment was made at the investigator's discretion. The primary variable was incidence and type of adverse events (AEs). Secondary variables included efficacy and other safety assessments. Mean daily doses were 143.6 and 142.0 mg in the quetiapine XR and quetiapine IR groups, respectively. Ninety patients completed the study; only one withdrew (in the quetiapine XR group) because of an AE. Laboratory evaluations identified severe neutropaenia (one patient), mild neutropaenia (three patients) and eosinophilia (five patients); however, these were not reported, as AEs and confounding factors, such as patient age, concomitant illness and medication, made it difficult to determine any relationship to quetiapine treatment. Numerical improvements from baseline were seen across both treatment groups in Neuropsychiatric Inventory frequency × severity total, Neuropsychiatric Inventory-Nursing Home version, Cohen-Mansfield Agitation Inventory, Clinical Global Impression-Severity of Illness and Clinical Global Impression-Improvement scores. Quetiapine XR dosed up to 300 mg/day was generally well tolerated, with a similar profile to that of quetiapine IR. Copyright © 2011 John Wiley & Sons, Ltd.

Dimethyl Fumarate Selectively Reduces Memory T Cells and Shifts the Balance between Th1/Th17 and Th2 in Multiple Sclerosis Patients.

PubMed

Wu, Qi; Wang, Qin; Mao, Guangmei; Dowling, Catherine A; Lundy, Steven K; Mao-Draayer, Yang

2017-04-15

Dimethyl fumarate (DMF; trade name Tecfidera) is an oral formulation of the fumaric acid ester that is Food and Drug Administration approved for treatment of relapsing-remitting multiple sclerosis. To better understand the therapeutic effects of Tecfidera and its rare side effect of progressive multifocal leukoencephalopathy, we conducted cross-sectional and longitudinal studies by immunophenotyping cells from peripheral blood (particularly T lymphocytes) derived from untreated and 4-6 and 18-26 mo Tecfidera-treated stable relapsing-remitting multiple sclerosis patients using multiparametric flow cytometry. The absolute numbers of CD4 and CD8 T cells were significantly decreased and the CD4/CD8 ratio was increased with DMF treatment. The proportions of both effector memory T cells and central memory T cells were reduced, whereas naive T cells increased in treated patients. T cell activation was reduced with DMF treatment, especially among effector memory T cells and effector memory RA T cells. Th subsets Th1 (CXCR3 + ), Th17 (CCR6 + ), and particularly those expressing both CXCR3 and CD161 were reduced most significantly, whereas the anti-inflammatory Th2 subset (CCR3 + ) was increased after DMF treatment. A corresponding increase in IL-4 and decrease in IFN-γ and IL-17-expressing CD4 + T cells were observed in DMF-treated patients. DMF in vitro treatment also led to increased T cell apoptosis and decreased activation, proliferation, reactive oxygen species, and CCR7 expression. Our results suggest that DMF acts on specific memory and effector T cell subsets by limiting their survival, proliferation, activation, and cytokine production. Monitoring these subsets could help to evaluate the efficacy and safety of DMF treatment. Copyright © 2017 by The American Association of Immunologists, Inc.

Dimethyl Fumarate Inhibits the Nuclear Factor κB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein.

PubMed

Kastrati, Irida; Siklos, Marton I; Calderon-Gierszal, Esther L; El-Shennawy, Lamiaa; Georgieva, Gergana; Thayer, Emily N; Thatcher, Gregory R J; Frasor, Jonna

2016-02-12

In breast tumors, activation of the nuclear factor κB (NFκB) pathway promotes survival, migration, invasion, angiogenesis, stem cell-like properties, and resistance to therapy--all phenotypes of aggressive disease where therapy options remain limited. Adding an anti-inflammatory/anti-NFκB agent to breast cancer treatment would be beneficial, but no such drug is approved as either a monotherapy or adjuvant therapy. To address this need, we examined whether dimethyl fumarate (DMF), an anti-inflammatory drug already in clinical use for multiple sclerosis, can inhibit the NFκB pathway. We found that DMF effectively blocks NFκB activity in multiple breast cancer cell lines and abrogates NFκB-dependent mammosphere formation, indicating that DMF has anti-cancer stem cell properties. In addition, DMF inhibits cell proliferation and significantly impairs xenograft tumor growth. Mechanistically, DMF prevents p65 nuclear translocation and attenuates its DNA binding activity but has no effect on upstream proteins in the NFκB pathway. Dimethyl succinate, the inactive analog of DMF that lacks the electrophilic double bond of fumarate, is unable to inhibit NFκB activity. Also, the cell-permeable thiol N-acetyl l-cysteine, reverses DMF inhibition of the NFκB pathway, supporting the notion that the electrophile, DMF, acts via covalent modification. To determine whether DMF interacts directly with p65, we synthesized and used a novel chemical probe of DMF by incorporating an alkyne functionality and found that DMF covalently modifies p65, with cysteine 38 being essential for the activity of DMF. These results establish DMF as an NFκB inhibitor with anti-tumor activity that may add therapeutic value in the treatment of aggressive breast cancers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

In vivo and in vitro effects of multiple sclerosis immunomodulatory therapeutics on glutamatergic excitotoxicity.

PubMed

Luchtman, Dirk; Gollan, René; Ellwardt, Erik; Birkenstock, Jérôme; Robohm, Kerstin; Siffrin, Volker; Zipp, Frauke

2016-03-01

In multiple sclerosis (MS), a candidate downstream mechanism for neuronal injury is glutamate (Glu)-induced excitotoxicity, leading to toxic increases in intraneuronal Ca(2+) . Here, we used in vivo two-photon imaging in the brain of TN-XXL transgenic Ca(2+) reporter mice to test whether promising oral MS therapeutics, namely fingolimod, dimethyl fumarate, and their respective metabolites fingolimod-phosphate and monomethyl fumarate, can protect neurons against acute glutamatergic excitotoxic damage. We also assessed whether these drugs can protect against excitotoxicity in vitro using primary cortical neurons, and whether they can directly inhibit Glu release from pathogenic T-helper 17 lymphocytes. In vivo, direct and acute (1 h) administration of 100 mM Glu to the brainstem resulted in a rapid and significant up-regulation in neuronal Ca(2+) signaling as well as morphological excitotoxic changes that were attenuated by the NMDA-receptor antagonist MK801. Direct CNS administration of MS drugs prior to Glu significantly delayed or reduced, but did not prevent the neuronal Ca(2+) increase or morphological changes. In vitro, prolonged (24 h) treatment of primary neurons with the fumarates significantly protected against neurotoxicity induced by Glu as well as NMDA, similar to MK801. Furthermore, monomethyl fumerate significantly reduced Glu release from pathogenic T-helper 17 lymphocytes. Overall, these data suggest that MS drugs may mediate neuroprotection via excitotoxicity modulating effects. Evidence suggests MS pathogenesis may involve neuronal excitotoxicity, induced by local release of glutamate. However, current MS drugs, including dimethyl fumerate (DMF) and fingolimod (FTY720) are largely anti-inflammatory and not yet fully tested for their neuroprotective potential. Here, we show that the drugs, in particular DMF metabolite monomethyl fumerate (MMF), protect neurons by excitotoxicity modulating effects. Th17, T-helper 17. © 2015 International Society for Neurochemistry.

The preparation and evaluation of salt forms of linogliride with reduced solubilities as candidates for extended release.

PubMed

Chrzanowski, Frank A; Ahmad, Kaleem

2017-03-01

Salts of linogliride with reduced solubilities were prepared and evaluated as potential candidates for extended-release oral dosage forms. A once-daily dose of 300-800 mg was intended. Seven acids were selected: p-acetamidobenzoic, benzoic, p-hydroxybenzoic, 3-hydroxy-2-naphthoic, 1-napsylic, pamoic, and p-toluenesulfonic acids but only four salts were able to be prepared in suitable quantities for evaluation: linogliride pamoate, p-hydroxybenzoate, 3-hydroxy-2-naphthoate, and 1-napsylate. The pH-solubility profiles of the four new salts, free base, and fumarate salt were compared over the pH 1.43-8.3 range and the intrinsic dissolution rates of the four new salts and the free base were determined at pH 1.43, 4.4, and 7.5. The range of the pH-solubility profile and intrinsic dissolution rates of the p-hydroxybenzoate salt were less than the free base and fumarate and higher than the other three new salts. The pH-solubilities and intrinsic dissolution rates of the 1-napsylate salt were pH-independent. The solubilities and intrinsic dissolution rates of the pamoate and 3-hydroxy-2-naphthoate were higher at pH 1.4-3.4 than at higher pH. At pH 4.4 and higher, the solubilities were essentially the same, in the 1-2 mg/mL range. The intrinsic dissolution rates were also very low and not very different. Dissolution studies with capsules containing 800 mg doses of the pamoate, 1-napsylate, free base, and fumarate performed in a dissolution medium of pH beginning at 2.2 and ending at 6.8 demonstrated that the pamoate and 1-napsylate salt forms dissolved slower and could be useful as extended-release forms.

Effects of delayed-release dimethyl fumarate on MRI measures in the phase 3 CONFIRM study.

PubMed

Miller, David H; Fox, Robert J; Phillips, J Theodore; Hutchinson, Michael; Havrdova, Eva; Kita, Mariko; Wheeler-Kingshott, Claudia A M; Tozer, Daniel J; MacManus, David G; Yousry, Tarek A; Goodsell, Mary; Yang, Minhua; Zhang, Ray; Viglietta, Vissia; Dawson, Katherine T

2015-03-17

To evaluate the effects of oral delayed-release dimethyl fumarate (DMF; also known as gastro-resistant DMF) on MRI lesion activity and load, atrophy, and magnetization transfer ratio (MTR) measures from the Comparator and an Oral Fumarate in Relapsing-Remitting Multiple Sclerosis (CONFIRM) study. CONFIRM was a 2-year, placebo-controlled study of the efficacy and safety of DMF 240 mg twice (BID) or 3 times daily (TID) in 1,417 patients with relapsing-remitting multiple sclerosis (RRMS); subcutaneous glatiramer acetate 20 mg once daily was included as an active reference comparator. The number and volume of T2-hyperintense, T1-hypointense, and gadolinium-enhancing (Gd+) lesions, as well as whole brain volume and MTR, were assessed in 681 patients (MRI cohort). DMF BID and TID produced significant and consistent reductions vs placebo in the number of new or enlarging T2-hyperintense lesions and new nonenhancing T1-hypointense lesions after 1 and 2 years of treatment and in the number of Gd+ lesions at week 24, year 1, and year 2. Lesion volumes were also significantly reduced. Reductions in brain atrophy and MTR changes with DMF relative to placebo did not reach statistical significance. The robust effects on MRI active lesion counts and total lesion volume in patients with RRMS demonstrate the ability of DMF to exert beneficial effects on inflammatory lesion activity in multiple sclerosis, and support DMF therapy as a valuable new treatment option in RRMS. This study provides Class I evidence of reduction in brain lesion number and volume, as assessed by MRI, over 2 years of delayed-release DMF treatment. © 2015 American Academy of Neurology.

Hacia el consumo informado de tabaco en México: efecto de las advertencias con pictogramas en población fumadora

PubMed Central

Thrasher, James F; Pérez-Hernández, Rosaura; Arillo-Santillán, Edna; Barrientos-Gutiérrez, Inti

2015-01-01

Resumen Objetivo Evaluar el efecto de las advertencias sanitarias (AS) con pictogramas en las cajetillas de tabaco en adultos fumadores. Material y métodos Cohorte de fumadores con representatividad poblacional de siete ciudades mexi canas, antes (2010) y después (2011) de la implementación de AS con pictogramas (ASP). Para determinar el cambio en las variables sobre el impacto cognitivo y conductual de las advertencias, se estimaron modelos bivariados y ajustados de ecuaciones de estimación generalizada. En el Segundo levantamiento (2011), se estimaron modelos para determiner los factores que se asocian con el reporte de recordar cada advertencia que había entrado al mercado, además de los factores asociados con el autorreporte del impacto de cada advertencia vigente. Resultados Se observaron incrementos importantes de 2010 a 2011 en los conocimientos sobre los riesgos de fumar, los componentes tóxicos del tabaco y el número telefónico para recibir consejos sobre dejar de fumar. La recordación e impacto de las primeras advertencias con pictogramas parecen ser amplios y equitativos a través de la población fumadora. En comparación con 2010, un mayor nivel de ex fumadores entrevistados en 2011 reportaron que las advertencias habían influido mucho en dejar de fumar (RM=2.44, 95% IC 1.27–4.72). Conclusiones Las AS con pictogramas han logrado un impacto importante en el conocimiento y conducta, información relevante para la población y en tomadores de decisiones. PMID:22689162

Gateways to clinical trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2005-04-01

Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity. prous.com. This issue focuses on the following selection of drugs: ABX-IL-8, Acclaim, adalimumab, AGI-1067, alagebrium chloride, alemtuzumab, Alequel, Androgel, anti-IL-12 MAb, AOD-9604, aripiprazole, atomoxetine hydrochloride; Biphasic insulin aspart, bosentan, botulinum toxin type B, bovine lactoferrin, brivudine; Cantuzumab mertansine, CB-1954, CDB-4124, CEA-TRICOM, choriogonadotropin alfa, cilansetron, CpG-10101, CpG-7909, CTL-102, CTL-102/CB-1954; DAC:GRF, darbepoetin alfa, davanat-1, decitabine, del-1 Genemedicine, dexanabinol, dextofisopam, dnaJP1, dronedarone hydrochloride, dutasteride; Ecogramostim, eletriptan, emtricitabine, EPI-hNE-4, eplerenone, eplivanserin fumarate, erlotinib hydrochloride, ertapenem sodium, escitalopram oxalate, esomeprazole magnesium, etoricoxib, ezetimibe; Falecalcitriol, fingolimod hydrochloride; Gepirone hydrochloride; HBV-ISS, HSV-2 theracine, human insulin; Imatinib mesylate, Indiplon, insulin glargine, ISAtx-247; L612 HuMAb, levodopa/carbidopa/entacapone, lidocaine/prilocaine, LL-2113AD, lucinactant, LY-156735; Meclinertant, metelimumab, morphine hydrochloride, morphine-6-glucuronide; Natalizumab, nimotuzumab, NX-1207, NYVAC-HIV C; Omalizumab, onercept, osanetant; PABA, palosuran sulfate, parathyroid hormone (human recombinant), parecoxib sodium, PBI-1402, PCK-3145, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pemetrexed disodium, pimecrolimus, PINC, pregabalin; Ramelteon, rasagiline mesilate, rasburicase, rimonabant hydrochloride, RO-0098557, rofecoxib, rosiglitazone maleate/metformin hydrochloride; Safinamide mesilate, SHL-749, sitaxsentan sodium, sparfosic acid, SprayGel, squalamine, St. John's Wort extract, synthetic human secretin; Taxus, telavancin hydrochloride, telithromycin, temoporfin, tenofovir disoproxil fumarate, tenofovir disoproxil fumarate/emtricitabine, teriparatide, testosterone gel, TG-1024, tirapazamine, travoprost, travoprost/timolol; Valdecoxib, valganciclovir hydrochloride, voriconazole; Ximelagatran.

Bioeconomy Initiative at MBI International

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kleff, Susanne, Ph.D.

Di-carboxylic acids have the potential to replace petrochemicals used in the polymer industry (Werpy and Petersen, 2004). MBI developed a process for the production of succinic acid using a proprietary organism. During this work MBI assessed the feasibility to produce other carboxylic acids either using A. succinogenes or other organisms. The development of recombinant A. succinogenes strain derivatives for a mono-carboxylic acid through over-expression of enzymatic activities was successful. Fermentations achieved titers of 58 g/L for this organic acid. Recombinant strains that produced the same acid, but a different stereoisomer, reached titers of 10 g/L. Attempts to increase the titersmore » for this isomer as well as other organic acids were unsuccessful. MBI is looking for commercial partners to pursue the development of recombinant A. succinogenes strains for the production of other organic acids. Attempts to develop recombinant strains of A. succinogenes for fumaric acid production through introduction of various antisense RNA constructs were unsuccessful. Alternative suitable organisms were evaluated and Rhizopus oryzae, a natural fumaric acid producer with potential for process improvements, was selected. A novel fermentation and one-step recovery process was developed that allowed capture of IP, produced titers of >80 g/L with a productivity of 1.8 g/L-h and 57% (g/g glucose) yield. The process was scaled to 2000 L pilot scale. The economic analysis projected a production cost of 72 c/lb. Recycling and re-use of the base was demonstrated and incorporated into the process. The ability of the organism to produce fumaric acid from other carbon sources and biomass hydrolysate was demonstrated. The production of other organic acids was evaluated and techno-economic de-risking roadmap documents were prepared.« less

Monitoring TCE Degradation by In-situ Bioremediation in TCE-Contaminated site

NASA Astrophysics Data System (ADS)

Han, K.; Hong, U.; Ahn, G.; Jiang, H.; Yoo, H.; Park, S.; Kim, N.; Ahn, H.; Kwon, S.; Kim, Y.

2012-12-01

Trichloroethylene (TCE) is a long-term common groundwater pollutant because the compound with high density is slowly released into groundwater. Physical and chemical remediation processes have been used to clean-up the contaminant, but novel remediation technology is required to overcome a low efficiency of the traditional treatment process. Many researchers focused on biological process using an anaerobic TCE degrading culture, but it still needs to evaluate whether the process can be applied into field scale under aerobic condition. Therefore, in this work we investigated two different tests (i.e., biostimulation and bioaugmentation) of biological remediation through the Well-to-Well test (injection well to extraction well) in TCE-contaminated site. Also solutions (Electron donor & acceptor, tracer) were injected into the aquifer using a liquid coupled with nitrogen gas sparging. In biostimulation, we use 3 phases to monitoring biological remediation. Phase 1: we inject formate solution to get electron donor hydrogen (hydrogen can be generated from fermentation of formate). We also inject bromide as tracer. Phase 2: we made injection solution by formate, bromide and sulfate. The reason why we inject sulfate is that as a kind of electron accepter, sulfate reduction process is helpful to create anaerobic condition. Phase 3: we inject mixed solution made by formate, sulfate, fumarate, and bromide. The degradation of fumarate has the same mechanism and condition with TCE degradation, so we added fumarate to make sure that if the anaerobic TCE degradation by indigenous microorganisms started up (Because low TCE concentration by gas sparging). In the bioaugmentation test, we inject the Evanite culture (containing dehalococcoides spp) and TCE degradation to c-DCE, VC, ETH was monitored. We are evaluating the transport of the Evanite culture in the field by measuring TCE and VC reductases.

Ligament Tissue Engineering Using a Novel Porous Polycaprolactone Fumarate Scaffold and Adipose Tissue-Derived Mesenchymal Stem Cells Grown in Platelet Lysate

PubMed Central

Wagner, Eric R.; Bravo, Dalibel; Dadsetan, Mahrokh; Riester, Scott M.; Chase, Steven; Westendorf, Jennifer J.; Dietz, Allan B.; van Wijnen, Andre J.; Yaszemski, Michael J.

2015-01-01

Purpose: Surgical reconstruction of intra-articular ligament injuries is hampered by the poor regenerative potential of the tissue. We hypothesized that a novel composite polymer “neoligament” seeded with progenitor cells and growth factors would be effective in regenerating native ligamentous tissue. Methods: We synthesized a fumarate-derivative of polycaprolactone fumarate (PCLF) to create macro-porous scaffolds to allow cell–cell communication and nutrient flow. Clinical grade human adipose tissue-derived human mesenchymal stem cells (AMSCs) were cultured in 5% human platelet lysate (PL) and seeded on scaffolds using a dynamic bioreactor. Cell growth, viability, and differentiation were examined using metabolic assays and immunostaining for ligament-related markers (e.g., glycosaminoglycans [GAGs], alkaline phosphatase [ALP], collagens, and tenascin-C). Results: AMSCs seeded on three-dimensional (3D) PCLF scaffolds remain viable for at least 2 weeks with proliferating cells filling the pores. AMSC proliferation rates increased in PL compared to fetal bovine serum (FBS) (p < 0.05). Cells had a low baseline expression of ALP and GAG, but increased expression of total collagen when induced by the ligament and tenogenic growth factor fibroblast growth factor 2 (FGF-2), especially when cultured in the presence of PL (p < 0.01) instead of FBS (p < 0.05). FGF-2 and PL also significantly increased immunostaining of tenascin-C and collagen at 2 and 4 weeks compared with human fibroblasts. Summary: Our results demonstrate that AMSCs proliferate and eventually produce a collagen-rich extracellular matrix on porous PCLF scaffolds. This novel scaffold has potential in stem cell engineering and ligament regeneration. PMID:26413793

Microbiologically Influenced Corrosion: an Update

DTIC Science & Technology

2014-01-01

with simulated YM waters stressed the importance of nitrate in groundwater as an inhibitor for localised corrosion.63 Little59 reviewed the data and...8 In the absence of sulphate, many SRB ferment organic acids and alcohols. Some SRB can reduce nitrate, sulphite, thiosul- phate or fumarate, in

Growth of Campylobacter Incubated Aerobically in Media Supplemented with Peptones

USDA-ARS?s Scientific Manuscript database

Growth of Campylobacter cultures incubated aerobically in media supplemented with peptones was studied, and additional experiments were conducted to compare growth of the bacteria in media supplemented with peptones to growth in media supplemented with fumarate-pyruvate-minerals-vitamins (FPMV). A b...

Aclidinium bromide plus formoterol for the treatment of chronic obstructive pulmonary disease.

PubMed

Lal, Chitra; Strange, Charlie

2015-02-01

Drugs that target dynamic hyperinflation such as long-acting β-2 agonists and long-acting antimuscarinic antagonists form a cornerstone of chronic obstructive pulmonary disease (COPD) management. The idea of combining these two medications in a single formulation, which may potentially improve patient compliance, is novel and attractive. The pharmacologic profiles of aclidinium bromide and formoterol fumarate are discussed. However, studies to define drug interactions and alterations in the pharmacodynamics and pharmacokinetics of the fixed dose combination (FDC) of aclidinium bromide/formoterol fumarate in large populations remain unpublished. Results of Phase II and two Phase III pivotal trials, ACLIFORM/COPD and AUGMENT COPD, evaluating the FDC are discussed. Initial data for the aclidinium/formoterol inhaler appears to be promising for impacting the lung function. To define if this benefit translates into improved long-term outcomes of decreased exacerbation frequency, improved quality of life and decreased disease-specific mortality are important. The introduction of this combination will likely have a significant impact on the prescribing habits of physicians across the world.

Continuous Digital Light Processing (cDLP): Highly Accurate Additive Manufacturing of Tissue Engineered Bone Scaffolds.

PubMed

Dean, David; Jonathan, Wallace; Siblani, Ali; Wang, Martha O; Kim, Kyobum; Mikos, Antonios G; Fisher, John P

2012-03-01

Highly accurate rendering of the external and internal geometry of bone tissue engineering scaffolds effects fit at the defect site, loading of internal pore spaces with cells, bioreactor-delivered nutrient and growth factor circulation, and scaffold resorption. It may be necessary to render resorbable polymer scaffolds with 50 μm or less accuracy to achieve these goals. This level of accuracy is available using Continuous Digital Light processing (cDLP) which utilizes a DLP(®) (Texas Instruments, Dallas, TX) chip. One such additive manufacturing device is the envisionTEC (Ferndale, MI) Perfactory(®). To use cDLP we integrate a photo-crosslinkable polymer, a photo-initiator, and a biocompatible dye. The dye attenuates light, thereby limiting the depth of polymerization. In this study we fabricated scaffolds using the well-studied resorbable polymer, poly(propylene fumarate) (PPF), titanium dioxide (TiO(2)) as a dye, Irgacure(®) 819 (BASF [Ciba], Florham Park, NJ) as an initiator, and diethyl fumarate as a solvent to control viscosity.

Sino-implant (II)® continuation and effect of concomitant tenofovir disoproxil fumarate-emtricitabine use on plasma levonorgestrel concentrations among women in Bondo, Kenya.

PubMed

Todd, Catherine S; Deese, Jennifer; Wang, Meng; Hubacher, David; Steiner, Markus J; Otunga, Sheila; Van Damme, Lut

2015-03-01

The objective was to assess associations between tenofovir disoproxil fumarate-emtricitabine (TDF-FTC) exposure and levonorgestrel (LNG) concentrations among Kenyan HIV prevention trial participants using Sino-implant (II) LNG implants for contraception. Women were offered implants among other contraceptive methods, were randomized to daily TDF-FTC or placebo, and followed monthly up to 56weeks. Associations between TDF-FTC exposure and mean LNG values were analyzed with linear mixed models. Of 739 women, 29 (3.9%) received implants with no incident pregnancies and one discontinuation. Mean LNG concentrations over 56weeks among 28 women contributing data ranged between 214.0 and 659.8pg/mL with no significant difference between TDF-FTC and placebo arms or between variable levels of TDF-FTC adherence. Concomitant TDF-FTC use was not associated with a significant change in plasma LNG concentrations among women using Sino-implant (II) in the first year of use. Copyright © 2015 Elsevier Inc. All rights reserved.

Limits in Proton Nuclear Singlet-State Lifetimes Measured with para-Hydrogen-Induced Polarization.

PubMed

Zhang, Yuning; Duan, Xueyou; Soon, Pei Che; Sychrovský, Vladimír; Canary, James W; Jerschow, Alexej

2016-10-05

The synthesis of a hyperpolarized molecule was developed, where the polarization and the singlet state were preserved over two controlled chemical steps. Nuclear singlet-state lifetimes close to 6 min for protons are reported in dimethyl fumarate. Owing to the high symmetry (AA'X 3 X 3 ' and A 2 systems), the singlet-state readout requires either a chemical desymmetrization or a long and repeated spin lock. Using DFT calculations and relaxation models, we further determine nuclear spin singlet lifetime limiting factors, which include the intramolecular dipolar coupling mechanism (proton-proton and proton-deuterium), the chemical shift anisotropy mechanism (symmetric and antisymmetric), and the intermolecular dipolar coupling mechanism (to oxygen and deuterium). If the limit of paramagnetic relaxation caused by residual oxygen could be lifted, the intramolecular dipolar coupling to deuterium would become the limiting relaxation mechanism and proton lifetimes upwards of 26 min could become available in the molecules considered here (dimethyl maleate and dimethyl fumarate). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dimethyl fumarate contact dermatitis of the foot: an increasingly widespread disease.

PubMed

D'Erme, Angelo Massimiliano; Bassi, Andrea; Lotti, Torello; Gola, Massimo

2012-01-01

Dimethyl fumarate (DMF) has been recognized as an extremely potent irritant and sensitizer found in sachets inside furniture. The first skin manifestations were correlated to contact with sofas, chairs, and other furniture. In these last years, some papers have reported a development of allergic contact dermatitis on the foot caused by DMF present in high concentration in shoes made in China. We report the case of a 37-year-old woman who presented with severe eczema on the foot shortly after having bought a new pair of shoes. The diagnosis was performed by patch tests with DMF in several dilutions, with pieces of internal and external parts of the shoes, and by chemical analysis of the shoes. In the last three years, goods containing DMF increased diffusely despite the augmentation on global preventive measures by Europe. Therefore, new cases of contact dermatitis could be dependent on DMF, and it is of note that this allergen is not included in most series for patch testing. © 2011 The International Society of Dermatology.

Crystal structure of an Fe-S cluster-containing fumarate hydratase enzyme from Leishmania major reveals a unique protein fold.

PubMed

Feliciano, Patricia R; Drennan, Catherine L; Nonato, M Cristina

2016-08-30

Fumarate hydratases (FHs) are essential metabolic enzymes grouped into two classes. Here, we present the crystal structure of a class I FH, the cytosolic FH from Leishmania major, which reveals a previously undiscovered protein fold that coordinates a catalytically essential [4Fe-4S] cluster. Our 2.05 Å resolution data further reveal a dimeric architecture for this FH that resembles a heart, with each lobe comprised of two domains that are arranged around the active site. Besides the active site, where the substrate S-malate is bound bidentate to the unique iron of the [4Fe-4S] cluster, other binding pockets are found near the dimeric enzyme interface, some of which are occupied by malonate, shown here to be a weak inhibitor of this enzyme. Taken together, these data provide a framework both for investigations of the class I FH catalytic mechanism and for drug design aimed at fighting neglected tropical diseases.

Effect of Chemical and Physical Properties on the In Vitro Degradation of 3D Printed High Resolution Poly(propylene fumarate) Scaffolds.

PubMed

Walker, Jason M; Bodamer, Emily; Krebs, Olivia; Luo, Yuanyuan; Kleinfehn, Alex; Becker, Matthew L; Dean, David

2017-04-10

Two distinct molecular masses of poly(propylene fumarate) (PPF) are combined with an additive manufacturing process to fabricate highly complex scaffolds possessing controlled chemical properties and porous architecture. Scaffolds were manufactured with two polymer molecular masses and two architecture styles. Degradation was assessed in an accelerated in vitro environment. The purpose of the degradation study is not to model or mimic in vivo degradation, but to efficiently compare the effect of modulating scaffold properties. This is the first study addressing degradation of chain-growth synthesized PPF, a process that allows for considerably more control over molecular mass distribution. It demonstrates that, with greater process control, not only is scaffold fabrication reproducible, but the mechanical properties and degradation kinetics can be tailored by altering the physical properties of the scaffold. This is a clear step forward in using PPF to address unmet medical needs while meeting regulatory demands and ultimately obtaining clinical relevancy.

Does menaquinone participate in brain astrocyte electron transport?

PubMed

Lovern, Douglas; Marbois, Beth

2013-10-01

Quinone compounds act as membrane resident carriers of electrons between components of the electron transport chain in the periplasmic space of prokaryotes and in the mitochondria of eukaryotes. Vitamin K is a quinone compound in the human body in a storage form as menaquinone (MK); distribution includes regulated amounts in mitochondrial membranes. The human brain, which has low amounts of typical vitamin K dependent function (e.g., gamma carboxylase) has relatively high levels of MK, and different regions of brain have different amounts. Coenzyme Q (Q), is a quinone synthesized de novo, and the levels of synthesis decline with age. The levels of MK are dependent on dietary intake and generally increase with age. MK has a characterized role in the transfer of electrons to fumarate in prokaryotes. A newly recognized fumarate cycle has been identified in brain astrocytes. The MK precursor menadione has been shown to donate electrons directly to mitochondrial complex III. Vitamin K compounds function in the electron transport chain of human brain astrocytes. Copyright © 2013 Elsevier Ltd. All rights reserved.

Metabolic behavior and enzymatic aspects of denitrifying EBPR sludge in a continuous-flow anaerobic-anoxic system.

PubMed

Zafiriadis, Ilias; Ntougias, Spyridon; Kapagiannidis, Anastasios G; Aivasidis, Alexander

2013-10-01

The metabolic aspects of enhanced biological phosphorus removal (EBPR) were investigated for the first time in a continuous-flow anaerobic-anoxic plant fed with acetate, propionate, or substrates which are involved in the tricarboxylic acid and/or glyoxylate cycle, i.e., fumarate, malate, or oxaloacetate, as the sole carbon source. Although the polyphosphate-accumulating organisms (PAOs) population remained stable with any carbon source examined, no typical EBPR metabolism was observed during fumarate, malate, or oxaloacetate utilization. Specific enzymatic activities related to EBPR were determined in activated sludge homogenates and directly correlated with the nutrient metabolic rates. The experimental results indicated the direct involvement of alkaline phosphatase, pyrophosphatase, and exopolyphosphatase in the denitrifying EBPR process. Metabolic aspects of glyoxylate cycle enzymes are discussed with regard to the biomass anaerobic and anoxic activity. Process performance was highly influenced by the kind of substrate utilized, indicating that specific metabolic pathways should be followed to favor efficient EBPR.

Media for the aerobic growth of campylobacter

USDA-ARS?s Scientific Manuscript database

The effect of agar and sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in a fumarate-pyruvate medium was examined. The broth medium was supplemented with 0.0 to 0.2% agar and inoculated with 106 CFU/ml of Campylobacter coli 33559, Campylobacter fetus 27349, Campylobacter...

Enhancing Aerobic Growth of Campylobacter in Media Supplemented with Organic Acids

USDA-ARS?s Scientific Manuscript database

The effect of agar and sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in was determined. A fumarate-pyruvate medium was supplemented with 0.0 to 0.2% agar and inoculated with Campylobacter coli, Campylobacter fetus, or Campylobacter jejuni. Portions of the inoculated me...

21 CFR 177.1520 - Olefin polymers.

Code of Federal Regulations, 2011 CFR

2011-04-01

... by reaction with fumaric acid in the absence of free radical initiators. Such polymers shall contain... acid in the absence of free radical initiators. Such polymers shall contain not more than 4.5 percent... tube for preheated, oxygen-free nitrogen, and an outlet tube located 1 inch off center. Nitrogen is fed...

21 CFR 177.1520 - Olefin polymers.

Code of Federal Regulations, 2010 CFR

2010-04-01

... by reaction with fumaric acid in the absence of free radical initiators. Such polymers shall contain... acid in the absence of free radical initiators. Such polymers shall contain not more than 4.5 percent... tube for preheated, oxygen-free nitrogen, and an outlet tube located 1 inch off center. Nitrogen is fed...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2011 CFR

2011-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2012 CFR

2012-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2014 CFR

2014-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2013 CFR

2013-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

Two Crystallographic Laboratory and Computational Exercises for Undergraduates.

ERIC Educational Resources Information Center

Lessinger, Leslie

1988-01-01

Describes two introductory exercises designed to teach the fundamental ideas and methods of crystallography, and to convey some important features of inorganic and organic crystal structures to students in an advanced laboratory course. Exercises include "The Crystal Structure of NiO" and "The Crystal Structure of Beta-Fumaric Acid." (CW)

21 CFR 522.84 - Beta-aminopropionitrile fumarate.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.... Do not use in horses with dermal irritation or open skin lesions in the injection area. Do not...

21 CFR 522.84 - Beta-aminopropionitrile fumarate.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.... Do not use in horses with dermal irritation or open skin lesions in the injection area. Do not...

21 CFR 522.84 - Beta-aminopropionitrile fumarate.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.... Do not use in horses with dermal irritation or open skin lesions in the injection area. Do not...

Real-World Adherence and Persistence to Oral Disease-Modifying Therapies in Multiple Sclerosis Patients Over 1 Year.

PubMed

Johnson, Kristen M; Zhou, Huanxue; Lin, Feng; Ko, John J; Herrera, Vivian

2017-08-01

Disease-modifying therapies (DMTs) are indicated to reduce relapse rates and slow disease progression for relapsing-remitting multiple sclerosis (MS) patients when taken as prescribed. Nonadherence or non-persistence in the real-world setting can lead to greater risk for negative clinical outcomes. Although previous research has demonstrated greater adherence and persistence to oral DMTs compared with injectable DMTs, comparisons among oral DMTs are lacking. To compare adherence, persistence, and time to discontinuation among MS patients newly prescribed the oral DMTs fingolimod, dimethyl fumarate, or teriflunomide. This retrospective study used MarketScan Commercial and Medicare Supplemental claims databases. MS patients with ≥ 1 claim for specified DMTs from April 1, 2013, to June 30, 2013, were identified. The index drug was defined as the first oral DMT within this period. To capture patients newly initiating index DMTs, patients could not have a claim for their index drugs in the previous 12 months. Baseline characteristics were described for patients in each treatment cohort. Adherence, as measured by medication possession ratio (MPR) and proportion of days covered (PDC); persistence (30-day gap allowed); and time to discontinuation over a 12-month follow-up period were compared across treatment cohorts. Adjusted logistic regression models were used to examine adherence, and Cox regression models estimated risk of discontinuation. 1,498 patients newly initiated oral DMTs and met study inclusion criteria: fingolimod (n = 185), dimethyl fumarate (n = 1,160), and teriflunomide (n = 143). Patients were similar across most baseline characteristics, including region, relapse history, and health care resource utilization. Statistically significant differences were observed across the treatment cohorts for age, gender, previous injectable/infused DMT use, and comorbidities. Adherence and time to discontinuation were adjusted for age, gender, region, previous oral and injectable/infused DMT use, relapse history, and Charlson Comorbidity Index score. Relative to fingolimod patients, dimethyl fumarate and teriflunomide patients were significantly less likely to have an MPR ≥ 80% (OR = 0.18; 95% CI = 0.09-0.36; P < 0.001 and OR = 0.19; 95% CI = 0.08-0.42; P < 0.001, respectively). Similarly, relative to fingolimod patients, dimethyl fumarate and teriflunomide patients were significantly less likely to have PDC ≥ 80% (OR = 0.47; 95% CI = 0.33-0.67; P < 0.001 and OR = 0.37; 95% CI = 0.23-0.59; P < 0.001, respectively). Additionally, the HR for discontinuation was about 2 times greater for dimethyl fumarate (HR = 1.93; 95% CI = 1.44-2.59; P < 0.001) and teriflunomide patients (HR = 2.27; 95% CI = 1.57-3.28; P < 0.001) compared with fingolimod. In a real-world setting, patients taking fingolimod had better adherence and persistence compared with patients taking other oral DMTs over 12 months. Coupled with clinical factors, medication adherence and persistence should be important considerations when determining coverage decisions for MS patients. This research was funded by Novartis Pharmaceuticals. Johnson, Lin, Ko, and Herrera are employed by Novartis Pharmaceuticals and own Novartis stock. Huanxue Zhou is employed by KMK Consulting, which provides consulting services to Novartis. Study concept and design were contributed by Johnson, Lin, Ko, and Herrera. Zhou collected the data, and data interpretation was performed by Johnson, Lin, Ko, and Herrera. All authors were involved in manuscript revision. The abstract for this study was presented at the AMCP Nexus 2015; October 26-29, 2015; Orlando, Florida.

Determination of the structure and catalytic mechanism of sorghum bicolor caffeoyl-CoA O-methyltransferase

USDA-ARS?s Scientific Manuscript database

Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the c...

21 CFR 184.1307d - Ferrous fumarate.

Code of Federal Regulations, 2012 CFR

2012-04-01

... National Academy Press, 2101 Constitution Ave NW., Washington, DC 20418, or available for inspection at the... at NARA, call 202-741-6030, or go to: http://www.archives.gov/federal_register/code_of_federal... section 412(g) of the Federal Food, Drug, and Cosmetic Act (the act) (21 U.S.C. 350a(g)), or with...

21 CFR 184.1307d - Ferrous fumarate.

Code of Federal Regulations, 2013 CFR

2013-04-01

... National Academy Press, 2101 Constitution Ave NW., Washington, DC 20418, or available for inspection at the... at NARA, call 202-741-6030, or go to: http://www.archives.gov/federal_register/code_of_federal... section 412(g) of the Federal Food, Drug, and Cosmetic Act (the act) (21 U.S.C. 350a(g)), or with...

21 CFR 522.82 - Aminopropazine fumarate sterile solution injection.

Code of Federal Regulations, 2012 CFR

2012-04-01

... equivalent to 25 milligrams of aminopropazine base. (b) Sponsor. See No. 000061 in § 510.600(c) of this chapter. (c) Conditions of use. (1) The drug is used for reducing excessive smooth muscle contractions, such as occur in urethral spasms associated with urolithiasis in cats and dogs and in colic spasms in...

21 CFR 522.82 - Aminopropazine fumarate sterile solution injection.

Code of Federal Regulations, 2013 CFR

2013-04-01

... equivalent to 25 milligrams of aminopropazine base. (b) Sponsor. See No. 000061 in § 510.600(c) of this chapter. (c) Conditions of use. (1) The drug is used for reducing excessive smooth muscle contractions, such as occur in urethral spasms associated with urolithiasis in cats and dogs and in colic spasms in...

21 CFR 522.82 - Aminopropazine fumarate sterile solution injection.

Code of Federal Regulations, 2011 CFR

2011-04-01

... equivalent to 25 milligrams of aminopropazine base. (b) Sponsor. See No. 000061 in § 510.600(c) of this chapter. (c) Conditions of use. (1) The drug is used for reducing excessive smooth muscle contractions, such as occur in urethral spasms associated with urolithiasis in cats and dogs and in colic spasms in...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2011 CFR

2011-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2012 CFR

2012-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2014 CFR

2014-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2013 CFR

2013-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 172.822 - Sodium lauryl sulfate.

Code of Federal Regulations, 2012 CFR

2012-04-01

... acid-acidulated dry beverage base whereby the additive does not exceed 25 parts per million of the finished beverage and such beverage base is not for use in a food for which a standard of identity established under section 401 of the Act precludes such use. (ii) Fumaric acid-acidulated fruit juice drinks...

ORGANIC REACTIONS IN THE SOLID STATE AND IN SOLID SOLUTIONS.

DTIC Science & Technology

on the reactions of phthalic acid and acetanilide , various acyl anilides, and ring-substituted acetanilides . Exploratory experiments were also...performed between ring-substituted acetanilides and succinic, glutaric, maleic and fumaric acids. The influence of imidazole as a catalyst of the...transacylation reaction of phthalic anhydride and acetanilide is also reported. (Author)

Regulation of succinate-ubiquinone reductase and fumarate reductase activities in human complex II by phosphorylation of its flavoprotein subunit.

PubMed

Tomitsuka, Eriko; Kita, Kiyoshi; Esumi, Hiroyasu

2009-01-01

Complex II (succinate-ubiquinone reductase; SQR) is a mitochondrial respiratory chain enzyme that is directly involved in the TCA cycle. Complex II exerts a reverse reaction, fumarate reductase (FRD) activity, in various species such as bacteria, parasitic helminths and shellfish, but the existence of FRD activity in humans has not been previously reported. Here, we describe the detection of FRD activity in human cancer cells. The activity level was low, but distinct, and it increased significantly when the cells were cultured under hypoxic and glucose-deprived conditions. Treatment with phosphatase caused the dephosphorylation of flavoprotein subunit (Fp) with a concomitant increase in SQR activity, whereas FRD activity decreased. On the other hand, treatment with protein kinase caused an increase in FRD activity and a decrease in SQR activity. These data suggest that modification of the Fp subunit regulates both the SQR and FRD activities of complex II and that the phosphorylation of Fp might be important for maintaining mitochondrial energy metabolism within the tumor microenvironment.

Examination of microbial fuel cell start-up times with domestic wastewater and additional amendments.

PubMed

Liu, Guangli; Yates, Matthew D; Cheng, Shaoan; Call, Douglas F; Sun, Dan; Logan, Bruce E

2011-08-01

Rapid startup of microbial fuel cells (MFCs) and other bioreactors is desirable when treating wastewaters. The startup time with unamended wastewater (118 h) was similar to that obtained by adding acetate or fumarate (110-115 h), and less than that with glucose (181 h) or Fe(III) (353 h). Initial current production took longer when phosphate buffer was added, with startup times increasing with concentration from 149 h (25 mM) to 251 h (50 mM) and 526 h (100 mM). Microbial communities that developed in the reactors contained Betaproteobacteria, Acetoanaerobium noterae, and Chlorobium sp. Anode biomass densities ranged from 200 to 600 μg/cm(2) for all amendments except Fe(Ш) (1650 μg/cm(2)). Wastewater produced 91 mW/m(2), with the other MFCs producing 50 mW/m(2) (fumarate) to 103mW/m(2) (Fe(III)) when amendments were removed. These experiments show that wastewater alone is sufficient to acclimate the reactor without the need for additional chemical amendments. Copyright © 2011 Elsevier Ltd. All rights reserved.

Towards excimer-laser-based stereolithography: a rapid process to fabricate rigid biodegradable photopolymer scaffolds

PubMed Central

Beke, S.; Anjum, F.; Tsushima, H.; Ceseracciu, L.; Chieregatti, E.; Diaspro, A.; Athanassiou, A.; Brandi, F.

2012-01-01

We demonstrate high-resolution photocross-linking of biodegradable poly(propylene fumarate) (PPF) and diethyl fumarate (DEF) using UV excimer laser photocuring at 308 nm. The curing depth can be tuned in a micrometre range by adjusting the total energy dose (total fluence). Young's moduli of the scaffolds are found to be a few gigapascal, high enough to support bone formation. The results presented here demonstrate that the proposed technique is an excellent tool for the fabrication of stiff and biocompatible structures on a micrometre scale with defined patterns of high resolution in all three spatial dimensions. Using UV laser photocuring at 308 nm will significantly improve the speed of rapid prototyping of biocompatible and biodegradable polymer scaffolds and enables its production in a few seconds, providing high lateral and horizontal resolution. This short timescale is indeed a tremendous asset that will enable a more efficient translation of technology to clinical applications. Preliminary cell tests proved that PPF : DEF scaffolds produced by excimer laser photocuring are biocompatible and, therefore, are promising candidates to be applied in tissue engineering and regenerative medicine. PMID:22696484

Pulsed EPR measurements on reaction rate constants for addition of photo-generated radicals to double bonds of diethyl fumarate and diethyl maleate

NASA Astrophysics Data System (ADS)

Takahashi, Hirona; Hagiwara, Kenta; Kawai, Akio

2016-11-01

Addition reaction of photo-generated radicals to double bonds of diethyl fumarate (deF) and diethyl maleate (deM), which are geometrical isomers, was studied by means of time-resolved- (TR-) and pulsed-electron paramagnetic resonance (EPR). Analysis of TR-EPR spectra indicates that adduct radicals from deF and deM should have the same structure. The double bonds of these monomers are converted to single ones by addition reaction, which allows hindered internal rotation to give the same structure of adduct radical. The rate constants for addition reaction of photo-generated radicals were determined by Stern-Volmer analysis of the decay time of electron spin-echo intensity of these radicals measured by the pulsed EPR method. Rate constants for deF were found to be larger than those for deM. This relation is in good consistent with efficiency of polymerisation of deF and deM. Experimentally determined rate constants were evaluated by introducing the addition reaction model on the basis of two important factors enthalpy and polar effects.

Brief Report: Randomized, Double-Blind Comparison of Tenofovir Alafenamide (TAF) vs Tenofovir Disoproxil Fumarate (TDF), Each Coformulated With Elvitegravir, Cobicistat, and Emtricitabine (E/C/F) for Initial HIV-1 Treatment: Week 144 Results.

PubMed

Arribas, José R; Thompson, Melanie; Sax, Paul E; Haas, Bernhard; McDonald, Cheryl; Wohl, David A; DeJesus, Edwin; Clarke, Amanda E; Guo, Susan; Wang, Hui; Callebaut, Christian; Plummer, Andrew; Cheng, Andrew; Das, Moupali; McCallister, Scott

2017-06-01

In 2 double-blind phase 3 trials, 1733 antiretroviral-naive adults were randomized to tenofovir alafenamide (TAF) or tenofovir disoproxil fumarate (TDF), each coformulated with elvitegravir/cobicistat/emtricitabine (E/C/F). At 144 weeks, TAF was superior to TDF in virologic efficacy, with 84.2% vs 80.0% having HIV-1 RNA <50 copies/mL (difference 4.2%; 95% confidence interval: 0.6% to 7.8%). TAF had less impact than TDF on bone mineral density and renal biomarkers. No participants on TAF had renal-related discontinuations vs 12 on TDF (P < 0.001), with no cases of proximal tubulopathy for TAF vs 4 for TDF. There were greater increases in lipids with TAF vs TDF, with no difference in the total cholesterol to high-density lipoprotein ratio. For initial HIV therapy, E/C/F/TAF is superior to E/C/F/TDF in efficacy and bone and renal safety.

Cocrystals of acyclovir with promising physicochemical properties.

PubMed

Sarkar, Anindita; Rohani, Sohrab

2015-01-01

Cocrystal forming ability of antiviral drug acyclovir (ACV) with different coformers was studied. Three cocrystals containing ACV with fumaric acid, malonic acid, and DL-tartaric acid were isolated. Methods of cocrystallization included grinding with dropwise solvent addition and solvent evaporation. The cocrystals were characterized by powder X-ray diffraction, differential scanning calorimetry, and thermogravimetric analysis. The crystal structure of the cocrystal with fumaric acid as conformer was determined by single crystal X-ray diffraction. Formation of supramolecular synthon was observed in the cocrystal. Stability with respect to relative humidity for the three cocrystals was evaluated. The aqueous solubility of the ACV-cocrystal materials was significantly improved with a maximum of malonic acid cocrystal, which was about six times more soluble at 35°C compared with that of parent ACV. The dissolution profile indicates that at any particular dissolution time, the concentration of cocrystals in the solution was higher than that of the parent ACV, and malonic acid cocrystals had a maximum release of about twice than the hydrated ACV. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Fertility, pregnancy and childbirth in patients with multiple sclerosis: impact of disease-modifying drugs.

PubMed

Amato, Maria Pia; Portaccio, Emilio

2015-03-01

In recent decades, pregnancy-related issues in multiple sclerosis (MS) have received growing interest. MS is more frequent in women than in men and typically starts during child-bearing age. An increasing number of disease-modifying drugs (DMDs) for the treatment of MS are becoming available. Gathering information on their influences on pregnancy-related issues is of crucial importance for the counselling of MS patients. As for the immunomodulatory drugs (interferons and glatiramer acetate), accumulating evidence points to the relative safety of pregnancy exposure in terms of maternal and foetal outcomes. In case of higher clinical disease activity before pregnancy, these drugs could be continued until conception. As for the 'newer' drugs (fingolimod, natalizumab, teriflunomide, dimethyl fumarate and alemtuzumab), the information is more limited. Whereas fingolimod and teriflunomide are likely associated with an increased risk of foetal malformations, the effects of natalizumab, dimethyl fumarate and alemtuzumab still need to be ascertained. This article provides a review of the available information on the use of DMDs during pregnancy, with a specific focus on fertility, foetal development, delivery and breast-feeding.

A comparative pharmacokinetic and tolerability analysis of the novel orotic acid salt form of tenofovir disoproxil and the fumaric acid salt form in healthy subjects

PubMed Central

Kim, Yu Kyong; Choi, Mun Ju; Oh, Tae Young; Yu, Kyung-Sang; Lee, SeungHwan

2017-01-01

A novel orotic acid salt form of tenofovir disoproxil (DA-2802) was developed and is expected to replace the fumaric acid salt form. The pharmacokinetic (PK) characteristics and tolerability profiles of DA-2802 were compared to those of tenofovir disoproxil fumarate (TDF, Viread®) in healthy subjects. A randomized, open-label, single-dose study was conducted in 36 healthy subjects using a two-treatment, two-period, and two-sequence crossover design. Subjects received a single oral dose of 319 mg DA-2802 or 300 mg TDF, during each period, with a 7-day washout. Serial blood samples were collected pre-dosing and up to 72 hours post-dosing in each period, for determination of serum tenofovir concentration, which was measured by ultra-performance liquid chromatography-tandem mass spectrometry. A non-compartmental method was used to obtain PK parameters of tenofovir. For comparison between the two tenofovir disoproxil salts, the 90% confidence intervals (90% CIs) of geometric mean ratios of DA-2802 to TDF for the maximum concentration (Cmax) and the area under the concentration–time curve to the last quantifiable concentration (AUC0–t) were determined. The tolerability profiles of tenofovir were assessed by evaluation of adverse events and vital signs, physical examination, ECG, and clinical laboratory tests. The serum tenofovir concentration–time profiles of DA-2802 or TDF were comparable in 32 subjects who completed the study. In both profiles, a two-compartmental elimination with first-order elimination kinetics in the terminal phase was reported in a few subjects, showing a secondary peak in the initial phase of elimination. The geometric mean ratio (90% CI) of DA-2802 to TDF was 0.898 (0.815–0.990) for Cmax and 0.904 (0.836–0.978) for AUC0–t. There were no clinically significant findings in the tolerability assessments. DA-2802 showed comparable PK characteristics and tolerability profiles to TDF. PMID:29158663

Metabolic engineering of Aspergillus oryzae for efficient production of l-malate directly from corn starch.

PubMed

Liu, Jingjing; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

2017-11-20

l-Malate, an important chemical building block, has been widely applied in the food, pharmaceutical, and bio-based materials industries. In previous work, we engineered Aspergillus oryzae by rewiring the reductive tricarboxylic acid pathway to produce l-malate from glucose. To decrease the production cost, here, we further engineered A. oryzae to efficiently produce l-malate directly from corn starch with simultaneous liquefaction-saccharification and fermentation. First, a promoter PN5 was constructed by quintuple tandem of the 97-bp fragment containing the cis-element of the glucoamylase gene promoter (PglaA), and with the promoter PN5, the transcriptional level of glaA gene increased by 25-45%. Then, by co-overexpression of glaA, a-amylase (amyB) and a-glucosidase (agdA) genes with the promoter PN5, the l-malate titer increased from 55.5g/L to 72.0g/L with 100g/L corn starch in shake flask. In addition, to reduce the concentration of byproducts succinate and fumarate, a fumarase from Saccharomyces cerevisiae, which facilitated the transformation of fumarate to l-malate, was overexpressed. As a result, the concentration of succinate and fumarate decreased from 12.6 and 1.29g/L to 7.8 and 0.59g/L, and the l-malate titer increased from 72.0g/L to 78.5g/L. Finally, we found that the addition of glucose at the initial fermentation stage facilitated the cell growth and l-malate synthesis, and the l-malate titer further increased to 82.3g/L by co-fermentation of 30g/L glucose and 70g/L corn starch, with a productivity of 1.18g/L/h and a yield of 0.82g/g total carbon sources. Copyright © 2017 Elsevier B.V. All rights reserved.

Crystal growth, structural, spectral, thermal, linear and nonlinear optical characterization of a new organic nonlinear chiral compound: L-tryptophan-fumaric acid-water (1/1/1) suitable for laser frequency conversion

NASA Astrophysics Data System (ADS)

Peer Mohamed, M.; Jayaprakash, P.; Nageshwari, M.; Rathika Thaya Kumari, C.; Sangeetha, P.; Sudha, S.; Mani, G.; Lydia Caroline, M.

2017-08-01

A new organic active nonlinear optical crystal L-tryptophan fumaric acid water (1/1/1), (C15H17N2 O7. H2O)(LTFAW), consisting of zwitterion tryptophan molecule in conjunction with a fumaric acid molecule and a water molecule was grown by slow solvent evaporation technique from aqueous solution. The organic chromophore crystallizes from water in its zwitterions exhibiting tabular habit in monoclinic system with acentric space group C2 (Z = 4). The sharp peaks observed in Powder X-ray diffractogram depicts the crystalline nature. The presence of functional groups in the grown crystal was analyzed using FT-IR spectrum. The carbon and hydrogen environment in molecular structure was investigated using FT-NMR technique using deuterated DMSO solution. Ultraviolet-visible spectral analysis reveal that the crystal possess lower cut-off wavelength down to 275 nm, is a key factor to exhibit Second Harmonic Generation (SHG) signal. The direct optical band gap is evaluated to be 5.28 eV from the UV absorption profile. The evaluation of optical constants by employing UV-visible absorbance data such as, extinction coefficient, reflectance, refractive index, optical conductivity are supportive towards good performance as NLO devices. Temperature of decomposition was investigated using thermogravimetric analysis/differential thermal analysis techniques (TG/DTA). The luminescence profile exhibited two peaks (362 nm, 683 nm) due to the donation of protons from carboxylic group to amino group. The nonlinear optical behavior from the noncentrosymmetric crystal was observed by the generation of frequency doubled (2ω) optical radiation when subjected to pulsed Nd:YAG laser (1064 nm, 10 ns, 10 Hz) using Kurtz-Perry method. The variation of dielectric constant (εʹ) and dielectric loss (εʹʹ) vs. Log f for the title compound was analysed at a few selected temperatures and frequencies.

Salt formation improved the properties of a candidate drug during early formulation development.

PubMed

Sigfridsson, Kalle; Ahlqvist, Matti; Lindsjö, Martin; Paulsson, Stefan

2018-07-30

The purpose of this study was to investigate if AZD5329, a dual neurokinin NK1/2 receptor antagonist, is a suitable candidate for further development as an oral immediate release (IR) solid dosage form as a final product. The neutral form of AZD5329 has only been isolated as amorphous material. In order to search for a solid material with improved physical and chemical stability and more suitable solid-state properties, a salt screen was performed. Crystalline material of a maleic acid salt and a fumaric acid salt of AZD5329 were obtained. X-ray powder diffractiometry, thermogravimetric analysis, differential scanning calorimetry and dynamic vapor sorption were used to investigate the physicochemical characteristics of the two salts. The fumarate salt of AZD5329 is anhydrous, the crystallization is reproducible and the hygroscopicity is acceptable. Early polymorphism assessment work using slurry technique did not reveal any better crystal modification or crystallinity for the fumarate salt. For the maleate salt, the form isolated originally was found to be a solvate, but an anhydrous form was found in later experiments; by suspension in water or acetone, by drying of the solvate to 100-120 °C or by subjecting the solvate form to conditions of 40 °C/75%RH for 3 months. The dissolution behavior and the chemical stability (in aqueous solutions, formulations and solid-state) of both salts were also studied and found to be satisfactory. The compound displays sensitivity to low pH, and the salt of the maleic acid, which is the stronger acid, shows more degradation during stability studies, in line with this observation. The presented data indicate that the substance fulfils basic requirements for further development of an IR dosage form, based on the characterization on crystalline salts of AZD5329. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of Putative Steroid Receptor Antagonists in Bottled Water: Combining Bioassays and High-Resolution Mass Spectrometry

PubMed Central

Wagner, Martin; Schlüsener, Michael P.; Ternes, Thomas A.; Oehlmann, Jörg

2013-01-01

Endocrine disrupting chemicals (EDCs) are man-made compounds interfering with hormone signaling and thereby adversely affecting human health. Recent reports provide evidence for the presence of EDCs in commercially available bottled water, including steroid receptor agonists and antagonists. However, since these findings are based on biological data the causative chemicals remain unidentified and, therefore, inaccessible for toxicological evaluation. Thus, the aim of this study is to assess the antiestrogenic and antiandrogenic activity of bottled water and to identify the causative steroid receptor antagonists. We evaluated the antiestrogenic and antiandrogenic activity of 18 bottled water products in reporter gene assays for human estrogen receptor alpha and androgen receptor. Using nontarget high-resolution mass spectrometry (LTQ-Orbitrap Velos), we acquired corresponding analytical data. We combined the biological and chemical information to determine the exact mass of the tentative steroid receptor antagonist. Further MSn experiments elucidated the molecule’s structure and enabled its identification. We detected significant antiestrogenicity in 13 of 18 products. 16 samples were antiandrogenic inhibiting the androgen receptor by up to 90%. Nontarget chemical analysis revealed that out of 24520 candidates present in bottled water one was consistently correlated with the antagonistic activity. By combining experimental and in silico MSn data we identified this compound as di(2-ethylhexyl) fumarate (DEHF). We confirmed the identity and biological activity of DEHF and additional isomers of dioctyl fumarate and maleate using authentic standards. Since DEHF is antiestrogenic but not antiandrogenic we conclude that additional, yet unidentified EDCs must contribute to the antagonistic effect of bottled water. Applying a novel approach to combine biological and chemical analysis this is the first study to identify so far unknown EDCs in bottled water. Notably, dioctyl fumarates and maleates have been overlooked by science and regulation to date. This illustrates the need to identify novel toxicologically relevant compounds to establish a more holistic picture of the human exposome. PMID:24015248

Succination is Increased on Select Proteins in the Brainstem of the NADH dehydrogenase (ubiquinone) Fe-S protein 4 (Ndufs4) Knockout Mouse, a Model of Leigh Syndrome*

PubMed Central

Piroli, Gerardo G.; Manuel, Allison M.; Clapper, Anna C.; Walla, Michael D.; Baatz, John E.; Palmiter, Richard D.; Quintana, Albert; Frizzell, Norma

2016-01-01

Elevated fumarate concentrations as a result of Krebs cycle inhibition lead to increases in protein succination, an irreversible post-translational modification that occurs when fumarate reacts with cysteine residues to generate S-(2-succino)cysteine (2SC). Metabolic events that reduce NADH re-oxidation can block Krebs cycle activity; therefore we hypothesized that oxidative phosphorylation deficiencies, such as those observed in some mitochondrial diseases, would also lead to increased protein succination. Using the Ndufs4 knockout (Ndufs4 KO) mouse, a model of Leigh syndrome, we demonstrate for the first time that protein succination is increased in the brainstem (BS), particularly in the vestibular nucleus. Importantly, the brainstem is the most affected region exhibiting neurodegeneration and astrocyte and microglial proliferation, and these mice typically die of respiratory failure attributed to vestibular nucleus pathology. In contrast, no increases in protein succination were observed in the skeletal muscle, corresponding with the lack of muscle pathology observed in this model. 2D SDS-PAGE followed by immunoblotting for succinated proteins and MS/MS analysis of BS proteins allowed us to identify the voltage-dependent anion channels 1 and 2 as specific targets of succination in the Ndufs4 knockout. Using targeted mass spectrometry, Cys77 and Cys48 were identified as endogenous sites of succination in voltage-dependent anion channels 2. Given the important role of voltage-dependent anion channels isoforms in the exchange of ADP/ATP between the cytosol and the mitochondria, and the already decreased capacity for ATP synthesis in the Ndufs4 KO mice, we propose that the increased protein succination observed in the BS of these animals would further decrease the already compromised mitochondrial function. These data suggest that fumarate is a novel biochemical link that may contribute to the progression of the neuropathology in this mitochondrial disease model. PMID:26450614

Molybdenum effector of fumarate reductase repression and nitrate reductase induction in Escherichia coli.

PubMed Central

Iuchi, S; Lin, E C

1987-01-01

In Escherichia coli the presence of nitrate prevents the utilization of fumarate as an anaerobic electron acceptor. The induction of the narC operon encoding the nitrate reductase is coupled to the repression of the frd operon encoding the fumarate reductase. This coupling is mediated by nitrate as an effector and the narL product as the regulatory protein (S. Iuchi and E. C. C. Lin, Proc. Natl. Acad. Sci. USA 84:3901-3905, 1987). The protein-ligand complex appears to control narC positively but frd negatively. In the present study we found that a molybdenum coeffector acted synergistically with nitrate in the regulation of frd and narC. In chlD mutants believed to be impaired in molybdate transport (or processing), full repression of phi(frd-lac) and full induction of phi(narC-lac) by nitrate did not occur unless the growth medium was directly supplemented with molybdate (1 microM). This requirement was not clearly manifested in wild-type cells, apparently because it was met by the trace quantities of molybdate present as a contaminant in the mineral medium. In chlB mutants, which are known to accumulate the Mo cofactor because of its failure to be inserted as a prosthetic group into proteins such as nitrate reductase, nitrate repression of frd and induction of narC were also intensified by molybdate supplementation. In this case a deficiency of the molybdenum coeffector might have resulted from enhanced feedback inhibition of molybdate transport (or processing) by the elevated level of the unutilized Mo cofactor. In addition, mutations in chlE, which are known to block the synthesis of the organic moiety of the Mo cofactor, lowered the threshold concentration of nitrate (< 1 micromole) necessary for frd repression and narC induction. These changes could be explained simply by the higher intracellular nitrate attainable in cells lacking the ability to destroy the effector. PMID:3301812

Succination is Increased on Select Proteins in the Brainstem of the NADH dehydrogenase (ubiquinone) Fe-S protein 4 (Ndufs4) Knockout Mouse, a Model of Leigh Syndrome.

PubMed

Piroli, Gerardo G; Manuel, Allison M; Clapper, Anna C; Walla, Michael D; Baatz, John E; Palmiter, Richard D; Quintana, Albert; Frizzell, Norma

2016-02-01

Elevated fumarate concentrations as a result of Krebs cycle inhibition lead to increases in protein succination, an irreversible post-translational modification that occurs when fumarate reacts with cysteine residues to generate S-(2-succino)cysteine (2SC). Metabolic events that reduce NADH re-oxidation can block Krebs cycle activity; therefore we hypothesized that oxidative phosphorylation deficiencies, such as those observed in some mitochondrial diseases, would also lead to increased protein succination. Using the Ndufs4 knockout (Ndufs4 KO) mouse, a model of Leigh syndrome, we demonstrate for the first time that protein succination is increased in the brainstem (BS), particularly in the vestibular nucleus. Importantly, the brainstem is the most affected region exhibiting neurodegeneration and astrocyte and microglial proliferation, and these mice typically die of respiratory failure attributed to vestibular nucleus pathology. In contrast, no increases in protein succination were observed in the skeletal muscle, corresponding with the lack of muscle pathology observed in this model. 2D SDS-PAGE followed by immunoblotting for succinated proteins and MS/MS analysis of BS proteins allowed us to identify the voltage-dependent anion channels 1 and 2 as specific targets of succination in the Ndufs4 knockout. Using targeted mass spectrometry, Cys(77) and Cys(48) were identified as endogenous sites of succination in voltage-dependent anion channels 2. Given the important role of voltage-dependent anion channels isoforms in the exchange of ADP/ATP between the cytosol and the mitochondria, and the already decreased capacity for ATP synthesis in the Ndufs4 KO mice, we propose that the increased protein succination observed in the BS of these animals would further decrease the already compromised mitochondrial function. These data suggest that fumarate is a novel biochemical link that may contribute to the progression of the neuropathology in this mitochondrial disease model. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Efficacy of Formoterol Fumarate Delivered by Metered Dose Inhaler Using Co-Suspension™ Delivery Technology Versus Foradil® Aerolizer® in Moderate-To-Severe COPD: A Randomized, Dose-Ranging Study.

PubMed

Sethi, Sanjay; Fogarty, Charles; Hanania, Nicola A; Martinez, Fernando J; Rennard, Stephen; Fries, Michael; Orevillo, Chad; Darken, Patrick; St Rose, Earl; Strom, Shannon; Fischer, Tracy; Golden, Michael; Dwivedi, Sarvajna; Reisner, Colin

2016-11-17

Background: Co-Suspension™ Delivery Technology offers a novel pharmaceutical platform for inhaled drug therapy. This randomized, double-blind, placebo-controlled, single-dose study (NCT01349868) evaluated the efficacy of a range of doses for formoterol fumarate (FF) delivered using Co-Suspension delivery technology via a pressurized metered dose inhaler (MDI) versus placebo in patients with moderate-to-severe chronic obstructive pulmonary disease (COPD). Secondary objectives included determination of non-inferior efficacy and systemic exposure compared with open-label Foradil ® 12 μg (Foradil ® Aerolizer ® ; formoterol fumarate dry powder inhaler). Methods: Patients received each of the 6 study treatments (FF MDI [7.2, 9.6 and 19.2μg], placebo MDI and open-label Foradil ® [12 and 24µg]), separated by 3-10 days. Spirometry was performed 60 and 30 minutes prior to and at regular intervals up to 12 hours post-administration of study drug. The primary outcome measure was the change in forced expiratory volume in 1 second (FEV 1 ) area under the curve between 0 and 12 hours (AUC 0-12 ) relative to test day baseline. Results: A total of 50 patients were randomized to study treatment sequences. All doses of FF MDI demonstrated superiority to placebo ( p <0.0001) and non-inferiority to Foradil ® 12μg, on bronchodilator outcome measures. No serious adverse events were reported during the study. Conclusions: This study demonstrates non-inferiority of bronchodilator response and bioequivalent exposure of FF MDI 9.6μg to Foradil ® 12μg, with both agents exhibiting a similar safety profile in patients with moderate-to-severe COPD. This study supports the selection of FF MDI 9.6µg for further evaluation in Phase III trials.

Fumarate decreases edema volume and improves functional outcome after experimental stroke.

PubMed

Clausen, Bettina Hjelm; Lundberg, Louise; Yli-Karjanmaa, Minna; Martin, Nellie Anne; Svensson, Martina; Alfsen, Maria Zeiler; Flæng, Simon Bertram; Lyngsø, Kristina; Boza-Serrano, Antonio; Nielsen, Helle H; Hansen, Pernille B; Finsen, Bente; Deierborg, Tomas; Illes, Zsolt; Lambertsen, Kate Lykke

2017-09-01

Oxidative stress and inflammation exacerbate tissue damage in the brain after ischemic stroke. Dimethyl-fumarate (DMF) and its metabolite monomethyl-fumarate (MMF) are known to stimulate anti-oxidant pathways and modulate inflammatory responses. Considering these dual effects of fumarates, we examined the effect of MMF treatment after ischemic stroke in mice. Permanent middle cerebral artery occlusion (pMCAO) was performed using adult, male C57BL/6 mice. Thirty minutes after pMCAO, 20mg/kg MMF was administered intravenously. Outcomes were evaluated 6, 24 and 48h after pMCAO. First, we examined whether a bolus of MMF was capable of changing expression of kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1) and nuclear factor erythroid 2-related factor (Nrf)2 in the infarcted brain. Next, we studied the effect of MMF on functional recovery. To explore mechanisms potentially influencing functional changes, we examined infarct volumes, edema formation, the expression of heat shock protein (Hsp)72, hydroxycarboxylic acid receptor 2 (Hcar2), and inducible nitric oxide synthase (iNOS) in the infarcted brain using real-time PCR and Western blotting. Concentrations of a panel of pro- and anti-inflammatory cytokines (IFNγ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p70, TNF) were examined in both the infarcted brain tissue and plasma samples 6, 24 and 48h after pMCAO using multiplex electrochemoluminiscence analysis. Administration of MMF increased the protein level of Nrf2 6h after pMCAO, and improved functional outcome at 24 and 48h after pMCAO. MMF treatment did not influence infarct size, however reduced edema volume at both 24 and 48h after pMCAO. MMF treatment resulted in increased Hsp72 expression in the brain 6h after pMCAO. Hcar2 mRNA levels increased significantly 24h after pMCAO, but were not different between saline- and MMF-treated mice. MMF treatment also increased the level of the anti-inflammatory cytokine IL-10 in the brain and plasma 6h after pMCAO, and additionally reduced the level of the pro-inflammatory cytokine IL-12p70 in the brain at 24 and 48h after pMCAO. A single intravenous bolus of MMF improved sensory-motor function after ischemic stroke, reduced edema formation, and increased the levels of the neuroprotective protein Hsp72 in the brain. The early increase in IL-10 and reduction in IL-12p70 in the brain combined with changes in systemic cytokine levels may also contribute to the functional recovery after pMCAO. Copyright © 2017. Published by Elsevier Inc.

Integrase inhibitor versus protease inhibitor based regimen for HIV-1 infected women (WAVES): a randomised, controlled, double-blind, phase 3 study

PubMed Central

Squires, Kathleen; Kityo, Cissy; Hodder, Sally; Johnson, Margaret; Voronin, Evgeny; Hagins, Debbie; Avihingsanon, Anchalee; Koenig, Ellen; Jiang, Shuping; White, Kirsten; Cheng, Andrew; Szwarcberg, Javier; Cao, Huyen

2018-01-01

Summary Background Women are under-represented in HIV antiretroviral therapy (ART) studies. Guidelines for selection of ART as initial therapy in patients with HIV-1 infection do not contain sex-specific treatment. We aimed to assess the safety and efficacy of the single tablet integrase inhibitor regimen containing elvitegravir, cobicistat, emtricitabine, and tenofovir disoproxil fumarate compared with a boosted protease inhibitor regimen of ritonavir-boosted atazanavir with emtricitabine and tenofovir disoproxil fumarate. Methods In this international, randomised, controlled, double-blind, phase 3 study (Women AntiretroViral Efficacy and Safety study [WAVES]), we recruited treatment-naive HIV-infected women with an estimated creatinine clearance of 70 mL/min or higher from 80 centres in 11 countries. Women were randomly assigned (1:1) to receive elvitegravir, cobicistat, emtricitabine, and tenofovir disoproxil fumarate (integrase inhibitor regimen) or ritonavir-boosted atazanavir with emtricitabine and tenofovir disoproxil fumarate (protease inhibitor based regimen); regimens were masked with matching placebos. Randomisation was done by a computer-generated allocation sequence (block size four) and was stratified by HIV-1 RNA viral load and race. Investigators, patients, study staff, and those assessing outcomes were masked to treatment group. All participants who received one dose of study drug were included in the primary efficacy and safety analyses. The main outcome was the proportion of patients with plasma HIV-1 RNA less than 50 copies per mL at week 48 as defined by US Food and Drug Administration snapshot algorithm (prespecified non-inferiority margin of 12%). This study is registered with ClinicalTrials.gov, number NCT01705574. Findings Between Nov 28, 2012, and March 12, 2014, 575 women were enrolled. 289 were randomly assigned to receive the integrase inhibitor regimen and 286 to receive the protease inhibitor based regimen. 252 (87%) women in the integrase inhibitor group had plasma HIV-1 RNA less than 50 copies per mL at week 48 compared with 231 (81%) women in the protease inhibitor group (adjusted difference 6·5%; 95% CI 0·4–12·6). No participant had virological failure with resistance in the integrase inhibitor group compared with three participants ([1%]; all Met184Val/Ile) in the protease inhibitor group. 19 women in the protease inhibitor group discontinued because of adverse events compared with five in the integrase inhibitor group. Interpretation WAVES shows that clinical trials of ART regimens in global and diverse populations of treatment-naive women are possible. The findings support guidelines recommending integrase inhibitor based regimens in first-line antiretroviral therapy. PMID:27562742

Stimulating Central Carbon Metabolism to Re-sensitize Pseudomonas aeruginosa to Aminoglycosides.

PubMed

Martins, Dorival; Nguyen, Dao

2017-02-16

In this issue of Cell Chemical Biology, Meylan et al. (2017) examine how stimulation of central carbon metabolism of Pseudomonas aeruginosa modulates aminoglycoside lethality in tolerant bacteria. They identify fumarate as a tobramycin potentiator that stimulates proton motive force-dependent drug uptake and increases respiration-dependent killing. Copyright © 2017. Published by Elsevier Ltd.

Study of the Glutaminase Inhibitor CB-839 in Solid Tumors

ClinicalTrials.gov

2016-08-18

Solid Tumors; Triple-Negative Breast Cancer; Non Small Cell Lung Cancer; Renal Cell Carcinoma; Mesothelioma; Fumarate Hydratase (FH)-Deficient Tumors; Succinate Dehydrogenase (SDH)-Deficient Gastrointestinal Stromal Tumors (GIST); Succinate Dehydrogenase (SDH)-Deficient Non-gastrointestinal Stromal Tumors; Tumors Harboring Isocitrate Dehydrogenase-1 (IDH1) and IDH2 Mutations; Tumors Harboring Amplifications in the cMyc Gene

21 CFR 522.82 - Aminopropazine fumarate sterile solution injection.

Code of Federal Regulations, 2010 CFR

2010-04-01

..., such as occur in urethral spasms associated with urolithiasis in cats and dogs and in colic spasms in... bioequivalency and safety information. (2) It is administered intramuscularly or intravenously to dogs and cats... hours, as indicated.1 (3) Not for use in animals intended for food purposes.1 (4) For use only by or on...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2014 CFR

2014-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Use of acid to correct...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2011 CFR

2011-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Use of acid to correct...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2012 CFR

2012-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Use of acid to correct...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2013 CFR

2013-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Use of acid to correct...

Higher plasma vitamin D binding protein and lower free calcitriol with tenofovir treatment: Cause of a functional vitamin D deficiency?

USDA-ARS?s Scientific Manuscript database

Background: Tenofovir disoproxil fumarate (TDF) causes bone, endocrine and renal changes, by unknown mechanism(s). There are limited data on tenofovir (TFV) pharmacokinetics and these effects. Methods: Using baseline data from a multicenter study in HIV-infected youth on stable treatment with cAR...

Temperature shift experiments suggest that metabolic impairment and enhanced rates of photorespiration decrease organic acid levels in soybean leaflets exposed to supra-optimal growth temperatures

USDA-ARS?s Scientific Manuscript database

Citrate, malate, malonate, fumarate and succinate in soybean leaflets decreased 40 to 80% when plants were grown continuously in controlled environment chambers at 36/28 compared to 28/20 °C. Glycerate was not temperature responsive in this study. Temperature effects on the above mentioned organi...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2014 CFR

2014-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2013 CFR

2013-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2010 CFR

2010-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2011 CFR

2011-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2012 CFR

2012-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

Vitamin D3 supplementation increases fibroblast growth factor-23 in HIV-infected youth treated with tenofovir disoproxil fumarate

USDA-ARS?s Scientific Manuscript database

Tenofovir (TDF) is associated with phosphaturia and elevated 1,25 dihydroxy vitamin D (1,25-OH(2)D). Fibroblast growth factor-23 causes phosphaturia and increases in response to elevated 1,25-OH(2)D. Vitamin D binding proetin (VDBP) binds to 1,25-OH(2)D, decreasing biologic activity, and is elevated...

Vitamin D Supplementation increases fibroblast growth factor-23 in HIV-infected youth treated with tenofovir disoproxil fumarate

USDA-ARS?s Scientific Manuscript database

BACKGROUND: Tenofovir (TDF) is associated with phosphaturia and elevated 1,25 dihydroxy vitamin D (1,25-OH(2)D). Fibroblast growth factor 23 (FGF23) causes phosphaturia and increases in response to elevated 1,25-OH(2)D. Vitamin D binding protein (VDBP) binds to 1,25-OH(2)D, decreasing its biologic...

Potential drugs which activate nuclear factor E2-related factor 2 signaling to prevent diabetic cardiovascular complications: A focus on fumaric acid esters.

PubMed

Zhou, Shanshan; Jin, Jingpeng; Bai, Tao; Sachleben, Leroy R; Cai, Lu; Zheng, Yang

2015-08-01

Diabetes and its cardiovascular complications have been a major public health issue. These complications are mainly attributable to a severe imbalance between free radical and reactive oxygen species production and the antioxidant defense systems. Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant enzyme genes and other cyto-protective phase II detoxifying enzymes. As a result, Nrf2 has gained great attention as a promising drug target for preventing diabetic cardiovascular complications. And while animal studies have shown that several Nrf2 activators manifest a potential to efficiently prevent the diabetic complications, their use in humans has not been approved due to the lack of substantial evidence regarding safety and efficacy of the Nrf2 activation. We provide here a brief review of a few clinically-used drugs that can up-regulate Nrf2 with the potential of extending their usage to diabetic patients for the prevention of cardiovascular complications and conclude with a closer inspection of dimethyl fumarate and its mimic members. Copyright © 2015 Elsevier Inc. All rights reserved.

Growth and Metabolism of Lactic Acid Bacteria during and after Malolactic Fermentation of Wines at Different pH

PubMed Central

Davis, C. R.; Wibowo, D. J.; Lee, T. H.; Fleet, G. H.

1986-01-01

Commercially produced red wines were adjusted to pH 3.0, 3.2, 3.5, 3.7, or 4.0 and examined during and after malolactic fermentation for growth of lactic acid bacteria and changes in the concentrations of carbohydrates, organic acids, amino acids, and acetaldehyde. With one exception, Leuconostoc oenos conducted the malolactic fermentation in all wines and was the only species to occur in wines at pH below 3.5. Malolactic fermentation by L. oenos was accompanied by degradation of malic, citric, and fumaric acids and production of lactic and acetic acids. The concentrations of arginine, histidine, and acetaldehyde also decreased at this stage, but the behavior of hexose and pentose sugars was complicated by other factors. Pediococcus parvulus conducted the malolactic fermentation in one wine containing 72 mg of total sulfur dioxide per liter. Fumaric and citric acids were not degraded during this malolactic fermentation, but hexose sugars were metabolized. P. parvulus and species of Lactobacillus grew after malolactic fermentation in wines with pH adjusted above 3.5. This growth was accompanied by the utilization of wine sugars and production of lactic and acetic acids. PMID:16347015

The efficacy of extrafine beclomethasone dipropionate–formoterol fumarate in COPD patients who are not “frequent exacerbators”: a post hoc analysis of the FORWARD study

PubMed Central

Singh, Dave; Vezzoli, Stefano; Petruzzelli, Stefano; Papi, Alberto

2017-01-01

The GOLD 2017 strategy document recommends that the pharmacological management of COPD patients be based on the risk of future exacerbations and the severity of symptoms. A threshold of two moderate exacerbations or one hospitalization is used to define high-risk patients. The FORWARD study was a randomized, double-blind, parallel-group trial that compared 48 weeks’ treatment with extrafine beclomethasone dipropionate plus formoterol fumarate (BDP-FF) versus FF in severe COPD patients with a history of one or more exacerbations in the previous year. The new GOLD 2017 recommendations mean that many patients in the FORWARD study are now reclassified as GOLD B. We conducted a post hoc analysis of the FORWARD study, in order to investigate the effects of extrafine BDP/FF in patients with one exacerbation in the previous year, focusing on those categorized as group B using the GOLD 2017 definition. The analysis showed a 35% reduction in exacerbation rate with an inhaled corticosteroid (ICS) + long-acting β-agonist (LABA) versus LABA. We propose that ICS-LABA treatment is a therapeutic option for COPD patients with one exacerbation in the previous year. PMID:29138555

EFFECT OF HYDROPHILIC AND HYDROPHOBIC POLYMER ON IN VITRO DISSOLUTION AND PERMEATION OF BISOPROLOL FUMARATE THROUGH TRANSDERMAL PATCH.

PubMed

Shabbir, Maryam; Ali, Sajid; Raza, Moosa; Sharif, Ali; Akhtar, Furoan Muhammad; Manan, Abdul; Fazli, Ali Raza; Younas, Neelofar; Manzoor, Iqra

2017-01-01

A matrix transdermal patch of bisoprolol fumarate was formulated with different concentrations of Eudragit RS 100 and Methocel E5 with PEG 400 as plasticizer by solvent evaporation technique. Tween 80 was added to the optimized patch to evaluate the effect of permeation enhancer at different concentration through the excised rabbit's skin. The patches were analyzed for weight variation, drug content, swelling index, erosion studies, moisture content, moisture uptake, water vapor transmission rate (WVTR) and water vapor permeability (WVP). In vitro dissolution test was carried out in USP dissolution apparatus V to select the optimized formulation. In vitr skin permeation studies were done in Franz diffusion cell using rabbit skin as a model membrane. The cumulative drug release and flux were determined to compare the result of test patches with a control patch. The greatest enhancement ratio (ER) was obtained in F03-PE with 30% Tween 80. F03-PE seemed to follow zero order kinetics with super case II mechanism of drug release. Statistical ANOVA suggested that there was a significant difference in formulations, steady flux and cumulative permeation rate at different Tween 80 concentrations.

Severe multiple sclerosis reactivation during prolonged lymphopenia after dimethyl fumarate discontinuation.

PubMed

Zecca, C; Antozzi, C G; Torri Clerici, V; Ferrazzini, M; Mantegazza, R E; Rossi, S; Gobbi, C

2018-06-01

Delayed-release dimethyl fumarate (DMF) treatment can be associated with reduced lymphocyte and leucocyte counts, which might persist after DMF discontinuation. We report the case of a patient with severe disease reactivation despite prolonged lymphopenia after DMF discontinuation. We describe the frequency and impact of prolonged lymphopenia after DMF discontinuation at two tertiary MS centres. A 36-year-old female patient with multiple sclerosis was switched to DMF after 14 years of treatment with interferon beta-1a. DMF was suspended after 4 months because of persistent lymphopenia for 3 months. Six months later, the patient had a severe relapse with multiple enhancing brain lesions at MRI although lymphopenia was still persistent. Haematological assessment excluded other causes of lymphopenia, which was evaluated as a probable iatrogenic complication of DMF. The patient was treated with i.v. methylprednisolone 1 gr daily for 3 days with clinical recovery. Prolonged lymphopenia after DMT discontinuation does not protect against disease reactivation. Starting a new immune therapy should be balanced against the option of a "wait and see." A different immunotherapeutic strategy such as an anti-B therapeutic approach could be considered. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Multiple Sclerosis and Subsequent Human Immunodeficiency Virus Infection: A Case with the Rare Comorbidity, Focus on Novel Treatment Issues and Review of the Literature.

PubMed

Skarlis, Charalampos; Gontika, Maria; Katsavos, Serafeim; Velonakis, Giorgios; Toulas, Panagiotis; Anagnostouli, Maria

2017-01-01

The comorbidity between Multiple Sclerosis (MS) and Human Immunodeficiency Virus (HIV) infection is particularly rare. Only a few cases of comorbidity of Clinically Definite(CD)-MS and HIV have been documented worldwide, while the potential beneficial role of antiretroviral therapy regarding MS activity has long been an area of debate. We present a 36-year old male, bearing a diagnosis of CD-MS for twelve years. He had been treated for ten years with interferon-beta-1b, when he voluntarily discontinued therapy, claiming clinical stability. One year later he was diagnosed positive for HIV and he started and continued only on efavirenz/emricitabine/tenofovir-disoproxil fumarate (ATRIPLA®), remaining relapse-free until today. This fact, in combination with the unique pharmaceutical composition of the drug, which contains a component similar to a newly-approved agent for MS, dimethyl fumarate, prompted us to review the literature regarding this rare comorbidity and to suggest that the role of the antiretroviral therapy should be further explored in MS. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

The Variations of Glycolysis and TCA Cycle Intermediate Levels Grown in Iron and Copper Mediums of Trichoderma harzianum.

PubMed

Tavsan, Zehra; Ayar Kayali, Hulya

2015-05-01

The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.

Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

PubMed

Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

2011-01-01

Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

Physical Properties and Cellular Responses to Crosslinkable Poly(Propylene Fumarate)/Hydroxyapatite Nanocomposites

PubMed Central

Lee, Kee-Won; Wang, Shanfeng; Yaszemski, Michael J.; Lu, Lichun

2008-01-01

A series of crosslinkable nanocomposites has been developed using hydroxyapatite (HA) nanoparticles and poly(propylene fumarate) (PPF). PPF/HA nanocomposites with four different weight fractions of HA nanoparticles have been characterized in terms of thermal and mechanical properties. To assess surface chemistry of crosslinked PPF/HA nanocomposites, their hydrophilicity and capability of adsorbing proteins have been determined using static contact angle measurement and MicroBCA protein assay kit after incubation with 10% fetal bovine serum (FBS), respectively. In vitro cell studies have been performed using MC3T3-E1 mouse pre-osteoblast cells to investigate the ability of PPF/HA nanocomposites to support cell attachment, spreading, and proliferation after 1, 4, and 7 days. By adding HA nanoparticles to PPF, the mechanical properties of crosslinked PPF/HA nanocomposites have not been increased due to the initially high modulus of crosslinked PPF. However, hydrophilicity and serum protein adsorption on the surface of nanocomposites have been significantly increased, resulting in enhanced cell attachment, spreading, and proliferation after 4 days of cell seeding. These results indicate that crosslinkable PPF/HA nanocomposites are useful for hard tissue replacement because of excellent mechanical strength and osteoconductivity. PMID:18403013

Safety of oral tenofovir disoproxil fumarate-based pre-exposure prophylaxis for HIV prevention.

PubMed

Mugwanya, Kenneth K; Baeten, Jared M

2016-01-01

Tenofovir disoproxil fumarate (TDF)-based pre-exposure prophylaxis is a novel HIV prevention strategy for individuals at increased sexual risk for HIV infection. For any biomedical prevention intervention, the bar for tolerating adverse effects in healthy persons is high compared to therapeutic interventions. We provide a concise summary of the clinical safety of TDF-based pre-exposure prophylaxis with focus on TDF-related effects on tolerability, kidney function, bone density, HIV resistance, sexual and reproductive health. The evidence base for this review is derived from a literature search of both randomized and observational studies evaluating efficacy and safety of TDF-based PrEP, TDF alone or in combination with emtricitabine, identified from PUBMED and EMBASE electronic databases, clinicaltrials.gov and major HIV conferences. TDF-based pre-exposure prophylaxis is a potent intervention against HIV acquisition when taken which is generally safe and well tolerated. The risk of the small, non-progressive, and reversible decline in glomerular filtration rate and bone mineral density as well as the potential selection for drug resistance associated with PrEP are outweighed, at the population level and broadly for individuals, by PrEP's substantial reduction in the risk of HIV infection.

Metabolic potential of fatty acid oxidation and anaerobic respiration by abundant members of Thaumarchaeota and Thermoplasmata in deep anoxic peat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Xueju; Handley, Kim M.; Gilbert, Jack A.

2015-12-01

To probe the metabolic potential of abundant Archaea in boreal peats, we reconstructed two near-complete archaeal genomes, affiliated with Thaumarchaeota group 1.1c (bin Fn1, 8% abundance), which was a genomically unrepresented group, and Thermoplasmata (bin Bg1, 26% abundance), from metagenomic data acquired from deep anoxic peat layers. Each of the near-complete genomes encodes the potential to degrade long-chain fatty acids (LCFA) via β-oxidation. Fn1 has the potential to oxidize LCFA either by syntrophic interaction with methanogens or by coupling oxidation with anaerobic respiration using fumarate as a terminal electron acceptor (TEA). Fn1 is the first Thaumarchaeota genome without an identifiablemore » carbon fixation pathway, indicating that this mesophilic phylum encompasses more diverse metabolisms than previously thought. Furthermore, we report genetic evidence suggestive of sulfite and/or organosulfonate reduction by Thermoplasmata Bg1. In deep peat, inorganic TEAs are often depleted to extremely low levels, yet the anaerobic respiration predicted for two abundant archaeal members suggests organic electron acceptors such as fumarate and organosulfonate (enriched in humic substances) may be important for respiration and C mineralization in peatlands.« less

Rapid fabrication of rigid biodegradable scaffolds by excimer laser mask projection technique: a comparison between 248 and 308 nm

NASA Astrophysics Data System (ADS)

Beke, S.; Anjum, F.; Ceseracciu, L.; Romano, I.; Athanassiou, A.; Diaspro, A.; Brandi, F.

2013-03-01

High-resolution photocrosslinking of the biodegradable poly(propylene fumarate) (PPF) and diethyl fumarate (DEF), using pulsed laser light at 248 and 308 nm is presented. The curing depth can be modulated between a few hundreds of nm and a few μm when using 248 nm and ten to a hundred μm when using 308 nm. By adjusting the total fluence (pulse numbers×laser fluence) dose and the weight ratios of PPF, DEF, and the photoinitiator in the photocrosslinkable mixtures, the height of polymerized structures can be precisely tuned. The lateral resolution is evaluated by projecting a pattern of a grid with a specified line width and line spacing. Young’s modulus of the cured parts is measured and found to be several GPa for both wavelengths, high enough to support bone formation. Several 2D and 2.5D microstructures, as well as porous 3D scaffolds fabricated by a layer-by-layer method, are presented. The results demonstrate that excimer laser-based photocuring is suitable for the fabrication of stiff and biocompatible structures with defined patterns of micrometer resolution in all three spatial dimensions.

Preclinical Explorative Assessment of Dimethyl Fumarate-Based Biocompatible Nanolipoidal Carriers for the Management of Multiple Sclerosis.

PubMed

Kumar, Pramod; Sharma, Gajanand; Gupta, Varun; Kaur, Ramanpreet; Thakur, Kanika; Malik, Ruchi; Kumar, Anil; Kaushal, Naveen; Raza, Kaisar

2018-05-16

Multiple sclerosis (MS) is a neurodegenerative disease in which myelin sheath damage occurs due to internal and external factors. MS especially affects the young population. Dimethyl fumarate (DMF) is a promising agent for MS treatment, although it is associated with concerns such as poor brain permeation, multiple dosing, and gastrointestinal flushing. The present study attempts to evaluate the preclinical performance of specially designed DMF-based lipoidal nanoparticles in a cuprizone-induced demyelination model in rodents. The studies proved the efficacy of lipid-based nanoparticles containing DMF in a once-a-day dosage regimen over that of thrice-a-day plain DMF administration on crucial parameters like motor coordination, grip strength, mortality, body weight, and locomotor activity. However, neither blank lipid nor blank neuroprotective (vitamins A, D, and E) loaded nanoparticles were able to elicit any desirable behavioral response. Histopathological studies showed that the designed once-a-day DMF nanomedicines were well tolerated and rejuvenated the myelin sheath vis-à-vis the plain DMF thrice-a-day regimen. These findings provide proof of concept for a biocompatible nanomedicine for MS with tremendous promise for effective brain delivery and patient compliance on the grounds of a reduction in the dosage frequency.

Dimethyl fumarate blocks pro-inflammatory cytokine production via inhibition of TLR induced M1 and K63 ubiquitin chain formation.

PubMed

McGuire, Victoria A; Ruiz-Zorrilla Diez, Tamara; Emmerich, Christoph H; Strickson, Sam; Ritorto, Maria Stella; Sutavani, Ruhcha V; Weiβ, Anne; Houslay, Kirsty F; Knebel, Axel; Meakin, Paul J; Phair, Iain R; Ashford, Michael L J; Trost, Matthias; Arthur, J Simon C

2016-08-08

Dimethyl fumarate (DMF) possesses anti-inflammatory properties and is approved for the treatment of psoriasis and multiple sclerosis. While clinically effective, its molecular target has remained elusive - although it is known to activate anti-oxidant pathways. We find that DMF inhibits pro-inflammatory cytokine production in response to TLR agonists independently of the Nrf2-Keap1 anti-oxidant pathway. Instead we show that DMF can inhibit the E2 conjugating enzymes involved in K63 and M1 polyubiquitin chain formation both in vitro and in cells. The formation of K63 and M1 chains is required to link TLR activation to downstream signaling, and consistent with the block in K63 and/or M1 chain formation, DMF inhibits NFκB and ERK1/2 activation, resulting in a loss of pro-inflammatory cytokine production. Together these results reveal a new molecular target for DMF and show that a clinically approved drug inhibits M1 and K63 chain formation in TLR induced signaling complexes. Selective targeting of E2s may therefore be a viable strategy for autoimmunity.

Urinary β2 microglobulin can predict tenofovir disoproxil fumarate-related renal dysfunction in HIV-1-infected patients who initiate tenofovir disoproxil fumarate-containing antiretroviral therapy.

PubMed

Nishijima, Takeshi; Kurosawa, Takuma; Tanaka, Noriko; Kawasaki, Yohei; Kikuchi, Yoshimi; Oka, Shinichi; Gatanaga, Hiroyuki

2016-06-19

In nephrotoxicity induced by tenofovir disoproxil fumarate (TDF), tubular dysfunction precedes the decline in GFR, suggesting that tubular markers are more sensitive than estimated glomerular filtration rate (eGFR). The hypothesis that urinary β2 microglobulin (β2 M), a tubular function marker, can predict TDF-renal dysfunction in HIV-1-infected patients was tested. A single-center observational study. The inclusion criteria were: HIV-1-infected patients who started TDF-containing antiretroviral therapy from 2004 to 2013, urinary β2 M after and closest to the day of TDF initiation within 180 days (termed 'β2 M after TDF') was measured. The associations between 'β2 M after TDF' and four renal end points (>10 ml/min per 1.73 m decrement in eGFR relative to baseline, >20 decrement, >25% decrement, and eGFR < 60) were estimated with logistic regression model. The association between 'β2 M after TDF' and longitudinal changes in eGFR after initiation of TDF was estimated with a mixed-model. A total 655 study patients were analyzed (96% men, median age 38, median CD4 238 cells/μl, 63% treatment naïve). The median baseline eGFR was 117 ml/min per 1.73 m (IQR 110-125), and the median duration of TDF use was 3.32 years (IQR 2.02-5.31). 'β2 M after TDF' was significantly associated with more than 20 decrement in eGFR (P = 0.024) and more than 25% decrement (P = 0.014), and was marginally associated with eGFR less than 60 (P = 0.076). It was also significantly associated with the longitudinal eGFR after initiation of TDF (P < 0.0001). 'β2 M after TDF' of 1700 μg/l was identified as the optimal cutoff value for the prediction of longitudinal eGFR. Urinary β2 M measured within 180 days after initiation of TDF predicts renal dysfunction related to long-term TDF use.

Intrinsic Anaerobic Bioremediation of Hydrocarbons in Contaminated Subsurface Plumes and Marine Sediments

NASA Astrophysics Data System (ADS)

Nanny, M. A.; Nanny, M. A.; Suflita, J. M.; Suflita, J. M.; Davidova, I.; Kropp, K.; Caldwell, M.; Philp, R.; Gieg, L.; Rios-Hernandez, L. A.

2001-05-01

In recent years, several classes of petroleum hydrocarbons contaminating subsurface and marine environments have been found susceptible to anaerobic biodegradation using novel mechanisms entirely distinct from aerobic metabolic pathways. For example, the anaerobic decay of toluene can be initiated by the addition of the aryl methyl group to the double bond of fumarate, resulting in a benzylsuccinic acid metabolite. Our work has shown that an analogous mechanism also occurs with ethylbenzene and the xylene isomers, yielding 3-phenyl-1,2-butane dicarboxylic acid and methylbenzylsuccinic acid, respectively. Moreover, these metabolites have been detected in contaminated environments. Most recently, we have identified metabolites resulting from the initial attack of H26- or D26-n-dodecane during degradation by a sulfate-reducing bacterial culture. Using GC-MS, these metabolites were identified as fatty acids that result from C-H or C-D addition across the double bond of fumarate to give dodecylsuccinic acids in which all 26 protons or deuteriums of the parent alkane were retained. Further, when this enrichment culture was challenged with hexane or decane, hexylsuccinic acid or decylsuccinic acid were identified as resulting metabolites. Similarly, the study of an ethylcyclopentane-degrading sulfate-reducing enrichment produced a metabolite, which is consistent with the addition of fumarate to the parent substrate. These novel anaerobic addition products are characterized by similar, distinctive mass spectral (MS) features (ions specific to the succinic acid portion of the molecule) that can potentially be used to probe contaminated environments for evidence of intrinsic remediation of hydrocarbons. Indeed, analyses of water extracts from two gas condensate-contaminated sites resulted in the tentative detection of alkyl- and cycloalkylsuccinic acids ranging from C3 to C9, including ethylcyclopentyl-succinic acid. In water extracts collected from an area underlying a petroleum production plant, MS profiles consistent with the addition products of methylcycloalkenes were observed. This work helps attests to: 1) the extrapolatability of laboratory results to the field, 2) the unifying metabolic features for the anaerobic destruction of diverse types of hydrocarbons, and 3) how this information can be used to assess the intrinsic bioremediation processes in petroleum-contaminated environments.

Suppression of experimental cerebral malaria by disruption of malate:quinone oxidoreductase.

PubMed

Niikura, Mamoru; Komatsuya, Keisuke; Inoue, Shin-Ichi; Matsuda, Risa; Asahi, Hiroko; Inaoka, Daniel Ken; Kita, Kiyoshi; Kobayashi, Fumie

2017-06-12

Aspartate, which is converted from oxaloacetate (OAA) by aspartate aminotransferase, is considered an important precursor for purine salvage and pyrimidine de novo biosynthesis, and is thus indispensable for the growth of Plasmodium parasites at the asexual blood stages. OAA can be produced in malaria parasites via two routes: (i) from phosphoenolpyruvate (PEP) by phosphoenolpyruvate carboxylase (PEPC) in the cytosol, or (ii) from fumarate by consecutive reactions catalyzed by fumarate hydratase (FH) and malate:quinone oxidoreductase (MQO) in the mitochondria of malaria parasites. Although PEPC-deficient Plasmodium falciparum and Plasmodium berghei (rodent malaria) parasites show a growth defect, the mutant P. berghei can still cause experimental cerebral malaria (ECM) with similar dynamics to wild-type parasites. In contrast, the importance of FH and MQO for parasite viability, growth and virulence is not fully understood because no FH- and MQO-deficient P. falciparum has been established. In this study, the role of FH and MQO in the pathogenicity of asexual-blood-stage Plasmodium parasites causing cerebral malaria was examined. First, FH- and MQO-deficient parasites were generated by inserting a luciferase-expressing cassette into the fh and mqo loci in the genome of P. berghei ANKA strain. Second, the viability of FH-deficient and MQO-deficient parasites that express luciferase was determined by measuring luciferase activity, and the effect of FH or MQO deficiency on the development of ECM was examined. While the viability of FH-deficient P. berghei was comparable to that of control parasites, MQO-deficient parasites exhibited considerably reduced viability. FH activity derived from erythrocytes was also detected. This result and the absence of phenotype in FH-deficient P. berghei parasites suggest that fumarate can be metabolized to malate by host or parasite FH in P. berghei-infected erythrocytes. Furthermore, although the growth of FH- and MQO-deficient parasites was impaired, the development of ECM was suppressed only in mice infected with MQO-deficient parasites. These findings suggest that MQO-mediated mitochondrial functions are required for development of ECM of asexual-blood-stage Plasmodium parasites.

[Not Available].

PubMed

Burgot, J L

1978-04-01

Maleic, fumaric, tartaric, glutaric and adipic acids are titrated directly with sodium hydroxide by means of an automatic thermometric titrimeter. The titration curves have two break-points, corresponding to the successive neutralization of the two acid groups. Previous standardization permits measurement of the heats of neutralization, from which the enthalpies of dissociation can be deduced. From 0.3 to 1 mmole of acid can be titrated with a relative standard deviation of about 3%.

Mortality from Listeria monocytogenes meningoencephalitis following escalation to alemtuzumab therapy for relapsing-remitting Multiple Sclerosis.

PubMed

Canham, L J W; Manara, A; Fawcett, J; Rolinski, M; Mortimer, A; Inglis, K E A; Cottrell, D A

2018-05-18

We report the case of a patient who died from the rare complication of Listeriosis in the immediate phase following alemtuzumab administration one month after discontinuing dimethyl fumarate (DMF). There is considerable overlap with typical post-infusion symptoms therefore high surveillance and low threshold for empirical or possible prophylactic antibiotic therapy is advocated. Copyright © 2018. Published by Elsevier B.V.

Identification and characterization of two new derivatives of chlorogenic acids in Arnica (Arnica montana L.) flowers by high-performance liquid chromatography/tandem mass spectrometry.

PubMed

Jaiswal, Rakesh; Kuhnert, Nikolai

2011-04-27

Arnica montana is a medicinally important plant due to its broad health effects, and it is used in Ayurvedic, Homeopathic, Unani, and folk medicines. We have used LC-MS(n) (n = 2-5) to detect and characterize in Arnica flowers 11 quantitatively minor fumaric and methoxyoxalic acid-containing chlorogenic acids, nine of them not previously reported in nature. These comprise 1,5-dicaffeoyl-3-methoxyoxaloylquinic acid, 1,3-dicaffeoyl-4-methoxyoxaloylquinic acid, 3,5-dicaffeoyl-4-methoxyoxaloylquinic acid, and 1-methoxyoxaloyl-4,5-dicaffeoylquinic acid (M(r) 602); 3-caffeoyl-4-feruloyl-5-methoxyoxaloylquinic acid and 3-feruloyl-4-methoxyoxaloyl-5-caffeoylquinic acid (M(r) 616); 1,5-dicaffeoyl-4-fumaroyl and 1,5-dicaffeoyl-3-fumaroylquinic acid (M(r) 614); 3,5-dicaffeoyl-1,4-dimethoxyoxaloylquinic acid (M(r) 688); and 1-methoxyoxaloyl-3,4,5-tricaffeoylquinic acid and 1,3,4-tricaffeoyl-5-methoxyoxaloylquinic acid (M(r) 764). All of the structures have been assigned on the basis of LC-MS(n) patterns of fragmentation, relative hydrophobicity, and analogy of fragmentation patterns if compared to caffeoylquinic acids. This is the first time when fumaric acid-containing chlorogenic acids are reported in nature.

Reformulating Polycaprolactone Fumarate to Eliminate Toxic Diethylene Glycol: Effects of Polymeric Branching and Autoclave Sterilization on Material Properties

PubMed Central

Runge, M. Brett; Wang, Huan; Spinner, Robert J; Windebank, Anthony J; Yaszemski, Michael J.

2011-01-01

Polycaprolactone fumarate (PCLF) is a cross-linkable derivate of polycaprolactone diol that has been shown to be an effective nerve conduit material that supports regeneration across segmental nerve defects and has warranted future clinical trials. Degradation of the previously studied PCLF (PCLFDEG) releases toxic small molecules of diethylene glycol used as the initiator for the synthesis of polycaprolactone diol. In an effort to eliminate this toxic degradation product we present a strategy for the synthesis of PCLF from either propylene glycol (PCLFPPD) or glycerol (PCLFGLY). PCLFPPD is linear and resembles the previously studied PCLFDEG, while PCLFGLY is branched and exhibits dramatically different material properties. The synthesis and characterization of their thermal, rheological, and mechanical properties are reported. The results show that the linear PCLFPPD has material properties similar to the previously studied PCLFDEG. The branched PCLFGLY exhibits dramatically lower crystalline properties resulting in lower rheological and mechanical moduli, and is therefore a more compliant material. In addition, the question of an appropriate FDA approvable sterilization method is addressed. This study shows that autoclave sterilization on PCLF materials is an acceptable sterilization method for cross-linked PCLF and has minimal effect on the PCLF thermal and mechanical properties. PMID:21911087

Loss of Fumarate Hydratase and Aberrant Protein Succination Detected With S-(2-Succino)-Cysteine Staining to Identify Patients With Multiple Cutaneous and Uterine Leiomyomatosis and Hereditary Leiomyomatosis and Renal Cell Cancer Syndrome.

PubMed

Llamas-Velasco, Mar; Requena, Luis; Adam, Julie; Frizzell, Norma; Hartmann, Arndt; Mentzel, Thomas

2016-12-01

Hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome is an autosomal dominant disorder caused by heterozygotic germline mutations in fumarate hydratase (FH) with incomplete penetrance, and clinically challenging to diagnose. Immunohistochemical stainings may favor an earlier diagnosis. The authors have tested 31 smooth muscle neoplasms. Ten of the 13 lesions from patients with HLRCC syndrome showed negative FH staining. Most sporadic piloleiomyomas presented strongly positive FH staining although 5 cases were negative. Sensitivity of FH staining in our series is 83.3% but specificity is 75%. Anti-S-(2-succino)-cysteine (2SC) showed the opposite intensity staining pattern and showed great correlation with anti-FH (rho spearman = -0.797). Anti-2SC staining increased the diagnostic accuracy in 19% of the cases. The main limitation of this study is the lack additional clinical data to further classify the cases as the case inclusion was histopathological. Negative FH staining could indicate a high risk of HLRCC but it could also suggest the presence of a syndrome in up to 25% of sporadic cases. Thus, when there is a doubtful case, anti-2SC may be added to exclude the syndrome if a negative staining is found.

Structural Insights into the Molecular Design of Flutolanil Derivatives Targeted for Fumarate Respiration of Parasite Mitochondria.

PubMed

Inaoka, Daniel Ken; Shiba, Tomoo; Sato, Dan; Balogun, Emmanuel Oluwadare; Sasaki, Tsuyoshi; Nagahama, Madoka; Oda, Masatsugu; Matsuoka, Shigeru; Ohmori, Junko; Honma, Teruki; Inoue, Masayuki; Kita, Kiyoshi; Harada, Shigeharu

2015-07-07

Recent studies on the respiratory chain of Ascaris suum showed that the mitochondrial NADH-fumarate reductase system composed of complex I, rhodoquinone and complex II plays an important role in the anaerobic energy metabolism of adult A. suum. The system is the major pathway of energy metabolism for adaptation to a hypoxic environment not only in parasitic organisms, but also in some types of human cancer cells. Thus, enzymes of the pathway are potential targets for chemotherapy. We found that flutolanil is an excellent inhibitor for A. suum complex II (IC50 = 0.058 μM) but less effectively inhibits homologous porcine complex II (IC50 = 45.9 μM). In order to account for the specificity of flutolanil to A. suum complex II from the standpoint of structural biology, we determined the crystal structures of A. suum and porcine complex IIs binding flutolanil and its derivative compounds. The structures clearly demonstrated key interactions responsible for its high specificity to A. suum complex II and enabled us to find analogue compounds, which surpass flutolanil in both potency and specificity to A. suum complex II. Structures of complex IIs binding these compounds will be helpful to accelerate structure-based drug design targeted for complex IIs.

A 68-year old male presenting with rhabdomyolysis-associated acute kidney injury following concomitant use of elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate and pravastatin/fenofibrate: a case report.

PubMed

Suttels, Veronique; Florence, Eric; Leys, John; Vekemans, Marc; Van den Ende, Jef; Vlieghe, Erika; Kenyon, Chris

2015-09-08

We present what we believe to be the first case in the literature of rhabdomyolysis-induced renal failure caused by a probable drug interaction between elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate (EVG/COBI/FTC/TDF) and pravastatin/fenofibrate. A 68-year old Caucasian man presented with progressive pain in both legs two weeks after commencing treatment with EVG/COBI/FTC/TDF. He was found to have biochemical evidence of rhabdomyolysis and acute renal failure. We emphasize the need for post marketing surveillance of adverse effects of new products. Pharmacokinetic studies are necessary to investigate the levels of pravastatin in patients taking COBI and fenofibrate with and without other comorbidities. Meanwhile, we suggest that creatine kinase levels should be monitored and patients advised to report myalgias when using concomitant EVG/COBI/FTC/TDF and pravastatin/fenofibrate. This case serves as an important reminder to use estimated glomerular filtration rates rather than serum creatinine levels when choosing new medications. If potentially nephrotoxic combinations are started in patients with borderline estimated glomerular filtration rates, it may be prudent to check these filtration rates more frequently than usual. In patients with reduced estimated glomerular filtration rates, potentially nephrotoxic combinations should be avoided wherever possible.

Reductive dehalogenation of carbon tetrachloride by Escherichia coli K-12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Criddle, C.S.; DeWitt, J.T.; McCarty, P.L.

1990-11-01

The formation of radicals from carbon tetrachloride (CT) is often invoked to explain the product distribution resulting from its transformation. Radicals formed by reduction of CT presumably react with constituents of the surrounding milieu to give the observed product distribution. The patterns of transformation observed in this work were consistent with such as hypothesis. In cultures of Escherichia coli K-12, the pathways and rates of CT transformation were dependent on the electron acceptor condition of the media. Use of oxygen and nitrate as electron acceptors generally prevented CT metabolism. At low oxygen levels ({approximately}1%), however, transformation of ({sup 14}C)CT tomore » {sup 14}CO{sub 2} and attachment to cell material did occur, in accord with reports of CT fate in mammalian cell cultures. Under fumarate-respiring conditions, ({sup 14}C)CT was recovered as {sup 14}CO{sub 2}, chloroform, and a nonvolatile fraction. In contrast, fermenting conditions resulted in more chloroform, more cell-bound {sup 14}C, and almost no {sup 14}CO{sub 2}. Rates of transformation of CT were faster under fermenting conditions than under fumarate-respiring conditions. Transformation rates also decreased over time, suggesting the gradual exhaustion of transformation activity. This loss was modeled with a simple exponential decay term.« less

Structural Insights into the Molecular Design of Flutolanil Derivatives Targeted for Fumarate Respiration of Parasite Mitochondria

PubMed Central

Inaoka, Daniel Ken; Shiba, Tomoo; Sato, Dan; Balogun, Emmanuel Oluwadare; Sasaki, Tsuyoshi; Nagahama, Madoka; Oda, Masatsugu; Matsuoka, Shigeru; Ohmori, Junko; Honma, Teruki; Inoue, Masayuki; Kita, Kiyoshi; Harada, Shigeharu

2015-01-01

Recent studies on the respiratory chain of Ascaris suum showed that the mitochondrial NADH-fumarate reductase system composed of complex I, rhodoquinone and complex II plays an important role in the anaerobic energy metabolism of adult A. suum. The system is the major pathway of energy metabolism for adaptation to a hypoxic environment not only in parasitic organisms, but also in some types of human cancer cells. Thus, enzymes of the pathway are potential targets for chemotherapy. We found that flutolanil is an excellent inhibitor for A. suum complex II (IC50 = 0.058 μM) but less effectively inhibits homologous porcine complex II (IC50 = 45.9 μM). In order to account for the specificity of flutolanil to A. suum complex II from the standpoint of structural biology, we determined the crystal structures of A. suum and porcine complex IIs binding flutolanil and its derivative compounds. The structures clearly demonstrated key interactions responsible for its high specificity to A. suum complex II and enabled us to find analogue compounds, which surpass flutolanil in both potency and specificity to A. suum complex II. Structures of complex IIs binding these compounds will be helpful to accelerate structure-based drug design targeted for complex IIs. PMID:26198225

Effect of Prevascularization on In Vivo Vascularization of Poly(Propylene fumarate)/Fibrin Scaffolds

PubMed Central

Mishra, Ruchi; Roux, Brianna M.; Posukonis, Megan; Bodamer, Emily; Brey, Eric M.; Fisher, John P.; Dean, David

2016-01-01

The importance of vascularization in the field of bone tissue engineering has been established by previous studies. The present work proposes a novel poly(propylene fumarate) (PPF)/fibrin composite scaffold for the development of vascularized neobone tissue. The effect of prevascularization (i.e., in vitro pre-culture prior to implantation) with human mesenchymal stem cells (hMSCs) and human umbilical vein endothelial cells (HUVECs) on in vivo vascularization of scaffolds was determined. Five conditions were studied: no pre-culture (NP), 1 week preculture (1P), 2 week pre-culture (2P), 3 week pre-culture (3P), and scaffolds without cells (control, C). Scaffolds were implanted subcutaneously in a severe combined immunodeficiency (SCID) mice model for 9 days. During in vitro studies, CD31 staining showed a significant increase in vascular network area over 3 weeks of culture. Vascular density was significantly higher in vivo when comparing NP to 3P groups. Immunohistochemical staining of human CD-31 expression indicated spreading of vascular networks with increasing pre-culture time. These vascular networks were perfused with mouse blood indicated by perfused lectin staining in human CD-31 positive vessels. Our results demonstrate that in vitro prevascularization supports in vivo vascularization in PPF/fibrin scaffolds. PMID:26606451

Safety of Oral Tenofovir Disoproxil Fumarate-Based Pre-Exposure Prophylaxis for HIV Prevention

PubMed Central

Mugwanya, Kenneth K.; Baeten, Jared M.

2016-01-01

Introduction Tenofovir disoproxil fumarate (TDF)-based pre-exposure prophylaxis is a novel HIV prevention strategy for individuals at increased sexual risk for HIV infection. For any biomedical prevention intervention, the bar for tolerating adverse effects in healthy persons is high compared to therapeutic interventions. Areas covered We provide a concise summary of the clinical safety of TDF-based pre-exposure prophylaxis with focus on TDF-related effects on tolerability and side effects, kidney function, bone density, HIV resistance, sexual and reproductive health. The evidence base for this review is derived from a literature search of both randomized and observational studies evaluating efficacy and safety of TDF-based PrEP, TDF alone or in combination with emtricitabine, identified from PUBMED and EMBASE electronic databases, clinicaltrials.gov and major HIV conferences. Expert opinion TDF-based pre-exposure prophylaxis is a potent intervention against HIV acquisition when taken which is generally safe and well tolerated. The risk of the small, non-progressive, and reversible decline in glomerular filtration rate and bone mineral density as well as the potential selection for drug resistance associated with PrEP are outweighed, at the population level and broadly for individuals, by PrEP’s substantial reduction in the risk of HIV infection. PMID:26634852

A study of the properties of compacts from silicified microcrystalline celluloses.

PubMed

Muzíková, Jitka; Nováková, Petra

2007-07-01

The paper deals with a study of tensile strength and disintegration time of compacts made from silicified microcrystalline celluloses, Prosolv SMCC 90, and Prosolv HD 90, in dependence on compression force, addition of two types of lubricants, and two active ingredients. The lubricants were magnesium stearate and sodium stearyl fumarate in a concentration of 0.5%, the active ingredients being ascorbic acid and acetylsalicylic acid in a concentration of 50%. Prosolv SMCC 90 proved to be better compatible than Prosolv HD 90; the compacts were of higher strength, which was markedly increased with increasing compression force. Prosolv HD 90 was more sensitive to additions of lubricants, and a greater decrease in strength was recorded due to the influence of sodium stearyl fumarate. The effect of lubricants on the strength of compacts in the presence of active ingredients was not identical. The disintegration time of compacts from Prosolv HD 90 without as well as with lubricants was shorter than from Prosolv SMCC 90 and was increasing with increasing compression force. Disintegration time was increased with added lubricants, and it was markedly shortened by addition of active ingredients. Compacts containing ascorbic acid possessed a shorter disintegration time than those containing acetylsalicylic acid, and it was not markedly influenced by the presence of lubricants.

The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aklujkar, Muktak; Krushkal, Julia; DiBartolo, Genevieve

Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recentlymore » in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae.« less

Development of Repair Materials for Avulsive Combat-Type Maxillofacial Injuries.

DTIC Science & Technology

1981-11-01

sone. A sample of 0.2702 grams of the resulting corn- nitic acid. tsocitric acid, alpha - ketoglutaric acid. suc- position was shaped into the form of a...polylactic acid and inorganic materials such as calcium carbonate or calcium sulfate. The chemistry of the system proposed for development includes...acid and high molecular weight poly(propylene fumarate) were synthesized at Dynatech to be used as organic fillers. Inorganic fil- lers such as calcium

European Congress on Biotechnology (4th) Held in Amsterdam, The Netherlands, on June 1987

DTIC Science & Technology

1988-02-19

car be used and thus higher Nmaraso Fumarate enzyme loadings can be achieved with a Glucose isomerase High- fructose corn syrup large effectiveness...is only after most of the the following reactions: glucose + oxy- glucose has been metabolized that aerobic gen + glucose oxidasa + water - gluconic...are obtained by mixing water solutions of two water -soluble * Biocatalysis polymers. Both phases have a high water * Animal cell cultures content and do

Evaluating 3D-printed biomaterials as scaffolds for vascularized bone tissue engineering.

PubMed

Wang, Martha O; Vorwald, Charlotte E; Dreher, Maureen L; Mott, Eric J; Cheng, Ming-Huei; Cinar, Ali; Mehdizadeh, Hamidreza; Somo, Sami; Dean, David; Brey, Eric M; Fisher, John P

2015-01-07

There is an unmet need for a consistent set of tools for the evaluation of 3D-printed constructs. A toolbox developed to design, characterize, and evaluate 3D-printed poly(propylene fumarate) scaffolds is proposed for vascularized engineered tissues. This toolbox combines modular design and non-destructive fabricated design evaluation, evaluates biocompatibility and mechanical properties, and models angiogenesis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Geobiology of Marine Magnetotactic Bacteria

DTIC Science & Technology

2006-06-01

acids (e.g. lactate, acetate, oxalate , succinate, fumarate, malate, and citrate) which are continually transported into the soil, in part due to the...microbial mats, and hydrothermal vent waters. J Environ Monit 3: 61-66. 177 Lyons TW (1997) Sulfur isotopic trends and pathways of iron sulfide formation in...case in sediments, microbial mats, and hydrothermal vent waters. J Environ Monit 3: 61-66. 200 O’Sullivan DW, Hanson Jr AK, Kester DR (1997) The

Tenofovir alafenamide versus tenofovir disoproxil fumarate: is there a true difference in efficacy and safety?

PubMed

Hill, Andrew; Hughes, Sophie L; Gotham, Dzintars; Pozniak, Anton L

2018-04-01

Higher plasma tenofovir concentrations are associated with higher risks of renal and bone adverse events. The pharmacokinetic boosters ritonavir (RTV) and cobicistat (COBI) significantly increase plasma area under the curve (AUC) concentrations of tenofovir disoproxil fumarate (TDF), by 25-37%. When combined with RTV or COBI, the dose of tenofovir alafenamide (TAF) is lowered from 25 mg to 10 mg daily, but the TDF dose is maintained at 300 mg daily. To assess the differences in safety and efficacy between tenofovir alafenamide (TAF) and tenofovir disoproxil fumarate (TDF) in regimens with and without the pharmacokinetic boosters RTV and COBI. A PubMed/Embase search inclusive of dates up to 17 July 2017 identified 11 randomised head-to-head trials (8111 patients) of TDF versus TAF. The Mantel-Haenszel method was used to calculate pooled risk differences and 95% confidence intervals using random-effects models. A pre-defined sub-group analysis compared TAF with TDF, either when boosted with RTV or COBI, or when unboosted. Nine clinical trials compared TAF and TDF for treatment of HIV-1 and two were for hepatitis B treatment. The eleven clinical trials documented 4574 patients with boosting RTV or COBI in both arms, covering 7198 patient-years of follow-up. Some 3537 patients received unboosted regimens, totalling 3595 patient-years of follow-up. Boosted TDF-treated patients showed borderline lower HIV RNA suppression <50 copies/mL ( P =0.05), more bone fractures ( P =0.04), larger decreases in bone mineral density ( P <0.001), and more discontinuations for bone ( P =0.03) or renal ( P =0.002) adverse events. By contrast, there were no significant differences in HIV RNA suppression rates or clinical safety endpoints between unboosted TAF and unboosted TDF. TDF boosted with RTV or COBI was associated with higher risks of bone and renal adverse events, and lower HIV RNA suppression rates, compared with TAF. By contrast, when ritonavir and cobicistat were not used, there were no efficacy differences between TAF and TDF, and marginal differences in safety. The health economic value of TAF versus low-cost generic TDF may be limited when these drugs are used without cobicistat or ritonavir.

Environmental Compliance Assessment System (USA ECAS)

DTIC Science & Technology

1991-09-01

Fuberidazole 100/10,000 3878-19-1 Fulminic acid , mercu- 10 P065 628-86-4 ry(I1) salt Fumaric acid 5000 110-17-8 Furan, tetrahydro- 1000 LT213 109-99-9 Furan...etc.)? S. Does the installation have any bulk acid storage? 6. Does the installation store batteries and/or have a battery reclamation point? I...gas turbines (greater than 1 MBtuhr) - bulk gasoline terminals - municipal waste combustors - sulfuric and nitric acid plants - rotogravure printers

Interconversion of biologically important carboxylic acids by radiation

NASA Technical Reports Server (NTRS)

Negron-Mendoza, A.; Ponnamperuma, C.

1978-01-01

The interconversion of a group of biologically important polycarboxylic acids (acetic, fumaric, malic, malonic, succinic, citric, isocitric, tricarballylic) under gamma-ray or ultraviolet radiation was investigated. The formation of high molecular weight compounds was observed in all cases. Succinic acid was formed in almost all radiolysis experiments. Citric, malonic, and succinic acids appeared to be relatively insensitive to radiation. Interconversion of the polycarboxylic acids studied may have occurred under the effect of radiation in the prebiotic earth.

Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-reducing microorganism.

PubMed Central

Caccavo, F; Lonergan, D J; Lovley, D R; Davis, M; Stolz, J F; McInerney, M J

1994-01-01

A dissimilatory metal- and sulfur-reducing microorganism was isolated from surface sediments of a hydrocarbon-contaminated ditch in Norman, Okla. The isolate, which was designated strain PCA, was an obligately anaerobic, nonfermentative nonmotile, gram-negative rod. PCA grew in a defined medium with acetate as an electron donor and ferric PPi, ferric oxyhydroxide, ferric citrate, elemental sulfur, Co(III)-EDTA, fumarate, or malate as the sole electron acceptor. PCA also coupled the oxidation of hydrogen to the reduction of Fe(III) but did not reduce Fe(III) with sulfur, glucose, lactate, fumarate, propionate, butyrate, isobutyrate, isovalerate, succinate, yeast extract, phenol, benzoate, ethanol, propanol, or butanol as an electron donor. PCA did not reduce oxygen, Mn(IV), U(VI), nitrate, sulfate, sulfite, or thiosulfate with acetate as the electron donor. Cell suspensions of PCA exhibited dithionite-reduced minus air-oxidized difference spectra which were characteristic of c-type cytochromes. Phylogenetic analysis of the 16S rRNA sequence placed PCA in the delta subgroup of the proteobacteria. Its closest known relative is Geobacter metallireducens. The ability to utilize either hydrogen or acetate as the sole electron donor for Fe(III) reduction makes strain PCA a unique addition to the relatively small group of respiratory metal-reducing microorganisms available in pure culture. A new species name, Geobacter sulfurreducens, is proposed. Images PMID:7527204

Effect of different iron compounds on rheological and technological parameters as well as bioaccessibility of minerals in whole wheat bread.

PubMed

Rebellato, Ana Paula; Bussi, Jéssica; Silva, Joyce Grazielle Siqueira; Greiner, Ralf; Steel, Caroline Joy; Pallone, Juliana Azevedo Lima

2017-04-01

This study aimed at investigating the effect of iron compounds used in whole wheat flour (WWF) fortification, both on rheological properties of the dough and on bread technological quality. Furthermore, bioaccessibility of iron (Fe), zinc (Zn) and calcium (Ca) in the final breads was determined. Rheological properties (mainly dough development time, stability, mixing tolerance index, resistance to extension and ratio number) of the dough and the technological quality of bread (mainly oven spring and cut opening) were altered. However, producing roll breads fortified with different iron compounds was still possible. NaFeEDTA (ferric sodium ethylene diamine tetra acetic acid) proved to be the most effective iron compound in the fortification of WWF, since it presented the highest levels of solubility (44.80%) and dialysability (46.14%), followed by microencapsulated ferrous fumarate (FFm). On the other hand, the microencapsulated ferrous sulfate (FSm) and reduced iron presented the lowest solubility (5.40 and 18.30%, respectively) and dialysability (33.12 and 31.79%, respectively). Zn dialysis was positively influenced by NaFeEDTA, FSm, and ferrous fumarate. As for Ca, dialysis was positively influenced by FSm and negatively influenced by FFm. The data indicated that there is a competitive interaction for the absorption of these minerals in whole wheat roll breads, but all studied minerals can be considered bioaccessible. Copyright © 2017 Elsevier Ltd. All rights reserved.

Spray drying of budesonide, formoterol fumarate and their composites-II. Statistical factorial design and in vitro deposition properties.

PubMed

Tajber, L; Corrigan, O I; Healy, A M

2009-02-09

The aim of this study was to investigate the effect of changing spray drying parameters on the production of a budesonide/formoterol fumarate 100:6 (w/w) composite. The systems were spray dried as solutions from 95% ethanol/5% water (v/v) using a Büchi 191-Mini Spray Dryer. A 2(5-1) factorial design study was undertaken to assess the consequence of altering spray drying processing variables on particle characteristics. The processing parameters that were studied were inlet temperature, spray drier airflow rate, pump rate, aspirator setting and feed concentration. Each batch of the resulting powder was characterised in terms of thermal and micromeritic properties as well as an in vitro deposition by twin impinger analysis. Overall, the parameter that had the greatest influence on each response investigated was production yield - airflow (higher airflow giving greater yields), median particle size - airflow (higher airflow giving smaller particle sizes) and Carr's compressibility index - feed concentration (lower feed concentration giving smaller Carr's indices). A six- to seven-fold difference in respirable fraction can be observed by changing the spray drying process parameters. The co-spray dried composite system which displayed best in vitro deposition characteristics, showed a 2.6-fold increase in respirable fraction in the twin impinger experiments and better dose uniformity compared with the physical mix of micronised powders.

A fermentative approach towards optimizing directed biosynthesis of fumaric acid by Rhizopus oryzae 1526 utilizing apple industry waste biomass.

PubMed

Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

2015-12-01

The present research account deals with the bioproduction of fumaric acid (FA) from apple pomace ultrafiltration sludge (APUS) and apple pomace (AP) through fermentation. The filamentous fungus Rhizopus oryzae 1526 was used as a biocatalyst and its morphological impact on FA production was analysed in detail. For submerged fermentation, 40 g L(-1) of total solids concentration of APUS, pH 6.0, 30 °C, 200 rpm flask shaking speed and 72 h of incubation were found to be optimum for FA production (25.2 ± 1.0 g L(-1), 0.350 g (L(-1) h(-1))). Broth viscosity (cP), residual reducing sugar (g L(-1)) and ethanol (g L(-1)) produced as by-product, were also analysed. Plastic trays were used for solid state fermentation and at optimized level of moisture and incubation period, 52 ± 2.67 g FA per kg dry weight of AP was obtained. Changes in the total phenolic content (mg g(-1) dry weight of AP) were monitored at regular intervals. Utilization of APUS and AP for the directed synthesis of the high-value platform chemical FA by the fungal strain R. oryzae 1526 was an excellent display of fungal physiological and morphological control over a fermentative product. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Reformulating polycaprolactone fumarate to eliminate toxic diethylene glycol: effects of polymeric branching and autoclave sterilization on material properties.

PubMed

Runge, M Brett; Wang, Huan; Spinner, Robert J; Windebank, Anthony J; Yaszemski, Michael J

2012-01-01

Polycaprolactone fumarate (PCLF) is a cross-linkable derivative of polycaprolactone diol that has been shown to be an effective nerve conduit material that supports regeneration across segmental nerve defects and has warranted future clinical trials. Degradation of PCLF (PCLF(DEG)) releases toxic small molecules of diethylene glycol used as the initiator for the synthesis of polycaprolactone diol. In an effort to eliminate this toxic degradation product we present a strategy for the synthesis of PCLF from either propylene glycol (PCLF(PPD)) or glycerol (PCLF(GLY)). PCLF(PPD) is linear and resembles the previously studied PCLF(DEG), while PCLF(GLY) is branched and exhibits dramatically different material properties. The synthesis and characterization of their thermal, rheological, and mechanical properties are reported. The results show that the linear PCLF(PPD) has material properties similar to the previously studied PCLF(DEG). The branched PCLF(GLY) exhibits dramatically lower crystalline properties resulting in lower rheological and mechanical moduli, and is therefore a more compliant material. In addition, the question of an appropriate Food and Drug Administration approvable sterilization method is addressed. This study shows that autoclave sterilization of PCLF materials is an acceptable sterilization method for cross-linked PCLF and has minimal effect on the PCLF thermal and mechanical properties. Copyright © 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Wirksamkeit und Sicherheit von Fumarsäureestern in Kombination mit Phototherapie bei Patienten mit moderater bis schwerer Plaque-Psoriasis (FAST).

PubMed

Weisenseel, Peter; Reich, Kristian; Griemberg, Wiebke; Merten, Katharina; Gröschel, Christine; Gomez, Natalie Nunez; Taipale, Kirsi; Bräu, Beate; Zschocke, Ina

2017-02-01

Die Behandlung von Psoriasis-Patienten mit einer Kombination aus Fumarsäureestern (FSE, Fumaderm ® ) und Phototherapie (UV) ist verbreitet, wurde aber im Rahmen von Studien wenig untersucht. Bisher liegen lediglich Daten aus einer kleinen Pilotstudie vor. Intention dieser Studie war, eine FSE/UV-Kombinationsbehandlung an einem größeren Patientenkollektiv mit mittelschwerer bis schwerer Psoriasis zu untersuchen. In dieser prospektiven, multizentrischen, nichtinterventionellen Studie wurden Daten von Patienten mit FSE/UV-Kombinationstherapie hinsichtlich der Wirksamkeit (PGA' PASI, DLQI, EQ-5D), Sicherheit und Dosierung über einen Zeitraum von zwölf Monaten erfasst und mit Daten einer retrospektiven Studie mit FSE-Monotherapie verglichen. Es wurden Daten von 363 Patienten ausgewertet. Unter der Kombinationstherapie verbesserten sich alle Wirksamkeitsparameter deutlich. Im Vergleich zur Monotherapie mit FSE konnte durch die Kombination mit UV ein schnellerer Wirkeintritt erzielt werden, wobei nach zwölf Monaten kein Unterschied in der Wirksamkeit bestand. Die Dauer und Art der Phototherapie zeigte keinen Einfluss auf die Wirksamkeitsparameter. Allgemein wurde die Kombinationstherapie gut vertragen. Unerwünschte Ereignisse wurden bei 7 % der Patienten berichtet. Die FSE/UV Kombinationstherapie zeigt eine gute Wirksamkeit und Verträglichkeit und kann zu einem schnelleren Wirkeintritt führen. Eine Kombinationstherapie erscheint vor allem in den ersten drei Monaten der FSE Behandlung sinnvoll. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2010-05-01

O(6)-Benzylguanine; (-)-Gossypol; Abatacept, AC-2592, Adalimumab, AIDSVAX gp120 B/E, Alemtuzumab, Aliskiren fumarate, ALVAC E120TMG, Ambrisentan, Amlodipine, Anakinra, Aripiprazole, Armodafinil, Atomoxetine hydrochloride, Avotermin; Bevacizumab, BIBW-2992, Bortezomib, Bosentan, Botulinum toxin type B; Canakinumab, CAT-354, Ciclesonide, CMV gB vaccine, Corifollitropin alfa, Daptomycin, Darbepoetin alfa, Dasatinib, Denosumab; EndoTAG-1, Eplerenone, Esomeprazole sodium, Eszopiclone, Etoricoxib, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; F-50040, Fesoterodine fumavate, Fondaparinux sodium, Fulvestrant; Gabapentin enacarbil, Golimumab; Imatinib mesylate, Inhalable human insulin, Insulin glargine, Ivabradine hydrochloride; Lercanidipine hydrochloride/enalapril maleate, Levosimendan, Liposomal vincristine sulfate, Liraglutide; MDV-3100, Mometasone furoate/formoterol fumavate, Multiepitope CTL peptide vaccine, Mycophenolic acid sodium salt, Nabiximols, Natalizumab, Nesiritide; Obeticholic acid, Olmesartan medoxomil, Omalizumab, Omecamtiv mecarbil; Paclitaxel-eluting stent, Paliperidone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, Polymyxin B nonapeptide, PORxin-302, Prasugrel, Pregabalin, Pridopidine; Ranelic acid distrontium salt, Rasagiline mesilate, rDEN4delta30-4995, Recombinant human relaxin H2, rhFSH, Rilonacept, Rolofylline, Rosiglitazone maleate/metformin hydrochloride, Rosuvastatin calcium, Rotigotine; Salcaprozic acid sodium salt, Sirolimus-eluting stent, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tapentadol hydrochloride, Temsirolimus, Tenofovir, Tenofovir disoproxil fumarate, Teriparatide, Tiotropium bromide, Tocilizumab, Tolvaptan, Tozasertib, Treprostinil sodium; Ustekinumab; Vardenafil hydrochloride hydrate, Varenicline tartrate, Vatalanib succinate, Voriconazole, Vorinostat; Zotarolimus-eluting stent. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

An understanding of modified release matrix tablets behavior during drug dissolution as the key for prediction of pharmaceutical product performance - case study of multimodal characterization of quetiapine fumarate tablets.

PubMed

Kulinowski, Piotr; Woyna-Orlewicz, Krzysztof; Rappen, Gerd-Martin; Haznar-Garbacz, Dorota; Węglarz, Władysław P; Dorożyński, Przemysław P

2015-04-30

Motivation for the study was the lack of dedicated and effective research and development (R&D) in vitro methods for oral, generic, modified release formulations. The purpose of the research was to assess multimodal in vitro methodology for further bioequivalence study risk minimization. Principal results of the study are as follows: (i) Pharmaceutically equivalent quetiapine fumarate extended release dosage form of Seroquel XR was developed using a quality by design/design of experiment (QbD/DoE) paradigm. (ii) The developed formulation was then compared with originator using X-ray microtomography, magnetic resonance imaging and texture analysis. Despite similarity in terms of compendial dissolution test, developed and original dosage forms differed in micro/meso structure and consequently in mechanical properties. (iii) These differences were found to be the key factors of failure of biorelevant dissolution test using the stress dissolution apparatus. Major conclusions are as follows: (i) Imaging methods allow to assess internal features of the hydrating extended release matrix and together with the stress dissolution test allow to rationalize the design of generic formulations at the in vitro level. (ii) Technological impact on formulation properties e.g., on pore formation in hydrating matrices cannot be overlooked when designing modified release dosage forms. Copyright © 2015 Elsevier B.V. All rights reserved.

Organic acids from root exudates of banana help root colonization of PGPR strain Bacillus amyloliquefaciens NJN-6

PubMed Central

Yuan, Jun; Zhang, Nan; Huang, Qiwei; Raza, Waseem; Li, Rong; Vivanco, Jorge M.; Shen, Qirong

2015-01-01

The successful colonization of plant growth promoting rhizobacteria (PGPR) in the rhizosphere is an initial and compulsory step in the protection of plants from soil-borne pathogens. Therefore, it is necessary to evaluate the role of root exudates in the colonization of PGPR. Banana root exudates were analyzed by high pressure liquid chromatography (HPLC) which revealed exudates contained several organic acids (OAs) including oxalic, malic and fumaric acid. The chemotactic response and biofilm formation of Bacillus amyloliquefaciens NJN-6 were investigated in response to OA’s found in banana root exudates. Furthermore, the transcriptional levels of genes involved in biofilm formation, yqxM and epsD, were evaluated in response to OAs via quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Results suggested that root exudates containing the OAs both induced the chemotaxis and biofilm formation in NJN-6. In fact, the strongest chemotactic and biofilm response was found when 50 μM of OAs were applied. More specifically, malic acid showed the greatest chemotactic response whereas fumaric acid significantly induced biofilm formation by a 20.7–27.3% increase and therefore biofilm formation genes expression. The results showed banana root exudates, in particular the OAs released, play a crucial role in attracting and initiating PGPR colonization on the host roots. PMID:26299781

A hydrogen-oxidizing, Fe(III)-reducing microorganism from the Great Bay estuary, New Hampshire

USGS Publications Warehouse

Caccavo, F.; Blakemore, R.P.; Lovley, D.R.

1992-01-01

A dissimilatory Fe(III)- and Mn(IV)-reducing bacterium was isolated from bottom sediments of the Great Bay estuary, New Hampshire. The isolate was a facultatively anaerobic gram-negative rod which did not appear to fit into any previously described genus. It was temporarily designated strain BrY. BrY grew anaerobically in a defined medium with hydrogen or lactate as the electron donor and Fe(III) as the electron acceptor. BrY required citrate, fumarate, or malate as a carbon source for growth on H2 and Fe(III). With Fe(III) as the sole electron acceptor, BrY metabolized hydrogen to a minimum threshold at least 60-fold lower than the threshold reported for pure cultures of sulfate reducers. This finding supports the hypothesis that when Fe(III) is available, Fe(III) reducers can outcompete sulfate reducers for electron donors. Lactate was incompletely oxidized to acetate and carbon dioxide with Fe(III) as the electron acceptor. Lactate oxidation was also coupled to the reduction of Mn(IV), U(VI), fumarate, thiosulfate, or trimethylamine n-oxide under anaerobic conditions. BrY provides a model for how enzymatic metal reduction by respiratory metal-reducing microorganisms has the potential to contribute to the mobilization of iron and trace metals and to the immobilization of uranium in sediments of Great Bay Estuary.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Enrichment and isolation of Bacillus beveridgei sp. nov., a facultative anaerobic haloalkaliphile from Mono Lake, California, that respires oxyanions of tellurium, selenium, and arsenic

USGS Publications Warehouse

Baesman, S.M.; Stolz, J.F.; Kulp, T.R.; Oremland, R.S.

2009-01-01

Mono Lake sediment slurries incubated with lactate and tellurite [Te(IV)] turned progressively black with time because of the precipitation of elemental tellurium [Te(0)]. An enrichment culture was established from these slurries that demonstrated Te(IV)-dependent growth. The enrichment was purified by picking isolated black colonies from lactate/Te(IV) agar plates, followed by repeated streaking and picking. The isolate, strain MLTeJB, grew in aqueous Te(IV)-medium if provided with a small amount of sterile solid phase material (e.g., agar plug; glass beads). Strain MLTeJB grew at high concentrations of Te(IV) (~8 mM) by oxidizing lactate to acetate plus formate, while reducing Te(IV) to Te(0). Other electron acceptors that were found to sustain growth were tellurate, selenate, selenite, arsenate, nitrate, nitrite, fumarate and oxygen. Notably, growth on arsenate, nitrate, nitrite and fumarate did not result in the accumulation of formate, implying that in these cases lactate was oxidized to acetate plus CO2. Strain MLTeJB is a low G + C Gram positive motile rod with pH, sodium, and temperature growth optima at 8.5-9.0, 0.5-1.5 M, and 40??C, respectively. The epithet Bacillus beveridgei strain MLTeJBT is proposed. ?? 2009 Springer.

Nematicidal Activity of Kojic Acid Produced by Aspergillus oryzae against Meloidogyne incognita.

PubMed

Kim, Tae Yoon; Jang, Ja Yeong; Jeon, Sun Jeong; Lee, Hye Won; Bae, Chang-Hwan; Yeo, Joo Hong; Lee, Hyang Burm; Kim, In Seon; Park, Hae Woong; Kim, Jin-Cheol

2016-08-28

The fungal strain EML-DML3PNa1 isolated from leaf of white dogwood (Cornus alba L.) showed strong nematicidal activity with juvenile mortality of 87.6% at a concentration of 20% fermentation broth filtrate at 3 days after treatment. The active fungal strain was identified as Aspergillus oryzae, which belongs to section Flavi, based on the morphological characteristics and sequence analysis of the ITS rDNA, calmodulin (CaM), and β-tubulin (BenA) genes. The strain reduced the pH value to 5.62 after 7 days of incubation. Organic acid analysis revealed the presence of citric acid (515.0 mg/kg), malic acid (506.6 mg/kg), and fumaric acid (21.7 mg/kg). The three organic acids showed moderate nematicidal activities, but the mixture of citric acid, malic acid, and fumaric acid did not exhibit the full nematicidal activity of the culture filtrate of EML- DML3PNa1. Bioassay-guided fractionation coupled with (1)H- and (13)C-NMR and EI-MS analyses led to identification of kojic acid as the major nematicidal metabolite. Kojic acid exhibited dose-dependent mortality and inhibited the hatchability of M. incognita, showing EC50 values of 195.2 µg/ml and 238.3 µg/ml, respectively, at 72 h postexposure. These results suggest that A. oryzae EML-DML3PNa1 and kojic acid have potential as a biological control agent against M. incognita.

Preparation, physical characterization, and stability of Ferrous-Chitosan microcapsules using different iron sources

NASA Astrophysics Data System (ADS)

Handayani, Noer Abyor; Luthfansyah, M.; Krisanti, Elsa; Kartohardjono, Sutrasno; Mulia, Kamarza

2017-11-01

Dietary modification, supplementation and food fortification are common strategies to alleviate iron deficiencies. Fortification of food is an effective long-term approach to improve iron status of populations. Fortification by adding iron directly to food will cause sensory problems and decrease its bioavailability. The purpose of iron encapsulation is: (1) to improve iron bioavailability, by preventing oxidation and contact with inhibitors and competitors; and (2) to disguise the rancid aroma and flavor of iron. A microcapsule formulation of two suitable iron compounds (iron II fumarate and iron II gluconate) using chitosan as a biodegradable polymer will be very important. Freeze dryer was also used for completing the iron microencapsulation process. The main objective of the present study was to prepare and characterize the iron-chitosan microcapsules. Physical characterization, i.e. encapsulation efficiency, iron loading capacity, and SEM, were also discussed in this paper. The stability of microencapsulated iron under simulated gastrointestinal conditions was also investigated, as well. Both iron sources were highly encapsulated, ranging from 71.5% to 98.5%. Furthermore, the highest ferrous fumarate and ferrous gluconate loaded were 1.9% and 4.8%, respectively. About 1.04% to 9.17% and 45.17% to 75.19% of Fe II and total Fe, were released in simulated gastric fluid for two hours and in simulated intestinal fluid for six hours, respectively.

Antibacterial SnO2 nanorods as efficient fillers of poly(propylene fumarate-co-ethylene glycol) biomaterials.

PubMed

Díez-Pascual, Ana M; Díez-Vicente, Angel L

2017-09-01

Antibacterial and biocompatible SnO 2 nanorods have been easily synthesized through a hydrothermal process with the aid of a cationic surfactant, and incorporated as nanoreinforcements in poly(propylene fumarate-co-ethylene glycol) (P(PF-co-EG)) copolymer crosslinked with N-vinyl-pyrrolidone (NVP) by sonication and thermal curing. The nanorods were randomly and individually dispersed inside the P(PF-co-EG) network, and noticeably increased the thermal stability, hydrophilicity, degree of crystallinity, protein absorption capability as well as stiffness and strength of the matrix, whilst decreased its level of porosity and biodegradation rate. More importantly, the resulting nanocomposites retained adequate rigidity and strength after immersion in a simulated body fluid (SBF) at 37°C. They also exhibited biocide action against Gram-positive and Gram-negative bacteria; their antibacterial effect was strong under UV-light illumination whilst in dark conditions was only moderate. Further, they did not cause toxicity on human dermal fibroblasts. The friction coefficient and wear rate strongly decreased with increasing nanorod loading under both dry and SBF conditions; the greatest drops in SBF were about 18-fold and 13-fold, respectively, compared to those of the copolymer network. These novel biomaterials are good candidates to be applied in the field of soft-tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.

Extrusion-based 3D printing of poly(propylene fumarate) scaffolds with hydroxyapatite gradients

PubMed Central

Trachtenberg, Jordan E.; Placone, Jesse K.; Smith, Brandon T.; Fisher, John P.; Mikos, Antonios G.

2017-01-01

The primary focus of this work is to present the current challenges of printing scaffolds with concentration gradients of nanoparticles with an aim to improve the processing of these scaffolds. Furthermore, we address how print fidelity is related to material composition and emphasize the importance of considering this relationship when developing complex scaffolds for bone implants. The ability to create complex tissues is becoming increasingly relevant in the tissue engineering community. For bone tissue engineering applications, this work demonstrates the ability to use extrusion-based printing techniques to control the spatial deposition of hydroxyapatite (HA) nanoparticles in a 3D composite scaffold. In doing so, we combined the benefits of synthetic, degradable polymers, such as poly(propylene fumarate) (PPF), with osteoconductive HA nanoparticles that provide robust compressive mechanical properties. Furthermore, the final 3D printed scaffolds consisted of well-defined layers with interconnected pores, two critical features for a successful bone implant. To demonstrate a controlled gradient of HA, thermogravimetric analysis was carried out to quantify HA on a per-layer basis. Moreover, we non-destructively evaluated the tendency of HA particles to aggregate within PPF using micro-computed tomography (µCT). This work provides insight for proper fabrication and characterization of composite scaffolds containing particle gradients and has broad applicability for future efforts in fabricating complex scaffolds for tissue engineering applications. PMID:28125380

Impaired Malate and Fumarate Accumulation Due to the Mutation of the Tonoplast Dicarboxylate Transporter Has Little Effects on Stomatal Behavior.

PubMed

Medeiros, David B; Barros, Kallyne A; Barros, Jessica Aline S; Omena-Garcia, Rebeca P; Arrivault, Stéphanie; Sanglard, Lílian M V P; Detmann, Kelly C; Silva, Willian Batista; Daloso, Danilo M; DaMatta, Fábio M; Nunes-Nesi, Adriano; Fernie, Alisdair R; Araújo, Wagner L

2017-11-01

Malate is a central metabolite involved in a multiplicity of plant metabolic pathways, being associated with mitochondrial metabolism and playing significant roles in stomatal movements. Vacuolar malate transport has been characterized at the molecular level and is performed by at least one carrier protein and two channels in Arabidopsis ( Arabidopsis thaliana ) vacuoles. The absence of the Arabidopsis tonoplast Dicarboxylate Transporter (tDT) in the tdt knockout mutant was associated previously with an impaired accumulation of malate and fumarate in leaves. Here, we investigated the consequences of this lower accumulation on stomatal behavior and photosynthetic capacity as well as its putative metabolic impacts. Neither the stomatal conductance nor the kinetic responses to dark, light, or high CO 2 were highly affected in tdt plants. In addition, we did not observe any impact on stomatal aperture following incubation with abscisic acid, malate, or citrate. Furthermore, an effect on photosynthetic capacity was not observed in the mutant lines. However, leaf mitochondrial metabolism was affected in the tdt plants. Levels of the intermediates of the tricarboxylic acid cycle were altered, and increases in both light and dark respiration were observed. We conclude that manipulation of the tonoplastic organic acid transporter impacted mitochondrial metabolism, while the overall stomatal and photosynthetic capacity were unaffected. © 2017 American Society of Plant Biologists. All Rights Reserved.

A New Vertebral Body Replacement Strategy Using Expandable Polymeric Cages

PubMed Central

Liu, Xifeng; Paulsen, Alex; Giambini, Hugo; Guo, Ji; Miller, A. Lee; Lin, Po-Chun; Yaszemski, Michael J.

2017-01-01

We have developed a novel polymeric expandable cage that can be delivered via a posterior-only surgical approach for the treatment of noncontained vertebral defects. This approach is less invasive than an anterior-only or combined approach and much more cost-effective than currently used expandable metal cages. The polymeric expandable cage is composed of oligo poly(ethylene glycol) fumarate (OPF), a hydrogel that has been previously shown to have excellent nerve and bone tissue biocompatibility. OPF hydrogel cages can expand to twice their original diameter and length within a surgical time frame following hydration. Modulation of parameters such as polymeric network crosslink density or the introduction of charge to the network allowed for precise expansion kinetics. To meet specific requirements due to size variations in patient vertebral bodies, we fabricated a series of molds with varied diameters and explored the expansion kinetics of the OPF cages. Results showed a stable expansion ratio of approximately twofold to the original size within 20 min, regardless of the absolute value of the cage size. Following implantation of a dried OPF cage into a noncontained vertebral defect and its in situ expansion with normal saline, other augmentation biomaterials, such as poly(propylene fumarate) (PPF), can be injected to the lumen of the OPF cage and allowed to crosslink in situ. The OPF/PPF composite scaffold can provide the necessary rigidity and stability to the augmented spine. PMID:27835935

Extrusion-based 3D printing of poly(propylene fumarate) scaffolds with hydroxyapatite gradients.

PubMed

Trachtenberg, Jordan E; Placone, Jesse K; Smith, Brandon T; Fisher, John P; Mikos, Antonios G

2017-04-01

The primary focus of this work is to present the current challenges of printing scaffolds with concentration gradients of nanoparticles with an aim to improve the processing of these scaffolds. Furthermore, we address how print fidelity is related to material composition and emphasize the importance of considering this relationship when developing complex scaffolds for bone implants. The ability to create complex tissues is becoming increasingly relevant in the tissue engineering community. For bone tissue engineering applications, this work demonstrates the ability to use extrusion-based printing techniques to control the spatial deposition of hydroxyapatite (HA) nanoparticles in a 3D composite scaffold. In doing so, we combined the benefits of synthetic, degradable polymers, such as poly(propylene fumarate) (PPF), with osteoconductive HA nanoparticles that provide robust compressive mechanical properties. Furthermore, the final 3D printed scaffolds consisted of well-defined layers with interconnected pores, two critical features for a successful bone implant. To demonstrate a controlled gradient of HA, thermogravimetric analysis was carried out to quantify HA on a per-layer basis. Moreover, we non-destructively evaluated the tendency of HA particles to aggregate within PPF using micro-computed tomography (μCT). This work provides insight for proper fabrication and characterization of composite scaffolds containing particle gradients and has broad applicability for future efforts in fabricating complex scaffolds for tissue engineering applications.

Protection by dimethyl fumarate against diabetic cardiomyopathy in type 1 diabetic mice likely via activation of nuclear factor erythroid-2 related factor 2.

PubMed

Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu

2018-05-01

Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.

Injectable, in situ forming poly(propylene fumarate)-based ocular drug delivery systems.

PubMed

Ueda, H; Hacker, M C; Haesslein, A; Jo, S; Ammon, D M; Borazjani, R N; Kunzler, J F; Salamone, J C; Mikos, A G

2007-12-01

This study sought to develop an injectable formulation for long-term ocular delivery of fluocinolone acetonide (FA) by dissolving the anti-inflammatory drug and the biodegradable polymer poly(propylene fumarate) (PPF) in the biocompatible, water-miscible, organic solvent N-methyl-2-pyrrolidone (NMP). Upon injection of the solution into an aqueous environment, a FA-loaded PPF matrix is precipitated in situ through the diffusion/extraction of NMP into surrounding aqueous fluids. Fabrication of the matrices and in vitro release studies were performed in phosphate buffered saline at 37 degrees C. Drug loadings up to 5% were achieved. High performance liquid chromatography was employed to determine the released amount of FA. The effects of drug loading, PPF content of the injectable formulation, and additional photo-crosslinking of the matrix surface were investigated. Overall, FA release was sustained in vitro over up to 400 days. After an initial burst release of 22 to 68% of initial FA loading, controlled drug release driven by diffusion and bulk erosion was observed. Drug release rates in a therapeutic range were demonstrated. Release kinetics were found to be dependent on drug loading, formulation PPF content, and extent of surface crosslinking. The results suggest that injectable, in situ formed PPF matrices are promising candidates for the formulation of long-term, controlled delivery devices for intraocular drug delivery. Copyright 2007 Wiley Periodicals, Inc.

Gateways to Clinical Trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2002-09-01

Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Studies knowledge area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: Adalimumab, aeroDose insulin inhaler, agomelatine, alendronic acid sodium salt, aliskiren fumarate, alteplase, amlodipine, aspirin, atazanavir; Bacillus Calmette-Guérin, basiliximab, BQ-788, bupropion hydrochloride; Cabergoline, caffeine citrate, carbamazepine, carvedilol, celecoxib, cyclosporine, clopidogrel hydrogensulfate, colestyramine; Dexamethasone, diclofenac sodium, digoxin, dipyridamole, docetaxel, dutasteride; Eletriptan, enfuvirtidie, eplerenone, ergotamine tartrate, esomeprazole magnesium, estramustine phosphate sodium; Finasteride, fluticasone propionate, fosinopril sodium; Ganciclovir, GBE-761-ONC, glatiramer acetate, gliclazide, granulocyte-CSF; Heparin sodium, human isophane insulin (pyr), Hydrochlorothiazide; Ibuprofen, inhaled insulin, interferon alfa, interferon beta-1a; Laminvudine, lansoprazole, lisinopril, lonafarnib, losartan potassium, lumiracoxib; MAb G250, meloxicam methotrexate, methylprednisolone aceponate, mitomycin, mycophenolate mofetil; Naproxen sodium, natalizumab, nelfinavir mesilate, nemifitide ditriflutate, nimesulide; Omalizumab, omapatrilat, omeprazole, oxybutynin chloride; Pantoprazole sodium, paracetamol, paroxetine, pentoxifylline, pergolide mesylate, permixon, phVEGF-A165, pramipexole hydrochloride, prasterone, prednisone, probucol, propiverine hydrochloride; Rabeprazole sodium, resiniferatoxin, risedronate sodium, risperidone, rofecoxib rosiglitazone maleate, ruboxistaurin mesilate hydrate; Selegiline transdermal system, sertraline, sildenafil citrate, streptokinase; Tadalafil, tamsulosin hydrochloride, technosphere/Insulin, tegaserod maleate, tenofovir disoproxil fumarate, testosterone heptanoate, testosterone undecanoate, tipifarnib, tolterodine tartrate, topiramate, troglitazone; Ursodeoxycholic acid; Valdecoxib, valsartan, vardenafil, venlafaxine hydrochloride, VX-745.

Krebs cycle dysfunction shapes epigenetic landscape of chromatin: novel insights into mitochondrial regulation of aging process.

PubMed

Salminen, Antero; Kaarniranta, Kai; Hiltunen, Mikko; Kauppinen, Anu

2014-07-01

Although there is a substantial literature that mitochondria have a crucial role in the aging process, the mechanism has remained elusive. The role of reactive oxygen species, mitochondrial DNA injuries, and a decline in mitochondrial quality control has been proposed. Emerging studies have demonstrated that Krebs cycle intermediates, 2-oxoglutarate (also known as α-ketoglutarate), succinate and fumarate, can regulate the level of DNA and histone methylation. Moreover, citrate, also a Krebs cycle metabolite, can enhance histone acetylation. Genome-wide screening studies have revealed that the aging process is linked to significant epigenetic changes in the chromatin landscape, e.g. global demethylation of DNA and histones and increase in histone acetylation. Interestingly, recent studies have revealed that the demethylases of DNA (TET1-3) and histone lysines (KDM2-7) are members of 2-oxoglutarate-dependent dioxygenases (2-OGDO). The 2-OGDO enzymes are activated by oxygen, iron and the major Krebs cycle intermediate, 2-oxoglutarate, whereas they are inhibited by succinate and fumarate. Considering the endosymbiont origin of mitochondria, it is not surprising that Krebs cycle metabolites can control the gene expression of host cell by modifying the epigenetic landscape of chromatin. It seems that age-related disturbances in mitochondrial metabolism can induce epigenetic reprogramming, which promotes the appearance of senescent phenotype and degenerative diseases. Copyright © 2014 Elsevier Inc. All rights reserved.

Preparation and brain delivery of nasal solid lipid nanoparticles of quetiapine fumarate in situ gel in rat model of schizophrenia

PubMed Central

Li, Jian-Chun; Zhang, Wen-Jing; Zhu, Jin-Xiu; Zhu, Na; Zhang, Hong-Min; Wang, Xiu; Zhang, Jin; Wang, Qing-Qing

2015-01-01

To investigate the brain delivery in rat by nasal Quetiapine fumarate (QF) loaded with solid lipid nanoparticles in situ gel (QF-SLN-gel). QF-SLN-gel was prepared through micro-emulsion technique. The rat model of schizophrenia was established by intraperitoneal injection of (+)-MK-801, evaluated by stereotypic behavior, Mori’s Water Maze (MWM) test and hematoxylin and eosin (HE) staining of hippocampus. The animals were administrated with QF via oral, nasal or tail vein approach and the concentration of QF in blood and brain was determined using high performance liquid chromatography (HPLC). The QF-SLN-gel was even and transparent, having size of 117.8±2.67 d.nm, potential of 57.2±0.24 mV and EF of 97.6±0.58%. After administration of QF-SLN-gel, the concentration of QF in blood and brain of rats in nasal QF-SLN-gel group was similar with that of rats in tail vein QF group, but significantly higher than that of rats in oral QF group. The hippocampal morphology changes induced by (+)-MK-801 were ameliorated by QF, with advantage of nasal QF-SLN-gel over tail vein QF. The nasal QF-SLN-gel had stable and good brain delivery and could ameliorate the damages in rat model of schizophrenia induced by (+)-MK-801. PMID:26770349

Desulfovibrio zosterae sp. nov., a new sulfate reducer isolated from surface-sterilized roots of the seagrass Zostera marina.

PubMed

Nielsen, J T; Liesack, W; Finster, K

1999-04-01

A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.

Enhanced rhizosphere colonization of beneficial Bacillus amyloliquefaciens SQR9 by pathogen infection.

PubMed

Liu, Yunpeng; Zhang, Nan; Qiu, Meihua; Feng, Haichao; Vivanco, Jorge M; Shen, Qirong; Zhang, Ruifu

2014-04-01

Root exudates play important roles in root-soil microorganism interactions and can mediate tripartite interactions of beneficial microorganisms-plant-pathogen in the rhizosphere. However, the roles of organic acid components in this process have not been well studied. In this study the colonization of a plant growth-promoting rhizobacterium, Bacillus amyloliquefaciens SQR9, on cucumber root infected by Fusarium oxysporum f. sp. cucumerinum J. H. Owen (FOC) was investigated. Chemotaxis and biofilm formation response of SQR9 to root exudates and their organic acid components were analysed. Infection of FOC on cucumber had a positive effect (3.30-fold increase) on the root colonization of SQR9 compared with controls. Root secretion of citric acid (2.3 ± 0.2 μM) and fumaric acid (5.7 ± 0.5 μM) was enhanced in FOC-infected cucumber plants. Bacillus amyloliquefaciens SQR9 exhibited enhanced chemotaxis to root exudates of FOC-infected cucumber seedlings. Further experiments demonstrated that citric acid acts as a chemoattractant and fumaric acid as a stimulator of biofilm formation in this process. These results suggest that root exudates mediate the interaction of cucumber root and rhizosphere strain B. amyloliquefaciens SQR9 and enhance its root colonization. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

A Validated Stability Indicating RP-HPLC Method for the Determination of Emtricitabine, Tenofovir Disoproxil Fumarate, Elvitegravir and Cobicistat in Pharmaceutical Dosage Form

PubMed Central

Runja, Chinnalalaiah; Ravi Kumar, Pigili; Avanapu, Srinivasa Rao

2016-01-01

A new simple, rapid stability indicating assay method has been developed and validated for the determination of emtricitabine, tenofovir disoproxil fumarate, elvitegravir and cobicistat using reverse-phase high-performance liquid chromatography in their pharmaceutical dosage form. The chromatographic separation was performed on an ODS column (250 × 4.6 mm, 5 µm) using mobile phase A (potassium dihydrogen orthophosphate, pH adjusted to 2.5) and mobile phase B (acetonitrile) in the ratio of 55:45% v/v at a flow rate of 1 mL/min. The analytes were detected at 250 nm. The method was found to be linear in the concentration range of 2–12 µg/mL for EMT, 3–18 µg/mL for TNDF, 1.5–9 µg/mL for ELV and COB, with the coefficient value (R2) of >0.9990. The accuracy was measured via recovery studies and found to be acceptable, and the percentage recoveries were found in the range of 99.93–100.08 ± 0.5%. Forced degradation studies were also conducted, and the drugs were subjected to various stress conditions such as acid hydrolysis, base hydrolysis, oxidative, photolytic and thermal degradation. The proposed method was successfully validated and applied for the quantitative estimation of these drugs in both bulk and tablet dosage forms. PMID:26865655

Crystal Structures and Phase Relationships of 2 Polymorphs of 1,4-Diazabicyclo[3.2.2]nonane-4-Carboxylic Acid 4-Bromophenyl Ester Fumarate, A Selective α-7 Nicotinic Receptor Partial Agonist.

PubMed

Robert, Benoît; Perrin, Marc-Antoine; Barrio, Maria; Tamarit, Josep-Lluis; Coquerel, Gérard; Ceolin, René; Rietveld, Ivo B

2016-01-01

Two polymorphs of the 1:1 fumarate salt of 1,4-diazabicyclo[3.2.2]nonane-4-carboxylic acid 4-bromophenyl ester, developed for the treatment of cognitive symptoms of schizophrenia and Alzheimer disease, have been characterized. The 2 crystal structures have been solved, and their phase relationships have been established. The space group of form I is P2₁/c with a unit-cell volume of 1811.6 (5) Å(3) with Z = 4. The crystals of form I were 2-component nonmerohedral twins. The space group of form II is P2₁/n with a unit-cell volume of 1818.6 (3) Å(3) with Z = 4. Relative stabilities have been inferred from experimental and topological P-T diagrams exhibiting an overall enantiotropic relationship between forms I and II although the solid-solid transition has never been observed. The slope of the I-II equilibrium in the P-T diagram is negative, form II is the stable phase below the solid-solid transition temperature of 371 K, and form I exhibits a stable melting equilibrium. The I-II transition temperature has been obtained from the intersection of the sublimation curves of the 2 solid forms. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Evaluation of "Guia para Dejar de Fumar," a self-help guide in Spanish to quit smoking.

PubMed Central

Pérez-Stable, E J; Sabogal, F; Marín, G; Marín, B V; Otero-Sabogal, R

1991-01-01

Because of the absence of culturally appropriate self-help smoking cessation materials for Latinos, a new Spanish language cessation guide, "Guia para Dejar de Fumar," was developed and evaluated. It was distributed as part of a community-wide intervention to decrease the prevalence of smoking. The "Guia" is an attractive full-color booklet written in universal Spanish that uses simple text and numerous photographs. Motivation to quit smoking is emphasized, and graphic demonstrations of the adverse health effects of smoking are included. A menu of quitting and maintenance techniques is presented. A total of 431 smokers were identified for evaluation at approximately 3, 6, and 12 months after receiving the "Guia." Self-reported quit rates declined from 21.1 percent at 2.5 months to 13.7 percent at 14 months; 8.4 percent of the sample had a validated quit status by saliva cotinine test at 1 year. Persons older than 44 years were more likely to remain nonsmokers, but sex, education, acculturation score, and cigarettes smoked per day did not predict smoking cessation. The components of the "Guia" most mentioned by those who were surveyed were the graphic photographs, the health emphasis, and the overall format. The authors concluded that the "Guia" is an appropriate self-help smoking cessation booklet for Spanish-speaking Latinos in the United States. PMID:1910191

Biowaiver monograph for immediate-release solid oral dosage forms: bisoprolol fumarate.

PubMed

Charoo, Naseem A; Shamsher, Areeg A A; Lian, Lai Y; Abrahamsson, Bertil; Cristofoletti, Rodrigo; Groot, D W; Kopp, Sabine; Langguth, Peter; Polli, James; Shah, Vinod P; Dressman, Jennifer

2014-02-01

Literature data relevant to the decision to allow a waiver of in vivo bioequivalence (BE) testing for the approval of immediate-release (IR) solid oral dosage forms containing bisoprolol as the sole active pharmaceutical ingredient (API) are reviewed. Bisoprolol is classified as a Class I API according to the current Biopharmaceutics Classification System (BCS). In addition to the BCS class, its therapeutic index, pharmacokinetic properties, data related to the possibility of excipient interactions, and reported BE/bioavailability problems are taken into consideration. Qualitative compositions of IR tablet dosage forms of bisoprolol with a marketing authorization (MA) in ICH (International Conference on Harmonisation) countries are tabulated. It was inferred that these tablets had been demonstrated to be bioequivalent to the innovator product. No reports of failure to meet BE standards have been made in the open literature. On the basis of all these pieces of evidence, a biowaiver can currently be recommended for bisoprolol fumarate IR dosage forms if (1) the test product contains only excipients that are well known, and used in normal amounts, for example, those tabulated for products with MA in ICH countries and (2) both the test and comparator dosage form are very rapidly dissolving, or, rapidly dissolving with similarity of the dissolution profiles demonstrated at pH 1.2, 4.5, and 6.8. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association.

Functional Multichannel Poly(Propylene Fumarate)-Collagen Scaffold with Collagen-Binding Neurotrophic Factor 3 Promotes Neural Regeneration After Transected Spinal Cord Injury.

PubMed

Chen, Xi; Zhao, Yannan; Li, Xing; Xiao, Zhifeng; Yao, Yuanjiang; Chu, Yun; Farkas, Balázs; Romano, Ilaria; Brandi, Fernando; Dai, Jianwu

2018-06-19

Many factors contribute to the poor axonal regrowth and ineffective functional recovery after spinal cord injury (SCI). Biomaterials have been used for SCI repair by promoting bridge formation and reconnecting the neural tissue at the lesion site. The mechanical properties of biomaterials are critical for successful design to ensure the stable support as soon as possible when compressed by the surrounding spine and musculature. Poly(propylene fumarate) (PPF) scaffolds with high mechanical strength have been shown to provide firm spatial maintenance and to promote repair of tissue defects. A multichannel PPF scaffold is combined with collagen biomaterial to build a novel biocompatible delivery system coated with neurotrophin-3 containing an engineered collagen-binding domain (CBD-NT3). The parallel-aligned multichannel structure of PPF scaffolds guide the direction of neural tissue regeneration across the lesion site and promote reestablishment of bridge connectivity. The combinatorial treatment consisting of PPF and collagen loaded with CBD-NT3 improves the inhibitory microenvironment, facilitates axonal and neuronal regeneration, survival of various types of functional neurons and remyelination and synapse formation of regenerated axons following SCI. This novel treatment strategy for SCI repair effectively promotes neural tissue regeneration after transected spinal injury by providing a regrowth-supportive microenvironment and eventually induces functional improvement. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development and validation of reversed-phase HPLC gradient method for the estimation of efavirenz in plasma.

PubMed

Gupta, Shweta; Kesarla, Rajesh; Chotai, Narendra; Omri, Abdelwahab

2017-01-01

Efavirenz is an anti-viral agent of non-nucleoside reverse transcriptase inhibitor category used as a part of highly active retroviral therapy for the treatment of infections of human immune deficiency virus type-1. A simple, sensitive and rapid reversed-phase high performance liquid chromatographic gradient method was developed and validated for the determination of efavirenz in plasma. The method was developed with high performance liquid chromatography using Waters X-Terra Shield, RP18 50 x 4.6 mm, 3.5 μm column and a mobile phase consisting of phosphate buffer pH 3.5 and Acetonitrile. The elute was monitored with the UV-Visible detector at 260 nm with a flow rate of 1.5 mL/min. Tenofovir disoproxil fumarate was used as internal standard. The method was validated for linearity, precision, accuracy, specificity, robustness and data obtained were statistically analyzed. Calibration curve was found to be linear over the concentration range of 1-300 μg/mL. The retention times of efavirenz and tenofovir disoproxil fumarate (internal standard) were 5.941 min and 4.356 min respectively. The regression coefficient value was found to be 0.999. The limit of detection and the limit of quantification obtained were 0.03 and 0.1 μg/mL respectively. The developed HPLC method can be useful for quantitative pharmacokinetic parameters determination of efavirenz in plasma.

Acceptance and Effect of Ferrous Fumarate Containing Micronutrient Sprinkles on Anemia, Iron Deficiency and Anthropometrics in Honduran Children

DTIC Science & Technology

2012-02-01

child health and nutrition programs to distribute micronutrient sprinkles and educate parents on their use is feasible and acceptable (Loechl et al...Children Teresa M. Kemmer1, Preston S. Omer2, Vinod K. Gidvani-Diaz3 and Miguel Coello4 1Health and Nutritional Sciences, SDSU Extension and...Antonio Uniformed Services Health Education Consortium, Pediatric Residency San Antonio, 4U.S. Medical Element, Joint Task Force-Bravo, Soto Cano Air

DISTILLER: a data integration framework to reveal condition dependency of complex regulons in Escherichia coli.

PubMed

Lemmens, Karen; De Bie, Tijl; Dhollander, Thomas; De Keersmaecker, Sigrid C; Thijs, Inge M; Schoofs, Geert; De Weerdt, Ami; De Moor, Bart; Vanderleyden, Jos; Collado-Vides, Julio; Engelen, Kristof; Marchal, Kathleen

2009-01-01

We present DISTILLER, a data integration framework for the inference of transcriptional module networks. Experimental validation of predicted targets for the well-studied fumarate nitrate reductase regulator showed the effectiveness of our approach in Escherichia coli. In addition, the condition dependency and modularity of the inferred transcriptional network was studied. Surprisingly, the level of regulatory complexity seemed lower than that which would be expected from RegulonDB, indicating that complex regulatory programs tend to decrease the degree of modularity.

Retrospective data collection of psoriasis treatment with fumaric acid esters in children and adolescents in Germany (KIDS FUTURE study).

PubMed

Reich, Kristian; Hartl, Christoph; Gambichler, Thilo; Zschocke, Ina

2016-01-01

Given that there is no standard systemic treatment for children and adolescents with plaque psoriasis, this non-interventional, multicenter, retrospective study collected data on the efficacy and safety of long-term treatment with fumaric acid esters (FAEs) in this particular patient group. In patients younger than 18 years of age at the start of FAE treatment, data on efficacy and safety was retrospectively collected for at least 36 months. Data from 127 patients (aged 6-17 years) was collected for treatment durations of up to 60 months. Physician's Global Assessment, Psoriasis Area and Severity Index, and Body Surface Area showed marked improvement in the first six months. After 36 months, these parameters had, on average, improved by up to two-thirds of baseline values. Thirty-seven patients experienced at least one adverse event (AE), which was FAE-related in 36 individuals. Three AEs (proteinuria (one case), flushing (two cases)) persisted during the observation period while on treatment. Fifteen AEs led to the discontinuation of therapy; nearly all of these cases were related to gastrointestinal disorders. The KIDS FUTURE study - for the first time - included a larger population of children and adolescents with psoriasis who were treated with FAEs. The data obtained suggests that long-term FAE therapy in this patient group may be effective and safe. The results are currently being verified in an ongoing clinical study. © 2015 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

The influence of stereolithographic scaffold architecture and composition on osteogenic signal expression with rat bone marrow stromal cells

PubMed Central

Kim, Kyobum; Dean, David; Wallace, Jonathan; Breithaupt, Rob; Mikos, Antonios G.; Fisher, John P.

2011-01-01

Scaffold design parameters, especially physical construction factors such as mechanical stiffness of substrate materials, pore size of 3D porous scaffolds, and channel geometry, are known to influence the osteogenic signal expression and subsequent differentiation of a transplanted cell population. In this study of photocrosslinked poly(propylene fumarate) (PPF) and diethyl fumarate (DEF) scaffolds, the effect of DEF incorporation ratio and pore size on the osteogenic signal expression of rat bone marrow stromal cells (BMSCs) was investigated. Results demonstrated that DEF concentrations and pore sizes that led to increased scaffold mechanical stiffness also upregulated osteogenic signal expression, including bone morphogenic protein-2 (BMP-2), fibroblast growth factors-2 (FGF-2), transforming growth factor-β1 (TGF-β1), vascular endothelial growth factor (VEGF), and Runx2 transcriptional factor. Similar scaffold fabrication parameters supported rapid BMSC osteoblastic differentiation, as demonstrated by increased alkaline phosphatase (ALP) and osteocalcin expression. When scaffolds with random architecture, fabricated by porogen leaching, were compared to those with controlled architecture, fabricated by stereolithography (SLA), results showed that SLA scaffolds with the highly permeable and porous channels also have significantly higher expression of FGF-2, TGF-β1, and VEGF. Subsequent ALP expression and osteopontin secretion were also significantly increased in SLA scaffolds. Based upon these results, we conclude that scaffold properties provided by additive manufacturing techniques such as SLA fabrication, particularly increased mechanical stiffness and high permeability, may stimulate dramatic BMSC responses that promote rapid bone tissue regeneration. PMID:21396709

Carbon Dots as Versatile Photosensitizers for Solar-Driven Catalysis with Redox Enzymes.

PubMed

Hutton, Georgina A M; Reuillard, Bertrand; Martindale, Benjamin C M; Caputo, Christine A; Lockwood, Colin W J; Butt, Julea N; Reisner, Erwin

2016-12-28

Light-driven enzymatic catalysis is enabled by the productive coupling of a protein to a photosensitizer. Photosensitizers used in such hybrid systems are typically costly, toxic, and/or fragile, with limited chemical versatility. Carbon dots (CDs) are low-cost, nanosized light-harvesters that are attractive photosensitizers for biological systems as they are water-soluble, photostable, nontoxic, and their surface chemistry can be easily modified. We demonstrate here that CDs act as excellent light-absorbers in two semibiological photosynthetic systems utilizing either a fumarate reductase (FccA) for the solar-driven hydrogenation of fumarate to succinate or a hydrogenase (H 2 ase) for reduction of protons to H 2 . The tunable surface chemistry of the CDs was exploited to synthesize positively charged ammonium-terminated CDs (CD-NHMe 2 + ), which were capable of transferring photoexcited electrons directly to the negatively charged enzymes with high efficiency and stability. Enzyme-based turnover numbers of 6000 mol succinate (mol FccA) -1 and 43,000 mol H 2 (mol H 2 ase) -1 were reached after 24 h. Negatively charged carboxylate-terminated CDs (CD-CO 2 - ) displayed little or no activity, and the electrostatic interactions at the CD-enzyme interface were determined to be essential to the high photocatalytic activity observed with CD-NHMe 2 + . The modular surface chemistry of CDs together with their photostability and aqueous solubility make CDs versatile photosensitizers for redox enzymes with great scope for their utilization in photobiocatalysis.

Poly(propylene fumarate)/Polyethylene Glycol-Modified Graphene Oxide Nanocomposites for Tissue Engineering.

PubMed

Díez-Pascual, Ana M; Díez-Vicente, Angel L

2016-07-20

Poly(propylene fumarate) (PPF)-based nanocomposites incorporating different amounts of polyethylene glycol-functionalized graphene oxide (PEG-GO) have been prepared via sonication and thermal curing, and their surface morphology, structure, thermal stability, hydrophilicity, water absorption, biodegradation, cytotoxicity, mechanical, viscoelastic and antibacterial properties have been investigated. SEM and TEM images corroborated that the noncovalent functionalization with PEG caused the exfoliation of GO into thinner flakes. IR spectra suggested the presence of strong hydrogen-bonding interactions between the nanocomposite components. A gradual rise in the level of hydrophilicity, water uptake, biodegradation rate, surface roughness, protein absorption capability and thermal stability was found upon increasing GO concentration in the composites. Tensile tests revealed improved stiffness, strength and toughness for the composites compared to unfilled PPF, ascribed to a homogeneous GO dispersion within the matrix along with a strong PPF/PEG-GO interfacial adhesion via polar and hydrogen bonding interactions. Further, the nanocomposites retained enough stiffness and strength under a biological state to provide effective support for bone tissue formation. The antibacterial activity was investigated against Gram-positive Staphylococcus aureus and Staphylococcus epidermidis as well as Gram-negative Pseudomonas aeruginosa and Escherichia coli microorganisms, and it rose sharply upon increasing GO concentration; systematically, the biocide effect was stronger versus Gram-positive bacteria. Cell viability data demonstrated that PPF/PEG-GO composites do not induce toxicity over human dermal fibroblasts. These novel materials show great potential to be applied in the bone tissue engineering field.

Intravaginal ring delivery of tenofovir disoproxil fumarate for prevention of HIV and herpes simplex virus infection.

PubMed

Mesquita, Pedro M M; Rastogi, Rachna; Segarra, Theodore J; Teller, Ryan S; Torres, N Merna; Huber, Ashley M; Kiser, Patrick F; Herold, Betsy C

2012-07-01

A safe and effective topical prevention strategy will likely require sustained delivery of potent antiviral drugs and a delivery system that simultaneously maximizes drug distribution and overcomes the behavioural challenges related to adherence. Activity against HIV and herpes simplex virus (HSV) would be advantageous, given the epidemiological link between the two pathogens. We hypothesize that tenofovir disoproxil fumarate (tenofovir DF), a prodrug of tenofovir, may be more potent than tenofovir and ideal for sustained intravaginal ring (IVR) delivery. The anti-HIV and anti-HSV activity of tenofovir and tenofovir DF were assessed in cell and explant models. Cumulative tenofovir DF release and stability from polyether urethane (PEU), ethylene-co-vinyl acetate (EVA) and silicone IVRs were compared, and the activity and safety of drug released were evaluated in cervical explants and in a polarized dual-chamber model. Tenofovir DF inhibited HIV and HSV at ≈ 100-fold lower concentrations than tenofovir and retained activity in the presence of semen. PEU rings delivered >1 mg/day of tenofovir DF for 30 days. Pre-treatment of cervical explants with 10 μg/mL tenofovir DF or eluants from PEU minirings resulted in >90% inhibition of HIV and reduced HSV-2 yields by 2.5 log. Tenofovir DF and eluants did not prevent cell growth or polarization, or have any deleterious effects on an epithelial barrier. The findings support the development of a PEU tenofovir DF ring, which may provide potent and sustained protection against HIV and HSV.

Triiodothyronine Facilitates Weaning From Extracorporeal Membrane Oxygenation by Improved Mitochondrial Substrate Utilization

PubMed Central

Files, Matthew D.; Kajimoto, Masaki; O'Kelly Priddy, Colleen M.; Ledee, Dolena R.; Xu, Chun; Des Rosiers, Christine; Isern, Nancy; Portman, Michael A.

2014-01-01

Background Extracorporeal membrane oxygenation (ECMO) provides a bridge to recovery after myocardial injury in infants and children, yet morbidity and mortality remain high. Weaning from the circuit requires adequate cardiac contractile function, which can be impaired by metabolic disturbances induced either by ischemia‐reperfusion and/or by ECMO. We tested the hypothesis that although ECMO partially ameliorates metabolic abnormalities induced by ischemia‐reperfusion, these abnormalities persist or recur with weaning. We also determined if thyroid hormone supplementation (triiodothyronine) during ECMO improves oxidative metabolism and cardiac function. Methods and Results Neonatal piglets underwent transient coronary ischemia to induce cardiac injury then were separated into 4 groups based on loading status. Piglets without coronary ischemia served as controls. We infused into the left coronary artery [2‐13C]pyruvate and [13C6, 15N]l‐leucine to evaluate oxidative metabolism by gas chromatography‐mass spectroscopy and nuclear magnetic resonance methods. ECMO improved survival, increased oxidative substrate contribution through pyruvate dehydrogenase, reduced succinate and fumarate accumulation, and ameliorated ATP depletion induced by ischemia. The functional and metabolic benefit of ECMO was lost with weaning, yet triiodothyronine supplementation during ECMO restored function, increased relative pyruvate dehydrogenase flux, reduced succinate and fumarate, and preserved ATP stores. Conclusions Although ECMO provides metabolic rest by decreasing energy demand, metabolic impairments persist, and are exacerbated with weaning. Treating ECMO‐induced thyroid depression with triiodothyronine improves substrate flux, myocardial oxidative capacity and cardiac contractile function. This translational model suggests that metabolic targeting can improve weaning. PMID:24650924

Triiodothyronine facilitates weaning from extracorporeal membrane oxygenation by improved mitochondrial substrate utilization.

PubMed

Files, Matthew D; Kajimoto, Masaki; O'Kelly Priddy, Colleen M; Ledee, Dolena R; Xu, Chun; Des Rosiers, Christine; Isern, Nancy; Portman, Michael A

2014-03-20

Extracorporeal membrane oxygenation (ECMO) provides a bridge to recovery after myocardial injury in infants and children, yet morbidity and mortality remain high. Weaning from the circuit requires adequate cardiac contractile function, which can be impaired by metabolic disturbances induced either by ischemia-reperfusion and/or by ECMO. We tested the hypothesis that although ECMO partially ameliorates metabolic abnormalities induced by ischemia-reperfusion, these abnormalities persist or recur with weaning. We also determined if thyroid hormone supplementation (triiodothyronine) during ECMO improves oxidative metabolism and cardiac function. Neonatal piglets underwent transient coronary ischemia to induce cardiac injury then were separated into 4 groups based on loading status. Piglets without coronary ischemia served as controls. We infused into the left coronary artery [2-(13)C]pyruvate and [(13)C6, (15)N]l-leucine to evaluate oxidative metabolism by gas chromatography-mass spectroscopy and nuclear magnetic resonance methods. ECMO improved survival, increased oxidative substrate contribution through pyruvate dehydrogenase, reduced succinate and fumarate accumulation, and ameliorated ATP depletion induced by ischemia. The functional and metabolic benefit of ECMO was lost with weaning, yet triiodothyronine supplementation during ECMO restored function, increased relative pyruvate dehydrogenase flux, reduced succinate and fumarate, and preserved ATP stores. Although ECMO provides metabolic rest by decreasing energy demand, metabolic impairments persist, and are exacerbated with weaning. Treating ECMO-induced thyroid depression with triiodothyronine improves substrate flux, myocardial oxidative capacity and cardiac contractile function. This translational model suggests that metabolic targeting can improve weaning.

"Application of Box-Behnken design for optimization and development of quetiapine fumarate loaded chitosan nanoparticles for brain delivery via intranasal route* ".

PubMed

Shah, Brijesh; Khunt, Dignesh; Misra, Manju; Padh, Harish

2016-08-01

The objective of the present investigation was to optimize and develop quetiapine fumarate (QF) loaded chitosan nanoparticles (QF-NP) by ionic gelation method using Box-Behnken design. Three independent variables viz., X1-Concentration of chitosan, X2-Concentration of sodium tripolyphosphate and X3-Volume of sodium tripolyphosphate were taken to investigate their effect on dependent variables (Y1-Size, Y2-PDI and Y3-%EE). Optimized formula of QF-NP was selected from the design space which was further evaluated for physicochemical, morphological, solid state characterization, nasal diffusion and in-vivo distribution for brain targeting following non-invasive intranasal administration. The average particle size, PDI, %EE and nasal diffusion were found to be 131.08±7.45nm, 0.252±0.064, 89.93±3.85% and 65.24±5.26% respectively. Neither toxicity nor structural damage on nasal mucosa was observed upon histopathological examination. Significantly higher brain/blood ratio and 2 folds higher nasal bioavailability in brain with QF-NP in comparison to drug solution following intranasal administration revealed preferential nose to brain transport bypassing blood-brain barrier and prolonged retention of QF at site of action suggesting superiority of chitosan as permeability enhancer. Overall, the above finding shows promising results in the area of developing non-invasive intranasal route as an alternative to oral route for brain delivery. Copyright © 2016 Elsevier B.V. All rights reserved.

The Succinated Proteome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merkley, Eric D.; Metz, Thomas O.; Smith, Richard D.

Succination is a chemical modification of cysteine in protein by the Krebs cycle intermediate, fumarate, yielding S-(2-succino)cysteine (2SC). Intracellular fumarate concentration and succination of proteins are increased by hyperpolarization of the inner mitochondrial membrane, in concert with mitochondrial, endoplasmic reticulum (ER) and oxidative stress in adipocytes grown in high glucose medium and in adipose tissue in obesity and diabetes. Increased succination of proteins is also detected in the kidney of a fumarase conditional knock-out mouse which develops renal tumors. Keap1, the gatekeeper of the antioxidant response, was identified as a major succinated protein in renal cancer cells, suggesting that succinationmore » may play a role in activation of the antioxidant response. A wide range of proteins is subject to succination, including enzymes, adipokines, cytoskeletal proteins and ER chaperones with functional cysteine residues. There is also significant overlap between succinated and glutathionylated proteins, and with proteins containing cysteine residues that are readily oxidized to the sulfenic (cysteic) acid. Succination of adipocyte proteins is inhibited by uncouplers, which discharge the mitochondrial membrane potential (Δψm) and by ER stress inhibitors. 2SC serves as a biomarker of mitochondrial stress or dysfunction in chronic diseases, such as obesity, diabetes and cancer, and recent studies suggest that succination is a mechanistic link between mitochondrial dysfunction, oxidative and ER stress, and cellular progression toward apoptosis. In this article, we review the history of the succinated proteome and the challenges associated with measuring this non-enzymatic post-translational modification of proteins by proteomics approaches.« less

Versatile transformations of hydrocarbons in anaerobic bacteria: substrate ranges and regio- and stereo-chemistry of activation reactions†

PubMed Central

Jarling, René; Kühner, Simon; Basílio Janke, Eline; Gruner, Andrea; Drozdowska, Marta; Golding, Bernard T.; Rabus, Ralf; Wilkes, Heinz

2015-01-01

Anaerobic metabolism of hydrocarbons proceeds either via addition to fumarate or by hydroxylation in various microorganisms, e.g., sulfate-reducing or denitrifying bacteria, which are specialized in utilizing n-alkanes or alkylbenzenes as growth substrates. General pathways for carbon assimilation and energy gain have been elucidated for a limited number of possible substrates. In this work the metabolic activity of 11 bacterial strains during anaerobic growth with crude oil was investigated and compared with the metabolite patterns appearing during anaerobic growth with more than 40 different hydrocarbons supplied as binary mixtures. We show that the range of co-metabolically formed alkyl- and arylalkyl-succinates is much broader in n-alkane than in alkylbenzene utilizers. The structures and stereochemistry of these products are resolved. Furthermore, we demonstrate that anaerobic hydroxylation of alkylbenzenes does not only occur in denitrifiers but also in sulfate reducers. We propose that these processes play a role in detoxification under conditions of solvent stress. The thermophilic sulfate-reducing strain TD3 is shown to produce n-alkylsuccinates, which are suggested not to derive from terminal activation of n-alkanes, but rather to represent intermediates of a metabolic pathway short-cutting fumarate regeneration by reverse action of succinate synthase. The outcomes of this study provide a basis for geochemically tracing such processes in natural habitats and contribute to an improved understanding of microbial activity in hydrocarbon-rich anoxic environments. PMID:26441848

Simultaneous determination of furfural and its degradation products, furoic acid and maleic acid, in transformer oil by the reversed-phase vortex-assisted liquid-liquid microextraction followed by high-performance liquid chromatography.

PubMed

Wang, Yifan; Li, Haiyan; Yang, Zhen; Zhang, Weijie; Hua, Jia

2017-12-01

To explore why the use of furfural as a transformer oil-paper insulation aging characteristic is problematic in real world application, we developed a method for the simultaneous determination of furfural, furoic acid, and maleic acid in transformer oil by reversed-phase vortex-assisted liquid-liquid microextraction combined with high-performance liquid chromatography. The conditions for the proposed method were optimized, and the obtained extract can be directly analyzed by high-performance liquid chromatography. The detection limits (signal-to-noise ratio = 3) of the method ranged from 1.0 to 4.6 μg/L, the enrichment factors for furfural, furoic acid, maleic acid, and fumaric acid were 4.6, 25.1, 15.6, and 17.5, respectively, and the recovery rates for three analytes (fumaric acid was undetected) range from 82.1 to 106.2%. The contents of furfural, furoic acid, and maleic acid resulted from accelerated aging of transformer insulation oil-paper were measured using the present method for the first time, and the aging samples were analyzed by liquid chromatography with mass spectrometry for the identification of furoic acid and maleic acid in the aging transformer oil samples. Using the optimal method, the target products of samples at different aging time were tracked and measured. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single-dose and steady-state pharmacokinetics of tenofovir disoproxil fumarate in human immunodeficiency virus-infected children.

PubMed

Hazra, Rohan; Balis, Frank M; Tullio, Antonella N; DeCarlo, Ellen; Worrell, Carol J; Steinberg, Seth M; Flaherty, John F; Yale, Kitty; Poblenz, Marianne; Kearney, Brian P; Zhong, Lijie; Coakley, Dion F; Blanche, Stephane; Bresson, Jean Louis; Zuckerman, Judith A; Zeichner, Steven L

2004-01-01

Tenofovir disoproxil fumarate (DF) is a potent nucleotide analog reverse transcriptase inhibitor approved for the treatment of human immunodeficiency virus (HIV)-infected adults. The single-dose and steady-state pharmacokinetics of tenofovir were evaluated following administration of tenofovir DF in treatment-experienced HIV-infected children requiring a change in antiretroviral therapy. Using increments of tenofovir DF 75-mg tablets, the target dose was 175 mg/m(2); the median administered dose was 208 mg/m(2). Single-dose pharmacokinetics were evaluated in 18 subjects, and the geometric mean area under the concentration-time curve from 0 h to infinity (AUC(0- infinity )) was 2,150 ng. h/ml and the geometric mean maximum concentration (C(max)) was 266 ng/ml. Subsequently, other antiretrovirals were added to each patient's regimen based upon treatment history and baseline viral resistance results. Steady-state pharmacokinetics were evaluated in 16 subjects at week 4. The steady-state, geometric mean AUC for the 24-h dosing interval was 2,920 ng. h/ml and was significantly higher than the AUC(0- infinity ) after the first dose (P = 0.0004). The geometric mean C(max) at steady state was 302 ng/ml. Tenofovir DF was generally very well tolerated. Steady-state tenofovir exposures in children receiving tenofovir DF-containing combination antiretroviral therapy approached values seen in HIV-infected adults (AUC, approximately 3,000 ng. h/ml; C(max), approximately 300 ng/ml) treated with tenofovir DF at 300 mg.

Drug-induced Fanconi syndrome associated with fumaric acid esters treatment for psoriasis: a case series.

PubMed

Balak, Deepak M W; Bouwes Bavinck, Jan Nico; de Vries, Aiko P J; Hartman, Jenny; Neumann, Hendrik A Martino; Zietse, Robert; Thio, Hok Bing

2016-02-01

Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37-46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28-111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome.

Fabrication of high flux and antifouling mixed matrix fumarate-alumoxane/PAN membranes via electrospinning for application in membrane bioreactors

NASA Astrophysics Data System (ADS)

Moradi, Golshan; Zinadini, Sirus; Rajabi, Laleh; Dadari, Soheil

2018-01-01

The nanofibrous Polyacrylonitrile (PAN) membranes embedded with fumarate-alumoxane (Fum-A) nanoparticles were prepared via electrospinning technique as high flux and antifouling membranes for membrane bioreactor (MBR) applications. The effect of Fum-A nanoparticles on membrane morphology, surface hydrophilicity, pure water flux, effluent turbidity and the antifouling property was investigated. Fum-A is a carboxylate-alumoxane nanoparticle covered by extra hydroxyl and carboxylate groups on its surface. By embedding Fum-A nanoparticles into the spinning solution, the surface hydrophilicity and pure water flux of the resulted membranes were improved. The smooth surface of fibers at the low amount of nanoparticles and the agglomeration of nanoparticles at their high concentration were shown in SEM images of the membranes surface. The energy dispersive spectroscopy (EDS) and Fourier transform infrared spectroscopy (FTIR) analysis of the prepared Fum-A/PAN membrane confirmed the presence of carboxylate and hydroxyl functional groups of Fum-A nanoparticles on the surface of the Fum-A nanoparticles containing membrane. The results obtained from the filtration of activated sludge suspension revealed that by addition of a low amount of Fum-A nanoparticles, the irreversible fouling was significantly decreased due to the higher hydrophilicity. The Fum-A/PAN membranes showed superior permeate flux and antifouling properties compared to bare electrospun PAN membrane. Finally, 2 wt.% Fum-A/PAN membrane exhibited the highest FRR of 96% and the lowest irreversible fouling of 4% with excellent durability of antifouling property during twenty repeated activated sludge filtrations.

Safety of oral tenofovir disoproxil fumarate-based HIV pre-exposure prophylaxis use in lactating HIV-uninfected women.

PubMed

Mugwanya, Kenneth K; John-Stewart, Grace; Baeten, Jared

2017-07-01

In settings where HIV is prevalent in heterosexual populations, pregnancy and postpartum breastfeeding periods can be associated with substantial HIV acquisition risk. Pre-exposure prophylaxis (PrEP) with daily oral tenofovir disoproxil fumarate (TDF)/emtricitabine is an attractive HIV prevention option for women who are lactating but data are limited on its safety during the lactation period. Areas covered: We provide a concise synthesis and summary of current evidence on the safety of TDF-based PrEP during breastfeeding. We conducted a review, searching Pubmed database and major PrEP conferences for primary studies with TDF-based PrEP exposure during postpartum breastfeeding. Expert opinion: TDF-based oral PrEP is an effective female-controlled HIV prevention option. There is evidence supporting the safety of TDF use for infant outcomes during breastfeeding in antiretroviral treatment regimens for HIV and hepatitis B virus, and more limited, but consistently safe, data from use of TDF as PrEP. The potential for risk is arguably outweighed for at-risk individuals by HIV prevention benefits, including indirect protection to the infant as a result of preventing HIV in the breastfeeding mother. As PrEP delivery is scaled up in heterosexual populations in high HIV prevalence settings and for at-risk persons in other settings, implementation science studies can provide a framework to increase the accrual of safety, acceptability, and use data related to PrEP during lactation.

Enhanced Gene Detection Assays for Fumarate-Adding Enzymes Allow Uncovering of Anaerobic Hydrocarbon Degraders in Terrestrial and Marine Systems

PubMed Central

von Netzer, Frederick; Pilloni, Giovanni; Kleindienst, Sara; Krüger, Martin; Knittel, Katrin; Gründger, Friederike

2013-01-01

The detection of anaerobic hydrocarbon degrader populations via catabolic gene markers is important for the understanding of processes at contaminated sites. Fumarate-adding enzymes (FAEs; i.e., benzylsuccinate and alkylsuccinate synthases) have already been established as specific functional marker genes for anaerobic hydrocarbon degraders. Several recent studies based on pure cultures and laboratory enrichments have shown the existence of new and deeply branching FAE gene lineages, such as clostridial benzylsuccinate synthases and homologues, as well as naphthylmethylsuccinate synthases. However, established FAE gene detection assays were not designed to target these novel lineages, and consequently, their detectability in different environments remains obscure. Here, we present a new suite of parallel primer sets for detecting the comprehensive range of FAE markers known to date, including clostridial benzylsuccinate, naphthylmethylsuccinate, and alkylsuccinate synthases. It was not possible to develop one single assay spanning the complete diversity of FAE genes alone. The enhanced assays were tested with a range of hydrocarbon-degrading pure cultures, enrichments, and environmental samples of marine and terrestrial origin. They revealed the presence of several, partially unexpected FAE gene lineages not detected in these environments before: distinct deltaproteobacterial and also clostridial bssA homologues as well as environmental nmsA homologues. These findings were backed up by dual-digest terminal restriction fragment length polymorphism diagnostics to identify FAE gene populations independently of sequencing. This allows rapid insights into intrinsic degrader populations and degradation potentials established in aromatic and aliphatic hydrocarbon-impacted environmental systems. PMID:23124238

Reinvestigation of Brevibacterium sp. Strain KY-4313 as a Source of Canthaxanthin

PubMed Central

Nelis, H. J.; De Leenheer, A. P.

1989-01-01

The hydrocarbon-utilizing Brevibacterium sp. strain KY-4313 was reevaluated for its potential to produce canthaxanthin, a carotenoid pigment of strong commercial interest. Three approaches were used to optimize the canthaxanthin yield from this organism, i.e., the preparation of mutants, the addition of supposedly carotenogenic chemicals to the growth medium, and growth promotion. Following treatment of the parent strain with N-nitrosomethylurea, a presumed mutant was isolated which showed a 32% increase in cellular canthaxanthin content. No effective carotenogenic chemicals were found in connection with hydrocarbon fermentations, in which mainly growth promotion through periodic medium renewal proved conducive to enhanced pigment production. Carotenogenesis could be stimulated in brain heart infusion broth by adding alcohols or retinol. Improved growth in this medium was generally not associated with higher canthaxanthin yields. Both superior growth and pigment levels were obtained in a newly designed medium based on fumaric acid-molasses. The maximum yields of canthaxanthin in shake flasks were (in milligrams per liter) 4.2 (brain heart infusion broth plus propanol-zinc sulfate), 3.6 (hydrocarbon medium), and 9.3 (fumaric acid-molasses), which represent a significant improvement over the originally reported optimal result (1 mg/liter). The corresponding yields of echinenone, the direct precursor of canthaxanthin, were 1.2, 1.6, and 2.3 mg/liter, respectively. Two-liter hydrocarbon batch fermentations involving medium renewal maximally produced 7.2 mg of canthaxanthin and 3.7 mg of echinenone per liter. PMID:16348027

Tenofovir alafenamide (TAF) as the successor of tenofovir disoproxil fumarate (TDF).

PubMed

De Clercq, Erik

2016-11-01

Tenofovir alafenamide (TAF) can be considered a new prodrug of tenofovir (TFV), as successor of tenofovir disoproxil fumarate (TDF). It is in vivo as potent against human immunodeficiency virus (HIV) at a 30-fold lower dose (10mg) than TDF (300mg). TAF has been approved in November 2015 (in the US and EU), as a single-tablet regimen (STR) containing 150mg elvitegravir (E), 150mg cobicistat (C), 200mg emtricitabine [(-)FTC] (F) and 10mg TAF, marketed as Genvoya®, on 01 March 2016 in the US as an STR containing 25mg rilpivirine (R), 200mg F and 25mg TAF, marketed as Odefsey®, and on 4 April 2016 in the US, as an STR containing 200mg F and 25mg TAF, marketed as Descovy®, for the treatment of HIV infections. STR combinations containing TAF and emtricitabine could be paired with a range of third agents, for example, darunavir and cobicistat. TAF has a much lower risk of kidney toxicity or bone density changes than TDF, and also offers long-term potential in the pre-exposure prophylaxis (PrEP) of HIV infections. TAF is specifically accumulated in lymphatic tissue, and in the liver, and hence also holds great potential for the treatment of hepatitis B virus (HBV) infections. Akin to TDF, TAF is converted intracellularly to TFV. Its active diphosphate metabolite (TFVpp) is targeted at the RNA-dependent DNA polymerase (reverse transcriptase) of either HIV or HBV. Copyright © 2016 Elsevier Inc. All rights reserved.

Cocrystals of the antimalarial drug 11-azaartemisinin with three alkenoic acids of 1:1 or 2:1 stoichiometry.

PubMed

Nisar, Madiha; Wong, Lawrence W Y; Sung, Herman H Y; Haynes, Richard K; Williams, Ian D

2018-06-01

The stoichiometry, X-ray structures and stability of four pharmaceutical cocrystals previously identified from liquid-assisted grinding (LAG) of 11-azaartemisinin (11-Aza; systematic name: 1,5,9-trimethyl-14,15,16-trioxa-11-azatetracyclo[10.3.1.0 4,13 .0 8,13 ]hexadecan-10-one) with trans-cinnamic (Cin), maleic (Mal) and fumaric (Fum) acids are herein reported. trans-Cinnamic acid, a mono acid, forms 1:1 cocrystal 11-Aza:Cin (1, C 15 H 23 NO 4 ·C 9 H 8 O 2 ). Maleic acid forms both 1:1 cocrystal 11-Aza:Mal (2, C 15 H 23 NO 4 ·C 4 H 4 O 4 ), in which one COOH group is involved in self-catenation, and 2:1 cocrystal 11-Aza 2 :Mal (3, 2C 15 H 23 NO 4 ·C 4 H 4 O 4 ). Its isomer, fumaric acid, only affords 2:1 cocrystal 11-Aza 2 :Fum (4). All cocrystal formation appears driven by acid-lactam R 2 2 (8) heterosynthons with short O-H...O=C hydrogen bonds [O...O = 2.56 (2) Å], augmented by weaker C=O...H-N contacts. Despite a better packing efficiency, cocrystal 3 is metastable with respect to 2, probably due to a higher conformational energy for the maleic acid molecule in its structure. In each case, the microcrystalline powders from LAG were useful in providing seeding for the single-crystal growth.

Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle 1

PubMed Central

Vanlerberghe, Greg C.; Horsey, Anne K.; Weger, Harold G.; Turpin, David H.

1989-01-01

Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH4+ in the dark under anaerobic conditions. Addition of NH4+ to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO2 efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H14CO3− to anaerobic cells assimilating NH4+ results in the incorporation of radiolabel into the α-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH4+ addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply α-ketoglutarate for glutamate production. During dark aerobic NH4+ assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH4+ assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH4+ assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity. PMID:16667215

Organic reactions catalyzed by methylrhenium trioxide: Reactions of ethyl diazoacetate and organic azides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Z.; Espenson, J.H.

1996-10-16

Methylrhenium trioxide (CH{sub 3}ReO{sub 3} or MTO) catalyzes several classes of reactions of ethyl diazoacetate, EDA. It is the first high valent oxo complex for carbene transfer. Under mild conditions and in the absence of other substrates, EDA was converted to a 9:1 mixture of diethyl maleate and diethyl fumarate. In the presence of alcohols, {alpha}-alkoxy ethyl acetates were obtained in good yield. The yields dropped for the larger and more branched alcohols, the balance of material being diethyl maleate and fumarate. An electron-donating group in the para position of phenols favors the formation of {alpha}-phenoxy ethyl acetates. The usemore » of EDA to form {alpha}-thio ethyl acetates and N-substituted glycine ethyl esters, on the other hand, is hardly affected by the size or structure of the parent thiol or amine, with all of these reactions proceeding in high yield. MTO-catalyzed cycloaddition reactions occur between EDA and aromatic imines, olefins, and carbonyl compounds. Three-membered ring products are formed: aziridines, cyclopropanes, and epoxides, respectively. The reactions favor the formation of trans products, and provide a convenient route for the preparation of aziridines. Intermediate carbenoid and nitrenoid species have been proposed. In the presence of an oxygen source such as an epoxide, ethyl diazoacetate and azibenzil are converted to an oxalic acid monoethyl ester and to benzil; at the same time the epoxide was converted to an olefin. 75 refs., 1 fig., 7 tabs.« less

Rilpivirine versus efavirenz with tenofovir and emtricitabine in treatment-naive adults infected with HIV-1 (ECHO): a phase 3 randomised double-blind active-controlled trial.

PubMed

Molina, Jean-Michel; Cahn, Pedro; Grinsztejn, Beatriz; Lazzarin, Adriano; Mills, Anthony; Saag, Michael; Supparatpinyo, Khuanchai; Walmsley, Sharon; Crauwels, Herta; Rimsky, Laurence T; Vanveggel, Simon; Boven, Katia

2011-07-16

Efavirenz with tenofovir-disoproxil-fumarate and emtricitabine is a preferred antiretroviral regimen for treatment-naive patients infected with HIV-1. Rilpivirine, a new non-nucleoside reverse transcriptase inhibitor, has shown similar antiviral efficacy to efavirenz in a phase 2b trial with two nucleoside/nucleotide reverse transcriptase inhibitors. We aimed to assess the efficacy, safety, and tolerability of rilpivirine versus efavirenz, each combined with tenofovir-disoproxil-fumarate and emtricitabine. We did a phase 3, randomised, double-blind, double-dummy, active-controlled trial, in patients infected with HIV-1 who were treatment-naive. The patients were aged 18 years or older with a plasma viral load at screening of 5000 copies per mL or greater, and viral sensitivity to all study drugs. Our trial was done at 112 sites across 21 countries. Patients were randomly assigned by a computer-generated interactive web response system to receive either once-daily 25 mg rilpivirine or once-daily 600 mg efavirenz, each with tenofovir-disoproxil-fumarate and emtricitabine. Our primary objective was to show non-inferiority (12% margin) of rilpivirine to efavirenz in terms of the percentage of patients with confirmed response (viral load <50 copies per mL intention-to-treat time-to-loss-of-virological-response [ITT-TLOVR] algorithm) at week 48. Our primary analysis was by intention-to-treat. We also used logistic regression to adjust for baseline viral load. This trial is registered with ClinicalTrials.gov, number NCT00540449. 346 patients were randomly assigned to receive rilpivirine and 344 to receive efavirenz and received at least one dose of study drug, with 287 (83%) and 285 (83%) in the respective groups having a confirmed response at week 48. The point estimate from a logistic regression model for the percentage difference in response was -0.4 (95% CI -5.9 to 5.2), confirming non-inferiority with a 12% margin (primary endpoint). The incidence of virological failures was 13% (rilpivirine) versus 6% (efavirenz; 11%vs 4% by ITT-TLOVR). Grade 2-4 adverse events (55 [16%] on rilpivirine vs 108 [31%] on efavirenz, p<0.0001), discontinuations due to adverse events (eight [2%] on rilpivirine vs 27 [8%] on efavirenz), rash, dizziness, and abnormal dreams or nightmares were more common with efavirenz. Increases in plasma lipids were significantly lower with rilpivirine. Rilpivirine showed non-inferior efficacy compared with efavirenz, with a higher virological-failure rate, but a more favourable safety and tolerability profile. Tibotec. Copyright © 2011 Elsevier Ltd. All rights reserved.

The Fumarate Reductase of Bacteroides thetaiotaomicron, unlike That of Escherichia coli, Is Configured so that It Does Not Generate Reactive Oxygen Species.

PubMed

Lu, Zheng; Imlay, James A

2017-01-03

The impact of oxidative stress upon organismal fitness is most apparent in the phenomenon of obligate anaerobiosis. The root cause may be multifaceted, but the intracellular generation of reactive oxygen species (ROS) likely plays a key role. ROS are formed when redox enzymes accidentally transfer electrons to oxygen rather than to their physiological substrates. In this study, we confirm that the predominant intestinal anaerobe Bacteroides thetaiotaomicron generates intracellular ROS at a very high rate when it is aerated. Fumarate reductase (Frd) is a prominent enzyme in the anaerobic metabolism of many bacteria, including B. thetaiotaomicron, and prior studies of Escherichia coli Frd showed that the enzyme is unusually prone to ROS generation. Surprisingly, in this study biochemical analysis demonstrated that the B. thetaiotaomicron Frd does not react with oxygen at all: neither superoxide nor hydrogen peroxide is formed. Subunit-swapping experiments indicated that this difference does not derive from the flavoprotein subunit at which ROS normally arise. Experiments with the related enzyme succinate dehydrogenase discouraged the hypothesis that heme moieties are responsible. Thus, resistance to oxidation may reflect a shift of electron density away from the flavin moiety toward the iron-sulfur clusters. This study shows that the autoxidizability of a redox enzyme can be suppressed by subtle modifications that do not compromise its physiological function. One implication is that selective pressures might enhance the oxygen tolerance of an organism by manipulating the electronic properties of its redox enzymes so they do not generate ROS. Whether in sediments or pathogenic biofilms, the structures of microbial communities are configured around the sensitivities of their members to oxygen. Oxygen triggers the intracellular formation of reactive oxygen species (ROS), and the sensitivity of a microbe to oxygen likely depends upon the rates at which ROS are formed inside it. This study supports that idea, as an obligate anaerobe was confirmed to generate ROS very rapidly upon aeration. However, the suspected source of the ROS was disproven, as the fumarate reductase of the anaerobe did not display the high oxidation rate of its E. coli homologue. Evidently, adjustments in its electronic structure can suppress the tendency of an enzyme to generate ROS. Importantly, this outcome suggests that evolutionary pressure may succeed in modifying redox enzymes and thereby diminishing the stress that an organism experiences in oxic environments. The actual source of ROS in the anaerobe remains to be discovered. Copyright © 2017 Lu and Imlay.

96 weeks treatment of tenofovir alafenamide vs. tenofovir disoproxil fumarate for hepatitis B virus infection.

PubMed

Agarwal, Kosh; Brunetto, Maurizia; Seto, Wai Kay; Lim, Young-Suk; Fung, Scott; Marcellin, Patrick; Ahn, Sang Hoon; Izumi, Namiki; Chuang, Wan-Long; Bae, Ho; Sharma, Manoj; Janssen, Harry L A; Pan, Calvin Q; Çelen, Mustafa Kemal; Furusyo, Norihiro; Shalimar, Dr; Yoon, Ki Tae; Trinh, Huy; Flaherty, John F; Gaggar, Anuj; Lau, Audrey H; Cathcart, Andrea L; Lin, Lanjia; Bhardwaj, Neeru; Suri, Vithika; Mani Subramanian, G; Gane, Edward J; Buti, Maria; Chan, Henry L Y

2018-04-01

Tenofovir alafenamide (TAF) is a new prodrug of tenofovir developed to treat patients with chronic hepatitis B virus (HBV) infection at a lower dose than tenofovir disoproxil fumarate (TDF) through more efficient delivery of tenofovir to hepatocytes. In 48-week results from two ongoing, double-blind, randomized phase III trials, TAF was non-inferior to TDF in efficacy with improved renal and bone safety. We report 96-week outcomes for both trials. In two international trials, patients with chronic HBV infection were randomized 2:1 to receive 25 mg TAF or 300 mg TDF in a double-blinded fashion. One study enrolled HBeAg-positive patients and the other HBeAg-negative patients. We assessed efficacy in each study, and safety in the pooled population. At week 96, the differences in the rates of viral suppression were similar in HBeAg-positive patients receiving TAF and TDF (73% vs. 75%, respectively, adjusted difference -2.2% (95% CI -8.3 to 3.9%; p = 0.47), and in HBeAg-negative patients receiving TAF and TDF (90% vs. 91%, respectively, adjusted difference -0.6% (95% CI -7.0 to 5.8%; p = 0.84). In both studies the proportions of patients with alanine aminotransferase above the upper limit of normal at baseline, who had normal alanine aminotransferase at week 96 of treatment, were significantly higher in patients receiving TAF than in those receiving TDF. In the pooled safety population, patients receiving TAF had significantly smaller decreases in bone mineral density than those receiving TDF in the hip (mean % change -0.33% vs. -2.51%; p <0.001) and lumbar spine (mean % change -0.75% vs. -2.57%; p <0.001), as well as a significantly smaller median change in estimated glomerular filtration rate by Cockcroft-Gault method (-1.2 vs. -4.8 mg/dl; p <0.001). In patients with HBV infection, TAF remained as effective as TDF, with continued improved renal and bone safety, two years after the initiation of treatment. Clinicaltrials.gov number: NCT01940471 and NCT01940341. At week 96 of two ongoing studies comparing the efficacy and safety of tenofovir alafenamide (TAF) to tenofovir disoproxil fumarate (TDF) for the treatment of chronic hepatitis B patients, TAF continues to be as effective as TDF with continued improved renal and bone safety. Registration: Clinicaltrials.gov number: NCT01940471 and NCT01940341. Copyright © 2017 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Laboratoire de Chimie Bactérienne C.N.R.S., Marsielle, France.

PubMed

Chippaux, M; Giudici, D; Abou-Jaoudé, A; Casse, F; Pascal, M C

1978-04-06

Mutants of E. coli, completely devoid of nitrite reductase activity with glucose or formate as donor were studied. Biochemical analysis indicates that they are simultaneously affected in nitrate reductase, nitrite reductase, fumarate reductase and hydrogenase activities as well as in cytochrome C552 biosynthesis. The use of an antiserum specific for nitrate reductase shows that the nitrate reductase protein is probably missing. A single mutation is responsible for this phenotype: the gene affected, nir R, is located close to tyr R i.e. at 29 min on the chromosomal map.

Effect of Calcium Phosphate Coating and rhBMP-2 on Bone Regeneration in Rabbit Calvaria Using Poly(propylene fumarate) Scaffolds

DTIC Science & Technology

2015-01-07

algorithm [30] applied across all the samples to minimize error. Morphometric analysis was carried out on CT images using CTanalyzer v. 1.4 (Bruker...remaining of 8.1 ± 1.0% was observed for uncoated PPF. 3.2. Scaffold micro-CT evaluation 3-D reconstructions of all scaffolds showed good geometric con...scaffolds. Within the single central histological cross-section, morphometric analysis indicated that the SBM scaffolds loaded with rhBMP-2 (50 and 100 lg

DISTILLER: a data integration framework to reveal condition dependency of complex regulons in Escherichia coli

PubMed Central

Lemmens, Karen; De Bie, Tijl; Dhollander, Thomas; De Keersmaecker, Sigrid C; Thijs, Inge M; Schoofs, Geert; De Weerdt, Ami; De Moor, Bart; Vanderleyden, Jos; Collado-Vides, Julio; Engelen, Kristof; Marchal, Kathleen

2009-01-01

We present DISTILLER, a data integration framework for the inference of transcriptional module networks. Experimental validation of predicted targets for the well-studied fumarate nitrate reductase regulator showed the effectiveness of our approach in Escherichia coli. In addition, the condition dependency and modularity of the inferred transcriptional network was studied. Surprisingly, the level of regulatory complexity seemed lower than that which would be expected from RegulonDB, indicating that complex regulatory programs tend to decrease the degree of modularity. PMID:19265557

The Path of Carbon in Photosynthesis VIII. The Role of Malic Acid

DOE R&D Accomplishments Database

Bassham, James A.; Benson, Andrew A.; Calvin, Melvin

1950-01-25

Malonate has been found to inhibit the formation of malic acid during short periods of photosynthesis with radioactive carbon dioxide. This result, together with studies which show the photosynthetic cycle to be operating normally at the same time, indicates that malic acid is not an intermediate in photosynthesis but is probably closely related to some intermediate of the cycle. Absence of labeled succinic and fumaric acids in these experiments, in addition to the failure of malonate to inhibit photosynthesis, precludes the participation of these acids as intermediates in photosynthesis.

Impact of fumaric acid esters on cardiovascular risk factors and depression in psoriasis: a prospective pilot study.

PubMed

Schmieder, Astrid; Poppe, Manuel; Hametner, Christian; Meyer-Schraml, Hanna; Schaarschmidt, Marthe-Lisa; Findeisen, Peter; Benoit, Sandrine; Bauer, Boris; Schmid, Sybille; Goebeler, Matthias; Goerdt, Sergij; Ludwig-Peitsch, Wiebke K

2015-07-01

Patients with psoriasis have an increased risk of cardiovascular disease that is partly attributable to chronic systemic inflammation. The aim of our prospective pilot study was to investigate the impact of fumaric acid esters (FAE), a first-line systemic antipsoriatic treatment in Germany, on cardiovascular risk parameters. Participants with moderate-to-severe psoriasis from the University Medical Center Mannheim and the University Hospital Würzburg were treated with FAE for 16 weeks according to standard dosage recommendations. Disease severity, life quality and depression scores as well as biomarkers of inflammation, lipid and glucose metabolism were assessed prior to initiation of FAE and after 16 weeks. Out of 39 participants recruited, 27 completed the study. 44% of all participants and 63% of those completing the 16-week treatment achieved PASI 50 response and 27 or 37% PASI 75 response. Clinical improvement was paralleled by significant improvement in quality of life, high treatment satisfaction and significant reduction of depressive symptoms. Adverse events, most frequently mild gastrointestinal complaints, flush and lymphocytopenia occurred in 89%. FAE did not modify glucose metabolism or inflammatory parameters substantially. However, a highly significant increase in serum levels of the atheroprotective cytokine adiponectin was noted after 16 weeks (median 4.7 vs. 8.9 µg/ml; p = 0.0002). Our study demonstrates a significant beneficial impact of FAE on adiponectin, indicating a potential cardioprotective effect. It will be interesting to verify this finding in larger cohorts and to assess the long-term influence of FAE on cardiovascular risk and disease.

Inhibition of fumarate reductase in Leishmania major and L. donovani by chalcones.

PubMed

Chen, M; Zhai, L; Christensen, S B; Theander, T G; Kharazmi, A

2001-07-01

Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity of mitochondrial dehydrogenases of Leishmania parasites. The present study was designed to further investigate the mechanism of action of chalcones, focusing on the parasite respiratory chain. The data show that licochalcone A inhibited the activity of fumarate reductase (FRD) in the permeabilized Leishmania major promastigote and in the parasite mitochondria, and it also inhibited solubilized FRD and a purified FRD from L. donovani. Two other chalcones, 2,4-dimethoxy-4'-allyloxychalcone (24m4ac) and 2,4-dimethoxy-4'-butoxychalcone (24mbc), also exhibited inhibitory effects on the activity of solubilized FRD in L. major promastigotes. Although licochalcone A inhibited the activities of succinate dehydrogenase (SDH), NADH dehydrogenase (NDH), and succinate- and NADH-cytochrome c reductases in the parasite mitochondria, the 50% inhibitory concentrations (IC(50)) of licochalcone A for these enzymes were at least 20 times higher than that for FRD. The IC(50) of licochalcone A for SDH and NDH in human peripheral blood mononuclear cells were at least 70 times higher than that for FRD. These findings indicate that FRD, one of the enzymes of the parasite respiratory chain, might be the specific target for the chalcones tested. Since FRD exists in the Leishmania parasite and does not exist in mammalian cells, it could be an excellent target for antiprotozoal drugs.

The Fumarate Reductase of Bacteroides thetaiotaomicron, unlike That of Escherichia coli, Is Configured so that It Does Not Generate Reactive Oxygen Species

PubMed Central

Lu, Zheng

2017-01-01

ABSTRACT The impact of oxidative stress upon organismal fitness is most apparent in the phenomenon of obligate anaerobiosis. The root cause may be multifaceted, but the intracellular generation of reactive oxygen species (ROS) likely plays a key role. ROS are formed when redox enzymes accidentally transfer electrons to oxygen rather than to their physiological substrates. In this study, we confirm that the predominant intestinal anaerobe Bacteroides thetaiotaomicron generates intracellular ROS at a very high rate when it is aerated. Fumarate reductase (Frd) is a prominent enzyme in the anaerobic metabolism of many bacteria, including B. thetaiotaomicron, and prior studies of Escherichia coli Frd showed that the enzyme is unusually prone to ROS generation. Surprisingly, in this study biochemical analysis demonstrated that the B. thetaiotaomicron Frd does not react with oxygen at all: neither superoxide nor hydrogen peroxide is formed. Subunit-swapping experiments indicated that this difference does not derive from the flavoprotein subunit at which ROS normally arise. Experiments with the related enzyme succinate dehydrogenase discouraged the hypothesis that heme moieties are responsible. Thus, resistance to oxidation may reflect a shift of electron density away from the flavin moiety toward the iron-sulfur clusters. This study shows that the autoxidizability of a redox enzyme can be suppressed by subtle modifications that do not compromise its physiological function. One implication is that selective pressures might enhance the oxygen tolerance of an organism by manipulating the electronic properties of its redox enzymes so they do not generate ROS. PMID:28049145

Free radical scavenging injectable hydrogels for regenerative therapy.

PubMed

Komeri, Remya; Thankam, Finosh Gnanaprakasam; Muthu, Jayabalan

2017-02-01

Pathological free radicals generated from inflamed and infarcted cardiac tissues interferes natural tissue repair mechanisms. Hypoxic microenvironment at the injured zone of non-regenerating cardiac tissues hinders the therapeutic attempts including cell therapy. Here we report an injectable, cytocompatible, free radical scavenging synthetic hydrogel formulation for regenerative therapy. New hydrogel (PEAX-P) is prepared with D-xylitol-co-fumarate-co-poly ethylene adipate-co-PEG comaromer (PEAX) and PEGDiacrylate. PEAX-P hydrogel swells 4.9 times the initial weight and retains 100.07kPa Young modulus at equilibrium swelling, which is suitable for cardiac applications. PEAX-P hydrogel retains elastic nature even at 60% compressive strain, which is favorable to fit with the dynamic and elastic natural tissue counterparts. PEAX-P hydrogel scavenges 51% DPPH radical, 40% hydroxyl radicals 41% nitrate radicals with 31% reducing power. The presence of hydrogel protects 62% cardiomyoblast cells treated with stress inducing media at LD 50 concentration. The free hydroxyl groups in sugar alcohols of the comacromer influence the free radical scavenging. Comparatively, PEAX-P hydrogel based on xylitol evinces slightly lower scavenging characteristics than with previously reported PEAM-P hydrogel containing mannitol having more hydroxyl groups. The possible free radical scavenging mechanism of the present hydrogel relies on the free π electrons associated with uncrosslinked fumarate bonds, hydrogen atoms associated with sugar alcohols/PEG and radical dilution by free water in the matrix. Briefly, the present PEAX-P hydrogel is a potential injectable system for combined antioxidant and regenerative therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

Low Risk of Proximal Tubular Dysfunction Associated With Emtricitabine-Tenofovir Disoproxil Fumarate Preexposure Prophylaxis in Men and Women

PubMed Central

Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina

2016-01-01

Objective. Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). Methods. A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Results. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52–3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10–14.0; P > .99). Conclusions. Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. PMID:27029778

Dimethyl fumarate reduces the risk of mycotoxins via improving intestinal barrier and microbiota

PubMed Central

Ma, Ning; Wu, Yi; Xie, Fei; Du, Kexin; Wang, Yuan; Shi, Linxin; Ji, Linbao; Liu, Tianyi; Ma, Xi

2017-01-01

The effects of dimethyl fumarate (DMF) on mycotoxins and animal growth performance are well documented. However, its mechanism of anti-mildew effects is still unknown. The current study investigated how DMF detoxified the mycotoxin and improved the growth performance using BALB/c mice model, especially its effects on intestinal barrier function and gut micro-ecology. Our study also compared with the ultraviolet radiation (UR) treatment, a traditional anti-mildew control (TC). The results indicated that the DMF treatment had a lower contents of mycotoxin, better growth performance and improved mucosal morphology (P < 0.05), accompanied with the decreased intestinal permeability and the tighter gut barrier. Moreover, the efficiency of DMF was better than TC (P < 0.05). 16S rRNA gene sequence analysis revealed that the richness and diversity of bacteria was increased in DMF treatment. The most abundant OTUs belonged to Firmicutes and Bacteroidetes, and their changes in DMF were more moderate than the TC group, suggesting a more stable micro-ecology and the positive impact of DMF on the biodiversity of intestine. Specifically, the increased abundance of bacteria producing short-chain fatty acids (SCFAs), such as Gemella, Roseburia, Bacillus and Bacteroides in DMF group and prebiotics such as Lactobacillus in TC group, suggested a more healthier microbial composition and distribution. These findings supported that DMF had significant effects on animal's growth performance and intestinal barrier function by modulating the pathway of nutrient absorption and increasing the diversity and balance of gut microbes, which also illuminate that DMF is more efficient than traditional anti-mildew method. PMID:28574825

Genetic Variation of the Kinases That Phosphorylate Tenofovir and Emtricitabine in Peripheral Blood Mononuclear Cells.

PubMed

Figueroa, Dominique B; Madeen, Erin P; Tillotson, Joseph; Richardson, Paul; Cottle, Leslie; McCauley, Marybeth; Landovitz, Raphael J; Andrade, Adriana; Hendrix, Craig W; Mayer, Kenneth H; Wilkin, Timothy; Gulick, Roy M; Bumpus, Namandjé N

2018-05-01

Tenofovir (TFV) disoproxil fumarate and emtricitabine (FTC) are used in combination for HIV treatment and pre-exposure prophylaxis (PrEP). TFV disoproxil fumarate is a prodrug that undergoes diester hydrolysis to TFV. FTC and TFV are nucleoside/nucleotide reverse transcriptase inhibitors that upon phosphorylation to nucleotide triphosphate analogs competitively inhibit HIV reverse transcriptase. We previously demonstrated that adenylate kinase 2, pyruvate kinase, muscle and pyruvate kinase, liver and red blood cell phosphorylate TFV in peripheral blood mononuclear cells (PBMC). To identify the kinases that phosphorylate FTC in PBMC, siRNAs targeted toward kinases that phosphorylate compounds structurally similar to FTC were delivered to PBMC, followed by incubation with FTC and the application of a matrix-assisted laser desorption ionization-mass spectrometry method and ultra high performance liquid chromatography-UV to detect the formation of FTC phosphates. Knockdown of deoxycytidine kinase decreased the formation of FTC-monophosphate, while siRNA targeted toward thymidine kinase 1 decreased the abundance of FTC-diphosphate. Knockdown of either cytidine monophosphate kinase 1 or phosphoglycerate kinase 1 decreased the abundance of FTC-triphosphate. Next-generation sequencing of genomic DNA isolated from 498 HIV-uninfected participants in the HIV Prevention Trials Network 069/AIDS Clinical Trials Group A5305 clinical study, revealed 17 previously unreported genetic variants of TFV or FTC phosphorylating kinases. Of note, four individuals were identified as simultaneous carriers of variants of both TFV and FTC activating kinases. These results identify the specific kinases that activate FTC in PBMC, while also providing further insight into the potential for genetic variation to impact TFV and FTC activation.

PubMed

Camporro, Fernando Astur; Gutierrez Magaldi, Ignacio; Bulacio, Exequiel

2017-09-08

Introducción: El tabaquismo es la primera causa evitable de muerte en el mundo. El cigarrillo electrónico (CE), es un dispositivo que simula a los cigarrillos convencionales y permite inhalar nicotina y otras sustancias de forma vaporizada, sin combustión de tabaco. Su conocimiento por parte de la población general, así como su comercialización y consumo viene en constante aumento. Es utilizado en todo el mundo con el objetivo de disminuir el consumo de tabaco, lograr su abandono o poder utilizarlo en lugares públicos donde el consumo de cigarrillos convencionales está prohibido. Efectos nocivos sobre la salud: Su utilización se ha asociado a neumonía lipoidea e irritación de la vía aérea superior y toxicidad por nicotina. Presenta sustancias cancerígenas como nitrosaminas, formaldeido y metales como el niquel, cromo y plomo. Aumenta la resistencia de la vía aérea, efecto que es similar al que se produce después de la inhalación del humo del tabaco. Eficacia para dejar de fumar: No hay hasta el momento trabajos que demuestren con poder estadístico y buena metodología que este producto sea eficaz para dejar de fumar.  Conclusiones: De acuerdo a la evidencia disponible, no podemos descartar que el uso del cigarrillo electrónico no tenga riesgos para la salud. La seguridad y eficacia de los cigarrillos electrónicos como ayuda para el abandono del hábito tabáquico no han sido demostradas.

Investigations of structure and metabolism within Shewanella oneidensis MR-1 biofilms.

PubMed

McLean, Jeffrey S; Majors, Paul D; Reardon, Catherine L; Bilskis, Christina L; Reed, Samantha B; Romine, Margaret F; Fredrickson, James K

2008-07-01

Biofilms possess spatially and temporally varying metabolite concentration profiles at the macroscopic and microscopic scales. This results in varying growth environments that may ultimately drive species diversity, determine biofilm structure and the spatial distribution of the community members. Using non-invasive nuclear magnetic resonance (NMR) microscopic imaging/spectroscopy and confocal imaging, we investigated the kinetics and stratification of anaerobic metabolism within live biofilms of the dissimilatory metal-reducing bacterium Shewanella oneidensis strain MR-1. Biofilms were pre-grown using a defined minimal medium in a constant-depth film bioreactor and subsequently transferred to an in-magnet sample chamber under laminar flow for NMR measurements. Biofilms generated in this manner were subjected to changing substrate/electron acceptor combinations (fumarate, dimethyl sulfoxide, and nitrate) and the metabolic responses measured. Localized NMR spectroscopy was used to non-invasively measure hydrogen-containing metabolites at high temporal resolution (4.5 min) under O(2)-limited conditions. Reduction of electron acceptor under anaerobic conditions was immediately observed upon switching feed solutions indicating that no gene induction (transcriptional response) was needed for MR-1 to switch metabolism from O(2) to fumarate, dimethyl sulfoxide or nitrate. In parallel experiments, confocal microscopy was used with constitutively expressed fluorescent reporters to independently investigate changes in population response to the availability of electron acceptor and to probe metabolic competition under O(2)-limited conditions. A clearer understanding of the metabolic diversity and plasticity of the biofilm mode of growth as well as how these factors relate to environmental fitness is made possible through the use of non-invasive and non-destructive techniques such as described herein.

Ruxolitinib synergizes with DMF to kill via BIM+BAD-induced mitochondrial dysfunction and via reduced SOD2/TRX expression and ROS.

PubMed

Tavallai, Mehrad; Booth, Laurence; Roberts, Jane L; McGuire, William P; Poklepovic, Andrew; Dent, Paul

2016-04-05

We determined whether the myelofibrosis drug ruxolitinib, an inhibitor of Janus kinases 1/2 (JAK1 and JAK2), could interact with the multiple sclerosis drug dimethyl-fumarate (DMF) to kill tumor cells; studies used the in vivo active form of the drug, mono-methyl fumarate (MMF). Ruxolitinib interacted with MMF to kill brain, breast, lung and ovarian cancer cells, and enhanced the lethality of standard of care therapies such as paclitaxel and temozolomide. MMF also interacted with other FDA approved drugs to kill tumor cells including Celebrex® and Gilenya®. The combination of [ruxolitinib + MMF] inactivated ERK1/2, AKT, STAT3 and STAT5; reduced expression of MCL-1, BCL-XL, SOD2 and TRX; increased BIM expression; decreased BAD S112 S136 phosphorylation; and enhanced pro-caspase 3 cleavage. Expression of activated forms of STAT3, MEK1 or AKT each significantly reduced drug combination lethality; prevented BAD S112 S136 dephosphorylation and decreased BIM expression; and preserved TRX, SOD2, MCL-1 and BCL-XL expression. The drug combination increased the levels of reactive oxygen species in cells, and over-expression of TRX or SOD2 prevented drug combination tumor cell killing. Over-expression of BCL-XL or knock down of BAX, BIM, BAD or apoptosis inducing factor (AIF) protected tumor cells. The drug combination increased AIF : HSP70 co-localization in the cytosol but this event did not prevent AIF : eIF3A association in the nucleus.

Bone health and HIV in resource-limited settings: a scoping review

PubMed Central

Matovu, Flavia Kiweewa; Wattanachanya, Lalita; Beksinska, Mags; Pettifor, John M.; Ruxrungtham, Kiat

2016-01-01

Purpose of review Sub-Saharan Africa and other resource-limited settings (RLS) bear the greatest burden of the HIV epidemic globally. Advantageously, the expanding access to antiretroviral therapy (ART) has resulted in increased survival of HIV individuals in the last 2 decades. Data from resource rich settings provide evidence of increased risk of comorbid conditions such as osteoporosis and fragility fractures among HIV-infected populations. We provide the first review of published and presented data synthesizing the current state of knowledge on bone health and HIV in RLS. Recent findings With few exceptions, we found a high prevalence of low bone mineral density (BMD) and hypovitaminosis D among HIV-infected populations in both RLS and resource rich settings. Although most recognized risk factors for bone loss are similar across settings, in certain RLS there is a high prevalence of both non-HIV-specific risk factors and HIV-specific risk factors, including advanced HIV disease and widespread use of ART, including tenofovir disoproxil fumarate, a non-BMD sparing ART. Of great concern, we neither found published data on the effect of tenofovir disoproxil fumarate initiation on BMD, nor any data on incidence and prevalence of fractures among HIV-infected populations in RLS. Summary To date, the prevalence and squeal of metabolic bone diseases in RLS are poorly described. This review highlights important gaps in our knowledge about HIV-associated bone health comorbidities in RLS. This creates an urgent need for targeted research that can inform HIV care and management guidelines in RLS. Video abstract: http://links.lww.com/COHA/A9. PMID:27023284

Current and future directions for treating hepatitis B virus infection

PubMed Central

Tawada, Akinobu; Kanda, Tatsuo; Yokosuka, Osamu

2015-01-01

Hepatitis B virus (HBV) persistently infects approximately 350 million people, and approximately 600000 liver-related deaths are observed per year worldwide. HBV infection is also one of the major risk factors for hepatocellular carcinoma (HCC). The persistence of serum hepatitis B e antigen (HBeAg) and high level of serum HBV DNA are thought to reflect a high HBV replication status in hepatocytes, causing cirrhosis, HCC and liver-related deaths. It has been reported that antiviral therapy, such as peginterferon and nucleos(t)ide analogues (NUCs), could suppress liver-related death by inhibiting the HBV DNA levels and inducing seroconversion from HBeAg to antibody to HBe antigen. Currently, peginterferon is widely used, but there are also several disadvantages in the use of peginterferon, such as various adverse events, the administration route and duration. It is difficult to predict the effects of treatment and interferon is contraindicated for the patients with advanced fibrosis of the liver and cirrhosis. With respect to NUCs, entecavir and tenofovir disoproxil fumarate are current the first-choice drugs. NUCs can be administered orally, and their anti-viral effects are stronger than that of peginterferon. However, because cessation of NUC administration leads to high levels of viral replication and causes severe hepatitis, they must be administered for a long time. On the other hand, the use of both interferon and NUCs cannot eliminate covalently closed circular DNA of HBV. In this review, we evaluate the natural course of chronic HBV infection and then provide an outline of these representative drugs, such as peginterferon, entecavir and tenofovir disoproxil fumarate. PMID:26085913

Design of sustained release pellets of ferrous fumarate using cow ghee as hot-melt coating agent.

PubMed

Sakarkar, Dinesh M; Dorle, Avinash K; Mahajan, Nilesh Manoharrao; Sudke, Suresh Gendappa

2013-07-01

The objective of the present study was to design ferrous fumarate (FF) sustained release (SR) pellets using of cow ghee (CG) as an important hot-melt coating (HMC) agent. The pellets were coated by HMC technique using CG and ethyl cellulose composition by conventional coating pan without the use of spray system. FF formulated as pellets and characterized with regard to the drug content and physico-chemical properties. Stability studies were carried out on the optimized formulation for a period of 6 months at 40 ± 2°C and 75 ± 5% relative humidity. Pellets with good surface morphology and smooth texture confirmed by stereo micrographs. HMC is easy, efficient, rapid and simple method since virtually no agglomeration seen during coating. In-vitro release from pellets at a given level of coating and for present pellet size was dependent upon the physico-chemical property of the drug and mostly aqueous solubility of the drug. The selection of optimized FF formulation was confirmed by comparing percent cumulative drug release with theoretical release profile. Formulation F2 had difference factor (f 1) and similarity factor (f 2) values was found to be 5 and 66 respectively. F2 showed SR of drug for 8 h with cumulative per cent release of 98.03 ± 4.49%. Release kinetics indicates approximately zero order release pattern. HMC pellets were stable during the course of stability study. By means of HMC using CG and ethyl cellulose, SR pellets containing FF were successfully prepared.

The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

PubMed Central

2009-01-01

Background The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second putative succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae. PMID:19473543

Succination of Thiol Groups in Adipose Tissue Proteins in Diabetes

PubMed Central

Frizzell, Norma; Rajesh, Mathur; Jepson, Matthew J.; Nagai, Ryoji; Carson, James A.; Thorpe, Suzanne R.; Baynes, John W.

2009-01-01

S-(2-Succinyl)cysteine (2SC) is formed by reaction of the Krebs cycle intermediate fumarate with cysteine residues in protein, a process termed succination of protein. Both fumarate and succination of proteins are increased in adipocytes cultured in high glucose medium (Nagai, R., Brock, J. W., Blatnik, M., Baatz, J. E., Bethard, J., Walla, M. D., Thorpe, S. R., Baynes, J. W., and Frizzell, N. (2007) J. Biol. Chem. 282, 34219–34228). We show here that succination of protein is also increased in epididymal, mesenteric, and subcutaneous adipose tissue of diabetic (db/db) mice and that adiponectin is a major target for succination in both adipocytes and adipose tissue. Cys-39, which is involved in cross-linking of adiponectin monomers to form trimers, was identified as a key site of succination of adiponectin in adipocytes. 2SC was detected on two of seven monomeric forms of adiponectin immunoprecipitated from adipocytes and epididymal adipose tissue. Based on densitometry, 2SC-adiponectin accounted for ∼7 and 8% of total intracellular adiponectin in cells and tissue, respectively. 2SC was found only in the intracellular, monomeric forms of adiponectin and was not detectable in polymeric forms of adiponectin in cell culture medium or plasma. We conclude that succination of adiponectin blocks its incorporation into trimeric and higher molecular weight, secreted forms of adiponectin. We propose that succination of proteins is a biomarker of mitochondrial stress and accumulation of Krebs cycle intermediates in adipose tissue in diabetes and that succination of adiponectin may contribute to the decrease in plasma adiponectin in diabetes. PMID:19592500

A phase 1 randomized placebo-controlled safety and pharmacokinetic trial of a tenofovir disoproxil fumarate vaginal ring.

PubMed

Keller, Marla J; Mesquita, Pedro M; Marzinke, Mark A; Teller, Ryan; Espinoza, Lilia; Atrio, Jessica M; Lo, Yungtai; Frank, Bruce; Srinivasan, Sujatha; Fredricks, David N; Rabe, Lorna; Anderson, Peter L; Hendrix, Craig W; Kiser, Patrick F; Herold, Betsy C

2016-03-13

Tenofovir disoproxil fumarate (TDF), a prodrug of tenofovir (TFV), may be ideal for topical HIV preexposure prophylaxis because it has higher tissue and cell permeability than TFV; is not adversely impacted by seminal proteins; and its active metabolite, TFV-diphosphate (TFV-DP), has a long intracellular half-life. We engineered a TDF eluting polyurethane reservoir intravaginal ring (IVR) to provide near constant mucosal antiretroviral concentrations. A first-in-human randomized placebo-controlled trial was conducted to assess the safety and pharmacokinetics of the TDF IVR in healthy, sexually abstinent women (15 TDF and 15 placebo). Drug concentrations were measured in cervicovaginal fluid (CVF) obtained by swab, cervical tissue, plasma, and dried blood spots (DBS) over 14 days of continuous ring use. There were 43 total, 23 reproductive tract, and eight product-related grade 1 adverse events. Steady-state CVF TFV concentrations were achieved proximal (vagina, ectocervix) and distal (introitus) to the TDF IVR 1 day after ring insertion. Median tissue TFV-DP concentrations 14 days after TDF IVR placement were 120 fmol/mg (interquartile range 90, 550). CVF collected from the cervix 1 week and 2 weeks after TDF IVR insertion provided significant protection against ex-vivo HIV challenge. Eleven of 14 (78%) participants had detectable TFV-DP DBS concentrations 14 days after TDF IVR placement, suggesting that DBS may provide a surrogate marker of adherence in future clinical trials. A TDF IVR is safe, well tolerated, and results in mucosal TFV concentrations that exceed those associated with HIV protection. The findings support further clinical evaluation of this TDF IVR.

Inhibition of Fumarate Reductase in Leishmania major and L. donovani by Chalcones

PubMed Central

Chen, Ming; Zhai, Lin; Christensen, Søren Brøgger; Theander, Thor G.; Kharazmi, Arsalan

2001-01-01

Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity of mitochondrial dehydrogenases of Leishmania parasites. The present study was designed to further investigate the mechanism of action of chalcones, focusing on the parasite respiratory chain. The data show that licochalcone A inhibited the activity of fumarate reductase (FRD) in the permeabilized Leishmania major promastigote and in the parasite mitochondria, and it also inhibited solubilized FRD and a purified FRD from L. donovani. Two other chalcones, 2,4-dimethoxy-4′-allyloxychalcone (24m4ac) and 2,4-dimethoxy-4′-butoxychalcone (24mbc), also exhibited inhibitory effects on the activity of solubilized FRD in L. major promastigotes. Although licochalcone A inhibited the activities of succinate dehydrogenase (SDH), NADH dehydrogenase (NDH), and succinate- and NADH-cytochrome c reductases in the parasite mitochondria, the 50% inhibitory concentrations (IC50) of licochalcone A for these enzymes were at least 20 times higher than that for FRD. The IC50 of licochalcone A for SDH and NDH in human peripheral blood mononuclear cells were at least 70 times higher than that for FRD. These findings indicate that FRD, one of the enzymes of the parasite respiratory chain, might be the specific target for the chalcones tested. Since FRD exists in the Leishmania parasite and does not exist in mammalian cells, it could be an excellent target for antiprotozoal drugs. PMID:11408218

Drug-induced Fanconi syndrome associated with fumaric acid esters treatment for psoriasis: a case series

PubMed Central

Balak, Deepak M.W.; Bouwes Bavinck, Jan Nico; de Vries, Aiko P.J.; Hartman, Jenny; Neumann, Hendrik A. Martino; Zietse, Robert; Thio, Hok Bing

2016-01-01

Background Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Methods Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. Results All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37–46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28–111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. Conclusions FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome. PMID:26798466

Repurposing the NRF2 Activator Dimethyl Fumarate as Therapy Against Synucleinopathy in Parkinson's Disease.

PubMed

Lastres-Becker, Isabel; García-Yagüe, Angel J; Scannevin, Robert H; Casarejos, María J; Kügler, Sebastian; Rábano, Alberto; Cuadrado, Antonio

2016-07-10

This preclinical study was aimed at determining whether pharmacological targeting of transcription factor NRF2, a master controller of many homeostatic genes, might provide a disease-modifying therapy in the animal model of Parkinson's disease (PD) that best reproduces the main hallmark of this pathology, that is, α-synucleinopathy, and associated events, including nigral dopaminergic cell death, oxidative stress, and neuroinflammation. Pharmacological activation of NRF2 was achieved at the basal ganglia by repurposing dimethyl fumarate (DMF), a drug already in use for the treatment of multiple sclerosis. Daily oral gavage of DMF protected nigral dopaminergic neurons against α-SYN toxicity and decreased astrocytosis and microgliosis after 1, 3, and 8 weeks from stereotaxic delivery to the ventral midbrain of recombinant adeno-associated viral vector expressing human α-synuclein. This protective effect was not observed in Nrf2-knockout mice. In vitro studies indicated that this neuroprotective effect was correlated with altered regulation of autophagy markers SQTSM1/p62 and LC3 in MN9D, BV2, and IMA 2.1 and with a shift in microglial dynamics toward a less pro-inflammatory and a more wound-healing phenotype. In postmortem samples of PD patients, the cytoprotective proteins associated with NRF2 expression, NQO1 and p62, were partly sequestered in Lewy bodies, suggesting impaired neuroprotective capacity of the NRF2 signature. These experiments provide a compelling rationale for targeting NRF2 with DMF as a therapeutic strategy to reinforce endogenous brain defense mechanisms against PD-associated synucleinopathy. DMF is ready for clinical validation in PD. Antioxid. Redox Signal. 25, 61-77.

Pharmacokinetic interactions between lersivirine and zidovudine, tenofovir disoproxil fumarate/emtricitabine and abacavir/lamivudine.

PubMed

Vourvahis, Manoli; Davis, John; Langdon, Grant; Layton, Gary; Fang, Juanzhi; Choo, Heng Wee; Hansson, Arne G; Tawadrous, Margaret

2013-01-01

To investigate pharmacokinetic interactions associated with coadministration of lersivirine with zidovudine, tenofovir disoproxil fumarate (DF)/emtricitabine (Truvada(®)) or abacavir/lamivudine (Epzicom(®)/Kivexa(®)). Three Phase I, open, crossover studies with two (studies 1 and 3) or three (study 2) treatment periods were conducted in healthy individuals. In study 1, individuals received zidovudine and placebo or zidovudine and lersivirine on days 1-14. In study 2, individuals received lersivirine and tenofovir DF/emtricitabine, lersivirine and placebo or tenofovir DF/emtricitabine and placebo on days 1-10. In study 3, individuals received abacavir/lamivudine only in period 1 (5 days) and abacavir/lamivudine and lersivirine in period 2 (10 days). Blood samples were taken on days 1-14 (study 1) or day of final dose (studies 2 and 3) and analysed using high performance liquid chromatography/dual mass spectrometry. Pharmacokinetic parameters were calculated by standard non-compartmental methods. When coadministered with lersivirine, zidovudine exposure increased by 35%, and exposure of its metabolite zidovudine-glucuronide decreased by 19%. Following coadministration of lersivirine and tenofovir DF/emtricitabine, tenofovir exposure increased by 30%, and lersivirine exposure decreased by 12%. Coadministration of lersivirine and abacavir/lamivudine increased abacavir exposure by 27% and decreased lamivudine exposure by 8%. Adverse events were predominantly mild in these Phase I studies. Coadministration of lersivirine with zidovudine, tenofovir DF/emtricitabine or abacavir/lamivudine influenced the systemic exposure of all nucleoside reverse transcriptase inhibitor agents investigated (except for lamivudine; emtricitabine pharmacokinetics were not assessed). Changes were not considered clinically meaningful for zidovudine and abacavir. The clinical relevance of the effect on tenofovir pharmacokinetics is currently unknown.

Comparative study between simple and optimized liposomal dispersion of quetiapine fumarate for diffusion through nasal route.

PubMed

Upadhyay, Pratik; Trivedi, Jatin; Pundarikakshudu, Kilambi; Sheth, Navin

2016-05-01

Nasal route of drug administration is preferred more and more for the targeted delivery to the brain in current drug development scenario due to its ease of use, reliability, quick action, and lesser side effects. Those CNS drugs which have limited oral bioavailability due to pharmacokinetic consequences and brain barrier repulsion are getting onto this direction. Quetiapine fumarate, an analogous to above and an antischizophrenic agent, is tested for its diffusion property with and without lipophilic carrier through sheep nasal membrane. Being a BCS class II' and high permeable candidate, it tends to crossover easily, so made up in a simple dispersion. To improve its diffusion rate, it was embedded into liposomal dispersion, which has proven that it has advanced efficiency for diffusion. For this, both the formulations were checked and compared for their diffusion profile, as it is an essential property for bioavailability through nasal route. Comparison was made on the basis of % drug diffusion within 6 h, rate, mechanism, profile, and coefficient. Liposomal dispersion has been proved superior with greater percentage diffusion of 32.61 ± 1.70 and very high permeability with a coefficient value of 4.1334 ± 0.7321 (× 10 (-) (5 )cm/s). Diffusion profile comparison bearing dissimilarity of 18 and similarity of 74 indicated that the diffusion profiles of liposomal dispersions and simple dispersion were similar but not identical. Liposomal diffusion supremacy was further sustained by in vivo, ciliotoxicity, and gamma scintigraphy studies.

Comparative analysis of metagenomes from three methanogenic hydrocarbon-degrading enrichment cultures with 41 environmental samples.

PubMed

Tan, Boonfei; Fowler, S Jane; Abu Laban, Nidal; Dong, Xiaoli; Sensen, Christoph W; Foght, Julia; Gieg, Lisa M

2015-09-01

Methanogenic hydrocarbon metabolism is a key process in subsurface oil reservoirs and hydrocarbon-contaminated environments and thus warrants greater understanding to improve current technologies for fossil fuel extraction and bioremediation. In this study, three hydrocarbon-degrading methanogenic cultures established from two geographically distinct environments and incubated with different hydrocarbon substrates (added as single hydrocarbons or as mixtures) were subjected to metagenomic and 16S rRNA gene pyrosequencing to test whether these differences affect the genetic potential and composition of the communities. Enrichment of different putative hydrocarbon-degrading bacteria in each culture appeared to be substrate dependent, though all cultures contained both acetate- and H2-utilizing methanogens. Despite differing hydrocarbon substrates and inoculum sources, all three cultures harbored genes for hydrocarbon activation by fumarate addition (bssA, assA, nmsA) and carboxylation (abcA, ancA), along with those for associated downstream pathways (bbs, bcr, bam), though the cultures incubated with hydrocarbon mixtures contained a broader diversity of fumarate addition genes. A comparative metagenomic analysis of the three cultures showed that they were functionally redundant despite their enrichment backgrounds, sharing multiple features associated with syntrophic hydrocarbon conversion to methane. In addition, a comparative analysis of the culture metagenomes with those of 41 environmental samples (containing varying proportions of methanogens) showed that the three cultures were functionally most similar to each other but distinct from other environments, including hydrocarbon-impacted environments (for example, oil sands tailings ponds and oil-affected marine sediments). This study provides a basis for understanding key functions and environmental selection in methanogenic hydrocarbon-associated communities.

Effect of Cobicistat on Tenofovir Disoproxil Fumarate (TDF): What Is True for TAF May Also Be True for TDF.

PubMed

Cattaneo, Dario; Minisci, Davide; Baldelli, Sara; Mazzali, Cristina; Giacomelli, Andrea; Milazzo, Laura; Meraviglia, Paola; Resnati, Chiara; Rizzardini, Giuliano; Clementi, Emilio; Galli, Massimo; Gervasoni, Cristina

2018-01-01

The dose of tenofovir alafenamide is reduced from 25 to 10 mg daily when given with boosting agents. However, such dose reduction has never been adopted for tenofovir disoproxil fumarate (TDF). In this study, we aim to quantify the effect of cobicistat (COBI) both on tenofovir concentrations and TDF durability in real life setting. HIV-positive patients receiving TDF-containing antiretroviral therapies with at least 1 assessment of tenofovir plasma trough concentrations were included in the study. Univariate and multivariate regression analyses were performed considering tenofovir concentration as the dependent variable and clinical characteristics as independent covariates. Subsequently, survival and Cox analyses were performed considering as the primary outcome TDF discontinuation for any reasons. Patients were given TDF with protease inhibitors/ritonavir (n = 212), non-nucleoside reverse transcriptase inhibitors (n = 176), integrase inhibitors (dolutegravir or raltegravir, n = 46), or with elvitegravir/COBI (ELV/COBI) (n = 76). By multivariate analysis, concomitant antiretroviral therapies resulted significantly associated with tenofovir levels, with the highest drug concentrations measured in patients given ELV/COBI. By survival analysis, we found that patients given TDF with ELV/COBI had the lowest rate of drug durability. Overall, these patients had a 2.3-fold increased risk to experience TDF discontinuation. Coadministration with COBI resulted in significantly higher tenofovir concentrations and higher TDF discontinuation compared with other antiretroviral regimens. Accordingly, the possibility that the lack of proper dose adjustment for TDF when given with COBI might have biased the safety comparisons with tenofovir alafenamide during registrative trials cannot be ruled out.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2010-01-01

(-)-Epigallocatechin gallate, Abafungin, ACE-031, Adapalene/benzoyl peroxide, AE-37, Aflibercept, AGS-003, Albiglutide, Alemtuzumab, Aliskiren fumarate, ALT-801, AN-2728, Anacetrapib, API, Aprepitant, ARQ-197, Ascorbic acid, Atazanavir sulfate, ATN-224, AVI-4658, Azacitidine, Azelnidipine; Belinostat, Bevacizumab, BI-2536, Biphasic insulin aspart, Bortezomib, Bovine lactoferrin, Bryostatin 1, Budesonide/formoterol fumarate; cAC10, Canfosfamide hydrochloride, Cediranib, Clofarabine, Cocaine conjugate vaccine; Darbepoetin alfa, Dasatinib, Denosumab, Disomotide, Doripenem, Dovitinib Lactate, Dronedarone hydrochloride, Drospirenone/estradiol, Dutasteride; Ecogramostim, Entinostat, Enzastaurin hydrochloride, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Fampridine, Fenretinide LXS, FFR-factor VIIa, Fingolimod hydrochloride, Frovatriptan; Gefitinib, Gimatecan, GP-2/GM-CSF; Iloperidone, Imatinib mesylate, Indibulin, Ipilimumab, Ivabradine hydrochloride; Lactobacillus rhamnosus, Lapatinib ditosylate, LC-07, Lenalidomide, Linifanib, Liposomal doxorubicin, Liposomal vincristine, Litenimod, Lutein; M-118, MDX-1401, MEDI-528, Midostaurin, Miglustat, MK-0657; Natalizumab, Nesiritide, NGR-TNF, Niacin/simvastatin; Obatoclax mesylate, Olaparib, Omacetaxine mepesuccinate; Paclitaxel nanoparticles, Paclitaxel-eluting stent, Palonosetron hydrochloride, Pazopanib hydrochloride, Pegfilgrastim, Pemetrexed disodium, PER.C-flu, Perifosine, PF-02341066, Pimecrolimus, Pitrakinra, Plerixafor hydrochloride, Posaconazole; Rasburicase, Recombinant human relaxin H2, ReoT3D, Retaspimycin hydrochloride, Riferminogene pecaplasmid, Rindopepimut, Romiplostim, Ronacaleret hydrochloride, Rosuvastatin calcium, Rotigotine; Sagopilone, sALP-FcD10, SAR-245409, SCH-697243, Selumetinib, Sirolimus-eluting stent, SIR-Spheres, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tandutinib, Tasimelteon, Temsirolimus, Teriparatide, Tiotropium bromide, TIV, Trabectedin, Tremelimumab, TRU-016; Vadimezan, Val8-GLP-1(7-37)OH, Vandetanib, Vernakalant hydrochloride, Voreloxin, Voriconazole, Vorinostat, Yttrium 90 (90Y) ibritumomab tiuxetan; Zeaxanthin, Ziprasidone hydrochloride, Zosuquidar trihydrochloride. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

Gateways to clinical trials. July-August 2008.

PubMed

Tomillero, A; Moral, M A

2008-01-01

(-)-Epigallocatechin gallate, 501516, 89-12; Abatacept, Adalimumab, Adefovir dipivoxil, AG-701, Agatolimod sodium, Alefacept, Aliskiren fumarate, Apixaban, Atazanavir sulfate, Atrasentan, Axitinib; BI-1744-CL, BIBF-1120, BIBW-2992, Bortezomib; Carboxyamidotriazole, Caspofungin acetate, CBP-501, Cediranib, Ceftobiprole, Certolizumab pegol, Cetuximab, Cholesteryl hydrophobized polysaccharide-Her2 protein complex, CHP-NY-ESO-1, Cypher; Dalbavancin, Dalcetrapib, Daptomycin, Darapladib, Deferasirox, Deforolimus, Denosumab, DNA-HIV-C, Dovitinib, DR-5001, Dronedarone hydrochloride, DT388IL3; E75, EC-17/EC-90, Ecogramostim, Efungumab, Entecavir, EP HIV-1090, EP-2101, Everolimus, Ezetimibe, Ezetimibe/simvastatin; Faropenem daloxate, Fluticasone furoate, Fondaparinux sodium, Fospropofol disodium, Fulvestrant; Golimumab, GSK-089, GW-590735; HO/03/03, hTERT572, hTERT572Y; Iloperidone; Immunoglobulin intravenous (human), Ispinesib mesylate, Istradefylline, Ixabepilone; JR-031, JX-594; KLH; Laropiprant, Lecozotan hydrochloride, Lenalidomide, Lestaurtinib, Linezolid; MGCD-0103, MK-0646, MVA-BN Measles; NI-0401, Niacin/laropiprant, NSC-719239, NYVAC-C; Ospemifene; Paliperidone palmitate, PAN-811, PCV7, Pegfilgrastim, Peginterferon alfa-2a, PEGirinotecan, Perifosine, Pertuzumab, PF-00299804, Picoplatin, Pimavanserin tartrate, Pitavastatin calcium, Pomalidomide, Prasterone, Pratosartan, Prucalopride, PSMA27/pDOM, Pyridoxal phosphate; QS-21, Quercetin; Rebimastat, Rimonabant, Rolofylline, Romidepsin, Rosuvastatin calcium, RTS,S/SBAS2; SCH-530348, SN-29244, Soblidotin, Sodium dichloroacetate, Solifenacin succinate, Sorafenib, Spheramine, SU-6668, Succinobucol; Taranabant, Taxus, Telaprevir, Telavancin hydrochloride, Telbivudine, Tenofovir disoproxil fumarate, Tigecycline, Tiotropium bromide, Tocilizumab, Triphendiol; UC-781, Udenafil, UNIL-025; V-5 Immunitor, Valsartan/amlodipine besylate, Varenicline tartrate, Velafermin, Vernakalant hydrochloride, Vinflunine, Vitespen, Vorinostat, VX-001; Xience V, XRP-0038; Yttrium Y90 Epratuzumab; Z-360, Ziconotide, Ziprasidone hydrochloride, Zotarolimus, Zotarolimus-eluting stent. Copyright 2008 Prous Science, S.A.U. or its licensors. All rights reserved.

Anaerobic carbon metabolism by the tricarboxylic acid cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanlerberghe, G.C.; Horsey, A.K.; Weger, H.G.

Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH{sub 4}{sup +} in the dark under anaerobic conditions. Addition of NH{sub 4}{sup +} to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO{sub 2} efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenspyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H{sup 14}CO{sub 3}{sup {minus}} to anaerobic cells assimilating NH{sub 4}{sup +} results in the incorporation of radiolabel into the {alpha}-carboxyl carbon of glutamic acid. Incorporationmore » of radiolabel into glutamic acid is not simply a short-term phenomenon following NH{sub 4}{sup +} addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply {alpha}ketoglutarate for glutamate production. During dark aerobic NH{sub 4}{sup +} assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH{sub 4}{sup +} assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH{sub 4}{sup +} assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.« less

Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle : Evidence for Partial Oxidative and Reductive Pathways during Dark Ammonium Assimilation.

PubMed

Vanlerberghe, G C; Horsey, A K; Weger, H G; Turpin, D H

1989-12-01

Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH(4) (+) in the dark under anaerobic conditions. Addition of NH(4) (+) to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO(2) efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H(14)CO(3) (-) to anaerobic cells assimilating NH(4) (+) results in the incorporation of radiolabel into the alpha-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH(4) (+) addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply alpha-ketoglutarate for glutamate production. During dark aerobic NH(4) (+) assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH(4) (+) assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH(4) (+) assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.

Evaluation of the feasibility of switching from immediate release quetiapine to extended release quetiapine fumarate in stable outpatients with schizophrenia.

PubMed

Möller, Hans-Jürgen; Johnson, Sunny; Mateva, Temenuzhka; Brecher, Martin; Svensson, Ola; Miller, Frank; Meulien, Didier

2008-03-01

This double-blind, double-dummy study (D1444C00146) evaluated the efficacy and safety of switching patients with clinically stable schizophrenia from quetiapine immediate release (IR) to the same dose of once-daily extended release quetiapine fumarate (quetiapine XR). Patients received quetiapine IR 400-800 mg/day twice daily for 4 weeks, and were then randomized (2 : 1) to a once-daily equivalent dose of quetiapine XR or maintained on IR for 6 weeks. The primary variable was the proportion of patients who discontinued treatment owing to lack of efficacy or whose Positive and Negative Syndrome Scale scores increased by at least 20% from randomization to any visit. In total, 497 patients were randomized to quetiapine XR (n=331) or IR (n=166). Noninferiority (6% margin; one-sided test, 2.5% significance level) was narrowly missed for the primary efficacy variable for the modified intention-to-treat population (9.1%, quetiapine XR; 7.2%, quetiapine IR; difference 1.86%; 95% confidence interval: -3.78, 6.57; P=0.0431), but was shown for the per-protocol population (5.3%, quetiapine XR; 6.2%, quetiapine IR; difference: -0.83%; 95% confidence interval: -6.75, 3.71; P=0.0017). Serious adverse event incidence was low for quetiapine XR and IR; there were no unexpected adverse events. In conclusion, efficacy was maintained without compromising safety/tolerability when switching patients with stable schizophrenia from twice-daily quetiapine IR to once-daily quetiapine XR (400-800 mg/day).

Mitochondria are the powerhouses of immunity.

PubMed

Mills, Evanna L; Kelly, Beth; O'Neill, Luke A J

2017-04-18

Recent evidence indicates that mitochondria lie at the heart of immunity. Mitochondrial DNA acts as a danger-associated molecular pattern (DAMP), and the mitochondrial outer membrane is a platform for signaling molecules such as MAVS in RIG-I signaling, and for the NLRP3 inflammasome. Mitochondrial biogenesis, fusion and fission have roles in aspects of immune-cell activation. Most important, Krebs cycle intermediates such as succinate, fumarate and citrate engage in processes related to immunity and inflammation, in both innate and adaptive immune cells. These discoveries are revealing mitochondrial targets that could potentially be exploited for therapeutic gain in inflammation and cancer.

Dicarboxylic acids generated by thermal alteration of kerogen and humic acids

NASA Technical Reports Server (NTRS)

Kawamura, Kimitaka; Kaplan, I. R.

1987-01-01

Significant amounts (up to 2 percent of organic geopolymers) of low-molecular-weight (LMW) dicarboxylic acids (C2-C10) have been detected during thermal alteration (270 C, 2 h) of kerogens and humic acids isolated from young or ancient lithified sediments. Their distribution is characterized by the predominance of oxalic acid followed by succinic, fumaric, and methylsuccinic acids. These acids are probably released by the breakdown of macromolecular structures, which have incorporated biogenic organic compounds, including diacids, during early digenesis in sediments. Because of their reactivity, LMW diacids may play geochemically important roles under natural conditions.

Safety of Systemic Agents for the Treatment of Pediatric Psoriasis.

PubMed

Bronckers, Inge M G J; Seyger, Marieke M B; West, Dennis P; Lara-Corrales, Irene; Tollefson, Megha; Tom, Wynnis L; Hogeling, Marcia; Belazarian, Leah; Zachariae, Claus; Mahé, Emmanuel; Siegfried, Elaine; Philipp, Sandra; Szalai, Zsuzsanna; Vleugels, Ruth Ann; Holland, Kristen; Murphy, Ruth; Baselga, Eulalia; Cordoro, Kelly; Lambert, Jo; Alexopoulos, Alex; Mrowietz, Ulrich; Kievit, Wietske; Paller, Amy S

2017-11-01

Use of systemic therapies for moderate to severe psoriasis in children is increasing, but comparative data on their use and toxicities are limited. To assess patterns of use and relative risks of systemic agents for moderate to severe psoriasis in children. A retrospective review was conducted at 20 centers in North America and Europe, and included all consecutive children with moderate to severe psoriasis who used systemic medications or phototherapy for at least 3 months from December 1, 1990, to September 16, 2014. The minimal core data set included age, sex, severity of psoriasis, systemic interventions, monitoring, adverse events (AEs), and reason for discontinuation. For 390 children (203 girls and 187 boys; mean [SD] age at diagnosis, 8.4 [3.7] years) with psoriasis who used 1 or more systemic medications, the mean interval between diagnosis and starting systemic therapy was 3.0 years. Methotrexate was used by 270 patients (69.2%), biologic agents (primarily etanercept) by 106 (27.2%), acitretin by 57 (14.6%), cyclosporine by 30 (7.7%), fumaric acid esters by 19 (4.9%), and more than 1 medication was used by 73 (18.7%). Of 270 children taking methotrexate, 130 (48.1%) reported 1 or more AEs associated with methotrexate, primarily gastrointestinal (67 [24.8%]). Folic acid 6 days per week (odds ratio, 0.16; 95% CI, 0.06-0.41; P < .001) or 7 days per week (OR, 0.21; 95% CI, 0.08-0.58; P = .003) protected against gastrointestinal AEs more than once-weekly folic acid, regardless of the total weekly dosage. Methotrexate-associated hepatic transaminase elevations were associated with obesity (35 of 270 patients [13.0%]), but a folic acid regimen was not. Injection site reactions occurred in 20 of 106 patients (18.9%) treated with tumor necrosis factor inhibitors, but did not lead to discontinuation of treatment. Having 1 or more AEs related to medication, gastrointestinal AE, laboratory abnormality, or AE leading to discontinuation of the drug was more likely with methotrexate than tumor necrosis factor inhibitors, but having 1 or more infections related to medication (predominantly upper airway) was less likely. Six patients developed a serious treatment-related AE (methotrexate, 3; fumaric acid esters, 2; and adalimumab, 1), but methotrexate and biologic agents were taken for a mean duration that was 2-fold greater than the mean duration for cyclosporine or fumaric acid esters. No patient developed tuberculosis or a malignant neoplasm. Medication-related AEs occur less often with tumor necrosis factor inhibitors than with methotrexate. Folic acid administration 6 or 7 times per week protected more against methotrexate-induced gastrointestinal AEs than did weekly administration. A prospective registry is needed to track the long-term risks of systemic agents for pediatric psoriasis.

A randomized clinical trial comparing metabolic parameters after 48 weeks of standard- and low-dose stavudine therapy and tenofovir disoproxil fumarate therapy in HIV-infected South African patients.

PubMed

Menezes, C N; Crowther, N J; Duarte, R; Van Amsterdam, D; Evans, D; Dickens, C; Dix-Peek, T; Rassool, M; Prinsloo, A; Raal, F; Sanne, I

2014-01-01

Low-dose stavudine therapy may have a lower toxicity profile compared with standard dose. A randomized controlled trial comparing these two doses of stavudine with tenofovir disoproxil fumarate (tenofovir DF) was performed to assess the effects on anthropometry, markers of inflammation, and lipid and glucose metabolism in Black South African patients. Sixty patients were randomized 1:1:1 to either standard-dose (30-40 mg) or low-dose (20-30 mg) stavudine or tenofovir DF (300 mg), each combined with lamivudine and efavirenz, for 48 weeks. Anthropometry, markers of inflammation, and lipid and glucose metabolism were assessed using standard techniques. In all three treatment arms, there was a significant increase in lipid levels over the study period. At 48 weeks, fasting glucose level (P < 0.005) and homeostasis model assessment (HOMA) score (P < 0.05) increased significantly in the standard-dose stavudine arm, as did insulin and C-peptide levels in both the standard- and low-dose stavudine arms. At week 48, a significant decrease (P < 0.05) in adiponectin was noted in the standard-dose stavudine arm, but there was an increase (P < 0.005) in the tenofovir DF arm. In both the stavudine arms, significant increases in anthropometric measures occurred at 24 weeks but these decreased by week 48. Mitochondrial toxicities occurred in both the stavudine arms. Immunological and virological outcomes were similar for all three arms. This study highlights the occurrence of metabolic abnormalities with both stavudine and tenofovir DF treatment. Awareness of the potential increased cardiovascular risk should be of concern with the use of both these therapies. © 2013 British HIV Association.

Tenofovir disoproxil fumarate safety for women and their infants during pregnancy and breastfeeding.

PubMed

Mofenson, Lynne M; Baggaley, Rachel C; Mameletzis, Ioannis

2017-01-14

Pregnant/lactating women in some sub-Saharan Africa settings are at substantial risk of HIV acquisition and could benefit from preexposure prophylaxis (PrEP) with tenofovir disoproxil fumarate (TDF), but safety data in pregnancy/lactation are limited. Systematic data review through August 2016. We reviewed research reports/conference abstracts with maternal/child adverse outcome data in HIV-infected and HIV-uninfected pregnant/lactating women receiving TDF alone or in combination with other drugs compared with non-TDF regimens. In total, 26 articles in HIV-infected and seven in HIV-uninfected women were identified. No statistically significant differences were observed between TDF and comparison non-TDF regimens in pregnancy incidence, stillbirth/pregnancy loss, preterm delivery less than 37 weeks, low birth weight <2500/<1500 g, small for gestational age, birth defects, or infant (>14 days) or maternal mortality. One study reported significantly higher very preterm delivery (<34 weeks) and neonatal mortality with TDF versus non-TDF antiretroviral therapy (ART), but no significant difference between TDF ART and zidovudine/single-dose nevirapine. Most studies report normal infant linear growth; one study showed slightly lower, and one higher 1-year length-for-age z-score in TDF ART-exposed infants. No significant differences were reported in abnormal laboratory values or bone markers between TDF and non-TDF-exposed infants in four studies. Lower maternal bone mineral density was observed at 74 weeks postpartum in breastfeeding women on TDF ART compared with no ART in one study. Given available safety data, there does not appear to be a safety-related rationale for prohibiting PrEP during pregnancy/lactation or for discontinuing PrEP in HIV-uninfected women receiving PrEP who become pregnant and are at continuing risk of HIV acquisition.

A mitochondrial NADH-dependent fumarate reductase involved in the production of succinate excreted by procyclic Trypanosoma brucei.

PubMed

Coustou, Virginie; Besteiro, Sébastien; Rivière, Loïc; Biran, Marc; Biteau, Nicolas; Franconi, Jean-Michel; Boshart, Michael; Baltz, Théo; Bringaud, Frédéric

2005-04-29

Trypanosoma brucei is a parasitic protist responsible for sleeping sickness in humans. The procyclic stage of T. brucei expresses a soluble NADH-dependent fumarate reductase (FRDg) in the peroxisome-like organelles called glycosomes. This enzyme is responsible for the production of about 70% of the excreted succinate, the major end product of glucose metabolism in this form of the parasite. Here we functionally characterize a new gene encoding FRD (FRDm1) expressed in the procyclic stage. FRDm1 is a mitochondrial protein, as evidenced by immunolocalization, fractionation of digitonin-permeabilized cells, and expression of EGFP-tagged FRDm1 in the parasite. RNA interference was used to deplete FRDm1, FRDg, or both together. The analysis of the resulting mutant cell lines showed that FRDm1 is responsible for 30% of the cellular NADH-FRD activity, which solves a long standing debate regarding the existence of a mitochondrial FRD in trypanosomatids. FRDg and FRDm1 together account for the total NADH-FRD activity in procyclics, because no activity was measured in the double mutant lacking expression of both proteins. Analysis of the end products of 13C-enriched glucose excreted by these mutant cell lines showed that FRDm1 contributes to the production of between 14 and 44% of the succinate excreted by the wild type cells. In addition, depletion of one or both FRD enzymes results in up to 2-fold reduction of the rate of glucose consumption. We propose that FRDm1 is involved in the maintenance of the redox balance in the mitochondrion, as proposed for the ancestral soluble FRD presumably present in primitive anaerobic cells.

Low Risk of Proximal Tubular Dysfunction Associated With Emtricitabine-Tenofovir Disoproxil Fumarate Preexposure Prophylaxis in Men and Women.

PubMed

Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina

2016-10-01

Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52-3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10-14.0; P > .99). Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Establishment and development of ruminal hydrogenotrophs in methanogen-free lambs.

PubMed

Fonty, Gérard; Joblin, Keith; Chavarot, Michel; Roux, Remy; Naylor, Graham; Michallon, Fabien

2007-10-01

The aim of this work was to determine whether reductive acetogenesis can provide an alternative to methanogenesis in the rumen. Gnotobiotic lambs were inoculated with a functional rumen microbiota lacking methanogens and reared to maturity on a fibrous diet. Lambs with a methanogen-free rumen grew well, and the feed intake and ruminal volatile fatty acid concentrations for lambs lacking ruminal methanogens were lower but not markedly dissimilar from those for conventional lambs reared on the same diet. A high population density (10(7) to 10(8) cells g(-1)) of ruminal acetogens slowly developed in methanogen-free lambs. Sulfate- and fumarate-reducing bacteria were present, but their population densities were highly variable. In methanogen-free lambs, the hydrogen capture from fermentation was low (28 to 46%) in comparison with that in lambs containing ruminal methanogens (>90%). Reductive acetogenesis was not a significant part of ruminal fermentation in conventional lambs but contributed 21 to 25% to the fermentation in methanogen-free meroxenic animals. Ruminal H(2) utilization was lower in lambs lacking ruminal methanogens, but when a methanogen-free lamb was inoculated with a methanogen, the ruminal H(2) utilization was similar to that in conventional lambs. H(2) utilization in lambs containing a normal ruminal microflora was age dependent and increased with the animal age. The animal age effect was less marked in lambs lacking ruminal methanogens. Addition of fumarate to rumen contents from methanogen-free lambs increased H(2) utilization. These findings provide the first evidence from animal studies that reductive acetogens can sustain a functional rumen and replace methanogens as a sink for H(2) in the rumen.

The effect of pH, buffer capacity and ionic strength on quetiapine fumarate release from matrix tablets prepared using two different polymeric blends.

PubMed

Hamed, Rania; AlJanabi, Reem; Sunoqrot, Suhair; Abbas, Aiman

2017-08-01

The objective of this study was to investigate the effect of the different physiological parameters of the gastrointestinal (GI) fluid (pH, buffer capacity, and ionic strength) on the in vitro release of the weakly basic BCS class II drug quetiapine fumarate (QF) from two once-a-day matrix tablet formulations (F1 and F2) developed as potential generic equivalents to Seroquel ® XR. F1 tablets were prepared using blends of high and low viscosity grades of hydroxypropyl methylcellulose (HPMC K4M and K100LV, respectively), while F2 tablets were prepared from HPMC K4M and PEGylated glyceryl behenate (Compritol ® HD5 ATO). The two formulations attained release profiles of QF over 24 h similar to that of Seroquel ® XR using the dissolution medium published by the Food and Drug Administration (FDA). A series of solubility and in vitro dissolution studies was then carried out using media that simulate the gastric and intestinal fluids and cover the physiological pH, buffer capacity and ionic strength range of the GIT. Solubility studies revealed that QF exhibits a typical weak base pH-dependent solubility profile and that the solubility of QF increases with increasing the buffer capacity and ionic strength of the media. The release profiles of QF from F1, F2 and Seroquel ® XR tablets were found to be influenced by the pH, buffer capacity and ionic strength of the dissolution media to varying degrees. Results highlight the importance of studying the physiological variables along the GIT in designing controlled release formulations for more predictive in vitro-in vivo correlations.

Dimethyl fumarate attenuates intracerebroventricular streptozotocin-induced spatial memory impairment and hippocampal neurodegeneration in rats.

PubMed

Majkutewicz, Irena; Kurowska, Ewelina; Podlacha, Magdalena; Myślińska, Dorota; Grembecka, Beata; Ruciński, Jan; Plucińska, Karolina; Jerzemowska, Grażyna; Wrona, Danuta

2016-07-15

Intracerebroventricular (ICV) injection of streptozotocin (STZ) is a widely-accepted animal model of sporadic Alzheimer's disease (sAD). The present study evaluated the ability of dimethyl fumarate (DMF), an agent with antioxidant and anti-inflammatory properties, to prevent spatial memory impairments and hippocampal neurodegeneration mediated by ICV injection of STZ in 4-month-old rats. Rodent chow containing DMF (0.4%) or standard rodent chow was made available on day 0. Rat body weight and food intake were measured daily for whole the experiment (21days). STZ or vehicle (SHAM) ICV injections were performed on days 2 and 4. Spatial reference and working memory were evaluated using the Morris water maze on days 14-21. Cells containing Fluoro-Jade B (neurodegeneration marker), IL-6, IL-10 were quantified in the hippocampus and choline acetyltransferase (ChAT) in the basal forebrain. The disruption of spatial memory and a high density of hippocampal CA1-3 cells labeled with Fluoro-Jade B or containing IL-6 or IL-10 were observed in the STZ group but not in the STZ+DMF group, as compared to the SHAM or SHAM+DMF groups. STZ vs. STZ+DMF differences were found: worse reference memory acquisition, fewer ChAT-positive neurons in the medial septum (Ch1), more Fluoro-Jade-positive CA1 hippocampal cells in STZ rats. DMF therapy in a rodent model of sAD prevented the disruption of spatial reference and working memory, loss of Ch1 cholinergic cells and hippocampal neurodegeneration as well as the induction of IL-6 and IL-10 in CA1. These beneficial cognitive and molecular effects validate the anti-inflammatory and neuroprotective properties of DMF in the hippocampus. Copyright © 2016 Elsevier B.V. All rights reserved.

Tenofovir disoproxil fumarate-associated hypophosphatemia as determined by fractional excretion of filtered phosphate in HIV-infected patients.

PubMed

Cheng, Chien-Yu; Chang, Shu-Yin; Lin, Mei-Hui; Ku, Shin-Yen; Sun, Na-Lee; Cheng, Shu-Hsing

2016-11-01

Tenofovir disoproxil fumarate (TDF) -containing regimens have been associated with nephrotoxicity and hypophosphatemia in HIV-infected patients. The objective of this study was to assess the possible risk factors for hypophosphatemia and evaluate the relationship between fractional excretion of filtered phosphate (FePi) and hypophosphatemia in TDF users. Patients were enrolled in a prospective cohort study between January 2011 and December 2014. We classified experienced HIV-infected patients (individuals maintained on antiretroviral therapy (ART) for 6 months or more) and naïve patients into 3 treatment groups: TDF-containing ART (group 1), non-TDF-containing ART (never received TDF or had not received TDF in the past 6 months; group 2) and naive to antiretroviral therapy (group 3). Specimens from each individual were assessed for serum phosphate, serum creatinine, urine phosphate, and urine creatinine. Multivariable logistic regression was performed to control for the following variables measured at baseline: eGFR, age, sex, sexual orientation, injection drug use (IDUs), HIV-RNA viral load, and CD4 cell count. The frequency of hypophosphatemia in groups 1, 2, and 3 was 20.2%, 7.2%, and 14.6%, respectively (P = 0.002). FePi above 10% also was significantly associated with hypophosphatemia (P = 0.003; adjusted odds ratio = 2.54). Patients with elevated CD4 cell counts (>500 cells/μL) exhibited a lower risk of hypophosphatemia (P = 0.002; adjusted odds ratio = 0.35). Hypophosphatemia is a multifactorial etiology; FePi was confirmed as a suggested method to predict the risk of hypophosphatemia in TDF users. Clinical Trial Number: TYGH103011. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Quantifying the Benefits of Dimethyl Fumarate Over β Interferon and Glatiramer Acetate Therapies on Work Productivity Outcomes in MS Patients.

PubMed

Lee, Andrew; Pike, James; Edwards, Michael R; Petrillo, Jennifer; Waller, John; Jones, Eddie

2017-06-01

Dimethyl fumarate (DMF) is a novel oral therapy used for the treatment of relapse-remitting multiple sclerosis (RRMS). In two 2-year pivotal Phase 3 trials in patients with RRMS, DMF significantly reduced disease activity based on both clinical and magnetic resonance imaging (MRI) findings and demonstrated an acceptable safety profile. However, there is currently a lack of comparative data which explore the relationship between work productivity and health-related quality of life (HRQoL) outcomes in RRMS and how these differ among RRMS therapies, including DMF. We explored this relationship through patient-reported data from the EuroQol Five-Dimensions (EQ-5D) tool, Work Productivity and Activity Impairment Questionnaire (WPAI), and the Hamburg Quality of Life Questionnaire in Multiple Sclerosis (HAQUAMS) using the Adelphi MS DSP® dataset. Our data demonstrated that patients receiving DMF experienced better outcomes, relative to patients receiving beta (β)interferons or glatiramer acetate, in all WPAI subscales [overall; average treatment effect (ATE) -13.92, 95% confidence interval (CI) -18.87 to -7.08; p < 0.001], EQ-5D (ATE +0.075, 95% Cl 0.014-0.136; p = 0.016) and HAQUAMS [ATE -0.45, 95% Cl -0.61 to -0.29; p < 0.001]. The EQ-5D and HAQUAMS were used with WPAI to determine the relationship between HRQoL outcomes and work productivity. Multiple linear regression analyses were performed, adjusting for age, sex, body mass index, ethnicity and number of comorbid conditions. These data demonstrate that therapy with DMF was associated with increased work productivity and HRQoL for patients with RRMS and that these outcomes were consistently improved compared to outcomes with interferon and glatiramer acetate therapies.

Fabrication and characterization of poly(propylene fumarate) scaffolds with controlled pore structures using 3-dimensional printing and injection molding.

PubMed

Lee, Kee-Won; Wang, Shanfeng; Lu, Lichun; Jabbari, Esmaiel; Currier, Bradford L; Yaszemski, Michael J

2006-10-01

Poly(propylene fumarate) (PPF) is an injectable, biodegradable polymer that has been used for fabricating preformed scaffolds in tissue engineering applications because of in situ crosslinking characteristics. Aiming for understanding the effects of pore structure parameters on bone tissue ingrowth, 3-dimensional (3D) PPF scaffolds with controlled pore architecture have been produced in this study from computer-aided design (CAD) models. We have created original scaffold models with 3 pore sizes (300, 600, and 900 microm) and randomly closed 0%, 10%, 20%, or 30% of total pores from the original models in 3 planes. PPF scaffolds were fabricated by a series steps involving 3D printing of support/build constructs, dissolving build materials, injecting PPF, and dissolving support materials. To investigate the effects of controlled pore size and interconnectivity on scaffolds, we compared the porosities between the models and PPF scaffolds fabricated thereby, examined pore morphologies in surface and cross-section using scanning electron microscopy, and measured permeability using the falling head conductivity test. The thermal properties of the resulting scaffolds as well as uncrosslinked PPF were determined by differential scanning calorimetry and thermogravimetric analysis. Average pore sizes and pore shapes of PPF scaffolds with 600- and 900-microm pores were similar to those of CAD models, but they depended on directions in those with 300-microm pores. Porosity and permeability of PPF scaffolds decreased as the number of closed pores in original models increased, particularly when the pore size was 300 microm as the result of low porosity and pore occlusion. These results show that 3D printing and injection molding technique can be applied to crosslinkable polymers to fabricate 3D porous scaffolds with controlled pore structures, porosity, and permeability using their CAD models.

Aniline Is an Inducer, and Not a Precursor, for Indole Derivatives in Rubrivivax benzoatilyticus JA2

PubMed Central

Mohammed, Mujahid; Ch, Sasikala; Ch, Ramana V.

2014-01-01

Rubrivivax benzoatilyticus JA2 and other anoxygenic photosynthetic bacteria produce indole derivatives when exposed to aniline, a xenobiotic compound. Though this phenomenon has been reported previously, the role of aniline in the production of indoles is still a biochemical riddle. The present study aims at understanding the specific role of aniline (as precursor or stimulator) in the production of indoles and elucidating the biochemical pathway of indoles in aniline-exposed cells by using stable isotope approaches. Metabolic profiling revealed tryptophan accumulation only in aniline exposed cells along with indole 3-acetic acid (IAA) and indole 3-aldehyde (IAld), the two major catabolites of tryptophan. Deuterium labelled aniline feeding studies revealed that aniline is not a precursor of indoles in strain JA2. Further, production of indoles only in aniline-exposed cells suggests that aniline is an indoles stimulator. In addition, production of indoles depended on the presence of a carbon source, and production enhanced when carbon sources were added to the culture. Isotope labelled fumarate feeding identified, fumarate as the precursor of indole, indicating de novo synthesis of indoles. Glyphosate (shikimate pathway inhibitor) inhibited the indoles production, accumulation of tryptophan, IAA and IAld indicating that indoles synthesis in strain JA2 occurs via the de novo shikimate pathway. The up-regulation of anthranilate synthase gene and induction of anthranilate synthase activity correlated well with tryptophan production in strain JA2. Induction of tryptophan aminotransferase and tryptophan 2-monooxygenase activities corroborated well with IAA levels, suggesting that tryptophan catabolism occurs simultaneously in aniline exposed cells. Our study demonstrates that aniline (stress) stimulates tryptophan/indoles synthesis via the shikimate pathway by possibly modulating the metabolic pathway. PMID:24533057

Aniline is an inducer, and not a precursor, for indole derivatives in Rubrivivax benzoatilyticus JA2.

PubMed

Mujahid, Mohammed; Sasikala, Ch; Ramana, Ch V

2014-01-01

Rubrivivax benzoatilyticus JA2 and other anoxygenic photosynthetic bacteria produce indole derivatives when exposed to aniline, a xenobiotic compound. Though this phenomenon has been reported previously, the role of aniline in the production of indoles is still a biochemical riddle. The present study aims at understanding the specific role of aniline (as precursor or stimulator) in the production of indoles and elucidating the biochemical pathway of indoles in aniline-exposed cells by using stable isotope approaches. Metabolic profiling revealed tryptophan accumulation only in aniline exposed cells along with indole 3-acetic acid (IAA) and indole 3-aldehyde (IAld), the two major catabolites of tryptophan. Deuterium labelled aniline feeding studies revealed that aniline is not a precursor of indoles in strain JA2. Further, production of indoles only in aniline-exposed cells suggests that aniline is an indoles stimulator. In addition, production of indoles depended on the presence of a carbon source, and production enhanced when carbon sources were added to the culture. Isotope labelled fumarate feeding identified, fumarate as the precursor of indole, indicating de novo synthesis of indoles. Glyphosate (shikimate pathway inhibitor) inhibited the indoles production, accumulation of tryptophan, IAA and IAld indicating that indoles synthesis in strain JA2 occurs via the de novo shikimate pathway. The up-regulation of anthranilate synthase gene and induction of anthranilate synthase activity correlated well with tryptophan production in strain JA2. Induction of tryptophan aminotransferase and tryptophan 2-monooxygenase activities corroborated well with IAA levels, suggesting that tryptophan catabolism occurs simultaneously in aniline exposed cells. Our study demonstrates that aniline (stress) stimulates tryptophan/indoles synthesis via the shikimate pathway by possibly modulating the metabolic pathway.

Characterization of lymphopenia in patients with MS treated with dimethyl fumarate and fingolimod.

PubMed

Nakhaei-Nejad, Maryam; Barilla, David; Lee, Chieh-Hsin; Blevins, Gregg; Giuliani, Fabrizio

2018-03-01

Lymphopenia is a common occurrence of disease-modifying therapies (DMTs) for relapsing-remitting MS (RRMS). The aim of this study was to dissect the prevalence of various lymphocyte subsets in patients with RRMS treated with 2 DMTs commonly associated with lymphopenia, dimethyl fumarate (DMF), and fingolimod (FTY). Multicolor flow cytometry and multiplex assays were used to identify up to 50 lymphocyte subpopulations and to examine the expression of multiple cytokines in selected patients. We compared patients untreated (NT) or treated with FTY or DMF who did (DMF-L) or did not (DMF-N) develop lymphopenia. All FTY patients developed lymphopenia in both T-cell and B-cell compartments. CD41 T cells were more affected by this treatment than CD81 cells. In the B-cell compartment, the CD271IgD2 subpopulation was reduced. T cells but not B cells were significantly reduced in DMF-L. However, within the B cells, CD271 cells were significantly lower. Both CD41 and CD81 subpopulations were reduced in DMF-L. Within the remaining CD41 and CD81 compartments, there was an expansion of the naive subpopulation and a reduction of the effector memory subpopulation. Unactivated lymphocyte from DMF-L patients had significantly higher levels of interferon-γ, interleukin (IL)-12, IL-2, IL-4, IL-6, and IL-1β compared with DMF-N. In plasma, TNFβ was significantly higher in DMF-N and DMF-L compared with NT, whereas CCL17 was significantly higher in DMF-L compared with NT and DMF-N. This study shows that different treatments can target different lymphocyte compartments and suggests that lymphopenia can induce compensatory mechanisms to maintain immune homeostasis.

Characterization of lymphopenia in patients with MS treated with dimethyl fumarate and fingolimod

PubMed Central

Nakhaei-Nejad, Maryam; Barilla, David; Lee, Chieh-Hsin; Blevins, Gregg

2017-01-01

Objective: Lymphopenia is a common occurrence of disease-modifying therapies (DMTs) for relapsing-remitting MS (RRMS). The aim of this study was to dissect the prevalence of various lymphocyte subsets in patients with RRMS treated with 2 DMTs commonly associated with lymphopenia, dimethyl fumarate (DMF), and fingolimod (FTY). Methods: Multicolor flow cytometry and multiplex assays were used to identify up to 50 lymphocyte subpopulations and to examine the expression of multiple cytokines in selected patients. We compared patients untreated (NT) or treated with FTY or DMF who did (DMF-L) or did not (DMF-N) develop lymphopenia. Results: All FTY patients developed lymphopenia in both T-cell and B-cell compartments. CD41 T cells were more affected by this treatment than CD81 cells. In the B-cell compartment, the CD271IgD2 subpopulation was reduced. T cells but not B cells were significantly reduced in DMF-L. However, within the B cells, CD271 cells were significantly lower. Both CD41 and CD81 subpopulations were reduced in DMF-L. Within the remaining CD41 and CD81 compartments, there was an expansion of the naive subpopulation and a reduction of the effector memory subpopulation. Unactivated lymphocyte from DMF-L patients had significantly higher levels of interferon-γ, interleukin (IL)-12, IL-2, IL-4, IL-6, and IL-1β compared with DMF-N. In plasma, TNFβ was significantly higher in DMF-N and DMF-L compared with NT, whereas CCL17 was significantly higher in DMF-L compared with NT and DMF-N. Conclusions: This study shows that different treatments can target different lymphocyte compartments and suggests that lymphopenia can induce compensatory mechanisms to maintain immune homeostasis. PMID:29296636

Liarozole fumarate (R85246): a novel imidazole in the treatment of receptor positive postmenopausal metastatic breast cancer.

PubMed

Goss, P E; Oza, A; Goel, R; Nabholtz, J M; De Coster, R; Bruynseels, J; Reid, C; Wadden, N; Crump, M; Tye, L M

2000-01-01

This phase II study of liarozole fumarate (R85246, liarozole), a novel imidazole with retinomimetic and aromatase inhibitory effects, was designed to determine the efficacy and tolerability in postmenopausal women with advanced breast cancer in progression, to correlate these effects with hormonal levels, and to evaluate quality of life. Twenty-nine women with ER-positive or unknown metastatic disease who received > or = 2 prior hormonal therapies were treated with 150-300 mg liarozole twice daily until disease progression. All patients were evaluable for toxicity and 25 for response. Four patients (16.0%, 95% CI 5.3-37.4%) had partial remission (PR) of their disease for a median of 7.4 months (range 1.2-12.9) and 7 (28%) had disease stabilization for a median of 4.8 months (1.6-16.0). Estradiol decreased from pre-treatment levels of 9.2-52 pM (mean 17.1) to below detection (9.2 pM, p = 0.0005) after 1 month. Similarly estrone levels fell from 14-307 pM (mean 92.7) to below detection (9.2 pM, p = 0.0001). The most common toxicity was dermatological (96.6%) with features compatible with hypervitaminosis A syndrome such as rash, pruritus, dry skin, and brittle nails. The majority of these were mild to moderate in severity. No significant improvement in quality of life scores (FLI-C) were noted. Liarozole is an active new treatment for breast cancer in patients heavily pre-treated with hormone therapies. Further studies are needed to confirm its relative efficacy in both receptor positive and negative postmenopausal breast cancer.

Safety and efficacy of fesoterodine fumarate in patients with overactive bladder: results of a post-marketing surveillance study in Korea.

PubMed

Kim, Tae Heon; Lee, Sang Eun; Lee, Hahn-Ey; Lee, Kyu-Sung

2016-08-01

The aim of this study was to evaluate the safety and efficacy of fesoterodine fumarate (fesoterodine; Toviaz ) in Korean patients with overactive bladder (OAB) in routine clinical practice. This was an open-label, non-interventional, prospective, post-marketing surveillance study submitted to the Korean Ministry of Food and Drug Safety. A total of 3109 patients aged ≥18 years with OAB symptoms were prescribed flexible doses of fesoterodine at the investigator's discretion. Safety was assessed based upon the reporting of adverse events (AEs). Efficacy was evaluated on the basis of patient self-assessment using a bladder diary as well as on the basis of investigator assessment in terms of overall clinical efficacy. A final analysis was performed on 3107 (99.9%) and 2978 (95.8%) patients for safety and efficacy analysis, respectively. The mean treatment duration of fesoterodine was 83.2 days. The incidence of AEs was 8.5% (265/3107). Common AEs that accounted for more than 1.0% of the total AE incidence included dry mouth (5.4%, 168/3107), constipation (1.5%, 48/3107) and micturition disorder (1.1%, 35/3107). Mean episodes of urinary frequency, urgency, and urgency urinary incontinence (UUI) per 24 hours decreased by 4.0, 2.4, and 0.8, respectively (all p < 0.001). At the final follow-up visit, the investigators found improvement in clinical efficacy for the majority of patients (90.1%, 2684/2978). Limitations of this study include the observational study design and the relatively short treatment duration. These results suggest that fesoterodine is a well tolerated and effective treatment for Korean patients with OAB in routine clinical practice.

Desulfomicrobium thermophilum sp. nov., a novel thermophilic sulphate-reducing bacterium isolated from a terrestrial hot spring in Colombia.

PubMed

Thevenieau, France; Fardeau, Marie-Laure; Ollivier, Bernard; Joulian, Catherine; Baena, Sandra

2007-03-01

A moderately thermophilic, sulphate-reducing bacterium, designated strain P6-2(T), was isolated from a terrestrial hot spring located at a height of 2,500 m in the Andean region, Colombia (5 degrees 43'69''N, 73 degrees 6'10''W). Cells of strain P6-2(T) were rod-shaped, stained Gram-negative and were motile by means of a single polar flagellum. The strain grew lithotrophically with H(2) as the electron donor and organotrophically on lactate, pyruvate, ethanol, malate, fumarate, n-propanol and succinate in the presence of sulphate as the terminal electron acceptor. Fumarate and pyruvate was fermented. Strain P6-2(T) grew optimally at 55 degrees C (range 37-60 degrees C), pH 6.6 (range 5.8-8.8) in the presence of 0.5% NaCl (range 0-4.5%) with lactate and sulphate and produced acetate, CO(2) and H(2)S as the major end-products. Sulphate, sulphite and thiosulphate could be used as electron acceptors but not elemental sulphur or nitrate. The G + C content of the genomic DNA was 58.7 mol%. The 16S rRNA sequence analysis indicated that strain P6-2(T) was a member of the class Deltaproteobacteria, domain Bacteria with Desulfomicrobium baculatum being the closest relative (similarity value of 94%). Phylogeny of genes encoding alpha- and beta-subunits of the dissimilatory sulphite reductase (dsrAB genes) supported its affiliation to members of the genus Desulfomicrobium. On the basis of this evidence, we propose to assign strain P6-2(T) as new species of the genus Desulfomicrobium, D. thermophilum sp. nov., with strain P6-2(T) as the type strain (= DSM 16697(T) = CCUG 49732(T)).

Non-invasive intranasal delivery of quetiapine fumarate loaded microemulsion for brain targeting: Formulation, physicochemical and pharmacokinetic consideration.

PubMed

Shah, Brijesh; Khunt, Dignesh; Misra, Manju; Padh, Harish

2016-08-25

Systemic drug delivery in schizophrenia is a major challenge due to presence of obstacles like, blood-brain barrier and P-glycoprotein, which prohibit entry of drugs into the brain. Quetiapine fumarate (QF), a substrate to P-glycoprotein under goes extensive first pass metabolism leading to limited absorption thus necessitating frequent oral administration. The aim of this study was to develop QF based microemulsion (ME) with and without chitosan (CH) to investigate its potential use in improving the bioavailability and brain targeting efficiency following non-invasive intranasal administration. QF loaded ME and mucoadhesive ME (MME) showed globule size, pH and viscosity in the range of 29-47nm, 5.5-6.5 and 17-40cP respectively. CH-ME with spherical globules having mean size of 35.31±1.71nm, pH value of 5.61±0.16 showed highest ex-vivo nasal diffusion (78.26±3.29%) in 8h with no sign of structural damage upon histopathological examination. Circular plume with an ovality ratio closer to 1.3 for CH-ME depicted ideal spray pattern. Significantly higher brain/blood ratio of CH-ME in comparison to QF-ME and drug solution following intranasal administration revealed prolonged retention of QF at site of action suggesting superiority of CH as permeability enhancer. Following intranasal administration, 2.7 and 3.8 folds higher nasal bioavailability in brain with CH-ME compared to QF-ME and drug solution respectively is indicative of preferential nose to brain transport (80.51±6.46%) bypassing blood-brain barrier. Overall, the above finding shows promising results in the area of developing non-invasive intranasal route as an alternative to oral route for brain delivery. Copyright © 2016 Elsevier B.V. All rights reserved.

Copper Efflux Is Induced during Anaerobic Amino Acid Limitation in Escherichia coli To Protect Iron-Sulfur Cluster Enzymes and Biogenesis

PubMed Central

Fung, Danny Ka Chun; Lau, Wai Yin; Chan, Wing Tat

2013-01-01

Adaptation to changing environments is essential to bacterial physiology. Here we report a unique role of the copper homeostasis system in adapting Escherichia coli to its host-relevant environment of anaerobiosis coupled with amino acid limitation. We found that expression of the copper/silver efflux pump CusCFBA was significantly upregulated during anaerobic amino acid limitation in E. coli without the supplement of exogenous copper. Inductively coupled plasma mass spectrometry analysis of the total intracellular copper content combined with transcriptional assay of the PcusC-lacZ reporter in the presence of specific Cu(I) chelators indicated that anaerobic amino acid limitation led to the accumulation of free Cu(I) in the periplasmic space of E. coli, resulting in Cu(I) toxicity. Cells lacking cusCFBA and another copper transporter, copA, under this condition displayed growth defects and reduced ATP production during fumarate respiration. Ectopic expression of the Fe-S cluster enzyme fumarate reductase (Frd), or supplementation with amino acids whose biosynthesis involves Fe-S cluster enzymes, rescued the poor growth of ΔcusC cells. Yet, Cu(I) treatment did not impair the Frd activity in vitro. Further studies revealed that the alternative Fe-S cluster biogenesis system Suf was induced during the anaerobic amino acid limitation, and ΔcusC enhanced this upregulation, indicating the impairment of the Fe-S cluster assembly machinery and the increased Fe-S cluster demands under this condition. Taken together, we conclude that the copper efflux system CusCFBA is induced during anaerobic amino acid limitation to protect Fe-S cluster enzymes and biogenesis from the endogenously originated Cu(I) toxicity, thus facilitating the physiological adaptation of E. coli. PMID:23893112

Dimethyl fumarate is highly cytotoxic in KRAS mutated cancer cells but spares non-tumorigenic cells.

PubMed

Bennett Saidu, Nathaniel Edward; Bretagne, Marie; Mansuet, Audrey Lupo; Just, Pierre-Alexandre; Leroy, Karen; Cerles, Olivier; Chouzenoux, Sandrine; Nicco, Carole; Damotte, Diane; Alifano, Marco; Borghese, Bruno; Goldwasser, François; Batteux, Frédéric; Alexandre, Jérôme

2018-02-06

KRAS mutation, one of the most common molecular alterations observed in adult carcinomas, was reported to activate the anti-oxidant program driven by the transcription factor NRF2 (Nuclear factor-erythroid 2-related factor 2). We previously observed that the antitumoral effect of Dimethyl fumarate (DMF) is dependent of NRF2 pathway inhibition. We used in vitro methods to examine the effect of DMF on cell death and the activation of the NRF2/DJ-1 antioxidant pathway. We report here that DMF is preferentially cytotoxic against KRAS mutated cancer cells. This effect was observed in patient-derived cancer cell lines harbouring a G12V KRAS mutation, compared with cell lines without such a mutation. In addition, KRAS*G12V over-expression in the human Caco-2 colon cancer cell line significantly promoted DMF-induced cell death, as well as DMF-induced- reactive oxygen species (ROS) formation and -glutathione (GSH) depletion. Moreover, in contrast to malignant cells, our data confirms that the same concentration of DMF has no significant cytotoxic effects on non-tumorigenic human ARPE-19 retinal epithelial, murine 3T3 fibroblasts and primary mice bone marrow cells; but is rather associated with NRF2 activation, decreased ROS and increased GSH levels. Furthermore, DJ-1 down-regulation experiments showed that this protein does not play a protective role against NRF2 in non-tumorigenic cells, as it does in malignant ones. This, interestingly, could be at the root of the differential effect of DMF observed between malignant and non-tumorigenic cells. Our results suggest for the first time that the dependence on NRF2 observed in mutated KRAS malignant cells makes them more sensitive to the cytotoxic effect of DMF, which thus opens up new prospects for the therapeutic applications of DMF.

Isolation and characterization of the stage-specific cytochrome b small subunit (CybS) of Ascaris suum complex II from the aerobic respiratory chain of larval mitochondria.

PubMed

Amino, Hisako; Osanai, Arihiro; Miyadera, Hiroko; Shinjyo, Noriko; Tomitsuka, Eriko; Taka, Hikari; Mineki, Reiko; Murayama, Kimie; Takamiya, Shinzaburo; Aoki, Takashi; Miyoshi, Hideto; Sakamoto, Kimitoshi; Kojima, Somei; Kita, Kiyoshi

2003-05-01

We recently reported that Ascaris suum mitochondria express stage-specific isoforms of complex II: the flavoprotein subunit and the small subunit of cytochrome b (CybS) of the larval complex II differ from those of adult enzyme, while two complex IIs share a common iron-sulfur cluster subunit (Ip). In the present study, A. suum larval complex II was highly purified to characterize the larval cytochrome b subunits in more detail. Peptide mass fingerprinting and N-terminal amino acid sequencing showed that the larval and adult cytochrome b (CybL) proteins are identical. In contrast, cDNA sequences revealed that the small subunit of larval cytochrome b (CybS(L)) is distinct from the adult CybS (CybS(A)). Furthermore, Northern analysis and immunoblotting showed stage-specific expression of CybS(L) and CybS(A) in larval and adult mitochondria, respectively. Enzymatic assays revealed that the ratio of rhodoquinol-fumarate reductase (RQFR) to succinate-ubiquinone reductase (SQR) activities and the K(m) values for quinones are almost identical for the adult and larval complex IIs, but that the fumarate reductase (FRD) activity is higher for the adult form than for the larval form. These results indicate that the adult and larval A. suum complex IIs have different properties than the complex II of the mammalian host and that the larval complex II is able to function as a RQFR. Such RQFR activity of the larval complex II would be essential for rapid adaptation to the dramatic change of oxygen availability during infection of the host.

Foamed oligo(poly(ethylene glycol)fumarate) hydrogels as versatile prefabricated scaffolds for tissue engineering.

PubMed

Henke, Matthias; Baumer, Julia; Blunk, Torsten; Tessmar, Joerg

2014-03-01

Radically cross-linked hydrogels are frequently used as cell carriers due to their excellent biocompatibility and their tissue-like mechanical properties. Through frequent investigation, PEG-based polymers such as oligo(poly(ethylene glycol)fumarate [OPF] have proven to be especially suitable as cell carriers by encapsulating cells during hydrogel formation. In some cases, NaCl or biodegradable gelatin microparticles were added prior to cross-linking in order to provide space for the proliferating cells, which would otherwise stay embedded in the hydrogel matrix. However, all of these immediate cross-linking procedures involve time consuming sample preparation and sterilization directly before cell culture and often show notable swelling after their preparation. In this study, ready to use OPF-hydrogel scaffolds were prepared by gas foaming, freeze drying, individual packing into bags and subsequent γ-sterilization. The scaffolds could be stored and used "off-the-shelf" without any need for further processing prior to cell culture. Thus the handling was simplified and the sterility of the cell carrier was assured. Further improvement of the gel system was achieved using a two component injectable system, which may be used for homogenous injection molding in order to create individually shaped three dimensional scaffolds. In order to evaluate the suitability of the scaffolds for tissue engineering, constructs were seeded with juvenile bovine chondrocytes and cultured for 28 days. Cross-sections of the respective constructs showed an intense and homogenous red staining of GAG with safranin O, indicating a homogenous cell distribution within the scaffolds and the production of substantial amounts of GAG-rich matrix. Copyright © 2012 John Wiley & Sons, Ltd.

Desulfosporosinus acididurans sp. nov.: an acidophilic sulfate-reducing bacterium isolated from acidic sediments.

PubMed

Sánchez-Andrea, Irene; Stams, Alfons J M; Hedrich, Sabrina; Ňancucheo, Ivan; Johnson, D Barrie

2015-01-01

Three strains of sulfate-reducing bacteria (M1(T), D, and E) were isolated from acidic sediments (White river and Tinto river) and characterized phylogenetically and physiologically. All three strains were obligately anaerobic, mesophilic, spore-forming straight rods, stained Gram-negative and displayed variable motility during active growth. The pH range for growth was 3.8-7.0, with an optimum at pH 5.5. The temperature range for growth was 15-40 °C, with an optimum at 30 °C. Strains M1(T), D, and E used a wide range of electron donors and acceptors, with certain variability within the different strains. The nominated type strain (M1(T)) used ferric iron, nitrate, sulfate, elemental sulfur, and thiosulfate (but not arsenate, sulfite, or fumarate) as electron acceptors, and organic acids (formate, lactate, butyrate, fumarate, malate, and pyruvate), alcohols (glycerol, methanol, and ethanol), yeast extract, and sugars (xylose, glucose, and fructose) as electron donors. It also fermented some substrates such as pyruvate and formate. Strain M1(T) tolerated up to 50 mM ferrous iron and 10 mM aluminum, but was inhibited by 1 mM copper. On the basis of phenotypic, phylogenetic, and genetic characteristics, strains M1(T), D, and E represent a novel species within the genus Desulfosporosinus, for which the name Desulfosporosinus acididurans sp. nov. is proposed. The type strain is M1(T) (=DSM 27692(T) = JCM 19471(T)). Strain M1(T) was the first acidophilic SRB isolated, and it is the third described species of acidophilic SRB besides Desulfosporosinus acidiphilus and Thermodesulfobium narugense.

Digital micromirror device (DMD)-based 3D printing of poly(propylene fumarate) scaffolds.

PubMed

Mott, Eric J; Busso, Mallory; Luo, Xinyi; Dolder, Courtney; Wang, Martha O; Fisher, John P; Dean, David

2016-04-01

Our recent investigations into the 3D printing of poly(propylene fumarate) (PPF), a linear polyester, using a DMD-based system brought us to a resin that used titanium dioxide (TiO2) as an ultraviolet (UV) filter for controlling cure depth. However, this material hindered the 3D printing process due to undesirable lateral or "dark" curing (i.e., in areas not exposed to light from the DMD chip). Well known from its use in sunscreen, another UV filter, oxybenzone, has previously been used in conjunction with TiO2. In this study we hypothesize that combining these two UV filters will result in a synergistic effect that controls cure depth and avoids dark cure. A resin mixture (i.e., polymer, initiator, UV filters) was identified that worked well. The resin was then further characterized through mechanical testing, cure testing, and cytotoxicity testing to investigate its use as a material for bone tissue engineering scaffolds. Results show that the final resin eliminated dark cure as shown through image analysis. Mechanically the new scaffolds proved to be far weaker than those printed from previous resins, with compressive strengths of 7.8 ± 0.5 MPa vs. 36.5 ± 1.6 MPa, respectively. The new scaffolds showed a 90% reduction in elastic modulus and a 74% increase in max strain. These properties may be useful in tissue engineering applications where resorption is required. Initial cytotoxicity evaluation was negative. As hypothesized, the use of TiO2 and oxybenzone showed synergistic effects in the 3D printing of PPF tissue engineering scaffolds. Copyright © 2015 Elsevier B.V. All rights reserved.

Sulfurospirillum arcachonense sp. nov., a new microaerophilic sulfur-reducing bacterium.

PubMed

Finster, K; Liesack, W; Tindall, B J

1997-10-01

The isolation of a new motile, gram-negative, heterotrophic, sulfur-reducing, microaerophilic, vibrioid bacterium, strain F1F6, from oxidized marine surface sediment (Arcachon Bay, French Atlantic coast) is described. Hydrogen (with acetate as the carbon source), formate (with acetate as the carbon source), pyruvate, lactate, alpha-ketoglutarate, glutarate, glutamate, and yeast extract supported growth with elemental sulfur under anaerobic conditions. Apart from H2 and formate, the oxidation of the substrates was incomplete. Microaerophilic growth was supported with hydrogen (acetate as the carbon source), formate (acetate as the carbon source), acetate, propionate, pyruvate, lactate, alpha-ketoglutarate, glutamate, yeast extract, fumarate, succinate, malate, citrate, and alanine. The isolate grew fermentatively with fumarate, succinate being the only organic product. Elemental sulfur and oxygen were the only electron acceptors used. Vitamins or amino acids were not required. The isolate was oxidase, catalase, and urease positive. Comparative 16S rDNA sequence analysis revealed a tight cluster consisting of the validly described species Sulfurospirillum deleyianum and the strains SES-3 and CCUG 13942 as the closest relatives of strain F1F6 (level of sequence similarity, 91.7 to 92.4%). Together with strain F1F6, these organisms form a novel lineage within the epsilon subclass of proteobacteria clearly separated from the described species of the genera Arcobacter, Campylobacter, Wolinella, and Helicobacter. Due to the phenotypic characteristics shared by strain F1F6 and S. deleyianum and considering their phylogenetic relationship, we propose the inclusion of strain F1F6 in the genus Sulfurospirillum, namely, as S. arcachonense sp. nov. Based on the results of this study, an emended description of the genus Sulfurospirillum is given.

Isolation and characterization of Sulfurospirillum carboxydovorans sp. nov., a new microaerophilic carbon monoxide oxidizing epsilon Proteobacterium.

PubMed

Jensen, Anders; Finster, Kai

2005-05-01

A new microaerophilic, Gram-negative, motile, 2-3 microm long and 0.3 microm wide, vibrioid to spirillum-shaped, CO oxidizing bacterium, designated strain MV, isolated from marine sediment (The North Sea) is described. Strain MV was able to couple the oxidation of CO to the reduction of elemental sulphur, DMSO and thiosulphate. Growth occurred with up to 100% (v/v) CO in the headspace. Acetate was needed as carbon source. No growth on CO was observed with nitrate and selenate as electron acceptor. Sulphite, elemental sulphur, DMSO, thiosulphate, nitrate, nitrite, perchloroethylene, arsenate and selenate were used as electron acceptors with pyruvate as energy and carbon source. Microaerophilic growth was observed. In non-agitated cultures growth occurred at atmospheric oxygen concentrations in the headspace. Hydrogen (with acetate as carbon source), formate (with acetate as carbon source), pyruvate, lactate, succinate, fumarate, malate alpha-ketoglutaric acid, aspartate and yeast extract (1% (w/v)) supported growth with nitrate as electron acceptor. Fumarate and malate were fermented. Vitamins were not required for growth. The strain was cytochrome C oxidase and catalase positive. The DNA mol G+C content was 30.5%. 16S rRNA gene sequence comparison showed that strain MV grouped within the genus Sulfurospirillum with Sulfurospirillum arcachonense (sequence similarity 98.3%) as closest relative. The relative DNA-DNA relatedness between strain MV and S. arcachonense was 33.1%. Based on a detailed phenotypic and phylogenetic analysis, inclusion of strain MV in the genus Sulfurospirillum as a well separated new species is proposed. As species name we propose Sulfurospirillum carboxydovorans. The type strain is strain MV (ATCC BAA-937 = DSM 16295, GenBank accession number: AY740528).

In Vitro Virology Profile of Tenofovir Alafenamide, a Novel Oral Prodrug of Tenofovir with Improved Antiviral Activity Compared to That of Tenofovir Disoproxil Fumarate

PubMed Central

Stepan, George; Tian, Yang; Miller, Michael D.

2015-01-01

Tenofovir alafenamide (TAF) is an investigational oral prodrug of the HIV-1 nucleotide reverse transcriptase inhibitor tenofovir (TFV). Tenofovir disoproxil fumarate (TDF) is another TFV prodrug, widely used for the treatment of HIV-1 infection. TAF is converted mostly intracellularly to TFV and, in comparison to TDF, achieves higher tenofovir diphosphate (TFV-DP) levels in peripheral blood mononuclear cells. As a result, TAF has demonstrated potent anti-HIV-1 activity at lower doses than TDF in monotherapy studies. Here, the in vitro virology profile of TAF was evaluated and compared to that of TDF. TAF displayed potent antiviral activity against all HIV-1 groups/subtypes, as well as HIV-2. TAF exhibited minimal changes in the drug concentration needed to inhibit 50% of viral spread (EC50) upon removal of the prodrug, similar to TDF, demonstrating intracellular antiviral persistence. While TAF and TDF exhibited comparable potencies in the absence of serum pretreatment, TAF maintained activity in the presence of human serum, whereas TDF activity was significantly reduced. This result demonstrates TAF's improved plasma stability over TDF, which is driven by the different metabolic pathways of the two prodrugs and is key to TAF's improved in vivo antiviral activity. The activity of TAF is specific for HIV, as TAF lacked activity against a large panel of human viruses, with the exception of herpes simplex virus 2, where weak TAF antiviral activity was observed, as previously observed with TFV. Finally, in vitro combination studies with antiretroviral drugs from different classes showed additive to synergistic interactions with TAF, consistent with ongoing clinical studies with TAF in fixed-dose combinations with multiple other antiretroviral drugs for the treatment of HIV. PMID:26149992

Superior Efficacy and Improved Renal and Bone Safety After Switching from a Tenofovir Disoproxil Fumarate- to a Tenofovir Alafenamide-Based Regimen Through 96 Weeks of Treatment.

PubMed

DeJesus, Edwin; Haas, Bernard; Segal-Maurer, Sorana; Ramgopal, Moti N; Mills, Anthony; Margot, Nicolas; Liu, Ya-Pei; Makadzange, Tariro; McCallister, Scott

2018-04-01

We previously demonstrated superior efficacy and safety advantages in HIV-infected, virologically suppressed adults switched to a regimen containing tenofovir alafenamide (TAF) as compared with those remaining on a tenofovir disoproxil fumarate (TDF) regimen through week 48. We now report long-term data through week 96. In this randomized, active-controlled, multicenter, open-label, noninferiority trial (ClinicalTrials.gov No. NCT01815736), we randomized virologically suppressed (HIV-1 RNA <50 copies/ml) adults (2:1) to receive a once-daily, single-tablet regimen containing elvitegravir (EVG), cobicistat (COBI), emtricitabine (FTC), and TAF group or to continue one of four TDF-containing regimens (TDF group) for 96 weeks. We evaluated efficacy (HIV-1 RNA <50 copies/ml using the FDA snapshot algorithm) and prespecified bone and renal endpoints at week 96. We randomized and treated 1,436 participants in this study (TAF n = 959, TDF n = 477). At week 96, TAF was superior to TDF in virologic efficacy, with 93% on TAF and 89% on TDF having HIV-1 RNA <50 copies/ml (difference 3.7%, 95% confidence interval: 0.4%-7.0%). Improvements in hip and spine bone mineral density for those assigned to TAF versus TDF continued through week 96 (p < .001). Significant improvements in urine protein or albumin to creatinine ratios were also seen among those in the TAF group versus TDF through week 96 (p < .001). There were no cases of investigator-reported proximal renal tubulopathy in the TAF group as compared with one case in the TDF group. Switching to EVG/COBI/FTC/TAF (E/C/F/TAF) was associated with statistically significant efficacy and safety advantages over remaining on a standard-of-care TDF-based regimen.

Design of eudragit RL nanoparticles by nanoemulsion method as carriers for ophthalmic drug delivery of ketotifen fumarate

PubMed Central

Soltani, Saieede; Zakeri-Milani, Parvin; Barzegar-Jalali, Mohammad; Jelvehgari, Mitra

2016-01-01

Objective(s): Ketotifen fumarate (KF) is a selective and noncompetitive histamine antagonist (H1-receptor) that is used topically in the treatment of allergic conditions of rhinitis and conjunctivitis. The aim of this study was to formulate and improve an ophthalmic delivery system of KF. Ocular nanoparticles were prepared with the objective of reducing the frequency of administration and obtaining controlled release to improve the anti-inflammatory drug delivery. Materials and Methods: In the present study, ocular KF loaded Eudragit RL 100 nanoparticles were prepared using O/W solvent diffusion method. The nanoparticles were evaluated for particle size, entrapment efficiency, surface morphology, X-ray diffraction (XRD), Fourier transform spectroscopy (FTIR), and differential scanning calorimetry (DSC). In vitro release and permeation studies were also carried out on nanoparticles. Results: An average size range of 182 to 314.30 nm in diameter was obtained and encapsulation efficiency up to 95.0% was observed for all the formulations. Drug release for all formulations after 24 hr was between 65.51% and 88.82% indicating effective controlled release property of KF. The mechanism of drug release for best formulation was found to be fickian diffusion mechanism. KF nanoparticles containing high polymer concentration (1:15) presented a faster drug release and a higher drug penetration; on the contrary, nanoparticles containing low polymer concentration (1:7.5) were able to give a more sustained release of the drug and thus a slower KF permeation through the cornea. Conclusion: The study revealed that KF NPs were capable of releasing the drug for a prolonged period of time and increasing the ocular bioavailability. PMID:27403262

Changes in renal function associated with oral emtricitabine/tenofovir disoproxil fumarate use for HIV pre-exposure prophylaxis

PubMed Central

Solomon, Marc M.; Lama, Javier R.; Glidden, David V.; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y.; Guanira, Juan Vicente; Veloso, Valdilea G.; Mayer, Kenneth H.; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N.; Grant, Robert M.

2014-01-01

Objective: Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. Design and methods: The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft–Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. Results: There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: −2.4 vs. −1.1 ml/min; P = 0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P = 0.02), and resolved after stopping pre-exposure prophylaxis (mean change: −0.1 vs. 0.0 ml/min; P = 0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. Conclusions: In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring. PMID:24499951

Design and evaluation of mucoadhesive vaginal tablets of tenofovir disoproxil fumarate for pre-exposure prophylaxis of HIV.

PubMed

Khan, Arshad Bashir; Thakur, Ram Sharnagat

2018-03-01

To design and evaluate novel, feasible, safe, mucoadhesive intravaginal tablets of tenofovir disoproxil fumarate (TDF). It may provide pre-exposure prophylaxis for women against HIV. TDF intravaginal tablets were formulated employing poylvinylpyrrolidone (PVP) as the matrix forming polymer and various mucoadhesive polymers such as carbopol 934, 940, chitosan, and sodium carboxymethylcellulose (SCMC). Wet granulation was used. The evaluation involved testing drug-excipient compatibility, precompression parameters such as percentage yield, bulk density and tapped density of the granules, Carr's index, Hausner ratio, angle of repose, post compression parameters such as color, shape, physical dimensions, weight variation, hardness, friability, swelling index, assay, in vitro dissolution study and ex vivo mucoadhesion studies. Based on in vitro evaluation, C1 was selected as the best formulation and evaluated further for release kinetics, curve fitting analysis, absorption studies using liquid chromatography-mass spectrometry (LC-MS) technique and histopathological assessment in female Sprague-Dawley rats. C1 followed Higuchi model kinetics. Accelerated stability study was as per ICH guidelines by keeping C1 at 40 ± 2 °C and 75 ± 5% RH for six months. C1 was selected as the best formulation due to better swelling index (65.93% at 24 h), prolonged release of 100.62% cumulative drug release (CDR) at 24 h, superior mucoadhesion force (35.93 × 10 2 dynes/cm 2 ) and retention time (16 h). The study revealed that C1 remained stable for six months. C1 showed nil systemic absorption which is desirable and according to histopathological study, C1, exhibited minimal damage on the rat vaginal epithelium indicating safety.

Synthesis by extrusion: continuous, large-scale preparation of MOFs using little or no solvent† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c4sc03217a Click here for additional data file.

PubMed Central

Crawford, Deborah; Casaban, José; Haydon, Robert; Giri, Nicola; McNally, Tony

2015-01-01

Grinding solid reagents under solvent-free or low-solvent conditions (mechanochemistry) is emerging as a general synthetic technique which is an alternative to conventional solvent-intensive methods. However, it is essential to find ways to scale-up this type of synthesis if its promise of cleaner manufacturing is to be realised. Here, we demonstrate the use of twin screw and single screw extruders for the continuous synthesis of various metal complexes, including Ni(salen), Ni(NCS)2(PPh3)2 as well as the commercially important metal organic frameworks (MOFs) Cu3(BTC)2 (HKUST-1), Zn(2-methylimidazolate)2 (ZIF-8, MAF-4) and Al(fumarate)(OH). Notably, Al(fumarate)(OH) has not previously been synthesised mechanochemically. Quantitative conversions occur to give products at kg h–1 rates which, after activation, exhibit surface areas and pore volumes equivalent to those of materials produced by conventional solvent-based methods. Some reactions can be performed either under completely solvent-free conditions whereas others require the addition of small amounts of solvent (typically 3–4 mol equivalents). Continuous neat melt phase synthesis is also successfully demonstrated by both twin screw and single screw extrusion for ZIF-8. The latter technique provided ZIF-8 at 4 kg h–1. The space time yields (STYs) for these methods of up to 144 × 103 kg per m3 per day are orders of magnitude greater than STYs for other methods of making MOFs. Extrusion methods clearly enable scaling of mechanochemical and melt phase synthesis under solvent-free or low-solvent conditions, and may also be applied in synthesis more generally. PMID:29308131

Incidence of Acute Kidney Injury in Patients Coinfected with HIV and Hepatitis C Virus Receiving Tenofovir Disoproxil Fumarate and Ledipasvir/Sofosbuvir in a Real-World, Urban, Ryan White Clinic.

PubMed

Michal, Jessica L; Rab, Saira; Patel, Manish; Kyle, Alison W; Miller, Lesley S; Easley, Kirk A; Kalapila, Aley G

2018-06-19

Ledipasvir/sofosbuvir (LDV/SOF), an antiviral treatment for hepatitis C virus (HCV), and tenofovir disoproxil fumarate (TDF), an antiretroviral for treating human immunodeficiency virus (HIV), may be coadministered in patients coinfected with these viruses. A drug interaction between LDV and TDF could increase TDF-associated nephrotoxicity rates; however, there is minimal clinical evidence describing acute kidney injury (AKI) rates in this population. This study was conducted at a Ryan White-funded facility in Atlanta, Georgia, that cares for over 5,000 patients with AIDS. This retrospective cohort used chart review to assess occurrence of and risk factors for AKI in HIV/HCV-coinfected patients receiving LDV/SOF and antiretroviral therapy (ART). AKI rates were compared between TDF-containing and non-TDF-containing ART groups according to Kidney Disease Improving Global Outcomes (KDIGO) criteria. Additional evaluated risk factors for AKI included chronic kidney disease and use of boosted protease inhibitor-based ART. In the 117 included patients, the overall incidence of AKI was 27.3%. AKI occurred more frequently in the non-TDF group (13/86, 15.1% vs. 19/31, 61.3%, p < .001). All AKI was KDIGO stage 1. From multivariable logistic regression, the only independent predictor of AKI was treatment with non-TDF relative to TDF (adjusted odds ratio 6.51, 95% confidence interval 2.34-18.10, p < .001). In this real-world cohort of HIV/HCV-coinfected patients, KDIGO-defined AKI was common, but occurred less frequently in patients receiving TDF-based ART. Our study suggests that patients with normal baseline renal function can be safely treated with TDF and LDV/SOF without significant nephrotoxicity if renal function is closely monitored.

Analysis of drug-drug interactions among patients receiving antiretroviral regimens using data from a large open-source prescription database.

PubMed

Patel, Nimish; Borg, Peter; Haubrich, Richard; McNicholl, Ian

2018-06-14

Results of a study of contraindicated concomitant medication use among recipients of preferred antiretroviral therapy (ART) regimens are reported. A retrospective study was conducted to evaluate concomitant medication use in a cohort of previously treatment-naive, human immunodeficiency virus (HIV)-infected U.S. patients prescribed preferred ART regimens during the period April 2014-March 2015. Data were obtained from a proprietary longitudinal prescription database; elements retrieved included age, sex, and prescription data. The outcome of interest was the frequency of drug-drug interactions (DDIs) associated with concomitant use of contraindicated medications. Data on 25,919 unique treatment-naive patients who used a preferred ART regimen were collected. Overall, there were 384 instances in which a contraindicated medication was dispensed for concurrent use with a recommended ART regimen. Rates of contraindicated concomitant medication use differed significantly by ART regimen; the highest rate (3.2%) was for darunavir plus ritonavir plus emtricitabine-tenofovir disoproxil fumarate (DRV plus RTV plus FTC/TDF), followed by elvitegravir-cobicistat-emtricitabine-tenofovir disoproxil fumarate (EVG/c/FTC/TDF)(2.8%). The highest frequencies of DDIs were associated with ART regimens that included a pharmacoenhancing agent: DRV plus RTV plus FTC/TDF (3.2%) and EVG/c/FTC/TDF (2.8%). In a large population of treatment-naive HIV-infected patients, ART regimens that contained a pharmacoenhancing agent were involved most frequently in contraindicated medication-related DDIs. All of the DDIs could have been avoided by using therapeutic alternatives within the same class not associated with a DDI. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

Desulfovibrio tunisiensis sp. nov., a novel weakly halotolerant, sulfate-reducing bacterium isolated from exhaust water of a Tunisian oil refinery.

PubMed

Ben Ali Gam, Zouhaier; Oueslati, Ridha; Abdelkafi, Slim; Casalot, Laurence; Tholozan, Jean Luc; Labat, Marc

2009-05-01

A novel weakly halotolerant, sulfate-reducing bacterium, designated strain RB22(T), was isolated from exhaust water of a Tunisian oil refinery. Cells of strain RB22(T) were Gram-negative, motile, vibrio-shaped or sigmoid and non-spore-forming, and occurred singly or in chains. Strain RB22(T) grew between 15 and 45 degrees C (optimum, 37 degrees C) and at pH 4.5 to 9 (optimum, pH 7). NaCl was not required for growth, but the strain tolerated high NaCl concentrations (up to 70 g l(-1)) with an optimum of 40 g l(-1). Sulfate, thiosulfate, sulfite and elemental sulfur served as electron acceptors, but not fumarate. Nitrate and nitrite were not reduced. Strain RB22(T) utilized lactate, formate, fumarate, succinate, glycerol, H(2)+CO(2) and methanol as substrates. The DNA G+C content was found to be 59.6 mol%. Phylogenetic analysis based on the 16S rRNA gene revealed that the isolate was a member of the genus Desulfovibrio, with no close relatives at the species level (16S rRNA gene sequence similarity of less than 95 %). Strain RB22(T) exhibited levels of 16S rRNA gene sequence similarity of 94.6 and 94.12 % to the type strains of the closely related species Desulfovibrio aespoeensis and Desulfovibrio dechloracetivorans, respectively. On the basis of genotypic and phylogenetic characteristics, and significant phenotypic differences, we suggest that strain RB22(T) represents a novel species, for which the name Desulfovibrio tunisiensis sp. nov. is proposed. The type strain is RB22(T) (=NCIMB 14400(T)=JCM 15076(T)=DSM 19275(T)).

The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

PubMed

Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

2006-07-01

A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

Changes in renal function associated with oral emtricitabine/tenofovir disoproxil fumarate use for HIV pre-exposure prophylaxis.

PubMed

Solomon, Marc M; Lama, Javier R; Glidden, David V; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y; Guanira, Juan Vicente; Veloso, Valdilea G; Mayer, Kenneth H; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N; Grant, Robert M

2014-03-27

Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft-Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: -2.4 vs. -1.1 ml/min; P=0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P=0.02), and resolved after stopping pre-exposure prophylaxis (mean change: -0.1 vs. 0.0 ml/min; P=0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring.

Development of sustained release antipsychotic tablets using novel polysaccharide isolated from Delonix regia seeds and its pharmacokinetic studies

PubMed Central

Krishnaraj, Kaliaperumal; Chandrasekar, Mulla Joghi Nanjan; Nanjan, Mulla Joghi; Muralidharan, Selvadurai; Manikandan, Duraikannu

2011-01-01

A natural polysaccharide was isolated from the seeds of Delonix regia. The isolated polysaccharide could maintain aqueous equilibrium between the dosage form and the surrounding medium due to its massive competence of water absorption (80.72%) and swelling index (266.7%). The Scanning Electron Micrograph of a polysaccharide exhibits rough surface with pores and crevices, hence, the drug release will be retarded because of the drug particles entrapment in the pores and crevices. Further, the surface tension of polysaccharide is higher than that of water, which may facilitate sustained release of drugs from dosage forms. An antipsychotic drug, quetiapine fumarate has a short half-life of 6 h and administered multiple times per day. Hence the quetiapine fumarate oral sustained release tablets were formulated using this polysaccharide in the concentration of 5–30% to avoid the side effects and increase patient compliance. Dissolution of the developed tablets with 25% polysaccharide content showed a better release profile than the other batches (5–20%) at the end of 12 h. The strong matrix complex has low solubility in water, it does not dissolve rapidly and the drug continues to diffuse through the gel layer at a consistent rate. Drug release from the matrix tablets follows matrix type except F-4 and F-5 which follow first order and Hix.crow type. The bioavailability study was carried out using healthy male New Zealand white rabbits that show the AUC(0–inf) value for developed SR tablets is 1.44 times higher than the reference thus, indicating more efficient and sustained drug delivery capable of maintaining plasma drug levels better. PMID:24115903

Highly efficient chiral resolution of DL-arginine by cocrystal formation followed by recrystallization under preferential-enrichment conditions.

PubMed

Iwama, Sekai; Kuyama, Kazunori; Mori, Yuko; Manoj, Kochunnoonny; Gonnade, Rajesh G; Suzuki, Katsuaki; Hughes, Colan E; Williams, P Andrew; Harris, Kenneth D M; Veesler, Stéphane; Takahashi, Hiroki; Tsue, Hirohito; Tamura, Rui

2014-08-11

An excellent chiral symmetry-breaking spontaneous enantiomeric resolution phenomenon, denoted preferential enrichment, was observed on recrystallization of the 1:1 cocrystal of dl-arginine and fumaric acid, which is classified as a racemic compound crystal with a high eutectic ee value (>95 %), under non-equilibrium crystallization conditions. On the basis of temperature-controlled video microscopy and in situ time-resolved solid-state (13) C NMR spectroscopic studies on the crystallization process, a new mechanism of phase transition that can induce preferential enrichment is proposed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tenofovir disoproxil fumarate is superior to lamivudine plus adefovir in lamivudine-resistant chronic hepatitis B patients.

PubMed

Yang, Dan-Hong; Xie, Yuan-Jun; Zhao, Nian-Feng; Pan, Hong-Ying; Li, Ming-Wei; Huang, Hai-Jun

2015-03-07

To assess the efficacy of tenofovir disoproxil fumarate (TDF) in lamivudine (LAM)-resistant patients with a suboptimal response to LAM plus adefovir (ADV). We retrospectively analyzed the efficacy of switching to tenofovir disoproxil fumarate in suboptimal responders to lamivudine plus adefovir. Charts were reviewed for LAM-resistant chronic hepatitis B (CHB) patients who visited the Zhejiang Province People's Hospital and The First Affiliated Hospital, College of Medicine, Zhejiang University, from June 2009 to May 2013. Patients whose serum hepatitis B virus (HBV) DNA remained detectable despite at least 6 mo of LAM plus ADV combination therapy were included. Patients with a suboptimal response to LAM plus ADV were randomized to switch to TDF monotherapy (300 mg/d orally; TDF group) or to continuation with LAM (100 mg/d orally) plus ADV (10 mg/d orally; LAM plus ADV group) and were followed for 48 wk. Serum HBV DNA was determined at baseline and weeks 4, 12, 24, 36, and 48. HBV serological markers and biochemistry were assessed at baseline and weeks 12, 24, and 48. Resistance surveillance and side effects were monitored during therapy. Fifty-nine patient were randomized to switch to TDF (n = 28) or continuation with LAM plus ADV (n = 31). No significant differences were found between the groups at baseline. Prior to TDF therapy, all patients had been exposed to LAM plus ADV for a median of 11 mo (range: 6-24 mo). No difference was seen in baseline serum HBV DNA between the two groups [5.13 ± 1.08 log10 copies/mL (TDF) vs 5.04 ± 31.16 log10 copies/mL (LAM + ADV), P = 0.639]. There was no significant difference in the rates of achieving complete virological response (CVR) at week 4 between the TDF and LAM + ADV groups (17.86% vs 6.45%, P = 0.24). The rate of achieving CVR in the TDF and LAM plus ADV groups was 75% vs 16.13% at week 12, 82.14% vs 22.58% at week 24, 89.29% vs 25.81% at week 36, and 96.43% vs 29.03% at week 48, respectively (P < 0.001). The rate of alanine aminotransferase normalization was significantly higher in the TDF than in the LAM plus ADV group at week 12 (75% vs 17.86%, P < 0.001), but not at week 24 (78.57% vs 54.84%, P = 0.097) or 48 (89.26% vs 67.74%, P = 0.062). Patients were hepatitis B e antigen (HBeAg) positive at baseline. There was no significant difference in HBeAg negativity between the TDF and LAM plus ADV groups at week 48 (4% vs 0%, P = 0.481). There were no drug-related adverse effects at week 48 in either group. Switching to TDF monotherapy was superior to continuous add-on therapy in patients with LAM-resistant CHB with a suboptimal response to LAM plus ADV.

Costs of the Smoking Cessation Program in Brazil.

PubMed

Mendes, Andréa Cristina Rosa; Toscano, Cristiana Maria; Barcellos, Rosilene Marques de Souza; Ribeiro, Alvaro Luis Pereira; Ritzel, Jonas Bohn; Cunha, Valéria de Souza; Duncan, Bruce Bartholow

2016-11-10

To assess the costs of the Smoking Cessation Program in the Brazilian Unified Health System and estimate the cost of its full implementation in a Brazilian municipality. The intensive behavioral therapy and treatment for smoking cessation includes consultations, cognitive-behavioral group therapy sessions, and use of medicines. The costs of care and management of the program were estimated using micro-costing methods. The full implementation of the program in the municipality of Goiania, Goias was set as its expansion to meet the demand of all smokers motivated to quit in the municipality that would seek care at Brazilian Unified Health System. We considered direct medical and non-medical costs: human resources, medicines, consumables, general expenses, transport, travels, events, and capital costs. We included costs of federal, state, and municipal levels. The perspective of the analysis was that from the Brazilian Unified Health System. Sensitivity analysis was performed by varying parameters concerning the amount of activities and resources used. Data sources included a sample of primary care health units, municipal and state secretariats of health, and the Brazilian Ministry of Health. The costs were estimated in Brazilian Real (R$) for the year of 2010. The cost of the program in Goiania was R$429,079, with 78.0% regarding behavioral therapy and treatment of smoking. The cost per patient was R$534, and, per quitter, R$1,435. The full implementation of the program in the municipality of Goiania would generate a cost of R$20.28 million to attend 35,323 smokers. The Smoking Cessation Program has good performance in terms of cost per patient that quit smoking. In view of the burden of smoking in Brazil, the treatment for smoking cessation must be considered as a priority in allocating health resources. Analisar os custos do Programa de Tratamento do Tabagismo no Sistema Único de Saúde e estimar o custo de sua implementação plena em um município brasileiro. A abordagem intensiva e tratamento do tabagismo engloba consultas, sessões de terapia cognitivo-comportamental em grupo e uso de medicamentos. Os custos do atendimento e gerenciamento do programa foram estimados utilizando a metodologia do microcusteio. A implementação plena do programa no município de Goiânia, Goiás, foi definida como sua expansão para suprir a demanda de todos os fumantes motivados a parar de fumar no município que seriam atendidos pelo Sistema Único de Saúde. Foram considerados custos médicos e não médicos diretos: recursos humanos, medicamentos, material de consumo, despesas gerais, transporte, viagens, eventos e custos de capital. Foram incluídos custos dos níveis federal, estadual e municipal de gestão. A perspectiva da análise foi a do Sistema Único de Saúde. Análise de sensibilidade foi realizada variando parâmetros referentes à quantidade de atividades e aos recursos utilizados. As fontes de dados incluíram uma amostra de unidades de saúde da Atenção Primária, secretarias de saúde municipal e estadual e Ministério da Saúde. Os custos foram estimados em reais (R$) para o ano de 2010. O custo do programa em Goiânia foi de R$429.079, sendo 78,0% referentes à abordagem e tratamento do tabagismo. O custo por paciente foi de R$534 e, por paciente que deixou de fumar, de R$1.435. A implementação plena do programa no município de Goiânia geraria custo de R$20,28 milhões, para atender 35.323 fumantes. O Programa de Tratamento do Tabagismo tem bom desempenho em termos de custo por paciente que deixa de fumar. Tendo em vista a carga do tabagismo no Brasil, o tratamento para cessação de fumar deve ser considerado prioritário ao se programar a alocação de recursos de saúde.

Growth of a Strictly Anaerobic Bacterium on Furfural (2-Furaldehyde)

PubMed Central

Brune, Gerhard; Schoberth, Siegfried M.; Sahm, Hermann

1983-01-01

A strictly anaerobic bacterium was isolated from a continuous fermentor culture which converted the organic constituents of sulfite evaporator condensate to methane and carbon dioxide. Furfural is one of the major components of this condensate. This furfural isolate could degrade furfural as the sole source of carbon and energy in a defined mineral-vitamin-sulfate medium. Acetic acid was the major fermentation product. This organism could also use ethanol, lactate, pyruvate, or fumarate and contained cytochrome c3 and desulfoviridin. Except for furfural degradation, the characteristics of the furfural isolate were remarkably similar to those of the sulfate reducer Desulfovibrio gigas. The furfural isolate has been tentatively identified as Desulfovibrio sp. strain F-1. Images PMID:16346423

S3 Guideline for the treatment of psoriasis vulgaris, update - Short version part 1 - Systemic treatment.

PubMed

Nast, Alexander; Amelunxen, Lasse; Augustin, Matthias; Boehncke, Wolf-Henning; Dressler, Corinna; Gaskins, Matthew; Härle, Peter; Hoffstadt, Bernd; Klaus, Joachim; Koza, Joachim; Mrowietz, Ulrich; Ockenfels, Hans-Michael; Philipp, Sandra; Reich, Kristian; Rosenbach, Thomas; Rzany, Berthold; Schlaeger, Martin; Schmid-Ott, Gerhard; Sebastian, Michael; von Kiedrowski, Ralph; Weberschock, Tobias

2018-05-01

The German guideline for the treatment of psoriasis vulgaris was updated using GRADE methodology. The guideline is based on a systematic literature review completed on December 1, 2016, and on a formal consensus and approval process. The first section of this short version of the guideline covers systemic treatment options considered relevant by the expert panel and approved in Germany at the time of the consensus conference (acitretin, adalimumab, apremilast, cyclosporine, etanercept, fumaric acid esters, infliximab, methotrexate, secukinumab and ustekinumab). Detailed information is provided on the management and monitoring of the included treatment options. © 2018 The Authors | Journal compilation © Blackwell Verlag GmbH, Berlin.

Oral Disease-Modifying Therapies for Multiple Sclerosis

PubMed Central

Kim, Woojun; Zandoná, Manuella Edler; Kim, Su-Hyun

2015-01-01

Classical multiple sclerosis (MS) treatments using first-line injectable drugs, although widely applied, remain a major concern in terms of therapeutic adherence and efficacy. New oral drugs recently approved for MS treatment represent significant advances in therapy. The oral route of administration clearly promotes patient satisfaction and increases therapeutic compliance. However, these drugs may also have safety and tolerability issues, and a thorough analysis of the risks and benefits is required. Three oral drugs have been approved by regulatory agencies for MS treatment: fingolimod, teriflunomide, and dimethyl fumarate. This article reviews the mechanisms of action, safety, and efficacy of these drugs and two other drugs that have yielded positive results in phase III trials: cladribine and laquinimod. PMID:25628732

Metabolomic Analyses of Blood Plasma after Oral Administration of D-Glucosamine Hydrochloride to Dogs

PubMed Central

Osaki, Tomohiro; Azuma, Kazuo; Kurozumi, Seiji; Takamori, Yoshimori; Tsuka, Takeshi; Imagawa, Tomohiro; Okamoto, Yoshiharu; Minami, Saburo

2012-01-01

D-Glucosamine hydrochloride (GlcN∙HCl) is an endogenous amino monosaccharide synthesized from glucose that is useful in the treatment of joint diseases in both humans and animals. The aim of this study was to examine amino acid metabolism in dogs after oral administration of GlcN∙HCl. Accelerated fumarate respiration and elevated plasma levels of lactic acid and alanine were observed after administration. These results suggest that oral administration of GlcN∙HCl induces anaerobic respiration and starvation in cells, and we hypothesize that these conditions promote cartilage regeneration. Further studies are required to evaluate the expression of transforming growth factor-beta (TGF-β). PMID:23015778

Top Value Added Chemicals from Biomass - Volume I, Results of Screening for Potential Candidates from Sugars and Synthesis Gas

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2004-08-01

This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol.

Top Value Added Chemicals from Biomass: Volume I -- Results of Screening for Potential Candidates from Sugars and Synthesis Gas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werpy, T.; Petersen, G.

2004-08-01

This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol.

Liquid Hydrogenation of Maleic Anhydride with Pd/C Catalyst at Low Pressure and Temperature in Batch Reactor.

PubMed

Kim, Ji Sun; Baek, Jae Ho; Ryu, Young Bok; Hong, Seong-Soo; Lee, Man Sig

2015-01-01

Succinic acid (SA) produced from hydrogenation of maleic anhydride (MAN) is used widely in manufacturing of pharmaceuticals, agrochemicals, surfactants and detergent, green solvent and biodegradable plastic. In this study, we performed that liquid hydrogenation of MAN to SA with 5 wt% Pd supported on activated carbon (Pd/C) at low pressure and temperature. The synthesis of SA was performed in aqueous solution while varying temperature, pressure, catalytic amount and agitation speed. We confirmed that the composition of the products consisting of SA, maleic acid (MA), fumaric acid (FA) and malic acid (MLA) depends on the process. The catalytic characteristics were analyzed by TGA, TEM.

Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.

PubMed

Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal

2005-01-01

Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.

Visible-light-induced two-electron-transfer photoreductions on CdS: Effects of morphology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiragami, Tsutomu; Pac, Chyongjin; Yanagida, Shozo

1990-01-25

Freshly prepared CdS suspensions (CdS-O) consisting of quantized particles and their loose aggregation catalyze photoreductions of aromatic ketones and olefins in methanol under visible light irradiation using triethylamine as sacrificial electron donor, yielding alcohols and dihydro compounds, respectively, which are more selective than photocatalysis of commercially available crystalline CdS (Aldrich) (CdS-Ald). Deuterium incorporation experiments in photolysis of dimethyl maleate in methanol-O-D revealed that CdS-O catalyzes sequential two-electron-transfer photoreduction, affording dideuterated dimethyl succinate, while CdS-Ald induces both photoreduction and photoisomerization through disproportionation between one-electron-transfer-reduction intermediates, yielding much trideuterated dimethyl succinate and monodeuterated dimethyl fumarate and maleate.

Development of laminated fiber-reinforced nanocomposites for bone regeneration

NASA Astrophysics Data System (ADS)

Xu, Weijie

There have been numerous efforts to develop synthetic and/or natural tissue engineering scaffolds that are suitable for bone regeneration applications to replace autograft and allograft bones. Current biomaterials as a scaffold for bone regeneration are limited by the extent of degradation concurrent with bone formation, mechanical strength, and the extent of osteogenic differentiation of marrow stromal cells migrating from the surrounding tissues. In this project, a novel laminated nanocomposite scaffold is fabricated, consisting of poly (L-lactide ethylene oxide fumarate) (PLEOF) hydrogel reinforced with poly (L-lactic acid) (PLLA) electrospun nanofibers and hydroxyapatite (HA) nanoparticles. PLEOF is a novel in situ crosslinkable macromer synthesized from biocompatible building units which can be functionalized with bioactive peptides like the cell-adhesive Arg--Gly--Asp (RGD) amino acid sequence. The hydrophilicity and degradation rate of the macromer can be tailored to a particular application by controlling the ratio of PEG to PLA blocks in the macromer and the unsaturated fumarate units can be used for in-situ crosslinking. The PLLA nanofibers were electrospun from high molecular weight PLLA. The laminated nanocomposites were fabricated by dry-hand lay up technique followed by compression molding and thermal crosslinking. The laminated nanocomposites were evaluated with respect to degradation, water uptake, mechanical strength, and the extent of osteogenic differentiation of bone marrow stromal (BMS) cells. Laminates with or without HA nanoparticles showed modulus values much higher than that of trabecular bone (50-100 MPa). The effect of laminated nanocomposites on osteogenic differentiation of BMS cells was determined in terms of cell number, ALPase activity and calcium content. Our results demonstrate that grafting RGD peptide and HA nanoparticles to a PLEOF hydrogel reinforced with PLLA nanofibers synergistically enhance osteogenic differentiation of BMS cells. In conclusion, the laminated nanocomposite with controllable degradation characteristics and robust mechanical properties is attractive as a synthetic bone-mimetic matrix for skeletal tissue regeneration.

Gateways to clinical trials.

PubMed

Bayes, M; Rabasseda, X; Prous, J R

2006-03-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 131I-labetuzumab; Abacavir sulfate, abatacept, adalimumab, ademetionine, adjuvanted influenza vaccine, alefacept, alemtuzumab, amlodipine, amphotericin B, anakinra, aripiprazole, aspirin, axitinib; Betamethasone dipropionate, bevacizumab, biphasic insulin aspart, bortezomib, bosentan, botulinum toxin type B, BQ-123; Calcium folinate, canertinib dihydrochloride, carboplatin, carmustine, cetirizine hydrochloride, cetuximab, cholecalciferol, ciclesonide, ciclosporin, cinacalcet hydrochloride, cisplatin, clarithromycin, clofazimine, cold-adapted influenza vaccine trivalent, CpG-7909; Darbepoetin alfa, darifenacin hydrobromide, DB-289, desloratadine, Dexamet, dicycloverine hydrochloride, dimethyl fumarate, docetaxel, dolastatin 10, drospirenone, drospirenone/estradiol, duloxetine hydrochloride; Ecogramostim, edotecarin, efaproxiral sodium, enalapril maleate, epoetin beta, epoprostenol sodium, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, estradiol, etanercept; Fluconazole, fludarabine phosphate, fluorouracil; Gefitinib, gemcitabine, Ghrelin (human), glibenclamide, glimepiride, GTI-2040; Haloperidol, human insulin, hydrocortisone probutate; Imatinib mesylate, indisulam, influenza vaccine, inhaled insulin, insulin aspart, insulin glulisine, insulin lispro, irinotecan, ispronicline; Lamivudine, lamivudine/zidovudine/abacavir sulfate, lapatinib, letrozole, levocetirizine, lomustine, lonafarnib, lumiracoxib;Magnesium sulfate, MD-1100, melphalan, metformin hydrochloride, methotrexate, metoclopramide hydrochloride, mitiglinide calcium hydrate, monophosphoryl lipid A, montelukast sodium, motexafin gadolinium, mycophenolate mofetil, mycophenolic acid sodium salt; Nitisinone; Omalizumab, omapatrilat, ONYX-015, oxaliplatin; Paclitaxel, paclitaxel nanoparticles, panitumumab, parathyroid hormone (human recombinant), peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pertuzumab, phosphatidylcholine-rich phospholipid mixture, pimecrolimus, pioglitazone hydrochloride, pramlintide acetate, prasterone; QR-333; Ranelic acid distrontium salt, ranolazine, rasagiline mesilate, RFB4(dsFv)-PE38, ribavirin, rifabutin, risperidone, rituximab, rofecoxib, rosiglitazone maleate, rosiglitazone maleate/metformin hydrochloride, rotavirus vaccine; S-236, salmeterol xinafoate, sarizotan hydrochloride, sildenafil, sildenafil citrate, sunitinib malate; Tadalafil, tegaserod maleate, temozolomide, tenofovir disoproxil fumarate, teriparatide, tiotropium bromide, tipifarnib, trabectedin, treprostinil sodium; Vandetanib, vardenafil hydrochloride hydrate, vatalanib succinate, vinflunine, virosome influenza vaccine, voriconazole; Zidovudine. (c) 2006 Prous Science. All rights reserved.