Sample records for fumaric acid production

  1. Fumaric acid production in Saccharomyces cerevisiae by simultaneous use of oxidative and reductive routes.

    PubMed

    Xu, Guoqiang; Chen, Xiulai; Liu, Liming; Jiang, Linghuo

    2013-11-01

    In this study, the simultaneous use of reductive and oxidative routes to produce fumaric acid was explored. The strain FMME003 (Saccharomyces cerevisiae CEN.PK2-1CΔTHI2) exhibited capability to accumulate pyruvate and was used for fumaric acid production. The fum1 mutant FMME004 could produce fumaric acid via oxidative route, but the introduction of reductive route derived from Rhizopus oryzae NRRL 1526 led to lower fumaric acid production. Analysis of the key factors associated with fumaric acid production revealed that pyruvate carboxylase had a low degree of control over the carbon flow to malic acid. The fumaric acid titer was improved dramatically when the heterologous gene RoPYC was overexpressed and 32 μg/L of biotin was added. Furthermore, under the optimal carbon/nitrogen ratio, the engineered strain FMME004-6 could produce up to 5.64 ± 0.16 g/L of fumaric acid. These results demonstrated that the proposed fermentative method is efficient for fumaric acid production. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Influence of Nutritional Conditions on Production of l-Glutamine by Flavobacterium rigense

    PubMed Central

    Nabe, Koichi; Ujimaru, Toshihiko; Yamada, Shigeki; Chibata, Ichiro

    1981-01-01

    The nutritional conditions for the production of l-glutamine by Flavobacterium rigense strain 703 were investigated. The optimum concentration of ammonia for achieving the highest yield of l-glutamine (25 mg/ml of broth) was relatively broad, from 0.9 to 1.6%, whereas fumaric acid had a narrow optimum range, near 5.5%. High concentration of inorganic ions such as chloride or sulfate ion clearly inhibited cell growth. Therefore, ammonium salts other than (NH4)2-fumarate were unsuitable for the highest production. The optimum concentration of (NH4)2-fumarate was 7%. To reduce the concentration of fumaric acid in the medium, many substances were evaluated as substitutes. The fumaric acid concentration required for highest l-glutamine yield could not be replaced by any one of the compounds tested. However, part of fumaric acid could be replaced with succinic acid and cupric ion; 4% (NH4)2-fumarate plus 2.5% succinic acid or 5% (NH4)2-fumarate plus 1 mM cupric ion produced results similar to 7% (NH4)2-fumarate in the fermentation medium. PMID:16345682

  3. Fumaric Acid Production from Alkali-Pretreated Corncob by Fed-Batch Simultaneous Saccharification and Fermentation Combined with Separated Hydrolysis and Fermentation at High Solids Loading.

    PubMed

    Li, Xin; Zhou, Jin; Ouyang, Shuiping; Ouyang, Jia; Yong, Qiang

    2017-02-01

    Production of fumaric acid from alkali-pretreated corncob (APC) at high solids loading was investigated using a combination of separated hydrolysis and fermentation (SHF) and fed-batch simultaneous saccharification and fermentation (SSF) by Rhizopus oryzae. Four different fermentation modes were tested to maximize fumaric acid concentration at high solids loading. The highest concentration of 41.32 g/L fumaric acid was obtained from 20 % (w/v) APC at 38 °C in the combined SHF and fed-batch SSF process, compared with 19.13 g/L fumaric acid in batch SSF alone. The results indicated that a combination of SHF and fed-batch SSF significantly improved production of fumaric acid from lignocellulose by R. oryzae than that achieved with batch SSF at high solids loading.

  4. Design of simulated moving bed for separation of fumaric acid with a little fronting phenomenon.

    PubMed

    Choi, Jae-Hwan; Kang, Mun-Seok; Lee, Chung-Gi; Wang, Nien-Hwa Linda; Mun, Sungyong

    2017-03-31

    The production of fumaric acid through a biotechnological pathway has grown in importance because of its potential value in related industries. This has sparked an interest in developing an economically-efficient process for separation of fumaric acid (product of interest) from acetic acid (by-product). This study aimed to develop a simulated moving bed (SMB) chromatographic process for such separation in a systematic way. As a first step for this work, commercially available adsorbents were screened for their applicability to the considered separation, which revealed that an Amberchrom-CG71C resin had a sufficient potential to become an adsorbent of the targeted SMB. Using this adsorbent, the intrinsic parameters of fumaric and acetic acids were determined and then applied to optimizing the SMB process under consideration. The optimized SMB process was tested experimentally, from which the yield of fumaric-acid product was found to become lower than expected in the design. An investigation about the reason for such problem revealed that it was attributed to a fronting phenomenon occurring in the solute band of fumaric acid. To resolve this issue, the extent of the fronting was evaluated quantitatively using an experimental axial dispersion coefficient for fumaric acid, which was then considered in the design of the SMB of interest. The SMB experimental results showed that the SMB design based on the consideration of the fumaric-acid fronting could guarantee the attainment of both high purity (>99%) and high yield (>99%) for fumaric-acid product under the desorbent consumption of 2.6 and the throughput of 0.36L/L/h. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Production of Fumaric Acid in 20-Liter Fermentors

    PubMed Central

    Rhodes, R. A.; Lagoda, A. A.; Misenheimer, T. J.; Smith, M. L.; Anderson, R. F.; Jackson, R. W.

    1962-01-01

    The conditions necessary for the production of fumaric acid in 20-liter fermentors by fermentation of glucose with Rhizopus arrhizus strain NRRL 2582 were determined. Continuous neutralization of fumaric acid was necessary for optimal yields. Yields of the calcium salt were in excess of 65 g of fumaric acid from 100 g of sugar consumed during fermentation of sugar concentrations of 10 to 16%. Conditions established for calcium fumarate production include a simple mineral salts medium, 0.5 v:v:min aeration rate, 300 rev/min agitation rate in a baffled tank, 33 C incubation temperature, CaCO3 to neutralize the acid formed, and a 4 to 5% (v/v) vegetative inoculum. A suitable procedure and medium for the preparation of a vigorous vegetative inoculum were established. The tendency for calcium fumarate fermentations to foam excessively was controlled with a proper antifoam agent added prior to sterilization of the medium and again at daily intervals during fermentation. The production of soluble sodium or potassium fumarates was inhibited when the concentration of fumarates reached 3.5 to 4.0%. No means of overcoming this inhibition was found. Starches and certain other grain-derived carbohydrates were fermented to form calcium fumarate in flask experiments with approximately the same efficiency as was glucose. PMID:16349614

  6. Production of fumaric acid by immobilized Rhizopus arrhizus RH 7-13-9# on loofah fiber in a stirred-tank reactor.

    PubMed

    Liu, Huan; Zhao, Shijie; Jin, Yuhan; Yue, Xuemin; Deng, Li; Wang, Fang; Tan, Tianwei

    2017-11-01

    Fumaric acid is an important building-block chemical. The production of fumaric acid by fermentation is possible. Loofah fiber is a natural, biodegradable, renewable polymer material with highly sophisticated and pore structure. This work investigated a new immobilization method using loofah fiber as carrier to produce fumaric acid in a stirred-tank reactor. Compared with other carriers, loofah fiber was proven to be efficiently and successfully used in the reactor. After the optimization process, 20g addition of loofah fiber and 400rpm agitation speed were chosen as the most suitable process conditions. 30.3g/L fumaric acid in the broth as well as 19.16g fumaric acid in the precipitation of solid was achieved, while the yield from glucose reached 0.211g/g. Three batches of fermentation using the same loofah fiber carrier were conducted successfully, which meant it provided a new method to produce fumaric acid in a stirred-tank reactor. Copyright © 2017. Published by Elsevier Ltd.

  7. Fumaric acid production using renewable resources from biodiesel and cane sugar production processes.

    PubMed

    Papadaki, Aikaterini; Papapostolou, Harris; Alexandri, Maria; Kopsahelis, Nikolaos; Papanikolaou, Seraphim; de Castro, Aline Machado; Freire, Denise M G; Koutinas, Apostolis A

    2018-04-13

    The microbial production of fumaric acid by Rhizopus arrhizus NRRL 2582 has been evaluated using soybean cake from biodiesel production processes and very high polarity (VHP) sugar from sugarcane mills. Soybean cake was converted into a nutrient-rich hydrolysate via a two-stage bioprocess involving crude enzyme production via solid state fermentations (SSF) of either Aspergillus oryzae or R. arrhizus cultivated on soybean cake followed by enzymatic hydrolysis of soybean cake. The soybean cake hydrolysate produced using crude enzymes derived via SSF of R. arrhizus was supplemented with VHP sugar and evaluated using different initial free amino nitrogen (FAN) concentrations (100, 200, and 400 mg/L) in fed-batch cultures for fumaric acid production. The highest fumaric acid concentration (27.3 g/L) and yield (0.7 g/g of total consumed sugars) were achieved when the initial FAN concentration was 200 mg/L. The combination of VHP sugar with soybean cake hydrolysate derived from crude enzymes produced by SSF of A. oryzae at 200 mg/L initial FAN concentration led to the production of 40 g/L fumaric acid with a yield of 0.86 g/g of total consumed sugars. The utilization of sugarcane molasses led to low fumaric acid production by R. arrhizus, probably due to the presence of various minerals and phenolic compounds. The promising results achieved through the valorization of VHP sugar and soybean cake suggest that a focused study on molasses pretreatment could lead to enhanced fumaric acid production.

  8. Methods for the synthesis of olefins and derivatives

    DOEpatents

    Burk, Mark J; Pharkya, Priti; Van Dien, Stephen J; Burgard, Anthony P; Schilling, Christophe H

    2013-06-04

    The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.

  9. Methods for the synthesis of olefins and derivatives

    DOEpatents

    Burk, Mark J [San Diego, CA; Pharkya, Priti [San Diego, CA; Van Dien, Stephen J [Encinitas, CA; Burgard, Anthony P [Bellefonte, PA; Schilling, Christophe H [San Diego, CA

    2011-09-27

    The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.

  10. Methods for synthesis of olefins and derivatives

    DOEpatents

    Burk, Mark J.; Pharkya, Priti; Van Dien, Stephen J.; Burgard, Anthony P.; Schilling, Christophe H.

    2016-06-14

    The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.

  11. Omics-based approaches reveal phospholipids remodeling of Rhizopus oryzae responding to furfural stress for fumaric acid-production from xylose.

    PubMed

    Pan, Xinrong; Liu, Huanhuan; Liu, Jiao; Wang, Cheng; Wen, Jianping

    2016-12-01

    In order to relieve the toxicity of furfural on Rhizopus oryzae fermentation, the molecular mechanism of R. oryzae responding to furfural stress for fumaric acid-production was investigated by omics-based approaches. In metabolomics analysis, 29 metabolites including amino acid, sugars, polyols and fatty acids showed significant changes for maintaining the basic cell metabolism at the cost of lowering fumaric acid production. To further uncover the survival mechanism, lipidomics was carried out, revealing that phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol and polyunsaturated acyl chains might be closely correlated with R. oryzae's adapting to furfural stress. Based on the above omics analysis, lecithin, inositol and soybean oil were exogenously supplemented separately with an optimized concentration in the presence of furfural, which increased fumaric acid titer from 5.78g/L to 10.03g/L, 10.05g/L and 12.13g/L (increased by 73.5%, 73.8% and 110%, respectively). These findings provide a methodological guidance for hemicellulose-fumaric acid development. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. pH-Dependent Uptake of Fumaric Acid in Saccharomyces cerevisiae under Anaerobic Conditions

    PubMed Central

    Jamalzadeh, Elaheh; Verheijen, Peter J. T.; Heijnen, Joseph J.

    2012-01-01

    Microbial production of C4 dicarboxylic acids from renewable resources has gained renewed interest. The yeast Saccharomyces cerevisiae is known as a robust microorganism and is able to grow at low pH, which makes it a suitable candidate for biological production of organic acids. However, a successful metabolic engineering approach for overproduction of organic acids requires an incorporation of a proper exporter to increase the productivity. Moreover, low-pH fermentations, which are desirable for facilitating the downstream processing, may cause back diffusion of the undissociated acid into the cells with simultaneous active export, thereby creating an ATP-dissipating futile cycle. In this work, we have studied the uptake of fumaric acid in S. cerevisiae in carbon-limited chemostat cultures under anaerobic conditions. The effect of the presence of fumaric acid at different pH values (3 to 5) has been investigated in order to obtain more knowledge about possible uptake mechanisms. The experimental results showed that at a cultivation pH of 5.0 and an external fumaric acid concentration of approximately 0.8 mmol · liter−1, the fumaric acid uptake rate was unexpectedly high and could not be explained by diffusion of the undissociated form across the plasma membrane alone. This could indicate the presence of protein-mediated import. At decreasing pH levels, the fumaric acid uptake rate was found to increase asymptotically to a maximum level. Although this observation is in accordance with protein-mediated import, the presence of a metabolic bottleneck for fumaric acid conversion under anaerobic conditions could not be excluded. PMID:22113915

  13. Continuous production of succinic acid by a fumarate-reducing bacterium immobilized in a hollow-fiber bioreactor.

    PubMed

    Wee, Young-Jung; Yun, Jong-Sun; Kang, Kui-Hyun; Ryu, Hwa-Won

    2002-01-01

    Enterococcus faecalis RKY1, a fumarate-reducing bacterium, was immobilized in an asymmetric hollow-fiber bioreactor (HFBR) for the continuous production of succinic acid. The cells were inoculated into the shell side of the HFBR, which was operated in transverse mode. Since the pH values in the HFBR declined during continuous operation to about 5.7, it was necessary to change the feed pH from 7.0 to 8.0 after 24 h of operation in order to enhance production of succinic acid. During continuous operation with a medium containing fumarate and glycerol, the productivity of succinate was 3.0-10.9 g/(L x h) with an initial concentration of 30 g/L of fumarate, 4.9-14.9 g/(L x h) with 50 g/L of fumarate, and 7.2-17.1 g/(L x h) with 80 g/L of fumarate for dilution rates between 0.1 and 0.4 h(-1). The maximum productivity of succinate obtained by the HFBR (17.1 g of succinate/[L x h]) was 1.7 times higher than that of the batch bioconversions (9.9 g of succinate/ [L x h]) with 80 g/L of fumarate. Furthermore, the long-term stability of the HFBR was demonstrated with a continuously efficient production of succinate for more than 15 d (360 h).

  14. Fumaric acid attenuates the eotaxin-1 expression in TNF-α-stimulated fibroblasts by suppressing p38 MAPK-dependent NF-κB signaling.

    PubMed

    Roh, Kyung-Baeg; Jung, Eunsun; Park, Deokhoon; Lee, Jongsung

    2013-08-01

    Eotaxin-1 is a potent chemoattractant for eosinophils and a critical mediator during the development of eosinophilic inflammation. Fumaric acid is an intermediate product of the citric acid cycle, which is source of intracellular energy. Although fumaric acid ameliorates psoriasis and multiple sclerosis, its involvement in eotaxin-1-mediated effects has not been assessed. In this study, we investigated the effects of fumaric acid on eotaxin-1 expression in a mouse fibroblast cell line. We found that fumaric acid significantly inhibited tumor necrosis factor-α (TNF-α-induced eotaxin-1 expression. This fumaric acid effect was mediated through the inhibition of p38 mitogen-activated protein kinase (MAPK)-dependent nuclear factor (NF)-κB signaling. We also found that fumaric acid operates downstream of MEKK3 during TNF-α-induced NF-κB signaling, which upregulated eotaxin-1 expression. In addition, fumaric acid attenuated expression of CC-chemokine receptor 3 (CCR3), an eotaxin-1 receptor, and adhesion molecules that play important roles in eosinophil binding to induce allergic inflammation. Taken together, these findings indicate that inhibiting TNF-α-induced eotaxin-1 expression by fumaric acid occurs primarily through suppression of NF-κB signaling, which is mediated by inhibiting p38 MAPK and suggest that fumaric acid may be used as a complementary treatment option for eotaxin-1-mediated diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. High-level production of recombinant trypsin in transgenic rice cell culture through utilization of an alternative carbon source and recycling system.

    PubMed

    Kim, Nan-Sun; Yu, Hwa-Young; Chung, Nguyen-Duc; Kwon, Tae-Ho; Yang, Moon-Sik

    2014-09-01

    Productivity of recombinant bovine trypsin using a rice amylase 3D promoter has been studied in transgenic rice suspension culture. Alternative carbon sources were added to rice cell suspension cultures in order to improve the production of recombinant bovine trypsin. It was demonstrated that addition of alternative carbon sources such as succinic acid, fumaric acid and malic acid in the culture medium could increase the productivity of recombinant bovine trypsin 3.8-4.3-fold compared to those in the control medium without carbon sources. The highest accumulated trypsin reached 68.2 mg/L on day 5 in the culture medium with 40 mM fumaric acid. The feasibility of repeated use of the cells for recombinant trypsin production was tested in transgenic rice cell suspension culture with the culture medium containing the combination of variable sucrose concentration and 40 mM fumaric acid. Among the used combinations, the combination of 1% sucrose and 40 mM fumaric acid resulted in a yield of up to 53 mg/L five days after incubation. It also increased 31% (W/W) of dry cell weight and improved 43% of cell viability compared to that in control medium without sucrose. Based on these data, recycling of the trypsin production process with repeated 1% sucrose and 40 mM fumaric acid supplying-harvesting cycles was developed in flask scale culture. Recombinant bovine trypsin could be stably produced with a yield of up to 53-39 mg/L per cycle during five recycling cycles. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Effect of sodium lauryl sulfate-fumaric Acid coupled addition on the in vitro rumen fermentation with special regard to methanogenesis.

    PubMed

    Abdl-Rahman, M A; Sawiress, F A R; Abd El-Aty, A M

    2010-01-01

    The aim of the current study was to evaluate the effect of sodium lauryl sulfate-fumaric acid coupled addition on in vitro methangenesis and rumen fermentation. Evaluation was carried out using in vitro gas production technique. Ruminal contents were collected from five steers immediately after slaughtering and used for preparation of inoculums of mixed rumen microorganisms. Rumen fluid was then mixed with the basal diet of steers and used to generate four treatments, negative control (no additives), sodium lauryl sulfate (SLS) treated, fumaric acid treated, and SLS-fumaric acid coupled addition treated. The results revealed that, relative to control, efficiency in reduction of methanogenesis was as follows: coupled addition > SLS-addition > fumaric acid addition. Both SLS-addition and SLS-fumaric acid coupled addition demonstrated a decremental effect on ammonia nitrogen (NH(3)-N), total short chain volatile fatty acids (SCVFAs) concentrations and the amount of substrate degraded, and an increment effect on microbial mass and microbial yield (Y(ATP)). Nevertheless, fumaric acid did not alter any of the previously mentioned parameters but induced a decremental effect on NH(3)-N. Furthermore, both fumaric acid and SLS-fumaric acid coupled addition increased propionate at the expense of acetate and butyrate, while, defaunation increased acetate at the expense of propionate and butyrate. The pH value was decreased by all treatments relative to control, while, cellulase activity did not differ by different treatments. The current study can be promising strategies for suppressing ruminal methane emissions and improving ruminants feed efficiency.

  17. Effect of Sodium Lauryl Sulfate-Fumaric Acid Coupled Addition on the In Vitro Rumen Fermentation with Special Regard to Methanogenesis

    PubMed Central

    Abdl-Rahman, M. A.; Sawiress, F. A. R.; Abd El-Aty, A. M.

    2010-01-01

    The aim of the current study was to evaluate the effect of sodium lauryl sulfate-fumaric acid coupled addition on in vitro methangenesis and rumen fermentation. Evaluation was carried out using in vitro gas production technique. Ruminal contents were collected from five steers immediately after slaughtering and used for preparation of inoculums of mixed rumen microorganisms. Rumen fluid was then mixed with the basal diet of steers and used to generate four treatments, negative control (no additives), sodium lauryl sulfate (SLS) treated, fumaric acid treated, and SLS-fumaric acid coupled addition treated. The results revealed that, relative to control, efficiency in reduction of methanogenesis was as follows: coupled addition > SLS-addition > fumaric acid addition. Both SLS-addition and SLS-fumaric acid coupled addition demonstrated a decremental effect on ammonia nitrogen (NH3–N), total short chain volatile fatty acids (SCVFAs) concentrations and the amount of substrate degraded, and an increment effect on microbial mass and microbial yield (YATP). Nevertheless, fumaric acid did not alter any of the previously mentioned parameters but induced a decremental effect on NH3–N. Furthermore, both fumaric acid and SLS-fumaric acid coupled addition increased propionate at the expense of acetate and butyrate, while, defaunation increased acetate at the expense of propionate and butyrate. The pH value was decreased by all treatments relative to control, while, cellulase activity did not differ by different treatments. The current study can be promising strategies for suppressing ruminal methane emissions and improving ruminants feed efficiency. PMID:20445794

  18. Preparation of hydrolytic liquid from dried distiller's grains with solubles and fumaric acid fermentation by Rhizopus arrhizus RH 7-13.

    PubMed

    Liu, Huan; Yue, Xuemin; Jin, Yuhan; Wang, Meng; Deng, Li; Wang, Fang; Tan, Tianwei

    2017-10-01

    Fumaric acid production from lignocellulosic materials is an alternative chemicals production system. This work investigated the suitable conditions for hydrolysis of dried distiller's grains with solubles (DDGS). The hydrolytic liquid was subsequently used for the production of fumaric acid. After optimizing the hydrolysis conditions, the most suitable concentration of H 2 SO 4 (2%), hydrolysis temperature (120 °C), hydrolysis time (100min) and solid/liquid ratio (1:10) were obtained. The yield of monosaccharides reached 258 mg/g DDGS and 15.88 g/L glucose, 7.53 g/L xylose and 2.35 g/L arabinose were obtained in unprocessed hydrolytic liquid. The furfural inhibitor in the hydrolytic liquid was also detected and the yield of it was reducing progressively in the pretreatment process. The ferment ability of the hydrolytic liquid from DDGS was tested through the process of fumaric acid production by Rhizopus arrhizus RH 7-13. The unprocessed hydrolytic liquid was not appropriate for the fermentation process. The yield of fumaric acid from the concentrated processed hydrolytic liquid reached 18.93 g/L, which was close to the yield of fermenting 80 g/L glucose. This result indicated that the commonly used carbon resource glucose could to some extent be replaced by processed hydrolytic liquid. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. The Growth and Protein Expression of Inflammatory Bowel Disease-Associated Campylobacter concisus Is Affected by the Derivatives of the Food Additive Fumaric Acid.

    PubMed

    Ma, Rena; Liu, Fang; Yap, Soe F; Lee, Hoyul; Leong, Rupert W; Riordan, Stephen M; Grimm, Michael C; Zhang, Li

    2018-01-01

    Inflammatory bowel diseases (IBD) are chronic inflammatory conditions of the gastrointestinal tract with multifactorial etiology. Both dietary factors and the microbe Campylobacter concisus have been found to be associated with the condition. The current study examined the effects of sodium fumarate, a neutralized product of the food additives fumaric acid and monosodium fumarate when in the intestinal environment, on the growth of C. concisus to determine the effects of these food additives on IBD-associated bacterial species. Through culture methods and quantification, it was found that neutralized fumaric acid, neutralized monosodium fumarate, and sodium fumarate increased the growth of C. concisus , with the greatest increase in growth at a concentration of 0.4%. Further examination of 50 C. concisus strains on media with added sodium fumarate showed that greatest growth was also achieved at a concentration of 0.4%. At a concentration of 2% sodium fumarate, all strains examined displayed less growth in comparison with those cultured on media without sodium fumarate. Using mass spectrometry, multiple C. concisus proteins showed significant differential expression when cultured on media with and without 0.4% sodium fumarate. The findings presented suggest that patients with IBD should consider avoiding excessive consumption of foods with fumaric acid or its sodium salts, and that the addition of 0.4% sodium fumarate alone to media may assist in the isolation of C. concisus from clinical samples.

  20. Simultaneous Production and Recovery of Fumaric Acid from Immobilized Rhizopus oryzae with a Rotary Biofilm Contactor and an Adsorption Column

    PubMed Central

    Cao, N.; Du, J.; Gong, C. S.; Tsao, G. T.

    1996-01-01

    An integrated system of simultaneous fermentation-adsorption for the production and recovery of fumaric acid from glucose by Rhizopus oryzae was investigated. The system was constructed such that growing Rhizopus mycelia were self-immobilized on the plastic discs of a rotary biofilm contactor during the nitrogen-rich growth phase. During the nongrowth, production phase, the biofilm was alternately exposed to liquid medium and air upon rotation of the discs in the horizontal fermentation vessel. The product of fermentation, fumaric acid, was removed simultaneously and continuously by a coupled adsorption column, thereby moderating inhibition, enhancing the fermentation rate, and sustaining cell viability. Another beneficial effect of the removal of fumaric acid is release of hydroxyl ions from a polyvinyl pyridine adsorbent into the circulating fermentation broth. This moderates the decrease in pH that would otherwise occur. Polyvinyl pyridine and IRA-900 gave the highest loading for this type of fermentation. This fermentation system is capable of producing fumaric acid with an average yield of 85 g/liter from 100 g of glucose per liter within 20 h under repetitive fed-batch cycles. On a weight yield basis, 91% of the theoretical maximum was obtained with a productivity of 4.25 g/liter/h. This is in contrast to stirred-tank fermentation supplemented with calcium carbonate, whose average weight yield was 65% after 72 h with a productivity of 0.9 g/liter/h. The immobilized reactor was operated repetitively for 2 weeks without loss of biological activity. PMID:16535381

  1. Efficient aspartic acid production by a psychrophile-based simple biocatalyst.

    PubMed

    Tajima, Takahisa; Hamada, Mai; Nakashimada, Yutaka; Kato, Junichi

    2015-10-01

    We previously constructed a Psychrophile-based Simple bioCatalyst (PSCat) reaction system, in which psychrophilic metabolic enzymes are inactivated by heat treatment, and used it here to study the conversion of aspartic acid from fumaric acid mediated by the activity of aspartate ammonia-lyase (aspartase). In Escherichia coli, the biosynthesis of aspartic acid competes with that of L-malic acid produced from fumaric acid by fumarase. In this study, E. coli aspartase was expressed in psychrophilic Shewanella livingstonensis Ac10 heat treated at 50 °C for 15 min. The resultant PSCat could convert fumaric acid to aspartic acid without the formation of L-malic acid because of heat inactivation of psychrophilic fumarase activity. Furthermore, alginate-immobilized PSCat produced high yields of aspartic acid and could be re-used nine times. The results of our study suggest that PSCat can be applied in biotechnological production as a new approach to increase the yield of target compounds.

  2. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central

    2012-01-01

    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  3. Complex effect of lignocellulosic biomass pretreatment with 1-butyl-3-methylimidazolium chloride ionic liquid on various aspects of ethanol and fumaric acid production by immobilized cells within SSF.

    PubMed

    Dotsenko, Anna S; Dotsenko, Gleb S; Senko, Olga V; Stepanov, Nikolay A; Lyagin, Ilya V; Efremenko, Elena N; Gusakov, Alexander V; Zorov, Ivan N; Rubtsova, Ekaterina A

    2018-02-01

    The pretreatment of softwood and hardwood samples (spruce and hornbeam wood) with 1-butyl-3-methylimidazolium chloride ([Bmim]Cl) was undertaken for further simultaneous enzymatic saccharification of renewable non-food lignocellulosic biomass and microbial fermentation of obtained sugars to ethanol and fumaric acid. A multienzyme cocktail based on cellulases and yeast or fungus cells producing ethanol and fumaric acid were the main objects of [Bmim]Cl influence studies. A complex effect of lignocellulosic biomass pretreatment with [Bmim]Cl on various aspects of the process (both action of cellulases and microbial conversion of hydrolysates to target products) was revealed. Positive effects of the pretreatment with [Bmim]Cl included decreasing the lignin content in the biomass, and increasing the effectiveness of enzymatic hydrolysis and microbial transformation of pretreated biomass. Immobilized cells of both yeasts and fungi possessed improved productive characteristics in the biotransformation of biomass pretreated with [Bmim]Cl to ethanol and fumaric acid. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Fumaric acid: an overlooked form of fixed carbon in Arabidopsis and other plant species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chia, D.W.; Yoder, T.J.; Reiter, W.D.

    2000-10-01

    Photoassimilates are used by plants for production of energy, as carbon skeletons and in transport of fixed carbon between different plant organs. Many studies have been devoted to characterizing the factors that. regulate photoassimilate concentrations in different plant species. Most studies examining photoassimilate concentrations in C{sub 3} plants have focused on analyzing starch and soluble sugars. However, work presented here demonstrates that a number of C{sub 3} plants, including the popular model organism Arabidopsis thaliana (L.) Heynh., and agriculturally important plants, such as soybean [Glycine ma (L.) Merr.], contain significant quantities of furnaric acid. In fact, furnaric acid can accumulatemore » to levels of several mg per g fresh weight in A-abidopsis leaves, often exceeding starch and soluble sugar levels. Furnaric acid is a component of the tricarboxylic acid cycle and, like starch and soluble sugars, can be metabolized to yield energy and carbon skeletons for production of other compounds. Fumaric acid concentrations increase with plant age and light intensity in Arabidopsis leaves. Arabidopsis phloem exudates contain significant quantities of fumaric acid, raising the possibility that fumaric acid may function in carbon transport.« less

  5. BG 12: BG 00012, BG 12/Oral Fumarate, FAG-201, second-generation fumarate derivative--Fumapharm/Biogen Idec.

    PubMed

    2005-01-01

    Fumapharm AG has developed a second-generation fumarate (fumaric acid) derivative, BG 12 [BG 00012, FAG-201, BG 12/Oral Fumarate], for the oral treatment of psoriasis. Biogen Idec is currently evaluating the product in clinical trials as an oral treatment for multiple sclerosis (phase II) and psoriasis (phase III) trials.BG 12 has an immunomodulatory mechanism of action. It seems that this product has been developed to reduce the adverse effects associated with a first-generation product containing fumaric acid esters (mixed dimethylfumarate and monoethylfumarate salts), Fumaderm. Fumaderm was approved in Germany in August 1994 and is currently the leading oral systemic therapy for moderate-to-severe psoriasis in Germany. One of the problems associated with Fumaderm capsules has been its gastrointestinal adverse effects (including diarrhoea and nausea). In September 2003, Biogen (now Biogen Idec) licensed exclusive worldwide rights (excluding Germany) from Fumapharm to develop and market BG 12. Biogen plans to collaborate with Fumapharm to accelerate phase III development for psoriasis and the registration programme worldwide. Financial terms of the agreement were not disclosed. Development plans for BG 12 include other autoimmune and inflammatory disorders, such as multiple sclerosis. In November 2003, Biogen and IDEC Pharmaceuticals merged to form Biogen Idec. Fumapharm completed phase II trials of this second-generation fumarate derivative for psoriasis prior to licensing of the product to Biogen, also with positive results.

  6. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Fumaric acid and salts of fumaric acid. 172.350... HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous, magnesium, potassium, and sodium salts may be safely used...

  7. Effects of irradiation and fumaric acid treatment on the inactivation of Listeria monocytogenes and Salmonella typhimurium inoculated on sliced ham

    NASA Astrophysics Data System (ADS)

    Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin

    2011-11-01

    To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham.

  8. Production of Plant Phthalate and its Hydrogenated Derivative from Bio-Based Platform Chemicals.

    PubMed

    Lu, Rui; Lu, Fang; Si, Xiaoqin; Jiang, Huifang; Huang, Qianqian; Yu, Weiqiang; Kong, Xiangtao; Xu, Jie

    2018-04-06

    Direct transformation of bio-based platform chemicals into aromatic dicarboxylic acids and their derivatives, which are widely used for the manufacture of polymers, is of significant importance for the sustainable development of the plastics industry. However, limited successful chemical processes have been reported. This study concerns a sustainable route for the production of phthalate and its hydrogenated derivative from bio-based malic acid and erythritol. The key Diels-Alder reaction is applied to build a substituted cyclohexene structure. The dehydration reaction of malic acid affords fumaric acid with 96.6 % yield, which could be used as the dienophile, and 1,3-butadiene generated in situ through erythritol deoxydehydration serves as the diene. Starting from erythritol and dibutyl fumarate, a 74.3 % yield of dibutyl trans-4-cyclohexene-1,2-dicarboxylate is obtained. The palladium-catalyzed dehydrogenation of the cycloadduct gives a 77.8 % yield of dibutyl phthalate. Dibutyl trans-cyclohexane-1,2-dicarboxylate could be formed in nearly 100 % yield under mild conditions by hydrogenation of the cycloadduct. Furthermore, fumaric acid and fumarate, with trans configurations, were found to be better dienophiles for this Diels-Alder reaction than maleic acid and maleate, with cis configuration, based on the experimental and computational results. This new route will pave the way for the production of environmental friendly plastic materials from plants. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. An Iterative O-Methyltransferase Catalyzes 1,11-Dimethylation of Aspergillus fumigatus Fumaric Acid Amides.

    PubMed

    Kalb, Daniel; Heinekamp, Thorsten; Schieferdecker, Sebastian; Nett, Markus; Brakhage, Axel A; Hoffmeister, Dirk

    2016-10-04

    S-adenosyl-l-methionine (SAM)-dependent methyltransfer is a common biosynthetic strategy to modify natural products. We investigated the previously uncharacterized Aspergillus fumigatus methyltransferase FtpM, which is encoded next to the bimodular fumaric acid amide synthetase FtpA. Structure elucidation of two new A. fumigatus natural products, the 1,11-dimethyl esters of fumaryl-l-tyrosine and fumaryl-l-phenylalanine, together with ftpM gene disruption suggested that FtpM catalyzes iterative methylation. Final evidence that a single enzyme repeatedly acts on fumaric acid amides came from an in vitro biochemical investigation with recombinantly produced FtpM. Size-exclusion chromatography indicated that this methyltransferase is active as a dimer. As ftpA and ftpM homologues are found clustered in other fungi, we expect our work will help to identify and annotate natural product biosynthesis genes in various species. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Studies on potential effects of fumaric acid on rumen microbial fermentation, methane production and microbial community.

    PubMed

    Riede, Susanne; Boguhn, Jeannette; Breves, Gerhard

    2013-01-01

    The greenhouse gas methane (CH4) contributes substantially to global climate change. As a potential approach to decrease ruminal methanogenesis, the effects of different dosages of fumaric acid (FA) on ruminal microbial metabolism and on the microbial community (archaea, bacteria) were studied using a rumen simulation technique (RUSITEC). FA acts as alternative hydrogen acceptor diverting 2H from methanogenesis of archaea towards propionate formation of bacteria. Three identical trials were conducted with 12 fermentation vessels over a period of 14 days. In each trial, four fermentation vessels were assigned to one of the three treatment groups differing in FA dosage: low fumaric acid (LFA), high fumaric acid (HFA) and without FA (control). FA was continuously infused with the buffer. Grass silage and concentrate served as substrate. FA led to decreases in pH and to higher production rates of total short chain fatty acids (SCFA) mediated by increases in propionate for LFA of 1.69 mmol d(-1) and in propionate and acetate production for HFA of 4.49 and 1.10 mmol d(-1), respectively. Concentrations of NH3-N, microbial crude protein synthesis, their efficiency, degradation of crude nutrients and detergent fibre fraction were unchanged. Total gas and CH4 production were not affected by FA. Effects of FA on structure of microbial community by means of single strand conformation polymorphism (SSCP) analyses could not be detected. Given the observed increase in propionate production and the unaffected CH4 production it can be supposed that the availability of reduction equivalents like 2H was not limited by the addition of FA in this study. It has to be concluded from the present study that the application of FA is not an appropriate approach to decrease the ruminal CH4 production.

  11. Immobilization of Escherichia coli Cells Containing Aspartase Activity with Polyurethane and Its Application for l-Aspartic Acid Production

    PubMed Central

    Fusee, Murray C.; Swann, Wayne E.; Calton, Gary J.

    1981-01-01

    Whole cells of Escherichia coli containing aspartase activity were immobilized by mixing a cell suspension with a liquid isocyanate-capped polyurethane prepolymer (Hypol). The immobilized cell preparation was used to convert ammonium fumarate to l-aspartic acid. Properties of the immobilized E. coli cells containing aspartase were investigated with a batch reactor. A 1.67-fold increase in the l-aspartic acid production rate was observed at 37°C as compared to 25°C operating temperature. The pH optimum was broad, ranging from 8.5 to 9.2. Increasing the concentration of ammonium fumarate to 1.5 M from 1.0 M negatively affected the reaction rate. l-Aspartic acid was produced at an average rate of 2.18 × 10−4 mol/min per g (wet weight) of immobilized E. coli cells with a 37°C substrate solution consisting of 1.0 M ammonium fumarate with 1 mM Mg2+ (pH 9.0). PMID:16345865

  12. Application of acetate, lactate, and fumarate as electron donors in microbial fuel cell

    NASA Astrophysics Data System (ADS)

    Vasyliv, Oresta M.; Bilyy, Oleksandr I.; Ferensovych, Yaroslav P.; Hnatush, Svitlana O.

    2013-09-01

    Microbial fuel cells (MFCs) are devices that use bacteria as the catalysts to oxidize organic and inorganic matter and generate current. Up to now, several classes of extracellular electron transfer mechanisms have been elucidated for various microorganisms. Shewanellaceae and Geobacteraceae families include the most of model exoelectrogenic microorganisms. Desulfuromonas acetoxidans bacterium inhabits aquatic sedimental sulfur-containing environments and is philogenetically close to representatives of Geobacteraceae family. Two chamber microbial fuel cell (0.3 l volume) was constructed with application of D. acetoxidans IMV B-7384 as anode biocatalyst. Acetic, lactic and fumaric acids were separately applied as organic electron donors for bacterial growth in constructed MFC. Bacterial cultivation in MFC was held during twenty days. Lactate oxidation caused electric power production with the highest value up to 0.071 mW on 64 hour of D. acetoxidans IMV B-7384 growth. Addition of acetic and fumaric acids into bacterial growth medium caused maximal power production up to 0.075 and 0.074 mW respectively on the 40 hour of their growth. Increasing of incubation time up to twentieth day caused decrease of generated electric power till 0.018 mW, 0.042 mW and 0.047 mW under usage of lactic, acetic and fumaric acids respectively by investigated bacteria. Power generation by D. acetoxidans IMV B-7384 was more stabile and durable under application of acetic and fumaric acids as electron donors in constructed MFC, than under addition of lactic acid in the same concentration into the growth medium.

  13. Bioeconomy Initiative at MBI International

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kleff, Susanne, Ph.D.

    Di-carboxylic acids have the potential to replace petrochemicals used in the polymer industry (Werpy and Petersen, 2004). MBI developed a process for the production of succinic acid using a proprietary organism. During this work MBI assessed the feasibility to produce other carboxylic acids either using A. succinogenes or other organisms. The development of recombinant A. succinogenes strain derivatives for a mono-carboxylic acid through over-expression of enzymatic activities was successful. Fermentations achieved titers of 58 g/L for this organic acid. Recombinant strains that produced the same acid, but a different stereoisomer, reached titers of 10 g/L. Attempts to increase the titersmore » for this isomer as well as other organic acids were unsuccessful. MBI is looking for commercial partners to pursue the development of recombinant A. succinogenes strains for the production of other organic acids. Attempts to develop recombinant strains of A. succinogenes for fumaric acid production through introduction of various antisense RNA constructs were unsuccessful. Alternative suitable organisms were evaluated and Rhizopus oryzae, a natural fumaric acid producer with potential for process improvements, was selected. A novel fermentation and one-step recovery process was developed that allowed capture of IP, produced titers of >80 g/L with a productivity of 1.8 g/L-h and 57% (g/g glucose) yield. The process was scaled to 2000 L pilot scale. The economic analysis projected a production cost of 72 c/lb. Recycling and re-use of the base was demonstrated and incorporated into the process. The ability of the organism to produce fumaric acid from other carbon sources and biomass hydrolysate was demonstrated. The production of other organic acids was evaluated and techno-economic de-risking roadmap documents were prepared.« less

  14. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... special dietary use, when the use is consistent with good nutrition practice. ...

  15. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... as a source of iron in foods for special dietary use, when the use is consistent with good nutrition...

  16. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... as a source of iron in foods for special dietary use, when the use is consistent with good nutrition...

  17. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric...

  18. Preservation of acidified cucumbers with a combination of fumaric acid and cinnamaldehyde that target lactic acid bacteria and yeasts

    USDA-ARS?s Scientific Manuscript database

    The naturally occurring compound, fumaric acid, was evaluated as a potential preservative for the long-term storage of cucumbers. Fumaric acid inhibited growth of lactic acid bacteria (LAB) in an acidified cucumber juice medium model system resembling conditions that could allow preservation of cucu...

  19. 27 CFR 24.182 - Use of acid to correct natural deficiencies.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Use of acid to correct...

  20. 27 CFR 24.182 - Use of acid to correct natural deficiencies.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Use of acid to correct...

  1. 27 CFR 24.182 - Use of acid to correct natural deficiencies.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Use of acid to correct...

  2. 27 CFR 24.182 - Use of acid to correct natural deficiencies.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Use of acid to correct...

  3. Rumen microbial response in production of CLA and methane to safflower oil in association with fish oil or/and fumarate.

    PubMed

    Li, Xiang Z; Long, Rui J; Yan, Chang G; Lee, Hong G; Kim, Young J; Song, Man K

    2011-06-01

    Supplementation effect of fish oil and/or fumarate on production of conjugated linoleic acid (CLA) and methane by rumen microbes was examined when incubated with safflower oil. One hundred and twenty milligrams of safflower oil (SO), safflower oil with 24 mg fish oil (SOFO), safflower oil with 24 mmol/L fumarate (SOFA), or safflower oil with 24 mg fish oil and 24 mmol/L fumarate (SOFOFA) were added to the 90 mL culture solution. The culture solution was also made without any supplements (control). The SOFA and SOFOFA increased pH and propionate (C3) compared to other treatments from 3 h incubation time. An accumulated amount of total methane (CH(4) ) for 12 h incubation was decreased by all the supplements compared to control. The concentrations of c9,t11CLA for all the incubation times were increased in the treatments of SOFO, SOFA and SOFOFA compared to SO. The highest concentration of c9,t11CLA was observed from SOFOFA among all the treatments at all incubation times. Overall data indicate that supplementation of combined fumarate and/or fish oil when incubated with safflower oil could depress CH(4) generation and increase production of C(3) and CLA under the condition of current in vitro study. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

  4. Overexpression of a C4-dicarboxylate transporter is the key for rerouting citric acid to C4-dicarboxylic acid production in Aspergillus carbonarius.

    PubMed

    Yang, Lei; Christakou, Eleni; Vang, Jesper; Lübeck, Mette; Lübeck, Peter Stephensen

    2017-03-14

    C 4 -dicarboxylic acids, including malic acid, fumaric acid and succinic acid, are valuable organic acids that can be produced and secreted by a number of microorganisms. Previous studies on organic acid production by Aspergillus carbonarius, which is capable of producing high amounts of citric acid from varieties carbon sources, have revealed its potential as a fungal cell factory. Earlier attempts to reroute citric acid production into C 4 -dicarboxylic acids have been with limited success. In this study, a glucose oxidase deficient strain of A. carbonarius was used as the parental strain to overexpress a native C 4 -dicarboxylate transporter and the gene frd encoding fumarate reductase from Trypanosoma brucei individually and in combination. Impacts of the introduced genetic modifications on organic acid production were investigated in a defined medium and in a hydrolysate of wheat straw containing high concentrations of glucose and xylose. In the defined medium, overexpression of the C 4 -dicarboxylate transporter alone and in combination with the frd gene significantly increased the production of C 4 -dicarboxylic acids and reduced the accumulation of citric acid, whereas expression of the frd gene alone did not result in any significant change of organic acid production profile. In the wheat straw hydrolysate after 9 days of cultivation, similar results were obtained as in the defined medium. High amounts of malic acid and succinic acid were produced by the same strains. This study demonstrates that the key to change the citric acid production into production of C 4 -dicarboxylic acids in A. carbonarius is the C 4 -dicarboxylate transporter. Furthermore it shows that the C 4 -dicarboxylic acid production by A. carbonarius can be further increased via metabolic engineering and also shows the potential of A. carbonarius to utilize lignocellulosic biomass as substrates for C 4 -dicarboxylic acid production.

  5. Growth and Metabolism of Lactic Acid Bacteria during and after Malolactic Fermentation of Wines at Different pH

    PubMed Central

    Davis, C. R.; Wibowo, D. J.; Lee, T. H.; Fleet, G. H.

    1986-01-01

    Commercially produced red wines were adjusted to pH 3.0, 3.2, 3.5, 3.7, or 4.0 and examined during and after malolactic fermentation for growth of lactic acid bacteria and changes in the concentrations of carbohydrates, organic acids, amino acids, and acetaldehyde. With one exception, Leuconostoc oenos conducted the malolactic fermentation in all wines and was the only species to occur in wines at pH below 3.5. Malolactic fermentation by L. oenos was accompanied by degradation of malic, citric, and fumaric acids and production of lactic and acetic acids. The concentrations of arginine, histidine, and acetaldehyde also decreased at this stage, but the behavior of hexose and pentose sugars was complicated by other factors. Pediococcus parvulus conducted the malolactic fermentation in one wine containing 72 mg of total sulfur dioxide per liter. Fumaric and citric acids were not degraded during this malolactic fermentation, but hexose sugars were metabolized. P. parvulus and species of Lactobacillus grew after malolactic fermentation in wines with pH adjusted above 3.5. This growth was accompanied by the utilization of wine sugars and production of lactic and acetic acids. PMID:16347015

  6. Protein and metabolic engineering for the production of organic acids.

    PubMed

    Liu, Jingjing; Li, Jianghua; Shin, Hyun-Dong; Liu, Long; Du, Guocheng; Chen, Jian

    2017-09-01

    Organic acids are natural metabolites of living organisms. They have been widely applied in the food, pharmaceutical, and bio-based materials industries. In recent years, biotechnological routes to organic acids production from renewable raw materials have been regarded as very promising approaches. In this review, we provide an overview of current developments in the production of organic acids using protein and metabolic engineering strategies. The organic acids include propionic acid, pyruvate, itaconic acid, succinic acid, fumaric acid, malic acid and citric acid. We also expect that rapid developments in the fields of systems biology and synthetic biology will accelerate protein and metabolic engineering for microbial organic acid production in the future. Copyright © 2017. Published by Elsevier Ltd.

  7. Intrinsic Anaerobic Bioremediation of Hydrocarbons in Contaminated Subsurface Plumes and Marine Sediments

    NASA Astrophysics Data System (ADS)

    Nanny, M. A.; Nanny, M. A.; Suflita, J. M.; Suflita, J. M.; Davidova, I.; Kropp, K.; Caldwell, M.; Philp, R.; Gieg, L.; Rios-Hernandez, L. A.

    2001-05-01

    In recent years, several classes of petroleum hydrocarbons contaminating subsurface and marine environments have been found susceptible to anaerobic biodegradation using novel mechanisms entirely distinct from aerobic metabolic pathways. For example, the anaerobic decay of toluene can be initiated by the addition of the aryl methyl group to the double bond of fumarate, resulting in a benzylsuccinic acid metabolite. Our work has shown that an analogous mechanism also occurs with ethylbenzene and the xylene isomers, yielding 3-phenyl-1,2-butane dicarboxylic acid and methylbenzylsuccinic acid, respectively. Moreover, these metabolites have been detected in contaminated environments. Most recently, we have identified metabolites resulting from the initial attack of H26- or D26-n-dodecane during degradation by a sulfate-reducing bacterial culture. Using GC-MS, these metabolites were identified as fatty acids that result from C-H or C-D addition across the double bond of fumarate to give dodecylsuccinic acids in which all 26 protons or deuteriums of the parent alkane were retained. Further, when this enrichment culture was challenged with hexane or decane, hexylsuccinic acid or decylsuccinic acid were identified as resulting metabolites. Similarly, the study of an ethylcyclopentane-degrading sulfate-reducing enrichment produced a metabolite, which is consistent with the addition of fumarate to the parent substrate. These novel anaerobic addition products are characterized by similar, distinctive mass spectral (MS) features (ions specific to the succinic acid portion of the molecule) that can potentially be used to probe contaminated environments for evidence of intrinsic remediation of hydrocarbons. Indeed, analyses of water extracts from two gas condensate-contaminated sites resulted in the tentative detection of alkyl- and cycloalkylsuccinic acids ranging from C3 to C9, including ethylcyclopentyl-succinic acid. In water extracts collected from an area underlying a petroleum production plant, MS profiles consistent with the addition products of methylcycloalkenes were observed. This work helps attests to: 1) the extrapolatability of laboratory results to the field, 2) the unifying metabolic features for the anaerobic destruction of diverse types of hydrocarbons, and 3) how this information can be used to assess the intrinsic bioremediation processes in petroleum-contaminated environments.

  8. Preservation of acidified cucumbers with a natural preservative combination of fumaric acid and allyl isothiocyanate that target lactic acid bacteria and yeasts

    USDA-ARS?s Scientific Manuscript database

    Without the addition of preservative compounds cucumbers acidified with 150 mM acetic acid with pH adjusted to 3.5 typically undergo fermentation by lactic acid bacteria. Fumaric acid (20 mM) inhibited growth of Lactobacillus plantarum and the lactic acid bacteria present on fresh cucumbers, but sp...

  9. Structural investigation of the cocrystal formed between 5-fluorocytosine and fumaric acid based on vibrational spectroscopic technique

    NASA Astrophysics Data System (ADS)

    Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan

    2017-05-01

    The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91 THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87 THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation.

  10. Metabolic engineering in the biotechnological production of organic acids in the tricarboxylic acid cycle of microorganisms: Advances and prospects.

    PubMed

    Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian

    2015-11-01

    Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Aerobic growth of campylobacter in media supplemented with a-ketoglutaric, lactic, and/or fumaric acids

    USDA-ARS?s Scientific Manuscript database

    A study was conducted to examine the ability of Campylobacter spp. to grow aerobically in media supplemented with selected organic acids. Basal broth media composed of tryptose, yeast extract, and a mineral-vitamin solution was supplemented with a-ketoglutaric, lactic, and/or fumaric acids. The fina...

  12. Structural investigation of the cocrystal formed between 5-fluorocytosine and fumaric acid based on vibrational spectroscopic technique.

    PubMed

    Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan

    2017-05-05

    The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Dihydrolipoyl dehydrogenase as a potential UVB target in skin epidermis; using an integrated approach of label-free quantitative proteomics and targeted metabolite analysis.

    PubMed

    Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou

    2015-03-18

    Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.

  14. Anaerobic Fermentation for Production of Carboxylic Acids as Bulk Chemicals from Renewable Biomass.

    PubMed

    Wang, Jufang; Lin, Meng; Xu, Mengmeng; Yang, Shang-Tian

    Biomass represents an abundant carbon-neutral renewable resource which can be converted to bulk chemicals to replace petrochemicals. Carboxylic acids have wide applications in the chemical, food, and pharmaceutical industries. This chapter provides an overview of recent advances and challenges in the industrial production of various types of carboxylic acids, including short-chain fatty acids (acetic, propionic, butyric), hydroxy acids (lactic, 3-hydroxypropionic), dicarboxylic acids (succinic, malic, fumaric, itaconic, adipic, muconic, glucaric), and others (acrylic, citric, gluconic, pyruvic) by anaerobic fermentation. For economic production of these carboxylic acids as bulk chemicals, the fermentation process must have a sufficiently high product titer, productivity and yield, and low impurity acid byproducts to compete with their petrochemical counterparts. System metabolic engineering offers the tools needed to develop novel strains that can meet these process requirements for converting biomass feedstock to the desirable product.

  15. Simultaneous determination of furfural and its degradation products, furoic acid and maleic acid, in transformer oil by the reversed-phase vortex-assisted liquid-liquid microextraction followed by high-performance liquid chromatography.

    PubMed

    Wang, Yifan; Li, Haiyan; Yang, Zhen; Zhang, Weijie; Hua, Jia

    2017-12-01

    To explore why the use of furfural as a transformer oil-paper insulation aging characteristic is problematic in real world application, we developed a method for the simultaneous determination of furfural, furoic acid, and maleic acid in transformer oil by reversed-phase vortex-assisted liquid-liquid microextraction combined with high-performance liquid chromatography. The conditions for the proposed method were optimized, and the obtained extract can be directly analyzed by high-performance liquid chromatography. The detection limits (signal-to-noise ratio = 3) of the method ranged from 1.0 to 4.6 μg/L, the enrichment factors for furfural, furoic acid, maleic acid, and fumaric acid were 4.6, 25.1, 15.6, and 17.5, respectively, and the recovery rates for three analytes (fumaric acid was undetected) range from 82.1 to 106.2%. The contents of furfural, furoic acid, and maleic acid resulted from accelerated aging of transformer insulation oil-paper were measured using the present method for the first time, and the aging samples were analyzed by liquid chromatography with mass spectrometry for the identification of furoic acid and maleic acid in the aging transformer oil samples. Using the optimal method, the target products of samples at different aging time were tracked and measured. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Using organic acids to control subacute ruminal acidosis and fermentation in feedlot cattle fed a high-grain diet.

    PubMed

    Vyas, D; Beauchemin, K A; Koenig, K M

    2015-08-01

    The objective of this study was to determine whether supplementing organic acids can prevent incidences of subacute ruminal acidosis (SARA) in beef heifers fed a diet consisting of 8% barley silage and 92% barley grain-based concentrate (DM basis). Ten ruminally cannulated Hereford crossbred heifers (484 ± 25 kg BW) were used in a replicated 5 × 5 Latin square design with 14-d periods including 10 d for dietary adaptation and 4 d for measurements. Dietary treatments included no supplementation (Control), low fumaric acid (61 g/d), high fumaric acid (125 g/d), low malic acid (59 g/d), and high malic acid (134 g/d). Organic acid supplementation had no effect on DMI ( = 0.77). Similarly, no effects were observed on mean ( = 0.74), minimum ( = 0.64), and maximum ( = 0.27) ruminal pH measured continuously for 48 h. Moreover, area under the curve for pH thresholds 6.2 ( = 0.97), 5.8 ( = 0.66), 5.5 ( = 0.55), and 5.2 ( = 0.93) was similar for all treatments. However, malic acid supplementation lowered the amount of time that ruminal pH was <6.2 compared with the Control ( = 0.02) and fumaric acid treatments ( < 0.01). No effects were observed on total VFA concentrations with organic acid supplementation ( = 0.98) compared with the Control, but greater total VFA concentrations were observed with fumaric acid compared with the malic acid treatments ( = 0.02). The population of total culturable bacteria 3 h after feeding was reduced with supplemental malic acid compared with the Control ( = 0.03) and fumaric acid treatments ( = 0.03). However, no effects were observed with organic acid supplementation on lactic acid-utilizing bacteria ( = 0.59). In conclusion, under the conditions of the present study, organic acid supplementation did not have any significant effects on ruminal fermentation parameters compared with the Control and were not effective in preventing SARA in beef cattle fed high-grain diets.

  17. Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

    PubMed Central

    Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

    2012-01-01

    ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

  18. Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition.

    PubMed

    Sciacovelli, Marco; Gonçalves, Emanuel; Johnson, Timothy Isaac; Zecchini, Vincent Roberto; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Drubbel, Alizee Vercauteren; Theobald, Sebastian Julian; Abbo, Sandra Riekje; Tran, Maxine Gia Binh; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Maher, Eamonn Richard; Maxwell, Patrick Henry; Saez-Rodriguez, Julio; Frezza, Christian

    2016-08-31

    Mutations of the tricarboxylic acid cycle enzyme fumarate hydratase cause hereditary leiomyomatosis and renal cell cancer. Fumarate hydratase-deficient renal cancers are highly aggressive and metastasize even when small, leading to a very poor clinical outcome. Fumarate, a small molecule metabolite that accumulates in fumarate hydratase-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite. Fumarate has been shown to inhibit α-ketoglutarate-dependent dioxygenases that are involved in DNA and histone demethylation. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of fumarate hydratase and the subsequent accumulation of fumarate in mouse and human cells elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster mir-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of fumarate hydratase-proficient cells with cell-permeable fumarate. Loss of fumarate hydratase is associated with suppression of miR-200 and the EMT signature in renal cancer and is associated with poor clinical outcome. These results imply that loss of fumarate hydratase and fumarate accumulation contribute to the aggressive features of fumarate hydratase-deficient tumours.

  19. Metabolically based liver damage pathophysiology in patients with urea cycle disorders - A new hypothesis.

    PubMed

    Ivanovski, Ivan; Ješić, Miloš; Ivanovski, Ana; Garavelli, Livia; Ivanovski, Petar

    2017-11-28

    The underlying pathophysiology of liver dysfunction in urea cycle disorders (UCDs) is still largely elusive. There is some evidence that the accumulation of urea cycle (UC) intermediates are toxic for hepatocyte mitochondria. It is possible that liver injury is directly caused by the toxicity of ammonia. The rarity of UCDs, the lack of checking of iron level in these patients, superficial knowledge of UC and an underestimation of the metabolic role of fumaric acid, are the main reasons that are responsible for the incomprehension of the mechanism of liver injury in patients suffering from UCDs. Owing to our routine clinical practice to screen for iron overload in severely ill neonates, with the focus on the newborns suffering from acute liver failure, we report a case of citrullinemia with neonatal liver failure and high blood parameters of iron overload. We hypothesize that the key is in the decreased-deficient fumaric acid production in the course of UC in UCDs that causes several sequentially intertwined metabolic disturbances with final result of liver iron overload. The presented hypothesis could be easily tested by examining the patients suffering from UCDs, for liver iron overload. This could be easily performed in countries with a high population and comprehensive national register for inborn errors of metabolism. Providing the hypothesis is correct, neonatal liver damage in patients having UCD can be prevented by the supplementation of pregnant women with fumaric or succinic acid, prepared in the form of iron supplementation pills. After birth, liver damage in patients having UCDs can be prevented by supplementation of these patients with zinc fumarate or zinc succinylate, as well.

  20. Growth of Campylobacter incubated aerobically in fumarate-pyruvate media or media supplemented with dairy, meat, or soy extracts and peptones.

    PubMed

    Hinton, Arthur

    2016-09-01

    The ability of Campylobacter to grow aerobically in media supplemented with fumarate-pyruvate or with dairy, meat, or soy extracts or peptones was examined. Optical densities (OD) of Campylobacter cultured in basal media, media supplemented with fumarate-pyruvate or with 1.0, 2.5, 5.0, or 7.5% beef extract was measured. Growth was also compared in media supplemented with other extracts or peptones. Finally, cfu/mL of Campylobacter recovered from basal media or media supplemented with fumarate-pyruvate, casamino acids, beef extract, soytone, or beef extract and soytone was determined. Results indicated that OD of cultures grown in media supplemented with fumarate-pyruvate or with 5.0 or 7.5% beef extract were higher than OD of isolates grown in basal media or media supplemented with lower concentrations of beef extract. Highest OD were produced by isolates grown in media supplemented with beef extract, peptone from meat, polypeptone, proteose peptone, or soytone. Also, more cfu/mL were recovered from media with fumarate-pyruvate, beef extract, soytone, or beef extract-soytone than from basal media or media with casamino acids. Findings indicate that media supplemented with organic acids, vitamins, and minerals and media supplemented with extracts or peptones containing these metabolites can support aerobic growth of Campylobacter. Published by Elsevier Ltd.

  1. Role of HCA₂ (GPR109A) in nicotinic acid and fumaric acid ester-induced effects on the skin.

    PubMed

    Hanson, Julien; Gille, Andreas; Offermanns, Stefan

    2012-10-01

    Nicotinic acid (NA) and fumaric acid esters (FAE) such as monomethyl fumarate or dimethyl fumarate are drugs that elicit a cutaneous reaction called flushing as a side effect. NA is used to reduce progression of atherosclerosis through its anti-dyslipidemic activity and lipid-independent mechanisms involving immune cells, whereas FAE are used to treat psoriasis via largely unknown mechanisms. Both, NA and FAE, induce flushing by the activation of the G-protein-coupled receptor (GPCR) Hydroxy-carboxylic acid receptor 2 (HCA₂, GPR109A) in cells of the epidermis. While the wanted effects of NA are at least in part also mediated by HCA₂, it is currently not clear whether this receptor is also involved in the anti-psoriatic effects of FAE. The HCA₂-mediated flushing response to these drugs involves the formation of prostaglandins D₂ and E₂ by Langerhans cells and keratinocytes via COX-1 in Langerhans cells and COX-2 in keratinocytes. This review summarizes recent progress in the understanding of the mechanisms underlying HCA₂-mediated flushing, describes strategies to mitigate it and discusses the potential link between flushing, HCA₂ and the anti-psoriatic effects of FAE. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Stimulation of Erwinia sp. fumarase and aspartase synthesis by changing medium components.

    PubMed

    Bagdasaryan, Z N; Aleksanyan, G A; Mirzoyan, A M; Roseiro, J C; Bagdasaryan, S N

    2005-05-01

    The optimal concentrations of nutrient medium components, aeration conditions, and pH providing for maximum biomass yields, as well as fumarase and L-aspartase activities, during submerged cultivation of Erwinia sp. were determined. The data showed that different concentrations of carbon source (molasses) and pH of the nutrient medium were required to reach the maximum fumarase and L-aspartase activities. Calculations performed by application of the additive lattice model suggested that the combination of these optimized factors would result in 3.2-, 3.4-, and 3.8-fold increases as compared to the experimental means in Erwinia sp. biomass, and L-aspartase and fumarase activities, respectively. The conditions of the fumaric acid biotransformations into L-malic and L-aspartic acids were optimized on the basis of intact Erwinia sp. cells, a fumarase and L-aspartase producer. In the cases of fumarate transformation into L-malic acid and of fumarate transformation into L-aspartic acids, fumarase and L-aspartase activities increased 1.5- and 1.7-fold, respectively. The experimental data were consistent with these estimates to 80% accuracy. In comparison with the additive lattice model, the application of polynomial nonlinear model allowed the between-factor relations to be considered and analyzed, which resulted in 1.1-, 1.27-, and 1.1-fold increases in Erwinia sp. biomass and fumarase and L-aspartase activities for the case of cultivation. In the case of fumarate transformation into L-malic acid, this model demonstrated a 1.7-fold increase in fumarase activity, whereas during fumarate transformation into L-aspartic acid no significant change in aspartase activity was observed.

  3. Carotenoids, but not vitamin A, improve iron uptake and ferritin synthesis by Caco-2 cells from ferrous fumarate and NaFe-EDTA.

    PubMed

    García-Casal, María N; Leets, Irene

    2014-04-01

    Due to the high prevalence of iron and vitamin A deficiencies and to the controversy about the role of vitamin A and carotenoids in iron absorption, the objectives of this study were to evaluate the following: (1) the effect of a molar excess of vitamin A as well as the role of tannic acid on iron uptake by Caco-2 cells; (2) iron uptake and ferritin synthesis in presence of carotenoids without pro-vitamin A activity: lycopene, lutein, and zeaxantin; and (3) iron uptake and ferritin synthesis from ferrous fumarate and NaFe-EDTA. Cells were incubated 1 h at 37 °C in PBS pH 5.5, containing (59) Fe and different iron compounds. Vitamin A, ferrous fumarate, β-carotene, lycopene, lutein, zeaxantin, and tannic acid were added to evaluate uptake. Ferritin synthesis was measured 24 h after uptake experiments. Vitamin A had no effect on iron uptake by Caco-2 cells, and was significantly lower from NaFe-EDTA than from ferrous fumarate (15.2 ± 2.5 compared with 52.5 ± 8.3 pmol Fe/mg cell protein, respectively). Carotenoids increase uptake up to 50% from fumarate and up to 300% from NaFe-EDTA, since absorption from this compound is low when administered alone. We conclude the following: (1) There was no effect of vitamin A on iron uptake and ferritin synthesis by Caco-2cells. (2) Carotenoids significantly increased iron uptake from ferrous fumarate and NaFe-EDTA, and were capable of partially overcoming the inhibition produced by tannic acid. (3) Iron uptake by Caco-2 cell from NaFe-EDTA was significantly lower compared to other iron compounds, although carotenoids increased and tannic acid inhibited iron uptake comparably to ferrous fumarate. © 2014 Institute of Food Technologists®

  4. Identification and characterization of a novel fumarase gene by metagenome expression cloning from marine microorganisms

    PubMed Central

    2010-01-01

    Background Fumarase catalyzes the reversible hydration of fumarate to L-malate and is a key enzyme in the tricarboxylic acid (TCA) cycle and in amino acid metabolism. Fumarase is also used for the industrial production of L-malate from the substrate fumarate. Thermostable and high-activity fumarases from organisms that inhabit extreme environments may have great potential in industry, biotechnology, and basic research. The marine environment is highly complex and considered one of the main reservoirs of microbial diversity on the planet. However, most of the microorganisms are inaccessible in nature and are not easily cultivated in the laboratory. Metagenomic approaches provide a powerful tool to isolate and identify enzymes with novel biocatalytic activities for various biotechnological applications. Results A plasmid metagenomic library was constructed from uncultivated marine microorganisms within marine water samples. Through sequence-based screening of the DNA library, a gene encoding a novel fumarase (named FumF) was isolated. Amino acid sequence analysis revealed that the FumF protein shared the greatest homology with Class II fumarate hydratases from Bacteroides sp. 2_1_33B and Parabacteroides distasonis ATCC 8503 (26% identical and 43% similar). The putative fumarase gene was subcloned into pETBlue-2 vector and expressed in E. coli BL21(DE3)pLysS. The recombinant protein was purified to homogeneity. Functional characterization by high performance liquid chromatography confirmed that the recombinant FumF protein catalyzed the hydration of fumarate to form L-malate. The maximum activity for FumF protein occurred at pH 8.5 and 55°C in 5 mM Mg2+. The enzyme showed higher affinity and catalytic efficiency under optimal reaction conditions: Km= 0.48 mM, Vmax = 827 μM/min/mg, and kcat/Km = 1900 mM/s. Conclusions We isolated a novel fumarase gene, fumF, from a sequence-based screen of a plasmid metagenomic library from uncultivated marine microorganisms. The properties of FumF protein may be ideal for the industrial production of L-malate under higher temperature conditions. The identification of FumF underscores the potential of marine metagenome screening for novel biomolecules. PMID:21092234

  5. Solid-state cocrystal formation between acyclovir and fumaric acid: Terahertz and Raman vibrational spectroscopic studies.

    PubMed

    Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong

    2017-11-05

    The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8C7N1H27 and the carboxyl group COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Solid-state cocrystal formation between acyclovir and fumaric acid: Terahertz and Raman vibrational spectroscopic studies

    NASA Astrophysics Data System (ADS)

    Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong

    2017-11-01

    The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10 THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8dbnd C7sbnd N1sbnd H27 and the carboxyl group sbnd COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34 THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation.

  7. Combined metabolomic and correlation networks analyses reveal fumarase insufficiency altered amino acid metabolism.

    PubMed

    Hou, Entai; Li, Xian; Liu, Zerong; Zhang, Fuchang; Tian, Zhongmin

    2018-04-01

    Fumarase catalyzes the interconversion of fumarate and l-malate in the tricarboxylic acid cycle. Fumarase insufficiencies were associated with increased levels of fumarate, decreased levels of malate and exacerbated salt-induced hypertension. To gain insights into the metabolism profiles induced by fumarase insufficiency and identify key regulatory metabolites, we applied a GC-MS based metabolomics platform coupled with a network approach to analyze fumarase insufficient human umbilical vein endothelial cells (HUVEC) and negative controls. A total of 24 altered metabolites involved in seven metabolic pathways were identified as significantly altered, and enriched for the biological module of amino acids metabolism. In addition, Pearson correlation network analysis revealed that fumaric acid, l-malic acid, l-aspartic acid, glycine and l-glutamic acid were hub metabolites according to Pagerank based on their three centrality indices. Alanine aminotransferase and glutamate dehydrogenase activities increased significantly in fumarase deficiency HUVEC. These results confirmed that fumarase insufficiency altered amino acid metabolism. The combination of metabolomics and network methods would provide another perspective on expounding the molecular mechanism at metabolomics level. Copyright © 2017 John Wiley & Sons, Ltd.

  8. Utilization of Electrically Reduced Neutral Red by Actinobacillus succinogenes: Physiological Function of Neutral Red in Membrane-Driven Fumarate Reduction and Energy Conservation

    PubMed Central

    Park, D. H.; Zeikus, J. G.

    1999-01-01

    Neutral red (NR) functioned as an electronophore or electron channel enabling either cells or membranes purified from Actinobacillus succinogenes to drive electron transfer and proton translocation by coupling fumarate reduction to succinate production. Electrically reduced NR, unlike methyl or benzyl viologen, bound to cell membranes, was not toxic, and chemically reduced NAD. The cell membrane of A. succinogenes contained high levels of benzyl viologen-linked hydrogenase (12.2 U), fumarate reductase (13.1 U), and diaphorase (109.7 U) activities. Fumarate reductase (24.5 U) displayed the highest activity with NR as the electron carrier, whereas hydrogenase (1.1 U) and diaphorase (0.8 U) did not. Proton translocation by whole cells was dependent on either electrically reduced NR or H2 as the electron donor and on the fumarate concentration. During the growth of Actinobacillus on glucose plus electrically reduced NR in an electrochemical bioreactor system versus on glucose alone, electrically reduced NR enhanced glucose consumption, growth, and succinate production by about 20% while it decreased acetate production by about 50%. The rate of fumarate reduction to succinate by purified membranes was twofold higher with electrically reduced NR than with hydrogen as the electron donor. The addition of 2-(n-heptyl)-4-hydroxyquinoline N-oxide to whole cells or purified membranes inhibited succinate production from H2 plus fumarate but not from electrically reduced NR plus fumarate. Thus, NR appears to replace the function of menaquinone in the fumarate reductase complex, and it enables A. succinogenes to utilize electricity as a significant source of metabolic reducing power. PMID:10198002

  9. Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.

    PubMed

    Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R

    2017-03-06

    Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.

  10. Fumaric Acid Esters Do Not Reduce Inflammatory NF-κB/p65 Nuclear Translocation, ICAM-1 Expression and T-Cell Adhesiveness of Human Brain Microvascular Endothelial Cells.

    PubMed

    Haarmann, Axel; Nehen, Mathias; Deiß, Annika; Buttmann, Mathias

    2015-08-13

    Dimethyl fumarate (DMF) is approved for disease-modifying treatment of patients with relapsing-remitting multiple sclerosis. Animal experiments suggested that part of its therapeutic effect is due to a reduction of T-cell infiltration of the central nervous system (CNS) by uncertain mechanisms. Here we evaluated whether DMF and its primary metabolite monomethyl fumarate (MMF) modulate pro-inflammatory intracellular signaling and T-cell adhesiveness of nonimmortalized single donor human brain microvascular endothelial cells at low passages. Neither DMF nor MMF at concentrations of 10 or 50 µM blocked the IL-1β-induced nuclear translocation of NF-κB/p65, whereas the higher concentration of DMF inhibited the nuclear entry of p65 in human umbilical vein endothelium cultured in parallel. DMF and MMF also did not alter the IL-1β-stimulated activation of p38 MAPK in brain endothelium. Furthermore, neither DMF nor MMF reduced the basal or IL-1β-inducible expression of ICAM-1. In accordance, both fumaric acid esters did not reduce the adhesion of activated Jurkat T cells to brain endothelium under basal or inflammatory conditions. Therefore, brain endothelial cells probably do not directly mediate a potential blocking effect of fumaric acid esters on the inflammatory infiltration of the CNS by T cells.

  11. Multi-organ sarcoidosis treatment with fumaric acid esters: a case report and review of the literature.

    PubMed

    Zouboulis, Christos C; Lippert, Undine; Karagiannidis, Ioannis

    2014-01-01

    Sarcoidosis is a rare, systemic disease that is characterized by the formation of granulomas in various organs, including the skin. As the etiology remains unknown, the treatment of sarcoidosis is challenging. We present a 47-year-old female patient with progressive, multi-organ sarcoidosis who had a complete clinical improvement of the skin lesions, a moderate reduction in pulmonary opacities on chest X-ray, a marked subjective improvement in general status and pulmonary efficiency and a marked reduction in serum angiotensin-converting enzyme and soluble interleukin-2 receptor after 6 months of therapy with fumaric acid esters. The present case and similar reports in the literature highlight the probable efficacy of fumaric acid esters in the treatment of sarcoidosis and other non-infectious, granulomatous diseases. © 2014 S. Karger AG, Basel.

  12. Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques

    NASA Astrophysics Data System (ADS)

    Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

    2016-01-01

    As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques.

  13. Development of an Amperometric Biosensor Platform for the Combined Determination of L-Malic, Fumaric, and L-Aspartic Acid.

    PubMed

    Röhlen, Désirée L; Pilas, Johanna; Schöning, Michael J; Selmer, Thorsten

    2017-10-01

    Three amperometric biosensors have been developed for the detection of L-malic acid, fumaric acid, and L -aspartic acid, all based on the combination of a malate-specific dehydrogenase (MDH, EC 1.1.1.37) and diaphorase (DIA, EC 1.8.1.4). The stepwise expansion of the malate platform with the enzymes fumarate hydratase (FH, EC 4.2.1.2) and aspartate ammonia-lyase (ASPA, EC 4.3.1.1) resulted in multi-enzyme reaction cascades and, thus, augmentation of the substrate spectrum of the sensors. Electrochemical measurements were carried out in presence of the cofactor β-nicotinamide adenine dinucleotide (NAD + ) and the redox mediator hexacyanoferrate (III) (HCFIII). The amperometric detection is mediated by oxidation of hexacyanoferrate (II) (HCFII) at an applied potential of + 0.3 V vs. Ag/AgCl. For each biosensor, optimum working conditions were defined by adjustment of cofactor concentrations, buffer pH, and immobilization procedure. Under these improved conditions, amperometric responses were linear up to 3.0 mM for L-malate and fumarate, respectively, with a corresponding sensitivity of 0.7 μA mM -1 (L-malate biosensor) and 0.4 μA mM -1 (fumarate biosensor). The L-aspartate detection system displayed a linear range of 1.0-10.0 mM with a sensitivity of 0.09 μA mM -1 . The sensor characteristics suggest that the developed platform provides a promising method for the detection and differentiation of the three substrates.

  14. A fermentative approach towards optimizing directed biosynthesis of fumaric acid by Rhizopus oryzae 1526 utilizing apple industry waste biomass.

    PubMed

    Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

    2015-12-01

    The present research account deals with the bioproduction of fumaric acid (FA) from apple pomace ultrafiltration sludge (APUS) and apple pomace (AP) through fermentation. The filamentous fungus Rhizopus oryzae 1526 was used as a biocatalyst and its morphological impact on FA production was analysed in detail. For submerged fermentation, 40 g L(-1) of total solids concentration of APUS, pH 6.0, 30 °C, 200 rpm flask shaking speed and 72 h of incubation were found to be optimum for FA production (25.2 ± 1.0 g L(-1), 0.350 g (L(-1) h(-1))). Broth viscosity (cP), residual reducing sugar (g L(-1)) and ethanol (g L(-1)) produced as by-product, were also analysed. Plastic trays were used for solid state fermentation and at optimized level of moisture and incubation period, 52 ± 2.67 g FA per kg dry weight of AP was obtained. Changes in the total phenolic content (mg g(-1) dry weight of AP) were monitored at regular intervals. Utilization of APUS and AP for the directed synthesis of the high-value platform chemical FA by the fungal strain R. oryzae 1526 was an excellent display of fungal physiological and morphological control over a fermentative product. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  15. Metabolic changes associated with tumor metastasis, part 2: Mitochondria, lipid and amino acid metabolism.

    PubMed

    Porporato, Paolo E; Payen, Valéry L; Baselet, Bjorn; Sonveaux, Pierre

    2016-04-01

    Metabolic alterations are a hallmark of cancer controlling tumor progression and metastasis. Among the various metabolic phenotypes encountered in tumors, this review focuses on the contributions of mitochondria, lipid and amino acid metabolism to the metastatic process. Tumor cells require functional mitochondria to grow, proliferate and metastasize, but shifts in mitochondrial activities confer pro-metastatic traits encompassing increased production of mitochondrial reactive oxygen species (mtROS), enhanced resistance to apoptosis and the increased or de novo production of metabolic intermediates of the TCA cycle behaving as oncometabolites, including succinate, fumarate, and D-2-hydroxyglutarate that control energy production, biosynthesis and the redox state. Lipid metabolism and the metabolism of amino acids, such as glutamine, glutamate and proline are also currently emerging as focal control points of cancer metastasis.

  16. Recent advances in the biomedical applications of fumaric acid and its ester derivatives: The multifaceted alternative therapeutics.

    PubMed

    Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

    2016-04-01

    Several lines of evidence have demonstrated the potential biomedical applications of fumaric acid (FA) and its ester derivatives against many human disease conditions. Fumaric acid esters (FAEs) have been licensed for the systemic treatment of the immune-mediated disease psoriasis. Biogen Idec Inc. announced about the safety and efficacy of the formulation FAE (BG-12) for treating RRMS (relapsing-remitting multiple sclerosis). Another FAE formulation DMF (dimethyl fumarate) was found to be capable of reduction in inflammatory cardiac conditions, such as autoimmune myocarditis and ischemia and reperfusion. DMF has also been reported to be effective as a potential neuroprotectant against the HIV-associated neurocognitive disorders (HAND). Many in vivo studies carried out on rat and mice models indicated inhibitory effects of fumaric acid on carcinogenesis of different origins. Moreover, FAEs has emerged as an important matrix ingredient in the fabrication of biodegradable scaffolds for tissue engineering applications. Drug delivery vehicles composed of FAEs have shown promising results in delivering some leading drug molecules. Apart from these specific applications and findings, many more studies on FAEs have revealed new therapeutic potentials with the scope of clinical applications. However, until now, this scattered vital information has not been written into a collective account and analyzed for minute details. The aim of this paper is to review the advancement made in the biomedical application of FA and FAEs and to focus on the clinical investigation and molecular interpretation of the beneficial effects of FA and FAEs. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  17. Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques.

    PubMed

    Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

    2016-01-15

    As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition

    PubMed Central

    Sciacovelli, Marco; Gonçalves, Emanuel; Isaac Johnson, Timothy; Roberto Zecchini, Vincent; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Vercauteren Drubbel, Alizee; Julian Theobald, Sebastian; Abbo, Sandra; Tran, Maxine; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Richard Maher, Eamonn; Henry Maxwell, Patrick; Saez-Rodriguez, Julio; Frezza, Christian

    2016-01-01

    Mutations of the tricarboxylic acid cycle (TCA cycle) enzyme fumarate hydratase (FH) cause Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)1. FH-deficient renal cancers are highly aggressive and metastasise even when small, leading to an abysmal clinical outcome2. Fumarate, a small molecule metabolite that accumulates in FH-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite3. Fumarate was shown to inhibit α-ketoglutarate (aKG)-dependent dioxygenases involved in DNA and histone demethylation4,5. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of FH and the subsequent accumulation of fumarate elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis6. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster6 miR-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of FH-proficient cells with cell-permeable fumarate. Loss of FH is associated with suppression of miR-200 and EMT signature in renal cancer patients, and is associated with poor clinical outcome. These results imply that loss of FH and fumarate accumulation contribute to the aggressive features of FH-deficient tumours. PMID:27580029

  19. DMF, but not other fumarates, inhibits NF-κB activity in vitro in an Nrf2-independent manner.

    PubMed

    Gillard, Geoffrey O; Collette, Brian; Anderson, John; Chao, Jianhua; Scannevin, Robert H; Huss, David J; Fontenot, Jason D

    2015-06-15

    Fumarate-containing pharmaceuticals are potent therapeutic agents that influence multiple cellular pathways. Despite proven clinical efficacy, there is a significant lack of data that directly defines the molecular mechanisms of action of related, yet distinct fumarate compounds. We systematically compared the impact of dimethyl fumarate (DMF), monomethyl fumarate (MMF) and a mixture of monoethyl fumarate salts (Ca(++), Mg(++), Zn(++); MEF) on defined cellular responses. We demonstrate that DMF inhibited NF-κB-driven cytokine production and nuclear translocation of p65 and p52 in an Nrf2-independent manner. Equivalent doses of MMF and MEF did not affect NF-κB signaling. These results highlight a key difference in the biological impact of related, yet distinct fumarate compounds. Copyright © 2015. Published by Elsevier B.V.

  20. Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle 1

    PubMed Central

    Vanlerberghe, Greg C.; Horsey, Anne K.; Weger, Harold G.; Turpin, David H.

    1989-01-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH4+ in the dark under anaerobic conditions. Addition of NH4+ to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO2 efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H14CO3− to anaerobic cells assimilating NH4+ results in the incorporation of radiolabel into the α-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH4+ addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply α-ketoglutarate for glutamate production. During dark aerobic NH4+ assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH4+ assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH4+ assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity. PMID:16667215

  1. Bioproduction of L-Aspartic Acid and Cinnamic Acid by L-Aspartate Ammonia Lyase from Pseudomonas aeruginosa PAO1.

    PubMed

    Patel, Arti T; Akhani, Rekha C; Patel, Manisha J; Dedania, Samir R; Patel, Darshan H

    2017-06-01

    Aspartase (L-aspartate ammonia lyase, EC 4.3.1.1) catalyses the reversible amination and deamination of L-aspartic acid to fumaric acid which can be used to produce important biochemical. In this study, we have explored the characteristics of aspartase from Pseudomonas aeruginosa PAO1 (PA-AspA). To overproduce PA-AspA, the 1425-bp gene was introduced in Escherichia coli BL21 and purified. A 51.0-kDa protein was observed as a homogenous purified protein on SDS-PAGE. The enzyme was optimally active at pH 8.0 and 35 °C. PA-AspA has retained 56% activity after 7 days of incubation at 35 °C, which displays the hyperthermostablility characteristics of the enzyme. PA-AspA is activated in the presence of metal ions and Mg2+ is found to be most effective. Among the substrates tested for specificity of PA-AspA, L-phenylalanine (38.35 ± 2.68) showed the highest specific activity followed by L-aspartic acid (31.21 ± 3.31) and fumarate (5.42 ± 2.94). K m values for L-phenylalanine, L-aspartic acid and fumarate were 1.71 mM, 0.346 μM and 2 M, respectively. The catalytic efficiency (k cat /K m ) for L-aspartic acid (14.18 s -1  mM -1 ) was higher than that for L-phenylalanine (4.65 s -1  mM -1 ). For bioconversion, from an initial concentration of 1000 mM of fumarate and 30 mM of L-phenylalanine, PA-AspA was found to convert 395.31 μM L-aspartic acid and 3.47 mM cinnamic acid, respectively.

  2. Synthesis of Poly(Propylene Fumarate)

    PubMed Central

    Kasper, F. Kurtis; Tanahashi, Kazuhiro; Fisher, John P.; Mikos, Antonios G.

    2010-01-01

    This protocol describes the synthesis of 500 – 4000 Da poly(propylene fumarate) by a two-step reaction of diethyl fumarate and propylene glycol through a bis(hydroxypropyl) fumarate diester intermediate. Purified PPF can be covalently crosslinked to form degradable polymer networks, which have been widely explored for biomedical applications. The properties of crosslinked PPF networks depend upon the molecular properties of the constituent polymer, such as the molecular weight. The purity of the reactants and the exclusion of water from the reaction system are of utmost importance in the generation of high-molecular-weight PPF products. Additionally, the reaction time and temperature influence the molecular weight of the PPF product. The expected time required to complete this protocol is 3 d. PMID:19325548

  3. Liquid Hydrogenation of Maleic Anhydride with Pd/C Catalyst at Low Pressure and Temperature in Batch Reactor.

    PubMed

    Kim, Ji Sun; Baek, Jae Ho; Ryu, Young Bok; Hong, Seong-Soo; Lee, Man Sig

    2015-01-01

    Succinic acid (SA) produced from hydrogenation of maleic anhydride (MAN) is used widely in manufacturing of pharmaceuticals, agrochemicals, surfactants and detergent, green solvent and biodegradable plastic. In this study, we performed that liquid hydrogenation of MAN to SA with 5 wt% Pd supported on activated carbon (Pd/C) at low pressure and temperature. The synthesis of SA was performed in aqueous solution while varying temperature, pressure, catalytic amount and agitation speed. We confirmed that the composition of the products consisting of SA, maleic acid (MA), fumaric acid (FA) and malic acid (MLA) depends on the process. The catalytic characteristics were analyzed by TGA, TEM.

  4. Value of acid metabolic products in identification of certain corynebacteria.

    PubMed Central

    Reddy, C A; Kao, M

    1978-01-01

    Acid metabolic products of 23 strains of human and animal pathogenic corynebacteria, representing eight different species, were determined by gas chromatography. The results showed that the species examined were metabolically heterogeneous and could be presumptively identified based on the acid products produced. Corynebacterium equi did not produce any acids; C. renale produced lactate; and C. pyogenes produced major amounts of lactate, variable amounts of acetate, and minor amounts of succinate and pyruvate. C. kutscheri produced propionate and lactate as major products and pyruvate and oxalacetate as minor products. C. diphtheriae and C. pseudotuberculosis produced major amounts of propionate, acetate, and formate. In addition, C. pseudotuberculosis produced major amounts of pyruvate and minor amounts of succinate, lactate, and oxalacetate, whereas C. diphtheriae strains produced minor but variable amounts of lactate, succinate, fumarate, pyruvate, and oxalacetate. C. bovis produced aicd products similar to those of C. pyogenes but was readily distinguishable from the latter by the lack of hemolysis on blood agar, colony morphology, catalase reaction, and biochemicals. C. suis characteristically produced major amounts of ethanol, acetate, and formate and minor amounts of lactate and succinate but no propionate. PMID:96126

  5. Salt formation improved the properties of a candidate drug during early formulation development.

    PubMed

    Sigfridsson, Kalle; Ahlqvist, Matti; Lindsjö, Martin; Paulsson, Stefan

    2018-07-30

    The purpose of this study was to investigate if AZD5329, a dual neurokinin NK1/2 receptor antagonist, is a suitable candidate for further development as an oral immediate release (IR) solid dosage form as a final product. The neutral form of AZD5329 has only been isolated as amorphous material. In order to search for a solid material with improved physical and chemical stability and more suitable solid-state properties, a salt screen was performed. Crystalline material of a maleic acid salt and a fumaric acid salt of AZD5329 were obtained. X-ray powder diffractiometry, thermogravimetric analysis, differential scanning calorimetry and dynamic vapor sorption were used to investigate the physicochemical characteristics of the two salts. The fumarate salt of AZD5329 is anhydrous, the crystallization is reproducible and the hygroscopicity is acceptable. Early polymorphism assessment work using slurry technique did not reveal any better crystal modification or crystallinity for the fumarate salt. For the maleate salt, the form isolated originally was found to be a solvate, but an anhydrous form was found in later experiments; by suspension in water or acetone, by drying of the solvate to 100-120 °C or by subjecting the solvate form to conditions of 40 °C/75%RH for 3 months. The dissolution behavior and the chemical stability (in aqueous solutions, formulations and solid-state) of both salts were also studied and found to be satisfactory. The compound displays sensitivity to low pH, and the salt of the maleic acid, which is the stronger acid, shows more degradation during stability studies, in line with this observation. The presented data indicate that the substance fulfils basic requirements for further development of an IR dosage form, based on the characterization on crystalline salts of AZD5329. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. The effect of change in pH on the solubility of iron bis-glycinate chelate and other iron compounds.

    PubMed

    García-Casal, M N; Layrisse, M

    2001-03-01

    The effect of a pH change from 2 to 6 was tested on the solubility of ferrous sulfate, ferrous fumarate, iron bis-glycine chelate (Ferrochel) and sodium-iron ethylenediaminetetraacetic acid (NaFeEDTA). It was found that at pH 2 ferrous sulfate, Ferrochel and NaFeEDTA were completely soluble and only 75% of iron from ferrous fumarate was soluble. When pH was raised to 6, iron from amino acid chelate and NaFeEDTA remained completely soluble while solubility from ferrous sulfate and ferrous fumarate decreased 64 and 74%, respectively compared to the amount of iron initially soluble at pH 2. These results suggest that iron solubility from iron bis-glycine chelate and NaFeEDTA is not affected by pH changes within the ranges tested, probably because iron remained associated to the respective compounds.

  7. Insights into the glycyl radical enzyme active site of benzylsuccinate synthase: a computational study.

    PubMed

    Bharadwaj, Vivek S; Dean, Anthony M; Maupin, C Mark

    2013-08-21

    The fumarate addition reaction, catalyzed by the enzyme benzylsuccinate synthase (BSS), is considered to be one of the most intriguing and energetically challenging reactions in biology. BSS belongs to the glycyl radical enzyme family and catalyzes the fumarate addition reaction, which enables microorganisms to utilize hydrocarbons as an energy source under anaerobic conditions. Unfortunately, the extreme sensitivity of the glycyl radical to oxygen has hampered the structural and kinetic characterization of BSS, thereby limiting our knowledge on this enzyme. To enhance our molecular-level understanding of BSS, a computational approach involving homology modeling, docking studies, and molecular dynamics (MD) simulations has been used to deduce the structure of BSS's catalytic subunit (BSSα) and illuminate the molecular basis for the fumarate addition reaction. We have identified two conserved and distinct binding pockets at the BSSα active site: a hydrophobic pocket for toluene binding and a polar pocket for fumaric acid binding. Subsequent dynamical and energetic evaluations have identified Glu509, Ser827, Leu390, and Phe384 as active site residues critical for substrate binding. The orientation of substrates at the active site observed in MD simulations is consistent with experimental observations of the syn addition of toluene to fumaric acid. It is also found that substrate binding tightens the active site and restricts the conformational flexibility of the thiyl radical, leading to hydrogen transfer distances conducive to the proposed reaction mechanism. The stability of substrates at the active site and the occurrence of feasible radical transfer distances between the thiyl radical, substrates, and the active site glycine indicate a substrate-assisted radical transfer pathway governing fumarate addition.

  8. Anaerobic carbon metabolism by the tricarboxylic acid cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanlerberghe, G.C.; Horsey, A.K.; Weger, H.G.

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH{sub 4}{sup +} in the dark under anaerobic conditions. Addition of NH{sub 4}{sup +} to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO{sub 2} efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenspyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H{sup 14}CO{sub 3}{sup {minus}} to anaerobic cells assimilating NH{sub 4}{sup +} results in the incorporation of radiolabel into the {alpha}-carboxyl carbon of glutamic acid. Incorporationmore » of radiolabel into glutamic acid is not simply a short-term phenomenon following NH{sub 4}{sup +} addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply {alpha}ketoglutarate for glutamate production. During dark aerobic NH{sub 4}{sup +} assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH{sub 4}{sup +} assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH{sub 4}{sup +} assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.« less

  9. Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle : Evidence for Partial Oxidative and Reductive Pathways during Dark Ammonium Assimilation.

    PubMed

    Vanlerberghe, G C; Horsey, A K; Weger, H G; Turpin, D H

    1989-12-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH(4) (+) in the dark under anaerobic conditions. Addition of NH(4) (+) to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO(2) efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H(14)CO(3) (-) to anaerobic cells assimilating NH(4) (+) results in the incorporation of radiolabel into the alpha-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH(4) (+) addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply alpha-ketoglutarate for glutamate production. During dark aerobic NH(4) (+) assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH(4) (+) assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH(4) (+) assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.

  10. Absolute configuration of a chiral CHD group via neutron diffraction: confirmation of the absolute stereochemistry of the enzymatic formation of malic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bau, R.; Brewer, I.; Chiang, M.Y.

    Neutron diffraction has been used to monitor the absolute stereochemistry of an enzymatic reaction. (-)(2S)malic-3-d acid was prepared by the action of fumarase on fumaric acid in D/sub 2/O. After a large number of cations were screened, it was found that (+)(R)..cap alpha..-phenylethylamine forms the large crystals necessary for a neutron diffraction analysis. The subsequent structure determination showed that (+)(R)..cap alpha..-phenylethylammonium (-)(2S)malate-3-d has an absolute configuration of R at the CHD site. This result confirms the absolute stereochemistry of fumarate-to-malate transformation as catalyzed by the enzyme fumarase.

  11. Influence of the composition of the cellulolytic flora on the development of hydrogenotrophic microorganisms, hydrogen utilization, and methane production in the rumens of gnotobiotically reared lambs.

    PubMed

    Chaucheyras-Durand, Frédérique; Masséglia, Sébastien; Fonty, Gérard; Forano, Evelyne

    2010-12-01

    We investigated the influence of the composition of the fibrolytic microbial community on the development and activities of hydrogen-utilizing microorganisms in the rumens of gnotobiotically reared lambs. Two groups of lambs were reared. The first group was inoculated with Fibrobacter succinogenes, a non-H(2)-producing species, as the main cellulolytic organism, and the second group was inoculated with Ruminococcus albus, Ruminococcus flavefaciens, and anaerobic fungi that produce hydrogen. The development of hydrogenotrophic bacterial communities, i.e., acetogens, fumarate and sulfate reducers, was monitored in the absence of methanogens and after inoculation of methanogens. Hydrogen production and utilization and methane production were measured in rumen content samples incubated in vitro in the presence of exogenous hydrogen (supplemented with fumarate or not supplemented with fumarate) or in the presence of ground alfalfa hay as a degradable substrate. Our results show that methane production was clearly reduced when the dominant fibrolytic species was a non-H(2)-producing species, such as Fibrobacter succinogenes, without significantly impairing fiber degradation and fermentations in the rumen. The addition of fumarate to the rumen contents stimulated H(2) utilization only by the ruminal microbiota inoculated with F. succinogenes, suggesting that these communities could play an important role in fumarate reduction in vivo.

  12. Top Value Added Chemicals From Biomass: I. Results of Screening for Potential Candidates from Sugars and Synthesis Gas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Werpy, Todd A.; Holladay, John E.; White, James F.

    2004-11-01

    This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol. In addition to building blocks, themore » report outlines the central technical barriers that are preventing the widespread use of biomass for products and chemicals.« less

  13. 21 CFR 177.2420 - Polyester resins, cross-linked.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use Only... this section: (1) Acids: Adipic. Fatty acids, and dimers thereof, from natural sources. Fumaric...

  14. 21 CFR 177.2420 - Polyester resins, cross-linked.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use Only... this section: (1) Acids: Adipic. Fatty acids, and dimers thereof, from natural sources. Fumaric...

  15. Addition of fumaric acid and sodium benzoate as an alternative method to achieve a 5-log reduction of Escherichia coli O157:H7 populations in apple cider.

    PubMed

    Comes, Justin E; Beelman, Robert B

    2002-03-01

    A study was conducted to develop a preservative treatment capable of the Food and Drug Administration-mandated 5-log reduction of Escherichia coli O157:H7 populations in apple cider. Unpreserved apple cider was treated with generally recognized as safe acidulants and preservatives before inoculation with E. coli O157:H7 in test tubes and subjected to mild heat treatments (25, 35, and 45 degrees C) followed by refrigerated storage (4 degrees C). Fumaric acid had significant (P < 0.05) bactericidal effect when added to cider at 0.10% (wt/vol) and adjusted to pH 3.3, but citric and malic acid had no effect. Strong linear correlation (R2 = 0.96) between increasing undissociated fumaric acid concentrations and increasing log reductions of E. coli O157:H7 in apple cider indicated the undissociated acid to be the bactericidal form. The treatment that achieved the 5-log reduction in three commercial ciders was the addition of fumaric acid (0.15%, wt/vol) and sodium benzoate (0.05%, wt/vol) followed by holding at 25 degrees C for 6 h before 24 h of refrigeration at 4 degrees C. Subsequent experiments revealed that the same preservatives added to cider in flasks resulted in a more than 5-log reduction in less than 5 and 2 h when held at 25 and 35 degrees C, respectively. The treatment also significantly (P < 0.05) reduced total aerobic counts in commercial ciders to populations less than those of pasteurized and raw ciders from the same source (after 5 and 21 days of refrigerated storage at 4 degrees C, respectively). Sensory evaluation of the same ciders revealed that consumers found the preservative-treated cider to be acceptable.

  16. Insights into the Anaerobic Biodegradation Pathway of n-Alkanes in Oil Reservoirs by Detection of Signature Metabolites

    PubMed Central

    Bian, Xin-Yu; Maurice Mbadinga, Serge; Liu, Yi-Fan; Yang, Shi-Zhong; Liu, Jin-Feng; Ye, Ru-Qiang; Gu, Ji-Dong; Mu, Bo-Zhong

    2015-01-01

    Anaerobic degradation of alkanes in hydrocarbon-rich environments has been documented and different degradation strategies proposed, of which the most encountered one is fumarate addition mechanism, generating alkylsuccinates as specific biomarkers. However, little is known about the mechanisms of anaerobic degradation of alkanes in oil reservoirs, due to low concentrations of signature metabolites and lack of mass spectral characteristics to allow identification. In this work, we used a multidisciplinary approach combining metabolite profiling and selective gene assays to establish the biodegradation mechanism of alkanes in oil reservoirs. A total of twelve production fluids from three different oil reservoirs were collected and treated with alkali; organic acids were extracted, derivatized with ethanol to form ethyl esters and determined using GC-MS analysis. Collectively, signature metabolite alkylsuccinates of parent compounds from C1 to C8 together with their (putative) downstream metabolites were detected from these samples. Additionally, metabolites indicative of the anaerobic degradation of mono- and poly-aromatic hydrocarbons (2-benzylsuccinate, naphthoate, 5,6,7,8-tetrahydro-naphthoate) were also observed. The detection of alkylsuccinates and genes encoding for alkylsuccinate synthase shows that anaerobic degradation of alkanes via fumarate addition occurs in oil reservoirs. This work provides strong evidence on the in situ anaerobic biodegradation mechanisms of hydrocarbons by fumarate addition. PMID:25966798

  17. 21 CFR 150.141 - Artificially sweetened fruit jelly.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

  18. 21 CFR 150.141 - Artificially sweetened fruit jelly.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

  19. 21 CFR 150.141 - Artificially sweetened fruit jelly.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

  20. 21 CFR 150.141 - Artificially sweetened fruit jelly.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

  1. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  2. Production of succinic Acid from citric Acid and related acids by lactobacillus strains.

    PubMed

    Kaneuchi, C; Seki, M; Komagata, K

    1988-12-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, alpha-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli.

  3. Shoe contact dermatitis from dimethyl fumarate: clinical manifestations, patch test results, chemical analysis, and source of exposure.

    PubMed

    Giménez-Arnau, Ana; Silvestre, Juan Francisco; Mercader, Pedro; De la Cuadra, Jesus; Ballester, Isabel; Gallardo, Fernando; Pujol, Ramón M; Zimerson, Erik; Bruze, Magnus

    2009-11-01

    The methyl ester form of fumaric acid named dimethyl fumarate (DMF) is an effective mould-growth inhibitor. Its irritating and sensitizing properties were demonstrated in animal models. Recently, DMF has been identified as responsible for furniture contact dermatitis in Europe. To describe the clinical manifestations, patch test results, shoe chemical analysis, and source of exposure to DMF-induced shoe contact dermatitis. Patients with suspected shoe contact dermatitis were studied in compliance with the Declaration of Helsinki. Patch test results obtained with their own shoe and the European baseline series, acrylates and fumaric acid esters (FAE), were recorded according to international guidelines. The content of DMF in shoes was analysed with gas chromatography and mass spectrometry. Acute, immediate irritant contact dermatitis and non-immunological contact urticaria were observed in eight adults and two children, respectively. All the adult patients studied developed a delayed sensitization demonstrated by a positive patch testing to DMF < or = 0.1% in pet. Cross-reactivity with other FAEs and acrylates was observed. At least 12 different shoe brands were investigated. The chemical analysis from the available shoes showed the presence of DMF. DMF in shoes was responsible for severe contact dermatitis. Global preventive measures for avoiding contact with DMF are necessary.

  4. Molecular docking and molecular dynamics simulations of fumarate hydratase and its mutant H235N complexed with pyromellitic acid and citrate.

    PubMed

    Subasri, S; Chaudhary, Santosh Kumar; Sekar, K; Kesherwani, Manish; Velmurugan, D

    2017-12-01

    Fumarase catalyzes the reversible, stereospecific hydration/dehydration of fumarate to L-malate during the Kreb's cycle. In the crystal structure of the tetrameric fumarase, it was found that some of the active site residues S145, T147, N188 G364 and H235 had water-mediated hydrogen bonding interactions with pyromellitic acid and citrate which help to the protonation state for the conversion of fumarate to malate. When His 235 is mutated with Asn (H235N), water-mediated interactions were lost due to the shifting of active site water molecule by 0.7 Å away. Molecular dynamics (MD) simulations were also carried out by NAMD and analyzed using Assisted Model Building with Energy Refinement (AMBER) program to better understand the conformational stability and other aspects during the binding of pyromellitic acid and citrate with native and mutant FH. The role of hydrogen bonds and hydrophobic interactions was also analyzed. The present study confirms that the H235N mutation has a major effect on the catalytic activity of fumarase which is evident from the biochemical studies.

  5. Copper Efflux Is Induced during Anaerobic Amino Acid Limitation in Escherichia coli To Protect Iron-Sulfur Cluster Enzymes and Biogenesis

    PubMed Central

    Fung, Danny Ka Chun; Lau, Wai Yin; Chan, Wing Tat

    2013-01-01

    Adaptation to changing environments is essential to bacterial physiology. Here we report a unique role of the copper homeostasis system in adapting Escherichia coli to its host-relevant environment of anaerobiosis coupled with amino acid limitation. We found that expression of the copper/silver efflux pump CusCFBA was significantly upregulated during anaerobic amino acid limitation in E. coli without the supplement of exogenous copper. Inductively coupled plasma mass spectrometry analysis of the total intracellular copper content combined with transcriptional assay of the PcusC-lacZ reporter in the presence of specific Cu(I) chelators indicated that anaerobic amino acid limitation led to the accumulation of free Cu(I) in the periplasmic space of E. coli, resulting in Cu(I) toxicity. Cells lacking cusCFBA and another copper transporter, copA, under this condition displayed growth defects and reduced ATP production during fumarate respiration. Ectopic expression of the Fe-S cluster enzyme fumarate reductase (Frd), or supplementation with amino acids whose biosynthesis involves Fe-S cluster enzymes, rescued the poor growth of ΔcusC cells. Yet, Cu(I) treatment did not impair the Frd activity in vitro. Further studies revealed that the alternative Fe-S cluster biogenesis system Suf was induced during the anaerobic amino acid limitation, and ΔcusC enhanced this upregulation, indicating the impairment of the Fe-S cluster assembly machinery and the increased Fe-S cluster demands under this condition. Taken together, we conclude that the copper efflux system CusCFBA is induced during anaerobic amino acid limitation to protect Fe-S cluster enzymes and biogenesis from the endogenously originated Cu(I) toxicity, thus facilitating the physiological adaptation of E. coli. PMID:23893112

  6. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

  7. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

  8. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

  9. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

  10. Escherichia coli strains engineered for homofermentative production of D-lactic acid from glycerol.

    PubMed

    Mazumdar, Suman; Clomburg, James M; Gonzalez, Ramon

    2010-07-01

    Given its availability and low price, glycerol has become an ideal feedstock for the production of fuels and chemicals. We recently reported the pathways mediating the metabolism of glycerol in Escherichia coli under anaerobic and microaerobic conditions. In this work, we engineer E. coli for the efficient conversion of glycerol to d-lactic acid (d-lactate), a negligible product of glycerol metabolism in wild-type strains. A homofermentative route for d-lactate production was engineered by overexpressing pathways involved in the conversion of glycerol to this product and blocking those leading to the synthesis of competing by-products. The former included the overexpression of the enzymes involved in the conversion of glycerol to glycolytic intermediates (GlpK-GlpD and GldA-DHAK pathways) and the synthesis of d-lactate from pyruvate (d-lactate dehydrogenase). On the other hand, the synthesis of succinate, acetate, and ethanol was minimized through two strategies: (i) inactivation of pyruvate-formate lyase (DeltapflB) and fumarate reductase (DeltafrdA) (strain LA01) and (ii) inactivation of fumarate reductase (DeltafrdA), phosphate acetyltransferase (Deltapta), and alcohol/acetaldehyde dehydrogenase (DeltaadhE) (strain LA02). A mutation that blocked the aerobic d-lactate dehydrogenase (Deltadld) also was introduced in both LA01 and LA02 to prevent the utilization of d-lactate. The most efficient strain (LA02Deltadld, with GlpK-GlpD overexpressed) produced 32 g/liter of d-lactate from 40 g/liter of glycerol at a yield of 85% of the theoretical maximum and with a chiral purity higher than 99.9%. This strain exhibited maximum volumetric and specific productivities for d-lactate production of 1.5 g/liter/h and 1.25 g/g cell mass/h, respectively. The engineered homolactic route generates 1 to 2 mol of ATP per mol of d-lactate and is redox balanced, thus representing a viable metabolic pathway.

  11. Pyruvate Formate-Lyase Is Essential for Fumarate-Independent Anaerobic Glycerol Utilization in the Enterococcus faecalis Strain W11

    PubMed Central

    Ikegami, Yuki

    2014-01-01

    Although anaerobic glycerol metabolism in Enterococcus faecalis requires exogenous fumarate for NADH oxidation, E. faecalis strain W11 can metabolize glycerol in the absence of oxygen without exogenous fumarate. In this study, metabolic end product analyses and reporter assays probing the expression of enzymes involved in pyruvate metabolism were performed to investigate this fumarate-independent anaerobic metabolism of glycerol in W11. Under aerobic conditions, the metabolic end products of W11 cultured with glycerol were similar to those of W11 cultured with glucose. However, when W11 was cultured anaerobically, most of the glucose was converted to l-lactate, but glycerol was converted to ethanol and formate. During anaerobic culture with glycerol, the expression of the l-lactate dehydrogenase and pyruvate dehydrogenase E1αβ genes in W11 was downregulated, whereas the expression of the pyruvate formate-lyase (Pfl) and aldehyde/alcohol dehydrogenase genes was upregulated. These changes in the expression levels caused the change in the composition of end products. A pflB gene disruptant (Δpfl mutant) of W11 could barely utilize glycerol under anaerobic conditions, but the growth of the Δpfl mutant cultured with either glucose or dihydroxyacetone (DHA) under anaerobic conditions was the same as that of W11. Glucose metabolism and DHA generates one NADH molecule per pyruvate molecule, whereas glycerol metabolism in the dehydrogenation pathway generates two NADH molecules per pyruvate molecule. These findings demonstrate that NADH generated from anaerobic glycerol metabolism in the absence of fumarate is oxidized through the Pfl-ethanol fermentation pathway. Thus, Pfl is essential to avoid the accumulation of excess NADH during fumarate-independent anaerobic glycerol metabolism. PMID:24769696

  12. A Na+-coupled C4-dicarboxylate transporter (Asuc_0304) and aerobic growth of Actinobacillus succinogenes on C4-dicarboxylates.

    PubMed

    Rhie, Mi Na; Yoon, Hyo Eun; Oh, Hye Yun; Zedler, Sandra; Unden, Gottfried; Kim, Ok Bin

    2014-07-01

    Actinobacillus succinogenes, which is known to produce large amounts of succinate during fermentation of hexoses, was able to grow on C4-dicarboxylates such as fumarate under aerobic and anaerobic conditions. Anaerobic growth on fumarate was stimulated by glycerol and the major product was succinate, indicating the involvement of fumarate respiration similar to succinate production from glucose. The aerobic growth on C4-dicarboxylates and the transport proteins involved were studied. Fumarate was oxidized to acetate. The genome of A. succinogenes encodes six proteins with similarity to secondary C4-dicarboxylate transporters, including transporters of the Dcu (C4-dicarboxylate uptake), DcuC (C4-dicarboxylate uptake C), DASS (divalent anion : sodium symporter) and TDT (tellurite resistance dicarboxylate transporter) family. From the cloned genes, Asuc_0304 of the DASS family protein was able to restore aerobic growth on C4-dicarboxylates in a C4-dicarboxylate-transport-negative Escherichia coli strain. The strain regained succinate or fumarate uptake, which was dependent on the electrochemical proton potential and the presence of Na(+). The transport had an optimum pH ~7, indicating transport of the dianionic C4-dicarboxylates. Transport competition experiments suggested substrate specificity for fumarate and succinate. The transport characteristics for C4-dicarboxylate uptake by cells of aerobically grown A. succinogenes were similar to those of Asuc_0304 expressed in E. coli, suggesting that Asuc_0304 has an important role in aerobic fumarate uptake in A. succinogenes. Asuc_0304 has sequence similarity to bacterial Na(+)-dicarboxylate cotransporters and contains the carboxylate-binding signature. Asuc_0304 was named SdcA (sodium-coupled C4-dicarboxylate transporter from A. succinogenes). © 2014 The Authors.

  13. Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway.

    PubMed

    Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J; Corey, Joseph M; Lundy, Steven K; Mao-Draayer, Yang

    2015-06-17

    Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS).

  14. Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway

    PubMed Central

    Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J.; Corey, Joseph M.; Lundy, Steven K.; Mao-Draayer, Yang

    2015-01-01

    Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS). PMID:26090715

  15. A Soluble NADH-Dependent Fumarate Reductase in the Reductive Tricarboxylic Acid Cycle of Hydrogenobacter thermophilus TK-6▿

    PubMed Central

    Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo

    2008-01-01

    Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle. PMID:18757546

  16. A soluble NADH-dependent fumarate reductase in the reductive tricarboxylic acid cycle of Hydrogenobacter thermophilus TK-6.

    PubMed

    Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo

    2008-11-01

    Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle.

  17. Identification and characterization of two new derivatives of chlorogenic acids in Arnica (Arnica montana L.) flowers by high-performance liquid chromatography/tandem mass spectrometry.

    PubMed

    Jaiswal, Rakesh; Kuhnert, Nikolai

    2011-04-27

    Arnica montana is a medicinally important plant due to its broad health effects, and it is used in Ayurvedic, Homeopathic, Unani, and folk medicines. We have used LC-MS(n) (n = 2-5) to detect and characterize in Arnica flowers 11 quantitatively minor fumaric and methoxyoxalic acid-containing chlorogenic acids, nine of them not previously reported in nature. These comprise 1,5-dicaffeoyl-3-methoxyoxaloylquinic acid, 1,3-dicaffeoyl-4-methoxyoxaloylquinic acid, 3,5-dicaffeoyl-4-methoxyoxaloylquinic acid, and 1-methoxyoxaloyl-4,5-dicaffeoylquinic acid (M(r) 602); 3-caffeoyl-4-feruloyl-5-methoxyoxaloylquinic acid and 3-feruloyl-4-methoxyoxaloyl-5-caffeoylquinic acid (M(r) 616); 1,5-dicaffeoyl-4-fumaroyl and 1,5-dicaffeoyl-3-fumaroylquinic acid (M(r) 614); 3,5-dicaffeoyl-1,4-dimethoxyoxaloylquinic acid (M(r) 688); and 1-methoxyoxaloyl-3,4,5-tricaffeoylquinic acid and 1,3,4-tricaffeoyl-5-methoxyoxaloylquinic acid (M(r) 764). All of the structures have been assigned on the basis of LC-MS(n) patterns of fragmentation, relative hydrophobicity, and analogy of fragmentation patterns if compared to caffeoylquinic acids. This is the first time when fumaric acid-containing chlorogenic acids are reported in nature.

  18. Microbial biosynthesis and secretion of l-malic acid and its applications.

    PubMed

    Chi, Zhe; Wang, Zhi-Peng; Wang, Guang-Yuan; Khan, Ibrar; Chi, Zhen-Ming

    2016-01-01

    l-Malic acid has many uses in food, beverage, pharmaceutical, chemical and medical industries. It can be produced by one-step fermentation, enzymatic transformation of fumaric acid to l-malate and acid hydrolysis of polymalic acid. However, the process for one-step fermentation is preferred as it has many advantages over any other process. The pathways of l-malic acid biosynthesis in microorganisms are partially clear and three metabolic pathways including non-oxidative pathway, oxidative pathway and glyoxylate cycle for the production of l-malic acid from glucose have been identified. Usually, high levels of l-malate are produced under the nitrogen starvation conditions, l-malate, as a calcium salt, is secreted from microbial cells and CaCO3 can play an important role in calcium malate biosynthesis and regulation. However, it is still unclear how it is secreted into the medium. To enhance l-malate biosynthesis and secretion by microbial cells, it is very important to study the mechanisms of l-malic acid biosynthesis and secretion at enzymatic and molecular levels.

  19. Effects of different culture conditions on biological potential and metabolites production in three Penicillium isolates.

    PubMed

    Reis, Filipa S; Ćirić, Ana; Stojković, Dejan; Barros, Lillian; Ljaljević-Grbić, Milica; Soković, Marina; Ferreira, Isabel C F R

    2015-02-01

    The genus Penicillium is well known for its importance in drug and food production. Certain species are produced on an industrial scale for the production of antibiotics (e.g. penicillin) or for insertion in food (e.g. cheese). In the present work, three Penicillium species, part of the natural mycobiota growing on various food products were selected - P. ochrochloron, P. funiculosum and P. verrucosum var. cyclopium. The objective of our study was to value these species from the point of view of production of bioactive metabolites. The species were obtained after inoculation and growth in Czapek and Malt media. Both mycelia and culture media were analyzed to monitor the production of different metabolites by each fungus and their release to the culture medium. The concentrations of sugars, organic acids, phenolic acids and tocopherols were determined. Antioxidant activity of the phenolic extracts was evaluated, as also the antimicrobial activity of phenolic acids, organic acids and tocopherols extracts. Rhamnose, xylose, fructose and trehalose were found in all the mycelia and culture media; the prevailing organic acids were oxalic and fumaric acids, and protocatechuic and p-hydroxybenzoic acids were the most common phenolic acids; γ-tocopherol was the most abundant vitamin E isoform. Generally, the phenolic extracts corresponding to the mycelia samples revealed higher antioxidant activity. Concerning the antimicrobial activity there were some fluctuations, however all the studied species revealed activity against the tested strains. Therefore, the in-vitro bioprocesses can be an alternative for the production of bioactive metabolites that can be used by pharmaceutical industry.

  20. Anaerobic organic acid metabolism of Candida zemplinina in comparison with Saccharomyces wine yeasts.

    PubMed

    Magyar, Ildikó; Nyitrai-Sárdy, Diána; Leskó, Annamária; Pomázi, Andrea; Kállay, Miklós

    2014-05-16

    Organic acid production under oxygen-limited conditions has been thoroughly studied in the Saccharomyces species, but practically never investigated in Candida zemplinina, which seems to be an acidogenic species under oxidative laboratory conditions. In this study, several strains of C. zemplinina were tested for organic acid metabolism, in comparison with Saccharomyces cerevisiae, Saccharomyces uvarum and Candida stellata, under fermentative conditions. Only C. stellata produced significantly higher acidity in simple minimal media (SM) with low sugar content and two different nitrogen sources (ammonia or glutamic acid) at low level. However, the acid profile differed largely between the Saccharomyces and Candida species and showed inverse types of N-dependence in some cases. Succinic acid production was strongly enhanced on glutamic acid in Saccharomyces species, but not in Candida species. 2-oxoglutarate production was strongly supported on ammonium nitrogen in Candida species, but remained low in Saccharomyces. Candida species, C. stellata in particular, produced more pyruvic acid regardless of N-sources. From the results, we concluded that the anaerobic organic acid metabolisms of C. zemplinina and C. stellata are different from each other and also from that of the Saccharomyces species. In the formation of succinic acid, the oxidative pathway from glutamic acid seems to play little or no role in C. zemplinina. The reductive branch of the TCA cycle, however, produces acidic intermediates (malic, fumaric, and succinic acid) in a level comparable with the production of the Saccharomyces species. An unidentified organic acid, which was produced on glutamic acid only by the Candida species, needs further investigation. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. 21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

  2. 21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

  3. 21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

  4. 21 CFR 520.82a - Aminopropazine fumarate tablets.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...

  5. 21 CFR 520.82a - Aminopropazine fumarate tablets.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...

  6. 21 CFR 520.82a - Aminopropazine fumarate tablets.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...

  7. 21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...

  8. Bis(PheOH) maleic acid amide-fumaric acid amide photoizomerization induces microsphere-to-gel fiber morphological transition: the photoinduced gelation system.

    PubMed

    Frkanec, Leo; Jokić, Milan; Makarević, Janja; Wolsperger, Kristina; Zinić, Mladen

    2002-08-21

    The photoinduced gelation system based on 1 (non-gelling) to 2 (gelling) molecular photoisomerization in water results by microspheres (1) to gel fibers (2) transformation at the supramolecular level.

  9. Cocrystals of acyclovir with promising physicochemical properties.

    PubMed

    Sarkar, Anindita; Rohani, Sohrab

    2015-01-01

    Cocrystal forming ability of antiviral drug acyclovir (ACV) with different coformers was studied. Three cocrystals containing ACV with fumaric acid, malonic acid, and DL-tartaric acid were isolated. Methods of cocrystallization included grinding with dropwise solvent addition and solvent evaporation. The cocrystals were characterized by powder X-ray diffraction, differential scanning calorimetry, and thermogravimetric analysis. The crystal structure of the cocrystal with fumaric acid as conformer was determined by single crystal X-ray diffraction. Formation of supramolecular synthon was observed in the cocrystal. Stability with respect to relative humidity for the three cocrystals was evaluated. The aqueous solubility of the ACV-cocrystal materials was significantly improved with a maximum of malonic acid cocrystal, which was about six times more soluble at 35°C compared with that of parent ACV. The dissolution profile indicates that at any particular dissolution time, the concentration of cocrystals in the solution was higher than that of the parent ACV, and malonic acid cocrystals had a maximum release of about twice than the hydrated ACV. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

  10. An NMR-Based Metabolomic Approach to Investigate the Effects of Supplementation with Glutamic Acid in Piglets Challenged with Deoxynivalenol

    PubMed Central

    Ren, Wenkai; Yin, Jie; Hu, Jiayu; Duan, Jielin; Liu, Gang; Tan, Bie; Xiong, Xia; Oso, Abimbola Oladele; Adeola, Olayiwola; Yao, Kang; Yin, Yulong; Li, Tiejun

    2014-01-01

    Deoxynivalenol (DON) has various toxicological effects in humans and pigs that result from the ingestion of contaminated cereal products. This study was conducted to investigate the protective effects of dietary supplementation with glutamic acid on piglets challenged with DON. A total of 20 piglets weaned at 28 d of age were randomly assigned to receive 1 of 4 treatments (5 piglets/treatment): 1) basal diet, negative control (NC); 2) basal diet +4 mg/kg DON (DON); 3) basal diet +2% (g/g) glutamic acid (GLU); 4) basal diet +4 mg/kg DON +2% glutamic acid (DG). A 7-d adaptation period was followed by 30 days of treatment. A metabolite analysis using nuclear magnetic resonance spectroscopy (1H-NMR)-based metabolomic technology and the determination of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities for plasma, as well as the activity of Caspase-3 and the proliferation of epithelial cells were conducted. The results showed that contents of low-density lipoprotein, alanine, arginine, acetate, glycoprotein, trimethylamine-N-oxide (TMAO), glycine, lactate, and urea, as well as the glutamate/creatinine ratio were higher but high-density lipoprotein, proline, citrate, choline, unsaturated lipids and fumarate were lower in piglets of DON treatment than that of NC treatment (P<0.05). Compared with DON treatment, dietary supplementation with glutamic acid increased the plasma concentrations of proline, citrate, creatinine, unsaturated lipids, and fumarate, and decreased the concentrations of alanine, glycoprotein, TMAO, glycine, and lactate, as well as the glutamate/creatinine ratio (P<0.05). Addition glutamic acid to DON treatment increased the plasma activities of SOD and GSH-Px and the proliferating cell nuclear antigen (PCNA) labeling indexes for the jejunum and ileum (P<0.05). These novel findings indicate that glutamic acid has the potential to repair the injuries associated with oxidative stress as well as the disturbances of energy and amino acid metabolism induced by DON. PMID:25502722

  11. An NMR-based metabolomic approach to investigate the effects of supplementation with glutamic acid in piglets challenged with deoxynivalenol.

    PubMed

    Wu, Miaomiao; Xiao, Hao; Ren, Wenkai; Yin, Jie; Hu, Jiayu; Duan, Jielin; Liu, Gang; Tan, Bie; Xiong, Xia; Oso, Abimbola Oladele; Adeola, Olayiwola; Yao, Kang; Yin, Yulong; Li, Tiejun

    2014-01-01

    Deoxynivalenol (DON) has various toxicological effects in humans and pigs that result from the ingestion of contaminated cereal products. This study was conducted to investigate the protective effects of dietary supplementation with glutamic acid on piglets challenged with DON. A total of 20 piglets weaned at 28 d of age were randomly assigned to receive 1 of 4 treatments (5 piglets/treatment): 1) basal diet, negative control (NC); 2) basal diet +4 mg/kg DON (DON); 3) basal diet +2% (g/g) glutamic acid (GLU); 4) basal diet +4 mg/kg DON +2% glutamic acid (DG). A 7-d adaptation period was followed by 30 days of treatment. A metabolite analysis using nuclear magnetic resonance spectroscopy (1H-NMR)-based metabolomic technology and the determination of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities for plasma, as well as the activity of Caspase-3 and the proliferation of epithelial cells were conducted. The results showed that contents of low-density lipoprotein, alanine, arginine, acetate, glycoprotein, trimethylamine-N-oxide (TMAO), glycine, lactate, and urea, as well as the glutamate/creatinine ratio were higher but high-density lipoprotein, proline, citrate, choline, unsaturated lipids and fumarate were lower in piglets of DON treatment than that of NC treatment (P<0.05). Compared with DON treatment, dietary supplementation with glutamic acid increased the plasma concentrations of proline, citrate, creatinine, unsaturated lipids, and fumarate, and decreased the concentrations of alanine, glycoprotein, TMAO, glycine, and lactate, as well as the glutamate/creatinine ratio (P<0.05). Addition glutamic acid to DON treatment increased the plasma activities of SOD and GSH-Px and the proliferating cell nuclear antigen (PCNA) labeling indexes for the jejunum and ileum (P<0.05). These novel findings indicate that glutamic acid has the potential to repair the injuries associated with oxidative stress as well as the disturbances of energy and amino acid metabolism induced by DON.

  12. Metabolic engineering of Aspergillus oryzae for efficient production of l-malate directly from corn starch.

    PubMed

    Liu, Jingjing; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

    2017-11-20

    l-Malate, an important chemical building block, has been widely applied in the food, pharmaceutical, and bio-based materials industries. In previous work, we engineered Aspergillus oryzae by rewiring the reductive tricarboxylic acid pathway to produce l-malate from glucose. To decrease the production cost, here, we further engineered A. oryzae to efficiently produce l-malate directly from corn starch with simultaneous liquefaction-saccharification and fermentation. First, a promoter PN5 was constructed by quintuple tandem of the 97-bp fragment containing the cis-element of the glucoamylase gene promoter (PglaA), and with the promoter PN5, the transcriptional level of glaA gene increased by 25-45%. Then, by co-overexpression of glaA, a-amylase (amyB) and a-glucosidase (agdA) genes with the promoter PN5, the l-malate titer increased from 55.5g/L to 72.0g/L with 100g/L corn starch in shake flask. In addition, to reduce the concentration of byproducts succinate and fumarate, a fumarase from Saccharomyces cerevisiae, which facilitated the transformation of fumarate to l-malate, was overexpressed. As a result, the concentration of succinate and fumarate decreased from 12.6 and 1.29g/L to 7.8 and 0.59g/L, and the l-malate titer increased from 72.0g/L to 78.5g/L. Finally, we found that the addition of glucose at the initial fermentation stage facilitated the cell growth and l-malate synthesis, and the l-malate titer further increased to 82.3g/L by co-fermentation of 30g/L glucose and 70g/L corn starch, with a productivity of 1.18g/L/h and a yield of 0.82g/g total carbon sources. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Biofilm reactors for industrial bioconversion processes: employing potential of enhanced reaction rates

    PubMed Central

    Qureshi, Nasib; Annous, Bassam A; Ezeji, Thaddeus C; Karcher, Patrick; Maddox, Ian S

    2005-01-01

    This article describes the use of biofilm reactors for the production of various chemicals by fermentation and wastewater treatment. Biofilm formation is a natural process where microbial cells attach to the support (adsorbent) or form flocs/aggregates (also called granules) without use of chemicals and form thick layers of cells known as "biofilms." As a result of biofilm formation, cell densities in the reactor increase and cell concentrations as high as 74 gL-1 can be achieved. The reactor configurations can be as simple as a batch reactor, continuous stirred tank reactor (CSTR), packed bed reactor (PBR), fluidized bed reactor (FBR), airlift reactor (ALR), upflow anaerobic sludge blanket (UASB) reactor, or any other suitable configuration. In UASB granular biofilm particles are used. This article demonstrates that reactor productivities in these reactors have been superior to any other reactor types. This article describes production of ethanol, butanol, lactic acid, acetic acid/vinegar, succinic acid, and fumaric acid in addition to wastewater treatment in the biofilm reactors. As the title suggests, biofilm reactors have high potential to be employed in biotechnology/bioconversion industry for viable economic reasons. In this article, various reactor types have been compared for the above bioconversion processes. PMID:16122390

  14. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...

  15. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...

  16. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...

  17. L-Asparaginase Production by the Rumen Anaerobe Vibrio succinogenes

    PubMed Central

    Kafkewitz, David; Goodman, David

    1974-01-01

    The rumen anaerobe Vibrio succinogenes possesses a constitutive L-asparaginase. The amount of enzyme produced is affected by the compound supplied to the organism to generate the fumaric acid it requires as a terminal electron acceptor. When nitrate is provided as the terminal electron acceptor, the amount of enzyme produced is affected by the compound provided to satisfy the nutritional requirement of the organism for succinic acid. Specific activities of up to 8.4 IU/mg of protein in cell-free extracts have been obtained. This specific activity is higher than has been previously reported for any organism. The enzyme has an apparent Km of 1.7 × 10-5 M and low activity towards L-glutamine when assayed at pH 8.5. PMID:4855647

  18. FUM2, a Cytosolic Fumarase, Is Essential for Acclimation to Low Temperature in Arabidopsis thaliana1[OPEN

    PubMed Central

    Dyson, Beth C.; Miller, Matthew A.E.; Feil, Regina; Rattray, Nicholas; Bowsher, Caroline G.

    2016-01-01

    Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the cold-tolerant model species Arabidopsis (Arabidopsis thaliana). A nontargeted metabolomic approach, using gas chromatography-mass spectrometry, identifies fumarate as a key component of the cold response in this species. Plants of T-DNA insertion mutants, lacking FUM2, show marked differences in their response to cold, with contrasting responses both in terms of metabolite concentrations and gene expression. The fum2 plants accumulated higher concentrations of phosphorylated sugar intermediates and of starch and malate. Transcripts for proteins involved in photosynthesis were markedly down-regulated in fum2.2 but not in wild-type Columbia-0. Plants of fum2 show a complete loss of the ability to acclimate photosynthesis to low temperature. We conclude that fumarate accumulation plays an essential role in low temperature sensing in Arabidopsis, either indirectly modulating metabolic or redox signals or possibly being itself directly involved in cold sensing. PMID:27440755

  19. 21 CFR 177.1520 - Olefin polymers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... by reaction with fumaric acid in the absence of free radical initiators. Such polymers shall contain... acid in the absence of free radical initiators. Such polymers shall contain not more than 4.5 percent... tube for preheated, oxygen-free nitrogen, and an outlet tube located 1 inch off center. Nitrogen is fed...

  20. 21 CFR 177.1520 - Olefin polymers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... by reaction with fumaric acid in the absence of free radical initiators. Such polymers shall contain... acid in the absence of free radical initiators. Such polymers shall contain not more than 4.5 percent... tube for preheated, oxygen-free nitrogen, and an outlet tube located 1 inch off center. Nitrogen is fed...

  1. The sulfate-reducing bacterium Desulfovibrio desulfuricans ND132 as a model for understanding bacterial mercury methylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilmour, C C; Elias, Dwayne A; Kucken, A M

    2010-01-01

    We propose the use of Desulfovibrio sp. ND132 as a model species for understanding the genetics and biochemistry of microbial Hg methylation. ND132 is a dissimilatory sulfate-reducing bacterium (DSRB) that exhibits exceptionally high rates of Hg methylation in culture, but is otherwise a characteristically typical Desulfovibrio strain. The full genome sequence of ND132 will be available soon. ND132 is very similar to other DSRB that are sequenced but do not methylate Hg, allowing comparison for potential methylation genes. Here, we describe the physiological characteristics of the strain, examine its MeHg production capability, and place the strain within the phylogeny ofmore » the Desulfovibrionales using 16S rRNA. We also examine Hg toxicity and the inducibility of MeHg production amongst the DSRB by comparing ND132 to non-methylating DSRB. The optimal growth medium for Hg methylation is pyruvate/fumarate, which supports strong respiratory growth without sulfide production. At moderate Hg concentrations (10 ng/ml), and using TiNTA as a reductant, ND132 methylates about 30% of added HgCl2 during batch culture growth on 40 mM pyruvate/fumarate. Under constant culture conditions, MeHg production is an exponential function of Hg concentration, probably reflecting Hg partitioning between aqueous and solid phases. To help understand how Hg is taken up by this organism, we examined the influence of a variety of small thiol-bearing ligands, as well as select amino acids, on methylation by D. desulfuricans ND132. All thiol bearing ligands tested affected methylation in similar ways, suggesting that Hg uptake by ND132 is not associated with uptake of a specific amino acid. To identify enzymes for the methylation activity, a genetic approach is being pursued. Conjugation from E. coli donors works well that allows the generation of a transposon library of random ND132 mutants. These mutants will be screened for affects on mercury methylation.« less

  2. Aniline Is an Inducer, and Not a Precursor, for Indole Derivatives in Rubrivivax benzoatilyticus JA2

    PubMed Central

    Mohammed, Mujahid; Ch, Sasikala; Ch, Ramana V.

    2014-01-01

    Rubrivivax benzoatilyticus JA2 and other anoxygenic photosynthetic bacteria produce indole derivatives when exposed to aniline, a xenobiotic compound. Though this phenomenon has been reported previously, the role of aniline in the production of indoles is still a biochemical riddle. The present study aims at understanding the specific role of aniline (as precursor or stimulator) in the production of indoles and elucidating the biochemical pathway of indoles in aniline-exposed cells by using stable isotope approaches. Metabolic profiling revealed tryptophan accumulation only in aniline exposed cells along with indole 3-acetic acid (IAA) and indole 3-aldehyde (IAld), the two major catabolites of tryptophan. Deuterium labelled aniline feeding studies revealed that aniline is not a precursor of indoles in strain JA2. Further, production of indoles only in aniline-exposed cells suggests that aniline is an indoles stimulator. In addition, production of indoles depended on the presence of a carbon source, and production enhanced when carbon sources were added to the culture. Isotope labelled fumarate feeding identified, fumarate as the precursor of indole, indicating de novo synthesis of indoles. Glyphosate (shikimate pathway inhibitor) inhibited the indoles production, accumulation of tryptophan, IAA and IAld indicating that indoles synthesis in strain JA2 occurs via the de novo shikimate pathway. The up-regulation of anthranilate synthase gene and induction of anthranilate synthase activity correlated well with tryptophan production in strain JA2. Induction of tryptophan aminotransferase and tryptophan 2-monooxygenase activities corroborated well with IAA levels, suggesting that tryptophan catabolism occurs simultaneously in aniline exposed cells. Our study demonstrates that aniline (stress) stimulates tryptophan/indoles synthesis via the shikimate pathway by possibly modulating the metabolic pathway. PMID:24533057

  3. Aniline is an inducer, and not a precursor, for indole derivatives in Rubrivivax benzoatilyticus JA2.

    PubMed

    Mujahid, Mohammed; Sasikala, Ch; Ramana, Ch V

    2014-01-01

    Rubrivivax benzoatilyticus JA2 and other anoxygenic photosynthetic bacteria produce indole derivatives when exposed to aniline, a xenobiotic compound. Though this phenomenon has been reported previously, the role of aniline in the production of indoles is still a biochemical riddle. The present study aims at understanding the specific role of aniline (as precursor or stimulator) in the production of indoles and elucidating the biochemical pathway of indoles in aniline-exposed cells by using stable isotope approaches. Metabolic profiling revealed tryptophan accumulation only in aniline exposed cells along with indole 3-acetic acid (IAA) and indole 3-aldehyde (IAld), the two major catabolites of tryptophan. Deuterium labelled aniline feeding studies revealed that aniline is not a precursor of indoles in strain JA2. Further, production of indoles only in aniline-exposed cells suggests that aniline is an indoles stimulator. In addition, production of indoles depended on the presence of a carbon source, and production enhanced when carbon sources were added to the culture. Isotope labelled fumarate feeding identified, fumarate as the precursor of indole, indicating de novo synthesis of indoles. Glyphosate (shikimate pathway inhibitor) inhibited the indoles production, accumulation of tryptophan, IAA and IAld indicating that indoles synthesis in strain JA2 occurs via the de novo shikimate pathway. The up-regulation of anthranilate synthase gene and induction of anthranilate synthase activity correlated well with tryptophan production in strain JA2. Induction of tryptophan aminotransferase and tryptophan 2-monooxygenase activities corroborated well with IAA levels, suggesting that tryptophan catabolism occurs simultaneously in aniline exposed cells. Our study demonstrates that aniline (stress) stimulates tryptophan/indoles synthesis via the shikimate pathway by possibly modulating the metabolic pathway.

  4. 46 CFR Table I to Part 150 - Alphabetical List of Cargoes

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

  5. 46 CFR Table I to Part 150 - Alphabetical List of Cargoes

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

  6. 46 CFR Table I to Part 150 - Alphabetical List of Cargoes

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

  7. 46 CFR Table I to Part 150 - Alphabetical List of Cargoes

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

  8. 46 CFR Table I to Part 150 - Alphabetical List of Cargoes

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

  9. Survey of dimethyl fumarate in desiccant products during 2009 in Italy.

    PubMed

    Stefanelli, Patrizia; Girolimetti, Silvana; Santilio, Angela; Dommarco, Roberto

    2011-04-01

    Dimethyl fumarate (DMFu) is a substance with remarkable hygroscopicity and fungicidal power, which has recently showed to be a strong sensitizer to humans. The use of DMFu in little desiccant pouches, for e.g. in handbags or footwear boxes, might result in the contamination of leather products, with the subsequent exposure to consumers by contact. In 2009, 153 samples of desiccant material were collected from leather manufactures all over Italy and analyzed for DMFu. Results proved to fall in a wide range (0.14-7145 mg/kg).

  10. Development of Repair Materials for Avulsive Combat-Type Maxillofacial Injuries.

    DTIC Science & Technology

    1981-11-01

    sone. A sample of 0.2702 grams of the resulting corn- nitic acid. tsocitric acid, alpha - ketoglutaric acid. suc- position was shaped into the form of a...polylactic acid and inorganic materials such as calcium carbonate or calcium sulfate. The chemistry of the system proposed for development includes...acid and high molecular weight poly(propylene fumarate) were synthesized at Dynatech to be used as organic fillers. Inorganic fil- lers such as calcium

  11. Poly(fumaric-co-sebacic anhydride). A degradation study as evaluated by FTIR, DSC, GPC and X-ray diffraction.

    PubMed

    Santos, C A; Freedman, B D; Leach, K J; Press, D L; Scarpulla, M; Mathiowitz, E

    1999-06-28

    The degradation of three poly(fumaric-co-sebacic anhydride) [P(FA:SA)] copolymers is examined in a composition of microspheres made by the hot melt encapsulation process. The emergence of low molecular weight oligomers occurs during degradation of the copolymer microspheres, as evidenced by a variety of characterization methods. Characterization was conducted to determine the extent of degradation of the polyanhydride microspheres using Fourier-transform infrared spectroscopy (FTIR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC) and X-ray diffraction. It is demonstrated that degradation of P(FA:SA) is greatly accelerated at basic pH, yet there is little difference between degradation in neutral and acidic buffers. A good correlation exists between the results of each characterization method, which allows a better understanding of the degradation process and the resulting formation of low molecular weight oligomers in poly(fumaric-co-sebacic anhydride).

  12. Nematicidal Activity of Kojic Acid Produced by Aspergillus oryzae against Meloidogyne incognita.

    PubMed

    Kim, Tae Yoon; Jang, Ja Yeong; Jeon, Sun Jeong; Lee, Hye Won; Bae, Chang-Hwan; Yeo, Joo Hong; Lee, Hyang Burm; Kim, In Seon; Park, Hae Woong; Kim, Jin-Cheol

    2016-08-28

    The fungal strain EML-DML3PNa1 isolated from leaf of white dogwood (Cornus alba L.) showed strong nematicidal activity with juvenile mortality of 87.6% at a concentration of 20% fermentation broth filtrate at 3 days after treatment. The active fungal strain was identified as Aspergillus oryzae, which belongs to section Flavi, based on the morphological characteristics and sequence analysis of the ITS rDNA, calmodulin (CaM), and β-tubulin (BenA) genes. The strain reduced the pH value to 5.62 after 7 days of incubation. Organic acid analysis revealed the presence of citric acid (515.0 mg/kg), malic acid (506.6 mg/kg), and fumaric acid (21.7 mg/kg). The three organic acids showed moderate nematicidal activities, but the mixture of citric acid, malic acid, and fumaric acid did not exhibit the full nematicidal activity of the culture filtrate of EML- DML3PNa1. Bioassay-guided fractionation coupled with (1)H- and (13)C-NMR and EI-MS analyses led to identification of kojic acid as the major nematicidal metabolite. Kojic acid exhibited dose-dependent mortality and inhibited the hatchability of M. incognita, showing EC50 values of 195.2 µg/ml and 238.3 µg/ml, respectively, at 72 h postexposure. These results suggest that A. oryzae EML-DML3PNa1 and kojic acid have potential as a biological control agent against M. incognita.

  13. Photocatalytic ozonation of terephthalic acid: a by-product-oriented decomposition study.

    PubMed

    Fuentes, Iliana; Rodríguez, Julia L; Poznyak, Tatyana; Chairez, Isaac

    2014-11-01

    Terephthalic acid (TA) is considered as a refractory model compound. For this reason, the TA degradation usually requires a prolonged reaction time to achieve mineralization. In this study, vanadium oxide (VxOy) supported on titanium oxide (TiO2) served as a photocatalyst in the ozonation of the TA with light-emitting diodes (LEDs), having a bandwidth centered at 452 nm. The modified catalyst (VxOy/TiO2) in combination with ozone and LEDs improved the TA degradation and its by-products. The results obtained by this system were compared with photolysis, single ozonation, catalytic ozonation, and photocatalytic ozonation of VxOy/TiO2 with UV lamp. The LED-based photocatalytic ozonation showed almost the same decomposition efficiency of the TA, but it was better in comparison with the use of UV lamp. The oxalic acid accumulation, as the final product of the TA decomposition, was directly influenced by either the presence of VxOy or/and the LED irradiation. Several by-products formed during the TA degradation, such as muconic, fumaric, and oxalic acids, were identified. Besides, two unidentified by-products were completely removed during the observed time (60 min). It was proposed that the TA elimination in the presence of VxOy/TiO2 as catalyst was carried out by the combination of different mechanisms: molecular ozone reaction, indirect mechanism conducted by ·OH, and the surface complex formation.

  14. Determination of the structure and catalytic mechanism of sorghum bicolor caffeoyl-CoA O-methyltransferase

    USDA-ARS?s Scientific Manuscript database

    Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the c...

  15. 21 CFR 172.822 - Sodium lauryl sulfate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... acid-acidulated dry beverage base whereby the additive does not exceed 25 parts per million of the finished beverage and such beverage base is not for use in a food for which a standard of identity established under section 401 of the Act precludes such use. (ii) Fumaric acid-acidulated fruit juice drinks...

  16. ORGANIC REACTIONS IN THE SOLID STATE AND IN SOLID SOLUTIONS.

    DTIC Science & Technology

    on the reactions of phthalic acid and acetanilide , various acyl anilides, and ring-substituted acetanilides . Exploratory experiments were also...performed between ring-substituted acetanilides and succinic, glutaric, maleic and fumaric acids. The influence of imidazole as a catalyst of the...transacylation reaction of phthalic anhydride and acetanilide is also reported. (Author)

  17. Optimization of cell-based assays to quantify the anti-inflammatory/allergic potential of test substances in 96-well format.

    PubMed

    Chandrasekaran, C V; Edwin Jothie, R; Kapoor, Preeti; Gupta, Anumita; Agarwal, Amit

    2011-06-01

    There is an insistent need for robust, reliable, and optimized assays for screening novel drugs targeting the inflammatory/allergic markers. The present study describes about the optimization of eight cell-based assays utilizing mammalian cell lines in 96-well format for quantifying anti-inflammatory/allergic drug candidates. We estimated the inhibitory response of reference compounds: 1400 W dihydrochloride on LPS-induced NO release, celecoxib on LPS-induced PGE(2) production and dexamethasone on LPS-induced pro-inflammatory cytokines IL-1 beta, IL-6, and TNF-alpha production by J774A.1 murine macrophages. Response of acetylsalicylic acid and celecoxib was studied on A23187-induced TXB(2) production; captopril on A23187-stimulated LTB(4) production by HL-60 cells. Effect of ketotifen fumarate was evaluated on A23187-elicited histamine release by RBL-2H3 cells. Each experiment was repeated twice to assess the reproducibility and suitability of the assays by determining appropriate statistical tools viz. %CV, S/B and Z' factor. 1400 W dihydrochloride was capable of inhibiting LPS-induced NO levels (IC(50) = 10.7 μM). Dexamethasone attenuated LPS-induced IL-1 beta (IC(50) = 70 nM), IL-6 (IC(50) = 58 nM) and TNF-alpha (IC(50) = 44 nM) release, whereas celecoxib, a specific COX-2 inhibitor showed marked reduction in LPS-induced PGE(2) (IC(50) = 23 nM) production. Captopril (IC(50) = 48 μM) and ketotifen fumarate (IC(50) = 36.4 μM) demonstrated potent inhibitory effect against A23187-stimulated LTB(4) and histamine levels, respectively. Both acetylsalicylic acid (IC(50) = 5.5 μM) and celecoxib (IC(50) = 7.9 nM) exhibited concentration-dependent decrease in TXB(2) production. Results for all the cell assays from two experiments showed a Z' factor varying from 0.30 to 0.99; the S/B ratio ranged from 2.39 to 24.92; %CV ranged between 1.52 and 20.14. The results proclaim that these cell-based assays can act as ideal tools for screening new anti-inflammatory/anti-allergic compounds.

  18. Interconversion of biologically important carboxylic acids by radiation

    NASA Technical Reports Server (NTRS)

    Negron-Mendoza, A.; Ponnamperuma, C.

    1978-01-01

    The interconversion of a group of biologically important polycarboxylic acids (acetic, fumaric, malic, malonic, succinic, citric, isocitric, tricarballylic) under gamma-ray or ultraviolet radiation was investigated. The formation of high molecular weight compounds was observed in all cases. Succinic acid was formed in almost all radiolysis experiments. Citric, malonic, and succinic acids appeared to be relatively insensitive to radiation. Interconversion of the polycarboxylic acids studied may have occurred under the effect of radiation in the prebiotic earth.

  19. Contribution of the tricarboxylic acid (TCA) cycle and the glyoxylate shunt in Saccharomyces cerevisiae to succinic acid production during dough fermentation.

    PubMed

    Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M

    2015-07-02

    Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Growth yields and fermentation balance of Bacteroides fragilis cultured in glucose-enriched medium.

    PubMed

    Frantz, J C; McCallum, R E

    1979-03-01

    Bacteroides fragilis is an obligate anaerobic bacterium classified with the gram-negative, non-sporeforming bacilli and is the Bacteroides species most frequently isolated from human infections. In the present study, experiments were designed to investigate growth characteristics of B. fragilis in a complex medium. In a minimal defined medium, which was employed for comparison purposes, B. fragilis grew with a generation time of 2 h. Growth of the organism in glucose-enriched medium used in the present study was superior. Maximum generation time was 60 min. Total and viable cells (colony-forming units) were 8.9 x 10(9) and 2.1 x 10(9), respectively, at maximum measurable growth. The molar growth yield (Ym) was 51.5. Growth yields were found to reach a maximum 2 to 3 h before maximum growth and to vary with respect to the phase of growth. Estimates of the fermentation products indicated that glucose was the sole energy substrate. Major products included acetic acid, propionic acid, lactic acid, and succinic acid. Other products included ethyl alcohol, pyruvic acid, and fumaric acid. No attempt was made to recover CO2 or formic acid. The OR balances from two experiments were 0.013 and -0.093 and the respective carbon recoveries were 6.268 and 6.241. The results of the present study show that B. fragilis is capable of rapid rates of growth in vitro by using glucose as the sole energy source.

  1. Stability of monacolin K and citrinin and biochemical characterization of red-koji vinegar during fermentation.

    PubMed

    Hsieh, Chia-Wen; Lu, Yi-Ru; Lin, Shu-Mei; Lai, Tzu-Yuan; Chiou, Robin Y-Y

    2013-07-31

    Red-koji vinegar is a Monascus -involved and acetic acid fermentation-derived traditional product, in which the presence of monacolin K and citrinin has attracted public attention. In this study, red-koji wine was prepared as the substrate and artificially supplemented with monacolin K and citrinin and subjected to vinegar fermentation with Acetobacter starter. After 30 days of fermentation, 43.0 and 98.1% of the initial supplements of monacolin K and citrinin were decreased, respectively. During fermentation, acetic acid contents increased, accompanied by decreases of ethanol and lactic acid contents and pH values. The contents of free amino acids increased while the contents of other organic acids, including fumaric acid, citric acid, succinic acid, and tartaric acid, changed limitedly. Besides, increased levels of total phenolics in accordance with increased antioxidative potency, α,α-diphenyl-β-picrylhydrazyl scavenging, and xanthine oxidase inhibitory (XOI) activities were detected. It is of merit that most citrinin was eliminated and >50% of the monacolin K was retained; contents of free amino acids and total phenolics along with antioxidant and XOI activities of the red-koji vinegar were increased after fermentation.

  2. [Not Available].

    PubMed

    Burgot, J L

    1978-04-01

    Maleic, fumaric, tartaric, glutaric and adipic acids are titrated directly with sodium hydroxide by means of an automatic thermometric titrimeter. The titration curves have two break-points, corresponding to the successive neutralization of the two acid groups. Previous standardization permits measurement of the heats of neutralization, from which the enthalpies of dissociation can be deduced. From 0.3 to 1 mmole of acid can be titrated with a relative standard deviation of about 3%.

  3. Potential drugs which activate nuclear factor E2-related factor 2 signaling to prevent diabetic cardiovascular complications: A focus on fumaric acid esters.

    PubMed

    Zhou, Shanshan; Jin, Jingpeng; Bai, Tao; Sachleben, Leroy R; Cai, Lu; Zheng, Yang

    2015-08-01

    Diabetes and its cardiovascular complications have been a major public health issue. These complications are mainly attributable to a severe imbalance between free radical and reactive oxygen species production and the antioxidant defense systems. Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant enzyme genes and other cyto-protective phase II detoxifying enzymes. As a result, Nrf2 has gained great attention as a promising drug target for preventing diabetic cardiovascular complications. And while animal studies have shown that several Nrf2 activators manifest a potential to efficiently prevent the diabetic complications, their use in humans has not been approved due to the lack of substantial evidence regarding safety and efficacy of the Nrf2 activation. We provide here a brief review of a few clinically-used drugs that can up-regulate Nrf2 with the potential of extending their usage to diabetic patients for the prevention of cardiovascular complications and conclude with a closer inspection of dimethyl fumarate and its mimic members. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. The Variations of Glycolysis and TCA Cycle Intermediate Levels Grown in Iron and Copper Mediums of Trichoderma harzianum.

    PubMed

    Tavsan, Zehra; Ayar Kayali, Hulya

    2015-05-01

    The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.

  5. Environmental Compliance Assessment System (USA ECAS)

    DTIC Science & Technology

    1991-09-01

    Fuberidazole 100/10,000 3878-19-1 Fulminic acid , mercu- 10 P065 628-86-4 ry(I1) salt Fumaric acid 5000 110-17-8 Furan, tetrahydro- 1000 LT213 109-99-9 Furan...etc.)? S. Does the installation have any bulk acid storage? 6. Does the installation store batteries and/or have a battery reclamation point? I...gas turbines (greater than 1 MBtuhr) - bulk gasoline terminals - municipal waste combustors - sulfuric and nitric acid plants - rotogravure printers

  6. Unsuspected task for an old team: succinate, fumarate and other Krebs cycle acids in metabolic remodeling.

    PubMed

    Bénit, Paule; Letouzé, Eric; Rak, Malgorzata; Aubry, Laetitia; Burnichon, Nelly; Favier, Judith; Gimenez-Roqueplo, Anne-Paule; Rustin, Pierre

    2014-08-01

    Seventy years from the formalization of the Krebs cycle as the central metabolic turntable sustaining the cell respiratory process, key functions of several of its intermediates, especially succinate and fumarate, have been recently uncovered. The presumably immutable organization of the cycle has been challenged by a number of observations, and the variable subcellular location of a number of its constitutive protein components is now well recognized, although yet unexplained. Nonetheless, the most striking observations have been made in the recent period while investigating human diseases, especially a set of specific cancers, revealing the crucial role of Krebs cycle intermediates as factors affecting genes methylation and thus cell remodeling. We review here the recent advances and persisting incognita about the role of Krebs cycle acids in diverse aspects of cellular life and human pathology. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Reinvestigation of Brevibacterium sp. Strain KY-4313 as a Source of Canthaxanthin

    PubMed Central

    Nelis, H. J.; De Leenheer, A. P.

    1989-01-01

    The hydrocarbon-utilizing Brevibacterium sp. strain KY-4313 was reevaluated for its potential to produce canthaxanthin, a carotenoid pigment of strong commercial interest. Three approaches were used to optimize the canthaxanthin yield from this organism, i.e., the preparation of mutants, the addition of supposedly carotenogenic chemicals to the growth medium, and growth promotion. Following treatment of the parent strain with N-nitrosomethylurea, a presumed mutant was isolated which showed a 32% increase in cellular canthaxanthin content. No effective carotenogenic chemicals were found in connection with hydrocarbon fermentations, in which mainly growth promotion through periodic medium renewal proved conducive to enhanced pigment production. Carotenogenesis could be stimulated in brain heart infusion broth by adding alcohols or retinol. Improved growth in this medium was generally not associated with higher canthaxanthin yields. Both superior growth and pigment levels were obtained in a newly designed medium based on fumaric acid-molasses. The maximum yields of canthaxanthin in shake flasks were (in milligrams per liter) 4.2 (brain heart infusion broth plus propanol-zinc sulfate), 3.6 (hydrocarbon medium), and 9.3 (fumaric acid-molasses), which represent a significant improvement over the originally reported optimal result (1 mg/liter). The corresponding yields of echinenone, the direct precursor of canthaxanthin, were 1.2, 1.6, and 2.3 mg/liter, respectively. Two-liter hydrocarbon batch fermentations involving medium renewal maximally produced 7.2 mg of canthaxanthin and 3.7 mg of echinenone per liter. PMID:16348027

  8. [Preparation and application on compound excipient of sodium stearyl fumarate and plasdone S-630].

    PubMed

    Jiang, Yan-Rong; Zhang, Zhen-Hai; Jia, Xiao-Bin

    2013-01-01

    The compound excipient containing sodium stearyl fumarate and plasdone S-630 was prepared by applying spray drying method. The basic physical properties of compound excipient were studied by solubility test, scanning electron microscope, differential scanning calorimeter, X-ray diffraction and Fourier transform infra-red spectroscopy. The effect of compound excipient on moisture absorption and ferulic acid in vitro dissolution of spray drying power of angelica were investigated. The results showed that the chemical constituents of compound excipient did not change before and after spray drying. The water soluble compound excipient can improve significantly moisture absorption and has application prospect.

  9. Gateways to clinical trials.

    PubMed

    Tomillero, A; Moral, M A

    2009-04-01

    (+)-Dapoxetine hydrochloride, [(123)I]-BZA, 9-Aminocamptothecin; Abacavir sulfate/lamivudine, Adalimumab, Adefovir dipivoxil, Alemtuzumab, Alvocidib hydrochloride, Ambrisentan, Amsilarotene, Anacetrapib, Anakinra, Apricitabine, Aripiprazole, Arsenic trioxide, Atazanavir sulfate, Atazanavir/ritonavir, Atrasentan, Azacitidine; Banoxantrone, Bazedoxifene acetate, Bevacizumab, Bexarotene, Biphasic insulin aspart, Bortezomib, Bosentan, Bromfenac; Cachectin, Calcipotriol/betamethasone dipropionate, Canakinumab, Carfilzomib, CAT-354, CCX-282, Certolizumab pegol, Cetuximab, Choline fenofibrate, Clevudine, Clofarabine, CNTO-328, Corifollitropin alfa, Crofelemer; Daptomycin, Darbepoetin alfa, Darunavir, Dasatinib, Decitabine, Deferasirox, Denosumab, Duloxetine hydrochloride, Dutasteride; Emtricitabine, Enfuvirtide, Entecavir, Epoetin zeta, Erlotinib hydrochloride, Escitalopram oxalate, Eslicarbazepine acetate, Eszopiclone, Etravirine, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Farglitazar, Febuxostat, Fosamprenavir calcium, FX-06; Gabapentin enacarbil, Gefitinib; HIVIS DNA; Imatinib mesylate, INCB- 18424, Indacaterol, Inotuzumab ozogamicin, Insulin detemir; JNJ-26854165; Lacosamide, Landiolol, Laromustine, Lenalidomide, Liposomal doxorubicin, L-NAME, Lopinavir, Lopinavir/ritonavir, Lumiracoxib; Maraviroc, Mepolizumab, Methoxy polyethylene glycol- epoetin-beta, Miglustat, MK-0493, MVA-CMDR, Mycophenolic acid sodium salt; Natalizumab, Nepafenac, Neratinib, Neridronic acid, Nesiritide, Nilotinib hydrochloride monohydrate; Olmesartan medoxomil, Omacetaxine mepesuccinate, Omalizumab; Paclitaxel poliglumex, Palifermin, Patupilone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, PHA-848125, Pitavastatin calcium, Posaconazole, Povidone-iodine liposome complex, Prasugrel, Pregabalin, Prucalopride; Raltegravir potassium, Retigabine, Revaprazan hydrochloride, rhFSH, Rilpivirine, Rivaroxaban, Romidepsin, Rosuvastatin calcium, RWJ-676070; SAR-109659, Sitagliptin phosphate monohydrate, Sorafenib, Stavudine/Lamivudine/Nevirapine, Sunitinib malate; Tadalafil, Telaprevir, Telbivudine, Tenofovir disoproxil fumarate, Tenofovir disoproxil fumarate/emtricitabine, Tenofovir disoproxil fumarate/emtricitabine/efavirenz, Teriparatide, Tigecycline, Tiotropium bromide, Tipifarnib, Tipranavir, Tocilizumab, Trifluridine/TPI; UP-780; Vandetanib, Vardenafil hydrochloride hydrate, Vatalanib succinate, Vitespen, Vorinostat; Yttrium 90 (90Y) ibritumomab tiuxetan; Zoledronic acid monohydrate. Copyright 2009 Prous Science, S.A.U. or its licensors. All rights reserved.

  10. Cascade oxime formation, cyclization to a nitrone, and intermolecular dipolar cycloaddition.

    PubMed

    Furnival, Rachel C; Saruengkhanphasit, Rungroj; Holberry, Heather E; Shewring, Jonathan R; Guerrand, Hélène D S; Adams, Harry; Coldham, Iain

    2016-11-22

    Simple haloaldehydes, including enolisable aldehydes, were found to be suitable for the formation of cyclic products by cascade (domino) condensation, cyclisation, dipolar cycloaddition chemistry. This multi-component reaction approach to heterocyclic compounds was explored by using hydroxylamine, a selection of aldehydes, and a selection of activated dipolarophiles. Initial condensation gives intermediate oximes that undergo cyclisation with displacement of halide to give intermediate nitrones; these nitrones undergo in situ intermolecular dipolar cycloaddition reactions to give isoxazolidines. The cycloadducts from using dimethyl fumarate were treated with zinc/acetic acid to give lactam products and this provides an easy way to prepare pyrrolizinones, indolizinones, and pyrrolo[2,1-a]isoquinolinones. The chemistry is illustrated with a very short synthesis of the pyrrolizidine alkaloid macronecine and a formal synthesis of petasinecine.

  11. Correlation between degradation pathway and toxicity of acetaminophen and its by-products by using the electro-Fenton process in aqueous media.

    PubMed

    Le, Thi Xuan Huong; Nguyen, Thi Van; Amadou Yacouba, Zoulkifli; Zoungrana, Laetitia; Avril, Florent; Nguyen, Duy Linh; Petit, Eddy; Mendret, Julie; Bonniol, Valerie; Bechelany, Mikhael; Lacour, Stella; Lesage, Geoffroy; Cretin, Marc

    2017-04-01

    The evolution of the degradation by-products of an acetaminophen (ACE) solution was monitored by HPLC-UV/MS and IC in parallel with its ecotoxicity (Vibrio fischeri 81.9%, Microtox ® screening tests) during electro-Fenton (EF) oxidation performed on carbon felt. The aromatic compounds 2-hydroxy-4-(N-acetyl) aminophenol, 1,4-benzoquinone, benzaldehyde and benzoic acid were identified as toxic sub-products during the first stage of the electrochemical treatment, whereas aliphatic short-chain carboxylic acids (oxalic, maleic, oxamic, formic, acetic and fumaric acids) and inorganic ions (ammonium and nitrate) were well identified as non-toxic terminal sub-products. Electrogenerated hydroxyl radicals then converted the eco-toxic and bio-refractory property of initial ACE molecule (500 mL, 1 mM) and subsequent aromatic sub-products into non-toxic compounds after 2 h of EF treatment. The toxicity of every intermediate produced during the mineralization of ACE was quantified, and a relationship was established between the degradation pathway of ACE and the global toxicity evolution of the solution. After 8 h of treatment, a total organic carbon removal of 86.9% could be reached for 0.1 mM ACE at applied current of 500 mA with 0.2 mM of Fe 2+ used as catalyst. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Dimethyl Fumarate Selectively Reduces Memory T Cells and Shifts the Balance between Th1/Th17 and Th2 in Multiple Sclerosis Patients.

    PubMed

    Wu, Qi; Wang, Qin; Mao, Guangmei; Dowling, Catherine A; Lundy, Steven K; Mao-Draayer, Yang

    2017-04-15

    Dimethyl fumarate (DMF; trade name Tecfidera) is an oral formulation of the fumaric acid ester that is Food and Drug Administration approved for treatment of relapsing-remitting multiple sclerosis. To better understand the therapeutic effects of Tecfidera and its rare side effect of progressive multifocal leukoencephalopathy, we conducted cross-sectional and longitudinal studies by immunophenotyping cells from peripheral blood (particularly T lymphocytes) derived from untreated and 4-6 and 18-26 mo Tecfidera-treated stable relapsing-remitting multiple sclerosis patients using multiparametric flow cytometry. The absolute numbers of CD4 and CD8 T cells were significantly decreased and the CD4/CD8 ratio was increased with DMF treatment. The proportions of both effector memory T cells and central memory T cells were reduced, whereas naive T cells increased in treated patients. T cell activation was reduced with DMF treatment, especially among effector memory T cells and effector memory RA T cells. Th subsets Th1 (CXCR3 + ), Th17 (CCR6 + ), and particularly those expressing both CXCR3 and CD161 were reduced most significantly, whereas the anti-inflammatory Th2 subset (CCR3 + ) was increased after DMF treatment. A corresponding increase in IL-4 and decrease in IFN-γ and IL-17-expressing CD4 + T cells were observed in DMF-treated patients. DMF in vitro treatment also led to increased T cell apoptosis and decreased activation, proliferation, reactive oxygen species, and CCR7 expression. Our results suggest that DMF acts on specific memory and effector T cell subsets by limiting their survival, proliferation, activation, and cytokine production. Monitoring these subsets could help to evaluate the efficacy and safety of DMF treatment. Copyright © 2017 by The American Association of Immunologists, Inc.

  13. The Path of Carbon in Photosynthesis VIII. The Role of Malic Acid

    DOE R&D Accomplishments Database

    Bassham, James A.; Benson, Andrew A.; Calvin, Melvin

    1950-01-25

    Malonate has been found to inhibit the formation of malic acid during short periods of photosynthesis with radioactive carbon dioxide. This result, together with studies which show the photosynthetic cycle to be operating normally at the same time, indicates that malic acid is not an intermediate in photosynthesis but is probably closely related to some intermediate of the cycle. Absence of labeled succinic and fumaric acids in these experiments, in addition to the failure of malonate to inhibit photosynthesis, precludes the participation of these acids as intermediates in photosynthesis.

  14. Dicarboxylic acids generated by thermal alteration of kerogen and humic acids

    NASA Technical Reports Server (NTRS)

    Kawamura, Kimitaka; Kaplan, I. R.

    1987-01-01

    Significant amounts (up to 2 percent of organic geopolymers) of low-molecular-weight (LMW) dicarboxylic acids (C2-C10) have been detected during thermal alteration (270 C, 2 h) of kerogens and humic acids isolated from young or ancient lithified sediments. Their distribution is characterized by the predominance of oxalic acid followed by succinic, fumaric, and methylsuccinic acids. These acids are probably released by the breakdown of macromolecular structures, which have incorporated biogenic organic compounds, including diacids, during early digenesis in sediments. Because of their reactivity, LMW diacids may play geochemically important roles under natural conditions.

  15. Cocrystals of the antimalarial drug 11-azaartemisinin with three alkenoic acids of 1:1 or 2:1 stoichiometry.

    PubMed

    Nisar, Madiha; Wong, Lawrence W Y; Sung, Herman H Y; Haynes, Richard K; Williams, Ian D

    2018-06-01

    The stoichiometry, X-ray structures and stability of four pharmaceutical cocrystals previously identified from liquid-assisted grinding (LAG) of 11-azaartemisinin (11-Aza; systematic name: 1,5,9-trimethyl-14,15,16-trioxa-11-azatetracyclo[10.3.1.0 4,13 .0 8,13 ]hexadecan-10-one) with trans-cinnamic (Cin), maleic (Mal) and fumaric (Fum) acids are herein reported. trans-Cinnamic acid, a mono acid, forms 1:1 cocrystal 11-Aza:Cin (1, C 15 H 23 NO 4 ·C 9 H 8 O 2 ). Maleic acid forms both 1:1 cocrystal 11-Aza:Mal (2, C 15 H 23 NO 4 ·C 4 H 4 O 4 ), in which one COOH group is involved in self-catenation, and 2:1 cocrystal 11-Aza 2 :Mal (3, 2C 15 H 23 NO 4 ·C 4 H 4 O 4 ). Its isomer, fumaric acid, only affords 2:1 cocrystal 11-Aza 2 :Fum (4). All cocrystal formation appears driven by acid-lactam R 2 2 (8) heterosynthons with short O-H...O=C hydrogen bonds [O...O = 2.56 (2) Å], augmented by weaker C=O...H-N contacts. Despite a better packing efficiency, cocrystal 3 is metastable with respect to 2, probably due to a higher conformational energy for the maleic acid molecule in its structure. In each case, the microcrystalline powders from LAG were useful in providing seeding for the single-crystal growth.

  16. Enhanced rhizosphere colonization of beneficial Bacillus amyloliquefaciens SQR9 by pathogen infection.

    PubMed

    Liu, Yunpeng; Zhang, Nan; Qiu, Meihua; Feng, Haichao; Vivanco, Jorge M; Shen, Qirong; Zhang, Ruifu

    2014-04-01

    Root exudates play important roles in root-soil microorganism interactions and can mediate tripartite interactions of beneficial microorganisms-plant-pathogen in the rhizosphere. However, the roles of organic acid components in this process have not been well studied. In this study the colonization of a plant growth-promoting rhizobacterium, Bacillus amyloliquefaciens SQR9, on cucumber root infected by Fusarium oxysporum f. sp. cucumerinum J. H. Owen (FOC) was investigated. Chemotaxis and biofilm formation response of SQR9 to root exudates and their organic acid components were analysed. Infection of FOC on cucumber had a positive effect (3.30-fold increase) on the root colonization of SQR9 compared with controls. Root secretion of citric acid (2.3 ± 0.2 μM) and fumaric acid (5.7 ± 0.5 μM) was enhanced in FOC-infected cucumber plants. Bacillus amyloliquefaciens SQR9 exhibited enhanced chemotaxis to root exudates of FOC-infected cucumber seedlings. Further experiments demonstrated that citric acid acts as a chemoattractant and fumaric acid as a stimulator of biofilm formation in this process. These results suggest that root exudates mediate the interaction of cucumber root and rhizosphere strain B. amyloliquefaciens SQR9 and enhance its root colonization. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  17. Organic reactions catalyzed by methylrhenium trioxide: Reactions of ethyl diazoacetate and organic azides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Z.; Espenson, J.H.

    1996-10-16

    Methylrhenium trioxide (CH{sub 3}ReO{sub 3} or MTO) catalyzes several classes of reactions of ethyl diazoacetate, EDA. It is the first high valent oxo complex for carbene transfer. Under mild conditions and in the absence of other substrates, EDA was converted to a 9:1 mixture of diethyl maleate and diethyl fumarate. In the presence of alcohols, {alpha}-alkoxy ethyl acetates were obtained in good yield. The yields dropped for the larger and more branched alcohols, the balance of material being diethyl maleate and fumarate. An electron-donating group in the para position of phenols favors the formation of {alpha}-phenoxy ethyl acetates. The usemore » of EDA to form {alpha}-thio ethyl acetates and N-substituted glycine ethyl esters, on the other hand, is hardly affected by the size or structure of the parent thiol or amine, with all of these reactions proceeding in high yield. MTO-catalyzed cycloaddition reactions occur between EDA and aromatic imines, olefins, and carbonyl compounds. Three-membered ring products are formed: aziridines, cyclopropanes, and epoxides, respectively. The reactions favor the formation of trans products, and provide a convenient route for the preparation of aziridines. Intermediate carbenoid and nitrenoid species have been proposed. In the presence of an oxygen source such as an epoxide, ethyl diazoacetate and azibenzil are converted to an oxalic acid monoethyl ester and to benzil; at the same time the epoxide was converted to an olefin. 75 refs., 1 fig., 7 tabs.« less

  18. Budesonide + formoterol fumarate dihydrate for the treatment of asthma.

    PubMed

    Wolthers, Ole D

    2016-01-01

    One of the most widely used fixed combinations in asthma management is dry powder budesonide+formoterol fumarate dihydrate which is commercially available as Symbicort Turbuhaler(®) (and generic products), Easyhaler Bufomix(®) and DuoRespSpiromax(®) inhaler. The aim of this paper was to review the fixed dry powder combination of inhaled budesonide+formoterol fumarate dihydrate for asthma treatment in adolescents and adults. A literature search using relevant search terms, reference lists for reviews and meta-analyses was performed. In symptomatic adolescent and adult patients with asthma maintenance and reliever therapy with a single-inhaler fixed combination of dry powder budesonide+formoterol fumarate dihydrate is an evidenced option. The combination treatment is convenient to patients. It reduces the number of exacerbations requiring treatment with oral corticosteroids. In some patients the strategy may also reduce the total intake of inhaled corticosteroids over time. Whether important outcome measures of asthma treatment, such as hospital admission and emergency room visit rates, may be reduced is less well documented since the published studies may have been influenced by publication bias. Non-pharmaceutical company-sponsored research evaluating such measures is needed. There is no evidence for the use of single inhaler fixed combinations of inhaled corticosteroids+long-acting β(2)-agonists in children (<12 years of age), and budesonide+formoterol fumarate dihydrate should not be prescribed to the age group.

  19. Simultaneous Determination of Formoterol Fumarate and Budesonide Epimers in Metered Dose Inhaler Using Ion-Pair Chromatography.

    PubMed

    Salem, Y A; Shaldam, M A; El-Sherbiny, D T; El-Wasseef, D R; El-Ashry, S M

    2017-11-01

    A simple, accurate and valid ion-pairing chromatographic method was developed for the simultaneous determination of formoterol fumarate (FF) and budesonide (BUD) epimers in metered dose inhaler. The separation was performed on C-18 column using mobile phase consisting of acetonitrile:0.05 M sodium acetate buffer (40:60% v/v) containing 0.03% sodium dodecyl sulfate adjusted to pH 3.1 using increasing volumes of either TEA or orthophosphoric acid isocratically eluted at 1.0 mL/min. Quantitation was achieved with UV detection at 214 nm. The retention times were 3.22, 6.41 and 6.91 min for formoterol fumarate, budesonide epimers B and A, respectively. The linearity range was 0.05-5.0 μg/mL for formoterol fumarate and 0.5-50.0 μg/mL for budesonide. The method was validated for, linearity; lower limit of quantification, lower limit of detection accuracy and precision. The proposed method is rapid (7 min), reproducible (RSD < 2.0%) and achieves satisfactory resolution between FF and BUD B (resolution factor = 12.07). The mean recoveries of the analytes in metered dose inhaler (99.97 and 99.83% for FF and BUD, respectively) were satisfactory. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Growth of a Strictly Anaerobic Bacterium on Furfural (2-Furaldehyde)

    PubMed Central

    Brune, Gerhard; Schoberth, Siegfried M.; Sahm, Hermann

    1983-01-01

    A strictly anaerobic bacterium was isolated from a continuous fermentor culture which converted the organic constituents of sulfite evaporator condensate to methane and carbon dioxide. Furfural is one of the major components of this condensate. This furfural isolate could degrade furfural as the sole source of carbon and energy in a defined mineral-vitamin-sulfate medium. Acetic acid was the major fermentation product. This organism could also use ethanol, lactate, pyruvate, or fumarate and contained cytochrome c3 and desulfoviridin. Except for furfural degradation, the characteristics of the furfural isolate were remarkably similar to those of the sulfate reducer Desulfovibrio gigas. The furfural isolate has been tentatively identified as Desulfovibrio sp. strain F-1. Images PMID:16346423

  1. Haloarchaea Endowed with Phosphorus Solubilization Attribute Implicated in Phosphorus Cycle

    PubMed Central

    Yadav, Ajar Nath; Sharma, Divya; Gulati, Sneha; Singh, Surender; Dey, Rinku; Pal, Kamal Krishna; Kaushik, Rajeev; Saxena, Anil Kumar

    2015-01-01

    Archaea are unique microorganisms that are present in ecological niches of high temperature, pH and salinity. A total of 157 archaea were obtained from thirteen sediment, water and rhizospheric soil samples collected from Rann of Kutch, Gujarat, India. With an aim to screen phosphate solubilizing archaea, a new medium was designed as Haloarchaea P Solubilization (HPS) medium. The medium supported the growth and P solubilization activity of archaea. Employing the HPS medium, twenty isolates showed the P-solubilization. Phosphate solubilizing archaea were identified as seventeen distinct species of eleven genera namely Haloarcula, Halobacterium, Halococcus, Haloferax, Halolamina, Halosarcina, Halostagnicola, Haloterrigena, Natrialba, Natrinema and Natronoarchaeum. Natrinema sp. strain IARI-WRAB2 was identified as the most efficient P-solubilizer (134.61 mg/L) followed by Halococcus hamelinensis strain IARI-SNS2 (112.56 mg/L). HPLC analysis detected seven different kinds of organic acids, namely: gluconic acid, citric acid, formic acid, fumaric acid succinic acid, propionic acid and tartaric acid from the cultures of these isolates. These phosphate solubilizing halophilic archaea may play a role in P nutrition to vegetation growing in these hypersaline soils. This is the first report for these haloarchaea to solubilize considerable amount of P by production of organic acids and lowering of pH. PMID:26216440

  2. A comparative pharmacokinetic and tolerability analysis of the novel orotic acid salt form of tenofovir disoproxil and the fumaric acid salt form in healthy subjects

    PubMed Central

    Kim, Yu Kyong; Choi, Mun Ju; Oh, Tae Young; Yu, Kyung-Sang; Lee, SeungHwan

    2017-01-01

    A novel orotic acid salt form of tenofovir disoproxil (DA-2802) was developed and is expected to replace the fumaric acid salt form. The pharmacokinetic (PK) characteristics and tolerability profiles of DA-2802 were compared to those of tenofovir disoproxil fumarate (TDF, Viread®) in healthy subjects. A randomized, open-label, single-dose study was conducted in 36 healthy subjects using a two-treatment, two-period, and two-sequence crossover design. Subjects received a single oral dose of 319 mg DA-2802 or 300 mg TDF, during each period, with a 7-day washout. Serial blood samples were collected pre-dosing and up to 72 hours post-dosing in each period, for determination of serum tenofovir concentration, which was measured by ultra-performance liquid chromatography-tandem mass spectrometry. A non-compartmental method was used to obtain PK parameters of tenofovir. For comparison between the two tenofovir disoproxil salts, the 90% confidence intervals (90% CIs) of geometric mean ratios of DA-2802 to TDF for the maximum concentration (Cmax) and the area under the concentration–time curve to the last quantifiable concentration (AUC0–t) were determined. The tolerability profiles of tenofovir were assessed by evaluation of adverse events and vital signs, physical examination, ECG, and clinical laboratory tests. The serum tenofovir concentration–time profiles of DA-2802 or TDF were comparable in 32 subjects who completed the study. In both profiles, a two-compartmental elimination with first-order elimination kinetics in the terminal phase was reported in a few subjects, showing a secondary peak in the initial phase of elimination. The geometric mean ratio (90% CI) of DA-2802 to TDF was 0.898 (0.815–0.990) for Cmax and 0.904 (0.836–0.978) for AUC0–t. There were no clinically significant findings in the tolerability assessments. DA-2802 showed comparable PK characteristics and tolerability profiles to TDF. PMID:29158663

  3. Microbiologically Influenced Corrosion: an Update

    DTIC Science & Technology

    2014-01-01

    with simulated YM waters stressed the importance of nitrate in groundwater as an inhibitor for localised corrosion.63 Little59 reviewed the data and...8 In the absence of sulphate, many SRB ferment organic acids and alcohols. Some SRB can reduce nitrate, sulphite, thiosul- phate or fumarate, in

  4. 21 CFR 172.826 - Sodium stearyl fumarate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...

  5. 21 CFR 172.826 - Sodium stearyl fumarate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...

  6. 21 CFR 172.826 - Sodium stearyl fumarate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... Sodium stearyl fumarate. Sodium stearyl fumarate may be safely used in food in accordance with the following conditions: (a) It contains not less than 99 percent sodium stearyl fumarate calculated on the...

  7. 21 CFR 172.826 - Sodium stearyl fumarate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...

  8. A study of the properties of compacts from silicified microcrystalline celluloses.

    PubMed

    Muzíková, Jitka; Nováková, Petra

    2007-07-01

    The paper deals with a study of tensile strength and disintegration time of compacts made from silicified microcrystalline celluloses, Prosolv SMCC 90, and Prosolv HD 90, in dependence on compression force, addition of two types of lubricants, and two active ingredients. The lubricants were magnesium stearate and sodium stearyl fumarate in a concentration of 0.5%, the active ingredients being ascorbic acid and acetylsalicylic acid in a concentration of 50%. Prosolv SMCC 90 proved to be better compatible than Prosolv HD 90; the compacts were of higher strength, which was markedly increased with increasing compression force. Prosolv HD 90 was more sensitive to additions of lubricants, and a greater decrease in strength was recorded due to the influence of sodium stearyl fumarate. The effect of lubricants on the strength of compacts in the presence of active ingredients was not identical. The disintegration time of compacts from Prosolv HD 90 without as well as with lubricants was shorter than from Prosolv SMCC 90 and was increasing with increasing compression force. Disintegration time was increased with added lubricants, and it was markedly shortened by addition of active ingredients. Compacts containing ascorbic acid possessed a shorter disintegration time than those containing acetylsalicylic acid, and it was not markedly influenced by the presence of lubricants.

  9. Progressive multifocal leukoencephalopathy in patients treated with fumaric acid esters: a review of 19 cases.

    PubMed

    Gieselbach, Robbert-Jan; Muller-Hansma, Annemarie H; Wijburg, Martijn T; de Bruin-Weller, Marjolein S; van Oosten, Bob W; Nieuwkamp, Dennis J; Coenjaerts, Frank E; Wattjes, Mike P; Murk, Jean-Luc

    2017-06-01

    Progressive multifocal leukoencephalopathy (PML) is a rare and potentially fatal condition caused by a brain infection with JC polyomavirus (JCV). PML develops almost exclusively in immunocompromised patients and has recently been associated with use of fumaric acid esters (FAEs), or fumarates. We reviewed the literature and the Dutch and European pharmacovigilance databases in order to identify all available FAE-associated PML cases and distinguish possible common features among these patients. A total of 19 PML cases associated with FAE use were identified. Five cases were associated with FAE use for multiple sclerosis and 14 for psoriasis. Ten patients were male and nine were female. The median age at PML diagnosis was 59 years. The median duration of FAE therapy to PML symptom onset or appearance of first PML lesion on brain imaging was 31 months (range 6-110). In all cases a certain degree of lymphocytopenia was reported. The median duration of lymphocytopenia to PML symptom onset was 23 months (range 6-72). The median lymphocyte count at PML diagnosis was 414 cells/µL. CD4 and CD8 counts were reported in ten cases, with median cell count of 137 and 39 cells/µL, respectively. Three patients died (16% mortality). The association between occurrence of PML in patients with low CD4 and CD8 counts is reminiscent of PML cases in the HIV population and suggests that loss of T cells is the most important risk factor.

  10. Direct measurement of backflux between oxaloacetate and fumarate following pyruvate carboxylation.

    PubMed

    Brekke, Eva; Walls, Anne B; Nørfeldt, Lasse; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

    2012-01-01

    Pyruvate carboxylation (PC) is thought to be the major anaplerotic reaction for the tricarboxylic acid cycle and is necessary for de novo synthesis of amino acid neurotransmitters. In the brain, the main enzyme involved is pyruvate carboxylase, which is predominantly located in astrocytes. Carboxylation leads to the formation of oxaloacetate, which condenses with acetyl coenzyme A to form citrate. However, oxaloacetate may also be converted to malate and fumarate before being regenerated. This pathway is termed the oxaloacetate-fumarate-flux or backflux. Carbon isotope-based methods for quantification of activity of PC lead to underestimation when backflux is not taken into account and critical errors have been made in the interpretation of results from metabolic studies. This study was conducted to establish the degree of backflux after PC in cerebellar and neocortical astrocytes. Astrocyte cultures from cerebellum or neocortex were incubated with either [3-(13) C] or [2-(13) C]glucose, and extracts were analyzed using mass spectrometry or nuclear magnetic resonance spectroscopy. Substantial PC compared with pyruvate dehydrogenase activity was observed, and extensive backflux was demonstrated in both types of astrocytes. The extent of backflux varied between the metabolites, reaffirming that metabolism is highly compartmentalized. By applying our calculations to published data, we demonstrate the existence of backflux in vivo in cat, rat, mouse, and human brain. Thus, backflux should be taken into account when calculating the magnitude of PC to allow for a more precise evaluation of cerebral metabolism. Copyright © 2011 Wiley Periodicals, Inc.

  11. Tracking the degradation of fresh orange juice and discrimination of orange varieties: an example of NMR in coordination with chemometrics analyses.

    PubMed

    de Oliveira, Clayton R; Carneiro, Renato L; Ferreira, Antonio G

    2014-12-01

    Brazil is currently the largest exporter of concentrated orange juice and, unlike the other exporter countries, the domestic consumption is mainly based on the fresh orange juice. The quality control by evaluating the major chemical constituents under the influence of the most important factors, such as temperature and storage time of the product, is very important in this context. Therefore, the objective of this study was to evaluate the influence of temperature and time on the degradation of fresh orange juice for 24h, by using (1)H NMR technique and chemometric tools for data mining. The storage conditions at 24h led to the production of the formic, fumaric and acetic acids; and an increase of succinic and lactic acids and ethanol, which were observed at low concentration at the initial time. Furthermore, analysis by PCA has successfully distinguished the juice of different species/varieties as well as the metabolites responsible for their separation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Organic acids from root exudates of banana help root colonization of PGPR strain Bacillus amyloliquefaciens NJN-6

    PubMed Central

    Yuan, Jun; Zhang, Nan; Huang, Qiwei; Raza, Waseem; Li, Rong; Vivanco, Jorge M.; Shen, Qirong

    2015-01-01

    The successful colonization of plant growth promoting rhizobacteria (PGPR) in the rhizosphere is an initial and compulsory step in the protection of plants from soil-borne pathogens. Therefore, it is necessary to evaluate the role of root exudates in the colonization of PGPR. Banana root exudates were analyzed by high pressure liquid chromatography (HPLC) which revealed exudates contained several organic acids (OAs) including oxalic, malic and fumaric acid. The chemotactic response and biofilm formation of Bacillus amyloliquefaciens NJN-6 were investigated in response to OA’s found in banana root exudates. Furthermore, the transcriptional levels of genes involved in biofilm formation, yqxM and epsD, were evaluated in response to OAs via quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Results suggested that root exudates containing the OAs both induced the chemotaxis and biofilm formation in NJN-6. In fact, the strongest chemotactic and biofilm response was found when 50 μM of OAs were applied. More specifically, malic acid showed the greatest chemotactic response whereas fumaric acid significantly induced biofilm formation by a 20.7–27.3% increase and therefore biofilm formation genes expression. The results showed banana root exudates, in particular the OAs released, play a crucial role in attracting and initiating PGPR colonization on the host roots. PMID:26299781

  13. Escherichia coli mutant with altered respiratory control of the frd operon.

    PubMed Central

    Iuchi, S; Kuritzkes, D R; Lin, E C

    1985-01-01

    In wild-type Escherichia coli, fumarate reductase encoded by the frd operon is inducible by its substrate in the absence of molecular oxygen and nitrate. Synthesis of this enzyme under permissive conditions requires the fnr+ gene product, which is believed to be a pleiotropic regulatory protein that activates transcription. A spontaneous mutant was isolated in which the expression of the frd operon no longer depended on the presence of fumarate or the fnr+ gene product. Aerobic repression of the operon was abolished, but nitrate repression remained intact. Transductional analysis showed that the mutation was closely linked to the frd locus. The mutant phenotype strongly suggests that repression by molecular oxygen and nitrate is mediated by different mechanisms. PMID:3882660

  14. Enhancing Aerobic Growth of Campylobacter in Media Supplemented with Organic Acids

    USDA-ARS?s Scientific Manuscript database

    The effect of agar and sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in was determined. A fumarate-pyruvate medium was supplemented with 0.0 to 0.2% agar and inoculated with Campylobacter coli, Campylobacter fetus, or Campylobacter jejuni. Portions of the inoculated me...

  15. Two Crystallographic Laboratory and Computational Exercises for Undergraduates.

    ERIC Educational Resources Information Center

    Lessinger, Leslie

    1988-01-01

    Describes two introductory exercises designed to teach the fundamental ideas and methods of crystallography, and to convey some important features of inorganic and organic crystal structures to students in an advanced laboratory course. Exercises include "The Crystal Structure of NiO" and "The Crystal Structure of Beta-Fumaric Acid." (CW)

  16. Temperature enhanced succinate production concurrent with increased central metabolism turnover in the cyanobacterium Synechocystis sp. PCC 6803.

    PubMed

    Hasunuma, Tomohisa; Matsuda, Mami; Kato, Yuichi; Vavricka, Christopher John; Kondo, Akihiko

    2018-05-27

    Succinate is a versatile petrochemical compound that can be produced by microorganisms, often from carbohydrate based carbon sources. Phototrophic cyanobacteria including Synechocystis sp. PCC 6803 can more efficiently produce organic acids such as succinate without sugar supplementation, via photosynthetic production of glycogen followed by glycogen utilization, typically under dark conditions. In this study, Synechocystis 6803 bioproduction of organic acids under dark anoxic conditions was found to increase with elevation of temperature from 30 °C to 37 °C. The further enhancement of succinate bioproduction by overexpression of the rate limiting enzyme phosphoenolpyruvate carboxylase resulted in improved glycogen utilization. To gain more insight into the mechanisms underlying the increased organic acid output, a novel temperature dependent metabolomics analysis was performed. Adenylate energy charge was found to decrease along with elevating temperature, while central metabolites glucose 6-phosphate, fructose 6-phosphate, fructose 1,6-bisphosphate, glycerol 3-phosphate, malate, fumarate and succinate increased. Temperature dependent 13 C-labeling metabolomics analysis further revealed a glycolysis to TCA bottleneck, which could be overcome by addition of CO 2 , leading to even higher organic acid production. Optimization of initial cell concentration to 25 g-dry cell weight/L, in combination with 100 mM NaHCO 3 supplementation, afforded a succinate titer of over 1.8 g/L, the highest reported autotrophic succinate titer. Succinate titers remained high after additional knockout of ackA, resulting in the highest reported autotrophic D-lactate titer as well. The optimization of Synechocystis 6803 organic acid production therefore holds significant promise for CO 2 capture and utilization. Copyright © 2018 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  17. Reductive Dehalogenation of Trichloroacetic Acid by Trichlorobacter thiogenes gen. nov., sp. nov.

    PubMed Central

    De Wever, Helene; Cole, James R.; Fettig, Michael R.; Hogan, Deborah A.; Tiedje, James M.

    2000-01-01

    A bacterium able to grow via reductive dechlorination of trichloroacetate was isolated from anaerobic soil enrichments. The isolate, designated strain K1, is a member of the δ proteobacteria and is related to other known sulfur and ferric iron reducers. In anaerobic mineral media supplemented with acetate and trichloroacetate, its doubling time was 6 h. Alternative electron donor and acceptors were acetoin and sulfur or fumarate, respectively. Trichloroacetate dehalogenation activity was constitutively present, and the dechlorination product was dichloroacetate and chloride. Trichloroacetate conversion seemed to be coupled to a novel sulfur-sulfide redox cycle, which shuttled electrons from acetate oxidation to trichloroacetate reduction. In view of its unique physiological characteristics, the name Trichlorobacter thiogenes is suggested for strain K1. PMID:10831402

  18. PA-1, a Versatile Anaerobe Obtained in Pure Culture, Catabolizes Benzenoids and Other Compounds in Syntrophy with Hydrogenotrophs, and P-2 plus Wolinella sp. Degrades Benzenoids

    PubMed Central

    Barik, Sudhakar; Brulla, W. J.; Bryant, M. P.

    1985-01-01

    Methanogenic enrichments catabolizing 13 mM phenylacetate or 4 mM phenol were established at 37°C, using a 10% inoculum from a municipal anaerobic digester. By using agar roll tubes of the basal medium plus 0.1% yeast extract-25 mM fumarate, a hydrogenotrophic lawn of Wolinella succinogenes and phenol or phenylacetate, strains P-2 and PA-1, respectively, were isolated in coculture with W. succinogenes. With the lawn deleted, PA-1 was isolated in pure culture. Strain P-2 is apparently a new species of anaerobic, motile, gram-negative, spindle-shaped, small rod that as yet has been grown only in coculture with W. succinogenes. It used phenol, hydrocinnamate, benzoate, and phenylacetate as energy sources. Product recovery by the coculture, per mole of phenol and 4.4 mol of fumarate used, included 2.03, 0.12, 0.08, and 3.23 mol, respectively, of acetate, propionate, butyrate, and succinate. Carbon recovery was 75% and H recovery was 80%, although CO2 and a few other possible products were not determined. That P-2 is an obligate proton-reducing acetogen and possible pathways for its degradation of phenol are discussed. Strain PA-1 is apparently a new species of anaerobic, motile, relatively small, gram-negative rod. It utilized compounds such as phenylacetate, hydrocinnamate, benzoate, phenol, resorcinol, gallate, 4-aminophenol, 2-aminobenzoate, pyruvate, Casamino Acids, and aspartate as energy sources in coculture with W. succinogenes. Per mole of phenylacetate and 1.44 mol of fumarate used, 1.04, 0.53, and 0.78 mol of acetate, propionate, and succinate, respectively, were recovered from the coculture. Only about 50% of the carbon and H were recovered. In coculture with Methanospirillum hungatei, 0.96 mol of acetate and 0.25 mol of methane were recovered per mol of pyruvate used; 0.90 mol of acetate and 0.33 mol of methane, per mol of fumarate used; 0.93 mol of acetate and 0.54 mol of methane, per mol of aspartate used; and 1.71 mol of acetate and 0.57 mol of methane, per mol of glucose used. Carbon and H recoveries, assuming CO2 and ammonia were produced in stoichiometric amounts, were 97 and 98% for pyruvate, 72.5 and 82% for fumarate, 96.5 and 98% for aspartate, and 61.8 and 76% for glucose. No explanation such as contamination could be found for the fact that the coculture PA-1 plus Wolinella sp. did not use glucose; after growth with M. hungatei on pyruvate, however, the latter coculture used glucose. The PA-1 pure culture produced 0.86 mol of propionate per mol of succinate used during growth. PA-1 produced a small amount of H2. Strain PA-1 is the most versatile anaerobic bacterium yet known that catabolizes monobenzenoids in the absence of electron acceptors such as sulfate or nitrate. PMID:16346852

  19. Top Value Added Chemicals from Biomass - Volume I, Results of Screening for Potential Candidates from Sugars and Synthesis Gas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    2004-08-01

    This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol.

  20. Top Value Added Chemicals from Biomass: Volume I -- Results of Screening for Potential Candidates from Sugars and Synthesis Gas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Werpy, T.; Petersen, G.

    2004-08-01

    This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol.

  1. Preparation, Characterization and Evaluation of Quetiapine Fumarate Solid Lipid Nanoparticles to Improve the Oral Bioavailability

    PubMed Central

    Narala, Arjun; Veerabrahma, Kishan

    2013-01-01

    Quetiapine fumarate is an antipsychotic drug with poor oral bioavailability (9%) due to first-pass metabolism. Present work is an attempt to improve oral bioavailability of quetiapine fumarate by incorporating in solid lipid nanoparticles (SLN). Six quetiapine fumarate SLN formulations were developed using three different lipids by hot homogenisation followed by ultrasonication. The drug excipient compatibility was studied by differential scanning calorimetry (DSC). Stable quetiapine fumarate SLNs having a mean particle size of 200–250 nm with entrapment efficiency varying in between 80% and 92% were developed. The physical stability of optimized formulation F3 was checked at room temperature for 2 months. Comparative bioavailability studies were conducted in male Wistar rats after oral administration of quetiapine fumarate suspension and SLN formulation. The relative bioavailability of quetiapine fumarate from optimized SLN preparation was increased by 3.71 times when compared with the reference quetiapine fumarate suspension. The obtained results are indicative of SLNs as potential lipid carriers for improving the bioavailability of quetiapine fumarate by minimizing first-pass metabolism. PMID:26555970

  2. Impact of an energy-conserving strategy on succinate production under weak acidic and anaerobic conditions in Enterobacter aerogenes.

    PubMed

    Tajima, Yoshinori; Yamamoto, Yoko; Fukui, Keita; Nishio, Yousuke; Hashiguchi, Kenichi; Usuda, Yoshihiro; Sode, Koji

    2015-06-11

    Succinate is an important C4 building block chemical, and its production via fermentative processes in bacteria has many practical applications in the biotechnology field. One of the major goals of optimizing the bacterium-based succinate production process is to lower the culture pH from the current neutral conditions, as this would reduce total production costs. In our previous studies, we selected Enterobacter aerogenes, a rapid glucose assimilator at pH 5.0, in order to construct a metabolically engineered strain that could produce succinate under weakly acidic conditions. This engineered strain produced succinate from glucose with a 72.7% (g/g) yield at pH 5.7, with a volumetric productivity of 0.23 g/L/h. Although this demonstrates proof-of-concept that bacterium-based succinate fermentation can be improved under weakly acidic conditions, several parameters still required further optimization. In this study, we genetically modified an E. aerogenes strain previously developed in our laboratory in order to increase the production of ATP during succinate synthesis, as we inferred that this would positively impact succinate biosynthesis. This led to the development of the ES08ΔptsG strain, which contains the following modifications: chromosomally expressed Actinobacillus succinogenes phosphoenolpyruvate carboxykinase, enhanced fumarate reductase, inactivated pyruvate formate lyase, pyruvate oxidase, and glucose-phosphotransferase permease (enzyme IIBC(Glc)). This strain produced 55.4 g/L succinate from glucose, with 1.8 g/L acetate as the major byproduct at pH 5.7 and anaerobic conditions. The succinate yield and volumetric productivity of this strain were 86.8% and 0.92 g/L/h, respectively. Focusing on increasing net ATP production during succinate synthesis leads to increased succinate yield and volumetric productivity in E. aerogenes. We propose that the metabolically engineered E. aerogenes ES08ΔptsG strain, which effectively produces succinate under weakly acidic and anaerobic conditions, has potential utility for economical succinate production.

  3. UV and γ-ray resistance of poly(N-methylmaleimide-alt-isobutene) and poly(diisopropyl fumarate) as transparent polymer films

    NASA Astrophysics Data System (ADS)

    Imaizumi, Ryota; Furuta, Masakazu; Okamura, Haruyuki; Matsumoto, Akikazu

    2017-09-01

    UV and γ-ray resistance of transparent polymers obtained by radical polymerization of maleic and fumaric acid derivatives, i.e., an alternating copolymer of N-methylmaleimide and isobutene (PMI) and poly(diisopropyl fumarate) (PDiPF), was investigated. Transmittance in UV and visible regions of these polymers were examined after UV irradiation and compared with the results for poly(methyl methacrylate) (PMMA) and polycarbonate (PC) as conventional transparent polymers. The order of stability toward UV irradiation was PMMA≈PDiPF>PMI>>PC, deduced from changes in the transmittance of 380 nm light. Tensile mechanical properties, such as elastic modulus, maximum strength, and elongation values of PMI, PDiPF, and PMMA were also investigated after UV and γ-radiation. UV irradiation induced the side chain scission of PMI and PDiPF via Norrish I type reaction as well as crosslinking by combination between formed polymer radicals, leading to deterioration in their optical and mechanical properties. γ-radiation induced significant changes in molecular weight and mechanical properties of the polymers. In conclusion, PMI exhibited unchanged mechanical properties and PDiPF maintained its high transparency under various irradiation conditions.

  4. Efficient Formation of Light-Absorbing Polymeric Nanoparticles from the Reaction of Soluble Fe(III) with C4 and C6 Dicarboxylic Acids.

    PubMed

    Tran, Ashley; Williams, Geoffrey; Younus, Shagufta; Ali, Nujhat N; Blair, Sandra L; Nizkorodov, Sergey A; Al-Abadleh, Hind A

    2017-09-05

    The role of transition metals in the formation and aging of secondary organic aerosol (SOA) from aliphatic and aromatic precursors in heterogeneous/multiphase reactions is not well understood. The reactivity of soluble Fe(III) toward known benzene photooxidation products that include fumaric (trans-butenedioic) and muconic (trans,trans-2,4-hexadienedioic) acids was investigated. Efficient formation of brightly colored nanoparticles was observed that are mostly rod- or irregular-shaped depending on the structure of the organic precursor. The particles were characterized for their optical properties, growth rate, elemental composition, iron content, and oxidation state. Results indicate that these particles have mass absorption coefficients on the same order as black carbon and larger than that of biomass burning aerosols. The particles are also amorphous in nature and consist of polymeric chains of Fe centers complexed to carboxylate groups. The oxidation state of Fe was found to be in between Fe(III) and Fe(II) in standard compounds. The organic reactant to iron molar ratio and pH were found to affect the particle growth rate. Control experiments using maleic acid (cis-butenedioic acid) and succinic acid (butanedioic acid) produced no particles. The formation of particles reported herein could account for new pathways that lead to SOA and brown carbon formation mediated by transition metals. In addition, the multiple chemically active components in these particles (iron, organics, and acidic groups) may have an effect on their chemical reactivity (enhanced uptake of trace gases, catalysis, and production of reactive oxygen species) and their likely poor cloud/ice nucleation properties.

  5. Single-agent tenofovir versus combination emtricitabine plus tenofovir for pre-exposure prophylaxis for HIV-1 acquisition: an update of data from a randomised, double-blind, phase 3 trial.

    PubMed

    Baeten, Jared M; Donnell, Deborah; Mugo, Nelly R; Ndase, Patrick; Thomas, Katherine K; Campbell, James D; Wangisi, Jonathan; Tappero, Jordan W; Bukusi, Elizabeth A; Cohen, Craig R; Katabira, Elly; Ronald, Allan; Tumwesigye, Elioda; Were, Edwin; Fife, Kenneth H; Kiarie, James; Farquhar, Carey; John-Stewart, Grace; Kidoguchi, Lara; Coombs, Robert W; Hendrix, Craig; Marzinke, Mark A; Frenkel, Lisa; Haberer, Jessica E; Bangsberg, David; Celum, Connie

    2014-11-01

    Antiretroviral pre-exposure prophylaxis (PrEP), with daily oral tenofovir disoproxil fumarate or tenofovir disoproxil fumarate in combination with emtricitabine, has been shown to be efficacious for HIV-1 prevention. Although the use of more than one antiretroviral agent is essential for effective HIV-1 treatment, more than one agent might not be required for effective prophylaxis. We assessed the efficacy of single-agent tenofovir disoproxil fumarate relative to combination emtricitabine plus tenofovir disoproxil fumarate as PrEP. We did a randomised, double-blind, placebo-controlled three-group phase 3 trial of daily oral tenofovir disoproxil fumarate and emtricitabine plus tenofovir disoproxil fumarate PrEP in HIV-1 uninfected individuals in heterosexual HIV-1 serodiscordant couples from Kenya and Uganda. After an interim review, the trial's placebo group was discontinued and thereafter the active groups were continued, and participants initially randomly assigned to placebo were offered rerandomisation in a 1:1 ratio to tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate as PrEP. The primary endpoints were HIV-1 seroconversion and safety. This trial is registered with ClinicalTrials.gov, number NCT00557245. 4410 (99·6%) of 4427 couples received tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate and were followed up for HIV-1 acquisition. Of 52 incident HIV-1 infections, 31 occurred in individuals assigned tenofovir disoproxil fumarate (incidence 0·71 cases per 100 person-years) and 21 were in those assigned emtricitabine plus tenofovir disoproxil fumarate (0·48 cases per 100 person-years); HIV-1 incidence in the placebo group until discontinuation was two cases per 100 person-years. HIV-1 prevention efficacy with emtricitabine plus tenofovir disoproxil fumarate was not significantly different from that of tenofovir disoproxil fumarate alone (hazard ratio [HR] 0·67, 95% CI 0·39-1·17; p=0·16). Detection of tenofovir in plasma samples, compared with no detection and as measured in seroconverters and a subset of non-seroconverters, was associated with an 85% relative risk reduction in HIV-1 acquisition for the tenofovir disoproxil fumarate group (HR 0·15, 95% CI 0·06-0·37; p<0·0001) and 93% for the emtricitabine plus tenofovir disoproxil fumarate group (0·07, 0·02-0·23; p<0·0001). No significant differences were noted in the frequency of deaths, serious adverse events, or serum creatinine and phosphorus abnormalities between the two groups. These results do not rule out the potential for a slight difference in HIV-1 protection with tenofovir disoproxil fumarate compared with emtricitabine plus tenofovir disoproxil fumarate, but show that once-daily oral tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate regimens both provide high protection against HIV-1 acquisition in heterosexual men and women. Bill & Melinda Gates Foundation and US National Institutes of Health. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Non-Targeted Metabolomics Analysis of Golden Retriever Muscular Dystrophy-Affected Muscles Reveals Alterations in Arginine and Proline Metabolism, and Elevations in Glutamic and Oleic Acid In Vivo.

    PubMed

    Abdullah, Muhammad; Kornegay, Joe N; Honcoop, Aubree; Parry, Traci L; Balog-Alvarez, Cynthia J; O'Neal, Sara K; Bain, James R; Muehlbauer, Michael J; Newgard, Christopher B; Patterson, Cam; Willis, Monte S

    2017-07-29

    Like Duchenne muscular dystrophy (DMD), the Golden Retriever Muscular Dystrophy (GRMD) dog model of DMD is characterized by muscle necrosis, progressive paralysis, and pseudohypertrophy in specific skeletal muscles. This severe GRMD phenotype includes moderate atrophy of the biceps femoris (BF) as compared to unaffected normal dogs, while the long digital extensor (LDE), which functions to flex the tibiotarsal joint and serves as a digital extensor, undergoes the most pronounced atrophy. A recent microarray analysis of GRMD identified alterations in genes associated with lipid metabolism and energy production. We, therefore, undertook a non-targeted metabolomics analysis of the milder/earlier stage disease GRMD BF muscle versus the more severe/chronic LDE using GC-MS to identify underlying metabolic defects specific for affected GRMD skeletal muscle. Untargeted metabolomics analysis of moderately-affected GRMD muscle (BF) identified eight significantly altered metabolites, including significantly decreased stearamide (0.23-fold of controls, p = 2.89 × 10 -3 ), carnosine (0.40-fold of controls, p = 1.88 × 10 -2 ), fumaric acid (0.40-fold of controls, p = 7.40 × 10 -4 ), lactamide (0.33-fold of controls, p = 4.84 × 10 -2 ), myoinositol-2-phosphate (0.45-fold of controls, p = 3.66 × 10 -2 ), and significantly increased oleic acid (1.77-fold of controls, p = 9.27 × 10 -2 ), glutamic acid (2.48-fold of controls, p = 2.63 × 10 -2 ), and proline (1.73-fold of controls, p = 3.01 × 10 -2 ). Pathway enrichment analysis identified significant enrichment for arginine/proline metabolism (p = 5.88 × 10 -4 , FDR 4.7 × 10 -2 ), where alterations in L-glutamic acid, proline, and carnosine were found. Additionally, multiple Krebs cycle intermediates were significantly decreased (e.g., malic acid, fumaric acid, citric/isocitric acid, and succinic acid), suggesting that altered energy metabolism may be underlying the observed GRMD BF muscle dysfunction. In contrast, two pathways, inosine-5'-monophosphate (VIP Score 3.91) and 3-phosphoglyceric acid (VIP Score 3.08) mainly contributed to the LDE signature, with two metabolites (phosphoglyceric acid and inosine-5'-monophosphate) being significantly decreased. When the BF and LDE were compared, the most significant metabolite was phosphoric acid, which was significantly less in the GRMD BF compared to control and GRMD LDE groups. The identification of elevated BF oleic acid (a long-chain fatty acid) is consistent with recent microarray studies identifying altered lipid metabolism genes, while alterations in arginine and proline metabolism are consistent with recent studies identifying elevated L-arginine in DMD patient sera as a biomarker of disease. Together, these studies demonstrate muscle-specific alterations in GRMD-affected muscle, which illustrate previously unidentified metabolic changes.

  7. Gateways to clinical trials.

    PubMed

    Tomillero, A; Moral, M A

    2010-05-01

    O(6)-Benzylguanine; (-)-Gossypol; Abatacept, AC-2592, Adalimumab, AIDSVAX gp120 B/E, Alemtuzumab, Aliskiren fumarate, ALVAC E120TMG, Ambrisentan, Amlodipine, Anakinra, Aripiprazole, Armodafinil, Atomoxetine hydrochloride, Avotermin; Bevacizumab, BIBW-2992, Bortezomib, Bosentan, Botulinum toxin type B; Canakinumab, CAT-354, Ciclesonide, CMV gB vaccine, Corifollitropin alfa, Daptomycin, Darbepoetin alfa, Dasatinib, Denosumab; EndoTAG-1, Eplerenone, Esomeprazole sodium, Eszopiclone, Etoricoxib, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; F-50040, Fesoterodine fumavate, Fondaparinux sodium, Fulvestrant; Gabapentin enacarbil, Golimumab; Imatinib mesylate, Inhalable human insulin, Insulin glargine, Ivabradine hydrochloride; Lercanidipine hydrochloride/enalapril maleate, Levosimendan, Liposomal vincristine sulfate, Liraglutide; MDV-3100, Mometasone furoate/formoterol fumavate, Multiepitope CTL peptide vaccine, Mycophenolic acid sodium salt, Nabiximols, Natalizumab, Nesiritide; Obeticholic acid, Olmesartan medoxomil, Omalizumab, Omecamtiv mecarbil; Paclitaxel-eluting stent, Paliperidone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, Polymyxin B nonapeptide, PORxin-302, Prasugrel, Pregabalin, Pridopidine; Ranelic acid distrontium salt, Rasagiline mesilate, rDEN4delta30-4995, Recombinant human relaxin H2, rhFSH, Rilonacept, Rolofylline, Rosiglitazone maleate/metformin hydrochloride, Rosuvastatin calcium, Rotigotine; Salcaprozic acid sodium salt, Sirolimus-eluting stent, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tapentadol hydrochloride, Temsirolimus, Tenofovir, Tenofovir disoproxil fumarate, Teriparatide, Tiotropium bromide, Tocilizumab, Tolvaptan, Tozasertib, Treprostinil sodium; Ustekinumab; Vardenafil hydrochloride hydrate, Varenicline tartrate, Vatalanib succinate, Voriconazole, Vorinostat; Zotarolimus-eluting stent. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

  8. Electrochemical destruction of trans-cinnamic acid by advanced oxidation processes: kinetics, mineralization, and degradation route.

    PubMed

    Flores, Nelly; Thiam, Abdoulaye; Rodríguez, Rosa María; Centellas, Francesc; Cabot, Pere Lluís; Garrido, José Antonio; Brillas, Enric; Sirés, Ignasi

    2017-03-01

    Acidic solutions of trans-cinnamic acid at pH 3.0 have been comparatively treated by anodic oxidation with electrogenerated H 2 O 2 (AO-H 2 O 2 ), electro-Fenton (EF), and photoelectro-Fenton (PEF). The electrolytic experiments were carried out with a boron-doped diamond (BDD)/air-diffusion cell. The substrate was very slowly abated by AO-H 2 O 2 because of its low reaction rate with oxidizing • OH produced from water discharge at the BDD anode. In contrast, its removal was very rapid and at similar rate by EF and PEF due to the additional oxidation by • OH in the bulk, formed from Fenton's reaction between cathodically generated H 2 O 2 and added Fe 2+ . The AO-H 2 O 2 treatment yielded the lowest mineralization. The EF process led to persistent final products like Fe(III) complexes, which were quickly photolyzed upon UVA irradiation in PEF to give an almost total mineralization with 98 % total organic carbon removal. The effect of current density and substrate concentration on all the mineralization processes was examined. Gas chromatography-mass spectrometry (GC-MS) analysis of electrolyzed solutions allowed identifying five primary aromatics and one heteroaromatic molecule, whereas final carboxylic acids like fumaric, acetic, and oxalic were quantified by ion exclusion high-performance liquid chromatography (HPLC). From all the products detected, a degradation route for trans-cinnamic acid is proposed.

  9. Degradation of clofibric acid in acidic aqueous medium by electro-Fenton and photoelectro-Fenton.

    PubMed

    Sirés, Ignasi; Arias, Conchita; Cabot, Pere Lluís; Centellas, Francesc; Garrido, José Antonio; Rodríguez, Rosa María; Brillas, Enric

    2007-01-01

    Acidic aqueous solutions of clofibric acid (2-(4-chlorophenoxy)-2-methylpropionic acid), the bioactive metabolite of various lipid-regulating drugs, have been degraded by indirect electrooxidation methods such as electro-Fenton and photoelectro-Fenton with Fe(2+) as catalyst using an undivided electrolytic cell with a Pt anode and an O(2)-diffusion cathode able to electrogenerate H(2)O(2). At pH 3.0 about 80% of mineralization is achieved with the electro-Fenton method due to the efficient production of oxidant hydroxyl radical from Fenton's reaction between Fe(2+) and H(2)O(2), but stable Fe(3+) complexes are formed. The photoelectro-Fenton method favors the photodecomposition of these species under UVA irradiation, reaching more than 96% of decontamination. The mineralization current efficiency increases with rising metabolite concentration up to saturation and with decreasing current density. The photoelectro-Fenton method is then viable for treating acidic wastewaters containing this pollutant. Comparative degradation by anodic oxidation (without Fe(2+)) yields poor decontamination. Chloride ion is released during all degradation processes. The decay kinetics of clofibric acid always follows a pseudo-first-order reaction, with a similar rate constant in electro-Fenton and photoelectro-Fenton that increases with rising current density, but decreases at greater metabolite concentration. 4-Chlorophenol, 4-chlorocatechol, 4-chlororesorcinol, hydroquinone, p-benzoquinone and 1,2,4-benzenetriol, along with carboxylic acids such as 2-hydroxyisobutyric, tartronic, maleic, fumaric, formic and oxalic, are detected as intermediates. The ultimate product is oxalic acid, which forms very stable Fe(3+)-oxalato complexes under electro-Fenton conditions. These complexes are efficiently photodecarboxylated in photoelectro-Fenton under the action of UVA light.

  10. Crystal growth, structural, spectral, thermal, linear and nonlinear optical characterization of a new organic nonlinear chiral compound: L-tryptophan-fumaric acid-water (1/1/1) suitable for laser frequency conversion

    NASA Astrophysics Data System (ADS)

    Peer Mohamed, M.; Jayaprakash, P.; Nageshwari, M.; Rathika Thaya Kumari, C.; Sangeetha, P.; Sudha, S.; Mani, G.; Lydia Caroline, M.

    2017-08-01

    A new organic active nonlinear optical crystal L-tryptophan fumaric acid water (1/1/1), (C15H17N2 O7. H2O)(LTFAW), consisting of zwitterion tryptophan molecule in conjunction with a fumaric acid molecule and a water molecule was grown by slow solvent evaporation technique from aqueous solution. The organic chromophore crystallizes from water in its zwitterions exhibiting tabular habit in monoclinic system with acentric space group C2 (Z = 4). The sharp peaks observed in Powder X-ray diffractogram depicts the crystalline nature. The presence of functional groups in the grown crystal was analyzed using FT-IR spectrum. The carbon and hydrogen environment in molecular structure was investigated using FT-NMR technique using deuterated DMSO solution. Ultraviolet-visible spectral analysis reveal that the crystal possess lower cut-off wavelength down to 275 nm, is a key factor to exhibit Second Harmonic Generation (SHG) signal. The direct optical band gap is evaluated to be 5.28 eV from the UV absorption profile. The evaluation of optical constants by employing UV-visible absorbance data such as, extinction coefficient, reflectance, refractive index, optical conductivity are supportive towards good performance as NLO devices. Temperature of decomposition was investigated using thermogravimetric analysis/differential thermal analysis techniques (TG/DTA). The luminescence profile exhibited two peaks (362 nm, 683 nm) due to the donation of protons from carboxylic group to amino group. The nonlinear optical behavior from the noncentrosymmetric crystal was observed by the generation of frequency doubled (2ω) optical radiation when subjected to pulsed Nd:YAG laser (1064 nm, 10 ns, 10 Hz) using Kurtz-Perry method. The variation of dielectric constant (εʹ) and dielectric loss (εʹʹ) vs. Log f for the title compound was analysed at a few selected temperatures and frequencies.

  11. Design of oral agents for the management of multiple sclerosis: benefit and risk assessment for dimethyl fumarate

    PubMed Central

    Nicholas, Jacqueline Ann; Boster, Aaron Lee; Imitola, Jaime; O’Connell, Colleen; Racke, Michael Karl

    2014-01-01

    Dimethyl fumarate (DMF) is the most recent oral disease-modifying therapy approved by the US Food and Drug Administration and is indicated for the treatment of relapsing forms of multiple sclerosis (MS). Prior to approval for use in MS, DMF and its active metabolite, monomethyl fumarate, had been used for decades as two of the fumaric acid esters in Fumaderm®, a medication used in Europe for the treatment of psoriasis. The unique mechanism of action of DMF remains under evaluation; however, it has been shown to act through multiple pathways leading to shifts away from the Th1 proinflammatory response to the less inflammatory Th2 response. Preliminary data suggest that DMF may induce neuroprotective effects in central nervous system white matter, although further studies are needed to demonstrate these effects on inflammatory demyelination. The DMF Phase III clinical trials demonstrated its efficacy with regard to a reduction in the annualized relapse rate and reductions in new or enlarging T2 lesions and numbers of gadolinium-enhancing lesions on magnetic resonance imaging. DMF has a well-defined safety profile, given the experience with its use in the treatment of psoriasis, and more recently from the DMF clinical trials program and post-marketing era for treatment of MS. The safety profile and oral mode of administration of DMF place it as an attractive first-line therapy option for the treatment of relapsing forms of MS. Long-term observational studies will be needed to determine the effects of DMF on progression of disability in MS. PMID:25045248

  12. Modeling of the Reaction Mechanism of Enzymatic Radical C–C Coupling by Benzylsuccinate Synthase

    PubMed Central

    Szaleniec, Maciej; Heider, Johann

    2016-01-01

    Molecular modeling techniques and density functional theory calculations were performed to study the mechanism of enzymatic radical C–C coupling catalyzed by benzylsuccinate synthase (BSS). BSS has been identified as a glycyl radical enzyme that catalyzes the enantiospecific fumarate addition to toluene initiating its anaerobic metabolism in the denitrifying bacterium Thauera aromatica, and this reaction represents the general mechanism of toluene degradation in all known anaerobic degraders. In this work docking calculations, classical molecular dynamics (MD) simulations, and DFT+D2 cluster modeling was employed to address the following questions: (i) What mechanistic details of the BSS reaction yield the most probable molecular model? (ii) What is the molecular basis of enantiospecificity of BSS? (iii) Is the proposed mechanism consistent with experimental observations, such as an inversion of the stereochemistry of the benzylic protons, syn addition of toluene to fumarate, exclusive production of (R)-benzylsuccinate as a product and a kinetic isotope effect (KIE) ranging between 2 and 4? The quantum mechanics (QM) modeling confirms that the previously proposed hypothetical mechanism is the most probable among several variants considered, although C–H activation and not C–C coupling turns out to be the rate limiting step. The enantiospecificity of the enzyme seems to be enforced by a thermodynamic preference for binding of fumarate in the pro(R) orientation and reverse preference of benzyl radical attack on fumarate in pro(S) pathway which results with prohibitively high energy barrier of the radical quenching. Finally, the proposed mechanism agrees with most of the experimental observations, although the calculated intrinsic KIE from the model (6.5) is still higher than the experimentally observed values (4.0) which suggests that both C–H activation and radical quenching may jointly be involved in the kinetic control of the reaction. PMID:27070573

  13. Effect of high pressure treatment on metabolite profile of marinated meat in soy sauce.

    PubMed

    Yang, Yang; Ye, Yangfang; Wang, Ying; Sun, Yangying; Pan, Daodong; Cao, Jinxuan

    2018-02-01

    Marinated meat in soy sauce was produced using hind leg by washing, rubbing salt, marinating with soy sauce and spices, and air dry-ripening for 15d. The effect of high pressure (HP) (150 and 300MPa for 15min) on the metabolite profiles of products was characterized using 1 H NMR and multivariate data analysis. The results showed that the metabonome was dominated by 26 metabolites, including amino acids, sugars, organic acids, nucleic aides and their derivatives. PC1 and PC2 explained a total of 75.4 and 11.9% of variables, respectively. HP treatments increased most of the metabolites, especially PC1, glutamate, sugars, nucleotides, anserine, lactate and creatine compared to the control. The increase of metabolites under HP was not dependent on pressure level except for alanine, lactate, acetate, formate, fumarate, glucose and 5'-IMP. These findings demonstrated that HP treatment at 150MPa was economical to improve the taste of marinated meat in soy sauce. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Identification of crude-oil components and microorganisms that cause souring under anaerobic conditions.

    PubMed

    Hasegawa, R; Toyama, K; Miyanaga, K; Tanji, Y

    2014-02-01

    Oil souring has important implications with respect to energy resources. Understanding the physiology of the microorganisms that play a role and the biological mechanisms are both important for the maintenance of infrastructure and mitigation of corrosion processes. The objective of this study was to identify crude-oil components and microorganisms in oil-field water that contribute to crude-oil souring. To identify the crude-oil components and microorganisms that are responsible for anaerobic souring in oil reservoirs, biological conversion of crude-oil components under anaerobic conditions was investigated. Microorganisms in oil field water in Akita, Japan degraded alkanes and aromatics to volatile fatty acids (VFAs) under anaerobic conditions, and fermenting bacteria such as Fusibacter sp. were involved in VFA production. Aromatics such as toluene and ethylbenzene were degraded by sulfate-reducing bacteria (Desulfotignum sp.) via the fumarate-addition pathway and not only degradation of VFA but also degradation of aromatics by sulfate-reducing bacteria was the cause of souring. Naphthenic acid and 2,4-xylenol were not converted.

  15. Engineering E. coli strain for conversion of short chain fatty acids to bioalcohols

    PubMed Central

    2013-01-01

    Background Recent progress in production of various biofuel precursors and molecules, such as fatty acids, alcohols and alka(e)nes, is a significant step forward for replacing the fossil fuels with renewable fuels. A two-step process, where fatty acids from sugars are produced in the first step and then converted to corresponding biofuel molecules in the second step, seems more viable and attractive at this stage. We have engineered an Escherichia coli strain to take care of the second step for converting short chain fatty acids into corresponding alcohols by using butyrate kinase (Buk), phosphotransbutyrylase (Ptb) and aldehyde/alcohol dehydrogenase (AdhE2) from Clostridium acetobutylicum. Results The engineered E. coli was able to convert butyric acid and other short chain fatty acids of chain length C3 to C7 into corresponding alcohols and the efficiency of conversion varied with different E. coli strain type. Glycerol proved to be a better donor of ATP and electron as compared to glucose for converting butyric acid to butanol. The engineered E. coli was able to tolerate up to 100 mM butyric acid and produced butanol with the conversion rate close to 100% under anaerobic condition. Deletion of native genes, such as fumarate reductase (frdA) and alcohol dehydrogenase (adhE), responsible for side products succinate and ethanol, which act as electron sink and could compete with butyric acid uptake, did not improve the butanol production efficiency. Indigenous acyl-CoA synthetase (fadD) was found to play no role in the conversion of butyric acid to butanol. Engineered E. coli was cultivated in a bioreactor under controlled condition where 60 mM butanol was produced within 24 h of cultivation. A continuous bioreactor with the provision of cell recycling allowed the continuous production of butanol at the average productivity of 7.6 mmol/l/h until 240 h. Conclusions E. coli engineered with the pathway from C. acetobutylicum could efficiently convert butyric acid to butanol. Other short chain fatty acids with the chain length of C3 to C7 were also converted to the corresponding alcohols. The ability of engineered strain to convert butyric acid to butanol continuously demonstrates commercial significance of the system. PMID:24020887

  16. The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aklujkar, Muktak; Krushkal, Julia; DiBartolo, Genevieve

    Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recentlymore » in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae.« less

  17. Electrochemical synthesis of formic acid from CO2 catalyzed by Shewanella oneidensis MR-1 whole-cell biocatalyst.

    PubMed

    Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan

    2018-09-01

    The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1  g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Characteristics of organic acids in the fruit of different pumpkin species.

    PubMed

    Nawirska-Olszańska, Agnieszka; Biesiada, Anita; Sokół-Łętowska, Anna; Kucharska, Alicja Z

    2014-04-01

    The aim of the research was to determine the composition of organic acids in fruit of different cultivars of three pumpkin species. The amount of acids immediately after fruit harvest and after 3 months of storage was compared. The content of organic acids in the examined pumpkin cultivars was assayed using the method of high performance liquid chromatography (HPLC). Three organic acids (citric acid, malic acid, and fumaric acid) were identified in the cultivars, whose content considerably varied depending on a cultivar. Three-month storage resulted in decreased content of the acids in the case of cultivars belonging to Cucurbita maxima and Cucurbita pepo species, while a slight increase was recorded for Cucurbita moschata species. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  19. Time Course-Dependent Methanogenic Crude Oil Biodegradation: Dynamics of Fumarate Addition Metabolites, Biodegradative Genes, and Microbial Community Composition

    PubMed Central

    Toth, Courtney R. A.; Gieg, Lisa M.

    2018-01-01

    Biodegradation of crude oil in subsurface petroleum reservoirs has adversely impacted most of the world's oil, converting this resource to heavier forms that are of lower quality and more challenging to recover. Oil degradation in deep reservoir environments has been attributed to methanogenesis over geological time, yet our understanding of the processes and organisms mediating oil transformation in the absence of electron acceptors remains incomplete. Here, we sought to identify hydrocarbon activation mechanisms and reservoir-associated microorganisms that may have helped shape the formation of biodegraded oil by incubating oilfield produced water in the presence of light (°API = 32) or heavy crude oil (°API = 16). Over the course of 17 months, we conducted routine analytical (GC, GC-MS) and molecular (PCR/qPCR of assA and bssA genes, 16S rRNA gene sequencing) surveys to assess microbial community composition and activity changes over time. Over the incubation period, we detected the formation of transient hydrocarbon metabolites indicative of alkane and alkylbenzene addition to fumarate, corresponding with increases in methane production and fumarate addition gene abundance. Chemical and gene-based evidence of hydrocarbon biodegradation under methanogenic conditions was supported by the enrichment of hydrocarbon fermenters known to catalyze fumarate addition reactions (e.g., Desulfotomaculum, Smithella), along with syntrophic bacteria (Syntrophus), methanogenic archaea, and several candidate phyla (e.g., “Atribacteria”, “Cloacimonetes”). Our results reveal that fumarate addition is a possible mechanism for catalyzing the methanogenic biodegradation of susceptible saturates and aromatic hydrocarbons in crude oil, and we propose the roles of community members and candidate phyla in our cultures that may be involved in hydrocarbon transformation to methane in crude oil systems. PMID:29354103

  20. The preparation and evaluation of salt forms of linogliride with reduced solubilities as candidates for extended release.

    PubMed

    Chrzanowski, Frank A; Ahmad, Kaleem

    2017-03-01

    Salts of linogliride with reduced solubilities were prepared and evaluated as potential candidates for extended-release oral dosage forms. A once-daily dose of 300-800 mg was intended. Seven acids were selected: p-acetamidobenzoic, benzoic, p-hydroxybenzoic, 3-hydroxy-2-naphthoic, 1-napsylic, pamoic, and p-toluenesulfonic acids but only four salts were able to be prepared in suitable quantities for evaluation: linogliride pamoate, p-hydroxybenzoate, 3-hydroxy-2-naphthoate, and 1-napsylate. The pH-solubility profiles of the four new salts, free base, and fumarate salt were compared over the pH 1.43-8.3 range and the intrinsic dissolution rates of the four new salts and the free base were determined at pH 1.43, 4.4, and 7.5. The range of the pH-solubility profile and intrinsic dissolution rates of the p-hydroxybenzoate salt were less than the free base and fumarate and higher than the other three new salts. The pH-solubilities and intrinsic dissolution rates of the 1-napsylate salt were pH-independent. The solubilities and intrinsic dissolution rates of the pamoate and 3-hydroxy-2-naphthoate were higher at pH 1.4-3.4 than at higher pH. At pH 4.4 and higher, the solubilities were essentially the same, in the 1-2 mg/mL range. The intrinsic dissolution rates were also very low and not very different. Dissolution studies with capsules containing 800 mg doses of the pamoate, 1-napsylate, free base, and fumarate performed in a dissolution medium of pH beginning at 2.2 and ending at 6.8 demonstrated that the pamoate and 1-napsylate salt forms dissolved slower and could be useful as extended-release forms.

  1. Organic Acids: The Pools of Fixed Carbon Involved in Redox Regulation and Energy Balance in Higher Plants

    PubMed Central

    Igamberdiev, Abir U.; Eprintsev, Alexander T.

    2016-01-01

    Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516

  2. Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.

    PubMed

    Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

    2010-10-01

    Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.

  3. Dry cereals fortified with electrolytic iron or ferrous fumarate are equally effective in breast-fed infants.

    PubMed

    Ziegler, Ekhard E; Fomon, Samuel J; Nelson, Steven E; Jeter, Janice M; Theuer, Richard C

    2011-02-01

    Precooked, instant (dry) infant cereals in the US are fortified with electrolytic iron, a source of low reactivity and suspected low bioavailability. Iron from ferrous fumarate is presumed to be more available. In this study, we compared a dry infant rice cereal (Cereal L) fortified with electrolytic iron (54.5 mg iron/100 g cereal) to a similar cereal (Cereal M) fortified with ferrous fumarate (52.2 mg Fe/100 g) for efficacy in maintaining iron status and preventing iron deficiency (ID) in breast-fed infants. Ascorbic acid was included in both cereals. In this prospective, randomized double-blind trial, exclusively breast-fed infants were enrolled at 1 mo and iron status was determined periodically. At 4 mo, 3 infants had ID anemia and were excluded. Ninety-five infants were randomized at 4 mo, and 69 (36 Cereal L, 33 Cereal M) completed the intervention at 9 mo. From 4 to 9 mo, they consumed daily one of the study cereals. With each cereal, 2 infants had mild ID, a prevalence of 4.2%, but no infant developed ID anemia. There were no differences in iron status between study groups. Iron intake from the study cereals was (mean ± SD) 1.21 ± 0.31 mg⋅kg(-1)⋅d(-1) from Cereal L and 1.07 ± 0.40 mg⋅kg(-1)⋅d(-1) from Cereal M. Eleven infants had low birth iron endowment (plasma ferritin < 55 μg/L at 2 mo) and 54% of these infants had ID with or without anemia by 4 mo. We conclude that electrolytic iron and ferrous fumarate were equally efficacious as fortificants of this infant cereal.

  4. Temperature shift experiments suggest that metabolic impairment and enhanced rates of photorespiration decrease organic acid levels in soybean leaflets exposed to supra-optimal growth temperatures

    USDA-ARS?s Scientific Manuscript database

    Citrate, malate, malonate, fumarate and succinate in soybean leaflets decreased 40 to 80% when plants were grown continuously in controlled environment chambers at 36/28 compared to 28/20 °C. Glycerate was not temperature responsive in this study. Temperature effects on the above mentioned organi...

  5. Metabolic potential of fatty acid oxidation and anaerobic respiration by abundant members of Thaumarchaeota and Thermoplasmata in deep anoxic peat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Xueju; Handley, Kim M.; Gilbert, Jack A.

    2015-12-01

    To probe the metabolic potential of abundant Archaea in boreal peats, we reconstructed two near-complete archaeal genomes, affiliated with Thaumarchaeota group 1.1c (bin Fn1, 8% abundance), which was a genomically unrepresented group, and Thermoplasmata (bin Bg1, 26% abundance), from metagenomic data acquired from deep anoxic peat layers. Each of the near-complete genomes encodes the potential to degrade long-chain fatty acids (LCFA) via β-oxidation. Fn1 has the potential to oxidize LCFA either by syntrophic interaction with methanogens or by coupling oxidation with anaerobic respiration using fumarate as a terminal electron acceptor (TEA). Fn1 is the first Thaumarchaeota genome without an identifiablemore » carbon fixation pathway, indicating that this mesophilic phylum encompasses more diverse metabolisms than previously thought. Furthermore, we report genetic evidence suggestive of sulfite and/or organosulfonate reduction by Thermoplasmata Bg1. In deep peat, inorganic TEAs are often depleted to extremely low levels, yet the anaerobic respiration predicted for two abundant archaeal members suggests organic electron acceptors such as fumarate and organosulfonate (enriched in humic substances) may be important for respiration and C mineralization in peatlands.« less

  6. Non-Targeted Metabolomics Analysis of Golden Retriever Muscular Dystrophy-Affected Muscles Reveals Alterations in Arginine and Proline Metabolism, and Elevations in Glutamic and Oleic Acid In Vivo

    PubMed Central

    Abdullah, Muhammad; Kornegay, Joe N.; Honcoop, Aubree; Parry, Traci L.; Balog-Alvarez, Cynthia J.; Muehlbauer, Michael J.; Newgard, Christopher B.; Patterson, Cam

    2017-01-01

    Background: Like Duchenne muscular dystrophy (DMD), the Golden Retriever Muscular Dystrophy (GRMD) dog model of DMD is characterized by muscle necrosis, progressive paralysis, and pseudohypertrophy in specific skeletal muscles. This severe GRMD phenotype includes moderate atrophy of the biceps femoris (BF) as compared to unaffected normal dogs, while the long digital extensor (LDE), which functions to flex the tibiotarsal joint and serves as a digital extensor, undergoes the most pronounced atrophy. A recent microarray analysis of GRMD identified alterations in genes associated with lipid metabolism and energy production. Methods: We, therefore, undertook a non-targeted metabolomics analysis of the milder/earlier stage disease GRMD BF muscle versus the more severe/chronic LDE using GC-MS to identify underlying metabolic defects specific for affected GRMD skeletal muscle. Results: Untargeted metabolomics analysis of moderately-affected GRMD muscle (BF) identified eight significantly altered metabolites, including significantly decreased stearamide (0.23-fold of controls, p = 2.89 × 10−3), carnosine (0.40-fold of controls, p = 1.88 × 10−2), fumaric acid (0.40-fold of controls, p = 7.40 × 10−4), lactamide (0.33-fold of controls, p = 4.84 × 10−2), myoinositol-2-phosphate (0.45-fold of controls, p = 3.66 × 10−2), and significantly increased oleic acid (1.77-fold of controls, p = 9.27 × 10−2), glutamic acid (2.48-fold of controls, p = 2.63 × 10−2), and proline (1.73-fold of controls, p = 3.01 × 10−2). Pathway enrichment analysis identified significant enrichment for arginine/proline metabolism (p = 5.88 × 10−4, FDR 4.7 × 10−2), where alterations in L-glutamic acid, proline, and carnosine were found. Additionally, multiple Krebs cycle intermediates were significantly decreased (e.g., malic acid, fumaric acid, citric/isocitric acid, and succinic acid), suggesting that altered energy metabolism may be underlying the observed GRMD BF muscle dysfunction. In contrast, two pathways, inosine-5′-monophosphate (VIP Score 3.91) and 3-phosphoglyceric acid (VIP Score 3.08) mainly contributed to the LDE signature, with two metabolites (phosphoglyceric acid and inosine-5′-monophosphate) being significantly decreased. When the BF and LDE were compared, the most significant metabolite was phosphoric acid, which was significantly less in the GRMD BF compared to control and GRMD LDE groups. Conclusions: The identification of elevated BF oleic acid (a long-chain fatty acid) is consistent with recent microarray studies identifying altered lipid metabolism genes, while alterations in arginine and proline metabolism are consistent with recent studies identifying elevated L-arginine in DMD patient sera as a biomarker of disease. Together, these studies demonstrate muscle-specific alterations in GRMD-affected muscle, which illustrate previously unidentified metabolic changes. PMID:28758940

  7. Impaired Malate and Fumarate Accumulation Due to the Mutation of the Tonoplast Dicarboxylate Transporter Has Little Effects on Stomatal Behavior.

    PubMed

    Medeiros, David B; Barros, Kallyne A; Barros, Jessica Aline S; Omena-Garcia, Rebeca P; Arrivault, Stéphanie; Sanglard, Lílian M V P; Detmann, Kelly C; Silva, Willian Batista; Daloso, Danilo M; DaMatta, Fábio M; Nunes-Nesi, Adriano; Fernie, Alisdair R; Araújo, Wagner L

    2017-11-01

    Malate is a central metabolite involved in a multiplicity of plant metabolic pathways, being associated with mitochondrial metabolism and playing significant roles in stomatal movements. Vacuolar malate transport has been characterized at the molecular level and is performed by at least one carrier protein and two channels in Arabidopsis ( Arabidopsis thaliana ) vacuoles. The absence of the Arabidopsis tonoplast Dicarboxylate Transporter (tDT) in the tdt knockout mutant was associated previously with an impaired accumulation of malate and fumarate in leaves. Here, we investigated the consequences of this lower accumulation on stomatal behavior and photosynthetic capacity as well as its putative metabolic impacts. Neither the stomatal conductance nor the kinetic responses to dark, light, or high CO 2 were highly affected in tdt plants. In addition, we did not observe any impact on stomatal aperture following incubation with abscisic acid, malate, or citrate. Furthermore, an effect on photosynthetic capacity was not observed in the mutant lines. However, leaf mitochondrial metabolism was affected in the tdt plants. Levels of the intermediates of the tricarboxylic acid cycle were altered, and increases in both light and dark respiration were observed. We conclude that manipulation of the tonoplastic organic acid transporter impacted mitochondrial metabolism, while the overall stomatal and photosynthetic capacity were unaffected. © 2017 American Society of Plant Biologists. All Rights Reserved.

  8. Phenotypic and genomic survey on organic acid utilization profile of Pseudomonas mendocina strain S5.2, a vineyard soil isolate.

    PubMed

    Chong, Teik Min; Chen, Jian-Woon; See-Too, Wah-Seng; Yu, Choo-Yee; Ang, Geik-Yong; Lim, Yan Lue; Yin, Wai-Fong; Grandclément, Catherine; Faure, Denis; Dessaux, Yves; Chan, Kok-Gan

    2017-12-01

    Root exudates are chemical compounds that are released from living plant roots and provide significant energy, carbon, nitrogen and phosphorus sources for microbes inhabiting the rhizosphere. The exudates shape the microflora associated with the plant, as well as influences the plant health and productivity. Therefore, a better understanding of the trophic link that is established between the plant and the associated bacteria is necessary. In this study, a comprehensive survey on the utilization of grapevine and rootstock related organic acids were conducted on a vineyard soil isolate which is Pseudomonas mendocina strain S5.2. Phenotype microarray analysis has demonstrated that this strain can utilize several organic acids including lactic acid, succinic acid, malic acid, citric acid and fumaric acid as sole growth substrates. Complete genome analysis using single molecule real-time technology revealed that the genome consists of a 5,120,146 bp circular chromosome and a 252,328 bp megaplasmid. A series of genetic determinants associated with the carbon utilization signature of the strain were subsequently identified in the chromosome. Of note, the coexistence of genes encoding several iron-sulfur cluster independent isoenzymes in the genome indicated the importance of these enzymes in the events of iron deficiency. Synteny and comparative analysis have also unraveled the unique features of D-lactate dehydrogenase of strain S5.2 in the study. Collective information of this work has provided insights on the metabolic role of this strain in vineyard soil rhizosphere.

  9. Effect of Organic and Conventional Management on Bio-Functional Quality of Thirteen Plum Cultivars (Prunus salicina Lindl.).

    PubMed

    Cuevas, Francisco Julián; Pradas, Inmaculada; Ruiz-Moreno, María José; Arroyo, Francisco Teodoro; Perez-Romero, Luis Felipe; Montenegro, José Carlos; Moreno-Rojas, José Manuel

    2015-01-01

    In this study, thirteen Japanese plum cultivars (Prunus salicina Lindl.) grown under conventional and organic conditions were compared to evaluate the influence of the culture system on bioactive compounds. Their organic acids content (malic, citric, tartaric, succinic, shikimic, ascorbic and fumaric acid), total polyphenols, total anthocyanins, total carotenoids and antioxidant capacity (FRAP, ABTS) were evaluated. The study was performed during two consecutive seasons (2012 and 2013) in two experimental orchards located at the IFAPA centre Las Torres-Tomejil (Seville, SW Spain). The culture system affected all the studied parameters except for total carotenoid content. The organic plums had significantly higher polyphenol and anthocyanin concentrations and a greater antioxidant capacity. Additionally, significant differences between cultivars were also found. 'Showtime' and 'Friar' were the cultivars with the highest polyphenol concentration and antioxidant capacity. 'Black Amber' had the highest anthocyanin content and 'Larry Ann' and 'Songold' the highest carotenoid content. 'Sapphire' and 'Black amber' were the cultivars with the highest concentration of ascorbic acid. Our results showed a strong year effect. In conclusion, organic management had an impact on the production of phytochemical compounds in plums.

  10. Effect of Organic and Conventional Management on Bio-Functional Quality of Thirteen Plum Cultivars (Prunus salicina Lindl.)

    PubMed Central

    Cuevas, Francisco Julián; Pradas, Inmaculada; Ruiz‐Moreno, María José; Arroyo, Francisco Teodoro; Perez-Romero, Luis Felipe; Montenegro, José Carlos; Moreno‐Rojas, José Manuel

    2015-01-01

    In this study, thirteen Japanese plum cultivars (Prunus salicina Lindl.) grown under conventional and organic conditions were compared to evaluate the influence of the culture system on bioactive compounds. Their organic acids content (malic, citric, tartaric, succinic, shikimic, ascorbic and fumaric acid), total polyphenols, total anthocyanins, total carotenoids and antioxidant capacity (FRAP, ABTS) were evaluated. The study was performed during two consecutive seasons (2012 and 2013) in two experimental orchards located at the IFAPA centre Las Torres-Tomejil (Seville, SW Spain). The culture system affected all the studied parameters except for total carotenoid content. The organic plums had significantly higher polyphenol and anthocyanin concentrations and a greater antioxidant capacity. Additionally, significant differences between cultivars were also found. ‘Showtime’ and ‘Friar’ were the cultivars with the highest polyphenol concentration and antioxidant capacity. ‘Black Amber’ had the highest anthocyanin content and ‘Larry Ann’ and ‘Songold’ the highest carotenoid content. ‘Sapphire’ and ‘Black amber’ were the cultivars with the highest concentration of ascorbic acid. Our results showed a strong year effect. In conclusion, organic management had an impact on the production of phytochemical compounds in plums. PMID:26313546

  11. Flavor Compounds in Pixian Broad-Bean Paste: Non-Volatile Organic Acids and Amino Acids.

    PubMed

    Lin, Hongbin; Yu, Xiaoyu; Fang, Jiaxing; Lu, Yunhao; Liu, Ping; Xing, Yage; Wang, Qin; Che, Zhenming; He, Qiang

    2018-05-29

    Non-volatile organic acids and amino acids are important flavor compounds in Pixian broad-bean paste, which is a traditional Chinese seasoning product. In this study, non-volatile organic acids, formed in the broad-bean paste due to the metabolism of large molecular compounds, are qualitatively and quantitatively determined by high-performance liquid chromatography (HPLC). Amino acids, mainly produced by hydrolysis of soybean proteins, were determined by the amino acid automatic analyzer. Results indicated that seven common organic acids and eighteen common amino acids were found in six Pixian broad-bean paste samples. The content of citric acid was found to be the highest in each sample, between 4.1 mg/g to 6.3 mg/g, and malic acid were between 2.1 mg/g to 3.6 mg/g ranked as the second. Moreover, fumaric acid was first detected in fermented bean pastes albeit with a low content. For amino acids, savory with lower sour taste including glutamine (Gln), glutamic acid (Glu), aspartic acid (Asp) and asparagines (Asn) were the most abundant, noted to be 6.5 mg/g, 4.0 mg/g, 6.4 mg/g, 4.9 mg/g, 6.2 mg/g and 10.2 mg/g, and bitter taste amino acids followed. More importantly, as important flavor materials in Pixian broad-bean paste, these two groups of substances are expected to be used to evaluate and represent the flavor quality of Pixian broad-bean paste. Moreover, the results revealed that citric acid, glutamic acid, methionine and proline were the most important flavor compounds. These findings are agreat contribution for evaluating the quality and further assessment of Pixian broad-bean paste.

  12. Reactive transport model for bioremediation of nitrate using fumarate in groundwater system: verification and field application

    NASA Astrophysics Data System (ADS)

    Lee, S.; Yeo, I. W.; Yeum, Y.; Kim, Y.

    2016-12-01

    Previous studies showed that groundwater of rural areas in Korea is often contaminated with nitrate highly exceeding the drinking water standard of 10 mg/L (NO3-N), which poses a major threat in human and livestock health. In-situ bioremediation method has been developed to reduce high nitrate-nitrogen concentration in groundwater using slowly released encapsulated carbon source. Collaborative research of this study revealed that fumarate was found to be a very effective carbon source in terms of cost and nitrate reduction against formate, propionate, and lactate. For reactive transport modeling of the bioremediation of nitrate using fumarate, the BTEX module of RT3D incorporated in GMS, a commercial groundwater modeling software developed by AQUAVEO, was adopted, where BTEX was replaced with fumarate as a carbon source. Column tests were carried out to determine transport and reaction parameters for numerical modeling such as dispersity and first order degradation rate of nitrate by fumarate. The calibration of the numerical model against column tests strongly indicated that nitrate, known to be not reactive in groundwater system, appeared to be retarded due to sorption by fumarate. The calibrated model was tested for field-scale application to the composting facility in Gimje, Korea. The numerical results showed that the model could simulate the nitrate reduction by fumarate in field scale groundwater system. The reactive transport model for nitrate can be used as a tool for optimum design of in-situ nitrate bioremediation system, such as released depth and amount of fumarate and the spacing of wells that encapsulated fumarate is released through.

  13. Seasonal evaluation of disinfection by-products throughout two full-scale drinking water treatment plants.

    PubMed

    Zhong, Xin; Cui, Chongwei; Yu, Shuili

    2017-07-01

    Carbonyl compounds can occur alpha-hydrogens or beta-diketones substitution reactions with disinfectants contributed to halogenated by-products formation. The objective of this research was to study the occurrence and fate of carbonyl compounds as ozonation by-products at two full-scale drinking water treatment plants (DWTPs) using different disinfectants for one year. The quality of the raw water used in both plants was varied according to the season. The higher carbonyl compounds concentrations were found in raw water in spring. Up to 15 (as the sum of both DWTPs) of the 24 carbonyl compounds selected for this work were found after disinfection. The dominant carbonyl compounds were formaldehyde, glyoxal, methyl-glyoxal, fumaric, benzoic, protocatechuic and 3-hydroxybenzoic acid at both DWTPs. In the following steps in each treatment plant, the concentration patterns of these carbonyl compounds differed depending on the type of disinfectant applied. Benzaldehyde was the only aromatic aldehyde detected after oxidation with ozone in spring. As compared with DWTP 1, five new carbonyl compounds were formed (crotonaldehyde, benzaldehyde, formic, oxalic and malonic acid) disinfection by ozone, and the levels of the carbonyl compounds increased. In addition, pre-ozonation (PO) and main ozonation (OZ) increased the levels of carbonyl compounds, however coagulation/flocculation (CF), sand filtration (SF) and granular activated carbon filtration (GAC) decreased the levels of carbonyl compounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Safety of Systemic Agents for the Treatment of Pediatric Psoriasis.

    PubMed

    Bronckers, Inge M G J; Seyger, Marieke M B; West, Dennis P; Lara-Corrales, Irene; Tollefson, Megha; Tom, Wynnis L; Hogeling, Marcia; Belazarian, Leah; Zachariae, Claus; Mahé, Emmanuel; Siegfried, Elaine; Philipp, Sandra; Szalai, Zsuzsanna; Vleugels, Ruth Ann; Holland, Kristen; Murphy, Ruth; Baselga, Eulalia; Cordoro, Kelly; Lambert, Jo; Alexopoulos, Alex; Mrowietz, Ulrich; Kievit, Wietske; Paller, Amy S

    2017-11-01

    Use of systemic therapies for moderate to severe psoriasis in children is increasing, but comparative data on their use and toxicities are limited. To assess patterns of use and relative risks of systemic agents for moderate to severe psoriasis in children. A retrospective review was conducted at 20 centers in North America and Europe, and included all consecutive children with moderate to severe psoriasis who used systemic medications or phototherapy for at least 3 months from December 1, 1990, to September 16, 2014. The minimal core data set included age, sex, severity of psoriasis, systemic interventions, monitoring, adverse events (AEs), and reason for discontinuation. For 390 children (203 girls and 187 boys; mean [SD] age at diagnosis, 8.4 [3.7] years) with psoriasis who used 1 or more systemic medications, the mean interval between diagnosis and starting systemic therapy was 3.0 years. Methotrexate was used by 270 patients (69.2%), biologic agents (primarily etanercept) by 106 (27.2%), acitretin by 57 (14.6%), cyclosporine by 30 (7.7%), fumaric acid esters by 19 (4.9%), and more than 1 medication was used by 73 (18.7%). Of 270 children taking methotrexate, 130 (48.1%) reported 1 or more AEs associated with methotrexate, primarily gastrointestinal (67 [24.8%]). Folic acid 6 days per week (odds ratio, 0.16; 95% CI, 0.06-0.41; P < .001) or 7 days per week (OR, 0.21; 95% CI, 0.08-0.58; P = .003) protected against gastrointestinal AEs more than once-weekly folic acid, regardless of the total weekly dosage. Methotrexate-associated hepatic transaminase elevations were associated with obesity (35 of 270 patients [13.0%]), but a folic acid regimen was not. Injection site reactions occurred in 20 of 106 patients (18.9%) treated with tumor necrosis factor inhibitors, but did not lead to discontinuation of treatment. Having 1 or more AEs related to medication, gastrointestinal AE, laboratory abnormality, or AE leading to discontinuation of the drug was more likely with methotrexate than tumor necrosis factor inhibitors, but having 1 or more infections related to medication (predominantly upper airway) was less likely. Six patients developed a serious treatment-related AE (methotrexate, 3; fumaric acid esters, 2; and adalimumab, 1), but methotrexate and biologic agents were taken for a mean duration that was 2-fold greater than the mean duration for cyclosporine or fumaric acid esters. No patient developed tuberculosis or a malignant neoplasm. Medication-related AEs occur less often with tumor necrosis factor inhibitors than with methotrexate. Folic acid administration 6 or 7 times per week protected more against methotrexate-induced gastrointestinal AEs than did weekly administration. A prospective registry is needed to track the long-term risks of systemic agents for pediatric psoriasis.

  15. Metabolomics approach to reduce the Crabtree effect in continuous culture of Saccharomyces cerevisiae.

    PubMed

    Imura, Makoto; Iwakiri, Ryo; Bamba, Takeshi; Fukusaki, Eiichiro

    2018-04-20

    The budding yeast Saccharomyces cerevisiae is an important microorganism for fermentation and the food industry. However, during production, S. cerevisiae commonly uses the ethanol fermentation pathway for glucose utilization if excess sugar is present, even in the presence of sufficient oxygen levels. This aerobic ethanol fermentation, referred to as "the Crabtree effect" is one of the most significant reasons for low cell yield. To weaken the Crabtree effect in fed-batch and continuous culture, sugar flow should be limited. In addition, in continuous culture, the dilution rate must be reduced to avoid washing out cells. However, under such conditions, production speed might be sacrificed. It is difficult to solve this problem with the tradeoff between cell yield and production speed by using conventional tactics. However, a metabolomics approach may be an effective way to search for clues regarding metabolic modulation. Therefore, the purpose of this study was to reduce ethanol production in continuous culture of S. cerevisiae at a higher dilution rate through a metabolomics approach. We used a metabolomics analysis to identify metabolites that were drastically increased or decreased in continuous culture when the dilution rate shifted from biomass formation to ethanol fermentation. The individual addition of two of the selected metabolites, fumaric acid and malic acid, reduced ethanol production at a higher dilution rate. This result demonstrates the potential for using metabolomics approaches to identify metabolites that reduce ethanol production in continuous culture at high dilution rates. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Management Strategies to Facilitate Optimal Outcomes for Patients Treated with Delayed-release Dimethyl Fumarate.

    PubMed

    Mayer, Lori; Fink, Mary Kay; Sammarco, Carrie; Laing, Lisa

    2018-04-01

    Delayed-release dimethyl fumarate is an oral disease-modifying therapy that has demonstrated significant efficacy in adults with relapsing-remitting multiple sclerosis. Incidences of flushing and gastrointestinal adverse events are common in the first month after delayed-release dimethyl fumarate initiation. Our objective was to propose mitigation strategies for adverse events related to initiation of delayed-release dimethyl fumarate in the treatment of patients with multiple sclerosis. Studies of individually developed mitigation strategies and chart reviews were evaluated. Those results, as well as mitigation protocols developed at multiple sclerosis care centers, are summarized. Key steps to optimize the effectiveness of delayed-release dimethyl fumarate treatment include education prior to and at the time of delayed-release dimethyl fumarate initiation, initiation dose protocol gradually increasing to maintenance dose, dietary suggestions for co-administration with food, gastrointestinal symptom management with over-the-counter medications, flushing symptom management with aspirin, and temporary dose reduction. Using the available evidence from clinical trials and evaluations of post-marketing studies, these strategies to manage gastrointestinal and flushing symptoms can be effective and helpful to the patient when initiating delayed-release dimethyl fumarate.

  17. Nanoparticles as strengthening agents in polymer systems

    NASA Astrophysics Data System (ADS)

    Shahid, Naureen

    2005-11-01

    Carboxylate-substituted alumina nanoparticles are produced solvent free using mechanical shear. The general nature of this method has been demonstrated for L-lysine-, stearate, and p-hydroxybenzoate-derived materials. The reaction rate and particle size is controlled by a combination of temperature and shear rate. The nanoparticles are spectroscopically equivalent to those reported from aqueous syntheses, however, the average particle size can be decreased and the particle size distribution narrowed depending on the reaction conditions. Lysine and p-hydroxybenzoato alumoxanes have been introduced in carbon fiber reinforced epoxide resin composites. Different preparation conditions have been studied to obtain composite with enhanced performances that are ideal for the motor sports and aerospace industries. A new composite material has been fabricated utilizing surface-modified carboxylate alumoxane nanoparticles and the biodegradable polymer poly(propylene fumarate)/poly(propylene fumarate)-diacrylate (PPF/PPF-DA). For this study, composites were prepared using various functional groups including: a surfactant alumoxane to enhance nanoparticle dispersion into the polymer; an activated-alumoxane to enhance nanoparticle interaction with the polymer matrix; a mixed alumoxane containing both activated and surfactant groups. Nanocomposites prepared with all types of alumoxane, as well as blank polymer resin and unmodified boehmite, underwent mechanical testing and were characterized by SEM and microprobe analysis. A nanocomposite composed of mixed alumoxane nanoparticles dispersed in PPF/PPF-DA exhibited increased flexural modulus compared to polymer resin alone, and a significant enhancement over both the activated and surfacted alumoxanes. Boric acid is used as the cross-linking agent in oil well drilling industry even though the efficacy of the borate ion, [B(OH)4]- , as a cross-linking agent is poor. The reaction product of boric acid and the polysaccharide guaran (the major component of guar gum) has been investigated by 11B NMR spectroscopy. By comparison with the 11B NMR of boric acid and phenyl boronic acid complexes of 1,2-diols [HOCMe2CMe2OH, cis-C6H 10(OH)2, trans-C6H10(OH) 2, o-C6H4(OH)2], 1,3-diols (neol-H2), monosaccharides (L-fucose, mannose and galactose) and disaccharides (celloboise and sucrose) it is found that the guaran polymer is cross-linked via a borate complex of two 1,2-diols both forming chelate 5-membered ring cycles, this contrasts with previous proposals. (Abstract shortened by UMI.)

  18. Anaerobic and aerobic pathways for salvage of proximal tubules from hypoxia-induced mitochondrial injury

    PubMed Central

    WEINBERG, JOEL M.; VENKATACHALAM, MANJERI A.; ROESER, NANCY F.; SAIKUMAR, POTHANA; DONG, ZHENG; SENTER, RUTH A.; NISSIM, ITZHAK

    2010-01-01

    We have further examined the mechanisms for a severe mitochondrial energetic deficit, deenergization, and impaired respiration in complex I that develop in kidney proximal tubules during hypoxia-reoxygenation, and their prevention and reversal by supplementation with α-ketoglutarate (α-KG) + aspartate. The abnormalities preceded the mitochondrial permeability transition and cytochrome c loss. Anaerobic metabolism of α-KG + aspartate generated ATP and maintained mitochondrial membrane potential. Other citric-acid cycle intermediates that can promote anaerobic metabolism (malate and fumarate) were also effective singly or in combination with α-KG. Succinate, the end product of these anaerobic pathways that can bypass complex I, was not protective when provided only during hypoxia. However, during reoxygenation, succinate also rescued the tubules, and its benefit, like that of α-KG + malate, persisted after the extra substrate was withdrawn. Thus proximal tubules can be salvaged from hypoxia-reoxygenation mitochondrial injury by both anaerobic metabolism of citric-acid cycle intermediates and aerobic metabolism of succinate. These results bear on the understanding of a fundamental mode of mitochondrial dysfunction during tubule injury and on strategies to prevent and reverse it. PMID:11053054

  19. 21 CFR 520.2455 - Tiamulin.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

  20. 21 CFR 520.2455 - Tiamulin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

  1. 21 CFR 520.2455 - Tiamulin.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

  2. 21 CFR 520.82a - Aminopropazine fumarate tablets.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Aminopropazine fumarate tablets. (a) Specifications. The drug is in tablet form. Each tablet contains...

  3. Drug-induced Fanconi syndrome associated with fumaric acid esters treatment for psoriasis: a case series.

    PubMed

    Balak, Deepak M W; Bouwes Bavinck, Jan Nico; de Vries, Aiko P J; Hartman, Jenny; Neumann, Hendrik A Martino; Zietse, Robert; Thio, Hok Bing

    2016-02-01

    Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37-46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28-111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome.

  4. Occurrence of Polyphenols, Organic Acids, and Sugars among Diverse Elderberry Genotypes Grown in Three Missouri (USA) Locations

    PubMed Central

    Thomas, A.L.; Byers, P.L.; Gu, S.; Avery, J.D.; Kaps, M.; Datta, A.; Fernando, L.; Grossi, P.; Rottinghaus, G.E.

    2016-01-01

    Elderberry (Sambucus spp.) is an emerging horticultural crop used in a variety of foods, wines, and dietary supplements. A better understanding of the elderberry juice complex including its putative health-promoting compounds in relation to genetic and environmental parameters is needed. A multi-location planting of nine elderberry genotypes was established in 2008 at three geographically-diverse sites in Missouri, USA. Fruits were harvested from replicated plots 2009-2011, frozen, and later prepared for laboratory analysis. Polyphenols, organic acids, and sugars were quantified by HPLC and the results evaluated for response to genotype, site, and year. The American genotypes ‘Ocoee’ and ‘Ozark’ were consistently higher in chlorogenic acids compared to other genotypes, whereas ‘Ocoee’ was significantly higher in rutin than ‘Ozark’. The European ‘Marge’ was significantly higher in isoquercitrin and other flavonoids compared to most North American genotypes. Significant differences in polyphenols were also detected among sites and production years. Malic, citric, and tartaric acids varied significantly among genotypes, sites, and years, whereas succinic, shikimic, and fumaric acids generally did not. Levels of lactic, acetic, and propionic acids were negligible in most samples. The American genotype ‘Ocoee’ was higher in citric and tartaric acids, while lower in malic acid. The sugars glucose and fructose also responded significantly to genotype, site, and year. ‘Ocoee’, ‘Ozark’, and ‘Marge’ perform very well in Missouri horticulturally and appear to have additional potential as cultivars based on their unique juice characteristics. PMID:27156707

  5. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... sulfate equivalent to 50 milligrams of neomycin base. (b) Sponsor. See No. 000061 in § 510.600(c) of this...

  6. Dielectric Properties of Iron- and Sodium-Fumarate

    NASA Astrophysics Data System (ADS)

    Skuban, Sonja J.; Džomić, Tanja; Kapor, Agneš

    2007-04-01

    The behaviour of dielectric parameters such as relative dielectric constant (ɛ'), relative loss factor (V'') and ac conductivity of well known pharmaceutical materials Fe(II)-fumarate and sodium-fumarate have been studied as a function of temperature (range 303 K to 483 K) and frequency (range 0.1 Hz to 100 kHz).

  7. The complex allosteric and redox regulation of the fumarate hydratase and malate dehydratase reactions of Arabidopsis thaliana Fumarase 1 and 2 gives clues for understanding the massive accumulation of fumarate.

    PubMed

    Zubimendi, Juan P; Martinatto, Andrea; Valacco, Maria P; Moreno, Silvia; Andreo, Carlos S; Drincovich, María F; Tronconi, Marcos A

    2018-06-01

    Arabidopsis thaliana possesses two fumarase genes (FUM), AtFUM1 (At2g47510) encoding for the mitochondrial Krebs cycle-associated enzyme and AtFUM2 (At5g50950) for the cytosolic isoform required for fumarate massive accumulation. Here, the comprehensive biochemical studies of AtFUM1 and AtFUM2 shows that they are active enzymes with similar kinetic parameters but differential regulation. For both enzymes, fumarate hydratase (FH) activity is favored over the malate dehydratase (MD) activity; however, MD is the most regulated activity with several allosteric activators. Oxalacetate, glutamine, and/or asparagine are modulators causing the MD reaction to become preferred over the FH reaction. Activity profiles as a function of pH suggest a suboptimal FUM activity in Arabidopsis cells; moreover, the direction of the FUM reaction is sensitive to pH changes. Under mild oxidation conditions, AtFUMs form high mass molecular aggregates, which present both FUM activities decreased to a different extent. The biochemical properties of oxidized AtFUMs (oxAtFUMs) were completely reversed by NADPH-supplied Arabidopsis leaf extracts, suggesting that the AtFUMs redox regulation can be accomplished in vivo. Mass spectrometry analyses indicate the presence of an active site-associated intermolecular disulfide bridge in oxAtFUMs. Finally, a phylogenetic approach points out that other plant species may also possess cytosolic FUM2 enzymes mainly encoded by paralogous genes, indicating that the evolutionary history of this trait has been drawn through a process of parallel evolution. Overall, according to our results, a multilevel regulatory pattern of FUM activities emerges, supporting the role of this enzyme as a carbon flow monitoring point through the organic acid metabolism in plants. © 2018 Federation of European Biochemical Societies.

  8. Metabolic behavior and enzymatic aspects of denitrifying EBPR sludge in a continuous-flow anaerobic-anoxic system.

    PubMed

    Zafiriadis, Ilias; Ntougias, Spyridon; Kapagiannidis, Anastasios G; Aivasidis, Alexander

    2013-10-01

    The metabolic aspects of enhanced biological phosphorus removal (EBPR) were investigated for the first time in a continuous-flow anaerobic-anoxic plant fed with acetate, propionate, or substrates which are involved in the tricarboxylic acid and/or glyoxylate cycle, i.e., fumarate, malate, or oxaloacetate, as the sole carbon source. Although the polyphosphate-accumulating organisms (PAOs) population remained stable with any carbon source examined, no typical EBPR metabolism was observed during fumarate, malate, or oxaloacetate utilization. Specific enzymatic activities related to EBPR were determined in activated sludge homogenates and directly correlated with the nutrient metabolic rates. The experimental results indicated the direct involvement of alkaline phosphatase, pyrophosphatase, and exopolyphosphatase in the denitrifying EBPR process. Metabolic aspects of glyoxylate cycle enzymes are discussed with regard to the biomass anaerobic and anoxic activity. Process performance was highly influenced by the kind of substrate utilized, indicating that specific metabolic pathways should be followed to favor efficient EBPR.

  9. Effect of bicarbonate concentration on aerobic growth of campylobacter in a fumarate-pyruvate medium

    USDA-ARS?s Scientific Manuscript database

    The purpose of the present study was to examine the effect of sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in a fumarate-pyruvate medium. Fumarate-pyruvate broth medium was supplemented with 0.00 to 0.10% NaHCO3 and inoculated with Campylobacter coli 33559, Campyloba...

  10. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... administered at a dosage level of one to two tablets per 10 pounds of body weight twice daily for 3 days.1 (3...

  11. Alternative energy production pathways in Taenia crassiceps cysticerci in vitro exposed to a benzimidazole derivative (RCB20).

    PubMed

    Fraga, Carolina Miguel; Da Costa, Tatiane Luiza; De Castro, Ana Maria; Reynoso-Ducoing, Olivia; Ambrosio, Javier; Hernández-Campos, Alicia; Castillo, Rafael; Vinaud, Marina Clare

    2016-04-01

    Biochemical studies of benzimidazole derivatives are important to determine their mode of action and activity against parasites. The lack of antihelminthic alternatives to treat parasitic infections and albendazole resistance cases make the search for new antiparasitary drugs of utmost importance. The 6-chloro-5-(1-naphthyloxy)-2-(trifluoromethyl)-1H-benzimidazole (RCB20) is a benzimidazole derivative with promising effect. This study evaluated the effect of different concentrations of RCB20 in the alternative energetic pathway of in vitro Taenia crassiceps cysticerci. The parasites were in vitro exposed to 6.5 and 13 µM of RCB20 and albendazole sulfoxide (ABZSO). The quantification of acetate, acetoacetate, β-hydroxybutyrate, fumarate and propionate was performed by high-performance liquid chromatography. The quantification of urea, creatinine and total proteins was performed by spectrophotometry. The increase in β-hydroxybutyrate reflects the enhancement of the fatty acid oxidation in the treated groups. Volatile fatty acids secretion, acetate and propionate, was increased in the treated groups. The secretion mechanisms of the treated parasites were impaired due to organic acids increased concentrations in the cysticerci. It is possible to conclude that the metabolic effect on alternative energetic pathways is slightly increased in the parasites treated with RCB20 than the ones treated with ABZSO.

  12. Capsicum chinensis L. growth and nutraceutical properties are enhanced by biostimulants in a long-term period: chemical and metabolomic approaches

    PubMed Central

    Ertani, Andrea; Pizzeghello, Diego; Francioso, Ornella; Sambo, Paolo; Sanchez-Cortes, Santiago; Nardi, Serenella

    2014-01-01

    Two biostimulants, one derived from alfalfa plants (AH) and the other obtained from red grape (RG), were chemically characterized using enzyme linked immuno-sorbent assays, Fourier transform infrared (FT-IR) and Raman spectroscopies. Two doses (50 and 100 mL L−1 for RG, and 25 and 50 mL L−1 for AH) of biostimulants were applied to Capsicum chinensis L. plants cultivated in pots inside a tunnel. The experimental design consisted of the factorial combination of treatment (no biostimulant, plus AH, plus RG) at three doses (zero, low, and high) and two time-course applications (at the second and fourth week after transplantation) and the effects were recorded at flowering and maturity. Both biostimulants contained different amounts of indoleacetic acid and isopentenyladenosine; the AH spectra exhibited amino acid functional groups in the peptidic structure, while the RG spectra showed the presence of polyphenols, such as resveratrol. These results revealed that at flowering, RG and AH increased the weights of fresh leaves and fruits and the number of green fruits, whereas at maturity, the biostimulants most affected the fresh weight and number of red fruits. At flowering, the leaves of the treated plants contained high amounts of epicatechin, ascorbic acid, quercetin, and dihydrocapsaicin. At maturity, the leaves of the treated plants exhibited elevated amounts of fructose, glucose, chlorogenic, and ferulic acids. Moreover, green fruits exhibited a high content of chlorogenic acid, p-hydroxybenzoic acid, p-coumaric acid and antioxidant activity, while both AH- and RG-treated red fruits were highly endowed in capsaicin. The 1H high-resolution magic-angle spinning (HRMAS)-nuclear magnetic resonance (NMR) spectra of red fruits revealed that both products induced a high amount of NADP+, whereas RG also increased glucose, fumarate, ascorbate, thymidine and high molecular weight species. Our results suggested that AH and RG promoted plant growth and the production of secondary metabolites, such as phenols. PMID:25136346

  13. Apple juice composition: sugar, nonvolatile acid, and phenolic profiles.

    PubMed

    Lee, H S; Wrolstad, R E

    1988-01-01

    Apples from Michigan, Washington, Argentina, Mexico, and New Zealand were processed into juice; the 8 samples included Golden Delicious, Jonathan, Granny Smith, and McIntosh varieties. Liquid chromatography was used for quantitation of sugars (glucose, fructose, sucrose, and sorbitol), nonvolatile acids (malic, quinic, citric, shikimic, and fumaric), and phenolics (chlorogenic acid and hydroxymethylfurfural [HMF]). Other determinations included pH, 0Brix, and L-malic acid. A number of compositional indices for these authentic juices, e.g., chlorogenic acid content, total malic - L-malic difference, and the HMF:chlorogenic ratio, were at variance with recommended standards. The phenolic profile was shown to be particularly influenced by gelatin fining, with peak areas decreasing by as much as 50%. The L-malic:total malic ratio serves as a better index for presence of synthetic malic acid than does the difference between the 2 determinations. No apparent differences in chemical composition could be attributed to geographic origin.

  14. Use of ion chromatography for monitoring microbial spoilage in the fruit juice industry.

    PubMed

    Trifirò, A; Saccani, G; Gherardi, S; Vicini, E; Spotti, E; Previdi, M P; Ndagijimana, M; Cavalli, S; Reschiotto, C

    1997-05-16

    Fruit juices and purees are defined as fermentable, but unfermented, products obtained by mechanical processing of fresh fruits. The presence of undesired metabolites derived from microbial growth can arise from the use of unsuitable fruit or from defects in the production line or subsequent contamination. This involves a loss in the overall quality that cannot be resolved by thermal treatment following the start of fermentation. With these considerations, together with microbiological control, the analysis of different metabolites, which can be considered as microbial growth markers, such as alcohols (i.e. ethanol, etc.), acids (i.e. acetic, fumaric, lactic, etc.) is fundamental in order to achieve a better evaluation of product quality. Enzymatic determination and other single-component analytical techniques are often used for the determination of these metabolites. When the microbial spoilage is not well known, this results in a long and cumbersome procedure. A versatile technique that is capable of determining many metabolites in one analysis could be helpful in improving routine quality control. For this purpose, an ion chromatographic technique, such as ion exclusion, for separation, and diode array spectrophotometry and conductivity, for detection, were evaluated. Both different industrial samples and inoculated samples were analyzed.

  15. A second dihydroorotate dehydrogenase (Type A) of the human pathogen Enterococcus faecalis: expression, purification, and steady-state kinetic mechanism.

    PubMed

    Marcinkeviciene, J; Jiang, W; Locke, G; Kopcho, L M; Rogers, M J; Copeland, R A

    2000-05-01

    We report the identification, expression, and characterization of a second Dihydroorotate dehydrogenase (DHODase A) from the human pathogen Enterococcus faecalis. The enzyme consists of a polypeptide chain of 322 amino acids that shares 68% identity with the cognate type A enzyme from the bacterium Lactococcus lactis. E. faecalis DHODase A catalyzed the oxidation of l-dihydroorotate while reducing a number of substrates, including fumarate, coenzyme Q(0), and menadione. The steady-state kinetic mechanism has been determined with menadione as an oxidizing substrate at pH 7.5. Initial velocity and product inhibition data suggest that the enzyme follows a two-site nonclassical ping-pong kinetic mechanism. The absorbance of the active site FMN cofactor is quenched in a concentration-dependent manner by titration with orotate and barbituric acid, two competitive inhibitors with respect to dihydroorotate. In contrast, titration of the enzyme with menadione had no effect on FMN absorbance, consistent with nonoverlapping binding sites for dihyroorotate and menadione, as suggested from the kinetic mechanism. The reductive half-reaction has been shown to be only partially rate limiting, and an attempt to evaluate the slow step in the overall reaction has been made by simulating orotate production under steady-state conditions. Our data indicate that the oxidative half-reaction is a rate-limiting segment, while orotate, most likely, retains significant affinity for the reduced enzyme, as suggested by the product inhibition pattern. Copyright 2000 Academic Press.

  16. Geobiology of Marine Magnetotactic Bacteria

    DTIC Science & Technology

    2006-06-01

    acids (e.g. lactate, acetate, oxalate , succinate, fumarate, malate, and citrate) which are continually transported into the soil, in part due to the...microbial mats, and hydrothermal vent waters. J Environ Monit 3: 61-66. 177 Lyons TW (1997) Sulfur isotopic trends and pathways of iron sulfide formation in...case in sediments, microbial mats, and hydrothermal vent waters. J Environ Monit 3: 61-66. 200 O’Sullivan DW, Hanson Jr AK, Kester DR (1997) The

  17. 21 CFR 522.84 - Beta-aminopropionitrile fumarate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.... Do not use in horses with dermal irritation or open skin lesions in the injection area. Do not...

  18. 21 CFR 522.84 - Beta-aminopropionitrile fumarate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.... Do not use in horses with dermal irritation or open skin lesions in the injection area. Do not...

  19. 21 CFR 522.84 - Beta-aminopropionitrile fumarate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.... Do not use in horses with dermal irritation or open skin lesions in the injection area. Do not...

  20. Study of Vitamins and Dietary Supplements Containing Ferrous Fumarate and Ferrous Sulfate Using Moessbauer Spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshtrakh, M. I.; Novikov, E. G.; Semionkin, V. A.

    2010-07-13

    A study of several samples of vitamins and dietary supplements containing ferrous fumarate and ferrous sulfate was carried out using Moessbauer spectroscopy with a high velocity resolution. A presence of ferrous and ferric impurities was revealed. Small variations of Moessbauer hyperfine parameters were found for both ferrous fumarates and ferrous sulfates in the investigated medicines.

  1. GiFRD encodes a protein involved in anaerobic growth in the arbuscular mycorrhizal fungus Glomus intraradices.

    PubMed

    Sędzielewska, Kinga A; Vetter, Katja; Bode, Rüdiger; Baronian, Keith; Watzke, Roland; Kunze, Gotthard

    2012-04-01

    Fumarate reductase is a protein involved in the maintenance of redox balance during oxygen deficiency. This enzyme irreversibly catalyzes the reduction of fumarate to succinate and requires flavin cofactors as electron donors. Two examples are the soluble mitochondrial and the cytosolic fumarate reductases of Saccharomyces cerevisiae encoded by the OSM1 and FRDS1 genes, respectively. This work reports the identification and characterization of the gene encoding cytosolic fumarate reductase enzyme in the arbuscular mycorrhizal fungus, Glomus intraradices and the establishment of its physiological role. Using a yeast expression system, we demonstrate that G. intraradices GiFRD encodes a protein that has fumarate reductase activity which can functionally substitute for the S. cerevisiae fumarate reductases. Additionally, we showed that GiFRD transformants are not affected by presence of salt in medium, indicating that the presence of this gene has no effect on yeast behavior under osmotic stress. The fact that GiFRD expression and enzymatic activity was present only in asymbiotic stage confirmed existence of at least one anaerobic metabolic pathway in this phase of fungus life cycle. This suggests that the AMF behave as facultative anaerobes in the asymbiotic stage. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Fumarate-Mediated Persistence of Escherichia coli against Antibiotics

    PubMed Central

    Kim, Jun-Seob; Cho, Da-Hyeong; Heo, Paul; Jung, Suk-Chae; Park, Myungseo; Oh, Eun-Joong; Sung, Jaeyun; Kim, Pan-Jun; Lee, Suk-Chan; Lee, Dae-Hee; Lee, Sarah; Lee, Choong Hwan; Shin, Dongwoo

    2016-01-01

    Bacterial persisters are a small fraction of quiescent cells that survive in the presence of lethal concentrations of antibiotics. They can regrow to give rise to a new population that has the same vulnerability to the antibiotics as did the parental population. Although formation of bacterial persisters in the presence of various antibiotics has been documented, the molecular mechanisms by which these persisters tolerate the antibiotics are still controversial. We found that amplification of the fumarate reductase operon (FRD) in Escherichia coli led to a higher frequency of persister formation. The persister frequency of E. coli was increased when the cells contained elevated levels of intracellular fumarate. Genetic perturbations of the electron transport chain (ETC), a metabolite supplementation assay, and even the toxin-antitoxin-related hipA7 mutation indicated that surplus fumarate markedly elevated the E. coli persister frequency. An E. coli strain lacking succinate dehydrogenase (SDH), thereby showing a lower intracellular fumarate concentration, was killed ∼1,000-fold more effectively than the wild-type strain in the stationary phase. It appears that SDH and FRD represent a paired system that gives rise to and maintains E. coli persisters by producing and utilizing fumarate, respectively. PMID:26810657

  3. Crystallographic studies of the binding of ligands to the dicarboxylate site of Complex II, and the identity of the ligand in the "oxaloacetate-inhibited" state.

    PubMed

    Huang, Li-Shar; Shen, John T; Wang, Andy C; Berry, Edward A

    2006-01-01

    Mitochondrial Complex II (succinate:ubiquinone oxidoreductase) is purified in a partially inactivated state, which can be activated by removal of tightly bound oxaloacetate (E.B. Kearney, et al., Biochem. Biophys. Res. Commun. 49 1115-1121). We crystallized Complex II in the presence of oxaloacetate or with the endogenous inhibitor bound. The structure showed a ligand essentially identical to the "malate-like intermediate" found in Shewanella Flavocytochrome c crystallized with fumarate (P. Taylor, et al., Nat. Struct. Biol. 6 1108-1112) Crystallization of Complex II in the presence of excess fumarate also gave the malate-like intermediate or a mixture of that and fumarate at the active site. In order to more conveniently monitor the occupation state of the dicarboxylate site, we are developing a library of UV/Vis spectral effects induced by binding different ligands to the site. Treatment with fumarate results in rapid development of the fumarate difference spectrum and then a very slow conversion into a species spectrally similar to the OAA-liganded complex. Complex II is known to be capable of oxidizing malate to the enol form of oxaloacetate (Y.O. Belikova, et al., Biochim. Biophys. Acta 936 1-9). The observations above suggest it may also be capable of interconverting fumarate and malate. It may be useful for understanding the mechanism and regulation of the enzyme to identify the malate-like intermediate and its pathway of formation from oxaloacetate or fumarate.

  4. Dimethyl fumarate blocks pro-inflammatory cytokine production via inhibition of TLR induced M1 and K63 ubiquitin chain formation.

    PubMed

    McGuire, Victoria A; Ruiz-Zorrilla Diez, Tamara; Emmerich, Christoph H; Strickson, Sam; Ritorto, Maria Stella; Sutavani, Ruhcha V; Weiβ, Anne; Houslay, Kirsty F; Knebel, Axel; Meakin, Paul J; Phair, Iain R; Ashford, Michael L J; Trost, Matthias; Arthur, J Simon C

    2016-08-08

    Dimethyl fumarate (DMF) possesses anti-inflammatory properties and is approved for the treatment of psoriasis and multiple sclerosis. While clinically effective, its molecular target has remained elusive - although it is known to activate anti-oxidant pathways. We find that DMF inhibits pro-inflammatory cytokine production in response to TLR agonists independently of the Nrf2-Keap1 anti-oxidant pathway. Instead we show that DMF can inhibit the E2 conjugating enzymes involved in K63 and M1 polyubiquitin chain formation both in vitro and in cells. The formation of K63 and M1 chains is required to link TLR activation to downstream signaling, and consistent with the block in K63 and/or M1 chain formation, DMF inhibits NFκB and ERK1/2 activation, resulting in a loss of pro-inflammatory cytokine production. Together these results reveal a new molecular target for DMF and show that a clinically approved drug inhibits M1 and K63 chain formation in TLR induced signaling complexes. Selective targeting of E2s may therefore be a viable strategy for autoimmunity.

  5. Catabolism of α-Ketoglutarate by a sucA Mutant of Bradyrhizobium japonicum: Evidence for an Alternative Tricarboxylic Acid Cycle

    PubMed Central

    Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.

    2000-01-01

    A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553

  6. Research on the degradation mechanism of pyridine in drinking water by dielectric barrier discharge.

    PubMed

    Li, Yang; Yi, Rongjie; Yi, Chengwu; Zhou, Biyun; Wang, Huijuan

    2017-03-01

    Pyridine, an important chemical raw material, is widely used in industry, for example in textiles, leather, printing, dyeing, etc. In this research, a dielectric barrier discharge (DBD) system was developed to remove pyridine, as a representative type of nitrogen heterocyclic compound in drinking water. First, the influence of the active species inhibitors tertiary butanol alcohol (TBA), HCO 3 - , and CO 3 2- on the degradation rate of pyridine was investigated to verify the existence of active species produced by the strong ionization discharge in the system. The intermediate and final products generated in the degradation process of pyridine were confirmed and analyzed through a series of analytical techniques, including liquid chromatography-mass spectrometry (LC-MS), high performance liquid chromatography (HPLC), ion chromatography (IC), total organic carbon (TOC) analysis, ultraviolet (UV) spectroscopy, etc. The results showed that the degradation of pyridine was mainly due to the strong oxidizing power of ozone and hydroxyl radical produced by the DBD system. Several intermediate products including 3-hydroxyl pyridine, fumaric acid, 2, 3-dihydroxypyridine, and oxalic acid were detected. Nitrogen was removed from the pyridine molecule to form nitrate. Through analysis of the degradation mechanism of pyridine, the oxidation pathway was deduced. The study provided a theoretical and experimental basis for the application of DBD strong ionization discharge in treatment of nitrogen heterocyclic compounds in drinking water. Copyright © 2016. Published by Elsevier B.V.

  7. Metabolic characterization of cultured mammalian cells by mass balance analysis, tracer labeling experiments and computer-aided simulations.

    PubMed

    Okahashi, Nobuyuki; Kohno, Susumu; Kitajima, Shunsuke; Matsuda, Fumio; Takahashi, Chiaki; Shimizu, Hiroshi

    2015-12-01

    Studying metabolic directions and flow rates in cultured mammalian cells can provide key information for understanding metabolic function in the fields of cancer research, drug discovery, stem cell biology, and antibody production. In this work, metabolic engineering methodologies including medium component analysis, (13)C-labeling experiments, and computer-aided simulation analysis were applied to characterize the metabolic phenotype of soft tissue sarcoma cells derived from p53-null mice. Cells were cultured in medium containing [1-(13)C] glutamine to assess the level of reductive glutamine metabolism via the reverse reaction of isocitrate dehydrogenase (IDH). The specific uptake and production rates of glucose, organic acids, and the 20 amino acids were determined by time-course analysis of cultured media. Gas chromatography-mass spectrometry analysis of the (13)C-labeling of citrate, succinate, fumarate, malate, and aspartate confirmed an isotopically steady state of the cultured cells. After removing the effect of naturally occurring isotopes, the direction of the IDH reaction was determined by computer-aided analysis. The results validated that metabolic engineering methodologies are applicable to soft tissue sarcoma cells derived from p53-null mice, and also demonstrated that reductive glutamine metabolism is active in p53-null soft tissue sarcoma cells under normoxia. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Probing the metabolic network in bloodstream-form Trypanosoma brucei using untargeted metabolomics with stable isotope labelled glucose.

    PubMed

    Creek, Darren J; Mazet, Muriel; Achcar, Fiona; Anderson, Jana; Kim, Dong-Hyun; Kamour, Ruwida; Morand, Pauline; Millerioux, Yoann; Biran, Marc; Kerkhoven, Eduard J; Chokkathukalam, Achuthanunni; Weidt, Stefan K; Burgess, Karl E V; Breitling, Rainer; Watson, David G; Bringaud, Frédéric; Barrett, Michael P

    2015-03-01

    Metabolomics coupled with heavy-atom isotope-labelled glucose has been used to probe the metabolic pathways active in cultured bloodstream form trypomastigotes of Trypanosoma brucei, a parasite responsible for human African trypanosomiasis. Glucose enters many branches of metabolism beyond glycolysis, which has been widely held to be the sole route of glucose metabolism. Whilst pyruvate is the major end-product of glucose catabolism, its transamination product, alanine, is also produced in significant quantities. The oxidative branch of the pentose phosphate pathway is operative, although the non-oxidative branch is not. Ribose 5-phosphate generated through this pathway distributes widely into nucleotide synthesis and other branches of metabolism. Acetate, derived from glucose, is found associated with a range of acetylated amino acids and, to a lesser extent, fatty acids; while labelled glycerol is found in many glycerophospholipids. Glucose also enters inositol and several sugar nucleotides that serve as precursors to macromolecule biosynthesis. Although a Krebs cycle is not operative, malate, fumarate and succinate, primarily labelled in three carbons, were present, indicating an origin from phosphoenolpyruvate via oxaloacetate. Interestingly, the enzyme responsible for conversion of phosphoenolpyruvate to oxaloacetate, phosphoenolpyruvate carboxykinase, was shown to be essential to the bloodstream form trypanosomes, as demonstrated by the lethal phenotype induced by RNAi-mediated downregulation of its expression. In addition, glucose derivatives enter pyrimidine biosynthesis via oxaloacetate as a precursor to aspartate and orotate.

  9. The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

    PubMed Central

    2009-01-01

    Background The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second putative succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae. PMID:19473543

  10. Drug-induced Fanconi syndrome associated with fumaric acid esters treatment for psoriasis: a case series

    PubMed Central

    Balak, Deepak M.W.; Bouwes Bavinck, Jan Nico; de Vries, Aiko P.J.; Hartman, Jenny; Neumann, Hendrik A. Martino; Zietse, Robert; Thio, Hok Bing

    2016-01-01

    Background Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Methods Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. Results All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37–46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28–111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. Conclusions FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome. PMID:26798466

  11. Overexpression of NADH-dependent fumarate reductase improves D-xylose fermentation in recombinant Saccharomyces cerevisiae.

    PubMed

    Salusjärvi, Laura; Kaunisto, Sanna; Holmström, Sami; Vehkomäki, Maija-Leena; Koivuranta, Kari; Pitkänen, Juha-Pekka; Ruohonen, Laura

    2013-12-01

    Deviation from optimal levels and ratios of redox cofactors NAD(H) and NADP(H) is common when microbes are metabolically engineered. The resulting redox imbalance often reduces the rate of substrate utilization as well as biomass and product formation. An example is the metabolism of D-xylose by recombinant Saccharomyces cerevisiae strains expressing xylose reductase and xylitol dehydrogenase encoding genes from Scheffersomyces stipitis. This pathway requires both NADPH and NAD(+). The effect of overexpressing the glycosomal NADH-dependent fumarate reductase (FRD) of Trypanosoma brucei in D-xylose-utilizing S. cerevisiae alone and together with an endogenous, cytosol directed NADH-kinase (POS5Δ17) was studied as one possible solution to overcome this imbalance. Expression of FRD and FRD + POS5Δ17 resulted in 60 and 23 % increase in ethanol yield, respectively, on D-xylose under anaerobic conditions. At the same time, xylitol yield decreased in the FRD strain suggesting an improvement in redox balance. We show that fumarate reductase of T. brucei can provide an important source of NAD(+) in yeast under anaerobic conditions, and can be useful for metabolic engineering strategies where the redox cofactors need to be balanced. The effects of FRD and NADH-kinase on aerobic and anaerobic D-xylose and D-glucose metabolism are discussed.

  12. Dimethyl fumarate modulation of immune and antioxidant responses: application to HIV therapy

    PubMed Central

    Gill, Alexander J.; Kolson, Dennis L.

    2013-01-01

    The persistence of chronic immune activation and oxidative stress in human immunodeficiency virus (HIV)-infected, antiretroviral drug-treated individuals are major obstacles to fully preventing HIV disease progression. The immune modulator and antioxidant dimethyl fumarate (DMF) is effective in treating immune-mediated diseases and it also has potential applications to limiting HIV disease progression. Among the relevant effects of DMF and its active metabolite monomethyl fumarate (MMF) are induction of a Th1 → Th2 lymphocyte shift, inhibition of pro-inflammatory cytokine signaling, inhibition of NF-κB nuclear translocation, inhibition of dendritic cell maturation, suppression of lymphocyte and endothelial cell adhesion molecule expression, and induction of the Nrf2-dependent antioxidant response element (ARE) and effector genes. Associated with these effects are reduced lymphocyte and monocyte infiltration into psoriatic skin lesions in humans and immune-mediated demyelinating brain lesions in rodents, which confirms potent systemic and central nervous system (CNS) effects. In addition, DMF and MMF limit HIV infection in macrophages in vitro, albeit by unknown mechanisms. Finally, DMF and MMF also suppress neurotoxin production from HIV-infected macrophages, which drives CNS neurodegeneration. Thus, DMF might protect against systemic and CNS complications in HIV infection through its effective suppression of immune activation, oxidative stress, HIV replication, and macrophage-associated neuronal injury. PMID:23971529

  13. Evaluation of three pumpkin species: correlation with physicochemical, antioxidant properties and classification using SPME-GC-MS and E-nose methods.

    PubMed

    Zhou, Chun-Li; Mi, Li; Hu, Xue-Yan; Zhu, Bi-Hua

    2017-09-01

    To ascertain the most discriminant variables for three pumpkin species principal component analysis (PCA) was performed. Twenty-four parameters (pH, conductivity, sucrose, glucose, total soluble solids, L* , a* , b* , individual weight, edible rate, firmness, citric acid, fumaric acid, l-ascorbic acid, malic acid, PPO activity, POD activity, total flavonoids, vitamin E, total phenolics, DPPH, FRAP, β-carotene, and aroma) were considered. The studied pumpkin species were Cucurbita maxima , Cucurbita moschata , and Cucurbita pepo . Three pumpkin species were classified by PCA based on aroma, physicochemical and antioxidant properties because the sum of PC1 and PC2 were both greater than 85% (85.06 and 93.64% respectively). Results were validated by the PCA and showed that PPO activity, total flavonoid, sucrose, glucose, TSS, a* , pH, malic acid, vitamin E, DPPH, FRAP and β-carotene, and aroma are highly useful parameters to classify pumpkin species.

  14. Nutritional and Biochemical Profiling of Leucopaxillus candidus (Bres.) Singer Wild Mushroom.

    PubMed

    Vieira, Vanessa; Barros, Lillian; Martins, Anabela; Ferreira, Isabel C F R

    2016-01-15

    The wild mushroom Leucopaxillus candidus (Bres.) Singer was studied for the first time to obtain information about its chemical composition, nutritional value and bioactivity. Free sugars, fatty acids, tocopherols, organic and phenolic acids were analysed by chromatographic techniques coupled to different detectors. L. candidus methanolic extract was tested regarding antioxidant potential (reducing power, radical scavenging activity and lipid peroxidation inhibition). L. candidus was shown to be an interesting species in terms of nutritional value, with high content in proteins and carbohydrates, but low fat levels, with the prevalence of polyunsaturated fatty acids. Mannitol was the most abundant free sugar and β-tocopherol was the main tocopherol isoform. Other compounds detected were oxalic and fumaric acids, p-hydroxybenzoic and cinnamic acids. The methanolic extract revealed antioxidant activity and did not show hepatoxicity in porcine liver primary cells. The present study provides new information about L. candidus.

  15. Chemical characteristics of dicarboxylic acids and related organic compounds in PM2.5 during biomass-burning and non-biomass-burning seasons at a rural site of Northeast China.

    PubMed

    Cao, Fang; Zhang, Shi-Chun; Kawamura, Kimitaka; Liu, Xiaoyan; Yang, Chi; Xu, Zufei; Fan, Meiyi; Zhang, Wenqi; Bao, Mengying; Chang, Yunhua; Song, Wenhuai; Liu, Shoudong; Lee, Xuhui; Li, Jun; Zhang, Gan; Zhang, Yan-Lin

    2017-12-01

    Fine particulate matter (PM2.5) samples were collected using a high-volume air sampler and pre-combusted quartz filters during May 2013 to January 2014 at a background rural site (47 ∘ 35 N, 133 ∘ 31 E) in Sanjiang Plain, Northeast China. A homologous series of dicarboxylic acids (C 2 -C 11 ) and related compounds (oxoacids, α-dicarbonyls and fatty acids) were analyzed by using a gas chromatography (GC) and GC-MS method employing a dibutyl ester derivatization technique. Intensively open biomass-burning (BB) episodes during the harvest season in fall were characterized by high mass concentrations of PM2.5, dicarboxylic acids and levoglucosan. During the BB period, mass concentrations of dicarboxylic acids and related compounds were increased by up to >20 times with different factors for different organic compounds (i.e., succinic (C 4 ) acid > oxalic (C 2 ) acid > malonic (C 3 ) acid). High concentrations were also found for their possible precursors such as glyoxylic acid (ωC 2 ), 4-oxobutanoic acid, pyruvic acid, glyoxal, and methylglyoxal as well as fatty acids. Levoglucosan showed strong correlations with carbonaceous aerosols (OC, EC, WSOC) and dicarboxylic acids although such good correlations were not observed during non-biomass-burning seasons. Our results clearly demonstrate biomass burning emissions are very important contributors to dicarboxylic acids and related compounds. The selected ratios (e.g., C 3 /C 4 , maleic acid/fumaric acid, C 2 /ωC 2 , and C 2 /levoglucosan) were used as tracers for secondary formation of organic aerosols and their aging process. Our results indicate that organic aerosols from biomass burning in this study are fresh without substantial aging or secondary production. The present chemical characteristics of organic compounds in biomass-burning emissions are very important for better understanding the impacts of biomass burning on the atmosphere aerosols. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Gateways to Clinical Trials.

    PubMed

    Bayés, M; Rabasseda, X; Prous, J R

    2002-09-01

    Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Studies knowledge area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: Adalimumab, aeroDose insulin inhaler, agomelatine, alendronic acid sodium salt, aliskiren fumarate, alteplase, amlodipine, aspirin, atazanavir; Bacillus Calmette-Guérin, basiliximab, BQ-788, bupropion hydrochloride; Cabergoline, caffeine citrate, carbamazepine, carvedilol, celecoxib, cyclosporine, clopidogrel hydrogensulfate, colestyramine; Dexamethasone, diclofenac sodium, digoxin, dipyridamole, docetaxel, dutasteride; Eletriptan, enfuvirtidie, eplerenone, ergotamine tartrate, esomeprazole magnesium, estramustine phosphate sodium; Finasteride, fluticasone propionate, fosinopril sodium; Ganciclovir, GBE-761-ONC, glatiramer acetate, gliclazide, granulocyte-CSF; Heparin sodium, human isophane insulin (pyr), Hydrochlorothiazide; Ibuprofen, inhaled insulin, interferon alfa, interferon beta-1a; Laminvudine, lansoprazole, lisinopril, lonafarnib, losartan potassium, lumiracoxib; MAb G250, meloxicam methotrexate, methylprednisolone aceponate, mitomycin, mycophenolate mofetil; Naproxen sodium, natalizumab, nelfinavir mesilate, nemifitide ditriflutate, nimesulide; Omalizumab, omapatrilat, omeprazole, oxybutynin chloride; Pantoprazole sodium, paracetamol, paroxetine, pentoxifylline, pergolide mesylate, permixon, phVEGF-A165, pramipexole hydrochloride, prasterone, prednisone, probucol, propiverine hydrochloride; Rabeprazole sodium, resiniferatoxin, risedronate sodium, risperidone, rofecoxib rosiglitazone maleate, ruboxistaurin mesilate hydrate; Selegiline transdermal system, sertraline, sildenafil citrate, streptokinase; Tadalafil, tamsulosin hydrochloride, technosphere/Insulin, tegaserod maleate, tenofovir disoproxil fumarate, testosterone heptanoate, testosterone undecanoate, tipifarnib, tolterodine tartrate, topiramate, troglitazone; Ursodeoxycholic acid; Valdecoxib, valsartan, vardenafil, venlafaxine hydrochloride, VX-745.

  17. Crystal Structures and Phase Relationships of 2 Polymorphs of 1,4-Diazabicyclo[3.2.2]nonane-4-Carboxylic Acid 4-Bromophenyl Ester Fumarate, A Selective α-7 Nicotinic Receptor Partial Agonist.

    PubMed

    Robert, Benoît; Perrin, Marc-Antoine; Barrio, Maria; Tamarit, Josep-Lluis; Coquerel, Gérard; Ceolin, René; Rietveld, Ivo B

    2016-01-01

    Two polymorphs of the 1:1 fumarate salt of 1,4-diazabicyclo[3.2.2]nonane-4-carboxylic acid 4-bromophenyl ester, developed for the treatment of cognitive symptoms of schizophrenia and Alzheimer disease, have been characterized. The 2 crystal structures have been solved, and their phase relationships have been established. The space group of form I is P2₁/c with a unit-cell volume of 1811.6 (5) Å(3) with Z = 4. The crystals of form I were 2-component nonmerohedral twins. The space group of form II is P2₁/n with a unit-cell volume of 1818.6 (3) Å(3) with Z = 4. Relative stabilities have been inferred from experimental and topological P-T diagrams exhibiting an overall enantiotropic relationship between forms I and II although the solid-solid transition has never been observed. The slope of the I-II equilibrium in the P-T diagram is negative, form II is the stable phase below the solid-solid transition temperature of 371 K, and form I exhibits a stable melting equilibrium. The I-II transition temperature has been obtained from the intersection of the sublimation curves of the 2 solid forms. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  18. [Faba bean fusarium wilt (Fusarium oxysporum )control and its mechanism in different wheat varieties and faba bean intercropping system].

    PubMed

    Dong, Yan; Dong, Kun; Zheng, Yi; Tang, Li; Yang, Zhi-Xian

    2014-07-01

    Field experiment and hydroponic culture were conducted to investigate effects of three wheat varieties (Yunmai 42, Yunmai 47 and Mianyang 29) and faba bean intercropping on the shoot biomass, disease index of fusarium wilt, functional diversity of microbial community and the amount of Fusarium oxysporum in rhizosphere of faba bean. Contents and components of the soluble sugars, free amino acids and organic acids in the root exudates were also examined. Results showed that, compared with monocropped faba bean, shoot biomass of faba bean significantly increased by 16.6% and 13.4%, disease index of faba bean fusarium wilt significantly decreased by 47.6% and 23.3% as intercropped with Yunmai 42 and Yunmai 47, but no significant differences of both shoot biomass and disease index were found as intercropped with Mianyang 29. Compared with monocropped faba bean, the average well color development (AWCD value) and total utilization ability of carbon sources of faba bean significantly increased, the amount of Fusarium oxysporum of faba bean rhizosphere significantly decreased, and the microbial community structures of faba bean rhizosphere changed as intercropped with YM42 and YM47, while no significant effects as intercropped with MY29. Total contents of soluble sugar, free amino acids and organic acids in root exudates were in the trend of MY29>YM47>YM42. Contents of serine, glutamic, glycine, valine, methionine, phenylalanine, lysine in root exudates of MY29 were significantly higher than that in YM42 and YM47. The arginine was detected only in the root exudates of YM42 and YM47, and leucine was detected only in the root exudates of MY29. Six organic acids of tartaric acid, malic acid, citric acid, succinic acid, fumaric acid, t-aconitic acid were detected in root exudates of MY29 and YM47, and four organic acids of tartaric acid, malic acid, citric acid, fumaric acid were detected in root exudates of YM42. Malic acid content in root exudates of YM47 and MY29 was significantly higher than that of YM42. In conclusion, intercropping influenced the microbial activity and substrate utilization of soil microorganisms, altered the microbial community diversity in rhizosphere of faba bean, reduced the amount of F. oxysporum and disease index of faba bean fusarium wilt, and promoted faba bean growth. Effects of intercropping on disease control were influenced by the intercropped wheat variety, suggesting that the differences of root exudates of wheat were important factors that affected soil-borne diseases control in intercropping.

  19. Study on US/O3 mechanism in p-chlorophenol decomposition

    PubMed Central

    Xu, Xian-wen; Xu, Xin-hua; Shi, Hui-xiang; Wang, Da-hui

    2005-01-01

    Study on the effects of sonolysis, ozonolysis and US/O3 system on the decomposition of p-chlorophenol in aqueous solutions indicated that in the cases of US/O3 system, individual ozonolysis and sonolysis, the decomposition rate of p-chlorophenol reached 78.78%, 56.20%, 2.79% after a 16-min reaction while its CODcr (chemical oxygen demand) removal rate was 97.02%, 62.17%, 3.67% after a 120-min reaction. The decomposition reaction of p-chlorophenol follows pseudo-first-order kinetics. The enhancement factors of p-chlorophenol and its CODcr under US/O3 system reached 63% and 237% respectively. The main intermediates during the decomposition include catechol, hydroquinone, p-benzoquinone, phenol, fumaric acid, maleic acid, oxalic acid and formic acid. The decomposition mechanism of p-chlorophenol was also discussed. PMID:15909343

  20. Mitochondrial fumarate reductase as a target of chemotherapy: from parasites to cancer cells.

    PubMed

    Sakai, Chika; Tomitsuka, Eriko; Esumi, Hiroyasu; Harada, Shigeharu; Kita, Kiyoshi

    2012-05-01

    Recent research on respiratory chain of the parasitic helminth, Ascaris suum has shown that the mitochondrial NADH-fumarate reductase system (fumarate respiration), which is composed of complex I (NADH-rhodoquinone reductase), rhodoquinone and complex II (rhodoquinol-fumarate reductase) plays an important role in the anaerobic energy metabolism of adult parasites inhabiting hosts. The enzymes in these parasite-specific pathways are potential target for chemotherapy. We isolated a novel compound, nafuredin, from Aspergillus niger, which inhibits NADH-fumarate reductase in helminth mitochondria at nM order. It competes for the quinone-binding site in complex I and shows high selective toxicity to the helminth enzyme. Moreover, nafuredin exerts anthelmintic activity against Haemonchus contortus in in vivo trials with sheep indicating that mitochondrial complex I is a promising target for chemotherapy. In addition to complex I, complex II is a good target because its catalytic direction is reverse of succinate-ubiquionone reductase in the host complex II. Furthermore, we found atpenin and flutolanil strongly and specifically inhibit mitochondrial complex II. Interestingly, fumarate respiration was found not only in the parasites but also in some types of human cancer cells. Analysis of the mitochondria from the cancer cells identified an anthelminthic as a specific inhibitor of the fumarate respiration. Role of isoforms of human complex II in the hypoxic condition of cancer cells and fetal tissues is a challenge. This article is part of a Special Issue entitled Biochemistry of Mitochondria, Life and Intervention 2010. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Analysis of mechanisms for memory enhancement using novel and potent 5-HT1A receptor ligands.

    PubMed

    Pittalà, Valeria; Siracusa, Maria A; Salerno, Loredana; Romeo, Giuseppe; Modica, Maria N; Madjid, Nather; Ogren, Sven Ove

    2015-08-01

    In light of the involvement of serotonergic 5-HT1A receptors in the mediation of the memory of aversive events, the potent and selective 5-HT1A receptor antagonists, MC18 fumarate and VP08/34 fumarate, were tested in the passive avoidance task (PA), a rodent model of instrumental conditioning. Either alone or in combination with the prototypical agonist 8-OH-DPAT, MC18 fumarate at doses (0.1, 0.3 and 1mg/kg given 15min prior to training) exerted a dose-dependent facilitation of PA memory retention. When administered 15min prior to 8-OH-DPAT (0.3 and 1mg/kg), MC18 fumarate at a dose of 0.3mg/kg, enhanced significantly the impairment of PA retention caused by 8-OH-DPAT (1mg/kg). However, VP08/34 fumarate given at the same doses exerted no statistically effect on PA retention memory. Furthermore, VP08/34 fumarate given 15min prior to 8-OH-DPAT (0.3 and 1mg/kg) only slightly enhanced the PA impairment induced by 8-OH-DPAT. In conclusion, the profile of MC18 fumarate is intriguing since it behaves in a manner which differs from both full receptor antagonists such as NAD-299 or partial receptor agonists. The results also illustrate the importance of subtle receptor interaction and probably ligand efficacy in determining the actions of two almost identical 5-HT1A receptor ligands in cognitive function such as instrumental learning. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

  2. Organic acids influence iron uptake in the human epithelial cell line Caco-2.

    PubMed

    Salovaara, Susan; Sandberg, Ann-Sofie; Andlid, Thomas

    2002-10-09

    It has previously been suggested that organic acids enhance iron absorption. We have studied the effect of nine organic acids on the absorption of Fe(II) and Fe(III) in the human epithelial cell line Caco-2. The effect obtained was dose-dependent, and the greatest increase (43-fold) was observed for tartaric acid (4 mmol/L) on Fe(III) (10 micromol/L). Tartaric, malic, succinic, and fumaric acids enhanced Fe(II) and Fe(III) uptake. Citric and oxalic acid, on the other hand, inhibited Fe(II) uptake but enhanced Fe(III) uptake. Propionic and acetic acid increased the Fe(II) uptake, but had no effect on Fe(III) uptake. Our results show a correlation between absorption pattern and chemical structure; e.g. hydroxyl groups, in addition to carboxyls, were connected with a positive influence. The results may be important for elucidating factors affecting iron bioavailability in the small intestine and for the development of foods with improved iron bioavailability.

  3. Sulfurospirillum arcachonense sp. nov., a new microaerophilic sulfur-reducing bacterium.

    PubMed

    Finster, K; Liesack, W; Tindall, B J

    1997-10-01

    The isolation of a new motile, gram-negative, heterotrophic, sulfur-reducing, microaerophilic, vibrioid bacterium, strain F1F6, from oxidized marine surface sediment (Arcachon Bay, French Atlantic coast) is described. Hydrogen (with acetate as the carbon source), formate (with acetate as the carbon source), pyruvate, lactate, alpha-ketoglutarate, glutarate, glutamate, and yeast extract supported growth with elemental sulfur under anaerobic conditions. Apart from H2 and formate, the oxidation of the substrates was incomplete. Microaerophilic growth was supported with hydrogen (acetate as the carbon source), formate (acetate as the carbon source), acetate, propionate, pyruvate, lactate, alpha-ketoglutarate, glutamate, yeast extract, fumarate, succinate, malate, citrate, and alanine. The isolate grew fermentatively with fumarate, succinate being the only organic product. Elemental sulfur and oxygen were the only electron acceptors used. Vitamins or amino acids were not required. The isolate was oxidase, catalase, and urease positive. Comparative 16S rDNA sequence analysis revealed a tight cluster consisting of the validly described species Sulfurospirillum deleyianum and the strains SES-3 and CCUG 13942 as the closest relatives of strain F1F6 (level of sequence similarity, 91.7 to 92.4%). Together with strain F1F6, these organisms form a novel lineage within the epsilon subclass of proteobacteria clearly separated from the described species of the genera Arcobacter, Campylobacter, Wolinella, and Helicobacter. Due to the phenotypic characteristics shared by strain F1F6 and S. deleyianum and considering their phylogenetic relationship, we propose the inclusion of strain F1F6 in the genus Sulfurospirillum, namely, as S. arcachonense sp. nov. Based on the results of this study, an emended description of the genus Sulfurospirillum is given.

  4. Products of Dark CO2 Fixation in Pea Root Nodules Support Bacteroid Metabolism 1

    PubMed Central

    Rosendahl, Lis; Vance, Carroll P.; Pedersen, Walther B.

    1990-01-01

    Products of the nodule cytosol in vivo dark [14C]CO2 fixation were detected in the plant cytosol as well as in the bacteroids of pea (Pisum sativum L. cv “Bodil”) nodules. The distribution of the metabolites of the dark CO2 fixation products was compared in effective (fix+) nodules infected by a wild-type Rhizobium leguminosarum (MNF 300), and ineffective (fix−) nodules of the R. leguminosarum mutant MNF 3080. The latter has a defect in the dicarboxylic acid transport system of the bacterial membrane. The 14C incorporation from [14C]CO2 was about threefold greater in the wild-type nodules than in the mutant nodules. Similarly, in wild-type nodules the in vitro phosphoenolpyruvate carboxylase activity was substantially greater than that of the mutant. Almost 90% of the 14C label in the cytosol was found in organic acids in both symbioses. Malate comprised about half of the total cytosol organic acid content on a molar basis, and more than 70% of the cytosol radioactivity in the organic acid fraction was detected in malate in both symbioses. Most of the remaining 14C was contained in the amino acid fraction of the cytosol in both symbioses. More than 70% of the 14C label found in the amino acids of the cytosol was incorporated in aspartate, which on a molar basis comprised only about 1% of the total amino acid pool in the cytosol. The extensive 14C labeling of malate and aspartate from nodule dark [14C]CO2 fixation is consistent with the role of phosphoenolpyruvate carboxlase in nodule dark CO2 fixation. Bacteroids from the effective wild-type symbiosis accumulated sevenfold more 14C than did the dicarboxylic acid transport defective bacteroids. The bacteroids of the effective MNF 300 symbiosis contained the largest proportion of the incorporated 14C in the organic acids, whereas ineffective MNF 3080 bacteroids mainly contained 14C in the amino acid fraction. In both symbioses a larger proportion of the bacteroid 14C label was detected in malate and aspartate than their corresponding proportions of the organic acids and amino acids on a molar basis. The proportion of 14C label in succinate, 2-oxogultarate, citrate, and fumarate in the bacteroids of the wild type greatly exceeded that of the dicarboxylate uptake mutant. The results indicate a central role for nodule cytosol dark CO2 fixation in the supply of the bacteroids with dicarboxylic acids. PMID:16667422

  5. Salmonella enterica serovar Typhimurium mutants unable to convert malate to pyruvate and oxaloacetate are avirulent and immunogenic in BALB/c mice.

    PubMed

    Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S

    2009-04-01

    Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.

  6. Three transcription regulators of the Nss family mediate the adaptive response induced by nitrate, nitric oxide or nitrous oxide in Wolinella succinogenes.

    PubMed

    Kern, Melanie; Simon, Jörg

    2016-09-01

    Sensing potential nitrogen-containing respiratory substrates such as nitrate, nitrite, hydroxylamine, nitric oxide (NO) or nitrous oxide (N2 O) in the environment and subsequent upregulation of corresponding catabolic enzymes is essential for many microbial cells. The molecular mechanisms of such adaptive responses are, however, highly diverse in different species. Here, induction of periplasmic nitrate reductase (Nap), cytochrome c nitrite reductase (Nrf) and cytochrome c N2 O reductase (cNos) was investigated in cells of the Epsilonproteobacterium Wolinella succinogenes grown either by fumarate, nitrate or N2 O respiration. Furthermore, fumarate respiration in the presence of various nitrogen compounds or NO-releasing chemicals was examined. Upregulation of each of the Nap, Nrf and cNos enzyme systems was found in response to the presence of nitrate, NO-releasers or N2 O, and the cells were shown to employ three transcription regulators of the Crp-Fnr superfamily (homologues of Campylobacter jejuni NssR), designated NssA, NssB and NssC, to mediate the upregulation of Nap, Nrf and cNos. Analysis of single nss mutants revealed that NssA controls production of the Nap and Nrf systems in fumarate-grown cells, while NssB was required to induce the Nap, Nrf and cNos systems specifically in response to NO-generators. NssC was indispensable for cNos production under any tested condition. The data indicate dedicated signal transduction routes responsive to nitrate, NO and N2 O and imply the presence of an N2 O-sensing mechanism. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Carboxylic acids permeases in yeast: two genes in Kluyveromyces lactis.

    PubMed

    Lodi, Tiziana; Fontanesi, Flavia; Ferrero, Iliana; Donnini, Claudia

    2004-09-15

    Two new genes KlJEN1 and KlJEN2 were identified in Kluyveromyces lactis. The deduced structure of their products is typical of membrane-bound carriers and displays high similarity to Jen1p, the monocarboxylate permease of Saccharomyces cerevisiae. Both KlJEN1 and KlJEN2 are under the control of glucose repression mediated by FOG1 and FOG2, corresponding to S. cerevisiae GAL83 and SNF1 respectively, and KlCAT8, proteins involved in glucose signalling cascade in K. lactis. KlJEN1, but not KlJEN2, is induced by lactate. KlJEN2 in contrast is expressed at high level in ethanol and succinate. The physiological characterization of null mutants showed that KlJEN1 is the functional homologue of ScJEN1, whereas KlJEN2 encodes a dicarboxylic acids transporter. In fact, KlJen1p [transporter classification (TC) number: 2.A.1.12.2.] is required for lactate uptake and therefore for growth on lactate. KlJen2p is required for succinate transport, as demonstrated by succinate uptake experiments and by inability of Kljen2 mutant to grow on succinate. This carrier appears to transport also malate and fumarate because the Kljen2 mutant cannot grow on these substrates and the succinate uptake is competed by these carboxylic acids. We conclude that KlJEN2 is the first yeast gene shown to encode a dicarboxylic acids permease.

  8. Solar photoelectro-Fenton degradation of the herbicide 4-chloro-2-methylphenoxyacetic acid optimized by response surface methodology.

    PubMed

    Garcia-Segura, Sergi; Almeida, Lucio Cesar; Bocchi, Nerilso; Brillas, Enric

    2011-10-30

    A central composite rotatable design and response surface methodology (RSM) were used to optimize the experimental variables of the solar photoelectro-Fenton (SPEF) treatment of the herbicide 4-chloro-2-methylphenoxyacetic acid (MCPA). The experiments were made with a flow plant containing a Pt/air-diffusion reactor coupled to a solar compound parabolic collector (CPC) under recirculation of 10 L of 186 mg L(-1) MCPA solutions in 0.05 M Na(2)SO(4) at a liquid flow rate of 180 L h(-1) with an average UV irradiation intensity of about 32 Wm(-2). The optimum variables found for the SPEF process were 5.0 A, 1.0mM Fe(2+) and pH 3.0 after 120 min of electrolysis. Under these conditions, 75% of mineralization with 71% of current efficiency and 87.7 k Wh kg(-1) TOC of energy consumption were obtained. MCPA decayed under the attack of generated hydroxyl radicals following a pseudo-first-order kinetics. Hydroxyl radicals also destroyed 4-chloro-2-methylphenol, methylhydroquinone and methyl-p-benzoquinone detected as aromatic by-products. Glycolic, maleic, fumaric, malic, succinic, tartronic, oxalic and formic acids were identified as generated carboxylic acids, which form Fe(III) complexes that are quickly photodecarboxylated by the UV irradiation of sunlight at the CPC photoreactor. A reaction sequence for the SPEF degradation of MCPA was proposed. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Osm1 facilitates the transfer of electrons from Erv1 to fumarate in the redox-regulated import pathway in the mitochondrial intermembrane space

    PubMed Central

    Neal, Sonya E.; Dabir, Deepa V.; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M.

    2017-01-01

    Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c, but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. PMID:28814504

  10. Evaluation of the binding interaction between bovine serum albumin and dimethyl fumarate, an anti-inflammatory drug by multispectroscopic methods

    NASA Astrophysics Data System (ADS)

    Jattinagoudar, Laxmi; Meti, Manjunath; Nandibewoor, Sharanappa; Chimatadar, Shivamurti

    2016-03-01

    The information of the quenching reaction of bovine serum albumin with dimethyl fumarate is obtained by multi-spectroscopic methods. The number of binding sites, n and binding constants, KA were determined at different temperatures. The effect of increasing temperature on Stern-Volmer quenching constants (KD) indicates that a dynamic quenching mechanism is involved in the interaction. The analysis of thermodynamic quantities namely, ∆H° and ∆S° suggested hydrophobic forces playing a major role in the interaction between dimethyl fumarate and bovine serum albumin. The binding site of dimethyl fumarate on bovine serum albumin was determined by displacement studies, using the site probes viz., warfarin, ibuprofen and digitoxin. The determination of magnitude of the distance of approach for molecular interactions between dimethyl fumarate and bovine serum albumin is calculated according to the theory of Förster energy transfer. The CD, 3D fluorescence spectra, synchronous fluorescence measurements and FT-IR spectral results were indicative of the change in secondary structure of the protein. The influence of some of the metal ions on the binding interaction was also studied.

  11. Identification, characterization, and high-performance liquid chromatography quantification of process-related impurities in vonoprazan fumarate.

    PubMed

    Liu, Lei; Cao, Na; Ma, Xingling; Xiong, Kaihe; Sun, Lili; Zou, Qiaogen

    2016-04-01

    High-performance liquid chromatography analysis of vonoprazan fumarate, a novel proton pump inhibitor drug revealed six impurities. These were identified by liquid chromatography with mass spectrometry. Further, the structures of the impurities were confirmed by synthesis followed by characterization by mass spectrometry, NMR spectroscopy, and infrared spectroscopy. On the basis of these data and knowledge of the synthetic scheme of vonoprazan fumarate, the previously unknown impurity was identified as 1-[5-(2-fluorophenyl)-1-(pyridin-3-ylsulfonyl)-1H-pyrrol-3-yl]-N-methyldimethylamine, which is a new compound. The possible mechanisms by which these impurities were formed were also discussed. A high-performance liquid chromatography method was optimized in order to separate, selectively detect, and quantify all process-related impurities of vonoprazan fumarate. The presented method has been validated in terms of linearity, limits of detection, and quantification, and response factors and, therefore, is highly suitable for routine analysis of vonoprazan fumarate related substances as well as stability studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Metabolomic Analyses of Blood Plasma after Oral Administration of D-Glucosamine Hydrochloride to Dogs

    PubMed Central

    Osaki, Tomohiro; Azuma, Kazuo; Kurozumi, Seiji; Takamori, Yoshimori; Tsuka, Takeshi; Imagawa, Tomohiro; Okamoto, Yoshiharu; Minami, Saburo

    2012-01-01

    D-Glucosamine hydrochloride (GlcN∙HCl) is an endogenous amino monosaccharide synthesized from glucose that is useful in the treatment of joint diseases in both humans and animals. The aim of this study was to examine amino acid metabolism in dogs after oral administration of GlcN∙HCl. Accelerated fumarate respiration and elevated plasma levels of lactic acid and alanine were observed after administration. These results suggest that oral administration of GlcN∙HCl induces anaerobic respiration and starvation in cells, and we hypothesize that these conditions promote cartilage regeneration. Further studies are required to evaluate the expression of transforming growth factor-beta (TGF-β). PMID:23015778

  13. Studies on biodegradable and crosslinkable poly(castor oil fumarate)/poly(propylene fumarate) composite adhesive as a potential injectable biomaterial.

    PubMed

    Mitha, M K; Jayabalan, M

    2009-12-01

    Biodegradable hydroxyl terminated-poly(castor oil fumarate) (HT-PCF) and poly(propylene fumarate) (HT-PPF) resins were synthesized as an injectable and in situ-cross linkable polyester resins for orthopedic applications. An injectable adhesive formulation containing this resin blend, N-vinyl pyrrolidone (NVP), hydroxy apatite, free radical initiator and accelerator was developed. The Composite adhesives containing the ratio of resin blend and NVP, 2.1:1.5, 2.1:1.2 and 2.1:1.0 set fast with tolerable exothermic temperature as a three dimensionally cross linked toughened material. Crosslink density and mechanical properties of the crosslinked composite increase with increase of NVP. The present crosslinked composite has hydrophilic character and cytocompatibility with L929 fibroblast cells.

  14. Desulfosporosinus acididurans sp. nov.: an acidophilic sulfate-reducing bacterium isolated from acidic sediments.

    PubMed

    Sánchez-Andrea, Irene; Stams, Alfons J M; Hedrich, Sabrina; Ňancucheo, Ivan; Johnson, D Barrie

    2015-01-01

    Three strains of sulfate-reducing bacteria (M1(T), D, and E) were isolated from acidic sediments (White river and Tinto river) and characterized phylogenetically and physiologically. All three strains were obligately anaerobic, mesophilic, spore-forming straight rods, stained Gram-negative and displayed variable motility during active growth. The pH range for growth was 3.8-7.0, with an optimum at pH 5.5. The temperature range for growth was 15-40 °C, with an optimum at 30 °C. Strains M1(T), D, and E used a wide range of electron donors and acceptors, with certain variability within the different strains. The nominated type strain (M1(T)) used ferric iron, nitrate, sulfate, elemental sulfur, and thiosulfate (but not arsenate, sulfite, or fumarate) as electron acceptors, and organic acids (formate, lactate, butyrate, fumarate, malate, and pyruvate), alcohols (glycerol, methanol, and ethanol), yeast extract, and sugars (xylose, glucose, and fructose) as electron donors. It also fermented some substrates such as pyruvate and formate. Strain M1(T) tolerated up to 50 mM ferrous iron and 10 mM aluminum, but was inhibited by 1 mM copper. On the basis of phenotypic, phylogenetic, and genetic characteristics, strains M1(T), D, and E represent a novel species within the genus Desulfosporosinus, for which the name Desulfosporosinus acididurans sp. nov. is proposed. The type strain is M1(T) (=DSM 27692(T) = JCM 19471(T)). Strain M1(T) was the first acidophilic SRB isolated, and it is the third described species of acidophilic SRB besides Desulfosporosinus acidiphilus and Thermodesulfobium narugense.

  15. Production, purification and detergent exchange of isotopically labeled Bacillussubtilis cytochrome b₅₅₈ (SdhC).

    PubMed

    Baureder, Michael; Hederstedt, Lars

    2011-11-01

    Cytochrome b₅₅₈ of the gram-positive bacterium Bacillussubtilis is the membrane anchor subunit of the succinate:quinone oxidoreductase of the citric acid cycle. The cytochrome consists of the SdhC polypeptide (202 residues) and two protoheme IX groups that function in transmembrane electron transfer to menaquinone. The general structure of the cytochrome is known from extensive experimental studies and by comparison to Wolinellasuccinogenes fumarate reductase for which the X-ray crystal structure has been determined. Solution state NMR can potentially be used to identify the quinone binding site(s) and study, e.g. redox-linked, dynamics of cytochrome b₅₅₈. In this work we present an efficient procedure for the isolation of preparative amounts of isotopically labeled B. subtilis cytochrome b₅₅₈ produced in Escherichia coli. We have also evaluated several detergents suitable for NMR for their effectiveness in maintaining the cytochrome solubilized and intact for days at room temperature. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Dimethyl Fumarate

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a condition in which ... day. Take dimethyl fumarate at around the same times every day. Follow the directions on your prescription ...

  17. Electron Donors Supporting Growth and Electroactivity of Geobacter sulfurreducens Anode Biofilms

    PubMed Central

    Speers, Allison M.

    2012-01-01

    Geobacter bacteria efficiently oxidize acetate into electricity in bioelectrochemical systems, yet the range of fermentation products that support the growth of anode biofilms and electricity production has not been thoroughly investigated. Here, we show that Geobacter sulfurreducens oxidized formate and lactate with electrodes and Fe(III) as terminal electron acceptors, though with reduced efficiency compared to acetate. The structure of the formate and lactate biofilms increased in roughness, and the substratum coverage decreased, to alleviate the metabolic constraints derived from the assimilation of carbon from the substrates. Low levels of acetate promoted formate carbon assimilation and biofilm growth and increased the system's performance to levels comparable to those with acetate only. Lactate carbon assimilation also limited biofilm growth and led to the partial oxidization of lactate to acetate. However, lactate was fully oxidized in the presence of fumarate, which redirected carbon fluxes into the tricarboxylic acid (TCA) cycle, and by acetate-grown biofilms. These results expand the known ranges of electron donors for Geobacter-driven fuel cells and identify microbial constraints that can be targeted to develop better-performing strains and increase the performance of bioelectrochemical systems. PMID:22101036

  18. Metabolomic profiling in inner ear fluid by gas chromatography/mass spectrometry in guinea pig cochlea.

    PubMed

    Fujita, Takeshi; Yamashita, Daisuke; Irino, Yasuhiro; Kitamoto, Junko; Fukuda, Yuriko; Inokuchi, Go; Hasegawa, Shingo; Otsuki, Naoki; Yoshida, Masaru; Nibu, Ken-ichi

    2015-10-08

    The composition and homeostasis of inner ear fluids are important in hearing function. The purpose of this study was to perform metabolomic analysis of the inner ear fluid in guinea pig cochlea, which has not been previously reported in literature, using gas chromatography/mass spectrometry (GC/MS). Seventy-seven kinds of metabolites were detected in the inner ear fluid. Six metabolites, ascorbic acid, fructose, galactosamine, inositol, pyruvate+oxaloacetic acid, and meso-erythritol, were significantly more abundant, and nine metabolites, phosphate, valine, glycine, glycerol, ornithine, glucose, citric acid+isocitric acid, mannose, and trans-4-hydroxy-L-proline, were less abundant in the inner ear fluid than in plasma. The levels of ten metabolites, 3-hydroxy-butyrate, glycerol, fumaric acid, galactosamine, pyruvate+oxaloacetic acid, phosphate, meso-erythritol, citric acid+isocitric acid, mannose, and inositol, in the inner ear fluid significantly changed after loud noise exposure. These observations may help to elucidate various clinical conditions of sensorineural hearing loss, including noise-induced hearing loss. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. The synthesis and the spectroscopic, thermal, and structural properties of the M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) clathrate (M = Co, Ni, Cd and Hg)

    NASA Astrophysics Data System (ADS)

    Kartal, Zeki; Yavuz, Abdülkerim

    2018-03-01

    In this study, the clathrates of fumarate-tetracyanonickel-dioxane, given by the formula M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) (M = Co, Ni, Cd and Hg), have been obtained for the first time through chemical methods. These clathrates have been characterized by elemental, thermal, FT-IR, and FT-Raman spectroscopies. The parameters of structures of clathrates have been determined by X-ray powder diffraction. The thermal behaviors of these clathrates have been also investigated by thermo-gravimetric analysis (TGA), differential thermal analysis (DTA), and derivative thermal gravimetric analysis (DTG) in the range of 20-900 °C. X-ray powder diffraction data have been recorded at ambient temperature in the 2θ range 5-50°. The FT-IR and FT-Raman spectra of clathrates have been recorded in the region of 4000-400 cm-1 and 4000-100 cm-1, respectively. The results of the spectral and thermal analyses of the newly synthesized clathrates of fumarate-tetracyanonickel-dioxane suggest that these clathrates are new examples of the Hofmann-type dioxane clathrates. In our study, the Hofmann-type dioxane clathrates, which are formed by bounding electrons of oxygen-donor atoms of fumarate ion ligand molecule to transition metal atoms, consist of the corrugated |M-Ni(CN)4|∞ polymeric layers, which are held in parallel through the chain of (-M-fumarate-M-).

  20. Retrospective data collection of psoriasis treatment with fumaric acid esters in children and adolescents in Germany (KIDS FUTURE study).

    PubMed

    Reich, Kristian; Hartl, Christoph; Gambichler, Thilo; Zschocke, Ina

    2016-01-01

    Given that there is no standard systemic treatment for children and adolescents with plaque psoriasis, this non-interventional, multicenter, retrospective study collected data on the efficacy and safety of long-term treatment with fumaric acid esters (FAEs) in this particular patient group. In patients younger than 18 years of age at the start of FAE treatment, data on efficacy and safety was retrospectively collected for at least 36 months. Data from 127 patients (aged 6-17 years) was collected for treatment durations of up to 60 months. Physician's Global Assessment, Psoriasis Area and Severity Index, and Body Surface Area showed marked improvement in the first six months. After 36 months, these parameters had, on average, improved by up to two-thirds of baseline values. Thirty-seven patients experienced at least one adverse event (AE), which was FAE-related in 36 individuals. Three AEs (proteinuria (one case), flushing (two cases)) persisted during the observation period while on treatment. Fifteen AEs led to the discontinuation of therapy; nearly all of these cases were related to gastrointestinal disorders. The KIDS FUTURE study - for the first time - included a larger population of children and adolescents with psoriasis who were treated with FAEs. The data obtained suggests that long-term FAE therapy in this patient group may be effective and safe. The results are currently being verified in an ongoing clinical study. © 2015 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

  1. Evaluation of Malolactic Bacteria Isolated from Oregon Wines †

    PubMed Central

    Henick-Kling, T.; Sandine, W. E.; Heatherbell, D. A.

    1989-01-01

    Oregon is a cool wine-producing region where grapes characteristically contain high concentrations of organic acids. To reduce the natural acidity and increase the microbiological stability and flavor complexity of the wine, malolactic fermentation is encouraged. In this study, strains of Leuconostoc oenos indigenous to Oregon wines were evaluated for their suitability to conduct malolactic fermentation in Oregon wines. Tests determined the malolactic activity of the Oregon isolates in comparison with commercial strains ML-34, PSU-1, MLT-kli, and ens 44-40 under various temperature and pH conditions. Sensitivities to sulfur dioxide, ethanol, and fumaric acid also were determined. Two Oregon strains, Er-1a and Ey-2d, were selected for commercial winemaking tests because they had greater malolactic activity under conditions of low pH (3.0) and low temperature (15 and 8°C), respectively. PMID:16347992

  2. Optimization of cyanophycin production in recombinant strains of Pseudomonas putida and Ralstonia eutropha employing elementary mode analysis and statistical experimental design.

    PubMed

    Diniz, Simone Cardoso; Voss, Ingo; Steinbüchel, Alexander

    2006-03-05

    Elementary mode analysis was applied to simulate conditions for cyanophycin (CGP) biosynthesis and to optimize its production in bacteria. The conclusions from these simulations were confirmed by experiments with recombinant strains of the wild types and polyhydroxyalkanoate (PHA)-negative mutants of Ralstonia eutropha and Pseudomonas putida expressing CGP synthetase genes (cphA) of Synechocystis sp. strain PCC6308 or Anabaena sp. strain PCC7120. In particular, the effects of suitable precursor substrates and of oxygen supply as well as of the capability to accumulate PHA in addition to CGP biosynthesis were investigated. Since CGP consists of the amino acids aspartate and arginine, the tricarboxylic acid cycle (TCC), which provides intermediates for biosynthesis of these amino acids, seems to be important. Excretion of intermediates of the TCC upon cultivation at restricted oxygen supply and conversion of fumarate mainly to malate and to only little succinate in the absence of oxygen indicated that TCC intermediates for arginine and aspartate biosynthesis were provided by the oxidative or reductive parts of the TCC, respectively. The following important conclusions were made from the experiments and the simulations: (i) external arginine additionally supplied to the medium, (ii) oxygen limitation, and (iii) absence of PHA accumulation exerted positive effects on CGP accumulation. These conclusions were utilized to obtain CGP contents in the cells of as high as 17.9% (w x w(-1)) during cultivation of the investigated bacteria at the 30-L scale using mineral salts medium. Such high CGP contents were previously not obtained with these bacteria at a 30-L scale, even if complex media were used.

  3. The gut microbiota modulates host energy and lipid metabolism in mice[S

    PubMed Central

    Velagapudi, Vidya R.; Hezaveh, Rahil; Reigstad, Christopher S.; Gopalacharyulu, Peddinti; Yetukuri, Laxman; Islam, Sama; Felin, Jenny; Perkins, Rosie; Borén, Jan; Orešič, Matej; Bäckhed, Fredrik

    2010-01-01

    The gut microbiota has recently been identified as an environmental factor that may promote metabolic diseases. To investigate the effect of gut microbiota on host energy and lipid metabolism, we compared the serum metabolome and the lipidomes of serum, adipose tissue, and liver of conventionally raised (CONV-R) and germ-free mice. The serum metabolome of CONV-R mice was characterized by increased levels of energy metabolites, e.g., pyruvic acid, citric acid, fumaric acid, and malic acid, while levels of cholesterol and fatty acids were reduced. We also showed that the microbiota modified a number of lipid species in the serum, adipose tissue, and liver, with its greatest effect on triglyceride and phosphatidylcholine species. Triglyceride levels were lower in serum but higher in adipose tissue and liver of CONV-R mice, consistent with increased lipid clearance. Our findings show that the gut microbiota affects both host energy and lipid metabolism and highlights its role in the development of metabolic diseases. PMID:20040631

  4. Gateways to clinical trials.

    PubMed

    Bayes, M; Rabasseda, X; Prous, J R

    2006-01-01

    Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs:(R)-Flurbiprofen, 90Yttrium-DOTA-huJ591; ABT-510, ACP-103, Ad5-FGF4, adalimumab, ademetionine, AG-7352, alemtuzumab, Amb a 1 ISS-DNA, anakinra, apaziquone, aprepitant, aripiprazole, atazanavir sulfate; BAL-8557, bevacizumab, BMS-188797, bortezomib, bosentan, brivudine; Calcipotriol/betamethasone dipropionate, cannabidiol, caspofungin acetate, catumaxomab, CERE-120, cetuximab, ciclesonide, cilomilast, cizolirtine citrate, Cypher, cystemustine; Dalbavancin, darifenacin hydrobromide, dasatinib, deferasirox, denosumab, desmoteplase, dihydrexidine, dimethyl fumarate, dutasteride, DW-166HC; Eculizumab, enfuvirtide, entecavir, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, eszopiclone, etoricoxib, everolimus; Fallypride, febuxostat, fenretinide, fesoterodine, fingolimod hydrochloride; Gabapentin enacarbil, gefitinib; hMaxi-K, human papillomavirus vaccine, HYAL-CT1101; Imatinib mesylate, indiplon, inolimomab, ISAtx-247; J591; Lacosamide, landiolol, lasofoxifene tartrate, lestaurtinib, lidocaine/prilocaine, linezolid, lixivaptan, lonafarnib, lopinavir, lopinavir/ritonavir, lumiracoxib; Natalizumab, nesiritide; OC-108, omalizumab, onercept, OSC; Palifermin, palonosetron hydrochloride, parathyroid hormone (human recombinant), parecoxib sodium, PD-MAGE-3 vaccine, PEG-filgrastim, peginterferon alfa-2a, peginterferon alfa-2b, pegsunercept, pelitinib, pitavastatin calcium, plerixafor hydrochloride, posaconazole, prasterone sulfate, pregabalin; Ramelteon, ranelic acid distrontium salt, rasburicase, rosuvastatin calcium, rotigotine, RSD-1235, rufinamide, rupatadine fumarate; Sarizotan hydrochloride, SHL-749, sirolimus-eluting stent, solifenacin succinate, sunitinib malate; Tadalafil, talampanel, tasidotin hydrochloride, Taxus, tegaserod maleate, telavancin hydrochloride, tenofovir disoproxil fumarate, tiotropium bromide, tocilizumab, tositumomab, treprostinil sodium, tridolgosir hydrochloride, TTS-CD3; Ularitide; Valdecoxib, Val-Tyr sardine peptidase, vardenafil hydrochloride hydrate, voriconazole; Yttrium (90Y) edotreotide, Yttrium 90 (90Y) ibritumomab tiuxetan; Zileuton, zucapsaicin.

  5. Potentiometric determination of ketotifen fumarate in pharmaceutical preparations and urine using carbon paste and PVC membrane selective electrodes.

    PubMed

    Frag, Eman Y Z; Mohamed, Gehad G; Khalil, Mohamed M; Hwehy, Mohammad M A

    2011-01-01

    This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10(-7) to 10(-2) mol L(-1). The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade(-1) for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0-6.0 and 2.0-7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method.

  6. Potentiometric Determination of Ketotifen Fumarate in Pharmaceutical Preparations and Urine Using Carbon Paste and PVC Membrane Selective Electrodes

    PubMed Central

    Frag, Eman Y. Z.; Mohamed, Gehad G.; Khalil, Mohamed M.; Hwehy, Mohammad M. A.

    2011-01-01

    This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10−7 to 10−2 mol L−1. The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade−1 for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0–6.0 and 2.0–7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method. PMID:22013443

  7. Gateways to clinical trials.

    PubMed

    Bayés, M; Rabasseda, X; Prous, J R

    2005-04-01

    Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity. prous.com. This issue focuses on the following selection of drugs: ABX-IL-8, Acclaim, adalimumab, AGI-1067, alagebrium chloride, alemtuzumab, Alequel, Androgel, anti-IL-12 MAb, AOD-9604, aripiprazole, atomoxetine hydrochloride; Biphasic insulin aspart, bosentan, botulinum toxin type B, bovine lactoferrin, brivudine; Cantuzumab mertansine, CB-1954, CDB-4124, CEA-TRICOM, choriogonadotropin alfa, cilansetron, CpG-10101, CpG-7909, CTL-102, CTL-102/CB-1954; DAC:GRF, darbepoetin alfa, davanat-1, decitabine, del-1 Genemedicine, dexanabinol, dextofisopam, dnaJP1, dronedarone hydrochloride, dutasteride; Ecogramostim, eletriptan, emtricitabine, EPI-hNE-4, eplerenone, eplivanserin fumarate, erlotinib hydrochloride, ertapenem sodium, escitalopram oxalate, esomeprazole magnesium, etoricoxib, ezetimibe; Falecalcitriol, fingolimod hydrochloride; Gepirone hydrochloride; HBV-ISS, HSV-2 theracine, human insulin; Imatinib mesylate, Indiplon, insulin glargine, ISAtx-247; L612 HuMAb, levodopa/carbidopa/entacapone, lidocaine/prilocaine, LL-2113AD, lucinactant, LY-156735; Meclinertant, metelimumab, morphine hydrochloride, morphine-6-glucuronide; Natalizumab, nimotuzumab, NX-1207, NYVAC-HIV C; Omalizumab, onercept, osanetant; PABA, palosuran sulfate, parathyroid hormone (human recombinant), parecoxib sodium, PBI-1402, PCK-3145, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pemetrexed disodium, pimecrolimus, PINC, pregabalin; Ramelteon, rasagiline mesilate, rasburicase, rimonabant hydrochloride, RO-0098557, rofecoxib, rosiglitazone maleate/metformin hydrochloride; Safinamide mesilate, SHL-749, sitaxsentan sodium, sparfosic acid, SprayGel, squalamine, St. John's Wort extract, synthetic human secretin; Taxus, telavancin hydrochloride, telithromycin, temoporfin, tenofovir disoproxil fumarate, tenofovir disoproxil fumarate/emtricitabine, teriparatide, testosterone gel, TG-1024, tirapazamine, travoprost, travoprost/timolol; Valdecoxib, valganciclovir hydrochloride, voriconazole; Ximelagatran.

  8. Age-Related Alterations in the Metabolic Profile in the Hippocampus of the Senescence-Accelerated Mouse Prone 8: A Spontaneous Alzheimer's Disease Mouse Model

    PubMed Central

    Wang, Hualong; Lian, Kaoqi; Han, Bing; Wang, Yanyong; Kuo, Sheng-Han; Geng, Yuan; Qiang, Jing; Sun, Meiyu; Wang, Mingwei

    2015-01-01

    Alzheimer's disease (AD), the most common age-dependent neurodegenerative disorder, produces a progressive decline in cognitive function. The metabolic mechanism of AD has emerged in recent years. In this study, we used multivariate analyses of gas chromatography-mass spectrometry measurements to determine that learning and retention-related metabolic profiles are altered during aging in the hippocampus of the senescence-accelerated mouse prone 8 (SAMP8). Alterations in 17 metabolites were detected in mature and aged mice compared to young mice (13 decreased and 4 increased metabolites), including metabolites related to dysfunctional lipid metabolism (significantly increased cholesterol, oleic acid, and phosphoglyceride levels), decreased amino acid (alanine, serine, glycine, aspartic acid, glutamate, and gamma-aminobutyric acid), and energy-related metabolite levels (malic acid, butanedioic acid, fumaric acid, and citric acid), and other altered metabolites (increased N-acetyl-aspartic acid and decreased pyroglutamic acid, urea, and lactic acid) in the hippocampus. All of these alterations indicated that the metabolic mechanisms of age-related cognitive impairment in SAMP8 mice were related to multiple pathways and networks. Lipid metabolism, especially cholesterol metabolism, appears to play a distinct role in the hippocampus in AD. PMID:24284365

  9. Cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate and intramuscular interferon-β1a in relapsing-remitting multiple sclerosis.

    PubMed

    Zhang, Xinke; Hay, Joel W; Niu, Xiaoli

    2015-01-01

    The aim of the study was to compare the cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate, and intramuscular (IM) interferon (IFN)-β(1a) as first-line therapies in the treatment of patients with relapsing-remitting multiple sclerosis (RRMS). A Markov model was developed to evaluate the cost effectiveness of disease-modifying drugs (DMDs) from a US societal perspective. The time horizon in the base case was 5 years. The primary outcome was incremental net monetary benefit (INMB), and the secondary outcome was incremental cost-effectiveness ratio (ICER). The base case INMB willingness-to-pay (WTP) threshold was assumed to be US$150,000 per quality-adjusted life year (QALY), and the costs were in 2012 US dollars. One-way sensitivity analyses and probabilistic sensitivity analysis were conducted to test the robustness of the model results. Dimethyl fumarate dominated all other therapies over the range of WTPs, from US$0 to US$180,000. Compared with IM IFN-β(1a), at a WTP of US$150,000, INMBs were estimated at US$36,567, US$49,780, and US$80,611 for fingolimod, teriflunomide, and dimethyl fumarate, respectively. The ICER of fingolimod versus teriflunomide was US$3,201,672. One-way sensitivity analyses demonstrated the model results were sensitive to the acquisition costs of DMDs and the time horizon, but in most scenarios, cost-effectiveness rankings remained stable. Probabilistic sensitivity analysis showed that for more than 90% of the simulations, dimethyl fumarate was the optimal therapy across all WTP values. The three oral therapies were favored in the cost-effectiveness analysis. Of the four DMDs, dimethyl fumarate was a dominant therapy to manage RRMS. Apart from dimethyl fumarate, teriflunomide was the most cost-effective therapy compared with IM IFN-β(1a), with an ICER of US$7,115.

  10. Proteomics analysis of high lipid-producing strain Mucor circinelloides WJ11: an explanation for the mechanism of lipid accumulation at the proteomic level.

    PubMed

    Tang, Xin; Zan, Xinyi; Zhao, Lina; Chen, Haiqin; Chen, Yong Q; Chen, Wei; Song, Yuanda; Ratledge, Colin

    2016-02-11

    The oleaginous fungus, Mucor circinelloides, is attracting considerable interest as it produces oil rich in γ-linolenic acid. Nitrogen (N) deficiency is a common strategy to trigger the lipid accumulation in oleaginous microorganisms. Although a simple pathway from N depletion in the medium to lipid accumulation has been elucidated at the enzymatic level, global changes at protein levels upon N depletion have not been investigated. In this study, we have systematically analyzed the changes at the levels of protein expression in M. circinelloides WJ11, a high lipid-producing strain (36 %, lipid/cell dry weight), during lipid accumulation. Proteomic analysis demonstrated that N depletion increased the expression of glutamine synthetase, involved in ammonia assimilation, for the supply of cellular nitrogen but decreased the metabolism of amino acids. Upon N deficiency, many proteins (e.g., fructose-bisphosphate aldolase, glyceraldehyde-3-phosphate dehydrogenase, enolase, pyruvate kinase) involved in glycolytic pathway were up-regulated while proteins involved in the tricarboxylic acid cycle (e.g., isocitrate dehydrogenase, succinyl-CoA ligase, succinate dehydrogenase, fumarate hydratase) were down-regulated, indicating this activity was retarded thereby leading to a greater flux of carbon into fatty acid biosynthesis. Moreover, glucose-6-phosphate dehydrogenase, transaldolase and transketolase, which participate in the pentose phosphate pathway, were up-regulated, leading to the increased production of NADPH, the reducing power for fatty acid biosynthesis. Furthermore, protein and nucleic acid metabolism were down-regulated and some proteins involved in energy metabolism, signal transduction, molecular chaperone and redox homeostasis were up-regulated upon N depletion, which may be the cellular response to the stress produced by the onset of N deficiency. N limitation increased those expressions of the proteins involved in ammonia assimilation but decreased that involved in the biosynthesis of amino acids. Upon N deprivation, the glycolytic pathway was up-regulated, while the activity of the tricarboxylic acid cycle was retarded, thus, leading more carbon flux to fatty acid biosynthesis. Moreover, the pentose phosphate pathway was up-regulated, then this would increase the production of NADPH. Together, coordinated regulation of central carbon metabolism upon N limitation, provides more carbon flux to acetyl-CoA and NADPH for fatty acid biosynthesis.

  11. TPhP exposure disturbs carbohydrate metabolism, lipid metabolism, and the DNA damage repair system in zebrafish liver

    NASA Astrophysics Data System (ADS)

    Du, Zhongkun; Zhang, Yan; Wang, Guowei; Peng, Jianbiao; Wang, Zunyao; Gao, Shixiang

    2016-02-01

    Triphenyl phosphate is a high production volume organophosphate flame retardant that has been detected in multiple environmental media at increasing concentrations. The environmental and health risks of triphenyl phosphate have drawn attention because of the multiplex toxicity of this chemical compound. However, few studies have paid close attention to the impacts of triphenyl phosphate on liver metabolism. We investigated hepatic histopathological, metabolomic and transcriptomic responses of zebrafish after exposure to 0.050 mg/L and 0.300 mg/L triphenyl phosphate for 7 days. Metabolomic analysis revealed significant changes in the contents of glucose, UDP-glucose, lactate, succinate, fumarate, choline, acetylcarnitine, and several fatty acids. Transcriptomic analysis revealed that related pathways, such as the glycosphingolipid biosynthesis, PPAR signaling pathway and fatty acid elongation, were significantly affected. These results suggest that triphenyl phosphate exposure markedly disturbs hepatic carbohydrate and lipid metabolism in zebrafish. Moreover, DNA replication, the cell cycle, and non-homologous end-joining and base excision repair were strongly affected, thus indicating that triphenyl phosphate hinders the DNA damage repair system in zebrafish liver cells. The present study provides a systematic analysis of the triphenyl phosphate-induced toxic effects in zebrafish liver and demonstrates that low concentrations of triphenyl phosphate affect normal metabolism and cell cycle.

  12. TPhP exposure disturbs carbohydrate metabolism, lipid metabolism, and the DNA damage repair system in zebrafish liver

    PubMed Central

    Du, Zhongkun; Zhang, Yan; Wang, Guowei; Peng, Jianbiao; Wang, Zunyao; Gao, Shixiang

    2016-01-01

    Triphenyl phosphate is a high production volume organophosphate flame retardant that has been detected in multiple environmental media at increasing concentrations. The environmental and health risks of triphenyl phosphate have drawn attention because of the multiplex toxicity of this chemical compound. However, few studies have paid close attention to the impacts of triphenyl phosphate on liver metabolism. We investigated hepatic histopathological, metabolomic and transcriptomic responses of zebrafish after exposure to 0.050 mg/L and 0.300 mg/L triphenyl phosphate for 7 days. Metabolomic analysis revealed significant changes in the contents of glucose, UDP-glucose, lactate, succinate, fumarate, choline, acetylcarnitine, and several fatty acids. Transcriptomic analysis revealed that related pathways, such as the glycosphingolipid biosynthesis, PPAR signaling pathway and fatty acid elongation, were significantly affected. These results suggest that triphenyl phosphate exposure markedly disturbs hepatic carbohydrate and lipid metabolism in zebrafish. Moreover, DNA replication, the cell cycle, and non-homologous end-joining and base excision repair were strongly affected, thus indicating that triphenyl phosphate hinders the DNA damage repair system in zebrafish liver cells. The present study provides a systematic analysis of the triphenyl phosphate-induced toxic effects in zebrafish liver and demonstrates that low concentrations of triphenyl phosphate affect normal metabolism and cell cycle. PMID:26898711

  13. Inhibition of sarcolemmal FAT/CD36 by sulfo-N-succinimidyl oleate rapidly corrects metabolism and restores function in the diabetic heart following hypoxia/reoxygenation

    PubMed Central

    Mansor, Latt S.; Sousa Fialho, Maria da Luz; Yea, Georgina; Coumans, Will A.; West, James A.; Kerr, Matthew; Carr, Carolyn A.; Luiken, Joost J.F.P.; Glatz, Jan F.C.; Evans, Rhys D.; Griffin, Julian L.; Tyler, Damian J.; Clarke, Kieran

    2017-01-01

    Aims The type 2 diabetic heart oxidizes more fat and less glucose, which can impair metabolic flexibility and function. Increased sarcolemmal fatty acid translocase (FAT/CD36) imports more fatty acid into the diabetic myocardium, feeding increased fatty acid oxidation and elevated lipid deposition. Unlike other metabolic modulators that target mitochondrial fatty acid oxidation, we proposed that pharmacologically inhibiting fatty acid uptake, as the primary step in the pathway, would provide an alternative mechanism to rebalance metabolism and prevent lipid accumulation following hypoxic stress. Methods and results Hearts from type 2 diabetic and control male Wistar rats were perfused in normoxia, hypoxia and reoxygenation, with the FAT/CD36 inhibitor sulfo-N-succinimidyl oleate (SSO) infused 4 min before hypoxia. SSO infusion into diabetic hearts decreased the fatty acid oxidation rate by 29% and myocardial triglyceride concentration by 48% compared with untreated diabetic hearts, restoring fatty acid metabolism to control levels following hypoxia-reoxygenation. SSO infusion increased the glycolytic rate by 46% in diabetic hearts during hypoxia, increased pyruvate dehydrogenase activity by 53% and decreased lactate efflux rate by 56% compared with untreated diabetic hearts during reoxygenation. In addition, SSO treatment of diabetic hearts increased intermediates within the second span of the Krebs cycle, namely fumarate, oxaloacetate, and the FAD total pool. The cardiac dysfunction in diabetic hearts following decreased oxygen availability was prevented by SSO-infusion prior to the hypoxic stress. Infusing SSO into diabetic hearts increased rate pressure product by 60% during hypoxia and by 32% following reoxygenation, restoring function to control levels. Conclusions Diabetic hearts have limited metabolic flexibility and cardiac dysfunction when stressed, which can be rapidly rectified by reducing fatty acid uptake with the FAT/CD36 inhibitor, SSO. This novel therapeutic approach not only reduces fat oxidation but also lipotoxicity, by targeting the primary step in the fatty acid metabolism pathway. PMID:28419197

  14. The Path of Carbon in Photosynthesis VII. Respiration and Photosynthesis

    DOE R&D Accomplishments Database

    Benson, A. A.; Calvin, M.

    1949-07-21

    The relationship of respiration to photosynthesis in barley seedling leaves and the algae, Chlorella and Scenedesmus, has been investigated using radioactive carbon dioxide and the techniques of paper chromatography and radioautography. The plants are allowed to photosynthesize normally for thirty seconds in c{sup 14}O{sub 2} after which they are allowed to respire in air or helium in the light or dark. Respiration of photosynthetic intermediates as evidenced by the appearance of labeled glutomic, isocitric, fumaric and succinic acids is slower in the light than in the dark. Labeled glycolic acid is observed in barley and algae. It disappears rapidly in the dark and is maintained and increased in quantity in the light in C0{sub 2}-free air.

  15. Nutritional or pharmacological activation of HCA(2) ameliorates neuroinflammation.

    PubMed

    Offermanns, Stefan; Schwaninger, Markus

    2015-04-01

    Neuroinflammation is a pathology common to many neurological diseases, including multiple sclerosis (MS) and stroke. However, therapeutic attempts to modulate neuroinflammation have proved difficult. Neuroinflammatory cells express HCA2, a receptor for the endogenous neuroprotective ketone body β-hydroxybutyrate (BHB) as well as for the drugs dimethyl fumarate (DMF) and nicotinic acid, which have established efficacy in the treatment of MS and experimental stroke, respectively. This review summarizes the evidence that HCA2 is involved in the therapeutic effects of DMF, nicotinic acid, and ketone bodies in reducing neuroinflammation. Furthermore, we discuss the mechanisms underlying the beneficial effects of HCA2 activation in neuroinflammatory diseases and the therapeutic potential of recently developed synthetic ligands of HCA2. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Identification of EayjjPB encoding a dicarboxylate transporter important for succinate production under aerobic and anaerobic conditions in Enterobacter aerogenes.

    PubMed

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Tokura, Mitsunori; Abe, Keietsu

    2018-05-01

    Enterobacter aerogenes, a gram-negative, rod-shaped bacterium, is an effective producer of succinate from glucose via the reductive tricarboxylic acid cycle under anaerobic conditions. However, to date, succinate-exporter genes have not been identified in E. aerogenes, although succinate exporters have a large impact on fermentative succinate production. Recently, we genetically identified yjjP and yjjB, as genes encoding a succinate transporter in Escherichia coli. Evaluation of the yjjPB homologs in E. aerogenes (EayjjPB genes) showed that succinate accumulation increased from 4.1 g L -1 to 9.1 g L -1 when the EayjjPB genes were expressed under aerobic conditions. Under anaerobic conditions, succinate yield increased from 53% to 60% by EayjjPB expression and decreased to 48% by deletion of EayjjPB. Furthermore, the production levels of fumarate and malate, which are intermediates of the succinate-biosynthesis pathway, were also increased by EayjjPB expression. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both EaYjjP and EaYjjB are required for the restoration of succinate production. Taken together, these results suggest that EaYjjPB function as a dicarboxylate transporter in E. aerogenes and that the products of both genes are required for dicarboxylate transport. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

    PubMed

    Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

    2011-01-01

    Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

  18. Biowaiver monograph for immediate-release solid oral dosage forms: bisoprolol fumarate.

    PubMed

    Charoo, Naseem A; Shamsher, Areeg A A; Lian, Lai Y; Abrahamsson, Bertil; Cristofoletti, Rodrigo; Groot, D W; Kopp, Sabine; Langguth, Peter; Polli, James; Shah, Vinod P; Dressman, Jennifer

    2014-02-01

    Literature data relevant to the decision to allow a waiver of in vivo bioequivalence (BE) testing for the approval of immediate-release (IR) solid oral dosage forms containing bisoprolol as the sole active pharmaceutical ingredient (API) are reviewed. Bisoprolol is classified as a Class I API according to the current Biopharmaceutics Classification System (BCS). In addition to the BCS class, its therapeutic index, pharmacokinetic properties, data related to the possibility of excipient interactions, and reported BE/bioavailability problems are taken into consideration. Qualitative compositions of IR tablet dosage forms of bisoprolol with a marketing authorization (MA) in ICH (International Conference on Harmonisation) countries are tabulated. It was inferred that these tablets had been demonstrated to be bioequivalent to the innovator product. No reports of failure to meet BE standards have been made in the open literature. On the basis of all these pieces of evidence, a biowaiver can currently be recommended for bisoprolol fumarate IR dosage forms if (1) the test product contains only excipients that are well known, and used in normal amounts, for example, those tabulated for products with MA in ICH countries and (2) both the test and comparator dosage form are very rapidly dissolving, or, rapidly dissolving with similarity of the dissolution profiles demonstrated at pH 1.2, 4.5, and 6.8. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association.

  19. Nuclear magnetic resonance (NMR) studies on the biosynthesis of fusaric acid from Fusarium oxysporum f. sp. vasinfectum.

    PubMed

    Stipanovic, Robert D; Wheeler, Michael H; Puckhaber, Lorraine S; Liu, Jinggao; Bell, Alois A; Williams, Howard J

    2011-05-25

    Fusarium oxysporum is a fungal pathogen that attacks many important plants. Uniquely pathogenic strains of F. oxysporum f. sp. vasinfectum were inadvertently imported into the United States on live cottonseed for dairy cattle feed. These strains produce exceptionally high concentrations of the phytotoxin fusaric acid. Thus, fusaric acid may be a critical component in the pathogenicity of these biotypes. This study investigated the biosynthesis of fusaric acid using (13)C-labeled substrates including [1,2-(13)C(2)]acetate as well as (13)C- and (15)N-labeled aspartate and [(15)N]glutamine. The incorporation of labeled substrates is consistent with the biosynthesis of fusaric acid from three acetate units at C5-C6, C7-C8, and C9-C10, with the remaining carbons being derived from aspartate via oxaloacetate and the TCA cycle; the oxaloacetate originates in part by transamination of aspartate, but most of the oxaloacetate is derived by deamination of aspartate to fumarate by aspartase. The nitrogen from glutamine is more readily incorporated into fusaric acid than that from aspartate.

  20. Chemical assessment and in vitro antioxidant capacity of Ficus carica latex.

    PubMed

    Oliveira, Andreia P; Silva, Luís R; Ferreres, Federico; Guedes de Pinho, Paula; Valentão, Patrícia; Silva, Branca M; Pereira, José A; Andrade, Paula B

    2010-03-24

    Ficus species possess latex-like material within their vasculatures, affording protection and self-healing from physical attacks. In this work, metabolite profiling was performed on Ficus carica latex. Volatiles profile was determined by HS-SPME/GC-IT-MS, with 34 compounds being identified, distributed by distinct chemical classes: 5 aldehydes, 7 alcohols, 1 ketone, 9 monoterpenes, 9 sesquiterpenes and 3 other compounds. Sesquiterpenes constituted the most abundant class in latex (ca. 91% of total identified compounds). Organic acids composition was also characterized, by HPLC-UV, and oxalic, citric, malic, quinic, shikimic and fumaric acids were determined. Malic and shikimic acids were present in higher amounts (ca. 26%, each). The antioxidant potential of this material was checked by distinct in vitro chemical assays. A concentration-dependent activity was noticed against DPPH, nitric oxide and superoxide radicals. Additionally, acetylcholinesterase inhibitory capacity was evaluated, but a weak effect was found.

  1. Nitrogen Metabolism in Plant Cell Suspension Cultures

    PubMed Central

    Behrend, Josef; Mateles, Richard I.

    1976-01-01

    Tobacco cells (Nicotiana tabacum) are capable of growth on ammonia as a sole nitrogen source only when succinate, malate, fumarate, citrate, α-ketoglutarate, glutamate, or pyruvate is added to the growth medium. A ratio between the molar concentrations of ammonia to succinate (as a complementary organic acid) in the growth medium of 1.5 was optimal. Succinate had no effect on the rate of uptake of ammonia from the medium into the cells although it did affect the intracellular concentration of ammonia. However, the changes were not sufficient to explain inhibition of growth as being due to ammonia toxicity. The radioactivity from 14C-succinate was incorporated into malate, glutamate, and aspartate within 2 minutes. It appears that the role of organic acids is neither connected to ammonium transport nor to relief of ammonia toxicity, but may be related to the need for additional carbon skeletons for synthesis of amino acids. PMID:16659706

  2. Path of carbon flow during NO/sub 3//sup -/-induced photosynthetic suppression in N-limited Selenastrum minutum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elrifi, I.R.; Turpin, D.H.

    Nitrate addition to nitrate-limited cultures of Selenastrum minutum Naeg. Collins (Chlorophyta) resulted in a 70% suppression of photosynthetic carbon fixation. In /sup 14/CO/sub 2/ pulse/chase experiments nitrate resupply increased radiolabel incorporation into amino and organic acids and decreased radiolabel incorporation into insoluble material. Nitrate resupply increased the concentration of phosphoenolpyruvate and increased the radiolabeling of phosphoenolpyruvate, pyruvate and tricarboxylic acid cycle intermediates, notably citrate, fumarate, and malate. Furthermore, nitrate also increased the pool sizes and radiolabeling of most amino acids, with alanine, aspartate, glutamate, and glutamine showing the largest changes. Nitrate resupply increased the proportion of radiolabel in the C-4more » position of malate and increased the ratios of radiolabel in aspartate to phosphoenolpyruvate and in pyruvate to phosphoenolpyruvate, indicative of increased phosphoenolpyruvate carboxylase and pyruvate kinase activities. Analysis of these data showed that the rate of carbon flow through glutamate (10.6 ..mu..moles glutamate per milligram chlorophyll per hour) and the rate of net glutamate production (7.9 ..mu..moles glutamate per milligram chlorophyll per hour) were both greater than the maximum rate of carbon export from the Calvin cycle which could be maintained during steady state photosynthesis. These results are consistent with the hypothesis that nitrogen resupply to nitrogen-limited microalgae results in a transient suppression of photosynthetic carbon fixation due, in part, to the severity of competition for carbon skeletons between the Calvin cycle and nitrogen assimilation.« less

  3. The Path of Carbon Flow during NO3−-Induced Photosynthetic Suppression in N-Limited Selenastrum minutum1

    PubMed Central

    Elrifi, Ivor R.; Turpin, David H.

    1987-01-01

    Nitrate addition to nitrate-limited cultures of Selenastrum minutum Naeg. Collins (Chlorophyta) resulted in a 70% suppression of photosynthetic carbon fixation. In 14CO2 pulse/chase experiments nitrate resupply increased radiolabel incorporation into amino and organic acids and decreased radiolabel incorporation into insoluble material. Nitrate resupply increased the concentration of phosphoenolpyruvate and increased the radiolabeling of phosphoenolpyruvate, pyruvate and tricarboxylic acid cycle intermediates, notably citrate, fumarate, and malate. Furthermore, nitrate also increased the pool sizes and radiolabeling of most amino acids, with alanine, aspartate, glutamate, and glutamine showing the largest changes. Nitrate resupply increased the proportion of radiolabel in the C-4 position of malate and increased the ratios of radiolabel in aspartate to phosphoenolpyruvate and in pyruvate to phosphoenolpyruvate, indicative of increased phosphoenolpyruvate carboxylase and pyruvate kinase activities. Analysis of these data showed that the rate of carbon flow through glutamate (10.6 μmoles glutamate per milligram chlorophyll per hour) and the rate of net glutamate production (7.9 μmoles glutamate per milligram chlorophyll per hour) were both greater than the maximum rate of carbon export from the Calvin cycle which could be maintained during steady state photosynthesis. These results are consistent with the hypothesis that nitrogen resupply to nitrogen-limited microalgae results in a transient suppression of photosynthetic carbon fixation due, in part, to the severity of competition for carbon skeletons between the Calvin cycle and nitrogen assimilation (IR Elrifi, DH Turpin 1986 Plant Physiol 81: 273-279). PMID:16665223

  4. The Path of Carbon Flow during NO(3)-Induced Photosynthetic Suppression in N-Limited Selenastrum minutum.

    PubMed

    Elrifi, I R; Turpin, D H

    1987-01-01

    Nitrate addition to nitrate-limited cultures of Selenastrum minutum Naeg. Collins (Chlorophyta) resulted in a 70% suppression of photosynthetic carbon fixation. In (14)CO(2) pulse/chase experiments nitrate resupply increased radiolabel incorporation into amino and organic acids and decreased radiolabel incorporation into insoluble material. Nitrate resupply increased the concentration of phosphoenolpyruvate and increased the radiolabeling of phosphoenolpyruvate, pyruvate and tricarboxylic acid cycle intermediates, notably citrate, fumarate, and malate. Furthermore, nitrate also increased the pool sizes and radiolabeling of most amino acids, with alanine, aspartate, glutamate, and glutamine showing the largest changes. Nitrate resupply increased the proportion of radiolabel in the C-4 position of malate and increased the ratios of radiolabel in aspartate to phosphoenolpyruvate and in pyruvate to phosphoenolpyruvate, indicative of increased phosphoenolpyruvate carboxylase and pyruvate kinase activities. Analysis of these data showed that the rate of carbon flow through glutamate (10.6 mumoles glutamate per milligram chlorophyll per hour) and the rate of net glutamate production (7.9 mumoles glutamate per milligram chlorophyll per hour) were both greater than the maximum rate of carbon export from the Calvin cycle which could be maintained during steady state photosynthesis. These results are consistent with the hypothesis that nitrogen resupply to nitrogen-limited microalgae results in a transient suppression of photosynthetic carbon fixation due, in part, to the severity of competition for carbon skeletons between the Calvin cycle and nitrogen assimilation (IR Elrifi, DH Turpin 1986 Plant Physiol 81: 273-279).

  5. Single-step purification and characterization of recombinant aspartase of Aeromonas media NFB-5.

    PubMed

    Singh, Ram Sarup; Yadav, Mukesh

    2012-07-01

    Aspartase (L-aspartate ammonia-lyase; EC 4.3.1.1) catalyzes the reversible amination of fumaric acid to produce L-aspartic acid. Aspartase coding gene (aspA) of Aeromonas media NFB-5 was cloned, sequenced, and expressed with His tag using pET-21b⁺ expression vector in Escherichia coli BL21. Higher expression was obtained with IPTG (1.5 mM) induction for 5 h at 37 °C in LB medium supplemented with 0.3% K₂HPO₄ and 0.3% KH₂PO₄. Recombinant His tagged aspartase was purified using Ni-NTA affinity chromatography and characterized for various biochemical and kinetic parameters. The purified aspartase showed optimal activity at pH 8.5 and 8.0 in the presence and absence of magnesium ions, respectively. The optimum temperature was determined to be 35 °C. The enzyme showed apparent K(m) and V(max) values for L-aspartate as 2.01 mM and 114 U/mg, respectively. The enzyme was stable in pH range of 6.5-9.5 and temperature up to 45 °C. Divalent metal ion requirement of enzyme was efficiently fulfilled by Mg²⁺, Mn²⁺, and Ca²⁺ ions. The cloned gene (aspA) product showed molecular weight of approximately 51 kDa by SDS-PAGE, which is in agreement with the molecular weight calculated from putative amino acid sequence. This is the first report on expression and characterization of recombinant aspartase from A. media.

  6. Capillary electrophoretic study of dibasic acids of different structures: Relation to separation of oxidative intermediates in remediation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Z.; Cocke, D.L.

    Dicarboxylic acids are important in environmental chemistry because they are intermediates in oxidative processes involved in natural remediation and waste management processes such as oxidative detoxification and advanced oxidation. Capillary electrophoresis (CE), a promising technique for separating and analyzing these intermediates, has been used to examine a series of dibasic acids of different structures and conformations. This series includes malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, maleic acid, fumaric acid, phthalic acid, and trans, trans-muconic acid. The CE parameters as well as structural variations (molecular structure and molecular isomers, buffer composition, pH, applied voltage, injection mode, current,more » temperature, and detection wavelength) that affect the separations and analytical results have been examined in this study. Those factors that affect the separation have been delineated. Among these parameters, the pH has been found to be the most important, which affects the double-layer of the capillary wall, the electro-osmotic flow and analyte mobility. The optimum pH for separating these dibasic acids, as well as the other parameters are discussed in detail and related to the development of methods for analyzing oxidation intermediates in oxidative waste management procedures.« less

  7. Conversion of the sensor kinase DcuS of Escherichia coli of the DcuB/DcuS sensor complex to the C4 -dicarboxylate responsive form by the transporter DcuB.

    PubMed

    Wörner, Sebastian; Strecker, Alexander; Monzel, Christian; Zeltner, Matthias; Witan, Julian; Ebert-Jung, Andrea; Unden, Gottfried

    2016-12-01

    The sensor kinase DcuS of Escherichia coli co-operates under aerobic conditions with the C 4 -dicarboxylate transporter DctA to form the DctA/DcuS sensor complex. Under anaerobic conditions C 4 -dicarboxylate transport in fumarate respiration is catalyzed by C 4 -dicarboxylate/fumarate antiporter DcuB. (i) DcuB interacted with DcuS as demonstrated by a bacterial two-hybrid system (BACTH) and by co-chromatography of the solubilized membrane-proteins (mHPINE assay). (ii) In the DcuB/DcuS complex only DcuS served as the sensor since mutations in the substrate site of DcuS changed substrate specificity of sensing, and substrates maleate or 3-nitropropionate induced DcuS response without affecting the fumarate site of DcuB. (iii) The half-maximal concentration for induction of DcuS by fumarate (1 to 2 mM) and the corresponding K m for transport (50 µM) differ by a factor of 20 to 40. Therefore, the fumarate sites are different in transport and sensing. (iv) Increasing levels of DcuB converted DcuS from the permanent ON (DcuB deficient) state to the fumarate responsive form. Overall, the data show that DcuS and DcuB form a DcuB/DcuS complex representing the C 4 -dicarboxylate responsive form, and that the sensory site of the complex is located in DcuS whereas DcuB is required for converting DcuS to the sensory competent state. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  8. Osm1 facilitates the transfer of electrons from Erv1 to fumarate in the redox-regulated import pathway in the mitochondrial intermembrane space.

    PubMed

    Neal, Sonya E; Dabir, Deepa V; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M

    2017-10-15

    Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c , but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. © 2017 Neal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  9. Identification of Putative Steroid Receptor Antagonists in Bottled Water: Combining Bioassays and High-Resolution Mass Spectrometry

    PubMed Central

    Wagner, Martin; Schlüsener, Michael P.; Ternes, Thomas A.; Oehlmann, Jörg

    2013-01-01

    Endocrine disrupting chemicals (EDCs) are man-made compounds interfering with hormone signaling and thereby adversely affecting human health. Recent reports provide evidence for the presence of EDCs in commercially available bottled water, including steroid receptor agonists and antagonists. However, since these findings are based on biological data the causative chemicals remain unidentified and, therefore, inaccessible for toxicological evaluation. Thus, the aim of this study is to assess the antiestrogenic and antiandrogenic activity of bottled water and to identify the causative steroid receptor antagonists. We evaluated the antiestrogenic and antiandrogenic activity of 18 bottled water products in reporter gene assays for human estrogen receptor alpha and androgen receptor. Using nontarget high-resolution mass spectrometry (LTQ-Orbitrap Velos), we acquired corresponding analytical data. We combined the biological and chemical information to determine the exact mass of the tentative steroid receptor antagonist. Further MSn experiments elucidated the molecule’s structure and enabled its identification. We detected significant antiestrogenicity in 13 of 18 products. 16 samples were antiandrogenic inhibiting the androgen receptor by up to 90%. Nontarget chemical analysis revealed that out of 24520 candidates present in bottled water one was consistently correlated with the antagonistic activity. By combining experimental and in silico MSn data we identified this compound as di(2-ethylhexyl) fumarate (DEHF). We confirmed the identity and biological activity of DEHF and additional isomers of dioctyl fumarate and maleate using authentic standards. Since DEHF is antiestrogenic but not antiandrogenic we conclude that additional, yet unidentified EDCs must contribute to the antagonistic effect of bottled water. Applying a novel approach to combine biological and chemical analysis this is the first study to identify so far unknown EDCs in bottled water. Notably, dioctyl fumarates and maleates have been overlooked by science and regulation to date. This illustrates the need to identify novel toxicologically relevant compounds to establish a more holistic picture of the human exposome. PMID:24015248

  10. Impact of fumaric acid esters on cardiovascular risk factors and depression in psoriasis: a prospective pilot study.

    PubMed

    Schmieder, Astrid; Poppe, Manuel; Hametner, Christian; Meyer-Schraml, Hanna; Schaarschmidt, Marthe-Lisa; Findeisen, Peter; Benoit, Sandrine; Bauer, Boris; Schmid, Sybille; Goebeler, Matthias; Goerdt, Sergij; Ludwig-Peitsch, Wiebke K

    2015-07-01

    Patients with psoriasis have an increased risk of cardiovascular disease that is partly attributable to chronic systemic inflammation. The aim of our prospective pilot study was to investigate the impact of fumaric acid esters (FAE), a first-line systemic antipsoriatic treatment in Germany, on cardiovascular risk parameters. Participants with moderate-to-severe psoriasis from the University Medical Center Mannheim and the University Hospital Würzburg were treated with FAE for 16 weeks according to standard dosage recommendations. Disease severity, life quality and depression scores as well as biomarkers of inflammation, lipid and glucose metabolism were assessed prior to initiation of FAE and after 16 weeks. Out of 39 participants recruited, 27 completed the study. 44% of all participants and 63% of those completing the 16-week treatment achieved PASI 50 response and 27 or 37% PASI 75 response. Clinical improvement was paralleled by significant improvement in quality of life, high treatment satisfaction and significant reduction of depressive symptoms. Adverse events, most frequently mild gastrointestinal complaints, flush and lymphocytopenia occurred in 89%. FAE did not modify glucose metabolism or inflammatory parameters substantially. However, a highly significant increase in serum levels of the atheroprotective cytokine adiponectin was noted after 16 weeks (median 4.7 vs. 8.9 µg/ml; p = 0.0002). Our study demonstrates a significant beneficial impact of FAE on adiponectin, indicating a potential cardioprotective effect. It will be interesting to verify this finding in larger cohorts and to assess the long-term influence of FAE on cardiovascular risk and disease.

  11. Leccinum molle (Bon) Bon and Leccinum vulpinum Watling: The First Study of Their Nutritional and Antioxidant Potential.

    PubMed

    Reis, Filipa S; Barros, Lillian; Martins, Anabela; Vasconcelos, M Helena; Morales, Patricia; Ferreira, Isabel C F R

    2016-02-20

    This work presents the chemical profile of two edible species of mushrooms from the genus Leccinum: Leccinum molle (Bon) Bon and Leccinum vulpinum Watling, both harvested on the outskirts of Bragança (Northeastern Portugal). Both species were prepared and characterized regarding their content in nutrients (i.e., free sugars, fatty acids and vitamins), non-nutrients (i.e., phenolic and other organic acids) and antioxidant activity. To the best of our knowledge, no previous studies on the chemical characterization and bioactivity of these species have been undertaken. Accordingly, this study intends to increase the available information concerning edible mushroom species, as well as to highlight another important factor regarding the conservation of the mycological resources--their potential as sources of nutraceutical/pharmaceutical compounds. Overall, both species revealed similar nutrient profiles, with low fat levels, fructose, mannitol and trehalose as the foremost free sugars, and high percentages of mono- and polyunsaturated fatty acids. They also revealed the presence of bioactive compounds, namely phenolic (e.g., gallic acid, protocatechuic acid and p-hydroxybenzoic acid) and organic acids (e.g., citric and fumaric acids) and presented antioxidant properties.

  12. Catalytically important flavin linked through a phosphoester bond in a eukaryotic fumarate reductase.

    PubMed

    Serebryakova, Marina V; Bertsova, Yulia V; Sokolov, Svyatoslav S; Kolesnikov, Alexander A; Baykov, Alexander A; Bogachev, Alexander V

    2018-06-01

    One of the three domains of kinetoplastid NADH:fumarate oxidoreductase (FRD) is homologous to bacterial flavin transferase that catalyzes transfer of FMN residue from FAD to threonine in flavoproteins. Leptomonas pyrrhocoris FRD produced in yeast cells, which lack flavin transferase gene in their proteome, reduces fumarate in the presence of NADH and contains an FMN residue covalently linked to a Ser9 residue. The conserved flavinylation motif of FRD, D 3 (g/s)x(s/t)(s/g)AS 9 , is similar to the Dxx(s/t)gAT motif recognized by flavin transferase in prokaryotic proteins. Ser9 replacement abolished the flavinylation and fumarate reductase activity of FRD. These findings suggest that the flavinylation is important for the activity of FRD and that this post-translational modification is carried out by the own flavin transferase domain. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Exudation of organic acids by Lupinus albus and Lupinus angustifolius as affected by phosphorus supply

    NASA Astrophysics Data System (ADS)

    Hentschel, Werner; Wiche, Oliver

    2016-04-01

    In phytomining and phytoremediation research mixed cultures of bioenergy crops with legumes hold promise to enhance availability of trace metals and metalloids in the soil plant system. This is due to the ability of certain legumes to mobilize trace elements during acquisition of nutrients making these elements available for co-cultured species. The legumes achieve this element mobilization by exudating carboxylates and enzymes as well as by lowering the pH value in the rhizosphere. The aim of our research was to determine characteristics and differences in the exudation of Lupinus albus and Lupinus angustifolius regarding to quantitative as to qualitative aspects. Especially the affection by phosphorus (P) supply was a point of interest. Thus we conducted laboratory batch experiments, wherein the plants were grown over four weeks under controlled light, moisture and nutritional conditions on sand as substrate. Half of the plants were supplied with 12 mg P per kg substrate, the other half were cultivated under a total lack of P. After cultivation the plants were transferred from the cultivation substrate into a 0,05 mmolṡL-1 CaCl2 solution. After two hours the plants were removed, moist and dry mass off shoots and roots were measured together with the root length (Tennants' method). Concentrations of exudated carboxylates in the CaCl2 solution were determined via IC (column: Metrosept OrganicAcids, eluent 0.5 molṡL-1 H2SO4 + 15% acetone, pH=3; 0.5 mLṡmin-1). As a result four different organic acids were identified (citric acid, fumaric acid, tartaric acid, malic acid) in concentration ranges of 0.15 mgṡL-1 (fumaric acid) to 9.21 mgṡL-1 (citric acid). Lupinus angustifolius showed a higher exudation rate (in nmol per cm root length per hour) than Lupinus albus in the presence of phosphorus (e.g. regarding citric acid: 1.99 vs 0.64 nmolṡ(gṡh)-1). However, as the root complexity and length of L. albus were far higher than of L. angustifolius, the total amount of exudated organic acids per plant of L. albus was higher than of L.angustifolius. Thus L.albus should be addressed as the more exudation effective plant in comparison to L.angustifolius (could be addressed as the more efficient one). Since organic acids in the rhizosphere of intermingling root systems of intercropped species play a key role during mobilization of trace metals our result clearly show that L.albus is most suitable for intercropping in a sense of phytoremediation and phytomining. These studies have been carried out in the framework of the PhytoGerm project financed by the Federal Ministry of Education and Research, Germany.

  14. Identification and characterization of five new classes of chlorogenic acids in burdock (Arctium lappa L.) roots by liquid chromatography/tandem mass spectrometry.

    PubMed

    Jaiswal, Rakesh; Kuhnert, Nikolai

    2011-01-01

    Burdock (Arcticum lappa L.) roots are used in folk medicine and also as a vegetable in Asian countries especially Japan, Korea, and Thailand. We have used LC-MS(n) (n = 2-4) to detect and characterize in burdock roots 15 quantitatively minor fumaric, succinic, and malic acid-containing chlorogenic acids, 11 of them not previously reported in nature. These comprise 3-succinoyl-4,5-dicaffeoyl or 1-succinoyl-3,4-dicaffeoylquinic acid, 1,5-dicaffeoyl-3-succinoylquinic acid, 1,5-dicaffeoyl-4-succinoylquinic acid, and 3,4-dicaffeoyl-5-succinoylquinic acid (M(r) 616); 1,3-dicaffeoyl-5-fumaroylquinic acid and 1,5-dicaffeoyl-4-fumaroylquinic acid (M(r) 614); 1,5-dicaffeoyl-3-maloylquinic acid, 1,4-dicaffeoyl-3-maloylquinic acid, and 1,5-dicaffeoyl-4-maloylquinic acid (M(r) 632); 1,3,5-tricaffeoyl-4-succinoylquinic acid (M(r) 778); 1,5-dicaffeoyl-3,4-disuccinoylquinic acid (M(r) 716); 1,5-dicaffeoyl-3-fumaroyl-4-succinoylquinic acid and 1-fumaroyl-3,5-dicaffeoyl-4-succinoylquinic acid (M(r) 714); dicaffeoyl-dimaloylquinic acid (M(r) 748); and 1,5-dicaffeoyl-3-succinoyl-4-dimaloylquinic acid (M(r) 732). All the structures have been assigned on the basis of LC-MS(n) patterns of fragmentation, relative hydrophobicity, and analogy of fragmentation patterns if compared to caffeoylquinic acids.

  15. Biomass-derived monomers for performance-differentiated fiber reinforced polymer composites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rorrer, Nicholas A.; Vardon, Derek R.; Dorgan, John R.

    Nearly all polymer resins used to manufacture critically important fiber reinforced polymer (FRP) composites are petroleum sourced. In particular, unsaturated polyesters (UPEs) are widely used as matrix materials and are often based on maleic anhydride, a four-carbon, unsaturated diacid. Typically, maleic anhydride is added as a reactant in a conventional step-growth polymerization to incorporate unsaturation throughout the backbone of the UPE, which is then dissolved in a reactive diluent (styrene is widely used) infused into a fiber mat and cross-linked. Despite widespread historical use, styrene has come under scrutiny due to environmental and health concerns; in addition, many conceivable UPEsmore » are not soluble in styrene. In this study, we demonstrate that renewably-sourced monomers offer the ability to overcome these issues and improve overall composite performance. The properties of poly(butylene succinate)-based UPEs incorporating maleic anhydride are used as a baseline for comparison against UPEs derived from fumaric acid, cis, cis-muconate, and trans, trans-muconate, all of which can be obtained biologically. The resulting biobased UPEs are combined with styrene, methacrylic acid, or a mixture of methacrylic acid and cinnaminic acid, infused into woven fiberglass and cross-linked with the addition of a free-radical initiator and heat. This process produces a series of partially or fully bio-derived composites. Overall, the muconate-containing UPE systems exhibit a more favorable property suite than the maleic anhydride and fumaric acid counterparts. In all cases at the same olefinic monomer loading, the trans, trans-muconate polymers exhibit the highest shear modulus, storage modulus, and glass transition temperature indicating stronger and more thermally resistant materials. They also exhibit the lowest loss modulus indicating a greater adhesion to the glass fibers. The use of a mixture of methacrylic and cinnaminic acid as the reactive diluent results in a FRP composite with properties that can be matched to reinforced composites prepared with styrene. Significantly, at one-third the monomer loading (corresponding to two-thirds the number of double bonds), trans, trans-muconate produces approximately the same storage modulus and glass transition temperature as maleic anhydride, while exhibiting a superior loss modulus. Altogether, this work demonstrates the novel synthesis of performance-differentiated FRP composites using renewably-sourced monomers.« less

  16. Biomass-derived monomers for performance-differentiated fiber reinforced polymer composites

    DOE PAGES

    Rorrer, Nicholas A.; Vardon, Derek R.; Dorgan, John R.; ...

    2017-03-14

    Nearly all polymer resins used to manufacture critically important fiber reinforced polymer (FRP) composites are petroleum sourced. In particular, unsaturated polyesters (UPEs) are widely used as matrix materials and are often based on maleic anhydride, a four-carbon, unsaturated diacid. Typically, maleic anhydride is added as a reactant in a conventional step-growth polymerization to incorporate unsaturation throughout the backbone of the UPE, which is then dissolved in a reactive diluent (styrene is widely used) infused into a fiber mat and cross-linked. Despite widespread historical use, styrene has come under scrutiny due to environmental and health concerns; in addition, many conceivable UPEsmore » are not soluble in styrene. In this study, we demonstrate that renewably-sourced monomers offer the ability to overcome these issues and improve overall composite performance. The properties of poly(butylene succinate)-based UPEs incorporating maleic anhydride are used as a baseline for comparison against UPEs derived from fumaric acid, cis, cis-muconate, and trans, trans-muconate, all of which can be obtained biologically. The resulting biobased UPEs are combined with styrene, methacrylic acid, or a mixture of methacrylic acid and cinnaminic acid, infused into woven fiberglass and cross-linked with the addition of a free-radical initiator and heat. This process produces a series of partially or fully bio-derived composites. Overall, the muconate-containing UPE systems exhibit a more favorable property suite than the maleic anhydride and fumaric acid counterparts. In all cases at the same olefinic monomer loading, the trans, trans-muconate polymers exhibit the highest shear modulus, storage modulus, and glass transition temperature indicating stronger and more thermally resistant materials. They also exhibit the lowest loss modulus indicating a greater adhesion to the glass fibers. The use of a mixture of methacrylic and cinnaminic acid as the reactive diluent results in a FRP composite with properties that can be matched to reinforced composites prepared with styrene. Significantly, at one-third the monomer loading (corresponding to two-thirds the number of double bonds), trans, trans-muconate produces approximately the same storage modulus and glass transition temperature as maleic anhydride, while exhibiting a superior loss modulus. Altogether, this work demonstrates the novel synthesis of performance-differentiated FRP composites using renewably-sourced monomers.« less

  17. Mineralization of aniline using hydroxyl/sulfate radical-based technology in a waterfall reactor.

    PubMed

    Durán, A; Monteagudo, J M; San Martín, I; Amunategui, F J; Patterson, D A

    2017-11-01

    The aim of this work is to study the applicability of a UV/H 2 O 2 process intensified with persulfate (PS) as a source of SO 4 - radicals to efficiently mineralize a synthetic effluent containing aniline in a glass reactor arranged in a cascade configuration. pH conditions were studied and the concentration of PS was optimized. The synergism for aniline mineralization between the UV/H 2 O 2 process and the combined UV/H 2 O 2 /PS process was quantified in 10.1%. Aniline degradation reached 100% under the UV/H2O2/PS process after 20 min. Its mineralization is favored under acidic conditions and with the presence of persulfate (optimal conditions: 49% in 90 min; pH = 4; [PS] = 250 ppm). On the contrary, the worst conditions were found at pH = 11, since hydrogen peroxide decomposes and carbonates were formed increasing the scavenging effect. The different mechanisms involved (formulated from intermediates identified by mass spectrometry) confirm these results. Aniline was found to follow a degradation pathway where phenol is the main intermediate. The presence of sulfate radicals increases phenol degradation rate leading to a higher mineralization extent. Benzoquinone was identified as the main aromatic oxidation product of phenol, whereas succinic, 4-oxo-pentanoic, fumaric and oxalic acids were detected as aliphatic oxidation products for both UV/H2O2 and UV/H2O2/PS oxidation processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Geometric Restraint Drives On- and Off-pathway Catalysis by the Escherichia coli Menaquinol:Fumarate Reductase*

    PubMed Central

    Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni; Luna-Chávez, César; Davis, Tyler A.; Sarwar, Maruf; Ham, Amy J.; McDonald, W. Hayes; Yankovskaya, Victoria; Stern, Harry A.; Johnston, Jeffrey N.; Maklashina, Elena; Cecchini, Gary; Iverson, Tina M.

    2011-01-01

    Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of the C2–C3 double bond of activated fumarate parallel to the C(4a)–N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR. PMID:21098488

  19. Geometric Restraint Drives On- and Off-pathway Catalysis by the Escherichia coli Menaquinol:Fumarate Reductase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni

    2012-01-05

    Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of themore » C2-C3 double bond of activated fumarate parallel to the C(4a)-N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR.« less

  20. Toxicity of Select Organic Acids to the Slightly Thermophilic Acidophile Acidithiobaccillus Caldus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    John E Aston; William A Apel; Brady D Lee

    2009-02-01

    Acidithiobacillus caldus is a thermophilic acidophile found in commercial biomining, acid mine drainage systems, and natural environments. Previous work has characterized A. caldus as a chemolithotrophic autotroph capable of utilizing reduced sulfur compounds under aerobic conditions. Organic acids are especially toxic to chemolithotrophs in low-pH environments, where they diffuse more readily into the cell and deprotonate within the cytoplasm. In the present study, the toxic effects of oxaloacetate, pyruvate, 2-ketoglutarate, acetate, malate, succinate, and fumarate on A. caldus strain BC13 were examined under batch conditions. All tested organic acids exhibited some inhibitory effect. Oxaloacetate was observed to inhibit growth completelymore » at a concentration of 250 µM, whereas other organic acids were completely inhibitory at concentrations of between 1,000 and 5,000 µM. In these experiments, the measured concentrations of organic acids decreased with time, indicating uptake or assimilation by the cells. Phospholipid fatty acid analyses indicated an effect of organic acids on the cellular envelope. Notable differences included an increase in cyclic fatty acids in the presence of organic acids, indicating possible instability of the cellular envelope. This was supported by field emission scanning-electron micrographs showing blebbing and sluffing in cells grown in the presence of organic acids.« less

  1. Reductive dehalogenation of carbon tetrachloride by Escherichia coli K-12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Criddle, C.S.; DeWitt, J.T.; McCarty, P.L.

    1990-11-01

    The formation of radicals from carbon tetrachloride (CT) is often invoked to explain the product distribution resulting from its transformation. Radicals formed by reduction of CT presumably react with constituents of the surrounding milieu to give the observed product distribution. The patterns of transformation observed in this work were consistent with such as hypothesis. In cultures of Escherichia coli K-12, the pathways and rates of CT transformation were dependent on the electron acceptor condition of the media. Use of oxygen and nitrate as electron acceptors generally prevented CT metabolism. At low oxygen levels ({approximately}1%), however, transformation of ({sup 14}C)CT tomore » {sup 14}CO{sub 2} and attachment to cell material did occur, in accord with reports of CT fate in mammalian cell cultures. Under fumarate-respiring conditions, ({sup 14}C)CT was recovered as {sup 14}CO{sub 2}, chloroform, and a nonvolatile fraction. In contrast, fermenting conditions resulted in more chloroform, more cell-bound {sup 14}C, and almost no {sup 14}CO{sub 2}. Rates of transformation of CT were faster under fermenting conditions than under fumarate-respiring conditions. Transformation rates also decreased over time, suggesting the gradual exhaustion of transformation activity. This loss was modeled with a simple exponential decay term.« less

  2. Genetic alterations in Krebs cycle and its impact on cancer pathogenesis.

    PubMed

    Sajnani, Karishma; Islam, Farhadul; Smith, Robert Anthony; Gopalan, Vinod; Lam, Alfred King-Yin

    2017-04-01

    Cancer cells exhibit alterations in many cellular processes, including oxygen sensing and energy metabolism. Glycolysis in non-oxygen condition is the main energy production process in cancer rather than mitochondrial respiration as in benign cells. Genetic and epigenetic alterations of Krebs cycle enzymes favour the shift of cancer cells from oxidative phosphorylation to anaerobic glycolysis. Mutations in genes encoding aconitase, isocitrate dehydrogenase, succinate dehydrogenase, fumarate hydratase, and citrate synthase are noted in many cancers. Abnormalities of Krebs cycle enzymes cause ectopic production of Krebs cycle intermediates (oncometabolites) such as 2-hydroxyglutarate, and citrate. These oncometabolites stabilize hypoxia inducible factor 1 (HIF1), nuclear factor like 2 (Nrf2), inhibit p53 and prolyl hydroxylase 3 (PDH3) activities as well as regulate DNA/histone methylation, which in turn activate cell growth signalling. They also stimulate increased glutaminolysis, glycolysis and production of reactive oxygen species (ROS). Additionally, genetic alterations in Krebs cycle enzymes are involved with increased fatty acid β-oxidations and epithelial mesenchymal transition (EMT) induction. These altered phenomena in cancer could in turn promote carcinogenesis by stimulating cell proliferation and survival. Overall, epigenetic and genetic changes of Krebs cycle enzymes lead to the production of oncometabolite intermediates, which are important driving forces of cancer pathogenesis and progression. Understanding and applying the knowledge of these mechanisms opens new therapeutic options for patients with cancer. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  3. 21 CFR 522.84 - Beta-aminopropionitrile fumarate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... use in breeding animals since the effects on fertility, pregnancy, or fetal health have not been... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Beta-aminopropionitrile fumarate. 522.84 Section 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...

  4. Raman spectroscopy based screening of IgG positive and negative sera for dengue virus infection

    NASA Astrophysics Data System (ADS)

    Bilal, M.; Saleem, M.; Bial, Maria; Khan, Saranjam; Ullah, Rahat; Ali, Hina; Ahmed, M.; Ikram, Masroor

    2017-11-01

    A quantitative analysis for the screening of immunoglobulin-G (IgG) positive human sera samples is presented for the dengue virus infection. The regression model was developed using 79 samples while 20 samples were used to test the performance of the model. The R-square (r 2) value of 0.91 was found through a leave-one-sample-out cross validation method, which shows the validity of this model. This model incorporates the molecular changes associated with IgG. Molecular analysis based on regression coefficients revealed that myristic acid, coenzyme-A, alanine, arabinose, arginine, vitamin C, carotene, fumarate, galactosamine, glutamate, lactic acid, stearic acid, tryptophan and vaccenic acid are positively correlated with IgG; while amide III, collagen, proteins, fatty acids, phospholipids and fucose are negatively correlated. For blindly tested samples, an excellent agreement has been found between the model predicted, and the clinical values of IgG. The parameters, which include sensitivity, specificity, accuracy and the area under the receiver operator characteristic curve, are found to be 100%, 83.3%, 95% and 0.99, respectively, which confirms the high quality of the model.

  5. Experimental design for extraction and quantification of phenolic compounds and organic acids in white "Vinho Verde" grapes.

    PubMed

    Dopico-García, M S; Valentão, P; Guerra, L; Andrade, P B; Seabra, R M

    2007-01-30

    An experimental design was applied for the optimization of extraction and clean-up processes of phenolic compounds and organic acids from white "Vinho Verde" grapes. The developed analytical method consisted in two steps: first a solid-liquid extraction of both phenolic compounds and organic acids and then a clean-up step using solid-phase extraction (SPE). Afterwards, phenolic compounds and organic acids were determined by high-performance liquid chromatography (HPLC) coupled to a diode array detector (DAD) and HPLC-UV, respectively. Plackett-Burman design was carried out to select the significant experimental parameters affecting both the extraction and the clean-up steps. The identified and quantified phenolic compounds were: quercetin-3-O-glucoside, quercetin-3-O-rutinoside, kaempferol-3-O-rutinoside, isorhamnetin-3-O-glucoside, quercetin, kaempferol and epicatechin. The determined organic acids were oxalic, citric, tartaric, malic, shikimic and fumaric acids. The obtained results showed that the most important variables were the temperature (40 degrees C) and the solvent (acid water at pH 2 with 5% methanol) for the extraction step and the type of sorbent (C18 non end-capped) for the clean-up step.

  6. A mitochondrial NADH-dependent fumarate reductase involved in the production of succinate excreted by procyclic Trypanosoma brucei.

    PubMed

    Coustou, Virginie; Besteiro, Sébastien; Rivière, Loïc; Biran, Marc; Biteau, Nicolas; Franconi, Jean-Michel; Boshart, Michael; Baltz, Théo; Bringaud, Frédéric

    2005-04-29

    Trypanosoma brucei is a parasitic protist responsible for sleeping sickness in humans. The procyclic stage of T. brucei expresses a soluble NADH-dependent fumarate reductase (FRDg) in the peroxisome-like organelles called glycosomes. This enzyme is responsible for the production of about 70% of the excreted succinate, the major end product of glucose metabolism in this form of the parasite. Here we functionally characterize a new gene encoding FRD (FRDm1) expressed in the procyclic stage. FRDm1 is a mitochondrial protein, as evidenced by immunolocalization, fractionation of digitonin-permeabilized cells, and expression of EGFP-tagged FRDm1 in the parasite. RNA interference was used to deplete FRDm1, FRDg, or both together. The analysis of the resulting mutant cell lines showed that FRDm1 is responsible for 30% of the cellular NADH-FRD activity, which solves a long standing debate regarding the existence of a mitochondrial FRD in trypanosomatids. FRDg and FRDm1 together account for the total NADH-FRD activity in procyclics, because no activity was measured in the double mutant lacking expression of both proteins. Analysis of the end products of 13C-enriched glucose excreted by these mutant cell lines showed that FRDm1 contributes to the production of between 14 and 44% of the succinate excreted by the wild type cells. In addition, depletion of one or both FRD enzymes results in up to 2-fold reduction of the rate of glucose consumption. We propose that FRDm1 is involved in the maintenance of the redox balance in the mitochondrion, as proposed for the ancestral soluble FRD presumably present in primitive anaerobic cells.

  7. Quantifying the Benefits of Dimethyl Fumarate Over β Interferon and Glatiramer Acetate Therapies on Work Productivity Outcomes in MS Patients.

    PubMed

    Lee, Andrew; Pike, James; Edwards, Michael R; Petrillo, Jennifer; Waller, John; Jones, Eddie

    2017-06-01

    Dimethyl fumarate (DMF) is a novel oral therapy used for the treatment of relapse-remitting multiple sclerosis (RRMS). In two 2-year pivotal Phase 3 trials in patients with RRMS, DMF significantly reduced disease activity based on both clinical and magnetic resonance imaging (MRI) findings and demonstrated an acceptable safety profile. However, there is currently a lack of comparative data which explore the relationship between work productivity and health-related quality of life (HRQoL) outcomes in RRMS and how these differ among RRMS therapies, including DMF. We explored this relationship through patient-reported data from the EuroQol Five-Dimensions (EQ-5D) tool, Work Productivity and Activity Impairment Questionnaire (WPAI), and the Hamburg Quality of Life Questionnaire in Multiple Sclerosis (HAQUAMS) using the Adelphi MS DSP® dataset. Our data demonstrated that patients receiving DMF experienced better outcomes, relative to patients receiving beta (β)interferons or glatiramer acetate, in all WPAI subscales [overall; average treatment effect (ATE) -13.92, 95% confidence interval (CI) -18.87 to -7.08; p < 0.001], EQ-5D (ATE +0.075, 95% Cl 0.014-0.136; p = 0.016) and HAQUAMS [ATE -0.45, 95% Cl -0.61 to -0.29; p < 0.001]. The EQ-5D and HAQUAMS were used with WPAI to determine the relationship between HRQoL outcomes and work productivity. Multiple linear regression analyses were performed, adjusting for age, sex, body mass index, ethnicity and number of comorbid conditions. These data demonstrate that therapy with DMF was associated with increased work productivity and HRQoL for patients with RRMS and that these outcomes were consistently improved compared to outcomes with interferon and glatiramer acetate therapies.

  8. Stress Studies of Tenofovir Disoproxil Fumarate by HPTLC in Bulk Drug and Pharmaceutical Formulation

    PubMed Central

    Havele, Shweta; Dhaneshwar, Sunil R.

    2012-01-01

    A stability-indicating high-performance thin-layer chromatographic (HPTLC) method for determination of tenofovir disoproxil fumarate in bulk drug and in tablet has been developed and validated. The mobile phase selected was chloroform : methanol (9.0 : 1.0, v/v) with ultraviolet (UV) detection at 260 nm. The retention factor was found to be 0.49 ± 0.03 with correlation coefficients of 0.9994 in the range 300–1500 ng/spot and with an accuracy of 99.25%. Method had the potential to determine tenofovir disoproxil fumarate from tablet without any interference, and it was a stability-indicating one. PMID:22606065

  9. Hydrocarbon activation under sulfate-reducing and methanogenic conditions proceeds by different mechanisms.

    NASA Astrophysics Data System (ADS)

    Head, Ian; Gray, Neil; Aitken, Caroline; Sherry, Angela; Jones, Martin; Larter, Stephen

    2010-05-01

    Microbial degradation of alkanes typically involves their conversion to fatty acids which are then catabolised by beta-oxidation. The critical step in this process is activation of the hydrocarbon. Under oxic conditions this is catalyzed by monooxygenase enzymes with the formation of long chain alcohols. In the absence of oxygen alternative alkane activation mechanisms have been observed or proposed. Fumarate addition to alkanes to form alkyl succinates is considered a central process in anaerobic hydrocarbon degradation. Comparative studies of crude oil degradation under sulphate-reducing and methanogenic conditions revealed distinctive patterns of compound class removal and metabolite formation. Alkyl succinates derived from C7 to C26 n-alkanes and branched chain alkanes were found in abundance in sulfate-reducing systems but these were not detected during methanogenic crude oil degradation. Only one other mechanism of alkane activation has been elucidated to date. This involves addition of carbon derived from bicarbonate/CO2 to C-3 of an alkane chain to form a 2-ethylalkane with subsequent removal of the ethyl group leading to the formation of a fatty acid 1 carbon shorter than the original alkane. 2-ethylalkanes have never been detected as metabolites of anaerobic alkane degradation and were not detected in crude oil-degrading methanogenic systems. Due to the range of alkanes present in crude oil it was not possible to infer the generation of C-odd acids from C-even alkanes which is characteristic of the C-3 carboxylation mechanism. Furthermore genes homologous to alkysuccinate synthetases were not detected in the methanogenic hydrocarbon degrading community by pyrosequencing of total DNA extracted from methanogenic enrichments cultures. beta-oxidation genes were detected and intriguingly, alcohol and aldehyde dehydrogenase genes were present. This offers the possibility that alkane activation in the methanogenic system does not proceed via acid metabolites, but may be initiated by an anaerobic hydroxylation reaction. This is not unprecedented and hydroxylation of ethylbenzene has been demonstrated. However the C-H bond dissociation energy of alkanes is typically considered too high to readily permit alkane hydroxylation. It is however clear that alkane activation in these methanogenic crude oil-degrading systems involves mechanisms other than the well-known fumarate-addition reactions.

  10. The antidiabetic drug metformin decreases mitochondrial respiration and tricarboxylic acid cycle activity in cultured primary rat astrocytes.

    PubMed

    Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf

    2017-11-01

    Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. [Determination of dimethyl fumarate in bakery food by d-SPE-HPLC-PDA].

    PubMed

    Yang, Jie; Luo, Mengtian; Feng, Di; Miao, Hong; Song, Shufeng; Zhao, Yunfeng

    2015-05-01

    To establish a simple and rapid pretreatment method with dispersive solid phase extraction ( d-SPE) by HPLC for determination of dimethyl fumarate in bakery foods. Dimethyl fumarate in samples was ultrasonically extracted by methanol, and cleaned up with d-SPE. Then, it was separated on C18 chromatographic column (4.6 mm x 25 mm, 5 μm) with a mixture of methanol--0.03 mol/L sodium acetate and 0.008 mol/L tetrabutyl ammonium bromide (40: 60, V/V) as mobile phase. The photodiode array detector was used in the determination under λ = 220 nm. In the linear range of 0.1 -25 μg/ml, the correlation coefficients was r > 0.999, and the average recoveries of the spiked samples were in the range of 82.8% - 107.5% with relative standard deviations (RSD) in the range of 3.30% - 7.30% (n = 6). The limit of detection ( LOD) was 0.4 mg/kg, and the limit of quantification was 1.0 mg/kg. The method is simple, rapid, sensitive and accurate, and suitable for determine dimethyl fumarate in bakery foods.

  12. A comprehensive analysis of myocardial substrate preference emphasizes the need for a synchronized fluxomic/metabolomic research design.

    PubMed

    Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E

    2017-06-01

    The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.

  13. Environmental metabolomics reveal geographic variation in aerobic metabolism and metabolic substrates in Mongolian gerbils (Meriones unguiculatus).

    PubMed

    Shi, Yao-Long; Chi, Qing-Sheng; Liu, Wei; Fu, He-Ping; Wang, De-Hua

    2015-06-01

    Mongolian gerbils (Meriones unguiculatus) have a large-scale distribution in northern China. Geographic physiological variations which related to energy and water metabolism are critical to animals' local adaptation and distribution. However, the underlying biochemical mechanism of such variation and its role in adaptation remains largely unknown. We used GC-MS metabolomics approach to investigate the biochemical adaptation of Mongolian gerbils from xeric (desert), transition (desert steppe) and mesic (typical steppe) environments. Gerbils in desert population had lower resting metabolic rate (RMR) and total evaporative water loss (TEWL) than mesic population. Serum metabolomics revealed that concentrations of five tricarboxylic acid cycle intermediates (citrate, cis-aconitate, α-ketoglutarate, fumarate and malate) were lower in desert population than mesic population. Gastrocnemius metabolomics and citrate synthase activity analysis showed a lower concentration of citrate and lower citrate synthase activity in desert population. These findings suggest that desert dwelling gerbils decrease RMR and TEWL via down-regulation of aerobic respiration. Gastrocnemius metabolomics also revealed that there were higher concentrations of glucose and glycolytic intermediates, but lower concentrations of lipids, amino acids and urea in desert population than mesic population. This geographic variation in metabolic substrates may enhance metabolic water production per oxygen molecule for desert population while constraining aerobic respiration to reduce RMR and TEWL. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Long-term trend of dicarboxylic acids, ketoacids and dicarbonyls in the marine aerosols over the western North Pacific in 2001-2006

    NASA Astrophysics Data System (ADS)

    Kawamura, K.; Tachibana, E.; Mochida, M.

    2006-12-01

    To understand a long-range atmospheric transport of water-soluble organics in the western North Pacific, remote marine aerosols were collected on weekly basis at a subtropical island (Chichijima, 142E; 27N) from 2001 to 2006 using a high volume air sampler and pre-combusted quartz filter. The island is located in the boundary of westerly and trade wind regimes. The aerosols were analyzed for dicarboxylic acids, ketoacids and dicarbonyls employing butyl ester derivatization followed by GC determination. Homologous saturated diacids (C2-C11) were detected with a predominance of oxalic (C2) acid followed by malonic (C3) and succinic (C4) acids as well as unsaturated diacids, including maleic (M), fumaric (F), phthalic acids. Ketoacids and dicarbonyls were also detected. Concentrations of total diacids fluctuated significantly in a range of 10-600 ngm-3 with winter/spring maximum and summer minimum. The winter/spring maximum can be explained by a combinattion of enhanced emissions of polluted aerosols and their precursors in Asia and the intensified westerlies over the North Pacific in the season. Seasonal trends of the molecular compositions were also found. For example, concentration ratios of C3 to C4 acid showed a maximum in summer, indicating more oxidation of longer-chain diacids to shorter ones. M/F ratios increased from summer to winter as a result of photochemically-induced isomerization of cis and trans configuration of unsaturated diacids. On the other hand, azelaic acid (C9) relative to other diacids showed a sharp increase in summer. Because C9 is a specific photo-oxidation product of unsaturated fatty acid such as oleic acid, this demonstrates an enhanced sea-to- air emission of unsaturated fatty acids in summer followed by photochemical oxidation. Long-term trends of diacids and related compounds in the aerosols will be discussed for 2001 to 2006. The results will also be compared with those obtained at the same site for 1990 to 1993 to detect long-term changes in the organic aerosol compositions that might be happened over the western North Pacific due to the enhanced human activity in East Asia.

  15. A spectroscopic and surface microhardness study of enamel exposed to beverages supplemented with ferrous fumarate and ferrous sulfate. A randomized in vitro trial.

    PubMed

    Xavier, Arun M; Rai, Kavita; Hegde, Amitha M; Shetty, Suchetha

    2016-06-01

    To compare the efficacy between supplementing ferrous fumarate and ferrous sulfate to carbonated beverages by recording the in vitro mineral loss and surface microhardness (SMH) changes in human enamel. 120 enamel blocks each (from primary and permanent teeth) were uniformly prepared and the initial SMH was recorded. These enamel specimens were equally divided (n = 60) for their respective beverage treatment in Group 1 (2 mmol/L ferrous sulfate) and Group 2 (2 mmol/L ferrous fumarate). Each group was further divided into three subgroups as Coca-Cola, Sprite and mineral water (n= 10). The specimens were subjected to three repetitive cycles of respective treatment for a 5-minute incubation period, equally interspaced by 5-minute storage in artificial saliva. The calcium and phosphate released after each cycle were analyzed spectrophotometrically and the final SMH recorded. The results were tested using student's t-test, one-way ANOVA and Wilcoxon signed rank test (P < 0.05). The spectrophotometric assessment of calcium and phosphate withdrawal found more loss with the supplementation of 2 mmol/L ferrous sulfate than ferrous fumarate (P < 0.005). Similarly, the mean surface microhardness reduction was less with the supplementation of 2 mmol/L ferrous fumarate than with ferrous sulfate (P < 0.005). Statistical comparisons revealed the maximum surface microhardness and mineral loss with primary enamel and the maximum loss produced in all groups by Coca-Cola (P < 0.005).

  16. Identification of Protein Succination as a Novel Modification of Tubulin

    PubMed Central

    Piroli, Gerardo G.; Manuel, Allison M.; Walla, Michael D.; Jepson, Matthew J.; Brock, Jonathan W.C.; Rajesh, Mathur P.; Tanis, Ross M.; Cotham, William E.; Frizzell, Norma

    2015-01-01

    Protein succination is a stable post-translational modification that occurs when fumarate reacts with cysteine residues to generate S-(2-succino)cysteine (2SC). We demonstrate that both alpha (α) and beta (β) tubulin are increasingly modified by succination in 3T3-L1 adipocytes and in the adipose tissue of db/db mice. Incubation of purified tubulin from porcine brain with fumarate (50 mM) or the pharmacological compound dimethylfumarate (DMF, 500 μM) inhibited polymerization up to 35% and 59%, respectively. Using mass spectrometry we identified Cys347α, Cys376α, Cys12β and Cys303β as sites of succination in porcine brain tubulin and the relative abundance of succination at these cysteines increased in association with fumarate concentration. The increase in succination after incubation with fumarate altered tubulin recognition by an anti-α-tubulin antibody. Succinated tubulin in adipocytes cultured in high glucose vs. normal glucose also had reduced reactivity with the anti-αtubulin antibody; suggesting that succination may interfere with tubulin:protein interactions. DMF reacted rapidly with 11 of the 20 cysteines in the αβ tubulin dimer, decreased the number of free sulfhydryls and inhibited the proliferation of 3T3-L1 fibroblasts. Our data suggests that inhibition of tubulin polymerization is an important, undocumented mechanism of action of DMF. Taken together, our results demonstrate that succination is a novel post-translational modification of tubulin and suggest that extensive modification by fumarate, either physiologically or pharmacologically, may alter microtubule dynamics. PMID:24909641

  17. Crystallographic Studies of the Binding of Ligands to theDicarboxylate Site of Complex II, and the Identity of the Ligand in the'Oxaloacetate-Inhibited' State

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Li-Shar; Shen, John T.; Wang, Andy C.

    2006-07-01

    Mitochondrial Complex II (succinate:ubiquinoneoxidoreductase) is purified in a partially innactivated state, which canbe activated by removal of tightly bound oxaloacetate (Kearney, E.B. etal. Biochem Biophys Res Commun 49, 1115-1121). We crystallized Complex IIin the presence of oxaloacetate or with the endogenous inhibitor bound.The structure showed a ligand essentially identical to the "malate-likeintermediate" found in Shewanella Flavocytochrome c crystallized withfumarate (Taylor, P., et al. Nat Struct Biol 6, 1108-1112.)Crystallization of Complex II in the presence of excess fumarate alsogave the malate-like intermediate or a mixture of that and fumarate atthe active site. In order to more conveniently monitor the occupationstate ofmore » the dicarboxylate site, we are developing a library of UV/Visspectral effects induced by binding different ligands to the site.Treatment with fumarate results in rapid development of the fumaratedifference spectrum and then a very slow conversion into a speciesspectrally similar to the OAA liganded complex. Complex II is known to becapable of oxidizing malate to the enol form of oxaloacetate (Belikova,Y.O., et al. Biochim Biophys Acta 936, 1-9). The observations abovesuggest it may also be capable of interconverting fumarate and malate. Itmay be useful for understanding the mechanism and regulation of theenzyme to identify the malate-like intermediate and its pathway offormation from oxaloacetate or fumarate.« less

  18. Anaplerotic therapy in propionic acidemia.

    PubMed

    Longo, Nicola; Price, Leisa B; Gappmaier, Eduard; Cantor, Nancy L; Ernst, Sharon L; Bailey, Carrie; Pasquali, Marzia

    2017-09-01

    Propionic acidemia is a rare metabolic disorder caused by a deficiency of propionyl- CoA carboxylase, the enzyme converting propionyl-CoA to methylmalonyl-CoA that subsequently enters the citric acid cycle as succinyl-CoA. Patients with propionic acidemia cannot metabolize propionic acid, which combines with oxaloacetate to form methylcitric acid. This, with the defective supply of succinyl-CoA, may lead to a deficiency in citric acid cycle intermediates. The objective of this study was to determine whether supplements with glutamine (400mg/kg per day), citrate (7.5mEq/kg per day), or ornithine α-ketoglutarate (400mg/kg per day) (anaplerotic agents that could fill up the citric acid cycle) would affect plasma levels of glutamine and ammonia, the urinary excretion of Krebs cycle intermediates, and the clinical outcome in 3 patients with propionic acidemia. Each supplement was administered daily for four weeks with a two week washout period between supplements. The supplement that produced the most favorable changes was supplemented for 30 weeks following the initial study period and then for a 2 year extension. The urinary excretion of the Krebs cycle intermediates, α-ketoglutarate, succinate, and fumarate increased significantly compared to baseline during citrate supplementation, but not with the other two supplements. For this reason, citrate supplements were continued in the second part of the study. The urinary excretion of methylcitric acid and 3-hydroxypropionic acid did not change with any intervention. No significant changes in ammonia or glutamine levels were observed with any supplement. However, supplementation with any anaplerotic agents normalized the physiological buffering of ammonia by glutamate, with plasma glutamate and alanine levels significantly increasing, rather than decreasing with increasing ammonia levels. No significant side effects were observed with any therapy and safety labs (blood counts, chemistry and thyroid profile) remained unchanged. Motor and cognitive development was severely delayed before the trial and did not change significantly with therapy. Hospitalizations per year did not change during the trial period, but decreased significantly (p<0.05) in the 2years following the study (when citrate was continued) compared to the 2years before and during the study. These results indicate that citrate entered the Krebs cycle providing successful anaplerotic therapy by increasing levels of the downstream intermediates of the Krebs cycle: α-ketoglutarate, succinate and fumarate. Citrate supplements were safe and might have contributed to reduce hospitalizations in patients with propionic acidemia. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Desulfobulbus mediterraneus sp. nov., a sulfate-reducing bacterium growing on mono- and disaccharides.

    PubMed

    Sass, Andrea; Rütters, Heike; Cypionka, Heribert; Sass, Henrik

    2002-06-01

    A new sulfate-reducing bacterium, strain 86FS1, was isolated from a deep-sea sediment in the western Mediterranean Sea with sodium lactate as electron and carbon source. Cells were ovoid, gram-negative and motile. Strain 86FS1 contained b- and c-type cytochromes. The organism was able to utilize propionate, pyruvate, lactate, succinate, fumarate, malate, alanine, primary alcohols (C(2)-C(5)), and mono- and disaccharides (glucose, fructose, galactose, ribose, sucrose, cellobiose, lactose) as electron donors for the reduction of sulfate, sulfite or thiosulfate. The major products of carbon metabolism were acetate and CO(2), with exception of n-butanol and n-pentanol, which were oxidized only to the corresponding fatty acids. The growth yield with sulfate and glucose or lactate was 8.3 and 15 g dry mass, respectively, per mol sulfate. The temperature limits for growth were 10 degrees C and 30 degrees C with an optimum at 25 degrees C. Growth was observed at salinities ranging from 10 to 70 g NaCl l(-1). Sulfide concentrations above 4 mmol l(-1) inhibited growth. The fatty acid pattern of strain 86FS1 resembled that of Desulfobulbus propionicus with n-14:0, n-16:1omega7, n-16:1 omega5, n-17:1 omega6 and n-18:1 omega7 as dominant fatty acids. On the basis of its phylogenetic position and its phenotypic properties, strain 86FS1 affiliates with the genus Desulfobulbus and is described as a new species, Desulfobulbus mediterraneus sp. nov.

  20. Gateways to clinical trials.

    PubMed

    Tomillero, A; Moral, M A

    2010-06-01

    [¹¹C]RAC; (18)F-Fluoromisonidazole; 89-12; 9-[¹⁸F]Fluoropropyl-(+)-dihydrotetrabenazine; Adalimumab, Adecatumumab, ADMVA, ADXS-11-001, Aflibercept, Agatolimod sodium, AGS-004, Alglucosidase alfa, Aliskiren fumarate, Alvocidib hydrochloride, AMG-108, AMG-853, Apixaban, Aripiprazole, Armodafinil, Atazanavir sulfate, Atomoxetine hydrochloride; Bevacizumab, BioMatrix Flex drug eluting stent, Biphasic insulin aspart, Bortezomib, Bosentan; Caspofungin acetate, Cediranib, Cetuximab, ChimeriVax-Dengue, Choriogonadotropin alfa, Cinacalcet hydrochloride, Cizolirtine citrate, Clofarabine, Cocaine conjugate vaccine, CX-717; Darbepoetin alfa, Dasatinib, Decitabine, Denosumab, Desvenlafaxine succinate, Dexamethasone sodium phosphate, Dienogest, Diphencyprone, Doripenem, DTaP-HepB-IPV, Dutasteride; E-7010, Ecallantide, Ecstasy, Eicosapentaenoic acid/docosahexaenoic acid, Emtricitabine, Enfuvirtide, Erlotinib hydrochloride, Eszopiclone, Etonogestrel/ethinyl estradiol, Etoricoxib, Everolimus, Everolimus-eluting coronary stent EVT-201, Ezetimibe, Ezetimibe/simvastatin; Ferumoxytol, Fesoterodine fumavate, Figitumumab, Filgrastim, Fingolimod hydrochloride, Fluticasone furoate, Fluval P, Fluzone, Fondaparinux sodium, Fulvestrant, Fungichromin; Gamma-hydroxybutyrate sodium, Gefitinib, GHB-01L1, GLY-230, GSK-1349572; Hib-MenCY-TT, Hib-TT, HPV-6/11/16/18, Hydrocodone bitartrate; IC-51, Icatibant acetate, Imatinib mesylate, Immunoglobulin intravenous (human), Indetanib, Influenza A (H1N1) 2009 Monovalent Vaccine, Inhalable human insulin, Insulin glargine, Insulin glulisine, Interferon-beta, Ispinesib mesylate, Ixabepilone; Laromustine, Latanoprost/timolol maleate, L-Citrulline, Lenalidomide, Lexatumumab, Linezolid, Lopinavir/ritonavir, Lutropin alfa; Mapatumumab, MDX-066, MDX-1388, Mepolizumab, Methoxy polyethylene glycol-epoetin-beta, Metreleptin, Micafungin sodium, Mometasone furoate/oxymetazoline hydrochloride, Mx-dnG1, Mycophenolic acid sodium salt; Nabiximols, Natalizumab, Nemonoxacin, Norelgestromin/ethinyl estradiol; Oblimersen sodium, Ocriplasmin, Olmesartan medoxomil, Omacetaxine mepesuccinate; Paclitaxel-eluting stent, Pagoclone, Paliperidone, Panitumumab, Pazopanib hydrochloride, PCV7, Pegaptanib octasodium, Peginterferon alfa-2a, Peginterferon alfa-2b/ ribavirin, Pegvisomant, Pemetrexed disodium, Perifosine, Pimecrolimus, Pitavastatin calcium, Plerixafor hydrochloride, Plitidepsin, Posaconazole, Pregabalin, Progesterone capriate; Raltegravir potassium, Ramucirumab, Ranelic acid distrontium salt, Rasburicase, Recombinant Bet V1, Recombinant human insulin, rhFSH, Rolofylline, Romidepsin, Romiplostim, Rosuvastatin calcium; Sapacitabine, Sevelamer carbonate, Sinecatechins, Sirolimus-eluting stent, Sitagliptin phosphate monohydrate, SN-29244, Sorafenib, Sugammadex sodium, Sunitinib malate; Tadalafil, Tafenoquine, Talnetant, Tanezumab, Tapentadol hydrochloride, Tasocitinib citrate, Technosphere/Insulin, Telcagepant, Tenofovir disoproxil fumarate, Teriparatide, Ticagrelor, Tigecycline, Tiotropium bromide, Tipifarnib, Tocilizumab, TS-041; Ulipristal acetate, Urtoxazumab, Ustekinumab; Vandetanib, Varenicline tartrate, Vicriviroc, Voriconazole, Vorinostat, VRC-HIVADV014-00-VP, VRC-HIVDNA016-00-VP; Zoledronic acid monohydrate. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

  1. Two Approaches to the Synthesis of Dimethyl Fumarate That Demonstrate Fundamental Principles of Organic Chemistry

    ERIC Educational Resources Information Center

    Love, Brian E.; Bennett, Lisa J.

    2017-01-01

    Two experiments are described which lead to the preparation of dimethyl fumarate, a compound currently used in the treatment of multiple sclerosis. Preparation of a compound with "real-world" applications is believed to increase student interest in the experiment. One experiment involves the isomerization of dimethyl maleate to the…

  2. Automated Control of the Organic and Inorganic Composition of Aloe vera Extracts Using (1)H NMR Spectroscopy.

    PubMed

    Monakhova, Yulia B; Randel, Gabriele; Diehl, Bernd W K

    2016-09-01

    Recent classification of Aloe vera whole-leaf extract by the International Agency for Research and Cancer as a possible carcinogen to humans as well as the continuous adulteration of A. vera's authentic material have generated renewed interest in controlling A. vera. The existing NMR spectroscopic method for the analysis of A. vera, which is based on a routine developed at Spectral Service, was extended. Apart from aloverose, glucose, malic acid, lactic acid, citric acid, whole-leaf material (WLM), acetic acid, fumaric acid, sodium benzoate, and potassium sorbate, the quantification of Mg(2+), Ca(2+), and fructose is possible with the addition of a Cs-EDTA solution to sample. The proposed methodology was automated, which includes phasing, baseline-correction, deconvolution (based on the Lorentzian function), integration, quantification, and reporting. The NMR method was applied to 41 A. vera preparations in the form of liquid A. vera juice and solid A. vera powder. The advantages of the new NMR methodology over the previous method were discussed. Correlation between the new and standard NMR methodologies was significant for aloverose, glucose, malic acid, lactic acid, citric acid, and WLM (P < 0.0001, R(2) = 0.99). NMR was found to be suitable for the automated simultaneous quantitative determination of 13 parameters in A. vera.

  3. Examination of microbial fuel cell start-up times with domestic wastewater and additional amendments.

    PubMed

    Liu, Guangli; Yates, Matthew D; Cheng, Shaoan; Call, Douglas F; Sun, Dan; Logan, Bruce E

    2011-08-01

    Rapid startup of microbial fuel cells (MFCs) and other bioreactors is desirable when treating wastewaters. The startup time with unamended wastewater (118 h) was similar to that obtained by adding acetate or fumarate (110-115 h), and less than that with glucose (181 h) or Fe(III) (353 h). Initial current production took longer when phosphate buffer was added, with startup times increasing with concentration from 149 h (25 mM) to 251 h (50 mM) and 526 h (100 mM). Microbial communities that developed in the reactors contained Betaproteobacteria, Acetoanaerobium noterae, and Chlorobium sp. Anode biomass densities ranged from 200 to 600 μg/cm(2) for all amendments except Fe(Ш) (1650 μg/cm(2)). Wastewater produced 91 mW/m(2), with the other MFCs producing 50 mW/m(2) (fumarate) to 103mW/m(2) (Fe(III)) when amendments were removed. These experiments show that wastewater alone is sufficient to acclimate the reactor without the need for additional chemical amendments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Towards excimer-laser-based stereolithography: a rapid process to fabricate rigid biodegradable photopolymer scaffolds

    PubMed Central

    Beke, S.; Anjum, F.; Tsushima, H.; Ceseracciu, L.; Chieregatti, E.; Diaspro, A.; Athanassiou, A.; Brandi, F.

    2012-01-01

    We demonstrate high-resolution photocross-linking of biodegradable poly(propylene fumarate) (PPF) and diethyl fumarate (DEF) using UV excimer laser photocuring at 308 nm. The curing depth can be tuned in a micrometre range by adjusting the total energy dose (total fluence). Young's moduli of the scaffolds are found to be a few gigapascal, high enough to support bone formation. The results presented here demonstrate that the proposed technique is an excellent tool for the fabrication of stiff and biocompatible structures on a micrometre scale with defined patterns of high resolution in all three spatial dimensions. Using UV laser photocuring at 308 nm will significantly improve the speed of rapid prototyping of biocompatible and biodegradable polymer scaffolds and enables its production in a few seconds, providing high lateral and horizontal resolution. This short timescale is indeed a tremendous asset that will enable a more efficient translation of technology to clinical applications. Preliminary cell tests proved that PPF : DEF scaffolds produced by excimer laser photocuring are biocompatible and, therefore, are promising candidates to be applied in tissue engineering and regenerative medicine. PMID:22696484

  5. Molecular compositions and decadal trends of dicarboxylic acids, ketoacids, α-dicarbonyls in the marine aerosols from Chichi-Jima Island in the western North Pacific

    NASA Astrophysics Data System (ADS)

    Kawamura, K.; Tachibana, E.

    2010-12-01

    A rapid industrial development in China and East Asian countries for last two decades may have seriously changed the air quality of the North Pacific. To better understand a long-term atmospheric changes of organic aerosols in the western North Pacific, we collected marine aerosol samples on weekly basis at a remote island, Chichijima (27°04'E; 142°13'N) in 2001-2010. The island is located in the boundary of westerly and easterly wind regimes. The aerosol samples were analyzed for dicarboxylic acids, ketoacids and α-dicarbonyls employing butyl ester derivatization followed by GC determination, together with total carbon (TC) and water-soluble organic carbon (WSOC). Homologous series of saturated diacids (C2-C11) were detected with a predominance of oxalic (C2) acid followed by malonic (C3) and succinic (C4) acids. Unsaturated diacids, including maleic (M), fumaric (F), phthalic, and iso-/tere-phthalic acids, were also detected together with ketoacids and α-dicarbonyls. Concentrations of total diacids fluctuated significantly in a range of 10-600 ngm-3 with winter/spring maximum and summer minimum. The maximum was explained by a combination of enhanced emissions of polluted aerosols and their precursors in Asia and enhanced atmospheric transport to the North Pacific due to the intensified westerly winds in winter/spring. Concentration ratios of C3 to C4 diacid (range 0.2-28, av. 2.8) showed a maximum during summer, indicating more oxidation of longer-chain diacids to shorter ones. Azelaic acid (C9) that is a specific photo-oxidation product of unsaturated fatty acid such as oleic acid showed a sharp increase relative to other diacids in summer, suggesting enhanced sea-to-air emission of unsaturated fatty acids followed by photochemical oxidation during summer. On the other hand, M/F ratios (range 0-8.7, av. 1.1) significantly decreased from winter to summer due to photochemical cis-to-trans isomerization. We also discuss decadal trends in the concentrations of diacids and related compounds as well as TC and WSOC, and their compositions and relative abundances.

  6. Non-volatile taste components of several cultivated mushrooms.

    PubMed

    Li, Wen; Gu, Zhen; Yang, Yan; Zhou, Shuai; Liu, Yanfang; Zhang, Jingsong

    2014-01-15

    Five species of dried mushrooms are commercially available in China, namely Agrocybe cylindracea, Pleurotus cystidiosus, Agaricus blazei, Pleurotus eryngii, and Coprinus comatus, and their nonvolatile taste components were studied. Trehalose (12.23-301.63mg/g) and mannitol (12.37-152.11mg/g) were considered as the major mushroom sugar/polyol in the five test species. The total free amino acid levels ranged from 4.09 to 22.73mg/g. MSG-like components contents ranged from 0.97 to 4.99mg/g. 5'-Nucleotide levels ranged from 1.68mg/g in P. eryngii to 3.79mg/g in C. comatus. Fumaric acid (96.11mg/g) in P. cystidiosus were significantly higher compared with the other mushrooms, and citric acid (113.13mg/g), as the highest of any organic acid among the five mushrooms, were found in A. blazei. Equivalent umami concentrations values in these five test mushrooms ranged from 11.19 to 88.37g/100g dry weight. A. blazei, C.comatus and A. cylindracea possessed highly strong umami taste. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Spray drying of budesonide, formoterol fumarate and their composites-II. Statistical factorial design and in vitro deposition properties.

    PubMed

    Tajber, L; Corrigan, O I; Healy, A M

    2009-02-09

    The aim of this study was to investigate the effect of changing spray drying parameters on the production of a budesonide/formoterol fumarate 100:6 (w/w) composite. The systems were spray dried as solutions from 95% ethanol/5% water (v/v) using a Büchi 191-Mini Spray Dryer. A 2(5-1) factorial design study was undertaken to assess the consequence of altering spray drying processing variables on particle characteristics. The processing parameters that were studied were inlet temperature, spray drier airflow rate, pump rate, aspirator setting and feed concentration. Each batch of the resulting powder was characterised in terms of thermal and micromeritic properties as well as an in vitro deposition by twin impinger analysis. Overall, the parameter that had the greatest influence on each response investigated was production yield - airflow (higher airflow giving greater yields), median particle size - airflow (higher airflow giving smaller particle sizes) and Carr's compressibility index - feed concentration (lower feed concentration giving smaller Carr's indices). A six- to seven-fold difference in respirable fraction can be observed by changing the spray drying process parameters. The co-spray dried composite system which displayed best in vitro deposition characteristics, showed a 2.6-fold increase in respirable fraction in the twin impinger experiments and better dose uniformity compared with the physical mix of micronised powders.

  8. Nafuredin, a novel inhibitor of NADH-fumarate reductase, produced by Aspergillus niger FT-0554.

    PubMed

    Ui, H; Shiomi, K; Yamaguchi, Y; Masuma, R; Nagamitsu, T; Takano, D; Sunazuka, T; Namikoshi, M; Omura, S

    2001-03-01

    A novel compound, nafuredin, was isolated as an inhibitor of anaerobic electron transport (NADH-fumarate reductase). It was obtained from culture broth of Aspergillus niger FT-0554 isolated from a marine sponge. The structure was elucidated as an epoxy-delta-lactone with an attached methylated olefinic side chain on the basis of spectral analysis.

  9. The Role of Glutamine Synthetase and Glutamate Dehydrogenase in Cerebral Ammonia Homeostasis

    PubMed Central

    Cooper, Arthur J. L.

    2012-01-01

    In the brain, glutamine synthetase (GS), which is located predominantly in astrocytes, is largely responsible for the removal of both blood-derived and metabolically generated ammonia. Thus, studies with [13N]ammonia have shown that about 25% of blood-derived ammonia is removed in a single pass through the rat brain and that this ammonia is incorporated primarily into glutamine (amide) in astrocytes. Major pathways for cerebral ammonia generation include the glutaminase reaction and the glutamate dehydrogenase (GDH) reaction. The equilibrium position of the GDH-catalyzed reaction in vitro favors reductive amination of α-ketoglutarate at pH 7.4. Nevertheless, only a small amount of label derived from [13N]ammonia in rat brain is incorporated into glutamate and the α-amine of glutamine in vivo. Most likely the cerebral GDH reaction is drawn normally in the direction of glutamate oxidation (ammonia production) by rapid removal of ammonia as glutamine. Linkage of glutamate/α-ketoglutarate-utilizing aminotransferases with the GDH reaction channels excess amino acid nitrogen toward ammonia for glutamine synthesis. At high ammonia levels and/or when GS is inhibited the GDH reaction coupled with glutamate/α-ketoglutarate-linked aminotransferases may, however, promote the flow of ammonia nitrogen toward synthesis of amino acids. Preliminary evidence suggests an important role for the purine nucleotide cycle (PNC) as an additional source of ammonia in neurons (Net reaction: L-Aspartate + GTP + H2O → Fumarate + GDP + Pi + NH3) and in the beat cycle of ependyma cilia. The link of the PNC to aminotransferases and GDH/GS and its role in cerebral nitrogen metabolism under both normal and pathological (e.g. hyperammonemic encephalopathy) conditions should be a productive area for future research. PMID:22618691

  10. Highly efficient chiral resolution of DL-arginine by cocrystal formation followed by recrystallization under preferential-enrichment conditions.

    PubMed

    Iwama, Sekai; Kuyama, Kazunori; Mori, Yuko; Manoj, Kochunnoonny; Gonnade, Rajesh G; Suzuki, Katsuaki; Hughes, Colan E; Williams, P Andrew; Harris, Kenneth D M; Veesler, Stéphane; Takahashi, Hiroki; Tsue, Hirohito; Tamura, Rui

    2014-08-11

    An excellent chiral symmetry-breaking spontaneous enantiomeric resolution phenomenon, denoted preferential enrichment, was observed on recrystallization of the 1:1 cocrystal of dl-arginine and fumaric acid, which is classified as a racemic compound crystal with a high eutectic ee value (>95 %), under non-equilibrium crystallization conditions. On the basis of temperature-controlled video microscopy and in situ time-resolved solid-state (13) C NMR spectroscopic studies on the crystallization process, a new mechanism of phase transition that can induce preferential enrichment is proposed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Comparison of the skin sensitizing potential of unsaturated compounds as assessed by the murine local lymph node assay (LLNA) and the guinea pig maximization test (GPMT).

    PubMed

    Kreiling, R; Hollnagel, H M; Hareng, L; Eigler, D; Lee, M S; Griem, P; Dreessen, B; Kleber, M; Albrecht, A; Garcia, C; Wendel, A

    2008-06-01

    The skin sensitization potential of eight unsaturated and one saturated lipid (bio)chemicals was tested in both the LLNA and the GPMT to address the hypothesis that chemicals with unsaturated carbon-carbon double bonds may result in a higher number of unspecific (false positive) results in the LLNA compared to the GPMT. Seven substances (oleic acid, linoleic acid, linolenic acid, undecylenic acid, maleic acid, squalene and octinol) gave clear positive results in the LLNA (stimulation index (SI)> or = 3) and thus would require labelling as skin sensitizer. Fumaric acid and succinic acid gave clearly negative results. In the GPMT, besides some sporadic skin reactions, reproducible skin reactions indicating an allergic response were found in a few animals for four test substances. Based on the GPMT results, only undecylenic acid would have to be classified and labelled as a skin sensitizer according to the European Dangerous Substance Directive (67/548/EEC) (results for linoleic acid were inconclusive), while the other seven test substances would not require labelling. Possible mechanisms for unspecific skin cell stimulation and lymph node responses are discussed. In conclusion, the suitability of the LLNA for unsaturated compounds bearing structural similarity to the tested substances should be carefully considered and the GPMT should remain available as an accepted test method for skin sensitization hazard identification.

  12. Metabolomic Response to Huanglongbing: Role of Carboxylic Compounds in Citrus sinensis Response to 'Candidatus Liberibacter asiaticus' and Its Vector, Diaphorina citri.

    PubMed

    Killiny, Nabil; Nehela, Yasser

    2017-08-01

    Huanglongbing, a destructive disease of citrus, is caused by the fastidious bacterium 'Candidatus Liberibacter asiaticus' and transmitted by Asian citrus psyllid, Diaphorina citri. The impact of 'Ca. L. asiaticus' infection or D. citri infestation on Valencia sweet orange (Citrus sinensis) leaf metabolites was investigated using gas chromatography mass spectrometry, followed by gene expression analysis for 37 genes involved in jasmonic acid (JA), salicylic acid (SA), and proline-glutamine pathways. The total amino acid abundance increased after 'Ca. L. asiaticus' infection, while the total fatty acids increased dramatically after infestation with D. citri, compared with control plants. Seven amino acids (glycine, l-isoleucine, l-phenylalanine, l-proline, l-serine, l-threonine, and l-tryptophan) and five organic acids (benzoic acid, citric acid, fumaric acid, SA, and succinic acid) increased in 'Ca. L. asiaticus'-infected plants. On the other hand, the abundance of trans-JA and its precursor α-linolenic increased in D. citri-infested plants. Surprisingly, the double attack of both D. citri infestation and 'Ca. L. asiaticus' infection moderated the metabolic changes in all chemical classes studied. In addition, the gene expression analysis supported these results. Based on these findings, we suggest that, although amino acids such as phenylalanine are involved in citrus defense against 'Ca. L. asiaticus' infection through the activation of an SA-mediated pathway, fatty acids, especially α-linolenic acid, are involved in defense against D. citri infestation via the induction of a JA-mediated pathway.

  13. In vitro assessment of potential intestinal absorption of some phenolic families and carboxylic acids from commercial instant coffee samples.

    PubMed

    López-Froilán, R; Ramírez-Moreno, E; Podio, N S; Pérez-Rodríguez, M L; Cámara, M; Baroni, M V; Wunderlin, D A; Sánchez-Mata, M C

    2016-06-15

    Coffee is one of the most consumed beverages in the world, being a source of bioactive compounds as well as flavors. Hydroxycinnamic acids, flavonols, and carboxylic acids have been studied in the samples of instant coffee commercialized in Spain. The studies about contents of food components should be complemented with either in vitro or in vivo bioaccessibility studies to know the amount of food components effectively available for functions in the human body. In this sense, a widely used in vitro model has been applied to assess the potential intestinal absorption of phenolic compounds and organic acids. The contents of hydroxycinnamic acids and flavonols were higher in instant regular coffee samples than in the decaffeinated ones. Bioaccessible phenolic compounds in most analyzed samples account for 20-25% of hydroxycinnamic acids and 17-26% of flavonols. This could mean that a great part of them can remain in the gut, acting as potential in situ antioxidants. Quinic, acetic, pyroglutamic, citric and fumaric acids were identified in commercial instant coffee samples. Succinic acid was found in the coffee blend containing chicory. All carboxylic acids showed a very high bioaccessibility. Particularly, acetic acid and quinic acid were found in higher contents in the samples treated with the in vitro simulation of gastrointestinal processes, compared to the original ones, which can be explained by their cleavage from chlorogenic acid during digestion. This is considered as a positive effect, since quinic acid is considered as an antioxidant inducer.

  14. Vitamin D3 supplementation increases spine bone mineral density in adolescents and young adults with HIV infection being treated with tenofovir disoproxil fumarate: a randomized, placebo controlled trial

    USDA-ARS?s Scientific Manuscript database

    Background: Tenofovir disoproxil fumarate (TDF) decreases bone mineral density (BMD). We hypothesized vitamin D3 (VITD3) would increase BMD in adolescents/young adults receiving TDF. Methods: Randomized double-blind placebo-controlled trial of directly observed VITD3 50,000 IU vs. placebo every 4 ...

  15. Role of dimethyl fumarate in oxidative stress of multiple sclerosis: A review.

    PubMed

    Suneetha, A; Raja Rajeswari, K

    2016-04-15

    Multiple sclerosis (MS) is a chronic inflammatory disease of the CNS affecting both white and grey matter. Inflammation and oxidative stress are also thought to promote tissue damage in multiple sclerosis. Recent data point at an important role of anti-oxidative pathways for tissue protection in chronic MS, particularly involving the transcription factor nuclear factor (erythroid-derived 2)-related factor 2 (Nrf2). Thus, novel therapeutics enhancing cellular resistance to free radicals could prove useful for MS treatment. Oxidative stress and anti-oxidative pathways are important players in MS pathophysiology and constitute a promising target for future MS therapy with dimethyl fumarate. The clinical utility of DMF in multiple sclerosis is being explored through phase III trials with BG-12, which is an oral therapeutic agent. Currently a wide research is going on to find out the exact mechanism of DMF, till date it is not clear. Based on strong signals of nephrotoxicity in non-humans and the theoretical risk of renal cell cancer from intracellular accumulation of fumarate, post-marketing study of a large population of patients will be necessary to fully assess the long-term safety of dimethyl fumarate. The current treatment goals are to shorten the duration and severity of relapses, prolong the time between relapses, and delay progression of disability. In this regard, dimethyl fumarate offers a promising alternative to orally administered fingolimod (GILENYA) or teriflunomide (AUBAGIO), which are currently marketed in the United States under FDA-mandated Risk Evaluation and Mitigation Strategy (REMS) programs because of serious safety concerns. More clinical experience with all three agents will be necessary to differentiate the tolerability of long-term therapy for patients diagnosed with multiple sclerosis. This write-up provides the detailed information of dimethyl fumarate in treating the neuro disease, multiple sclerosis and its mechanism involved via oxidative stress pathway. The rapid screening methods are also need to be developed to estimate DMF in biological samples to perform and proceed for further investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. High abundances of water-soluble dicarboxylic acids, ketocarboxylic acids and α-dicarbonyls in the mountain aerosols over the North China Plain during wheat burning season

    NASA Astrophysics Data System (ADS)

    Kawamura, K.; Tachibana, E.; Okuzawa, K.; Aggarwal, S. G.; Kanaya, Y.; Wang, Z. F.

    2013-02-01

    Aerosol (TSP) samples were collected at the summit of Mount Tai (elevation: 1534 m a.s.l., 36.25° N; 117.10° E) located in the North China Plain using a high-volume air sampler and pre-combusted quartz filters. Sampling was conducted on day/night or 3 h basis in the period from 29 May to 28 June 2006 during the field burning of wheat straw residue and the post-burning season. The filter samples were analyzed for low molecular weight dicarboxylic acids, ketoacids and α-dicarbonyls using capillary gas chromatography (GC) and GC-MS employing water extraction and butyl ester derivatization. Dicarboxylic acids (C2-C11, 220-6070 ng m-3) were characterized by a predominance of oxalic (C2) acid (105-3920 ng m-3) followed by succinic (C4) or malonic (C3) acid. Unsaturated aliphatic diacids, including maleic (M), isomaleic (iM) and fumaric (F) acid, were also detected together with aromatic diacids (phthalic, iso-phthalic and tere-phthalic acids). ω-Oxocarboxylic acids (C2-C9, 24-610 ng m-3) were detected as the second most abundant compound class with the predominance of glyoxylic acid (11-360 ng m-3), followed by α-ketoacid (pyruvic acid, 3-140 ng m-3) and α-dicarbonyls (glyoxal, 1-230 ng m-3 and methylglyoxal, 2-120 ng m-3). We found that these levels (> 6000 ng m-3 for diacids) are several times higher than those reported in Chinese megacities at ground levels. The concentrations of diacids increased from late May to early June showing a maximum on 7 June and then significantly decreased during 8-11 June when the wind direction shifted from northeasterly to northerly. Similar temporal trends were found for ketocarboxylic acids and α-dicarbonyls as well as total carbon (TC) and water-soluble organic carbon (WSOC). The temporal variations of water-soluble organics were interpreted by the direct emission from the field burning products of agricultural wastes (wheat straw) in the North China Plain and the subsequent photochemical oxidation of volatile and semi-volatile organic precursors emitted from field burning. This study demonstrates that the field burning of agricultural wastes in early summer strongly influenced the air quality of the free troposphere over the North China Plain.

  17. Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle

    PubMed Central

    Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro

    2017-01-01

    Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886

  18. Improved Understanding of Microbial Iron and Sulfate Reduction Through a Combination of Bottom-up and Top-down Functional Proteomics Assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richardson, Ruth

    Our overall goal was to improve the understanding of microbial iron and sulfate reduction by evaluating a diverse iron and sulfate reducing organisms utilizing a multi-omics approach combining “top-down” and “bottom-up” omics methodologies. We initiated one of the first combined comparative genomics, shotgun proteomics, RTqPCR, and heterologous expression studies in pursuit of our project objectives. Within the first year of this project, we created a new bioinformatics tool for ortholog identification (“SPOCS”). SPOCS is described in our publication, Curtis et al., 2013. Using this tool we were able to identify conserved orthologous groups across diverse iron and sulfate reducing microorganismsmore » from Firmicutes, gamma-proteobacteria and delta-proteobacteria. For six iron and sulfate reducers we also performed shotgun proteomics (“bottom-up” proteomics including accurate mass and time (AMT) tag and iTRAQ approaches). Cultures include Gram (-) and Gram (+) microbes. Gram (-) were: Geobacter sulfureducens (grown on iron citrate and fumarate), Geobacter bemidjiensis (grown on iron citrate and fumarate), Shewanella oneidiensis (grown on iron citrate and fumarate) and Anaeromyxobacter dehalogenans (grown on iron citrate and fumarate). Although all cultures grew on insoluble iron, the iron precipitates interfered with protein extraction and analysis; which remains a major challenge for researchers in disparate study systems. Among the Gram (-) organisms studied, Anaeromyxobacter dehalogenans remains the most poorly characterized. Yet, it is arguably the most versatile organisms we studied. In this work we have used comparative proteomics to hypothesize which two of the dozens of predicted c-type cytochromes within Anaeromyxobacter dehalogenans may be directly involved in soluble iron reduction. Unfortunately, heterologous expression of these Anaeromyxobacter dehalogenans ctype cytochromes led to poor protein production and/or formation of inclusion bodies, even when we co-expressed several genes known to be important for assembly of cytochrome holoenzymes. We confirmed the proteomics trends at the RNA level by designing specific primer sets for hypothesized iron reductases in Anaeromyxobacter dehalogenans, and performed Reverse Transcription-qPCR. AD_0127 was 20 fold upregulated only on iron citrate conditions. AD_0127 is described as a hypothetical protein, but Pfam predicts it to be C554 type cytochrome having a possible role in nitrification (Wang et al., in preparation).« less

  19. Cost-Effectiveness of Treatments for Relapsing Remitting Multiple Sclerosis: A French Societal Perspective.

    PubMed

    Chevalier, Julie; Chamoux, Catherine; Hammès, Florence; Chicoye, Annie

    2016-01-01

    The paper aimed to estimate the incremental cost-effectiveness ratio (ICER) at the public published price for delayed-release dimethyl fumarate versus relevant Multiple Sclerosis disease-modifying therapies available in France in June 2015. The economic model was adapted to the French setting in accordance with the Haute Autorité de Santé guidelines using a model previously developed for NICE. A cohort of Relapsing Remitting Multiple Sclerosis patients was simulated over a 30-year time horizon. Twenty one health states were taken into account: Kurtzke Expanded Disability Status Scale (EDSS) 0-9 for Relapsing Remitting Multiple Sclerosis patients, EDSS 0-9 for Secondary Progressive Multiple Sclerosis patients, and death. Estimates of relative treatment efficacy were determined using a mixed-treatment comparison. Probabilities of events were derived from the dimethyl fumarate pivotal clinical trials and the London Ontario Dataset. Costs and utilities were extracted from the published literature from both the payer and societal perspectives. Univariate and probabilistic sensitivity analyses were performed to assess the robustness of the model results. From both perspectives, dimethyl fumarate and interferon beta-1a (IFN beta-1a) 44 mcg were the two optimal treatments, as the other treatments (IFN beta-1a 30 mcg, IFN beta-1b 250 mcg, teriflunomide, glatiramer acetate, fingolimod) were dominated on the efficiency frontier. From the societal perspective, dimethyl fumarate versus IFN beta-1a 44 mcg incurred an incremental cost of €3,684 and an incremental quality-adjusted life year (QALY) of 0.281, corresponding to an ICER of €13,110/QALY. Despite no reference threshold for France, dimethyl fumarate can be considered as a cost-effective option as it is on the efficiency frontier.

  20. Anaerobic respiration of Escherichia coli in the mouse intestine.

    PubMed

    Jones, Shari A; Gibson, Terri; Maltby, Rosalie C; Chowdhury, Fatema Z; Stewart, Valley; Cohen, Paul S; Conway, Tyrrell

    2011-10-01

    The intestine is inhabited by a large microbial community consisting primarily of anaerobes and, to a lesser extent, facultative anaerobes, such as Escherichia coli, which we have shown requires aerobic respiration to compete successfully in the mouse intestine (S. A. Jones et al., Infect. Immun. 75:4891-4899, 2007). If facultative anaerobes efficiently lower oxygen availability in the intestine, then their sustained growth must also depend on anaerobic metabolism. In support of this idea, mutants lacking nitrate reductase or fumarate reductase have extreme colonization defects. Here, we further explore the role of anaerobic respiration in colonization using the streptomycin-treated mouse model. We found that respiratory electron flow is primarily via the naphthoquinones, which pass electrons to cytochrome bd oxidase and the anaerobic terminal reductases. We found that E. coli uses nitrate and fumarate in the intestine, but not nitrite, dimethyl sulfoxide, or trimethylamine N-oxide. Competitive colonizations revealed that cytochrome bd oxidase is more advantageous than nitrate reductase or fumarate reductase. Strains lacking nitrate reductase outcompeted fumarate reductase mutants once the nitrate concentration in cecal mucus reached submillimolar levels, indicating that fumarate is the more important anaerobic electron acceptor in the intestine because nitrate is limiting. Since nitrate is highest in the absence of E. coli, we conclude that E. coli is the only bacterium in the streptomycin-treated mouse large intestine that respires nitrate. Lastly, we demonstrated that a mutant lacking the NarXL regulator (activator of the NarG system), but not a mutant lacking the NarP-NarQ regulator, has a colonization defect, consistent with the advantage provided by NarG. The emerging picture is one in which gene regulation is tuned to balance expression of the terminal reductases that E. coli uses to maximize its competitiveness and achieve the highest possible population in the intestine.

  1. Respiration-linked proton translocation coupled to anaerobic reduction of manganese(IV) and iron(III) in Shewanella putrefaciens MR-1.

    PubMed Central

    Myers, C R; Nealson, K H

    1990-01-01

    An oxidant pulse technique, with lactate as the electron donor, was used to study respiration-linked proton translocation in the manganese- and iron-reducing bacterium Shewanella putrefaciens MR-1. Cells grown anaerobically with fumarate or nitrate as the electron acceptor translocated protons in response to manganese (IV), fumarate, or oxygen. Cells grown anaerobically with fumarate also translocated protons in response to iron(III) and thiosulfate, whereas those grown with nitrate did not. Aerobically grown cells translocated protons only in response to oxygen. Proton translocation with all electron acceptors was abolished in the presence of the protonophore carbonyl cyanide m-chlorophenylhydrazone (20 microM) and was partially to completely inhibited by the electron transport inhibitor 2-n-heptyl-4-hydroxyquinoline N-oxide (50 microM). PMID:2172208

  2. Crystallization of mitochondrial rhodoquinol-fumarate reductase from the parasitic nematode Ascaris suum with the specific inhibitor flutolanil

    PubMed Central

    Osanai, Arihiro; Harada, Shigeharu; Sakamoto, Kimitoshi; Shimizu, Hironari; Inaoka, Daniel Ken; Kita, Kiyoshi

    2009-01-01

    In adult Ascaris suum (roundworm) mitochondrial membrane-bound complex II acts as a rhodoquinol-fumarate reductase, which is the reverse reaction to that of mammalian complex II (succinate-ubiquinone reductase). The adult A. suum rhodoquinol-fumarate reductase was crystallized in the presence of octaethyleneglycol monododecyl ether and n-dodecyl-β-d-maltopyranoside in a 3:2 weight ratio. The crystals belonged to the orthorhombic space group P212121, with unit-cell parameters a = 123.75, b = 129.08, c = 221.12 Å, and diffracted to 2.8 Å resolution using synchrotron radiation. The presence of two molecules in the asymmetric unit (120 kDa × 2) gives a crystal volume per protein mass (V M) of 3.6 Å3 Da−1. PMID:19724139

  3. Effect of different iron compounds on rheological and technological parameters as well as bioaccessibility of minerals in whole wheat bread.

    PubMed

    Rebellato, Ana Paula; Bussi, Jéssica; Silva, Joyce Grazielle Siqueira; Greiner, Ralf; Steel, Caroline Joy; Pallone, Juliana Azevedo Lima

    2017-04-01

    This study aimed at investigating the effect of iron compounds used in whole wheat flour (WWF) fortification, both on rheological properties of the dough and on bread technological quality. Furthermore, bioaccessibility of iron (Fe), zinc (Zn) and calcium (Ca) in the final breads was determined. Rheological properties (mainly dough development time, stability, mixing tolerance index, resistance to extension and ratio number) of the dough and the technological quality of bread (mainly oven spring and cut opening) were altered. However, producing roll breads fortified with different iron compounds was still possible. NaFeEDTA (ferric sodium ethylene diamine tetra acetic acid) proved to be the most effective iron compound in the fortification of WWF, since it presented the highest levels of solubility (44.80%) and dialysability (46.14%), followed by microencapsulated ferrous fumarate (FFm). On the other hand, the microencapsulated ferrous sulfate (FSm) and reduced iron presented the lowest solubility (5.40 and 18.30%, respectively) and dialysability (33.12 and 31.79%, respectively). Zn dialysis was positively influenced by NaFeEDTA, FSm, and ferrous fumarate. As for Ca, dialysis was positively influenced by FSm and negatively influenced by FFm. The data indicated that there is a competitive interaction for the absorption of these minerals in whole wheat roll breads, but all studied minerals can be considered bioaccessible. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  5. Desulfovibrio zosterae sp. nov., a new sulfate reducer isolated from surface-sterilized roots of the seagrass Zostera marina.

    PubMed

    Nielsen, J T; Liesack, W; Finster, K

    1999-04-01

    A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.

  6. A Validated Stability Indicating RP-HPLC Method for the Determination of Emtricitabine, Tenofovir Disoproxil Fumarate, Elvitegravir and Cobicistat in Pharmaceutical Dosage Form

    PubMed Central

    Runja, Chinnalalaiah; Ravi Kumar, Pigili; Avanapu, Srinivasa Rao

    2016-01-01

    A new simple, rapid stability indicating assay method has been developed and validated for the determination of emtricitabine, tenofovir disoproxil fumarate, elvitegravir and cobicistat using reverse-phase high-performance liquid chromatography in their pharmaceutical dosage form. The chromatographic separation was performed on an ODS column (250 × 4.6 mm, 5 µm) using mobile phase A (potassium dihydrogen orthophosphate, pH adjusted to 2.5) and mobile phase B (acetonitrile) in the ratio of 55:45% v/v at a flow rate of 1 mL/min. The analytes were detected at 250 nm. The method was found to be linear in the concentration range of 2–12 µg/mL for EMT, 3–18 µg/mL for TNDF, 1.5–9 µg/mL for ELV and COB, with the coefficient value (R2) of >0.9990. The accuracy was measured via recovery studies and found to be acceptable, and the percentage recoveries were found in the range of 99.93–100.08 ± 0.5%. Forced degradation studies were also conducted, and the drugs were subjected to various stress conditions such as acid hydrolysis, base hydrolysis, oxidative, photolytic and thermal degradation. The proposed method was successfully validated and applied for the quantitative estimation of these drugs in both bulk and tablet dosage forms. PMID:26865655

  7. Monitoring of the fermentation media of citric acid by the trimethylsilyl derivatives of the organic acids formed.

    PubMed

    Ghassempour, Alireza; Nojavan, Saeed; Talebpour, Zahra; Amiri, Ali Asghar; Najafi, Nahid Mashkouri

    2004-10-20

    In this approach, a derivatization method is described for monitoring of organic acids in fermentation media without any separation step. The aqueous phase of fermentation media was evaporated and heated in a silylation reagent to form trimethylsilyl (TMS) derivatives. The silylated compounds are analyzed by 29Si nuclear magnetic resonance (29Si NMR) and gas chromatography-mass spectrometry (GC-MS). 29Si NMR can qualitatively monitor the components produced in the Krebs cycle. Quantification of these compounds is investigated by using selected ion monitoring mode of mass spectrometry. In this mode, mass to charge (m/z) values of their [M - 15]+ ions, which are 465, 275, 247, 221, 335, 251, and 313 of TMS derivatives of citric, alpha-ketoglutaric, succinic, fumaric, l-malic, oxaloacetic, and palmitic (as an internal standard), acids, respectively, are used. The limit of detection and the linear working range for derivatized citric acid were found to be 0.1 mg L(-1) and 10-3 x 10(4) mg L(-1). The relative standard deviation of the method for five replicates was 2.1%. The average recovery efficiency for citric acid added to culture media was approximately 97.2%. Quantitative results of GC-MS are compared with those obtained by an ultraviolet-visible method. Copyright 2004 American Chemical Society

  8. Cutaneous and uterine leiomyomatosis and ovarian cystadenoma associated with deficiency of fumarate hydratase

    PubMed Central

    Hüller, Cornelia; Grunow, Norbert; Nadler, Torsten; Bär, Michael

    2011-01-01

    We report on an exceedingly rare case of cutaneous and uterine leiomyomatosis in a 58-year-old Caucasian woman associated with ovarian cystadenoma and complete deletion of the fumarate hydratase gene. All patients and their family members with verified mutation have to be regularly screened for associated neoplasms, in particular papillary renal cell carcinoma (HLRCC, hereditary leiomyomatosis and renal cell cancer). PMID:24396716

  9. In vitro and in vivo evaluation of ketotifen fumarate-loaded silicone hydrogel contact lenses for ocular drug delivery.

    PubMed

    Xu, Jinku; Li, Xinsong; Sun, Fuqian

    2011-02-01

    The purpose of this work was to evaluate the usefulness of silicone hydrogel contact lenses loaded with ketotifen fumarate for ocular drug delivery. First, silicone contact lenses were prepared by photopolymerization of bitelechelic methacrylated polydimethylsiloxanes macromonomer, 3-methacryloxypropyltris(trimethylsiloxy)silane, and N,N-dimethylacrylamide using ethylene glycol dimethacrylate as a cross-linker and Darocur 1173 as an initiator followed by surface plasma treatment. Then, the silicone hydrogel matrices of the contact lenses were characterized by equilibrium swelling ratio (ESR), tensile tests, ion permeability, and surface contact angle. Finally, the contact lenses were loaded with ketotifen fumarate by pre-soaking in drug solution to evaluate drug loading capacity, in vitro and in vivo release behavior of the silicone contact lenses. The results showed that ESR and ion permeability increase, and the surface contact angle and tensile strength decreased with the increase of DMA component in the silicone hydrogel. The drug loading and in vitro releases were dependent on the hydrogel composition of hydrophilic/hydrophobic phase of the contact lenses. In rabbit eyes, the pre-soaked contact lenses sustained ketotifen fumarate release for more than 24 h, which leads to a more stable drug concentration and a longer mean retention time in tear fluid than that of eye drops of 0.05%.

  10. Pharmacokinetics of Dolutegravir When Administered With Mineral Supplements in Healthy Adult Subjects

    PubMed Central

    Song, Ivy; Borland, Julie; Arya, Niki; Wynne, Brian; Piscitelli, Stephen

    2015-01-01

    All commercially available integrase inhibitors are 2-metal binders and may be affected by co-administration with metal cations. The purpose of this study was to evaluate the effect of calcium and iron supplements on dolutegravir pharmacokinetics and strategies (dose separation and food) to attenuate the effects if significant reductions in dolutegravir exposure were observed. This was an open-label, crossover study that randomized 24 healthy subjects into 1 of 2 cohorts to receive 4 treatments: (1) dolutegravir alone, fasting; (2) dolutegravir with calcium carbonate or ferrous fumarate, fasting; (3) dolutegravir with calcium carbonate or ferrous fumarate with a moderate-fat meal; (4) dolutegravir administered 2 hours before calcium carbonate or ferrous fumarate, fasting. Plasma dolutegravir AUC(0–∞), Cmax, and C24 were reduced by 39%, 37%, and 39%, respectively, when co-administered with calcium carbonate while fasting and were reduced by 54%, 57%, and 56%, respectively, when co-administered with ferrous fumarate while fasting. Dolutegravir administration 2 hours before calcium or iron supplement administration (fasted), as well as administration with a meal, counteracted the effect. Dolutegravir and calcium or iron supplements can be co-administered if taken with a meal. Under fasted conditions, dolutegravir should be administered 2 hours before or 6 hours after calcium or iron supplements. PMID:25449994

  11. Content of selected elements and low-molecular-weight organic acids in fruiting bodies of edible mushroom Boletus badius (Fr.) Fr. from unpolluted and polluted areas.

    PubMed

    Mleczek, Mirosław; Magdziak, Zuzanna; Gąsecka, Monika; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Zalicka, Sylwia; Sobieralski, Krzysztof

    2016-10-01

    The aim of the study was to (i) investigate the potential of edible mushroom Boletus badius (Fr.) Fr. to accumulate 53 elements from unpolluted acidic sandy soil and polluted alkaline flotation tailing sites in Poland, (ii) to estimate the low-molecular-weight organic acid (LMWOA) profile and contents in fruit bodies, and finally (iii) to explore the possible relationship between elements and LMWOA content in mushrooms. The content of most elements in fruiting bodies collected from the flotation tailings was significantly higher than in mushrooms from the unpolluted soils. The occurrence of elements determined in fruiting bodies of B. badius has been varied (from 0.01 mg kg -1 for Eu, Lu, and Te up to 18,932 mg kg -1 for K). The results established the high importance of element contents in substrate. Among ten organic acids, nine have been found in wide range: from below 0.01 mg kg -1 for fumaric acid to 14.8 mg g -1 for lactic acid. Lactic and succinic acids were dominant in both areas, and citric acid was also in high content in polluted area. The correlation between element contents and the individual and total content of LMWOAs was confirmed.

  12. Study of structural, surface and hydrogen storage properties of boric acid mediated metal (sodium)-organic frameworks

    NASA Astrophysics Data System (ADS)

    Ozer, Demet; Köse, Dursun A.; Sahin, Onur; Oztas, Nursen A.

    2018-04-01

    Three boric acid mediated metal organic frameworks were synthesized by solution method with using succinic acid, fumaric acid and acetylene dicarboxylic acid as a ligand source and sodium as a metal source. The complexes were characterized by FT-IR, powder XRD, elemental analyses and single crystal measurements. The complexes with the formula, C4H18B2Na2O14, C4H16B2Na2O14 and C4H14B2Na2O14 were successfully obtained. BET surface area of complexes were calculated and found as 13.474 m2/g for catena-(tetrakis(μ2-hydroxo)-(μ2-trihydrogen borate)-(μ2-succinato)-di-sodium boric acid solvate), 1.692 m2/g for catena-(tetrakis(μ2-hydroxo)-(μ2-trihydrogen borate)-(μ2-fumarato)-di-sodium boric acid solvate) and 5.600 m2/g for catena-(tetrakis(μ2-hydroxo)-(μ2-trihydrogen borate)-(μ2-acetylenedicarboxylato)-di-sodium boric acid solvate). Hydrogen storage capacities of the complexes were also studied at 77 K 1 bar pressure and found as 0.108%, 0.033%, 0.021% by mass. When different ligands were used, the pore volume, pore width and surface area of the obtained complexes were changed. As a consequence, hydrogen storage capacities also changed.

  13. Succinyl-CoA:(R)-Benzylsuccinate CoA-Transferase: an Enzyme of the Anaerobic Toluene Catabolic Pathway in Denitrifying Bacteria†

    PubMed Central

    Leutwein, Christina; Heider, Johann

    2001-01-01

    Anaerobic microbial toluene catabolism is initiated by addition of fumarate to the methyl group of toluene, yielding (R)-benzylsuccinate as first intermediate, which is further metabolized via β-oxidation to benzoyl-coenzyme A (CoA) and succinyl-CoA. A specific succinyl-CoA:(R)-benzylsuccinate CoA-transferase activating (R)-benzylsuccinate to the CoA-thioester was purified and characterized from Thauera aromatica. The enzyme is fully reversible and forms exclusively the 2-(R)-benzylsuccinyl-CoA isomer. Only some close chemical analogs of the substrates are accepted by the enzyme: succinate was partially replaced by maleate or methylsuccinate, and (R)-benzylsuccinate was replaced by methylsuccinate, benzylmalonate, or phenylsuccinate. In contrast to all other known CoA-transferases, the enzyme consists of two subunits of similar amino acid sequences and similar sizes (44 and 45 kDa) in an α2β2 conformation. Identity of the subunits with the products of the previously identified toluene-induced bbsEF genes was confirmed by determination of the exact masses via electrospray-mass spectrometry. The deduced amino acid sequences resemble those of only two other characterized CoA-transferases, oxalyl-CoA:formate CoA-transferase and (E)-cinnamoyl-CoA:(R)-phenyllactate CoA-transferase, which represent a new family of CoA-transferases. As suggested by kinetic analysis, the reaction mechanism of enzymes of this family apparently involves formation of a ternary complex between the enzyme and the two substrates. PMID:11418570

  14. Decline in bone mass with tenofovir disoproxil fumarate/emtricitabine is associated with hormonal changes in the absence of renal impairment when used by HIV uninfected adolescent boys and young men for HIV pre-exposure

    USDA-ARS?s Scientific Manuscript database

    Background. We aimed to define the relative importance of renal and endocrine changes in tenofovir disoproxil fumarate (TDF)-related bone toxicity. Methods. In a study of daily TDF/emtricitabine (FTC) pre-exposure prophylaxis (PrEP) in HIV uninfected young men who have sex with men, we measured ch...

  15. S3 Guideline for the treatment of psoriasis vulgaris, update - Short version part 1 - Systemic treatment.

    PubMed

    Nast, Alexander; Amelunxen, Lasse; Augustin, Matthias; Boehncke, Wolf-Henning; Dressler, Corinna; Gaskins, Matthew; Härle, Peter; Hoffstadt, Bernd; Klaus, Joachim; Koza, Joachim; Mrowietz, Ulrich; Ockenfels, Hans-Michael; Philipp, Sandra; Reich, Kristian; Rosenbach, Thomas; Rzany, Berthold; Schlaeger, Martin; Schmid-Ott, Gerhard; Sebastian, Michael; von Kiedrowski, Ralph; Weberschock, Tobias

    2018-05-01

    The German guideline for the treatment of psoriasis vulgaris was updated using GRADE methodology. The guideline is based on a systematic literature review completed on December 1, 2016, and on a formal consensus and approval process. The first section of this short version of the guideline covers systemic treatment options considered relevant by the expert panel and approved in Germany at the time of the consensus conference (acitretin, adalimumab, apremilast, cyclosporine, etanercept, fumaric acid esters, infliximab, methotrexate, secukinumab and ustekinumab). Detailed information is provided on the management and monitoring of the included treatment options. © 2018 The Authors | Journal compilation © Blackwell Verlag GmbH, Berlin.

  16. Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.

    PubMed

    Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal

    2005-01-01

    Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.

  17. Effects of Lactobacilli and lactose on Salmonella typhimurium colonisation and microbial fermentation in the crop of the young turkey.

    PubMed

    Cutler, S A; Rasmussen, M A; Hensley, M J; Wilhelms, K W; Griffith, R W; Scanes, C G

    2005-12-01

    1. Three experiments were performed to examine the effects of Lactobacilli and lactose on microbial fermentation and Salmonella enterica serovar Typhimurium colonisation in the crop of the young turkey. 2. The following carboxylic acids were detected in the crop ingesta: formic, acetic, butyric, lactic, valeric, caproic, oxalic, phenyl acetic, succinic and fumaric; propionic, isobutyric and isovaleric acids were not detectable. 3. At the beginning of the night, there were considerable quantities of ingesta in the crop of young turkeys. During the scotophase, there were progressive reductions in the contents and pH. Moreover, there were linear increases in the concentration of lactic, valeric and caproic acids (by approximately 7-fold over 8 h). Much smaller changes in crop pH were observed in the study where dietary treatments of Lactobacilli were not included. 4. Chronic addition of lactose or Lactobacilli to the diet exerted modest effects on the carboxylic acid concentration in the crop contents but did not consistently influence colonisation of the crop by Salmonella enterica serovar Typhimurium. 5. Young turkeys confine eating to the hours of illumination (photophase) with a peak in consumption prior to the subjective dusk.

  18. Fumarate decreases edema volume and improves functional outcome after experimental stroke.

    PubMed

    Clausen, Bettina Hjelm; Lundberg, Louise; Yli-Karjanmaa, Minna; Martin, Nellie Anne; Svensson, Martina; Alfsen, Maria Zeiler; Flæng, Simon Bertram; Lyngsø, Kristina; Boza-Serrano, Antonio; Nielsen, Helle H; Hansen, Pernille B; Finsen, Bente; Deierborg, Tomas; Illes, Zsolt; Lambertsen, Kate Lykke

    2017-09-01

    Oxidative stress and inflammation exacerbate tissue damage in the brain after ischemic stroke. Dimethyl-fumarate (DMF) and its metabolite monomethyl-fumarate (MMF) are known to stimulate anti-oxidant pathways and modulate inflammatory responses. Considering these dual effects of fumarates, we examined the effect of MMF treatment after ischemic stroke in mice. Permanent middle cerebral artery occlusion (pMCAO) was performed using adult, male C57BL/6 mice. Thirty minutes after pMCAO, 20mg/kg MMF was administered intravenously. Outcomes were evaluated 6, 24 and 48h after pMCAO. First, we examined whether a bolus of MMF was capable of changing expression of kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1) and nuclear factor erythroid 2-related factor (Nrf)2 in the infarcted brain. Next, we studied the effect of MMF on functional recovery. To explore mechanisms potentially influencing functional changes, we examined infarct volumes, edema formation, the expression of heat shock protein (Hsp)72, hydroxycarboxylic acid receptor 2 (Hcar2), and inducible nitric oxide synthase (iNOS) in the infarcted brain using real-time PCR and Western blotting. Concentrations of a panel of pro- and anti-inflammatory cytokines (IFNγ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p70, TNF) were examined in both the infarcted brain tissue and plasma samples 6, 24 and 48h after pMCAO using multiplex electrochemoluminiscence analysis. Administration of MMF increased the protein level of Nrf2 6h after pMCAO, and improved functional outcome at 24 and 48h after pMCAO. MMF treatment did not influence infarct size, however reduced edema volume at both 24 and 48h after pMCAO. MMF treatment resulted in increased Hsp72 expression in the brain 6h after pMCAO. Hcar2 mRNA levels increased significantly 24h after pMCAO, but were not different between saline- and MMF-treated mice. MMF treatment also increased the level of the anti-inflammatory cytokine IL-10 in the brain and plasma 6h after pMCAO, and additionally reduced the level of the pro-inflammatory cytokine IL-12p70 in the brain at 24 and 48h after pMCAO. A single intravenous bolus of MMF improved sensory-motor function after ischemic stroke, reduced edema formation, and increased the levels of the neuroprotective protein Hsp72 in the brain. The early increase in IL-10 and reduction in IL-12p70 in the brain combined with changes in systemic cytokine levels may also contribute to the functional recovery after pMCAO. Copyright © 2017. Published by Elsevier Inc.

  19. Colonization on Cucumber Root and Enhancement of Chlorimuron-ethyl Degradation in the Rhizosphere by Hansschlegelia zhihuaiae S113 and Root Exudates.

    PubMed

    Zhang, Hao; Chen, Feng; Zhao, Hua-Zhu; Lu, Jia-Sen; Zhao, Meng-Jun; Hong, Qing; Huang, Xing

    2018-05-09

    The colonization of Hansschlegelia zhihuaiae S113 and its degradation of the herbicide chlorimuron-ethyl in the cucumber rhizosphere was investigated. The results reveal that S113 colonized the cucumber roots (2.14 × 10 5 cells per gram of roots) and were able to survive in the rhizosphere (maintained for 20 d). The root exudates promoted colonization on roots and increased the degradation of chlorimuron-ethyl by S113. Five organic acids in cucumber-root exudates were detected and identified by HPLC. Citric acid and fumaric acid significantly stimulated S113 colonization on cucumber roots, with 18.4 and 15.5% increases, respectively, compared with the control. After irrigation with an S113 solution for 10 days, chlorimuron-ethyl could not be detected in the roots, seedlings, or rhizosphere soil, which allowed for improved cucumber growth. Therefore, the degradation mechanism of chlorimuron-ethyl residues by S113 in the rhizosphere could be applied in situ for the bioremediation of chlorimuron-ethyl contaminated soil to ensure crop safety.

  20. Pharmacokinetics and food interaction of a novel prodrug of tenofovir, tenofovir dipivoxil fumarate, in healthy volunteers.

    PubMed

    Lu, C; Jia, Y; Chen, L; Ding, Y; Yang, J; Chen, M; Song, Y; Sun, X; Wen, A

    2013-04-01

    Tenofovir dipivoxil fumarate is a novel ester prodrug of tenofovir, a specific anti-hepatitis B virus (HBV) drug candidate. The pharmacokinetic properties and the effects of food intake on tenofovir dipivoxil have not yet been reported in healthy adults. The aim of this study was to evaluate the pharmacokinetic properties and food interaction of tenofovir dipivoxil in healthy Chinese volunteers. Pharmacokinetic studies included an ascending single dose of 150, 300, 600 mg and multiple doses of 300 mg. Food interaction was evaluated following a single oral dose of tenofovir dipivoxil fumarate 300 mg administered with a high-fat and high-energy standard breakfast or after a 12-h fast. Pharmacokinetic parameters of tenofovir given in each treatment period were calculated using non-compartmental analysis. After a single dose of 150, 300 and 600 mg, the main pharmacokinetic parameters for tenofovir were as follows: Cmax 209·6, 456·7, 989·8 ng/mL; AUClast 1744·9, 2663·5, 6010·2 ng h/mL, respectively. After multiple doses of 300 mg, the main pharmacokinetic parameters for tenofovir were Cmax 523·4 ng/mL, AUClast 4152·4 ng h/mL. After a single dose of 300 mg with a high-fat and high-energy standard breakfast, the main pharmacokinetic parameters for tenofovir were Cmax 448·5 ng/mL, AUClast 3286·8 ng h/mL. The plasma Cmax and AUC of tenofovir showed significance difference between a single dose of 300 mg and the accordingly multiple doses (P < 0·05). A standard high-fat meal enhanced mean AUClast values of tenofovir (relative AUClast  = 125·8%; 90% CI 114·5, 136·2); however, food did not show any significant on Cmax (relative Cmax  = 103·4%; 90% CI 94·6, 112·6). Oral tenofovir dipivoxil fumarate produced predictable and dose-proportional plasma tenofovir pharmacokinetics. The accumulation ratio was 1·51, suggesting tenofovir dipivoxil fumarate displayed accumulation after repeated administration. The bioavailability of tenofovir dipivoxil fumarate was increased by approximately 25% as measured by AUClast after a single dose when taken with food, compared with fasting. © 2012 Blackwell Publishing Ltd.

  1. Highlighting the Need for Systems-Level Experimental Characterization of Plant Metabolic Enzymes.

    PubMed

    Engqvist, Martin K M

    2016-01-01

    The biology of living organisms is determined by the action and interaction of a large number of individual gene products, each with specific functions. Discovering and annotating the function of gene products is key to our understanding of these organisms. Controlled experiments and bioinformatic predictions both contribute to functional gene annotation. For most species it is difficult to gain an overview of what portion of gene annotations are based on experiments and what portion represent predictions. Here, I survey the current state of experimental knowledge of enzymes and metabolism in Arabidopsis thaliana as well as eleven economically important crops and forestry trees - with a particular focus on reactions involving organic acids in central metabolism. I illustrate the limited availability of experimental data for functional annotation of enzymes in most of these species. Many enzymes involved in metabolism of citrate, malate, fumarate, lactate, and glycolate in crops and forestry trees have not been characterized. Furthermore, enzymes involved in key biosynthetic pathways which shape important traits in crops and forestry trees have not been characterized. I argue for the development of novel high-throughput platforms with which limited functional characterization of gene products can be performed quickly and relatively cheaply. I refer to this approach as systems-level experimental characterization. The data collected from such platforms would form a layer intermediate between bioinformatic gene function predictions and in-depth experimental studies of these functions. Such a data layer would greatly aid in the pursuit of understanding a multiplicity of biological processes in living organisms.

  2. Modeling metabolism and stage-specific growth of Plasmodium falciparum HB3 during the intraerythrocytic developmental cycle.

    PubMed

    Fang, Xin; Reifman, Jaques; Wallqvist, Anders

    2014-10-01

    The human malaria parasite Plasmodium falciparum goes through a complex life cycle, including a roughly 48-hour-long intraerythrocytic developmental cycle (IDC) in human red blood cells. A better understanding of the metabolic processes required during the asexual blood-stage reproduction will enhance our basic knowledge of P. falciparum and help identify critical metabolic reactions and pathways associated with blood-stage malaria. We developed a metabolic network model that mechanistically links time-dependent gene expression, metabolism, and stage-specific growth, allowing us to predict the metabolic fluxes, the biomass production rates, and the timing of production of the different biomass components during the IDC. We predicted time- and stage-specific production of precursors and macromolecules for P. falciparum (strain HB3), allowing us to link specific metabolites to specific physiological functions. For example, we hypothesized that coenzyme A might be involved in late-IDC DNA replication and cell division. Moreover, the predicted ATP metabolism indicated that energy was mainly produced from glycolysis and utilized for non-metabolic processes. Finally, we used the model to classify the entire tricarboxylic acid cycle into segments, each with a distinct function, such as superoxide detoxification, glutamate/glutamine processing, and metabolism of fumarate as a byproduct of purine biosynthesis. By capturing the normal metabolic and growth progression in P. falciparum during the IDC, our model provides a starting point for further elucidation of strain-specific metabolic activity, host-parasite interactions, stress-induced metabolic responses, and metabolic responses to antimalarial drugs and drug candidates.

  3. Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS

    PubMed Central

    Gaude, Edoardo; Aksentijević, Dunja; Sundier, Stephanie Y.; Robb, Ellen L.; Logan, Angela; Nadtochiy, Sergiy M.; Ord, Emily N. J.; Smith, Anthony C.; Eyassu, Filmon; Shirley, Rachel; Hu, Chou-Hui; Dare, Anna J.; James, Andrew M.; Rogatti, Sebastian; Hartley, Richard C.; Eaton, Simon; Costa, Ana S.H.; Brookes, Paul S.; Davidson, Sean M.; Duchen, Michael R.; Saeb-Parsy, Kourosh; Shattock, Michael J.; Robinson, Alan J.; Work, Lorraine M.; Frezza, Christian; Krieg, Thomas; Murphy, Michael P.

    2014-01-01

    Ischaemia-reperfusion (IR) injury occurs when blood supply to an organ is disrupted and then restored, and underlies many disorders, notably heart attack and stroke. While reperfusion of ischaemic tissue is essential for survival, it also initiates oxidative damage, cell death, and aberrant immune responses through generation of mitochondrial reactive oxygen species (ROS)1-5. Although mitochondrial ROS production in IR is established, it has generally been considered a non-specific response to reperfusion1,3. Here, we developed a comparative in vivo metabolomic analysis and unexpectedly identified widely conserved metabolic pathways responsible for mitochondrial ROS production during IR. We showed that selective accumulation of the citric acid cycle (CAC) intermediate succinate is a universal metabolic signature of ischaemia in a range of tissues and is responsible for mitochondrial ROS production during reperfusion. Ischaemic succinate accumulation arises from reversal of succinate dehydrogenase (SDH), which in turn is driven by fumarate overflow from purine nucleotide breakdown and partial reversal of the malate/aspartate shuttle. Upon reperfusion, the accumulated succinate is rapidly re-oxidised by SDH, driving extensive ROS generation by reverse electron transport (RET) at mitochondrial complex I. Decreasing ischaemic succinate accumulation by pharmacological inhibition is sufficient to ameliorate in vivo IR injury in murine models of heart attack and stroke. Thus, we have identified a conserved metabolic response of tissues to ischaemia and reperfusion that unifies many hitherto unconnected aspects of IR injury. Furthermore, these findings reveal a novel pathway for metabolic control of ROS production in vivo, while demonstrating that inhibition of ischaemic succinate accumulation and its oxidation upon subsequent reperfusion is a potential therapeutic target to decrease IR injury in a range of pathologies. PMID:25383517

  4. Primary Metabolism and Medium-Chain Fatty Acid Alterations Precede Long-Chain Fatty Acid Changes Impacting Neutral Lipid Metabolism in Response to an Anticancer Lysophosphatidylcholine Analogue in Yeast.

    PubMed

    Tambellini, Nicolas P; Zaremberg, Vanina; Krishnaiah, Saikumari; Turner, Raymond J; Weljie, Aalim M

    2017-10-06

    The nonmetabolizable lysophosphatidylcholine (LysoPC) analogue edelfosine is the prototype of a class of compounds being investigated for their potential as selective chemotherapeutic agents. Edelfosine targets membranes, disturbing cellular homeostasis. Is not clear at this point how membrane alterations are communicated between intracellular compartments leading to growth inhibition and eventual cell death. In the present study, a combined metabolomics/lipidomics approach for the unbiased identification of metabolic pathways altered in yeast treated with sublethal concentrations of the LysoPC analogue was employed. Mass spectrometry of polar metabolites, fatty acids, and lipidomic profiling was used to study the effects of edelfosine on yeast metabolism. Amino acid and sugar metabolism, the Krebs cycle, and fatty acid profiles were most disrupted, with polar metabolites and short-medium chain fatty acid changes preceding long and very long-chain fatty acid variations. Initial increases in metabolites such as trehalose, proline, and γ-amino butyric acid with a concomitant decrease in metabolites of the Krebs cycle, citrate and fumarate, are interpreted as a cellular attempt to offset oxidative stress in response to mitochondrial dysfunction induced by the treatment. Notably, alanine, inositol, and myristoleic acid showed a steady increase during the period analyzed (2, 4, and 6 h after treatment). Of importance was the finding that edelfosine induced significant alterations in neutral glycerolipid metabolism resulting in a significant increase in the signaling lipid diacylglycerol.

  5. Effect of an acid filler on hydrolysis and biodegradation of poly-lactic acid (PLA)

    NASA Astrophysics Data System (ADS)

    Iozzino, Valentina; Speranza, Vito; Pantani, Roberto

    2015-12-01

    The use of biodegradable polymers is certainly an excellent strategy to solve many of the problems related to the disposal of the traditional polymers, whose accumulation in the environment is harmful and damaging. In order to optimize the use of biodegradable polymers, it is very important to understand and control the transformation processes, the structures and the morphologies resulting from the process conditions used to produce the articles and, not least, the biodegradation. The latter is strictly dependent on the just mentioned variables. The poly-lactic acid, PLA, is a biodegradable polymer. Many studies have been carried out on the degradation process of this polymer. In the course of this work we performed degradation tests on the PLA, with a specific D-isomer content, having amorphous structure, and in particular of biodegradation and hydrolysis. An acid chemical, fumaric acid, was added to PLA with the objective of controlling the rate of hydrolysis and of biodegradation. The hydrolysis process was followed, as function of time, by means of different techniques: pH variation, variation of weight of samples and variation of crystallinity degree and glass transition temperature using DSC analysis. The samples were also analyzed in terms of biodegradability by means of a homemade respirometer apparatus, in controlled composting conditions.

  6. Vonoprazan fumarate, a novel potassium-competitive acid blocker, in the management of gastroesophageal reflux disease: safety and clinical evidence to date

    PubMed Central

    Sugano, Kentaro

    2018-01-01

    Potassium-competitive acid blocker (P-CAB) is a class of drug that competitively blocks the potassium-binding site of H+, K+-adenosine triphosphate (ATP)ase. Although the history of this class of drugs started over 30 years ago, clinical use of two P-CABs, revaprazan and vonoprazan, were only recently approved in Korea and Japan, respectively. Among them, vonoprazan has several advantages over conventional proton-pump inhibitors (PPIs), including rapid onset of action, long duration of acid suppression, fewer interindividual variations in terms of acid suppression, and minimum dietary influence on its action. These advantages of vonoprazan have been proved in clinical trials conducted for license approvals for several acid-related diseases. In this review article, current evidence of vonoprazan in the management of gastroesophageal reflux disease (GERD) will be summarized. Since the clinical trial data, as well as postmarketed clinical data, have consistently demonstrated superiority of vonoprazan over conventional PPIs in terms of achieving healing of mucosal breaks and maintaining the healing, it may provide an excellent, if not complete, option for fulfilling some of the unmet needs for current GERD therapy. The safety problem of vonoprazan is also discussed, as more pronounced hypergastrinemia inevitably ensues with its use. PMID:29383028

  7. Sensorial evaluation of nutritional supplements (PROGRESA) enriched with 3 different forms of iron in a rural Mexican community.

    PubMed

    Morales, J; Vargas, F; Cassís, L; Sánchez, E; Villalpando, S

    2008-01-01

    As part of the efforts to reduce iron deficiency anemia (IDA), the Mexican Federal program PROGRESA distributes complementary foods to toddlers and pregnant women living in extreme poverty. Complementary foods were originally fortified with hydrogen-reduced iron, which proved a limited efficacy. The supplement was reformulated to provide higher iron bioavailability. This investigation aims to assess the sensory changes and the acceptance of new versions of the complementary foods fortified with either reduced iron, ferrous fumarate, or ferrous sulfate, stored at room temperature for 2, 4, and 6 mo. Complementary foods were presented without flavor (plain) or flavored with either chocolate or vanilla. The complementary foods were evaluated in toddlers and their mothers using a hedonic scale. The percentage of overall acceptance for the baby foods was higher in toddlers (80% to 88%) than in their mothers (63% to 68%). The complementary foods with a better acceptance were those fortified with reduced iron (63% to 68%) and ferrous fumarate (61% to 80%) independently of the flavoring added. The acceptance of the beverage intended for women was better for those fortified with reduced iron (52% to 63%) or ferrous fumarate (44% to 63%) in their vanilla-flavored version. For women, the most accepted sources of iron were reduced iron (50% to 60%) and ferrous fumarate (50% to 58%).

  8. Emission characteristics of carboxylates in PM2.5 from incense burning with the effect of light on acetate

    NASA Astrophysics Data System (ADS)

    Kuo, Su-Ching; Tsai, Ying I.; Sopajaree, Khajornsak

    2016-08-01

    Incense burning produces potentially harmful particulate matter. In this study we investigated the emissions of PM2.5 and gaseous acetic acid from four brands of traditional incense; Liao and Shang Lao Shan (SLS), sold in Taiwan, and Thai Yellow (Thai Y) and Thai Black (Thai B), sold in Thailand. Additionally, photochemical reactions of PM2.5 carboxylates emitted from incense burning were studied via a simulated light experiment. The average PM2.5 mass emission factor of each incense type was inversely correlated with the ash production of that incense. The Thailand incense carboxylate emissions were markedly higher than the Taiwan incense. Acetate accounted for 87.46% of total carboxylate emissions, with acetate emitted from the Thailand incense 1.26 times higher than from the Taiwan incense. Phthalate was detected in the PM2.5, indicating the presence of plasticizer. Concentrations of PM2.5 acetate, formate, pyruvate, glutarate, succinate, fumarate and tartarate were reduced in simulated light (51.5%-97.1% of those under dark), indicating that these seven types of carboxylate are easily photodegradable. In contrast, malonate, maleate, oxalate and phthalate concentrations in light were 1.17-1.84 times higher than in darkness, indicating photochemical reactions contribute to the formation of these species. The formation of the low-molecular weight dicarboxylates oxalate and malonate was most noticeable. Acetic acid, highly irritating to the respiratory system and skin, was present at high levels for all four incense types, as shown by the gaseous acetic acid/PM2.5 acetate ratios of 1.03-3.61. Burning incense indoors can generate high concentrations of PM2.5 acetate that increases the risks of respiratory and contact irritation, particularly when burning the Thailand incense. Moreover, burning incense in poorly ventilated, dimly lit indoor areas (e.g., temples and homes) can markedly increase the risk of irritation because the gaseous acetic acid is not degraded as it would be in light.

  9. Development of laminated fiber-reinforced nanocomposites for bone regeneration

    NASA Astrophysics Data System (ADS)

    Xu, Weijie

    There have been numerous efforts to develop synthetic and/or natural tissue engineering scaffolds that are suitable for bone regeneration applications to replace autograft and allograft bones. Current biomaterials as a scaffold for bone regeneration are limited by the extent of degradation concurrent with bone formation, mechanical strength, and the extent of osteogenic differentiation of marrow stromal cells migrating from the surrounding tissues. In this project, a novel laminated nanocomposite scaffold is fabricated, consisting of poly (L-lactide ethylene oxide fumarate) (PLEOF) hydrogel reinforced with poly (L-lactic acid) (PLLA) electrospun nanofibers and hydroxyapatite (HA) nanoparticles. PLEOF is a novel in situ crosslinkable macromer synthesized from biocompatible building units which can be functionalized with bioactive peptides like the cell-adhesive Arg--Gly--Asp (RGD) amino acid sequence. The hydrophilicity and degradation rate of the macromer can be tailored to a particular application by controlling the ratio of PEG to PLA blocks in the macromer and the unsaturated fumarate units can be used for in-situ crosslinking. The PLLA nanofibers were electrospun from high molecular weight PLLA. The laminated nanocomposites were fabricated by dry-hand lay up technique followed by compression molding and thermal crosslinking. The laminated nanocomposites were evaluated with respect to degradation, water uptake, mechanical strength, and the extent of osteogenic differentiation of bone marrow stromal (BMS) cells. Laminates with or without HA nanoparticles showed modulus values much higher than that of trabecular bone (50-100 MPa). The effect of laminated nanocomposites on osteogenic differentiation of BMS cells was determined in terms of cell number, ALPase activity and calcium content. Our results demonstrate that grafting RGD peptide and HA nanoparticles to a PLEOF hydrogel reinforced with PLLA nanofibers synergistically enhance osteogenic differentiation of BMS cells. In conclusion, the laminated nanocomposite with controllable degradation characteristics and robust mechanical properties is attractive as a synthetic bone-mimetic matrix for skeletal tissue regeneration.

  10. Gateways to clinical trials.

    PubMed

    Bayes, M; Rabasseda, X; Prous, J R

    2006-03-01

    Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 131I-labetuzumab; Abacavir sulfate, abatacept, adalimumab, ademetionine, adjuvanted influenza vaccine, alefacept, alemtuzumab, amlodipine, amphotericin B, anakinra, aripiprazole, aspirin, axitinib; Betamethasone dipropionate, bevacizumab, biphasic insulin aspart, bortezomib, bosentan, botulinum toxin type B, BQ-123; Calcium folinate, canertinib dihydrochloride, carboplatin, carmustine, cetirizine hydrochloride, cetuximab, cholecalciferol, ciclesonide, ciclosporin, cinacalcet hydrochloride, cisplatin, clarithromycin, clofazimine, cold-adapted influenza vaccine trivalent, CpG-7909; Darbepoetin alfa, darifenacin hydrobromide, DB-289, desloratadine, Dexamet, dicycloverine hydrochloride, dimethyl fumarate, docetaxel, dolastatin 10, drospirenone, drospirenone/estradiol, duloxetine hydrochloride; Ecogramostim, edotecarin, efaproxiral sodium, enalapril maleate, epoetin beta, epoprostenol sodium, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, estradiol, etanercept; Fluconazole, fludarabine phosphate, fluorouracil; Gefitinib, gemcitabine, Ghrelin (human), glibenclamide, glimepiride, GTI-2040; Haloperidol, human insulin, hydrocortisone probutate; Imatinib mesylate, indisulam, influenza vaccine, inhaled insulin, insulin aspart, insulin glulisine, insulin lispro, irinotecan, ispronicline; Lamivudine, lamivudine/zidovudine/abacavir sulfate, lapatinib, letrozole, levocetirizine, lomustine, lonafarnib, lumiracoxib;Magnesium sulfate, MD-1100, melphalan, metformin hydrochloride, methotrexate, metoclopramide hydrochloride, mitiglinide calcium hydrate, monophosphoryl lipid A, montelukast sodium, motexafin gadolinium, mycophenolate mofetil, mycophenolic acid sodium salt; Nitisinone; Omalizumab, omapatrilat, ONYX-015, oxaliplatin; Paclitaxel, paclitaxel nanoparticles, panitumumab, parathyroid hormone (human recombinant), peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pertuzumab, phosphatidylcholine-rich phospholipid mixture, pimecrolimus, pioglitazone hydrochloride, pramlintide acetate, prasterone; QR-333; Ranelic acid distrontium salt, ranolazine, rasagiline mesilate, RFB4(dsFv)-PE38, ribavirin, rifabutin, risperidone, rituximab, rofecoxib, rosiglitazone maleate, rosiglitazone maleate/metformin hydrochloride, rotavirus vaccine; S-236, salmeterol xinafoate, sarizotan hydrochloride, sildenafil, sildenafil citrate, sunitinib malate; Tadalafil, tegaserod maleate, temozolomide, tenofovir disoproxil fumarate, teriparatide, tiotropium bromide, tipifarnib, trabectedin, treprostinil sodium; Vandetanib, vardenafil hydrochloride hydrate, vatalanib succinate, vinflunine, virosome influenza vaccine, voriconazole; Zidovudine. (c) 2006 Prous Science. All rights reserved.

  11. Organic acids, sugars, vitamin C content and some pomological characteristics of eleven hawthorn species (Crataegus spp.) from Turkey.

    PubMed

    Gundogdu, Muttalip; Ozrenk, Koray; Ercisli, Sezai; Kan, Tuncay; Kodad, Ossama; Hegedus, Attila

    2014-05-30

    The Hawthorn (Crateagus sp.) mostly occurs around the temperate region of the world with a high number of species, producing a fruit with numerous beneficial effects for human health. The aim of the study was to determine organic acid and sugar contents in the fruit of a number of hawthorn species grown in Erzincan province of Turkey. Citric acid was the predominant organic acid in all hawthorn species and C. pseudoheterophylla had the highest citric acid content (23.688 g/100 g). There were not statistically significant differences among hawthorn species (except C. atrosanguinea Pojark) in terms of fumaric acid content. C.pontica C.Koch had a higher content of vitamin C (9.418 mg/100 g) compared to other species. Fructose was the predominant sugar component in all species and C. monogyna subsp. monogyna Joiq had the highest fructose content (18.378 g/100 g). The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source. The study revealed that there were differences in terms of fruit characteristics among hawthorn species and thus better quality hawthorn genotypes can be selected within the species. Hence, this study is considered to be a valuable reference for forthcoming studies. The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source.

  12. Molybdenum effector of fumarate reductase repression and nitrate reductase induction in Escherichia coli.

    PubMed Central

    Iuchi, S; Lin, E C

    1987-01-01

    In Escherichia coli the presence of nitrate prevents the utilization of fumarate as an anaerobic electron acceptor. The induction of the narC operon encoding the nitrate reductase is coupled to the repression of the frd operon encoding the fumarate reductase. This coupling is mediated by nitrate as an effector and the narL product as the regulatory protein (S. Iuchi and E. C. C. Lin, Proc. Natl. Acad. Sci. USA 84:3901-3905, 1987). The protein-ligand complex appears to control narC positively but frd negatively. In the present study we found that a molybdenum coeffector acted synergistically with nitrate in the regulation of frd and narC. In chlD mutants believed to be impaired in molybdate transport (or processing), full repression of phi(frd-lac) and full induction of phi(narC-lac) by nitrate did not occur unless the growth medium was directly supplemented with molybdate (1 microM). This requirement was not clearly manifested in wild-type cells, apparently because it was met by the trace quantities of molybdate present as a contaminant in the mineral medium. In chlB mutants, which are known to accumulate the Mo cofactor because of its failure to be inserted as a prosthetic group into proteins such as nitrate reductase, nitrate repression of frd and induction of narC were also intensified by molybdate supplementation. In this case a deficiency of the molybdenum coeffector might have resulted from enhanced feedback inhibition of molybdate transport (or processing) by the elevated level of the unutilized Mo cofactor. In addition, mutations in chlE, which are known to block the synthesis of the organic moiety of the Mo cofactor, lowered the threshold concentration of nitrate (< 1 micromole) necessary for frd repression and narC induction. These changes could be explained simply by the higher intracellular nitrate attainable in cells lacking the ability to destroy the effector. PMID:3301812

  13. The Succinated Proteome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Merkley, Eric D.; Metz, Thomas O.; Smith, Richard D.

    Succination is a chemical modification of cysteine in protein by the Krebs cycle intermediate, fumarate, yielding S-(2-succino)cysteine (2SC). Intracellular fumarate concentration and succination of proteins are increased by hyperpolarization of the inner mitochondrial membrane, in concert with mitochondrial, endoplasmic reticulum (ER) and oxidative stress in adipocytes grown in high glucose medium and in adipose tissue in obesity and diabetes. Increased succination of proteins is also detected in the kidney of a fumarase conditional knock-out mouse which develops renal tumors. Keap1, the gatekeeper of the antioxidant response, was identified as a major succinated protein in renal cancer cells, suggesting that succinationmore » may play a role in activation of the antioxidant response. A wide range of proteins is subject to succination, including enzymes, adipokines, cytoskeletal proteins and ER chaperones with functional cysteine residues. There is also significant overlap between succinated and glutathionylated proteins, and with proteins containing cysteine residues that are readily oxidized to the sulfenic (cysteic) acid. Succination of adipocyte proteins is inhibited by uncouplers, which discharge the mitochondrial membrane potential (Δψm) and by ER stress inhibitors. 2SC serves as a biomarker of mitochondrial stress or dysfunction in chronic diseases, such as obesity, diabetes and cancer, and recent studies suggest that succination is a mechanistic link between mitochondrial dysfunction, oxidative and ER stress, and cellular progression toward apoptosis. In this article, we review the history of the succinated proteome and the challenges associated with measuring this non-enzymatic post-translational modification of proteins by proteomics approaches.« less

  14. Development and application of an exchange model for anisotropic water diffusion in the microporous MOF aluminum fumarate

    NASA Astrophysics Data System (ADS)

    Splith, Tobias; Fröhlich, Dominik; Henninger, Stefan K.; Stallmach, Frank

    2018-06-01

    Diffusion of water in aluminum fumarate was studied by means of pulsed field gradient (PFG) nuclear magnetic resonance (NMR). Due to water molecules exchanging between the intracrystalline anisotropic pore space and the isotropic intercrystalline void space the model of intracrystalline anisotropic diffusion fails to describe the experimental PFG NMR data at high observation times. Therefore, the two-site exchange model developed by Kärger is extended to the case of exchange between an anisotropic and an isotropic site. This extended exchange model is solved by numerical integration. It describes the experimental data very well and yields values for the intracrystalline diffusion coefficient and the mean residence times of the respective sites. Further PFG NMR studies were performed with coatings consisting of small aluminum fumarate crystals, which are used in adsorptive heat transformation applications. The diffusion coefficients of water in the small crystal coating are compared to the values expected from the extended two-site exchange model and from the model of long-range diffusion.

  15. Effect of Bulk MoS₂ on the Metabolic Profile of Yeast.

    PubMed

    Yu, Yadong; Yang, Qi; Wu, Na; Tang, Hanlin; Yi, Yanliang; Wang, Gaihong; Ge, Yilin; Zong, Jiajun; Madzak, Catherine; Zhao, Ye; Jiang, Ling; Huang, He

    2018-06-01

    MoS2, a kind of two-dimensional material with unique performances, has been widely used in many fields. However, an in-depth understanding of its toxicity is still needed, let alone its effects on the environmental microorganism. Herein, we used different methods, including metabolomics technology, to investigate the influence of bulk MoS2 (BMS) on yeast cells. The results indicated that high concentrations (1 mg/L and more) of BMS could destroy cell membrane and induce ROS accumulation. When exposed to a low concentration of BMS (0.1 mg/L), the intracellular concentrations of many metabolites (e.g., fumaric acid, lysine) increased. However, most of their concentrations descended significantly as the yeast cells were treated with BMS of high concentrations (1 mg/L and more). Metabolomics analysis further revealed that exposure to high concentrations of BMS could significantly affect some metabolic pathways such as amino acid and citrate cycle related metabolism. These findings will be beneficial for MoS2 toxicity assessment and further applications.

  16. Development of Competence of Haemophilus influenzae

    PubMed Central

    Spencer, Hugh T.; Herriott, Roger M.

    1965-01-01

    Spencer, Hugh T. (The Johns Hopkins University School of Hygiene and Public Health, Baltimore, Md.), and Roger M. Herriott. Development of competence of Haemophilus influenzae. J. Bacteriol. 90:911–920. 1965.—A chemically defined nongrowth medium was developed for the induction of competence of Haemophilus influenzae by a stepdown procedure. Cells grown logarithmically in Heart Infusion Broth became competent after being transferred to a medium which consisted of amino acids, sodium fumarate, and inorganic salts. Chloramphenicol (2 μg/ml) or l-valine (1 μg/ml) in the nongrowth medium inhibited development of competence. The inhibitory action of l-valine was reversed by comparable concentrations of l-isoleucine. Kinetic studies of the development of competence showed a variable capacity of competent cells to take up deoxyribonucleic acid and reaffirmed earlier findings that competence was not transmissible in H. influenzae. Addition of nicotinamide adenine dinucleotide, thiamine, calcium pantothenate, uracil, and hypoxanthine to the medium for competence resulted in a minimal growth medium in which reduced levels of competence were developed. PMID:5294817

  17. Thermostable and highly specific L-aspartate oxidase from Thermococcus litoralis DSM 5473: cloning, overexpression, and enzymological properties.

    PubMed

    Washio, Tsubasa; Oikawa, Tadao

    2018-01-01

    We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.

  18. Reformulating Polycaprolactone Fumarate to Eliminate Toxic Diethylene Glycol: Effects of Polymeric Branching and Autoclave Sterilization on Material Properties

    PubMed Central

    Runge, M. Brett; Wang, Huan; Spinner, Robert J; Windebank, Anthony J; Yaszemski, Michael J.

    2011-01-01

    Polycaprolactone fumarate (PCLF) is a cross-linkable derivate of polycaprolactone diol that has been shown to be an effective nerve conduit material that supports regeneration across segmental nerve defects and has warranted future clinical trials. Degradation of the previously studied PCLF (PCLFDEG) releases toxic small molecules of diethylene glycol used as the initiator for the synthesis of polycaprolactone diol. In an effort to eliminate this toxic degradation product we present a strategy for the synthesis of PCLF from either propylene glycol (PCLFPPD) or glycerol (PCLFGLY). PCLFPPD is linear and resembles the previously studied PCLFDEG, while PCLFGLY is branched and exhibits dramatically different material properties. The synthesis and characterization of their thermal, rheological, and mechanical properties are reported. The results show that the linear PCLFPPD has material properties similar to the previously studied PCLFDEG. The branched PCLFGLY exhibits dramatically lower crystalline properties resulting in lower rheological and mechanical moduli, and is therefore a more compliant material. In addition, the question of an appropriate FDA approvable sterilization method is addressed. This study shows that autoclave sterilization on PCLF materials is an acceptable sterilization method for cross-linked PCLF and has minimal effect on the PCLF thermal and mechanical properties. PMID:21911087

  19. A 68-year old male presenting with rhabdomyolysis-associated acute kidney injury following concomitant use of elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate and pravastatin/fenofibrate: a case report.

    PubMed

    Suttels, Veronique; Florence, Eric; Leys, John; Vekemans, Marc; Van den Ende, Jef; Vlieghe, Erika; Kenyon, Chris

    2015-09-08

    We present what we believe to be the first case in the literature of rhabdomyolysis-induced renal failure caused by a probable drug interaction between elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate (EVG/COBI/FTC/TDF) and pravastatin/fenofibrate. A 68-year old Caucasian man presented with progressive pain in both legs two weeks after commencing treatment with EVG/COBI/FTC/TDF. He was found to have biochemical evidence of rhabdomyolysis and acute renal failure. We emphasize the need for post marketing surveillance of adverse effects of new products. Pharmacokinetic studies are necessary to investigate the levels of pravastatin in patients taking COBI and fenofibrate with and without other comorbidities. Meanwhile, we suggest that creatine kinase levels should be monitored and patients advised to report myalgias when using concomitant EVG/COBI/FTC/TDF and pravastatin/fenofibrate. This case serves as an important reminder to use estimated glomerular filtration rates rather than serum creatinine levels when choosing new medications. If potentially nephrotoxic combinations are started in patients with borderline estimated glomerular filtration rates, it may be prudent to check these filtration rates more frequently than usual. In patients with reduced estimated glomerular filtration rates, potentially nephrotoxic combinations should be avoided wherever possible.

  20. Development and optimization of iron- and zinc-containing nanostructured powders for nutritional applications.

    PubMed

    Hilty, F M; Teleki, A; Krumeich, F; Büchel, R; Hurrell, R F; Pratsinis, S E; Zimmermann, M B

    2009-11-25

    Reducing the size of low-solubility iron (Fe)-containing compounds to nanoscale has the potential to improve their bioavailability. Because Fe and zinc (Zn) deficiencies often coexist in populations, combined Fe/Zn-containing nanostructured compounds may be useful for nutritional applications. Such compounds are developed here and their solubility in dilute acid, a reliable indicator of iron bioavailability in humans, and sensory qualities in sensitive food matrices are investigated. Phosphates and oxides of Fe and atomically mixed Fe/Zn-containing (primarily ZnFe2O4) nanostructured powders were produced by flame spray pyrolysis (FSP). Chemical composition and surface area were systematically controlled by varying precursor concentration and feed rate during powder synthesis to increase solubility to the level of ferrous sulfate at maximum Fe and Zn content. Solubility of the nanostructured compounds was dependent on their particle size and crystallinity. The new nanostructured powders produced minimal color changes when added to dairy products containing chocolate or fruit compared to the changes produced when ferrous sulfate or ferrous fumarate were added to these foods. Flame-made Fe- and Fe/Zn-containing nanostructured powders have solubilities comparable to ferrous and Zn sulfate but may produce fewer color changes when added to difficult-to-fortify foods. Thus, these powders are promising for food fortification and other nutritional applications.

  1. Thermophilic anaerobic degradation of butyrate by a butyrate-utilizing bacterium in coculture and triculture with methanogenic bacteria.

    PubMed

    Ahring, B K; Westermann, P

    1987-02-01

    We studied syntrophic butyrate degradation in thermophilic mixed cultures containing a butyrate-degrading bacterium isolated in coculture with Methanobacterium thermoautotrophicum or in triculture with M. thermoautotrophicum and the TAM organism, a thermophilic acetate-utilizing methanogenic bacterium. Butyrate was beta-oxidized to acetate with protons as the electron acceptors. Acetate was used concurrently with its production in the triculture. We found a higher butyrate degradation rate in the triculture, in which both hydrogen and acetate were utilized, than in the coculture, in which acetate accumulated. Yeast extract, rumen fluid, and clarified digestor fluid stimulated butyrate degradation, while the effect of Trypticase was less pronounced. Penicillin G, d-cycloserine, and vancomycin caused complete inhibition of butyrate utilization by the cultures. No growth or degradation of butyrate occurred when 2-bromoethanesulfonic acid or chloroform, specific inhibitors of methanogenic bacteria, was added to the cultures and common electron acceptors such as sulfate, nitrate, and fumarate were not used with butyrate as the electron donor. Addition of hydrogen or oxygen to the gas phase immediately stopped growth and butyrate degradation by the cultures. Butyrate was, however, metabolized at approximately the same rate when hydrogen was removed from the cultures and was metabolized at a reduced rate in the cultures previously exposed to hydrogen.

  2. Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

    PubMed

    Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

    2010-07-01

    Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

  3. Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

    PubMed

    Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

    2018-07-15

    Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

  4. Fanconi Anemia complementation group C protein in metabolic disorders.

    PubMed

    Nepal, Manoj; Ma, Chi; Xie, Guoxiang; Jia, Wei; Fei, Peiwen

    2018-06-21

    Given importance of 22-Fanconi Anemia (FA) proteins together to act in a signaling pathway in preventing deleterious clinical symptoms, e.g. severe bone marrow failure, congenital defects, an early onset of aging and cancer, studies on each FA protein become increasingly attractive. However, an unbiased and systematic investigation of cellular effects resulting from each FA protein is missing. Here, we report roles of FA complementation C group protein (FANCC) in the protection from metabolic disorders. This study was prompted by the diabetes-prone feature displayed in FANCC knockout mice, which is not typically shown in patients with FA. We found that in cells expressing FANCC at different levels, there are representative alterations in metabolites associated with aging (glycine, citrulline, ornithine, L-asparagine, L-tyrosine, L-arginine, L-glutamine, L-leucine, L-isoleucine, L-valine, L-proline and L-alanine), Diabetes Mellitus (DM) (carbon monoxide, collagens, fatty acids, D-glucose, fumaric acid, 2-oxoglutaric acid, C3), inflammation (inosine, L-arginine, L-isoleucine, L-leucine, L-lysine, L-phenylalanine, hypoxanthine, L-methionine), and cancer ( L-methionine, sphingomyelin, acetyl-L-carnitine, L-aspartic acid, L-glutamic acid, niacinamide, phospho-rylethanolamine). We also found that FANCC can act in an FA-pathway-independent manner in tumor suppression. Collectively, featured-metabolic alterations are readouts of functional mechanisms underlying reduced tumorigenicity driven by FANCC, demonstrating close links among cancer, aging, inflammation and DM.

  5. In Vitro Cytocompatibility of One- and Two-Dimensional Nanostructure-Reinforced Biodegradable Polymeric Nanocomposites

    PubMed Central

    Farshid, Behzad; Lalwani, Gaurav; Sitharaman, Balaji

    2015-01-01

    This study investigates the in vitro cytocompatibility of one- and two-dimensional (1-D and 2-D) carbon and inorganic nanomaterial reinforced polymeric nanocomposites fabricated using biodegradable polymer poly (propylene fumarate), crosslinking agent N-vinyl pyrrolidone (NVP) and following nanomaterials: single- and multi- walled carbon nanotubes, single- and multi- walled graphene oxide nanoribbons, graphene oxide nanoplatelets, molybdenum disulfide nanoplatelets, or tungsten disulfide nanotubes dispersed between 0.02–0.2 wt% concentrations in the polymer. The extraction media of unreacted components, crosslinked nanocomposites and their degradation products between 1X-100X dilutions were examined for effects on viability and attachment employing two cell lines: NIH3T3 fibroblasts and MC3T3 pre-osteoblasts. The extraction media of unreacted PPF/NVP elicited acute dose-dependent cytotoxicity attributed to leaching of unreacted components into cell culture media. However, extraction media of crosslinked nanocomposites showed no dose dependent adverse effects. Further, all crosslinked nanocomposites showed high viability (78–100%), high cellular attachment (40–55%), and spreading that was confirmed by confocal and scanning electron microscopy. Degradation products of nanocomposites showed a mild dose-dependent cytotoxicity possibly due to acidic degradation components of PPF. In general, compared to PPF control, none of the nanocomposites showed significant differences in cellular response to the unreacted components, crosslinked nanocomposites and their degradation products. The initial minor cytotoxic response and lower cell attachment numbers were observed only for a few nanocomposite groups; these effects were absent at later time points for all PPF nanocomposites. The favorable cytocompatibility results for all the nanocomposites opens avenues for in vivo safety and efficacy studies for bone tissue engineering applications. PMID:25367032

  6. The Compositional HJ-Biplot—A New Approach to Identifying the Links among Bioactive Compounds of Tomatoes

    PubMed Central

    Hernández Suárez, Marcos; Molina Pérez, Daniel; Rodríguez-Rodríguez, Elena M.; Díaz Romero, Carlos; Espinosa Borreguero, Francisco; Galindo-Villardón, Purificación

    2016-01-01

    Tomatoes have been described as a functional food because of their particular composition of different bioactive compounds. In this study, the proximate composition, minerals and trace elements, and antioxidant compounds were determined in two tomato cultivars (Mariana and Dunkan) that were grown in Gran Canaria (Spain) either conventionally or hydroponically. Although compositional data of this type require being subjected to the specific statistical techniques of compositional analysis, this approach has not usually been considered in this context. In the present case, a compositional Mann–Whitney U test of the data showed significant differences for each factor (cultivar and cultivation system) in several of the compositional variables studied. For the differences between cultivars, these parameters were the protein, Mg, lycopene, ascorbic acid, citric acid, and fumaric acid contents. For the differences between cultivation systems, they were mainly those of the mineral and trace elements group. Although one-year data are insufficient to make clear relationship among compounds because more repetitions in several localities and years are necessary, the compositional HJ-biplot (in which the links provide estimates of the linear relationship among variables) results agreed with other scientific results about linear relationship among some compounds analyzed. PMID:27827839

  7. Comparative analysis of Danggui and European Danggui using nuclear magnetic resonance-based metabolic fingerprinting.

    PubMed

    Li, Zhen-Yu; Zhang, Zheng-Zheng; Du, Guan-Hua; Qin, Xue-Mei

    2015-01-25

    Danggui is a widely used herbal drug in traditional Chinese medicine, and adulteration with European Danggui is frequently encountered in the market. We compared the chemical compositions and biological effects of Danggui and European Danggui using proton nuclear magnetic resonance spectroscopy coupled with multivariate analysis. Results showed that Danggui and European Danggui differed in both primary and secondary metabolites. Danggui contained higher levels of alanine, γ-aminobutyrate, adenosine, arginine, sucrose, α-glucose, β-glucose, tryptophan, and cis-Z,Z'-3a.7a',7a.3a'-dihydroxyligustilide than European Danggui. Meanwhile, European Danggui contained higher contents of valine, proline, fumaric acid, phenylalanine, nicotinamide derivative, Z-butylidenephthalide, coniferyl ferulate, ferulic acid, Z-ligustilide, and Z,Z-6,6'7,3a-diligustilide than Danggui. A blood deficiency model was used to compare the biological effects of the two drugs. Despite its higher levels of Z-ligustilide and ferulic acid, European Danggui showed a weaker blood enriching effect than Danggui. Thus, the bioactive compounds responsible for the blood enriching effect in Danggui and their possible synergistic effects should be further studied. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Adjustment of growth and central metabolism to a mild but sustained nitrogen-limitation in Arabidopsis.

    PubMed

    Tschoep, Hendrik; Gibon, Yves; Carillo, Petronia; Armengaud, Patrick; Szecowka, Marek; Nunes-Nesi, Adriano; Fernie, Alisdair R; Koehl, Karin; Stitt, Mark

    2009-03-01

    We have established a simple soil-based experimental system that allows a small and sustained restriction of growth of Arabidopsis by low nitrogen (N). Plants were grown in a large volume of a peat-vermiculite mix that contained very low levels of inorganic N. As a control, inorganic N was added in solid form to the peat-vermiculite mix, or plants were grown in conventional nutrient-rich solids. The low N growth regime led to a sustained 20% decrease of the relative growth rate over a period of 2 weeks, resulting in a two- to threefold decrease in biomass in 35- to 40-day-old plants. Plants in the low N regime contained lower levels of nitrate, lower nitrate reductase activity, lower levels of malate, fumarate and other organic acids and slightly higher levels of starch, as expected from published studies of N-limited plants. However, their rosette protein content was unaltered, and total and many individual amino acid levels increased compared with N-replete plants. This metabolic phenotype reveals that Arabidopsis responds adaptively to low N by decreasing the rate of growth, while maintaining the overall protein content, and maintaining or even increasing the levels of many amino acids.

  9. Unsaturated fatty acids show clear elicitation responses in a modified local lymph node assay with an elicitation phase, and test positive in the direct peptide reactivity assay.

    PubMed

    Yamashita, Kunihiko; Shinoda, Shinsuke; Hagiwara, Saori; Miyazaki, Hiroshi; Itagaki, Hiroshi

    2015-12-01

    The Organisation for Economic Co-operation and Development (OECD) Test Guidelines (TG) adopted the murine local lymph node assay (LLNA) and guinea pig maximization test (GPMT) as stand-alone skin sensitization test methods. However, unsaturated carbon-carbon double-bond and/or lipid acids afforded false-positive results more frequently in the LLNA compared to those in the GPMT and/or in human subjects. In the current study, oleic, linoleic, linolenic, undecylenic, fumaric, maleic, and succinic acid and squalene were tested in a modified LLNA with an elicitation phase (LLNA:DAE), and in a direct peptide reactivity assay (DPRA) to evaluate their skin-sensitizing potential. Oleic, linoleic, linolenic, undecylenic and maleic acid were positive in the LLNA:DAE, of which three, linoleic, linolenic, and maleic acid were positive in the DPRA. Furthermore, the results of the cross-sensitizing tests using four LLNA:DAE-positive chemicals were negative, indicating a chemical-specific elicitation response. In a previous report, the estimated concentration needed to produce a stimulation index of 3 (EC3) of linolenic acid, squalene, and maleic acid in the LLNA was < 10%. Therefore, these chemicals were classified as moderate skin sensitizers in the LLNA. However, the skin-sensitizing potential of all LLNA:DAE-positive chemicals was estimated as weak. These results suggested that oleic, linoleic, linolenic, undecylenic, and maleic acid had skin-sensitizing potential, and that the LLNA overestimated the skin-sensitizing potential compared to that estimated by the LLNA:DAE.

  10. Mineral and metabolic profiles in tea leaves and flowers during flower development.

    PubMed

    Jia, Sisi; Wang, Yu; Hu, Jianhui; Ding, Zhaotang; Liang, Qing; Zhang, Yinfei; Wang, Hui

    2016-09-01

    Tea [Camellia sinensis (L.) O. Kuntze] is one of the most popular non-alcoholic beverage crops in the world, and the physiological processes and gene regulations involved in development in tea plants have been well characterized. However, relatively little is known about the metabolic changes combined with mineral distributions that occur during flower development. Here we detected the contents of 11 elements in tea leaves and flowers and found that, some of them, especially phosphorus, sulfur and copper, showed significant changes during tea flowering. We also detected 122 metabolites in tea leaves and flowers and found that, 72 of them showed significant differences between flowers and leaves, of which sugars, organic acids, and flavonoids dominated. The sugars, such as trehalose and galactose, all accumulated in tea flowers, and the organic acids, such as malic acid, citric acid and fumaric acid involved in TCA cycle. The flavonoids, like epicatechin, catechin gallate and epigallocatechin, were more abundant in leaves. Furthermore, we found that the contents of 33 metabolites changed during the development of flowers. Especially, citric acid, phenylalanine and most flavonoids decreased while fructose and galactose increased during flowering stages in flowers. We also analyzed the correlations between the ions and metabolites and found that, some mineral nutrients including phosphorus, sulfur, manganese and zinc had close relations to organic acids, flavonoids, sugars and several amino acids during flowering. We mapped the metabolic pathway according to the KEGG database. This work will serve as the foundation for a systems biology approach to the understanding of mineral metabolism. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Iron bioavailability in corn-masa tortillas is improved by the addition of disodium EDTA.

    PubMed

    Walter, Tomás; Pizarro, Fernando; Olivares, Manuel

    2003-10-01

    Corn-masa flour flat bread tortillas are the main staple of Mexican and Central American populations. Due to high concentrations of inhibitors of iron absorption, the bioavailability from this matrix is unknown. We wanted to determine the most suitable fortificant that would efficaciously improve iron bioavailability. In tortillas prepared with commercial precooked, lime-treated, corn-masa flour, we examined the in vitro solubility of the following forms of iron: native iron with and without Na2EDTA, elemental reduced iron plus Na2EDTA, ferrous fumarate with and without Na2EDTA, bisglycine iron, ferrous sulfate and NaFeEDTA. We also examined the in vivo bioavailability in humans with double radioiron erythrocyte incorporation of ferrous fumarate with and without Na2EDTA, bisglycine iron, NaFeEDTA and native iron plus Na2EDTA, beans and rice. In vitro, solubility ranged from 1% in iron forms without Na2EDTA to 19.4% for NaFeEDTA. Forms of iron with Na2EDTA had intermediate values. In vivo radioiron studies showed that iron forms without Na2EDTA also had low bioavailability (< or =1%). NaFeEDTA had the highest bioavailability (5.3%). The bioavailability of all iron forms improved significantly when tested with Na2EDTA (<0.05). Adding Na2EDTA to ferrous fumarate increased bioavailability from 0.87% to 2.9% (P < 0.001). We conclude that NaFeEDTA is the form of iron best absorbed, but alternatively, ferrous fumarate plus Na2EDTA comprises a feasible option as a fortificant.

  12. Quality of life outcomes with BG-12 (dimethyl fumarate) in patients with relapsing-remitting multiple sclerosis: the DEFINE study.

    PubMed

    Kappos, Ludwig; Gold, Ralf; Arnold, Douglas L; Bar-Or, Amit; Giovannoni, Gavin; Selmaj, Krzysztof; Sarda, Sujata P; Agarwal, Sonalee; Zhang, Annie; Sheikh, Sarah I; Seidman, Emily; Dawson, Katherine T

    2014-02-01

    Oral BG-12 (dimethyl fumarate), approved for the treatment of the relapsing forms of MS, has demonstrated clinical efficacy with an acceptable safety profile in the Phase III "Determination of the Efficacy and Safety of Oral Fumarate in Relapsing-Remitting Multiple Sclerosis (RRMS)" (DEFINE) and "Comparator and an Oral Fumarate in RRMS" (CONFIRM) studies. To evaluate the health-related quality of life (HRQoL) impairment that is associated with RRMS and to assess the effects of BG-12 on HRQoL in the DEFINE study. Patients with RRMS were randomized to BG-12 240 mg twice (BID) or three times (TID) daily, or placebo, for 2 years. HRQoL was assessed by the Short Form-36 (SF-36), global assessment of well-being visual analog scale and the EuroQol-5D. In the 1237 patients from DEFINE, HRQoL impairment was greatest in patients who had higher disability scores and in those who had experienced relapse. Change in SF-36 physical component summary scores during 2 years' treatment significantly favored BG-12 over placebo (both doses: p < 0.001). We saw similar benefits in other measures of functioning and general well-being as early as Week 24. These benefits were maintained during the study. Our results add to evidence for a negative impact of RRMS on HRQoL and they demonstrate the benefits of BG-12 on HRQoL measures, which coupled with significant clinical efficacy, further support its use as a new treatment for RRMS.

  13. Water Adsorption on Various Metal Organic Framework

    NASA Astrophysics Data System (ADS)

    Teo, H. W. B.; Chakraborty, A.

    2017-12-01

    In this paper, Metal Organic Framework (MOF) undergoes N2 and water adsorption experiment to observe how the material properties affects the water sorption performance. The achieved N2 isotherms is used to estimate the BET surface area, pore volume and, most importantly, the pore size distribution of the adsorbent material. It is noted that Aluminium Fumarate and CAU-10 has pore distribution of about 6Å while MIL-101(Cr) has 16 Å. The water adsorption isotherms at 25°C shows MIL-101(Cr) has a long hydrophobic length from relative pressure of 0 ≤ P/Ps ≤ 0.4 with a maximum water uptake of 1kg/kg sorbent. Alkali metal ions doped MIL-101(Cr) reduced the hydrophobic length and maximum water uptake of original MIL-101(Cr). Aluminium Fumarate and CAU-10 has lower water uptake, but the hydrophobic length of both materials is within relative pressure of P/Ps ≤ 0.2. The kinetic behaviour of doped MIL-101(Cr), Aluminium Fumarate and CAU-10 are faster than MIL-101(Cr).

  14. Studies on Poly(propylene fumarate-co-caprolactone diol) Thermoset Composites towards the Development of Biodegradable Bone Fixation Devices

    PubMed Central

    Jayabalan, M.

    2009-01-01

    The effect of reinforcement in the cross-linked poly(propylene fumarate-co-caprolactone diol) thermoset composites based on Kevlar fibres and hydroxyapatite was studied. Cross-linked poly(propylene fumarate-co-caprolactone diol) was also studied without any reinforcement for comparison. The reinforcing fibre acts as a barrier for the curing reaction leading to longer setting time and lesser cross-link density. The fibre and HA reinforced composites have almost the same compressive strength. Nonreinforced material undergoes greater degree of swelling. Among the reinforced materials, the hydroxyapatite reinforced composite has a much higher swelling percentage than the fibre reinforced one. The studies on in vitro degradation of the cured materials reveal hydrolytic degradation in Ringer's solution and PBS medium during aging. All the three materials are found to swell initially in Ringer's solution and PBS medium during aging and then undergo gradual degradation. Compression properties of these cross-linked composites increase with aging; HA reinforced composite has the highest compressive strength and compressive modulus, whereas the aged fibre-reinforced composite has the least compressive strength and modulus. PMID:20126578

  15. Polypropylene fumarate/phloroglucinol triglycidyl methacrylate blend for use as partially biodegradable orthopaedic cement.

    PubMed

    Jayabalan, M; Thomas, V; Rajesh, P N

    2001-10-01

    Polypropylene fumarate/phloroglucinol triglycidyl methacrylate oligomeric blend-based bone cement was studied. Higher the percentage of phloroglucinol triglycidyl methacrylate, lesser the setting time. An optimum setting time could be arrived with 50:50 blend composition of the two oligomers. Composite cement of 50:50 blend prepared with hydroxyapatite granules of particle size 125 microm binds bovine rib bones. The tensile strength of this adhesive bond was found to be 1.11 kPa. The thermal studies suggest the onset of cross-linking reaction in the cured blend if the blend is heated. The absence of softening endotherm in the cured blend shows the thermosetting-like amorphous nature of blend system, which may restrict the changes in creep properties. The in vitro biodegradation studies reveal possible association of calcium ions with negatively charged units of degrading polymer chain resulting in slow down of degradation. Relatively slow degradation was observed in Ringer's solution. The study reveals the potential use of polypropylene fumarate/phloroglucinol triglycidyl methacrylate as partially degradable polymeric cement for orthopaedic applications.

  16. Studies on Poly(propylene fumarate-co-caprolactone diol) Thermoset Composites towards the Development of Biodegradable Bone Fixation Devices.

    PubMed

    Jayabalan, M

    2009-01-01

    The effect of reinforcement in the cross-linked poly(propylene fumarate-co-caprolactone diol) thermoset composites based on Kevlar fibres and hydroxyapatite was studied. Cross-linked poly(propylene fumarate-co-caprolactone diol) was also studied without any reinforcement for comparison. The reinforcing fibre acts as a barrier for the curing reaction leading to longer setting time and lesser cross-link density. The fibre and HA reinforced composites have almost the same compressive strength. Nonreinforced material undergoes greater degree of swelling. Among the reinforced materials, the hydroxyapatite reinforced composite has a much higher swelling percentage than the fibre reinforced one. The studies on in vitro degradation of the cured materials reveal hydrolytic degradation in Ringer's solution and PBS medium during aging. All the three materials are found to swell initially in Ringer's solution and PBS medium during aging and then undergo gradual degradation. Compression properties of these cross-linked composites increase with aging; HA reinforced composite has the highest compressive strength and compressive modulus, whereas the aged fibre-reinforced composite has the least compressive strength and modulus.

  17. Metabolic flexibility of a prospective bioremediator: Desulfitobacterium hafniense Y51 challenged in chemostats.

    PubMed

    Marozava, Sviatlana; Vargas-López, Raquel; Tian, Ye; Merl-Pham, Juliane; Braster, Martin; Meckenstock, Rainer U; Smidt, Hauke; Röling, Wilfred F M; Westerhoff, Hans V

    2018-06-19

    Desulfitobacterium hafniense Y51 has been widely used in investigations of perchloroethylene (PCE) biodegradation, but limited information exists on its other physiological capabilities. We investigated how D. hafniense Y51 confronts the debilitating limitations of not having enough electron donor (lactate), or electron acceptor (fumarate) during cultivation in chemostats. The residual concentrations of the substrates supplied in excess were much lower than expected. Transcriptomics, proteomics, and fluxomics were integrated to investigate how this phenomenon was regulated. Through diverse regulation at both transcriptional and translational levels, strain Y51 turned to fermenting the excess lactate and disproportionating the excess fumarate under fumarate- and lactate-limiting conditions, respectively. Genes and proteins related to the utilization of a variety of alternative electron donors and acceptors absent from the medium were induced, apparently involving the Wood-Ljungdahl pathway. Through this metabolic flexibility, D. hafniense Y51 may be able to switch between different metabolic capabilities under limiting conditions. This article is protected by copyright. All rights reserved. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Efficacy, safety, bone and metabolic effects of HIV nucleoside reverse transcriptase inhibitor BMS-986001 (AI467003): a phase 2b randomised, controlled, partly blinded trial.

    PubMed

    Gupta, Samir K; McComsey, Grace A; Lombaard, John; Echevarría, Juan; Orrell, Catherine; Avihingsanon, Anchalee; Osiyemi, Olayemi; Santoscoy, Mario; Ray, Neelanjana; Stock, David A; Joshi, Samit R; Hanna, George J; Lataillade, Max

    2016-01-01

    BMS-986001 is a thymidine analogue nucleoside reverse transcriptase inhibitor (NRTI) designed to maintain in-vitro antiviral activity while minimising off-target effects. We assessed the efficacy and safety of BMS-986001 versus tenofovir disoproxil fumarate in treatment-naive patients with HIV-1. In this phase 2b, randomised, active-controlled trial (AI467003), we recruited treatment-naive (no current or previous exposure to an antiretroviral drug for >1 week) adults (aged at least 18 years) with HIV-1 from 47 sites across Asia, Australia, Europe, North America, South Africa, and South America. Patients with plasma HIV-1 RNA greater than 5000 copies per mL and CD4 counts greater than 200 cells per μL were randomly assigned (2:2:2:3) to receive BMS-986001 100 mg, 200 mg, or 400 mg once a day or to receive tenofovir disoproxil fumarate 300 mg once a day; each allocation was given with efavirenz 600 mg once a day and lamivudine 300 mg once a day. Both patients and investigators were masked to BMS-986001 dose (achieved with similar looking placebo tablets), but not allocation up to and including week 48. The primary endpoints were the proportion of patients with plasma HIV-1 RNA less than 50 copies per mL and safety events (serious adverse events and adverse events leading to discontinuation) through week 24; the main analysis was with a modified intention-to-treat population. Resistance analysis was a secondary endpoint, and additional safety parameters were exploratory endpoints. This trial is registered with ClinicalTrials.gov, number NCT01489046, and the European Clinical Trials Database, number EudraCT 2011-003329-89. Patients were recruited between Jan 25, 2012, and Oct 3, 2012; 757 patients were assessed for eligibility and 301 were randomly assigned to receive either BMS-986001 once a day (67 patients to 100 mg, 67 to 200 mg, and 66 to 400 mg) or tenofovir disoproxil fumarate (n=101). 297 patients received at least one dose of study drug. At week 24, 57 (88%) of 65 patients for whom there were data in the 100 mg group, 54 (81%) of 67 in the 200 mg group, 62 (94%) of 66 in the 400 mg group achieved HIV-1 RNA less than 50 copies per mL, compared with 88 (89%) of 99 in the tenofovir disoproxil fumarate group (modified intention-to-treat population). BMS-986001 was generally well tolerated through week 48. Two patients had BMS-986001-related serious adverse events (atypical drug eruption and thrombocytopenia) and two in the tenofovir disoproxil fumarate group had study drug-related serious adverse events (potential drug-induced liver injury and depression or lipodystrophy) that led to discontinuation. NRTI resistance-associated mutations were reported in four (2%) of 198 patients, and non-NRTI mutations in 17 (9%) of 198 patients receiving BMS-986001 versus none of 99 and one (1%) of 99 patients receiving tenofovir disoproxil fumarate, respectively. Compared with tenofovir disoproxil fumarate, individuals in the BMS-986001 groups showed a smaller decrease in lumbar spine and hip bone mineral density but greater accumulation of limb and trunk fat, subcutaneous and visceral adipose tissue, and increased total cholesterol. BMS-986001 had similar efficacy to that of tenofovir disoproxil fumarate and was associated with a smaller decrease in bone mineral density; however, greater resistance and gains in both peripheral and central fat accumulation were recorded for the investigational drug. Bristol-Myers Squibb has discontinued its involvement in the development of BMS-986001, and future decisions on development will be made by Oncolys BioPharma. Bristol-Myers Squibb. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Low Risk of Proximal Tubular Dysfunction Associated With Emtricitabine-Tenofovir Disoproxil Fumarate Preexposure Prophylaxis in Men and Women

    PubMed Central

    Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina

    2016-01-01

    Objective. Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). Methods. A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Results. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52–3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10–14.0; P > .99). Conclusions. Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. PMID:27029778

  20. Dimethyl fumarate reduces the risk of mycotoxins via improving intestinal barrier and microbiota

    PubMed Central

    Ma, Ning; Wu, Yi; Xie, Fei; Du, Kexin; Wang, Yuan; Shi, Linxin; Ji, Linbao; Liu, Tianyi; Ma, Xi

    2017-01-01

    The effects of dimethyl fumarate (DMF) on mycotoxins and animal growth performance are well documented. However, its mechanism of anti-mildew effects is still unknown. The current study investigated how DMF detoxified the mycotoxin and improved the growth performance using BALB/c mice model, especially its effects on intestinal barrier function and gut micro-ecology. Our study also compared with the ultraviolet radiation (UR) treatment, a traditional anti-mildew control (TC). The results indicated that the DMF treatment had a lower contents of mycotoxin, better growth performance and improved mucosal morphology (P < 0.05), accompanied with the decreased intestinal permeability and the tighter gut barrier. Moreover, the efficiency of DMF was better than TC (P < 0.05). 16S rRNA gene sequence analysis revealed that the richness and diversity of bacteria was increased in DMF treatment. The most abundant OTUs belonged to Firmicutes and Bacteroidetes, and their changes in DMF were more moderate than the TC group, suggesting a more stable micro-ecology and the positive impact of DMF on the biodiversity of intestine. Specifically, the increased abundance of bacteria producing short-chain fatty acids (SCFAs), such as Gemella, Roseburia, Bacillus and Bacteroides in DMF group and prebiotics such as Lactobacillus in TC group, suggested a more healthier microbial composition and distribution. These findings supported that DMF had significant effects on animal's growth performance and intestinal barrier function by modulating the pathway of nutrient absorption and increasing the diversity and balance of gut microbes, which also illuminate that DMF is more efficient than traditional anti-mildew method. PMID:28574825

  1. Gateways to clinical trials.

    PubMed

    Tomillero, A; Moral, M A

    2010-01-01

    (-)-Epigallocatechin gallate, Abafungin, ACE-031, Adapalene/benzoyl peroxide, AE-37, Aflibercept, AGS-003, Albiglutide, Alemtuzumab, Aliskiren fumarate, ALT-801, AN-2728, Anacetrapib, API, Aprepitant, ARQ-197, Ascorbic acid, Atazanavir sulfate, ATN-224, AVI-4658, Azacitidine, Azelnidipine; Belinostat, Bevacizumab, BI-2536, Biphasic insulin aspart, Bortezomib, Bovine lactoferrin, Bryostatin 1, Budesonide/formoterol fumarate; cAC10, Canfosfamide hydrochloride, Cediranib, Clofarabine, Cocaine conjugate vaccine; Darbepoetin alfa, Dasatinib, Denosumab, Disomotide, Doripenem, Dovitinib Lactate, Dronedarone hydrochloride, Drospirenone/estradiol, Dutasteride; Ecogramostim, Entinostat, Enzastaurin hydrochloride, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Fampridine, Fenretinide LXS, FFR-factor VIIa, Fingolimod hydrochloride, Frovatriptan; Gefitinib, Gimatecan, GP-2/GM-CSF; Iloperidone, Imatinib mesylate, Indibulin, Ipilimumab, Ivabradine hydrochloride; Lactobacillus rhamnosus, Lapatinib ditosylate, LC-07, Lenalidomide, Linifanib, Liposomal doxorubicin, Liposomal vincristine, Litenimod, Lutein; M-118, MDX-1401, MEDI-528, Midostaurin, Miglustat, MK-0657; Natalizumab, Nesiritide, NGR-TNF, Niacin/simvastatin; Obatoclax mesylate, Olaparib, Omacetaxine mepesuccinate; Paclitaxel nanoparticles, Paclitaxel-eluting stent, Palonosetron hydrochloride, Pazopanib hydrochloride, Pegfilgrastim, Pemetrexed disodium, PER.C-flu, Perifosine, PF-02341066, Pimecrolimus, Pitrakinra, Plerixafor hydrochloride, Posaconazole; Rasburicase, Recombinant human relaxin H2, ReoT3D, Retaspimycin hydrochloride, Riferminogene pecaplasmid, Rindopepimut, Romiplostim, Ronacaleret hydrochloride, Rosuvastatin calcium, Rotigotine; Sagopilone, sALP-FcD10, SAR-245409, SCH-697243, Selumetinib, Sirolimus-eluting stent, SIR-Spheres, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tandutinib, Tasimelteon, Temsirolimus, Teriparatide, Tiotropium bromide, TIV, Trabectedin, Tremelimumab, TRU-016; Vadimezan, Val8-GLP-1(7-37)OH, Vandetanib, Vernakalant hydrochloride, Voreloxin, Voriconazole, Vorinostat, Yttrium 90 (90Y) ibritumomab tiuxetan; Zeaxanthin, Ziprasidone hydrochloride, Zosuquidar trihydrochloride. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

  2. Pearson Syndrome: A Retrospective Cohort Study from the Marrow Failure Study Group of A.I.E.O.P. (Associazione Italiana Emato-Oncologia Pediatrica).

    PubMed

    Farruggia, Piero; Di Cataldo, Andrea; Pinto, Rita M; Palmisani, Elena; Macaluso, Alessandra; Valvo, Laura Lo; Cantarini, Maria E; Tornesello, Assunta; Corti, Paola; Fioredda, Francesca; Varotto, Stefania; Martire, Baldo; Moroni, Isabella; Puccio, Giuseppe; Russo, Giovanna; Dufour, Carlo; Pillon, Marta

    2016-01-01

    Pearson syndrome (PS) is a very rare and often fatal multisystemic mitochondrial disorder involving the liver, kidney, pancreas, and hematopoietic and central nervous system. It is characterized principally by a transfusion-dependent anemia that usually improves over time, a tendency to develop severe infections, and a high mortality rate. We describe a group of 11 PS patients diagnosed in Italy in the period 1993-2014. The analysis of this reasonably sized cohort of patients contributes to the clinical profile of the disease and highlights a rough incidence of 1 case/million newborns. Furthermore, it seems that some biochemical parameters like increased serum alanine and urinary fumaric acid can help to address an early diagnosis.

  3. l-Asparaginase from Proteus vulgaris1

    PubMed Central

    Tosa, Tetsuya; Sano, Ryujiro; Yamamoto, Kozo; Nakamura, Masatoshi; Ando, Katsuko; Chibata, Ichiro

    1971-01-01

    To produce an immunologically and enzymologically new type of l-asparaginase, 108 strains of bacteria were screened for enzyme production. As a result, 13 bacteria belonging to the genera Alcaligenes, Bacterium, and Proteus were found to produce l-asparaginases in high levels. Among these l-asparaginases, partially purified l-asparaginases from B. cadaveris and P. vulgaris showed antitumor activity. A partially purified l-asparaginase preparation of P. vulgaris did not react with the antibody of Escherichia colil-asparaginase on the Ouchterlony agar plate. Culture conditions for the production of l-asparaginase by P. vulgaris were investigated in detail. The enzyme was produced in high yields when cells were grown aerobically in a medium containing sodium fumarate and corn steep liquor. The addition of glucose or ammonium ion to the medium, however, resulted in depressed production of l-asparaginase. Under the optimum conditions, 3,700 international units of l-asparaginase was obtained from 1 liter of culture medium. Images PMID:5000866

  4. Enhancement of succinate yield by manipulating NADH/NAD+ ratio and ATP generation.

    PubMed

    Li, Jiaojiao; Li, Yikui; Cui, Zhiyong; Liang, Quanfeng; Qi, Qingsheng

    2017-04-01

    We previously engineered Escherichia coli YL104 to efficiently produce succinate from glucose. In this study, we investigated the relationships between the NADH/NAD + ratio, ATP level, and overall yield of succinate production by using glucose as the carbon source in YL104. First, the use of sole NADH dehydrogenases increased the overall yield of succinate by 7% and substantially decreased the NADH/NAD + ratio. Second, the soluble fumarate reductase from Saccharomyces cerevisiae was overexpressed to manipulate the anaerobic NADH/NAD + ratio and ATP level. Third, another strategy for reducing the ATP level was applied by introducing ATP futile cycling for improving succinate production. Finally, a combination of these methods exerted a synergistic effect on improving the overall yield of succinate, which was 39% higher than that of the previously engineered strain YL104. The study results indicated that regulation of the NADH/NAD + ratio and ATP level is an efficient strategy for succinate production.

  5. Tenofovir-induced kidney injury.

    PubMed

    Gitman, Michael D; Hirschwerk, David; Baskin, Cindy H; Singhal, Pravin C

    2007-03-01

    Tenofovir disoproxil fumarate is a nucleotide reverse transcriptase inhibitor with activity against both HIV and the hepatitis B virus. It has had minimal nephrotoxic effects in early clinical trials, but as clinical use has widened, case reports describing tenofovir-induced renal tubular damage, Fanconi's syndrome and diabetes insipidus have been described. The authors review the pharmacokinetics, mechanism of action and clinical uses of tenofovir disoproxil fumarate. The large clinical trials, as well as the case reports of tenofovir-induced kidney injury, are also reviewed. The potential mechanism of renal damage is discussed and recommendations for evaluation and treatment of tenofovir-induced kidney injury are given.

  6. Mechanical energy storage performance of an aluminum fumarate metal–organic framework† †Electronic supplementary information (ESI) available: Experimental procedures, X-ray diffraction, and molecular simulation. See DOI: 10.1039/c5sc02794b

    PubMed Central

    Vanduyfhuys, Louis; Alvarez, Elsa; Rodriguez, Julien; Itié, Jean-Paul; Fabry, Paul; Guillou, Nathalie; Devic, Thomas; Beurroies, Isabelle; Llewellyn, Philip L.; Van Speybroeck, Veronique; Serre, Christian; Maurin, Guillaume

    2016-01-01

    The aluminum fumarate MOF A520 or MIL-53–FA is revealed to be a promising material for mechanical energy-related applications with performances in terms of work and heat energies which surpass those of any porous solids reported so far. Complementary experimental and computational tools are deployed to finely characterize and understand the pressure-induced structural transition at the origin of these unprecedented levels of performance. PMID:29861993

  7. Potential of ion chromatography coupled to isotope ratio mass spectrometry via a liquid interface for beverages authentication.

    PubMed

    Guyon, Francois; Gaillard, Laetitia; Brault, Audrey; Gaultier, Nicolas; Salagoïty, Marie-Hélène; Médina, Bernard

    2013-12-27

    New tools for the determination of characteristic parameters for food authentication are requested to prevent food adulteration from which health concerns, unfair competition could follow. A new coupling in the area of compound-specific carbon 13 isotope ratio (δ(13)C) analysis was developed to simultaneously quantify δ(13)C values of sugars and organic acids. The coupling of ion chromatography (IC) together with isotope ratio mass spectrometry (IRMS) can be achieved using a liquid interface allowing a chemical oxidation (co) of organic matter. Synthetic solutions containing 1 polyol (glycerol), 3 carbohydrates (sucrose, glucose and fructose) and 12 organic acids (gluconic, lactic, malic, tartaric, oxalic, fumaric, citric and isocitric) were used to optimize chromatographic conditions (concentration gradient and 3 types of column) and the studied isotopic range (-32.28 to -10.65‰) corresponds to the values found in food products. Optimum chromatographic conditions are found using an IonPac AS15, an elution flow rate of 0.3mLmin(-1) and a linear concentration gradient from 2 to 76mM (rate 21mMmin(-1)). Comparison between δ(13)C value individually obtained for each compound with the coupling IRMS and elemental analyzer, EA-IRMS, and the ones measured on the mixture of compounds by IC-co-IRMS does not reveal any isotope fractionation. Thus, under these experimental conditions, IC-co-IRMS results are accurate and reproducible. This new coupling was tested on two food matrices, an orange juice and a sweet wine. Some optimization is necessary as the concentration range between sugars and organic acids is too large: an increase in the filament intensity of the IRMS is necessary to simultaneously detect the two compound families. These first attempts confirm the good results obtained on synthetic solutions and the strong potential of the coupling IC-co-IRMS in food authentication area. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Salt and cocrystals of sildenafil with dicarboxylic acids: solubility and pharmacokinetic advantage of the glutarate salt.

    PubMed

    Sanphui, Palash; Tothadi, Srinu; Ganguly, Somnath; Desiraju, Gautam R

    2013-12-02

    Sildenafil is a drug used to treat erectile dysfunction and pulmonary arterial hypertension. Because of poor aqueous solubility of the drug, the citrate salt, with improved solubility and pharmacokinetics, has been marketed. However, the citrate salt requires an hour to reach its peak plasma concentration. Thus, to improve solubility and bioavailability characteristics, cocrystals and salts of the drug have been prepared by treating aliphatic dicarboxylic acids with sildenafil; the N-methylated piperazine of the drug molecule interacts with the carboxyl group of the acid to form a heterosynthon. Salts are formed with oxalic and fumaric acid; salt monoanions are formed with succinic and glutaric acid. Sildenafil forms cocrystals with longer chain dicarboxylic acids such as adipic, pimelic, suberic, and sebacic acids. Auxiliary stabilization via C-H···O interactions is also present in these cocrystals and salts. Solubility experiments of sildenafil cocrystal/salts were carried out in 0.1N HCl aqueous medium and compared with the solubility of the citrate salt. The glutarate salt and pimelic acid cocrystal dissolve faster than the citrate salt in a two hour dissolution experiment. The glutarate salt exhibits improved solubility (3.2-fold) compared to the citrate salt in water. Solubilities of the binary salts follow an inverse correlation with their melting points, while the solubilities of the cocrystals follow solubilities of the coformer. Pharmacokinetic studies on rats showed that the glutarate salt exhibits doubled plasma AUC values in a single dose within an hour compared to the citrate salt. The high solubility of glutaric acid, in part originating from the strained conformation of the molecule and its high permeability, may be the reason for higher plasma levels of the drug.

  9. Acidification of apple and orange hosts by Penicillium digitatum and Penicillium expansum.

    PubMed

    Vilanova, L; Viñas, I; Torres, R; Usall, J; Buron-Moles, G; Teixidó, N

    2014-05-16

    New information about virulence mechanisms of Penicillium digitatum and Penicillium expansum could be an important avenue to control fungal diseases. In this study, the ability of P. digitatum and P. expansum to enhance their virulence by locally modulating the pH of oranges and apples was evaluated. For each host, pH changes with a compatible pathogen and a non-host pathogen were recorded, and the levels of different organic acids were evaluated to establish possible relationships with host pH modifications. Moreover, fruits were harvested at three maturity stages to determine whether fruit maturity could affect the pathogens' virulence. The pH of oranges and apples decreased when the compatible pathogens (P. digitatum and P. expansum, respectively) decayed the fruit. The main organic acid detected in P. digitatum-decayed oranges was galacturonic acid produced as a consequence of host maceration in the rot development process. However, the obtained results showed that this acid was not responsible for the pH decrease in decayed orange tissue. The mixture of malic and citric acids could at least contribute to the acidification of P. digitatum-decayed oranges. The pH decrease in P. expansum decayed apples is related to the accumulation of gluconic and fumaric acids. The pH of oranges and apples was not affected when the non-host pathogen was not able to macerate the tissues. However, different organic acid contents were detected in comparison to healthy tissues. The main organic acids detected in P. expansum-oranges were oxalic and gluconic and in P. digitatum-apples were citric, gluconic and galacturonic. Further research is needed to identify the pathogenicity factors of both fungi because the contribution of organic acids has profound implications. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Comparison of ion-pair chromatography and capillary zone electrophoresis for the assay of organic acids as markers of abnormal metabolism.

    PubMed

    Wang, Shu-Ping; Liao, Chiou-Shyi

    2004-10-08

    The abnormal organic acids in urine are closely related with physiological metabolism. To determinate the low-molecular-mass metabolites in human biological fluids, although there were some previous reports by both of capillary electrophoresis and ion-exchange high-performance liquid chromatography, but it was rarely found by reverse phase of liquid chromatography using ion pair reagent. The objective of this study was aimed to suggest and compare two methods, an additional chromatographic method-ion-pair chromatography (IPC) and a sharp capillary zone electrophoresis (CZE), to determinate organic acids, acting as the abnormal metabolic markers, namely uric acid, orotic acid, pyruvic acid, alpha-ketoglutaric acid, fumaric acid, and hippuric acid. The proposed method of IPC possessed both the extreme stability for column and the good results of reproducibility, linearity and detection limit. The optimum mobile phase was 22% methanol and 10 mM tetra-n-butyl ammonium hydrogen sulfate (pH 4) by gradient elution. As well as the optimum condition of CZE was 5% acetonitrile and 0.5 mM CTAB in phosphate buffer. From the results, CZE showed better recovery and sharp lucid electropherogram. Finally, the two proposed analytical methods were applied to assay human urine with direct and spiked analysis. CZE showed good potency to overcome the sample-to sample variation with standard deviation less than 10%. By comparison results of urinary spiked analysis between IPC and CZE by statistical paired t-test, the results were evaluated no significant difference under P < 0.05. The quantitative linearity of both methods was fitted in application of clinical biological analysis even with 50-fold dilution.

  11. Reformulating polycaprolactone fumarate to eliminate toxic diethylene glycol: effects of polymeric branching and autoclave sterilization on material properties.

    PubMed

    Runge, M Brett; Wang, Huan; Spinner, Robert J; Windebank, Anthony J; Yaszemski, Michael J

    2012-01-01

    Polycaprolactone fumarate (PCLF) is a cross-linkable derivative of polycaprolactone diol that has been shown to be an effective nerve conduit material that supports regeneration across segmental nerve defects and has warranted future clinical trials. Degradation of PCLF (PCLF(DEG)) releases toxic small molecules of diethylene glycol used as the initiator for the synthesis of polycaprolactone diol. In an effort to eliminate this toxic degradation product we present a strategy for the synthesis of PCLF from either propylene glycol (PCLF(PPD)) or glycerol (PCLF(GLY)). PCLF(PPD) is linear and resembles the previously studied PCLF(DEG), while PCLF(GLY) is branched and exhibits dramatically different material properties. The synthesis and characterization of their thermal, rheological, and mechanical properties are reported. The results show that the linear PCLF(PPD) has material properties similar to the previously studied PCLF(DEG). The branched PCLF(GLY) exhibits dramatically lower crystalline properties resulting in lower rheological and mechanical moduli, and is therefore a more compliant material. In addition, the question of an appropriate Food and Drug Administration approvable sterilization method is addressed. This study shows that autoclave sterilization of PCLF materials is an acceptable sterilization method for cross-linked PCLF and has minimal effect on the PCLF thermal and mechanical properties. Copyright © 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  12. An understanding of modified release matrix tablets behavior during drug dissolution as the key for prediction of pharmaceutical product performance - case study of multimodal characterization of quetiapine fumarate tablets.

    PubMed

    Kulinowski, Piotr; Woyna-Orlewicz, Krzysztof; Rappen, Gerd-Martin; Haznar-Garbacz, Dorota; Węglarz, Władysław P; Dorożyński, Przemysław P

    2015-04-30

    Motivation for the study was the lack of dedicated and effective research and development (R&D) in vitro methods for oral, generic, modified release formulations. The purpose of the research was to assess multimodal in vitro methodology for further bioequivalence study risk minimization. Principal results of the study are as follows: (i) Pharmaceutically equivalent quetiapine fumarate extended release dosage form of Seroquel XR was developed using a quality by design/design of experiment (QbD/DoE) paradigm. (ii) The developed formulation was then compared with originator using X-ray microtomography, magnetic resonance imaging and texture analysis. Despite similarity in terms of compendial dissolution test, developed and original dosage forms differed in micro/meso structure and consequently in mechanical properties. (iii) These differences were found to be the key factors of failure of biorelevant dissolution test using the stress dissolution apparatus. Major conclusions are as follows: (i) Imaging methods allow to assess internal features of the hydrating extended release matrix and together with the stress dissolution test allow to rationalize the design of generic formulations at the in vitro level. (ii) Technological impact on formulation properties e.g., on pore formation in hydrating matrices cannot be overlooked when designing modified release dosage forms. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Therapeutic effects of oral dimethyl fumarate on stroke induced by middle cerebral artery occlusion: An animal experimental study.

    PubMed

    Safari, Anahid; Fazeli, Mehdi; Namavar, Mohammad Reza; Tanideh, Nader; Jafari, Peyman; Borhani-Haghighi, Afshin

    2017-01-01

    Dimethyl fumarate (DMF) has immune-modulatory and neuro-protective characteristics that can be used for treatment of acute ischemic stroke. To investigate the therapeutic effects of DMF on histological and functional recovery of rats after transient middle cerebral artery (MCA) occlusion. 22 Sprague-Dawley male rats weighing 275-300 g were randomized into three groups by block randomization. In the sham group (n = 7), the neck was opened, but neither MCA was occluded, nor any drug was administered.The control group (n = 7) was treated with vehicle (methocel) by gavage for 14 days after MCA occlusion. In the DMF-treated group (n = 8), treatment was performed with 15 mg/kg body weight dimethyl fumarate twice a day for 14 days after MCA occlusion. Transient occlusion of the right MCA was performed by intraluminal thread method in the DMF-treated and the control group. Neurological deficit score (NDS), pole test, and adhesive removal test were performed before the surgery, and on post-operative Days 0, 3, 5, 7, 10, and 14. After the final behaviour test, the animals' brains were perfused and removed. Brains were frozen and sectioned serially and coronally using a cryostat. Infract volume and brain volume were estimated by stereology. The percentage of infarct volume was significantly lower in DMF-treated animals (5.76%) than in the control group (22.39%) (P < 0.0001). Regarding behavioural tests, the DMF-treated group showed better function in NDS on Days 7 (P = 0.041) and 10 (P = 0.046), but not in pole and adhesive removal tests. There was no significant correlation between behavioural tests and histological results. Dimethyl fumarate could be beneficial as a potential neuroprotective agent in the treatment of stroke.

  14. Structural and biochemical analyses reveal insights into covalent flavinylation of the Escherichia coli Complex II homolog quinol:fumarate reductase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Starbird, C. A.; Maklashina, Elena; Sharma, Pankaj

    The Escherichia coli Complex II homolog quinol:fumarate reductase (QFR, FrdABCD) catalyzes the interconversion of fumarate and succinate at a covalently attached FAD within the FrdA subunit. The SdhE assembly factor enhances covalent flavinylation of Complex II homologs, but the mechanisms underlying the covalent attachment of FAD remain to be fully elucidated. Here, we explored the mechanisms of covalent flavinylation of the E. coli QFR FrdA subunit. Using a ΔsdhE E. coli strain, we show that the requirement for the assembly factor depends on the cellular redox environment. We next identified residues important for the covalent attachment and selected the FrdAE245more » residue, which contributes to proton shuttling during fumarate reduction, for detailed biophysical and structural characterization. We found that QFR complexes containing FrdAE245Q have a structure similar to that of the WT flavoprotein, but lack detectable substrate binding and turnover. In the context of the isolated FrdA subunit, the anticipated assembly intermediate during covalent flavinylation, FrdAE245 variants had stability similar to that of WT FrdA, contained noncovalent FAD, and displayed a reduced capacity to interact with SdhE. However, small-angle X-ray scattering (SAXS) analysis of WT FrdA cross-linked to SdhE suggested that the FrdAE245 residue is unlikely to contribute directly to the FrdA-SdhE protein-protein interface. We also found that no auxiliary factor is absolutely required for flavinylation, indicating that the covalent flavinylation is autocatalytic. We propose that multiple factors, including the SdhE assembly factor and bound dicarboxylates, stimulate covalent flavinylation by preorganizing the active site to stabilize the quinone-methide intermediate.« less

  15. Use of microencapsulated iron(II) fumarate sprinkles to prevent recurrence of anaemia in infants and young children at high risk.

    PubMed Central

    Zlotkin, Stanley; Antwi, Kojo Yeboah; Schauer, Claudia; Yeung, George

    2003-01-01

    OBJECTIVE: To compare the effectiveness of microencapsulated iron(II) fumarate sprinkles (with and without vitamin A), iron(II) sulfate drops, and placebo sprinkles in preventing recurrence of anaemia and to determine the long-term haematological outcomes in children at high risk of recurrence of anaemia 12 months after the end of supplementation. METHODS: A prospective, randomized, placebo-controlled design was used to study 437 Ghanaian children aged 8-20 months who were not anaemic (haemoglobin > or = 100 g/l). Four groups were given microencapsulated iron(II) fumarate sprinkles, microencapsulated iron(II) fumarate sprinkles with vitamin A, iron(II) sulfate drops or placebo sprinkles daily for six months. Primary outcome measures were change in haemoglobin and anaemic status at baseline and study end. Non-anaemic children at the end of the supplementation period were reassessed 12 months after supplementation ended. FINDINGS: Overall, 324 children completed the supplementation period. Among the four groups, no significant changes were seen in mean haemoglobin, ferritin or serum retinol values from baseline to the end of the supplementation period. During the trial, 82.4% (267/324) of children maintained their non-anaemic status. Sprinkles were well accepted without complications. At 12 months post-supplementation, 77.1% (162/210) of children with no intervention remained non-anaemic. This proportion was similar for children among the four groups. CONCLUSION: In most children previously treated for anaemia, further supplementation was not needed to maintain their non-anaemic status. These results may have important implications for community intervention programmes in which initial high-dose treatment is needed because of a high prevalence of anaemia. PMID:12756979

  16. Genomic, proteomic, and biochemical analysis of the organohalide respiratory pathway in Desulfitobacterium dehalogenans.

    PubMed

    Kruse, Thomas; van de Pas, Bram A; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M; van der Oost, John; Smidt, Hauke; Stams, Alfons J M

    2015-03-01

    Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1(T) consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Genomic, Proteomic, and Biochemical Analysis of the Organohalide Respiratory Pathway in Desulfitobacterium dehalogenans

    PubMed Central

    van de Pas, Bram A.; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R.; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M.; van der Oost, John; Smidt, Hauke

    2014-01-01

    Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1T consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. PMID:25512312

  18. Combination Therapy of Etanercept and Fumarates versus Etanercept Monotherapy in Psoriasis: A Randomized Exploratory Study

    PubMed Central

    van Bezooijen, Ji Sun; Balak, Deepak M.W.; van Doorn, Martijn B.A.; Looman, Caspar W.N.; Schreurs, Marco W.J.; Koch, Birgit C.P.; van Gelder, Teun; Prens, Errol P.

    2016-01-01

    Background Biologics are a safe and efficacious therapy for psoriasis. The drug survival of biologics may be disappointing, primarily due to loss of efficacy. Therefore, safe combination treatments are sought to improve their clinical response. Objective To assess the efficacy, safety and tolerability of the combination therapy of etanercept with fumarates versus etanercept monotherapy. Methods Thirty-three patients with psoriasis were randomized 1:1 to receive etanercept combined with fumarates or etanercept monotherapy. The primary outcome measure was the difference in PASI-75 response after 24 weeks; additionally, a longitudinal analysis was performed. An important secondary outcome measure was the proportion of patients with a Physician Global Assessment (PGA) of clear or almost clear. Adverse events were collected throughout the study. Results In the combination therapy group, 78% (14 out of 18 patients) reached PASI-75 at week 24 versus 57% (8 out of 14 patients) in the monotherapy group (p = 0.27). The longitudinal analysis showed a PASI reduction of 5.97% per week for the combination therapy group and of 4.76% for the monotherapy group (p = 0.11). In the combination therapy group, 94% (17 out of 18 patients) of patients had a PGA of clear/almost clear versus 64% (9 out of 14 patients) in the monotherapy group (p = 0.064). The incidence of mild gastrointestinal complaints was higher in the combination group than in the monotherapy group. Conclusion Using the PGA, combination therapy showed a trend towards faster improvement in the first 24 weeks. The difference in the PASI score between the two groups was not statistically significant. Addition of fumarates to etanercept for 48 weeks appeared safe with an acceptable tolerability. PMID:27576483

  19. Gastro-protective and Anti-stress Efficacies of Monomethyl Fumarate and a Fumaria indica Extract in Chronically Stressed Rats.

    PubMed

    Shakya, Anshul; Soni, Upendra Kumar; Rai, Geeta; Chatterjee, Shyam Sunder; Kumar, Vikas

    2016-05-01

    Results of the very first experiments conducted to evaluate therapeutic potentials of a fumarate containing Fumaria indica extract and of fairly low daily oral doses of monomethyl fumarate for prevention of chronic unavoidable foot-shock stress-induced gastric ulcers, and possible involvement of diverse neuro-hormonal and oxidative process in their stress response desensitizing effects are reported and discussed in this article. Preventive effects of 21 daily oral 60, 120, and 240 mg/kg doses of a standardized 50 % methanolic F. indica extract (MFI) and 1.25, 2.50, and 5.00 mg/kg/day of pure monomethyl fumarate (MMF) were compared in rats subjected to one hour daily unavoidable foot-shocks. A pharmaceutically well-standardized Withania somnifera (WS) root extract was used as a reference herbal anti-stress agent in all experiments. Effects of the treatments on stress-induced alterations in body weight, adrenal and spleen weights, gastric ulcer and ulcer index, weight of glandular stomach, protective mucosal glycoprotein content, cellular proliferation, oxidative stress on stomach fundus, and brain tissues of male rats were quantified. Other parameters quantified were plasma corticosterone levels, brain monoamine levels, and expressions of the cytokines TNF-α, IL-10, and IL-1β in blood and brain of stressed and treated rats. Most but not every observed stress-induced anomalies were suppressed or completely prevented by both MFI and pure MMF treatments in dose-dependent manner. Qualitatively, the observed activity profiles of both of them were similar to those of WS dose tested. These results reveal that both MFI and MMF are potent gastro-protective agents against chronic unavoidable stress-induced ulcers and strongly suggest that they act as regulators or modulators of monoamine, corticosterone, and cytokine homeostasis.

  20. Alginate-polyester comacromer based hydrogels as physiochemically and biologically favorable entities for cardiac tissue engineering.

    PubMed

    Thankam, Finosh G; Muthu, Jayabalan

    2015-11-01

    The physiochemical and biological responses of tissue engineering hydrogels are crucial in determining their desired performance. A hybrid comacromer was synthesized by copolymerizing alginate and poly(mannitol fumarate-co-sebacate) (pFMSA). Three bimodal hydrogels pFMSA-AA, pFMSA-MA and pFMSA-NMBA were synthesized by crosslinking with Ca(2+) and vinyl monomers acrylic acid (AA), methacrylic acid (MA) and N,N'-methylene bisacrylamide (NMBA), respectively. Though all the hydrogels were cytocompatible and exhibited a normal cell cycle profile, pFMSA-AA exhibited superior physiochemical properties viz non-freezable water content (58.34%) and water absorption per unit mass (0.97 g water/g gel) and pore length (19.92±3.91 μm) in comparing with other two hydrogels. The increased non-freezable water content and water absorption of pFMSA-AA hydrogels greatly influenced its biological performance, which was evident from long-term viability assay and cell cycle proliferation. The physiochemical and biological favorability of pFMSA-AA hydrogels signifies its suitability for cardiac tissue engineering. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Synthesis of Unsaturated Polyester Resins from Various Bio-Derived Platform Molecules.

    PubMed

    Farmer, Thomas J; Castle, Rachael L; Clark, James H; Macquarrie, Duncan J

    2015-07-02

    Utilisation of bio-derived platform molecules in polymer synthesis has advantages which are, broadly, twofold; to digress from crude oil dependence of the polymer industry and secondly to reduce the environmental impact of the polymer synthesis through the inherent functionality of the bio-derived platform molecules. Bulk polymerisation of bio-derived unsaturated di-acids has been employed to produce unsaturated polyester (UPEs) which have been analysed by GPC, TGA, DSC and NMR spectroscopy, advancing on the analysis previously reported. UPEs from the diesters of itaconic, succinic, and fumaric acids were successfully synthesised with various diols and polyols to afford resins of MN 480-477,000 and Tg of -30.1 to -16.6 °C with solubilities differing based on starting monomers. This range of properties allows for many applications and importantly due to the surviving Michael acceptor moieties, solubility and cross-linking can be specifically tailored, post polymerisation, to the desired function. An improved synthesis of itaconate and succinate co-polymers, via the initial formation of an itaconate bis-diol, is also demonstrated for the first time, resulting in significantly improved itaconate incorporation.

  2. Nickel Availability in Soil as Influenced by Liming and Its Role in Soybean Nitrogen Metabolism

    PubMed Central

    de Macedo, Fernando G.; Bresolin, Joana D.; Santos, Elcio F.; Furlan, Felipe; Lopes da Silva, Wilson T.; Polacco, Joe C.; Lavres, José

    2016-01-01

    Nickel (Ni) availability in soil varies as a function of pH. Plants require Ni in small quantities for normal development, especially in legumes due its role in nitrogen (N) metabolism. This study investigated the effect of soil base saturation, and Ni amendments on Ni uptake, N accumulation in the leaves and grains, as well as to evaluate organic acids changes in soybean. In addition, two N assimilation enzymes were assayed: nitrate reductase (NR) and Ni-dependent urease. Soybean plants inoculated with Bradyrhizobium japonicum were cultivated in soil-filled pots under two base-cation saturation (BCS) ratios (50 and 70%) and five Ni rates – 0.0; 0.1; 0.5; 1.0; and 10.0 mg dm-3 Ni. At flowering (R1 developmental stage), plants for each condition were evaluated for organic acids (oxalic, malonic, succinic, malic, tartaric, fumaric, oxaloacetic, citric and lactic) levels as well as the activities of urease and NR. At the end of the growth period (R7 developmental stage – grain maturity), grain N and Ni accumulations were determined. The available soil-Ni in rhizosphere extracted by DTPA increased with Ni rates, notably in BCS50. The highest concentrations of organic acid and N occurred in BCS70 and 0.5 mg dm-3 of Ni. There were no significant differences for urease activity taken on plants grown at BSC50 for Ni rates, except for the control treatment, while plants cultivated at soil BCS70 increased the urease activity up to 0.5 mg dm-3 of Ni. In addition, the highest values for urease activities were reached from the 0.5 mg dm-3 of Ni rate for both BCS treatments. The NR activity was not affected by any treatment indicating good biological nitrogen fixation (BNF) for all plants. The reddish color of the nodules increased with Ni rates in both BCS50 and 70, also confirms the good BNF due to Ni availability. The optimal development of soybean occurs in BCS70, but requires an extra Ni supply for the production of organic acids and for increased N-shoot and grain accumulation. PMID:27660633

  3. Aminiphilus circumscriptus gen. nov., sp. nov., an anaerobic amino-acid-degrading bacterium from an upflow anaerobic sludge reactor.

    PubMed

    Díaz, C; Baena, S; Fardeau, M-L; Patel, B K C

    2007-08-01

    Strain ILE-2(T) was isolated from an upflow anaerobic sludge bed reactor treating brewery wastewater. The motile, non-sporulating, slightly curved cells (2-4 x 0.1 microm) stained Gram-negative and grew optimally at 42 degrees C and pH 7.1 with 0.5 % NaCl. The strain required yeast extract for growth and fermented Casamino acids, peptone, isoleucine, arginine, lysine, alanine, valine, glutamate, histidine, glutamine, methionine, malate, fumarate, glycerol and pyruvate to acetate, propionate and minor amounts of branched-chain fatty acids. Carbohydrates, formate, acetate, propionate, butyrate, isovalerate, methanol, ethanol, 1-propanol, butanol, lactate, succinate, starch, casein, gelatin, xylan and a number of other amino acids were not utilized. The DNA G+C content of strain ILE-2(T) was 52.7 mol%. 16S rRNA gene sequence analysis revealed that ILE-2(T) was distantly related to members of the genera Aminobacterium (83 % similarity) and Aminomonas (85 % similarity) in the family Syntrophomonadaceae, order Clostridiales, phylum Firmicutes. On the basis of the results of our polyphasic analysis, strain ILE-2(T) represents a novel species and genus within the family Syntrophomonadaceae, for which the name Aminiphilus circumscriptus gen. nov., sp. nov. is proposed. The type strain of Aminiphilus circumscriptus is ILE-2(T) (=DSM 16581(T) =JCM 14039(T)).

  4. Syntrophus aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids and benzoate in syntrophic association with hydrogen-using microorganisms

    NASA Technical Reports Server (NTRS)

    Jackson, B. E.; Bhupathiraju, V. K.; Tanner, R. S.; Woese, C. R.; McInerney, M. J.

    1999-01-01

    Strain SBT is a new, strictly anaerobic, gram-negative, nonmotile, non-sporeforming, rod-shaped bacterium that degrades benzoate and certain fatty acids in syntrophic association with hydrogen/formate-using microorganisms. Strain SBT produced approximately 3 mol of acetate and 0.6 mol of methane per mol of benzoate in coculture with Methanospirillum hungatei strain JF1. Saturated fatty acids, some unsaturated fatty acids, and methyl esters of butyrate and hexanoate also supported growth of strain SBT in coculture with Desulfovibrio strain G11. Strain SBT grew in pure culture with crotonate, producing acetate, butyrate, caproate, and hydrogen. The molar growth yield was 17 +/- 1 g cell dry mass per mol of crotonate. Strain SBT did not grow with fumarate, iron(III), polysulfide, or oxyanions of sulfur or nitrogen as electron acceptors with benzoate as the electron donor. The DNA base composition of strain SBT was 43.1 mol% G+C. Analysis of the 16 S rRNA gene sequence placed strain SBT in the delta-subdivision of the Proteobacteria, with sulfate-reducing bacteria. Strain SBT was most closely related to members of the genus Syntrophus. The clear phenotypic and genotypic differences between strain SBT and the two described species in the genus Syntrophus justify the formation of a new species, Syntrophus aciditrophicus.

  5. Different Polar Metabolites and Protein Profiles between High- and Low-Quality Japanese Ginjo Sake

    PubMed Central

    Takahashi, Kei; Kohno, Hiromi

    2016-01-01

    Japanese ginjo sake is a premium refined sake characterized by a pleasant fruity apple-like flavor and a sophisticated taste. Because of technical difficulties inherent in brewing ginjo sake, off-flavors sometimes occur. However, the metabolites responsible for off-flavors as well as those present or absent in higher quality ginjo sake remain uncertain. Here, the relationship between 202 polar chemical compounds in sake identified using capillary electrophoresis coupled with time-of-flight mass spectrometry and its organoleptic properties, such as quality and off-flavor, was examined. First, we found that some off-flavored sakes contained higher total amounts of metabolites than other sake samples. The results also identified that levels of 2-oxoglutaric acid and fumaric acid, metabolites in the tricarboxylic acid cycle, were highly but oppositely correlated with ginjo sake quality. Similarly, pyridoxine and pyridoxamine, co-enzymes for amino transferase, were also highly but oppositely correlated with ginjo sake quality. Additionally, pyruvic acid levels were associated with good quality as well. Compounds involved in the methionine salvage cycle, oxidative glutathione derivatives, and amino acid catabolites were correlated with low quality. Among off-flavors, an inharmonious bitter taste appeared attributable to polyamines. Furthermore, protein analysis displayed that a diversity of protein components and yeast protein (triosephosphate isomerase, TPI) leakage was linked to the overall metabolite intensity in ginjo sake. This research provides insight into the relationship between sake components and organoleptic properties. PMID:26939054

  6. Integrative Metabolic Signatures for Hepatic Radiation Injury

    PubMed Central

    Su, Gang; Meng, Fan; Liu, Laibin; Mohney, Robert; Kulkarni, Shilpa; Guha, Chandan

    2015-01-01

    Background Radiation-induced liver disease (RILD) is a dose-limiting factor in curative radiation therapy (RT) for liver cancers, making early detection of radiation-associated liver injury absolutely essential for medical intervention. A metabolomic approach was used to determine metabolic signatures that could serve as biomarkers for early detection of RILD in mice. Methods Anesthetized C57BL/6 mice received 0, 10 or 50 Gy Whole Liver Irradiation (WLI) and were contrasted to mice, which received 10 Gy whole body irradiation (WBI). Liver and plasma samples were collected at 24 hours after irradiation. The samples were processed using Gas Chromatography/Mass Spectrometry and Liquid Chromatography/Mass Spectrometry. Results Twenty four hours after WLI, 407 metabolites were detected in liver samples while 347 metabolites were detected in plasma. Plasma metabolites associated with 50 Gy WLI included several amino acids, purine and pyrimidine metabolites, microbial metabolites, and most prominently bradykinin and 3-indoxyl-sulfate. Liver metabolites associated with 50 Gy WLI included pentose phosphate, purine, and pyrimidine metabolites in liver. Plasma biomarkers in common between WLI and WBI were enriched in microbial metabolites such as 3 indoxyl sulfate, indole-3-lactic acid, phenyllactic acid, pipecolic acid, hippuric acid, and markers of DNA damage such as 2-deoxyuridine. Metabolites associated with tryptophan and indoles may reflect radiation-induced gut microbiome effects. Predominant liver biomarkers in common between WBI and WLI were amino acids, sugars, TCA metabolites (fumarate), fatty acids (lineolate, n-hexadecanoic acid) and DNA damage markers (uridine). Conclusions We identified a set of metabolomic markers that may prove useful as plasma biomarkers of RILD and WBI. Pathway analysis also suggested that the unique metabolic changes observed after liver irradiation was an integrative response of the intestine, liver and kidney. PMID:26046990

  7. Determination of low-molecular-weight organic acids in non-small cell lung cancer with a new liquid chromatography-tandem mass spectrometry method.

    PubMed

    Klupczynska, Agnieszka; Plewa, Szymon; Dyszkiewicz, Wojciech; Kasprzyk, Mariusz; Sytek, Natalia; Kokot, Zenon J

    2016-09-10

    As compared to other classes of metabolites, determination of organic acids is an underrepresented field in cancer research and till now there has been a lack of appropriate analytical procedure for determination of serum levels of organic acids potentially associated with cancer development. The aim of the study was to develop a new rapid liquid chromatography-tandem mass spectrometry method for the quantification of six low-molecular-weight organic acids in human serum and to apply this method in an analysis of samples collected from non-small cell lung cancer (NSCLC) patients and a matched control group. The samples were prepared by solid phase extraction (Clean-up CUQAX, UCT). Chromatography was conducted on a Synergi Hydro-RP column (Phenomenex) and a gradient run of 15min. Detection was performed using a negative multiple reaction monitoring mode. The calibration ranges were as follows: 0.24-38.42μmol/L for 2-hydroxybutyric acid, 0.09-17.23μmol/L for fumaric acid, 0.08-15.13μmol/L for glutaric acid, 0.11-2.22mmol/L for lactic acid, 0.39-30.98μmol/L for pyroglutamic acid, and 0.08-16.93μmol/L for succinic acid. Mean relative recovery range was 85.99-114.42% and the determined intra- and inter day coefficients of variation were ≤14%. Among the studied acids, pyroglutamic acid showed the best discriminating potential and enabled to identify accurately NSCLC patients and control subjects regardless of the cancer stage. Further investigations of serum organic acids may allow us to better understand the underlying mechanisms involved in NSCLC and develop novel means of its detection and treatment. The developed method may be also a valuable tool to study metabolic changes associated with other types of cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Titrimetric and Spectrophotometric Methods for the Assay of Ketotifen Using Cerium(IV) and Two Reagents

    PubMed Central

    Raghu, Madihalli Srinivas; Basavaiah, Kanakapura; Prashanth, Kudige Nagaraj; Vinay, Kanakapura Basavaiah

    2013-01-01

    One titrimetric and two spectrophotometric methods are described for the determination of ketotifen fumarate (KTF) in bulk drug and in tablets using cerium(IV) as the oxidimetric agent. In titrimetry (method A), the drug was treated with a measured excess of cerium(IV) in H2SO4 medium and after a standing time of 10 min, the surplus oxidant was determined by back titration with iron(II). The spectrophotometric procedures involve addition of a known excess of cerium(IV) to KTF in acid medium followed by the determination of unreacted oxidant by reacting with either p-dimethyl amino benzaldehyde and measuring the resulting colour at 460 nm (method B) or o-dianisidine and subsequent measurement of the absorbance of coloured product at 470 nm (method C). Titrimetric assay is based on a 1 : 2 reaction stoichiometry between KTF and cerium(IV) and the method is applicable over 2–18 mg range. In spectrophotometry, regression analysis of Beer's law plots showed a good correlation in 0.4–8.0 and 0.4–10.0 g mL−1 KTF ranges for method B and method C, respectively, and the corresponding molar absorptivity coefficients are calculated to be 4.0 × 104 and 3.7 × 104 L mol−1 cm−1. PMID:24324496

  9. A pilot study of the metabolomic profiles of saliva from female orthodontic patients with external apical root resorption.

    PubMed

    Zhou, Jinglin; Hu, Huimin; Huang, Renhuan

    2018-03-01

    Orthodontically induced external apical root resorption (OIEARR) is one of the most severe complications of orthodontic treatment, which is hard to diagnose at early stage by merely radiographic examination. This study aimed to identify salivary metabolic products using unbiased metabolic profiling in order to discover biomarkers that may indicate OIEARR. Unstimulated saliva samples were analyzed from 19 healthy orthodontic patients with EARR (n=8) and non-EARR (n=11). Metabolite profiling was performed using 1 H Nuclear Magnetic Resonance (NMR) spectroscopy. A total of 187 metabolites were found in saliva samples. With supervised partial least squares discriminant analysis and regression analysis, samples from 2 groups were well separated, attributed by a series of metabolites of interest, including butyrate, propane-1,2-diol, α-linolenic acid (Ala), α-glucose, urea, fumarate, formate, guanosine, purine, etc. Indicating the increased inflammatory responses in the periodontal tissues possibly associated with energy metabolism and oxidative stress. The effective separation capacity of 1 H NMR based metabolomics suggested potential feasibility of clinical application in monitoring periodontal and apical condition in orthodontic patients during treatment and make early diagnosis of OIEARR. Metabolites detected in this study need further validation to identify exact biomarkers of OIEARR. Saliva biomarkers may assist in diagnosis and monitoring of this disease. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Knocking down mitochondrial iron transporter (MIT) reprograms primary and secondary metabolism in rice plants

    PubMed Central

    Vigani, Gianpiero; Bashir, Khurram; Ishimaru, Yasuhiro; Lehmann, Martin; Casiraghi, Fabio Marco; Nakanishi, Hiromi; Seki, Motoaki; Geigenberger, Peter; Zocchi, Graziano; Nishizawa, Naoko K.

    2016-01-01

    Iron (Fe) is an essential micronutrient for plant growth and development, and its reduced bioavailability strongly impairs mitochondrial functionality. In this work, the metabolic adjustment in the rice (Oryza sativa) mitochondrial Fe transporter knockdown mutant (mit-2) was analysed. Biochemical characterization of purified mitochondria from rice roots showed alteration in the respiratory chain of mit-2 compared with wild-type (WT) plants. In particular, proteins belonging to the type II alternative NAD(P)H dehydrogenases accumulated strongly in mit-2 plants, indicating that alternative pathways were activated to keep the respiratory chain working. Additionally, large-scale changes in the transcriptome and metabolome were observed in mit-2 rice plants. In particular, a strong alteration (up-/down-regulation) in the expression of genes encoding enzymes of both primary and secondary metabolism was found in mutant plants. This was reflected by changes in the metabolic profiles in both roots and shoots of mit-2 plants. Significant alterations in the levels of amino acids belonging to the aspartic acid-related pathways (aspartic acid, lysine, and threonine in roots, and aspartic acid and ornithine in shoots) were found that are strictly connected to the Krebs cycle. Furthermore, some metabolites (e.g. pyruvic acid, fumaric acid, ornithine, and oligosaccharides of the raffinose family) accumulated only in the shoot of mit-2 plants, indicating possible hypoxic responses. These findings suggest that the induction of local Fe deficiency in the mitochondrial compartment of mit-2 plants differentially affects the transcript as well as the metabolic profiles in root and shoot tissues. PMID:26685186

  11. In Folio Respiratory Fluxomics Revealed by 13C Isotopic Labeling and H/D Isotope Effects Highlight the Noncyclic Nature of the Tricarboxylic Acid “Cycle” in Illuminated Leaves1[W

    PubMed Central

    Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael

    2009-01-01

    While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152

  12. The Energy Metabolism in Caenorhabditis elegans under The Extremely Low-Frequency Electromagnetic Field Exposure

    NASA Astrophysics Data System (ADS)

    Shi, Zhenhua; Yu, Hui; Sun, Yongyan; Yang, Chuanjun; Lian, Huiyong; Cai, Peng

    2015-02-01

    A literal mountain of documentation generated in the past five decades showing unmistakable health hazards associated with extremely low-frequency electromagnetic fields (ELF-EMFs) exposure. However, the relation between energy mechanism and ELF-EMF exposure is poorly understood. In this study, Caenorhabditis elegans was exposed to 50 Hz ELF-EMF at intensities of 0.5, 1, 2, and 3 mT, respectively. Their metabolite variations were analyzed by GC-TOF/MS-based metabolomics. Although minimal metabolic variations and no regular pattern were observed, the contents of energy metabolism-related metabolites such as pyruvic acid, fumaric acid, and L-malic acid were elevated in all the treatments. The expressions of nineteen related genes that encode glycolytic enzymes were analyzed by using quantitative real-time PCR. Only genes encoding GAPDH were significantly upregulated (P < 0.01), and this result was further confirmed by western blot analysis. The enzyme activity of GAPDH was increased (P < 0.01), whereas the total intracellular ATP level was decreased. While no significant difference in lifespan, hatching rate and reproduction, worms exposed to ELF-EMF exhibited less food consumption compared with that of the control (P < 0.01). In conclusion, C. elegans exposed to ELF-EMF have enhanced energy metabolism and restricted dietary, which might contribute to the resistance against exogenous ELF-EMF stress.

  13. The Complex Conductivity Signature of Geobacter Species in Geological Media

    NASA Astrophysics Data System (ADS)

    Brown, I.; Atekwana, E. A.; Sarkisova, S.; Achang, M.

    2013-12-01

    The Complex Conductivity (CC) technique is a promising biogeophysical approach for sensing microbially-induced changes in geological media because of its low-invasive character and sufficient sensitivity to enhanced microbial activity in the near subsurface. Geobacter species have been shown to play important roles in the bioremediation of groundwater contaminated with petroleum and landfill leachate. This capability is based on the ability of Geobacter species to reduce Fe(III) by transferring of electrons from the reduced equivalents to Fe(III) rich minerals through respiration chain and special metallic-like conductors - pili. Only the cultivation of Geobacter species on Fe(III) oxides specifically express pili biosynthesis. Moreover, mutants that cannot produce pili are unable to reduce Fe(III) oxides. However, little is known about the contribution of these molecular conductors (nanowires) to the generation of complex conductivity signatures in geological media. Here, we present the results about the modulation of CC signatures in geological media by Geobacter sulfurreducens (G.s.). Cultures of wild strain G.s. and its pilA(-) mutant were anaerobically cultivated in the presence of the pair of such donors and acceptors of electrons: acetate - fumarate, and acetate - magnetite under anaerobic conditions. Each culture was injected in CC sample holders filled either with N2-CO2 mix (planktonic variant) or with this gases mix and glass beads, d=1 mm, (porous medium variant). Both strains of G.s. proliferated well in a medium supplemented with acetate-fumarate. However, pilA(-) mutant did not multiply in a medium supplemented with ox-red pair yeast extract - magnetite. This observation confirmed that only wild pilA(+) strain is capable of the dissimilatory reduction of Fe(III) within magnetite molecule. The measurement of CC responses from planktonic culture of G.s. wild strain grown with acetate-fumarate did not show linear correlation with their magnitudes but were substantially different from CC responses in sterile medium and pilA(-) mutant planktonic culture. Complex conductivity responses in planktonic cultures of both pilA(+) and pilA(-) strains grown with acetate-fumarate pair were significantly different from magnitudes of φ and σ' in a sterile medium. No notable difference between CC signatures from planktonic cultures of both pilA(+) and pilA(-) strains grown with acetate-fumarate was found. This result has been anticipated because the cultivation of G.s. with ox-red pair acetate-fumarate does not induce the pili biosynthesis. In contrast, the presence of the cells of G.s. pilA(+) strain grown with magnetite in both planktonic and porous media notable shifted to the right of the relaxation peaks of both φ and σ'. Our results taking together suggest that only Geobacter cells administrating Fe(III) dissimilatory reduction and possessing pili can modulate CC responses from subsurface porous media. More experiments and techniques, including different types of microscopy, will be conducted to confirm these observations.

  14. Dancing with chemical formulae of antivirals: a personal account.

    PubMed

    De Clercq, Erik

    2013-09-15

    A chemical structure is a joy forever, and this is how I perceived the chemical structures of a number of antiviral compounds with which I have been personally acquainted over the past 3 decades: (1) amino acid esters of acyclovir (i.e. valaciclovir); (2) 5-substituted 2'-deoxyuridines (i.e. brivudin); (3) 2',3'-dideoxynucleoside analogues (i.e. stavudine); (4) acyclic nucleoside phosphonates (ANPs) (i.e. cidofovir, adefovir); (5) tenofovir disoproxil fumarate (TDF) and drug combinations therewith; (6) tenofovir alafenamide (TAF, GS-7340), a new phosphonoamidate prodrug of tenofovir; (7) pro-prodrugs of PMEG (i.e. GS-9191 and GS-9219); (8) new ANPs: O-DAPy and 5-aza-C phosphonates; (9) non-nucleoside reverse transcriptase inhibitors (NNRTIs): HEPT and TIBO derivatives; and (10) bicyclam derivatives (i.e. AMD3100). Copyright © 2013 Elsevier Inc. All rights reserved.

  15. ¹H NMR and multivariate data analysis of the relationship between the age and quality of duck meat.

    PubMed

    Liu, Chunli; Pan, Daodong; Ye, Yangfang; Cao, Jinxuan

    2013-11-15

    To contribute to a better understanding of the factors affecting meat quality, we investigated the influence of age on the chemical composition of duck meat. Aging probably affects the quality of meat through changes in metabolism. Therefore, we studied the metabolic composition of duck meat using (1)H nuclear magnetic resonance (NMR) spectroscopy. Comprehensive multivariate data analysis showed significant differences between extracts from ducks that had been aged for four different time periods. Although lactate and anserine increased with age, fumarate, betaine, taurine, inosine and alkyl-substituted free amino acids decreased. These results contribute to a better understanding of changes in duck meat metabolism as meat ages, which could be used to help assess the quality of duck meat as a food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Role of S…O non-bonded interaction in controlling supramolecular assemblies in a new series of 2-aminobenzothiazole based organic salts/ co-crystals

    NASA Astrophysics Data System (ADS)

    Yadav, Priyanka; Patel, Vatsa; Ballabh, Amar

    2018-07-01

    A new series of 2-aminobenzothiazole based organic salts were synthesized with mono- / di-carboxylic acid and characterized with various physico-chemical methods. One of the synthesized salt 2-aminobenzothiazolium-hydrogen fumarate (BTzA4) was found to be capable of gelling water with minimum gelator concentration (MGC) around 1.25 wt% (w/v). The single crystal structures of gelator (BTzA4) and non-gelators were analyzed for the presence of various supramolecular synthons especially the rarely occurring non-bonded S…O interactions and their role in controlling the overall hydrogen bonded network in these series of salts/ cocrystals. Charge assisted hydrogen bonded network was found to be governing the weak non-bonded S…O supramolecular synthons in the present study.

  17. Effect of glycine nitrogen on lettuce growth under soilless culture: a metabolomics approach to identify the main changes occurred in plant primary and secondary metabolism.

    PubMed

    Yang, Xiao; Feng, Lei; Zhao, Li; Liu, Xiaosong; Hassani, Danial; Huang, Danfeng

    2018-01-01

    Lettuce is a significant source of antioxidants and bioactive compounds. Nitrate is a cardinal fertilizer in horticulture and influences vegetable yield and quality; however, the negative effects of nitrate on the biosynthesis of flavonoids require further study. It is expected that using fertilizers containing organic nitrogen (N) could promote the synthesis of health-promoting compounds. Lettuces were hydroponically cultured in media containing 9 mmol L -1 nitrate or 9 mmol L -1 glycine for 4 weeks. Primary and secondary metabolites were analyzed using gas chromatography/mass spectrometry (GC/MS) and ultra-performance liquid chromatography/ion mobility spectrometry/quadrupole time-of-flight mass spectrometry (UPLC/IMS/QTOF-MS). Data analysis revealed that 29 metabolites were significantly altered between nitrate and glycine treatments. Metabolites were tentatively identified by comparison with online databases, literature and standards and using collision cross-section values. Significant differences in flavonoid biosynthesis, phenolic biosynthesis and the tricarboxylic acid (TCA) cycle response were observed between N sources. Compared with nitrate, glycine promoted accumulation of glycosylated flavonoids (quercetin 3-glucoside, quercetin 3-(6″-malonyl-glucoside), luteolin 7-glucuronide, luteolin 7-glucoside), ascorbic acid and amino acids (l-valine, l-leucine, l-glutamine, asparagine, l-serine, l-ornithine, 4-aminobutanoic acid, l-phenylalanine) but reduced phenolic acids (dihydroxybenzoic acid hexose isomers 1 and 2, chicoric acid, chicoric acid isomer 1) and TCA intermediates (fumaric, malic, citric and succinic acids). The novel methodology applied in this study can be used to characterize metabolites in lettuce. Accumulation of glycosylated flavonoids, amino acids and ascorbic acid in response to glycine supply provides strong evidence supporting the idea that using amino acids as an N source alters the nutritional value of vegetable crops. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Low Risk of Proximal Tubular Dysfunction Associated With Emtricitabine-Tenofovir Disoproxil Fumarate Preexposure Prophylaxis in Men and Women.

    PubMed

    Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina

    2016-10-01

    Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52-3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10-14.0; P > .99). Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  19. Establishment and development of ruminal hydrogenotrophs in methanogen-free lambs.

    PubMed

    Fonty, Gérard; Joblin, Keith; Chavarot, Michel; Roux, Remy; Naylor, Graham; Michallon, Fabien

    2007-10-01

    The aim of this work was to determine whether reductive acetogenesis can provide an alternative to methanogenesis in the rumen. Gnotobiotic lambs were inoculated with a functional rumen microbiota lacking methanogens and reared to maturity on a fibrous diet. Lambs with a methanogen-free rumen grew well, and the feed intake and ruminal volatile fatty acid concentrations for lambs lacking ruminal methanogens were lower but not markedly dissimilar from those for conventional lambs reared on the same diet. A high population density (10(7) to 10(8) cells g(-1)) of ruminal acetogens slowly developed in methanogen-free lambs. Sulfate- and fumarate-reducing bacteria were present, but their population densities were highly variable. In methanogen-free lambs, the hydrogen capture from fermentation was low (28 to 46%) in comparison with that in lambs containing ruminal methanogens (>90%). Reductive acetogenesis was not a significant part of ruminal fermentation in conventional lambs but contributed 21 to 25% to the fermentation in methanogen-free meroxenic animals. Ruminal H(2) utilization was lower in lambs lacking ruminal methanogens, but when a methanogen-free lamb was inoculated with a methanogen, the ruminal H(2) utilization was similar to that in conventional lambs. H(2) utilization in lambs containing a normal ruminal microflora was age dependent and increased with the animal age. The animal age effect was less marked in lambs lacking ruminal methanogens. Addition of fumarate to rumen contents from methanogen-free lambs increased H(2) utilization. These findings provide the first evidence from animal studies that reductive acetogens can sustain a functional rumen and replace methanogens as a sink for H(2) in the rumen.

  20. Isolation and characterization of the stage-specific cytochrome b small subunit (CybS) of Ascaris suum complex II from the aerobic respiratory chain of larval mitochondria.

    PubMed

    Amino, Hisako; Osanai, Arihiro; Miyadera, Hiroko; Shinjyo, Noriko; Tomitsuka, Eriko; Taka, Hikari; Mineki, Reiko; Murayama, Kimie; Takamiya, Shinzaburo; Aoki, Takashi; Miyoshi, Hideto; Sakamoto, Kimitoshi; Kojima, Somei; Kita, Kiyoshi

    2003-05-01

    We recently reported that Ascaris suum mitochondria express stage-specific isoforms of complex II: the flavoprotein subunit and the small subunit of cytochrome b (CybS) of the larval complex II differ from those of adult enzyme, while two complex IIs share a common iron-sulfur cluster subunit (Ip). In the present study, A. suum larval complex II was highly purified to characterize the larval cytochrome b subunits in more detail. Peptide mass fingerprinting and N-terminal amino acid sequencing showed that the larval and adult cytochrome b (CybL) proteins are identical. In contrast, cDNA sequences revealed that the small subunit of larval cytochrome b (CybS(L)) is distinct from the adult CybS (CybS(A)). Furthermore, Northern analysis and immunoblotting showed stage-specific expression of CybS(L) and CybS(A) in larval and adult mitochondria, respectively. Enzymatic assays revealed that the ratio of rhodoquinol-fumarate reductase (RQFR) to succinate-ubiquinone reductase (SQR) activities and the K(m) values for quinones are almost identical for the adult and larval complex IIs, but that the fumarate reductase (FRD) activity is higher for the adult form than for the larval form. These results indicate that the adult and larval A. suum complex IIs have different properties than the complex II of the mammalian host and that the larval complex II is able to function as a RQFR. Such RQFR activity of the larval complex II would be essential for rapid adaptation to the dramatic change of oxygen availability during infection of the host.

  1. Isolation and characterization of Sulfurospirillum carboxydovorans sp. nov., a new microaerophilic carbon monoxide oxidizing epsilon Proteobacterium.

    PubMed

    Jensen, Anders; Finster, Kai

    2005-05-01

    A new microaerophilic, Gram-negative, motile, 2-3 microm long and 0.3 microm wide, vibrioid to spirillum-shaped, CO oxidizing bacterium, designated strain MV, isolated from marine sediment (The North Sea) is described. Strain MV was able to couple the oxidation of CO to the reduction of elemental sulphur, DMSO and thiosulphate. Growth occurred with up to 100% (v/v) CO in the headspace. Acetate was needed as carbon source. No growth on CO was observed with nitrate and selenate as electron acceptor. Sulphite, elemental sulphur, DMSO, thiosulphate, nitrate, nitrite, perchloroethylene, arsenate and selenate were used as electron acceptors with pyruvate as energy and carbon source. Microaerophilic growth was observed. In non-agitated cultures growth occurred at atmospheric oxygen concentrations in the headspace. Hydrogen (with acetate as carbon source), formate (with acetate as carbon source), pyruvate, lactate, succinate, fumarate, malate alpha-ketoglutaric acid, aspartate and yeast extract (1% (w/v)) supported growth with nitrate as electron acceptor. Fumarate and malate were fermented. Vitamins were not required for growth. The strain was cytochrome C oxidase and catalase positive. The DNA mol G+C content was 30.5%. 16S rRNA gene sequence comparison showed that strain MV grouped within the genus Sulfurospirillum with Sulfurospirillum arcachonense (sequence similarity 98.3%) as closest relative. The relative DNA-DNA relatedness between strain MV and S. arcachonense was 33.1%. Based on a detailed phenotypic and phylogenetic analysis, inclusion of strain MV in the genus Sulfurospirillum as a well separated new species is proposed. As species name we propose Sulfurospirillum carboxydovorans. The type strain is strain MV (ATCC BAA-937 = DSM 16295, GenBank accession number: AY740528).

  2. Changes in renal function associated with oral emtricitabine/tenofovir disoproxil fumarate use for HIV pre-exposure prophylaxis

    PubMed Central

    Solomon, Marc M.; Lama, Javier R.; Glidden, David V.; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y.; Guanira, Juan Vicente; Veloso, Valdilea G.; Mayer, Kenneth H.; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N.; Grant, Robert M.

    2014-01-01

    Objective: Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. Design and methods: The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft–Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. Results: There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: −2.4 vs. −1.1 ml/min; P = 0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P = 0.02), and resolved after stopping pre-exposure prophylaxis (mean change: −0.1 vs. 0.0 ml/min; P = 0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. Conclusions: In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring. PMID:24499951

  3. Changes in renal function associated with oral emtricitabine/tenofovir disoproxil fumarate use for HIV pre-exposure prophylaxis.

    PubMed

    Solomon, Marc M; Lama, Javier R; Glidden, David V; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y; Guanira, Juan Vicente; Veloso, Valdilea G; Mayer, Kenneth H; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N; Grant, Robert M

    2014-03-27

    Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft-Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: -2.4 vs. -1.1 ml/min; P=0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P=0.02), and resolved after stopping pre-exposure prophylaxis (mean change: -0.1 vs. 0.0 ml/min; P=0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring.

  4. Skeletal Muscle Acute and Chronic Metabolic Response to Essential Amino Acid Supplementation in Hypertriglyceridemic Older Adults

    PubMed Central

    Marquis, Bryce J; Hurren, Nicholas M; Carvalho, Eugenia; Kim, Il-Young; Schutzler, Scott; Azhar, Gohar; Wolfe, Robert R; Børsheim, Elisabet

    2017-01-01

    Abstract Background: Supplementation with essential amino acids (EAAs) + arginine is a promising nutritional approach to decrease plasma triglyceride (TG) concentrations, which are an independent risk factor for ischemic heart disease. Objective: The objective of this study was to examine the effects of 8 wk of EAA supplementation on skeletal muscle basal metabolite concentrations and changes in metabolic response to acute EAA intake, with an emphasis on mitochondrial metabolism, in adults with elevated TGs to better understand the mechanisms of lowering plasma TGs. Methods: Older adults with elevated plasma TG concentrations were given 22 g EAAs to ingest acutely before and after an 8-wk EAA supplementation period. Skeletal muscle biopsy samples were collected before and after acute EAA intake, both pre- and postsupplementation (4 biopsy samples), and targeted metabolomic analyses of organic acids and acylcarnitines were conducted on the specimens. Results: Acute EAA intake resulted in increased skeletal muscle acylcarnitine concentrations associated with oxidative catabolism of the supplement components, with the largest increases found in acylcarnitines of branched-chain amino acid oxidative catabolism, including isovaleryl-carnitine (2200%) and 2-methylbutyryl-carnitine (2400%). The chronic EAA supplementation resulted in a 19% decrease in plasma TGs along with accumulation of long-chain acylcarnitines myristoyl- (90%) and stearoyl- (120%) carnitine in skeletal muscle and increases in succinyl-carnitine (250%) and the late-stage tricarboxylic acid cycle intermediates fumarate (44%) and malate (110%). Conclusions: Supplementation with EAAs shows promise as an approach for moderate reduction in plasma TGs. Changes in skeletal muscle metabolites suggest incomplete fatty acid oxidation and increased anaplerosis, which suggests a potential bottleneck in fatty acid metabolism.

  5. Reduction of an E. coli O157:H7 and Salmonella composite on fresh strawberries by varying antimicrobial washes and vacuum perfusion.

    PubMed

    Gurtler, Joshua B; Bailey, Rebecca B; Jin, Tony Z; Fan, Xuetong

    2014-10-17

    A 2011 outbreak of hemorrhagic colitis, which resulted in the death of two individuals, was associated with contaminated strawberries. A study was conducted to identify antimicrobial washes effective at reducing E. coli O157:H7 and Salmonella enterica from the surface of fresh whole strawberries during two-minute immersion washes. Twenty-seven antimicrobial treatments were tested. Vacuum perfusion was applied to strawberries during chlorine and peracetic acid treatments to promote infiltration of sanitizer into porous strawberry tissue. Strawberries were inoculated to 7.1logCFU/strawberry with a seven-strain bacterial composite, consisting of three strains of E. coli O157:H7 and four serovars of Salmonella enterica. Berries were air-dried for 2h and immersed in circulating antimicrobial solutions for 120s at 22°C. Four treatments reduced ≥3.0logCFU/strawberry, including (a) 1% acetic acid+1% H2O2, (b) 30% ethanol+1% H2O2, (c) 90ppm peracetic acid, and (d) 1% lactic acid+1% H2O2. Two additional treatments that reduced 2.8logCFU/strawberry were (a) 40% ethanol, and (b) 1% each of phosphoric+fumaric acids. Eight treatments reduced 2.0-2.6logCFU/strawberry. Five treatments reduced <1.45CFU/strawberry, including (a) 1% citric acid, (b) 1% lactic acid, (c) 1% acetic acid, (d) 0.5% each of acetic+citric acids and (e) 0.5% each of acetic+lactic acids. The use of vacuum perfusion with 200ppm chlorine or 90ppm peracetic acid did not reduce greater populations of pathogens than did the same treatments without vacuum perfusion. Fourteen treatments reduced no more pathogens (p<0.05) than did sterile deionized water. Results from this study provide some options for end-point decontamination of strawberries for retail operations just prior to serving to customers. Published by Elsevier B.V.

  6. Trans-hemispheric contribution of C2-C10 α, ω-dicarboxylic acids, and related polar compounds to water-soluble organic carbon in the western Pacific aerosols in relation to photochemical oxidation reactions

    NASA Astrophysics Data System (ADS)

    SempéRé, Richard; Kawamura, Kimitaka

    2003-06-01

    Marine aerosol samples were collected during a western Pacific cruise covering the latitude range between 35°N and 40°S (140°E-180°E). They were analyzed for total carbon (TC), total nitrogen (TN), water-soluble organic carbon (WSOC) along with the molecular distributions of C2-C10 α, ω-dicarboxylic acids, and related polar compounds, mainly, ω-oxocarboxylic acids (C2-C9) and α-dicarbonyls (C2-C3). Oxalic acid (C2) was the most abundant followed by malonic (C3) and succinic (C4) acids. The total diacid concentration range was 7-605 ng m-3 (av. 85 ng m-3) and the diacid-carbon accounted for 2-15% (average 8%) of WSOC which comprised 29-55% (average 40%) of TC. Dry depositions of total diacids over the northern and southern Pacific Ocean were estimated to be 256-1907 μg m-2 yr-1 (average 735; n = 4) and 22-396 μg m-2 yr-1 (average 134; n = 14), respectively, whereas the air-to-sea flux of oxalic acid was 18-1351 μg m-2 yr-1 (average 466 μg m-2 yr-1) and 7.5-275 μg m-2 yr-1 (average 75 μg m-2 yr-1) in the Northern and Southern Hemispheres. We observed that the concentration ratios of diacid-C/WSOC, azelaic acid (C9)/ω-oxononanoic acid, maleic acid (iC4cis)/fumaric (iC4trans) acid and succinic acid (C4)/total diacids were correlated with air temperature. These findings showed that the intensity of photochemical oxidation reactions and thus the variation in sunlight intensity characterized here by air temperature, significantly control the molecular distribution of water-soluble organic compounds during the long-range transport of anthropogenic and/or biogenic higher molecular weight organic compounds.

  7. Decursin and decursinol angelate selectively inhibit NADH-fumarate reductase of Ascaris suum.

    PubMed

    Shiomi, Kazuro; Hatano, Hiroko; Morimoto, Hiromi; Ui, Hideaki; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tomoda, Hiroshi; Lee, Eun Woo; Heo, Tae Ryeon; Kawagishi, Hirokazu; Omura, Satoshi

    2007-11-01

    NADH-fumarate reductase (NFRD) is a key enzyme in many anaerobic helminths. Decursin and decursinol angelate have been isolated from the roots of ANGELICA GIGAS Nakai (Apiaceae) as NFRD inhibitors. They inhibited ASCARIS SUUM NFRD with IC (50) values of 1.1 and 2.7 microM, respectively. Their target is the electron transport enzyme complex I. Since the inhibitory activities of decursin against bovine heart complexes are weak, it is a selective inhibitor of the nematode complex I. In contrast, decursinol angelate moderately inhibits bovine heart complexes II and III. Decursinol inhibits A. SUUM NFRD to a similar extent, but its target is complex II. It also inhibits bovine heart complexes II and III.

  8. Tenofovir Disoproxil Fumarate Fails to Prevent HIV Acquisition or the Establishment of a Viral Reservoir: Two Case Reports.

    PubMed

    Fox, Julie; Brady, Michael; Alexander, Hannah; Davies, Olubanke; Robinson, Nicola; Pace, Mathew; Else, Laura; Cason, John; Khoo, Saye; Back, David; Fidler, Sarah; Frater, John

    2016-03-01

    The use of antiretrovirals as pre-exposure prophylaxis (PrEP) is highly efficacious in HIV prevention. The World Health Organization recently recommended Truvada(®) (Gilead Sciences, Inc.) or tenofovir disoproxil fumarate (TDF) for high-risk individuals, with limited data for single-agent TDF PrEP in men who have sex with men (MSM). We report two cases of TDF PrEP failure in MSM who had received long-term TDF for hepatitis B infection and had therapeutic levels of drug immediately after HIV acquisition. Rapid antiretroviral intensification at diagnosis of acute HIV infection failed to limit immune dysfunction or prevent the establishment of a viral reservoir.

  9. Carbon Dots as Versatile Photosensitizers for Solar-Driven Catalysis with Redox Enzymes.

    PubMed

    Hutton, Georgina A M; Reuillard, Bertrand; Martindale, Benjamin C M; Caputo, Christine A; Lockwood, Colin W J; Butt, Julea N; Reisner, Erwin

    2016-12-28

    Light-driven enzymatic catalysis is enabled by the productive coupling of a protein to a photosensitizer. Photosensitizers used in such hybrid systems are typically costly, toxic, and/or fragile, with limited chemical versatility. Carbon dots (CDs) are low-cost, nanosized light-harvesters that are attractive photosensitizers for biological systems as they are water-soluble, photostable, nontoxic, and their surface chemistry can be easily modified. We demonstrate here that CDs act as excellent light-absorbers in two semibiological photosynthetic systems utilizing either a fumarate reductase (FccA) for the solar-driven hydrogenation of fumarate to succinate or a hydrogenase (H 2 ase) for reduction of protons to H 2 . The tunable surface chemistry of the CDs was exploited to synthesize positively charged ammonium-terminated CDs (CD-NHMe 2 + ), which were capable of transferring photoexcited electrons directly to the negatively charged enzymes with high efficiency and stability. Enzyme-based turnover numbers of 6000 mol succinate (mol FccA) -1 and 43,000 mol H 2 (mol H 2 ase) -1 were reached after 24 h. Negatively charged carboxylate-terminated CDs (CD-CO 2 - ) displayed little or no activity, and the electrostatic interactions at the CD-enzyme interface were determined to be essential to the high photocatalytic activity observed with CD-NHMe 2 + . The modular surface chemistry of CDs together with their photostability and aqueous solubility make CDs versatile photosensitizers for redox enzymes with great scope for their utilization in photobiocatalysis.

  10. Versatile transformations of hydrocarbons in anaerobic bacteria: substrate ranges and regio- and stereo-chemistry of activation reactions†

    PubMed Central

    Jarling, René; Kühner, Simon; Basílio Janke, Eline; Gruner, Andrea; Drozdowska, Marta; Golding, Bernard T.; Rabus, Ralf; Wilkes, Heinz

    2015-01-01

    Anaerobic metabolism of hydrocarbons proceeds either via addition to fumarate or by hydroxylation in various microorganisms, e.g., sulfate-reducing or denitrifying bacteria, which are specialized in utilizing n-alkanes or alkylbenzenes as growth substrates. General pathways for carbon assimilation and energy gain have been elucidated for a limited number of possible substrates. In this work the metabolic activity of 11 bacterial strains during anaerobic growth with crude oil was investigated and compared with the metabolite patterns appearing during anaerobic growth with more than 40 different hydrocarbons supplied as binary mixtures. We show that the range of co-metabolically formed alkyl- and arylalkyl-succinates is much broader in n-alkane than in alkylbenzene utilizers. The structures and stereochemistry of these products are resolved. Furthermore, we demonstrate that anaerobic hydroxylation of alkylbenzenes does not only occur in denitrifiers but also in sulfate reducers. We propose that these processes play a role in detoxification under conditions of solvent stress. The thermophilic sulfate-reducing strain TD3 is shown to produce n-alkylsuccinates, which are suggested not to derive from terminal activation of n-alkanes, but rather to represent intermediates of a metabolic pathway short-cutting fumarate regeneration by reverse action of succinate synthase. The outcomes of this study provide a basis for geochemically tracing such processes in natural habitats and contribute to an improved understanding of microbial activity in hydrocarbon-rich anoxic environments. PMID:26441848

  11. Analysis of quetiapine in human plasma using fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Mostafa, Islam M.; Omar, Mahmoud A.; Nagy, Dalia M.; Derayea, Sayed M.

    2018-05-01

    A simple and sensitive spectrofluorimetric method has been development for the assurance of quetiapine fumarate (QTF). The proposed method was utilized for measuring the fluorescence intensity of the yellow fluorescent product at 510 nm (λex 470 nm). The fluorescent product has resulted from the nucleophilic substitution reaction of QTF with 4-chloro-7-nitrobenzofurazane (NBD-Cl) in Mcllvaine buffer (pH 7.0). The diverse variables influencing the development of the reaction product were deliberately changed and optimized. The linear concentration range of the proposed method was of 0.2-2.0 μg ml-1.The limits of detection and quantitation were 0.05 and 0.17 μg ml-1, respectively. The proposed method was applied for the assurance of QTF in its tablets without interference from basic excipients. In addition, the proposed method was used for in vitro analysis of the QTF in spiked human plasma, the percent mean recovery was (n = 3) 98.82 ± 1.484%.

  12. Economic impact of the new oral treatments for multiple sclerosis.

    PubMed

    Álvarez Ayuso, L; Rodríguez Marrodán, B; Blasco Quílez, M R; García-Merino, J A; Sánchez Guerrero, A

    2018-01-11

    Multiple sclerosis (MS) is a chronic disease affecting the central nervous system and is characterised by inflammation, demyelination, gliosis, and axonal damage. The introduction of dimethyl fumarate and teriflunomide has led to an increase in the number of alternative first-line therapies for MS. The objective of this study was to evaluate the economic impact of the incorporation of new oral therapies at the reference unit (CSUR) at Hospital Universitario Puerta de Hierro Majadahonda. We performed a retrospective observational study including patients diagnosed with MS, who underwent treatment with disease-modifying drugs in 2015 and were followed up for a minimum mean time of one year. Data were collected from patients' electronic clinical histories and the pharmacy service's programme for dispensing drugs to outpatients. Evaluating the cost of changing 125 patients' treatment from other drugs to dimethyl fumarate and teriflunomide, and comparing this with the cost that would have resulted from maintaining their previous treatment, demonstrated a total saving of €169,107.31 over the study period. In addition to contributing new therapeutic alternatives, dimethyl fumarate and teriflunomide produced an economic saving in MS treatment at our hospital. Copyright © 2017 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  13. The Succinated Proteome of FH-Mutant Tumours

    PubMed Central

    Yang, Ming; Ternette, Nicola; Su, Huizhong; Dabiri, Raliat; Kessler, Benedikt M.; Adam, Julie; Teh, Bin Tean; Pollard, Patrick J.

    2014-01-01

    Inherited mutations in the Krebs cycle enzyme fumarate hydratase (FH) predispose to hereditary leiomyomatosis and renal cell cancer (HLRCC). Loss of FH activity in HLRCC tumours causes accumulation of the Krebs cycle intermediate fumarate to high levels, which may act as an oncometabolite through various, but not necessarily mutually exclusive, mechanisms. One such mechanism, succination, is an irreversible non-enzymatic modification of cysteine residues by fumarate, to form S-(2-succino)cysteine (2SC). Previous studies have demonstrated that succination of proteins including glyceraldehyde 3-phosphate dehydrogenase (GAPDH), kelch-like ECH-associated protein 1 (KEAP1) and mitochondrial aconitase (ACO2) can have profound effects on cellular metabolism. Furthermore, immunostaining for 2SC is a sensitive and specific biomarker for HLRCC tumours. Here, we performed a proteomic screen on an FH-mutant tumour and two HLRCC-derived cancer cell lines and identified 60 proteins where one or more cysteine residues were succinated; 10 of which were succinated at cysteine residues either predicted, or experimentally proven, to be functionally significant. Bioinformatic enrichment analyses identified most succinated targets to be involved in redox signaling. To our knowledge, this is the first proteomic-based succination screen performed in human tumours and cancer-derived cells and has identified novel 2SC targets that may be relevant to the pathogenesis of HLRCC. PMID:25105836

  14. Azo polymeric micelles designed for colon-targeted dimethyl fumarate delivery for colon cancer therapy.

    PubMed

    Ma, Zhen-Gang; Ma, Rui; Xiao, Xiao-Lin; Zhang, Yong-Hui; Zhang, Xin-Zi; Hu, Nan; Gao, Jin-Lai; Zheng, Yu-Feng; Dong, De-Li; Sun, Zhi-Jie

    2016-10-15

    Colon-targeted drug delivery and circumventing drug resistance are extremely important for colon cancer chemotherapy. Our previous work found that dimethyl fumarate (DMF), the approved drug by the FDA for the treatment of multiple sclerosis, exhibited anti-tumor activity on colon cancer cells. Based on the pharmacological properties of DMF and azo bond in olsalazine chemical structure, we designed azo polymeric micelles for colon-targeted dimethyl fumarate delivery for colon cancer therapy. We synthesized the star-shape amphiphilic polymer with azo bond and fabricated the DMF-loaded azo polymeric micelles. The four-arm polymer star-PCL-azo-mPEG (sPCEG-azo) (constituted by star-shape PCL (polycaprolactone) and mPEG (methoxypolyethylene glycols)-olsalazine) showed self-assembly ability. The average diameter and polydispersity index of the DMF-loaded sPCEG-azo polymeric micelles were 153.6nm and 0.195, respectively. In vitro drug release study showed that the cumulative release of DMF from the DMF-loaded sPCEG-azo polymeric micelles was no more than 20% in rat gastric fluid within 10h, whereas in the rat colonic fluids, the cumulative release of DMF reached 60% in the initial 2h and 100% within 10h, indicating that the DMF-loaded sPCEG-azo polymeric micelles had excellent colon-targeted property. The DMF-loaded sPCEG-azo polymeric micelles had no significant cytotoxicity on colon cancer cells in phosphate buffered solution (PBS) and rat gastric fluid. In rat colonic fluid, the micelles showed significant cytotoxic effect on colon cancer cells. The blank sPCEG-azo polymeric micelles (without DMF) showed no cytotoxic effect on colon cancer cells in rat colonic fluids. In conclusion, the DMF-loaded sPCEG-azo polymeric micelles show colon-targeted DMF release and anti-tumor activity, providing a novel approach potential for colon cancer therapy. Colon-targeted drug delivery and circumventing drug resistance are extremely important for colon cancer chemotherapy. Our previous work found that dimethyl fumarate (DMF), the approved drug by the FDA for the treatment of multiple sclerosis, exhibited anti-tumor activities on colon cancer cells (Br J Pharmacol. 2015 172(15):3929-43.). Based on the pharmacological properties of DMF and azo bond in olsalazine chemical structure, we designed azo polymeric micelles for colon-targeted dimethyl fumarate delivery for colon cancer therapy. We found that the DMF-loaded sPCEG-azo polymeric micelles showed colon-targeted DMF release and anti-tumor activities, providing a novel approach potential for colon cancer therapy. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  15. Metabolomic Analysis of Alfalfa (Medicago sativa L.) Root-Symbiotic Rhizobia Responses under Alkali Stress.

    PubMed

    Song, Tingting; Xu, Huihui; Sun, Na; Jiang, Liu; Tian, Pu; Yong, Yueyuan; Yang, Weiwei; Cai, Hua; Cui, Guowen

    2017-01-01

    Alkaline salts (e.g., NaHCO 3 and Na 2 CO 3 ) causes more severe morphological and physiological damage to plants than neutral salts (e.g., NaCl and Na 2 SO 4 ) due to differences in pH. The mechanism by which plants respond to alkali stress is not fully understood, especially in plants having symbotic relationships such as alfalfa ( Medicago sativa L.). Therefore, a study was designed to evaluate the metabolic response of the root-nodule symbiosis in alfalfa under alkali stress using comparative metabolomics. Rhizobium-nodulized (RI group) and non-nodulized (NI group) alfalfa roots were treated with 200 mmol/L NaHCO 3 and, roots samples were analyzed for malondialdehydyde (MDA), proline, glutathione (GSH), superoxide dismutase (SOD), and peroxidase (POD) content. Additionally, metabolite profiling was conducted using gas chromatography combined with time-of-flight mass spectrometry (GC/TOF-MS). Phenotypically, the RI alfalfa exhibited a greater resistance to alkali stress than the NI plants examined. Physiological analysis and metabolic profiling revealed that RI plants accumulated more antioxidants (SOD, POD, GSH), osmolytes (sugar, glycols, proline), organic acids (succinic acid, fumaric acid, and alpha-ketoglutaric acid), and metabolites that are involved in nitrogen fixation. Our pairwise metabolomics comparisons revealed that RI alfalfa plants exhibited a distinct metabolic profile associated with alkali putative tolerance relative to NI alfalfa plants. Data provide new information about the relationship between non-nodulized, rhizobium-nodulized alfalfa and alkali resistance.

  16. Metabolomic Analysis of Alfalfa (Medicago sativa L.) Root-Symbiotic Rhizobia Responses under Alkali Stress

    PubMed Central

    Song, Tingting; Xu, Huihui; Sun, Na; Jiang, Liu; Tian, Pu; Yong, Yueyuan; Yang, Weiwei; Cai, Hua; Cui, Guowen

    2017-01-01

    Alkaline salts (e.g., NaHCO3 and Na2CO3) causes more severe morphological and physiological damage to plants than neutral salts (e.g., NaCl and Na2SO4) due to differences in pH. The mechanism by which plants respond to alkali stress is not fully understood, especially in plants having symbotic relationships such as alfalfa (Medicago sativa L.). Therefore, a study was designed to evaluate the metabolic response of the root-nodule symbiosis in alfalfa under alkali stress using comparative metabolomics. Rhizobium-nodulized (RI group) and non-nodulized (NI group) alfalfa roots were treated with 200 mmol/L NaHCO3 and, roots samples were analyzed for malondialdehydyde (MDA), proline, glutathione (GSH), superoxide dismutase (SOD), and peroxidase (POD) content. Additionally, metabolite profiling was conducted using gas chromatography combined with time-of-flight mass spectrometry (GC/TOF-MS). Phenotypically, the RI alfalfa exhibited a greater resistance to alkali stress than the NI plants examined. Physiological analysis and metabolic profiling revealed that RI plants accumulated more antioxidants (SOD, POD, GSH), osmolytes (sugar, glycols, proline), organic acids (succinic acid, fumaric acid, and alpha-ketoglutaric acid), and metabolites that are involved in nitrogen fixation. Our pairwise metabolomics comparisons revealed that RI alfalfa plants exhibited a distinct metabolic profile associated with alkali putative tolerance relative to NI alfalfa plants. Data provide new information about the relationship between non-nodulized, rhizobium-nodulized alfalfa and alkali resistance. PMID:28744296

  17. Formulation and development of pH-independent/dependent sustained release matrix tablets of ondansetron HCl by a continuous twin-screw melt granulation process.

    PubMed

    Patil, Hemlata; Tiwari, Roshan V; Upadhye, Sampada B; Vladyka, Ronald S; Repka, Michael A

    2015-12-30

    The objective of the present study was to develop pH-independent/dependent sustained release (SR) tablets of ondansetron HCl dihydrate (OND), a selective 5-HT3 receptor antagonist that is used for prevention of nausea and vomiting caused by chemotherapy, radiotherapy and postoperative treatment. The challenge with the OND API is its pH-dependent solubility and relatively short elimination half-life. Therefore, investigations were made to solve these problems in the current study. Formulations were prepared using stearic acid as a binding agent via a melt granulation process in a twin-screw extruder. The micro-environmental pH of the tablet was manipulated by the addition of fumaric acid to enhance the solubility and release of OND from the tablet. The in vitro release study demonstrated sustained release for 24h with 90% of drug release in formulations using stearic acid in combination with ethyl cellulose, whereas 100% drug release in 8h for stearic acid-hydroxypropylcellulose matrices. The formulation release kinetics was correlated to the Higuchi diffusion model and a non-Fickian drug release mechanism. The results of the present study demonstrated for the first time the pH dependent release from hydrophilic-lipid matrices as well as pH independent release from hydrophobic-lipid matrices for OND SR tablets manufactured by means of a continuous melt granulation technique utilizing a twin-screw extruder. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Gateways to clinical trials.

    PubMed

    Bayés, M; Rabasseda, X; Prous, J R

    2007-12-01

    Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Intergrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 249553, 2-Methoxyestradiol; Abatacept, Adalimumab, Adefovir dipivoxil, Agalsidase beta, Albinterferon alfa-2b, Aliskiren fumarate, Alovudine, Amdoxovir, Amlodipine besylate/atorvastatin calcium, Amrubicin hydrochloride, Anakinra, AQ-13, Aripiprazole, AS-1404, Asoprisnil, Atacicept, Atrasentan; Belimumab, Bevacizumab, Bortezomib, Bosentan, Botulinum toxin type B, Brivaracetam; Catumaxomab, Cediranib, Cetuximab, cG250, Ciclesonide, Cinacalcet hydrochloride, Curcumin, Cypher; Darbepoetin alfa, Denosumab, Dihydrexidine; Eicosapentaenoic acid/docosahexaenoic acid, Entecavir, Erlotinib hydrochloride, Escitalopram oxalate, Etoricoxib, Everolimus, Ezetimibe; Febuxostat, Fenspiride hydrochloride, Fondaparinux sodium; Gefitinib, Ghrelin (human), GSK-1562902A; HSV-tk/GCV; Iclaprim, Imatinib mesylate, Imexon, Indacaterol, Insulinotropin, ISIS-112989; L-Alanosine, Lapatinib ditosylate, Laropiprant; Methoxy polyethylene glycol-epoetin-beta, Mipomersen sodium, Motexafin gadolinium; Natalizumab, Nimotuzumab; OSC, Ozarelix; PACAP-38, Paclitaxel nanoparticles, Parathyroid Hormone-Related Protein-(1-36), Pasireotide, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Pemetrexed disodium, Pertuzumab, Picoplatin, Pimecrolimus, Pitavastatin calcium, Plitidepsin; Ranelic acid distrontium salt, Ranolazine, Recombinant human relaxin H2, Regadenoson, RFB4(dsFv)-PE38, RO-3300074, Rosuvastatin calcium; SIR-Spheres, Solifenacin succinate, Sorafenib, Sunitinib malate; Tadalafil, Talabostat, Taribavirin hydrochloride, Taxus, Temsirolimus, Teriparatide, Tiotropium bromide, Tipifarnib, Tirapazamine, Tocilizumab; UCN-01, Ularitide, Uracil, Ustekinumab; V-260, Vandetanib, Vatalanib succinate, Vernakalant hydrochloride, Vorinostat; YM-155; Zileuton, Zoledronic acid monohydrate.

  19. Anti-trypanosomal activities and structural chemical properties of selected compound classes.

    PubMed

    Ponte-Sucre, Alicia; Bruhn, Heike; Schirmeister, Tanja; Cecil, Alexander; Albert, Christian R; Buechold, Christian; Tischer, Maximilian; Schlesinger, Susanne; Goebel, Tim; Fuß, Antje; Mathein, Daniela; Merget, Benjamin; Sotriffer, Christoph A; Stich, August; Krohne, Georg; Engstler, Markus; Bringmann, Gerhard; Holzgrabe, Ulrike

    2015-02-01

    Potent compounds do not necessarily make the best drugs in the market. Consequently, with the aim to describe tools that may be fundamental for refining the screening of candidates for animal and preclinical studies and further development, molecules of different structural classes synthesized within the frame of a broad screening platform were evaluated for their trypanocidal activities, cytotoxicities against murine macrophages J774.1 and selectivity indices, as well as for their ligand efficiencies and structural chemical properties. To advance into their modes of action, we also describe the morphological and ultrastructural changes exerted by selected members of each compound class on the parasite Trypanosoma brucei. Our data suggest that the potential organelles targeted are either the flagellar pocket (compound 77, N-Arylpyridinium salt; 15, amino acid derivative with piperazine moieties), the endoplasmic reticulum membrane systems (37, bisquaternary bisnaphthalimide; 77, N-Arylpyridinium salt; 68, piperidine derivative), or mitochondria and kinetoplasts (88, N-Arylpyridinium salt; 68, piperidine derivative). Amino acid derivatives with fumaric acid and piperazine moieties (4, 15) weakly inhibiting cysteine proteases seem to preferentially target acidic compartments. Our results suggest that ligand efficiency indices may be helpful to learn about the relationship between potency and chemical characteristics of the compounds. Interestingly, the correlations found between the physico-chemical parameters of the selected compounds and those of commercial molecules that target specific organelles indicate that our rationale might be helpful to drive compound design toward high activities and acceptable pharmacokinetic properties for all compound families.

  20. Knocking down mitochondrial iron transporter (MIT) reprograms primary and secondary metabolism in rice plants.

    PubMed

    Vigani, Gianpiero; Bashir, Khurram; Ishimaru, Yasuhiro; Lehmann, Martin; Casiraghi, Fabio Marco; Nakanishi, Hiromi; Seki, Motoaki; Geigenberger, Peter; Zocchi, Graziano; Nishizawa, Naoko K

    2016-03-01

    Iron (Fe) is an essential micronutrient for plant growth and development, and its reduced bioavailability strongly impairs mitochondrial functionality. In this work, the metabolic adjustment in the rice (Oryza sativa) mitochondrial Fe transporter knockdown mutant (mit-2) was analysed. Biochemical characterization of purified mitochondria from rice roots showed alteration in the respiratory chain of mit-2 compared with wild-type (WT) plants. In particular, proteins belonging to the type II alternative NAD(P)H dehydrogenases accumulated strongly in mit-2 plants, indicating that alternative pathways were activated to keep the respiratory chain working. Additionally, large-scale changes in the transcriptome and metabolome were observed in mit-2 rice plants. In particular, a strong alteration (up-/down-regulation) in the expression of genes encoding enzymes of both primary and secondary metabolism was found in mutant plants. This was reflected by changes in the metabolic profiles in both roots and shoots of mit-2 plants. Significant alterations in the levels of amino acids belonging to the aspartic acid-related pathways (aspartic acid, lysine, and threonine in roots, and aspartic acid and ornithine in shoots) were found that are strictly connected to the Krebs cycle. Furthermore, some metabolites (e.g. pyruvic acid, fumaric acid, ornithine, and oligosaccharides of the raffinose family) accumulated only in the shoot of mit-2 plants, indicating possible hypoxic responses. These findings suggest that the induction of local Fe deficiency in the mitochondrial compartment of mit-2 plants differentially affects the transcript as well as the metabolic profiles in root and shoot tissues. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Top