Sample records for functional tertiary interactions
-
Cooperative Tertiary Interaction Network Guides RNA Folding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Behrouzi, Reza; Roh, Joon Ho; Kilburn, Duncan
2013-04-08
Noncoding RNAs form unique 3D structures, which perform many regulatory functions. To understand how RNAs fold uniquely despite a small number of tertiary interaction motifs, we mutated the major tertiary interactions in a group I ribozyme by single-base substitutions. The resulting perturbations to the folding energy landscape were measured using SAXS, ribozyme activity, hydroxyl radical footprinting, and native PAGE. Double- and triple-mutant cycles show that most tertiary interactions have a small effect on the stability of the native state. Instead, the formation of core and peripheral structural motifs is cooperatively linked in near-native folding intermediates, and this cooperativity depends onmore » the native helix orientation. The emergence of a cooperative interaction network at an early stage of folding suppresses nonnative structures and guides the search for the native state. We suggest that cooperativity in noncoding RNAs arose from natural selection of architectures conducive to forming a unique, stable fold.« less
-
McDowell, S. Elizabeth; Jun, Jesse M.; Walter, Nils G.
2010-01-01
Enzymes generally are thought to derive their functional activity from conformational motions. The limited chemical variation in RNA suggests that such structural dynamics may play a particularly important role in RNA function. Minimal hammerhead ribozymes are known to cleave efficiently only in ∼10-fold higher than physiologic concentrations of Mg2+ ions. Extended versions containing native loop–loop interactions, however, show greatly enhanced catalytic activity at physiologically relevant Mg2+ concentrations, for reasons that are still ill-understood. Here, we use Mg2+ titrations, activity assays, ensemble, and single molecule fluorescence resonance energy transfer (FRET) approaches, combined with molecular dynamics (MD) simulations, to ask what influence the spatially distant tertiary loop–loop interactions of an extended hammerhead ribozyme have on its structural dynamics. By comparing hammerhead variants with wild-type, partially disrupted, and fully disrupted loop–loop interaction sequences we find that the tertiary interactions lead to a dynamic motional sampling that increasingly populates catalytically active conformations. At the global level the wild-type tertiary interactions lead to more frequent, if transient, encounters of the loop-carrying stems, whereas at the local level they lead to an enrichment in favorable in-line attack angles at the cleavage site. These results invoke a linkage between RNA structural dynamics and function and suggest that loop–loop interactions in extended hammerhead ribozymes—and Mg2+ ions that bind to minimal ribozymes—may generally allow more frequent access to a catalytically relevant conformation(s), rather than simply locking the ribozyme into a single active state. PMID:20921269
-
High-Throughput, Data-Rich Cellular RNA Device Engineering
Townshend, Brent; Kennedy, Andrew B.; Xiang, Joy S.; Smolke, Christina D.
2015-01-01
Methods for rapidly assessing sequence-structure-function landscapes and developing conditional gene-regulatory devices are critical to our ability to manipulate and interface with biology. We describe a framework for engineering RNA devices from preexisting aptamers that exhibit ligand-responsive ribozyme tertiary interactions. Our methodology utilizes cell sorting, high-throughput sequencing, and statistical data analyses to enable parallel measurements of the activities of hundreds of thousands of sequences from RNA device libraries in the absence and presence of ligands. Our tertiary interaction RNA devices exhibit improved performance in terms of gene silencing, activation ratio, and ligand sensitivity as compared to optimized RNA devices that rely on secondary structure changes. We apply our method to building biosensors for diverse ligands and determine consensus sequences that enable ligand-responsive tertiary interactions. These methods advance our ability to develop broadly applicable genetic tools and to elucidate understanding of the underlying sequence-structure-function relationships that empower rational design of complex biomolecules. PMID:26258292
-
Predicting loop–helix tertiary structural contacts in RNA pseudoknots
Cao, Song; Giedroc, David P.; Chen, Shi-Jie
2010-01-01
Tertiary interactions between loops and helical stems play critical roles in the biological function of many RNA pseudoknots. However, quantitative predictions for RNA tertiary interactions remain elusive. Here we report a statistical mechanical model for the prediction of noncanonical loop–stem base-pairing interactions in RNA pseudoknots. Central to the model is the evaluation of the conformational entropy for the pseudoknotted folds with defined loop–stem tertiary structural contacts. We develop an RNA virtual bond-based conformational model (Vfold model), which permits a rigorous computation of the conformational entropy for a given fold that contains loop–stem tertiary contacts. With the entropy parameters predicted from the Vfold model and the energy parameters for the tertiary contacts as inserted parameters, we can then predict the RNA folding thermodynamics, from which we can extract the tertiary contact thermodynamic parameters from theory–experimental comparisons. These comparisons reveal a contact enthalpy (ΔH) of −14 kcal/mol and a contact entropy (ΔS) of −38 cal/mol/K for a protonated C+•(G–C) base triple at pH 7.0, and (ΔH = −7 kcal/mol, ΔS = −19 cal/mol/K) for an unprotonated base triple. Tests of the model for a series of pseudoknots show good theory–experiment agreement. Based on the extracted energy parameters for the tertiary structural contacts, the model enables predictions for the structure, stability, and folding pathways for RNA pseudoknots with known or postulated loop–stem tertiary contacts from the nucleotide sequence alone. PMID:20100813
-
Computational study of stability of an H-H-type pseudoknot motif.
Wang, Jun; Zhao, Yunjie; Wang, Jian; Xiao, Yi
2015-12-01
Motifs in RNA tertiary structures are important to their structural organizations and biological functions. Here we consider an H-H-type pseudoknot (HHpk) motif that consists of two hairpins connected by a junction loop and with kissing interactions between the two hairpin loops. Such a tertiary structural motif is recurrently found in RNA tertiary structures, but is difficult to predict computationally. So it is important to understand the mechanism of its formation and stability. Here we investigate the stability of the HHpk tertiary structure by using an all-atom molecular dynamics simulation. The results indicate that the HHpk tertiary structure is stable. However, it is found that this stability is not due to the helix-helix packing, as is usually expected, but is maintained by the combined action of the kissing hairpin loops and junctions, although the former plays the main role. Stable HHpk motifs may form structural platforms for the molecules to realize their biological functions. These results are useful for understanding the construction principle of RNA tertiary structures and structure prediction.
-
Thermodynamic Origins of Monovalent Facilitated RNA Folding
Holmstrom, Erik D.; Fiore, Julie L.; Nesbitt, David J.
2012-01-01
Cations have long been associated with formation of native RNA structure and are commonly thought to stabilize the formation of tertiary contacts by favorably interacting with the electrostatic potential of the RNA, giving rise to an “ion atmosphere”. A significant amount of information regarding the thermodynamics of structural transitions in the presence of an ion atmosphere has accumulated and suggests stabilization is dominated by entropic terms. This work provides an analysis of how RNA–cation interactions affect the entropy and enthalpy associated with an RNA tertiary transition. Specifically, temperature-dependent single-molecule fluorescence resonance energy transfer studies have been exploited to determine the free energy (ΔG°), enthalpy (ΔH°), and entropy (ΔS°) of folding for an isolated tetraloop–receptor tertiary interaction as a function of Na+ concentration. Somewhat unexpectedly, increasing the Na+ concentration changes the folding enthalpy from a strongly exothermic process [e.g., ΔH° = −26(2) kcal/mol at 180 mM] to a weakly exothermic process [e.g., ΔH° = −4(1) kcal/mol at 630 mM]. As a direct corollary, it is the strong increase in folding entropy [Δ(ΔS°) > 0] that compensates for this loss of exothermicity for the achievement of more favorable folding [Δ(ΔG°) < 0] at higher Na+ concentrations. In conjunction with corresponding measurements of the thermodynamics of the transition state barrier, these data provide a detailed description of the folding pathway associated with the GAAA tetraloop–receptor interaction as a function of Na+ concentration. The results support a potentially universal mechanism for monovalent facilitated RNA folding, whereby an increasing monovalent concentration stabilizes tertiary structure by reducing the entropic penalty for folding. PMID:22448852
-
Tertiary network in mammalian mitochondrial tRNAAsp revealed by solution probing and phylogeny
Messmer, Marie; Pütz, Joern; Suzuki, Takeo; Suzuki, Tsutomu; Sauter, Claude; Sissler, Marie; Catherine, Florentz
2009-01-01
Primary and secondary structures of mammalian mitochondrial (mt) tRNAs are divergent from canonical tRNA structures due to highly skewed nucleotide content and large size variability of D- and T-loops. The nonconservation of nucleotides involved in the expected network of tertiary interactions calls into question the rules governing a functional L-shaped three-dimensional (3D) structure. Here, we report the solution structure of human mt-tRNAAsp in its native post-transcriptionally modified form and as an in vitro transcript. Probing performed with nuclease S1, ribonuclease V1, dimethylsulfate, diethylpyrocarbonate and lead, revealed several secondary structures for the in vitro transcribed mt-tRNAAsp including predominantly the cloverleaf. On the contrary, the native tRNAAsp folds into a single cloverleaf structure, highlighting the contribution of the four newly identified post-transcriptional modifications to correct folding. Reactivities of nucleotides and phosphodiester bonds in the native tRNA favor existence of a full set of six classical tertiary interactions between the D-domain and the variable region, forming the core of the 3D structure. Reactivities of D- and T-loop nucleotides support an absence of interactions between these domains. According to multiple sequence alignments and search for conservation of Leontis–Westhof interactions, the tertiary network core building rules apply to all tRNAAsp from mammalian mitochondria. PMID:19767615
-
Hu, Jingjing; Cheng, Yiyun; Wu, Qinglin; Zhao, Libo; Xu, Tongwen
2009-08-06
The host-guest chemistry of dendrimer-drug complexes is investigated by NMR techniques, including (1)H NMR and 2D-NOESY studies. The effects of molecular properties of drug molecules (protonation ability and spatial steric hindrance of charged groups) and surface functionalities of dendrimers (positively charged amine groups and negatively charged carboxylate groups) on the host-guest interactions are discussed. Different interaction mechanisms between dendrimers and drug molecules are proposed on the basis of NMR results. Primary amine- and secondary amine-containing drugs preferentially bind to negatively charged dendrimers by strong electrostatic interactions, whereas tertiary amine and quaternary ammonium-containing drugs have weak binding ability with dendrimers due to relatively low protonation ability of the tertiary amine group and serious steric hindrance of the quaternary ammonium group. Positively charged drugs locate only on the surface of negatively charged dendrimers, whereas negatively charged drugs locate both on the surface and in the interior cavities of positively charged dendrimers. The host-guest chemistry of dendrimer-drug complexes is promising for the development of new drug delivery systems.
-
Mustoe, Anthony M.; Brooks, Charles L.; Al-Hashimi, Hashim M.
2014-01-01
Recent studies have shown that basic steric and connectivity constraints encoded at the secondary structure level are key determinants of 3D structure and dynamics in simple two-way RNA junctions. However, the role of these topological constraints in higher order RNA junctions remains poorly understood. Here, we use a specialized coarse-grained molecular dynamics model to directly probe the thermodynamic contributions of topological constraints in defining the 3D architecture and dynamics of transfer RNA (tRNA). Topological constraints alone restrict tRNA's allowed conformational space by over an order of magnitude and strongly discriminate against formation of non-native tertiary contacts, providing a sequence independent source of folding specificity. Topological constraints also give rise to long-range correlations between the relative orientation of tRNA's helices, which in turn provides a mechanism for encoding thermodynamic cooperativity between distinct tertiary interactions. These aspects of topological constraints make it such that only several tertiary interactions are needed to confine tRNA to its native global structure and specify functionally important 3D dynamics. We further show that topological constraints are conserved across tRNA's different naturally occurring secondary structures. Taken together, our results emphasize the central role of secondary-structure-encoded topological constraints in defining RNA 3D structure, dynamics and folding. PMID:25217593
-
Secondary structure encodes a cooperative tertiary folding funnel in the Azoarcus ribozyme
Mustoe, Anthony M.; Al-Hashimi, Hashim M.; Brooks, Charles L.
2016-01-01
A requirement for specific RNA folding is that the free-energy landscape discriminate against non-native folds. While tertiary interactions are critical for stabilizing the native fold, they are relatively non-specific, suggesting additional mechanisms contribute to tertiary folding specificity. In this study, we use coarse-grained molecular dynamics simulations to explore how secondary structure shapes the tertiary free-energy landscape of the Azoarcus ribozyme. We show that steric and connectivity constraints posed by secondary structure strongly limit the accessible conformational space of the ribozyme, and that these so-called topological constraints in turn pose strong free-energy penalties on forming different tertiary contacts. Notably, native A-minor and base-triple interactions form with low conformational free energy, while non-native tetraloop/tetraloop–receptor interactions are penalized by high conformational free energies. Topological constraints also give rise to strong cooperativity between distal tertiary interactions, quantitatively matching prior experimental measurements. The specificity of the folding landscape is further enhanced as tertiary contacts place additional constraints on the conformational space, progressively funneling the molecule to the native state. These results indicate that secondary structure assists the ribozyme in navigating the otherwise rugged tertiary folding landscape, and further emphasize topological constraints as a key force in RNA folding. PMID:26481360
-
A Method to Predict the Structure and Stability of RNA/RNA Complexes.
Xu, Xiaojun; Chen, Shi-Jie
2016-01-01
RNA/RNA interactions are essential for genomic RNA dimerization and regulation of gene expression. Intermolecular loop-loop base pairing is a widespread and functionally important tertiary structure motif in RNA machinery. However, computational prediction of intermolecular loop-loop base pairing is challenged by the entropy and free energy calculation due to the conformational constraint and the intermolecular interactions. In this chapter, we describe a recently developed statistical mechanics-based method for the prediction of RNA/RNA complex structures and stabilities. The method is based on the virtual bond RNA folding model (Vfold). The main emphasis in the method is placed on the evaluation of the entropy and free energy for the loops, especially tertiary kissing loops. The method also uses recursive partition function calculations and two-step screening algorithm for large, complicated structures of RNA/RNA complexes. As case studies, we use the HIV-1 Mal dimer and the siRNA/HIV-1 mutant (T4) to illustrate the method.
-
Predicting RNA 3D structure using a coarse-grain helix-centered model
Kerpedjiev, Peter; Höner zu Siederdissen, Christian; Hofacker, Ivo L.
2015-01-01
A 3D model of RNA structure can provide information about its function and regulation that is not possible with just the sequence or secondary structure. Current models suffer from low accuracy and long running times and either neglect or presume knowledge of the long-range interactions which stabilize the tertiary structure. Our coarse-grained, helix-based, tertiary structure model operates with only a few degrees of freedom compared with all-atom models while preserving the ability to sample tertiary structures given a secondary structure. It strikes a balance between the precision of an all-atom tertiary structure model and the simplicity and effectiveness of a secondary structure representation. It provides a simplified tool for exploring global arrangements of helices and loops within RNA structures. We provide an example of a novel energy function relying only on the positions of stems and loops. We show that coupling our model to this energy function produces predictions as good as or better than the current state of the art tools. We propose that given the wide range of conformational space that needs to be explored, a coarse-grain approach can explore more conformations in less iterations than an all-atom model coupled to a fine-grain energy function. Finally, we emphasize the overarching theme of providing an ensemble of predicted structures, something which our tool excels at, rather than providing a handful of the lowest energy structures. PMID:25904133
-
European Science Notes, Volume 40, Number 7.
1986-07-01
for example, University of i.e., the details of protein-protein, Gbttingen--have departments of biochem- protein-nucleic acid , and nucleic acid ...istry but do not award degrees in bio- nucleic acid interactions and their reg- chemistry.) The Institute for Biochem- ulation is still to be resolved. A...tertiary structure acids structure and function; protein/ of the 5S rRNA molecule--the folding of nucleic- acid interactions; molecular the entire molecule of
-
Fluorescence Competition Assay Measurements of Free Energy Changes for RNA Pseudoknots†
2009-01-01
RNA pseudoknots have important functions, and thermodynamic stability is a key to predicting pseudoknots in RNA sequences and to understanding their functions. Traditional methods, such as UV melting and differential scanning calorimetry, for measuring RNA thermodynamics are restricted to temperature ranges around the melting temperature for a pseudoknot. Here, we report RNA pseudoknot free energy changes at 37 °C measured by fluorescence competition assays. Sequence-dependent studies for the loop 1−stem 2 region reveal (1) the individual nearest-neighbor hydrogen bonding (INN-HB) model provides a reasonable estimate for the free energy change when a Watson−Crick base pair in stem 2 is changed, (2) the loop entropy can be estimated by a statistical polymer model, although some penalty for certain loop sequences is necessary, and (3) tertiary interactions can significantly stabilize pseudoknots and extending the length of stem 2 may alter tertiary interactions such that the INN-HB model does not predict the net effect of adding a base pair. The results can inform writing of algorithms for predicting and/or designing RNA secondary structures. PMID:19921809
-
Bisaria, Namita; Greenfeld, Max; Limouse, Charles; Pavlichin, Dmitri S.; Mabuchi, Hideo; Herschlag, Daniel
2016-01-01
The past decade has seen a wealth of 3D structural information about complex structured RNAs and identification of functional intermediates. Nevertheless, developing a complete and predictive understanding of the folding and function of these RNAs in biology will require connection of individual rate and equilibrium constants to structural changes that occur in individual folding steps and further relating these steps to the properties and behavior of isolated, simplified systems. To accomplish these goals we used the considerable structural knowledge of the folded, unfolded, and intermediate states of P4-P6 RNA. We enumerated structural states and possible folding transitions and determined rate and equilibrium constants for the transitions between these states using single-molecule FRET with a series of mutant P4-P6 variants. Comparisons with simplified constructs containing an isolated tertiary contact suggest that a given tertiary interaction has a stereotyped rate for breaking that may help identify structural transitions within complex RNAs and simplify the prediction of folding kinetics and thermodynamics for structured RNAs from their parts. The preferred folding pathway involves initial formation of the proximal tertiary contact. However, this preference was only ∼10 fold and could be reversed by a single point mutation, indicating that a model akin to a protein-folding contact order model will not suffice to describe RNA folding. Instead, our results suggest a strong analogy with a modified RNA diffusion-collision model in which tertiary elements within preformed secondary structures collide, with the success of these collisions dependent on whether the tertiary elements are in their rare binding-competent conformations. PMID:27493222
-
Zuend, Stephan J; Jacobsen, Eric N
2007-12-26
The mechanism of the enantioselective cyanosilylation of ketones catalyzed by tertiary amino-thiourea derivatives was investigated using a combination of experimental and theoretical methods. The kinetic analysis is consistent with a cooperative mechanism in which both the thiourea and the tertiary amine of the catalyst are involved productively in the rate-limiting cyanide addition step. Density functional theory calculations were used to distinguish between mechanisms involving thiourea activation of ketone or of cyanide in the enantioselectivity-determining step. The strong correlation obtained between experimental and calculated ee's for a range of substrates and catalysts provides support for the most favorable calculated transition structures involving amine-bound HCN adding to thiourea-bound ketone. The calculations suggest that enantioselectivity arises from direct interactions between the ketone substrate and the amino-acid derived portion of the catalyst. On the basis of this insight, more enantioselective catalysts with broader substrate scope were prepared and evaluated experimentally.
-
The K-turn motif in riboswitches and other RNA species☆
Lilley, David M.J.
2014-01-01
The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078
-
Przybilski, Rita; Hammann, Christian
2007-01-01
Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711
-
Masso, Majid
2018-09-14
Scientific breakthroughs in recent decades have uncovered the capability of RNA molecules to fulfill a wide array of structural, functional, and regulatory roles in living cells, leading to a concomitantly significant increase in both the number and diversity of experimentally determined RNA three-dimensional (3D) structures. Atomic coordinates from a representative training set of solved RNA structures, displaying low sequence and structure similarity, facilitate derivation of knowledge-based energy functions. Here we develop an all-atom four-body statistical potential and evaluate its capacity to distinguish native RNA 3D structures from nonnative folds based on calculated free energy scores. Atomic four-body nearest-neighbors are objectively identified by their occurrence as tetrahedral vertices in the Delaunay tessellations of RNA structures, and rates of atomic quadruplet interactions expected by chance are obtained from a multinomial reference distribution. Our four-body energy function, referred to as RAMP (ribonucleic acids multibody potential), is subsequently derived by applying the inverted Boltzmann principle to the frequency data, yielding an energy score for each type of atomic quadruplet interaction. Several well-known benchmark datasets reveal that RAMP is comparable with, and often outperforms, existing knowledge- and physics-based energy functions. To the best of our knowledge, this is the first study detailing an RNA tertiary structure-based multibody statistical potential and its comparative evaluation. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki
2016-05-26
Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.
-
Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki
2016-01-01
Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414
-
Designing cooperatively folded abiotic uni- and multimolecular helix bundles
NASA Astrophysics Data System (ADS)
de, Soumen; Chi, Bo; Granier, Thierry; Qi, Ting; Maurizot, Victor; Huc, Ivan
2018-01-01
Abiotic foldamers, that is foldamers that have backbones chemically remote from peptidic and nucleotidic skeletons, may give access to shapes and functions different to those of peptides and nucleotides. However, design methodologies towards abiotic tertiary and quaternary structures are yet to be developed. Here we report rationally designed interactional patterns to guide the folding and assembly of abiotic helix bundles. Computational design facilitated the introduction of hydrogen-bonding functionalities at defined locations on the aromatic amide backbones that promote cooperative folding into helix-turn-helix motifs in organic solvents. The hydrogen-bond-directed aggregation of helices not linked by a turn unit produced several thermodynamically and kinetically stable homochiral dimeric and trimeric bundles with structures that are distinct from the designed helix-turn-helix. Relative helix orientation within the bundles may be changed from parallel to tilted on subtle solvent variations. Altogether, these results prefigure the richness and uniqueness of abiotic tertiary structure behaviour.
-
Three-dimensional tertiary structure of yeast phenylalanine transfer RNA
NASA Technical Reports Server (NTRS)
Kim, S. H.; Sussman, J. L.; Suddath, F. L.; Quigley, G. J.; Mcpherson, A.; Wang, A. H. J.; Seeman, N. C.; Rich, A.
1974-01-01
Results of an analysis and interpretation of a 3-A electron density map of yeast phenylalanine transfer RNA. Some earlier detailed assignments of nucleotide residues to electron density peaks are found to be in error, even though the overall tracing of the backbone conformation of yeast phenylalanine transfer RNA was generally correct. A new, more comprehensive interpretation is made which makes it possible to define the tertiary interactions in the molecule. The new interpretation makes it possible to visualize a number of tertiary interactions which not only explain the structural role of most of the bases which are constant in transfer RNAs, but also makes it possible to understand in a direct and simple fashion the chemical modification data on transfer RNA. In addition, this pattern of tertiary interactions provides a basis for understanding the general three-dimensional folding of all transfer RNA molecules.
-
Trinus, F P; Braver-Chernobul'skaia, B S; Luĭk, A I; Boldeskul, A E; Velichko, A N
1984-01-01
High affinity interactions between blood serum albumin and five substances of various chemical structure, exhibiting distinct physiological activity, were accompanied by alterations in the protein tertiary structure, while the albumin secondary structure was involved in conformational transformation after less effective affinity binding.
-
ERIC Educational Resources Information Center
Rubdy, Rani; Hui, Leng
2003-01-01
Investigates what constitutes effective and ineffective tone management in English-as-a-Foreign-Language classrooms with specific reference to tertiary level context in China. Findings indicate that effective tone management is likely to lead to a more congenial and contingent pattern of classroom interaction, where students become symmetrical…
-
NASA Astrophysics Data System (ADS)
Prasanth, S.; RitheshRaj, D.; Vineeshkumar, T. V.; Sudarsanakumar, C.
2018-05-01
The introduction of nanoparticles into biological fluids often leads to the formation of biocorona over the surface of nanoparticles. For the effective use of nanoparticles in biological applications it is very essential to understand their interactions with proteins. Herein, we investigated the interactions of Poly ethylene glycol capped Ag2S nanoparticles with Bovine Serum Albumin by spectroscopic techniques. By the addition of Ag2S nanoparticles, a ground state complex is formed. The CD spectroscopy reveals that the secondary structure of BSA is altered by complexation with PEG-Ag2S nanoparticles, while the overall tertiary structure remains closer to that of native BSA.
-
Efficient Ligation of the Schistosoma Hammerhead Ribozyme †
Canny, Marella D.; Jucker, Fiona M.; Pardi, Arthur
2011-01-01
The hammerhead ribozyme from Schistosoma mansoni is the best characterized of the natural hammerhead ribozymes. Biophysical, biochemical, and structural studies have shown that the formation of the loop-loop tertiary interaction between stems I and II alters the global folding, cleavage kinetics, and conformation of the catalytic core of this hammerhead, leading to a ribozyme that is readily cleaved under physiological conditions. This study investigates the ligation kinetics and the internal equilibrium between cleavage and ligation for the Schistosoma hammerhead. Single turnover kinetic studies on a construct where the ribozyme cleaves and ligates substrate(s) in trans showed up to 23% ligation when starting from fully cleaved products. This was achieved by a ~2,000-fold increase in the rate of ligation compared to a minimal hammerhead without the loop-loop tertiary interaction, yielding an internal equilibrium that ranges from 2–3 at physiological Mg2+ ion concentrations (0.1 –1 mM). Thus, the natural Schistosoma hammerhead ribozyme is almost as efficient at ligation as it is at cleavage. The results here are consistent with a model where formation of the loop-loop tertiary interaction leads to a higher population of catalytically active molecules, and where formation of this tertiary interaction has a much larger effect on the ligation than the cleavage activity of the Schistosoma hammerhead ribozyme. PMID:17319693
-
Fiore, Julie L.; Kraemer, Benedikt; Koberling, Felix; Edmann, Rainer; Nesbitt, David J.
2010-01-01
RNA folding thermodynamics are crucial for structure prediction, which requires characterization of both enthalpic and entropic contributions of tertiary motifs to conformational stability. We explore the temperature dependence of RNA folding due to the ubiquitous GAAA tetraloop–receptor docking interaction, exploiting immobilized and freely diffusing single-molecule fluorescence resonance energy transfer (smFRET) methods. The equilibrium constant for intramolecular docking is obtained as a function of temperature (T = 21–47 °C), from which a van’t Hoff analysis yields the enthalpy (ΔH°) and entropy (ΔS°) of docking. Tetraloop–receptor docking is significantly exothermic and entropically unfavorable in 1 mM MgCl2 and 100 mM NaCl, with excellent agreement between immobilized (ΔH° = −17.4 ± 1.6 kcal/mol, and ΔS° = −56.2 ± 5.4 cal mol−1 K−1) and freely diffusing (ΔH° = −17.2 ± 1.6 kcal/mol, and ΔS° = −55.9 ± 5.2 cal mol−1 K−1) species. Kinetic heterogeneity in the tetraloop–receptor construct is unaffected over the temperature range investigated, indicating a large energy barrier for interconversion between the actively docking and nondocking subpopulations. Formation of the tetraloop–receptor interaction can account for ~60% of the ΔH° and ΔS° of P4–P6 domain folding in the Tetrahymena ribozyme, suggesting that it may act as a thermodynamic clamp for the domain. Comparison of the isolated tetraloop–receptor and other tertiary folding thermodynamics supports a theme that enthalpy- versus entropy-driven folding is determined by the number of hydrogen bonding and base stacking interactions. PMID:19186984
-
RNA Tertiary Interactions in a Riboswitch Stabilize the Structure of a Kink Turn
Schroeder, Kersten T.; Daldrop, Peter; Lilley, David M.J.
2011-01-01
Summary The kink turn is a widespread RNA motif that introduces an acute kink into the axis of duplex RNA, typically comprising a bulge followed by a G⋅A and A⋅G pairs. The kinked conformation is stabilized by metal ions, or the binding of proteins including L7Ae. We now demonstrate a third mechanism for the stabilization of k-turn structure, involving tertiary interactions within a larger RNA structure. The SAM-I riboswitch contains an essential standard k-turn sequence that kinks a helix so that its terminal loop can make a long-range interaction. We find that some sequence variations in the k-turn within the riboswitch do not prevent SAM binding, despite preventing the folding of the k-turn in isolation. Furthermore, two crystal structures show that the sequence-variant k-turns are conventionally folded within the riboswitch. This study shows that the folded structure of the k-turn can be stabilized by tertiary interactions within a larger RNA structure. PMID:21893284
-
An Amino Acid Code to Define a Protein’s Tertiary Packing Surface
Fraga, Keith J.; Joo, Hyun; Tsai, Jerry
2015-01-01
One difficult aspect of the protein-folding problem is characterizing the non-specific interactions that define packing in protein tertiary structure. To better understand tertiary structure, this work extends the knob-socket model by classifying the interactions of a single knob residue packed into a set of contiguous sockets, or a pocket made up of 4 or more residues. The knob-socket construct allows for a symbolic two-dimensional mapping of pockets. The two-dimensional mapping of pockets provides a simple method to investigate the variety of pocket shapes in order to understand the geometry of protein tertiary surfaces. The diversity of pocket geometries can be organized into groups of pockets that share a common core, which suggests that some interactions in pockets are ancillary to packing. Further analysis of pocket geometries displays a preferred configuration that is right-handed in α-helices and left-handed in β-sheets. The amino acid composition of pockets illustrates the importance of non-polar amino acids in packing as well as position specificity. As expected, all pocket shapes prefer to pack with hydrophobic knobs; however, knobs are not selective for the pockets they pack. Investigating side-chain rotamer preferences for certain pocket shapes uncovers no strong correlations. These findings allow a simple vocabulary based on knobs and sockets to describe protein tertiary packing that supports improved analysis, design and prediction of protein structure. PMID:26575337
-
Schneider, Séverine; Ftouni, Hussein; Niu, Songlin; Schmitt, Martine; Simonin, Frédéric; Bihel, Frédéric
2015-07-07
We report a selective ruthenium catalyzed reduction of tertiary amides on the side chain of Fmoc-Gln-OtBu derivatives, leading to innovative unnatural α,β or γ-amino acids functionalized with tertiary amines. Rapid and scalable, this process allowed us to build a library of basic unnatural amino acids at the gram-scale and directly usable for liquid- or solid-phase peptide synthesis. The diversity of available tertiary amines allows us to modulate the physicochemical properties of the resulting amino acids, such as basicity or hydrophobicity.
-
Sengupta, Durba; Prasanna, Xavier; Mohole, Madhura; Chattopadhyay, Amitabha
2018-06-07
Gprotein-coupled receptors (GPCRs) are seven transmembrane receptors that mediate a large number of cellular responses and are important drug targets. One of the current challenges in GPCR biology is to analyze the molecular signatures of receptor-lipid interactions and their subsequent effects on GPCR structure, organization, and function. Molecular dynamics simulation studies have been successful in predicting molecular determinants of receptor-lipid interactions. In particular, predicted cholesterol interaction sites appear to correspond well with experimentally determined binding sites and estimated time scales of association. In spite of several success stories, the methodologies in molecular dynamics simulations are still emerging. In this Feature Article, we provide a comprehensive overview of coarse-grain and atomistic molecular dynamics simulations of GPCR-lipid interaction in the context of experimental observations. In addition, we discuss the effect of secondary and tertiary structural constraints in coarse-grain simulations in the context of functional dynamics and structural plasticity of GPCRs. We envision that this comprehensive overview will help resolve differences in computational studies and provide a way forward.
-
Structure-Function Study of Tertiary Amines as Switchable Polarity Solvents
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aaron D. Wilson; Frederick F. Stewart
2014-02-01
A series of tertiary amines have been screened for their function as switchable polarity solvents (SPS). The relative ratios of tertiary amine and carbonate species as well as maximum possible concentration were determined through quantitative 1H and 13C NMR spectroscopy. The viscosities of the polar SPS solutions were measured and ranged from near water in dilute systems through to gel formation at high concentrations. The van't Hoff indices for SPS solutions were measured through freezing point depression studies as a proxy for osmotic pressures. A new form of SPS with an amine : carbonate ratio significantly greater than unity hasmore » been identified. Tertiary amines that function as SPS at ambient pressures appear to be limited to molecules with fewer than 12 carbons. The N,N-dimethyl-n-alkylamine structure has been identified as important to the function of an SPS.« less
-
Making the Bend: DNA Tertiary Structure and Protein-DNA Interactions
Harteis, Sabrina; Schneider, Sabine
2014-01-01
DNA structure functions as an overlapping code to the DNA sequence. Rapid progress in understanding the role of DNA structure in gene regulation, DNA damage recognition and genome stability has been made. The three dimensional structure of both proteins and DNA plays a crucial role for their specific interaction, and proteins can recognise the chemical signature of DNA sequence (“base readout”) as well as the intrinsic DNA structure (“shape recognition”). These recognition mechanisms do not exist in isolation but, depending on the individual interaction partners, are combined to various extents. Driving force for the interaction between protein and DNA remain the unique thermodynamics of each individual DNA-protein pair. In this review we focus on the structures and conformations adopted by DNA, both influenced by and influencing the specific interaction with the corresponding protein binding partner, as well as their underlying thermodynamics. PMID:25026169
-
Tertiary and Quaternary Ammonium-Phosphate Ionic Liquids as Lubricant Additives
Barnhill, William C.; Luo, Huimin; Meyer, III, Harry M; ...
2016-06-23
In this work we investigated the feasibility of five quaternary (aprotic) and four tertiary (protic) ammonium ionic liquids (ILs) with an identical organophosphate anion as lubricant antiwear additives. Viscosity, oil solubility, thermal stability, and corrosivity of the candidate ILs were characterized and correlated to the molecular structure. The protic group exhibits higher oil solubility than the aprotic group, and longer alkyl chains seem to provide better oil solubility and higher thermal stability. Selected ILs were applied as oil additives in steel-cast iron tribological tests and demonstrated promising anti-scuffing and anti-wear functionality. The thickness, nanostructure, coverage and composition of the tribofilmmore » formed by the besting performing IL were revealed by surface characterization for mechanistic understanding of the tribochemical interactions between the IL and metal surface. Results provide fundamental insights of the correlations among the molecular structure, physiochemical properties and lubricating performance for ammonium-phosphate ILs.« less
-
Tertiary and Quaternary Ammonium-Phosphate Ionic Liquids as Lubricant Additives
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barnhill, William C.; Luo, Huimin; Meyer, III, Harry M
In this work we investigated the feasibility of five quaternary (aprotic) and four tertiary (protic) ammonium ionic liquids (ILs) with an identical organophosphate anion as lubricant antiwear additives. Viscosity, oil solubility, thermal stability, and corrosivity of the candidate ILs were characterized and correlated to the molecular structure. The protic group exhibits higher oil solubility than the aprotic group, and longer alkyl chains seem to provide better oil solubility and higher thermal stability. Selected ILs were applied as oil additives in steel-cast iron tribological tests and demonstrated promising anti-scuffing and anti-wear functionality. The thickness, nanostructure, coverage and composition of the tribofilmmore » formed by the besting performing IL were revealed by surface characterization for mechanistic understanding of the tribochemical interactions between the IL and metal surface. Results provide fundamental insights of the correlations among the molecular structure, physiochemical properties and lubricating performance for ammonium-phosphate ILs.« less
-
Kihara, Daisuke; Sael, Lee; Chikhi, Rayan; Esquivel-Rodriguez, Juan
2011-09-01
The tertiary structures of proteins have been solved in an increasing pace in recent years. To capitalize the enormous efforts paid for accumulating the structure data, efficient and effective computational methods need to be developed for comparing, searching, and investigating interactions of protein structures. We introduce the 3D Zernike descriptor (3DZD), an emerging technique to describe molecular surfaces. The 3DZD is a series expansion of mathematical three-dimensional function, and thus a tertiary structure is represented compactly by a vector of coefficients of terms in the series. A strong advantage of the 3DZD is that it is invariant to rotation of target object to be represented. These two characteristics of the 3DZD allow rapid comparison of surface shapes, which is sufficient for real-time structure database screening. In this article, we review various applications of the 3DZD, which have been recently proposed.
-
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs
2017-01-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980
-
Systematic detection of internal symmetry in proteins using CE-Symm.
Myers-Turnbull, Douglas; Bliven, Spencer E; Rose, Peter W; Aziz, Zaid K; Youkharibache, Philippe; Bourne, Philip E; Prlić, Andreas
2014-05-29
Symmetry is an important feature of protein tertiary and quaternary structures that has been associated with protein folding, function, evolution, and stability. Its emergence and ensuing prevalence has been attributed to gene duplications, fusion events, and subsequent evolutionary drift in sequence. This process maintains structural similarity and is further supported by this study. To further investigate the question of how internal symmetry evolved, how symmetry and function are related, and the overall frequency of internal symmetry, we developed an algorithm, CE-Symm, to detect pseudo-symmetry within the tertiary structure of protein chains. Using a large manually curated benchmark of 1007 protein domains, we show that CE-Symm performs significantly better than previous approaches. We use CE-Symm to build a census of symmetry among domain superfamilies in SCOP and note that 18% of all superfamilies are pseudo-symmetric. Our results indicate that more domains are pseudo-symmetric than previously estimated. We establish a number of recurring types of symmetry-function relationships and describe several characteristic cases in detail. With the use of the Enzyme Commission classification, symmetry was found to be enriched in some enzyme classes but depleted in others. CE-Symm thus provides a methodology for a more complete and detailed study of the role of symmetry in tertiary protein structure [availability: CE-Symm can be run from the Web at http://source.rcsb.org/jfatcatserver/symmetry.jsp. Source code and software binaries are also available under the GNU Lesser General Public License (version 2.1) at https://github.com/rcsb/symmetry. An interactive census of domains identified as symmetric by CE-Symm is available from http://source.rcsb.org/jfatcatserver/scopResults.jsp]. Copyright © 2014. Published by Elsevier Ltd.
-
Formaldehyde cross-linking and structural proteomics: Bridging the gap.
Srinivasa, Savita; Ding, Xuan; Kast, Juergen
2015-11-01
Proteins are dynamic entities constantly moving and altering their structures based on their functions and interactions inside and outside the cell. Formaldehyde cross-linking combined with mass spectrometry can accurately capture interactions of these rapidly changing biomolecules while maintaining their physiological surroundings. Even with its numerous established uses in biology and compatibility with mass spectrometry, formaldehyde has not yet been applied in structural proteomics. However, formaldehyde cross-linking is moving toward analyzing tertiary structure, which conventional cross-linkers have already accomplished. The purpose of this review is to describe the potential of formaldehyde cross-linking in structural proteomics by highlighting its applications, characteristics and current status in the field. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Rigid-Docking Approaches to Explore Protein-Protein Interaction Space.
Matsuzaki, Yuri; Uchikoga, Nobuyuki; Ohue, Masahito; Akiyama, Yutaka
Protein-protein interactions play core roles in living cells, especially in the regulatory systems. As information on proteins has rapidly accumulated on publicly available databases, much effort has been made to obtain a better picture of protein-protein interaction networks using protein tertiary structure data. Predicting relevant interacting partners from their tertiary structure is a challenging task and computer science methods have the potential to assist with this. Protein-protein rigid docking has been utilized by several projects, docking-based approaches having the advantages that they can suggest binding poses of predicted binding partners which would help in understanding the interaction mechanisms and that comparing docking results of both non-binders and binders can lead to understanding the specificity of protein-protein interactions from structural viewpoints. In this review we focus on explaining current computational prediction methods to predict pairwise direct protein-protein interactions that form protein complexes.
-
NASA Astrophysics Data System (ADS)
Weigt, Martin
Over the last years, biological research has been revolutionized by experimental high-throughput techniques, in particular by next-generation sequencing technology. Unprecedented amounts of data are accumulating, and there is a growing request for computational methods unveiling the information hidden in raw data, thereby increasing our understanding of complex biological systems. Statistical-physics models based on the maximum-entropy principle have, in the last few years, played an important role in this context. To give a specific example, proteins and many non-coding RNA show a remarkable degree of structural and functional conservation in the course of evolution, despite a large variability in amino acid sequences. We have developed a statistical-mechanics inspired inference approach - called Direct-Coupling Analysis - to link this sequence variability (easy to observe in sequence alignments, which are available in public sequence databases) to bio-molecular structure and function. In my presentation I will show, how this methodology can be used (i) to infer contacts between residues and thus to guide tertiary and quaternary protein structure prediction and RNA structure prediction, (ii) to discriminate interacting from non-interacting protein families, and thus to infer conserved protein-protein interaction networks, and (iii) to reconstruct mutational landscapes and thus to predict the phenotypic effect of mutations. References [1] M. Figliuzzi, H. Jacquier, A. Schug, O. Tenaillon and M. Weigt ''Coevolutionary landscape inference and the context-dependence of mutations in beta-lactamase TEM-1'', Mol. Biol. Evol. (2015), doi: 10.1093/molbev/msv211 [2] E. De Leonardis, B. Lutz, S. Ratz, S. Cocco, R. Monasson, A. Schug, M. Weigt ''Direct-Coupling Analysis of nucleotide coevolution facilitates RNA secondary and tertiary structure prediction'', Nucleic Acids Research (2015), doi: 10.1093/nar/gkv932 [3] F. Morcos, A. Pagnani, B. Lunt, A. Bertolino, D. Marks, C. Sander, R. Zecchina, J.N. Onuchic, T. Hwa, M. Weigt, ''Direct-coupling analysis of residue co-evolution captures native contacts across many protein families'', Proc. Natl. Acad. Sci. 108, E1293-E1301 (2011).
-
Hanke, Christian A.
2017-01-01
Riboswitches are genetic regulatory elements that control gene expression depending on ligand binding. The guanine-sensing riboswitch (Gsw) binds ligands at a three-way junction formed by paired regions P1, P2, and P3. Loops L2 and L3 cap the P2 and P3 helices and form tertiary interactions. Part of P1 belongs to the switching sequence dictating the fate of the mRNA. Previous studies revealed an intricate relationship between ligand binding and presence of the tertiary interactions, and between ligand binding and influence on the P1 region. However, no information is available on the interplay among these three main regions in Gsw. Here we show that stabilization of the L2-L3 region by tertiary interactions, and the ligand binding site by ligand binding, cooperatively influences the structural stability of terminal base pairs in the P1 region in the presence of Mg2+ ions. The results are based on molecular dynamics simulations with an aggregate simulation time of ~10 μs across multiple systems of the unbound state of the Gsw aptamer and a G37A/C61U mutant, and rigidity analyses. The results could explain why the three-way junction is a central structural element also in other riboswitches and how the cooperative effect could become contextual with respect to intracellular Mg2+ concentration. The results suggest that the transmission of allosteric information to P1 can be entropy-dominated. PMID:28640851
-
RNA 3D Structural Motifs: Definition, Identification, Annotation, and Database Searching
NASA Astrophysics Data System (ADS)
Nasalean, Lorena; Stombaugh, Jesse; Zirbel, Craig L.; Leontis, Neocles B.
Structured RNA molecules resemble proteins in the hierarchical organization of their global structures, folding and broad range of functions. Structured RNAs are composed of recurrent modular motifs that play specific functional roles. Some motifs direct the folding of the RNA or stabilize the folded structure through tertiary interactions. Others bind ligands or proteins or catalyze chemical reactions. Therefore, it is desirable, starting from the RNA sequence, to be able to predict the locations of recurrent motifs in RNA molecules. Conversely, the potential occurrence of one or more known 3D RNA motifs may indicate that a genomic sequence codes for a structured RNA molecule. To identify known RNA structural motifs in new RNA sequences, precise structure-based definitions are needed that specify the core nucleotides of each motif and their conserved interactions. By comparing instances of each recurrent motif and applying base pair isosteriCity relations, one can identify neutral mutations that preserve its structure and function in the contexts in which it occurs.
-
Tertiary structure-based analysis of microRNA–target interactions
Gan, Hin Hark; Gunsalus, Kristin C.
2013-01-01
Current computational analysis of microRNA interactions is based largely on primary and secondary structure analysis. Computationally efficient tertiary structure-based methods are needed to enable more realistic modeling of the molecular interactions underlying miRNA-mediated translational repression. We incorporate algorithms for predicting duplex RNA structures, ionic strength effects, duplex entropy and free energy, and docking of duplex–Argonaute protein complexes into a pipeline to model and predict miRNA–target duplex binding energies. To ensure modeling accuracy and computational efficiency, we use an all-atom description of RNA and a continuum description of ionic interactions using the Poisson–Boltzmann equation. Our method predicts the conformations of two constructs of Caenorhabditis elegans let-7 miRNA–target duplexes to an accuracy of ∼3.8 Å root mean square distance of their NMR structures. We also show that the computed duplex formation enthalpies, entropies, and free energies for eight miRNA–target duplexes agree with titration calorimetry data. Analysis of duplex–Argonaute docking shows that structural distortions arising from single-base-pair mismatches in the seed region influence the activity of the complex by destabilizing both duplex hybridization and its association with Argonaute. Collectively, these results demonstrate that tertiary structure-based modeling of miRNA interactions can reveal structural mechanisms not accessible with current secondary structure-based methods. PMID:23417009
-
Educational Online Technologies in Blended Tertiary Environments: A Review of Literature
ERIC Educational Resources Information Center
Tuapawa, Kimberley N.
2013-01-01
This is a review of the literature surrounding five popular media-rich educational online technologies (EOTs) currently being used by educationalists to support blended learning within tertiary environments. This review considers the following EOTs: 1) connective media, 2) interactive gaming, 3) virtual worlds, 4) web conferencing and 5) learning…
-
ERIC Educational Resources Information Center
Tuapawa, Kimberley
2017-01-01
Although educational online technologies (EOTs) have transformed the delivery of learning in higher education, significant EOT challenges have impeded their effectiveness, preventing widespread implementation. The persistence of these challenges suggests that tertiary education institutes (TEIs) have experienced a gap in understandings about the…
-
Running, William E; Reilly, James P
2010-10-01
Ribosomes occupy a central position in cellular metabolism, converting stored genetic information into active cellular machinery. Ribosomal proteins modulate both the intrinsic function of the ribosome and its interaction with other cellular complexes, such as chaperonins or the signal recognition particle. Chemical modification of proteins combined with mass spectrometric detection of the extent and position of covalent modifications is a rapid, sensitive method for the study of protein structure and flexibility. By altering the pH of the solution, we have induced non-denaturing changes in the structure of bacterial ribosomal proteins and detected these conformational changes by covalent labeling. Changes in ribosomal protein modification across a pH range from 6.6 to 8.3 are unique to each protein, and correlate with their structural environment in the ribosome. Lysine residues whose extent of modification increases as a function of increasing pH are on the surface of proteins, but in close proximity either to glutamate and aspartate residues, or to rRNA backbone phosphates. Increasing pH disrupts tertiary and quaternary interactions mediated by hydrogen bonding or ionic interactions, and regions of protein structure whose conformations are sensitive to these changes are of potential importance in modulating the flexibility of the ribosome or its interaction with other cellular complexes.
-
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
-
Who Has to Pay for Their Education? Evidence from European Tertiary Education
ERIC Educational Resources Information Center
Lim, Gieyoung; Kim, Chong-Uk
2013-01-01
In this article, we investigate a positive tertiary education externality in 18 European countries. Using a simple Cobb-Douglas-type production function with constant returns to scale, we find that there are positive spillover effects from tertiary education in European countries. According to our model prediction, on average, 72,000 new employed…
-
Co-Construction of Knowledge in Tertiary Online Settings: An Ecology of Resources Perspective
ERIC Educational Resources Information Center
Westberry, Nicola; Franken, Margaret
2013-01-01
Tertiary education has seen a shift toward pedagogies that make use of social interaction. As part of the shift, teachers have considered re-framing their role in the teaching process, and giving more attention to ways in which knowledge construction amongst students can be supported. While many online technologies are well positioned to support…
-
α-Crystallins Are Small Heat Shock Proteins: Functional and Structural Properties.
Tikhomirova, T S; Selivanova, O M; Galzitskaya, O V
2017-02-01
During its life cycle, a cell can be subjected to various external negative effects. Many proteins provide cell protection, including small heat shock proteins (sHsp) that have chaperone-like activity. These proteins have several important functions involving prevention of apoptosis and retention of cytoskeletal integrity; also, sHsp take part in the recovery of enzyme activity. The action mechanism of sHsp is based on the binding of hydrophobic regions exposed to the surface of a molten globule. α-Crystallins presented in chordate cells as two αA- and αB-isoforms are the most studied small heat shock proteins. In this review, we describe the main functions of α-crystallins, features of their secondary and tertiary structures, and examples of their partners in protein-protein interactions.
-
Importance of Diffuse Metal Ion Binding to RNA
Tan, Zhi-Jie; Chen, Shi-Jie
2016-01-01
RNAs are highly charged polyanionic molecules. RNA structure and function are strongly correlated with the ionic condition of the solution. The primary focus of this article is on the role of diffusive ions in RNA folding. Due to the long-range nature of electrostatic interactions, the diffuse ions can contribute significantly to RNA structural stability and folding kinetics. We present an overview of the experimental findings as well as the theoretical developments on the diffuse ion effects in RNA folding. This review places heavy emphasis on the effect of magnesium ions. Magnesium ions play a highly efficient role in stabilizing RNA tertiary structures and promoting tertiary structural folding. The highly efficient role goes beyond the mean-field effect such as the ionic strength. In addition to the effects of specific ion binding and ion dehydration, ion-ion correlation for the diffuse ions can contribute to the efficient role of the multivalent ions such as the magnesium ions in RNA folding. PMID:22010269
-
Importance of diffuse metal ion binding to RNA.
Tan, Zhi-Jie; Chen, Shi-Jie
2011-01-01
RNAs are highly charged polyanionic molecules. RNA structure and function are strongly correlated with the ionic condition of the solution. The primary focus of this article is on the role of diffusive ions in RNA folding. Due to the long-range nature of electrostatic interactions, the diffuse ions can contribute significantly to RNA structural stability and folding kinetics. We present an overview of the experimental findings as well as the theoretical developments on the diffuse ion effects in RNA folding. This review places heavy emphasis on the effect of magnesium ions. Magnesium ions play a highly efficient role in stabilizing RNA tertiary structures and promoting tertiary structural folding. The highly efficient role goes beyond the mean-field effect such as the ionic strength. In addition to the effects of specific ion binding and ion dehydration, ion-ion correlation for the diffuse ions can contribute to the efficient role of the multivalent ions such as the magnesium ions in RNA folding.
-
Nosov, Roman; Padnya, Pavel; Shurpik, Dmitriy; Stoikov, Ivan
2018-05-08
A convenient approach to the synthesis of multithiacalix[4]arene derivatives containing amino groups and phthalimide fragments by the formation of quaternary ammonium salts is presented. As the initial macrocycle for the synthesis of multithiacalix[4]arenes, a differently substituted p-tert- butylthiacalix[4]arene containing bromoacetamide and three phthalimide fragments was used in a 1,3-alternate conformation. The macrocycle in cone conformation containing the tertiary amino groups was found to be a convenient core for the multithiacalix[4]arene systems. Interaction of the core multithiacalix[4]arene with monobromoacetamide derivatives of p-tert- butylthiacalix[4]arene resulted in formation in high yields of pentakisthiacalix[4]arene containing quaternary ammonium and phthalimide fragments. The removal of phthalimide groups led to the formation of amino multithiacalix[4]arene in a good yield. Based on dynamic light scattering, it was shown that the synthesized amino multithiacalix[4]arene, with pronounced hydrophobic and hydrophilic fragments, formed dendrimer-like nanoparticles in water via direct supramolecular self-assembly.
-
Pulmonary function and adverse cardiovascular outcomes: Can cardiac function explain the link?
Burroughs Peña, Melissa S; Dunning, Allison; Schulte, Phillip J; Durheim, Michael T; Kussin, Peter; Checkley, William; Velazquez, Eric J
2016-12-01
The complex interaction between pulmonary function, cardiac function and adverse cardiovascular events has only been partially described. We sought to describe the association between pulmonary function with left heart structure and function, all-cause mortality and incident cardiovascular hospitalization. This study is a retrospective analysis of patients evaluated in a single tertiary care medical center. We used multivariable linear regression analyses to examine the relationship between FVC and FEV1 with left ventricular ejection fraction (LVEF), left ventricular internal dimension in systole and diastole (LVIDS, LVIDD) and left atrial diameter, adjusting for baseline characteristics, right ventricular function and lung hyperinflation. We also used Cox proportional hazards models to examine the relationship between FVC and FEV1 with all-cause mortality and cardiac hospitalization. A total of 1807 patients were included in this analysis with a median age of 61 years and 50% were female. Decreased FVC and FEV1 were both associated with decreased LVEF. In individuals with FVC less than 2.75 L, decreased FVC was associated with increased all-cause mortality after adjusting for left and right heart echocardiographic variables (hazard ratio [HR] 0.49, 95% CI 0.29, 0.82, respectively). Decreased FVC was associated with increased cardiac hospitalization after adjusting for left heart size (HR 0.80, 95% CI 0.67, 0.96), even in patients with normal LVEF (HR 0.75, 95% CI 0.57, 0.97). In a tertiary care center reduced pulmonary function was associated with adverse cardiovascular events, a relationship that is not fully explained by left heart remodeling or right heart dysfunction. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Reinharz, Vladimir; Soulé, Antoine; Westhof, Eric; Waldispühl, Jérôme; Denise, Alain
2018-05-04
The wealth of the combinatorics of nucleotide base pairs enables RNA molecules to assemble into sophisticated interaction networks, which are used to create complex 3D substructures. These interaction networks are essential to shape the 3D architecture of the molecule, and also to provide the key elements to carry molecular functions such as protein or ligand binding. They are made of organised sets of long-range tertiary interactions which connect distinct secondary structure elements in 3D structures. Here, we present a de novo data-driven approach to extract automatically from large data sets of full RNA 3D structures the recurrent interaction networks (RINs). Our methodology enables us for the first time to detect the interaction networks connecting distinct components of the RNA structure, highlighting their diversity and conservation through non-related functional RNAs. We use a graphical model to perform pairwise comparisons of all RNA structures available and to extract RINs and modules. Our analysis yields a complete catalog of RNA 3D structures available in the Protein Data Bank and reveals the intricate hierarchical organization of the RNA interaction networks and modules. We assembled our results in an online database (http://carnaval.lri.fr) which will be regularly updated. Within the site, a tool allows users with a novel RNA structure to detect automatically whether the novel structure contains previously observed RINs.
-
Shimpuku, Mayumi; Futagami, Seiji; Tajima, Natsuki; Yamawaki, Hiroshi; Maruki, Yuuta; Kodaka, Yasuhiro; Nagoya, Hiroyuki; Gudis, Katya; Kawagoe, Tetsuro; Sakamoto, Choitsu
2014-01-01
Background/Aims There is no available data on factors associated with healthcare-seeking behavior for functional dyspepsia (FD) symptoms at either tertiary or primary clinics in Japan. Therefore, we aimed to compare clinical symptoms and life styles such as sleep disorders and eating attitude in FD patients visiting general practitioners at primary clinics with those consulting gastroenterologists at tertiary clinics to clarify healthcare-seeking patterns in Japanese patients. Methods Fifty-one FD outpatients in a tertiary clinic (college hospital), 50 FD outpatients visiting primary clinics and 50 healthy volunteers were enrolled. Clinical symptoms, quality of life, sleep disorders, eating attitude and anxiety were estimated using the Gastrointestinal Symptom Rating Scale (GSRS), Social Functioning-8 (SF-8) test, Pittsburg Sleep Quality Index (PSQI) test and State-Trait Anxiety Inventory (STAI) for FD outpatients and healthy volunteers. Results FD outpatients exhibited higher mean scores of GSRS than healthy volunteers. The SF-8 physical component summary scores in the tertiary clinic group were significantly lower than those in the primary clinic group. GSRS scores were significantly (P < 0.001, P = 0.002) associated with global PSQI scores in FD outpatients as well as with STAI-trait scores (P = 0.006, P = 0.001) compared to healthy volunteers. The frequency of eating between meals in the primary clinic group was significantly (P < 0.05) higher than that in the tertiary clinic group. Conclusions It may be important for clarification of healthcare-seeking behavior to determine the difference in both impairment of physical quality of life and eating attitudes between tertiary clinic and primary clinic FD outpatients in Japan. PMID:25273121
-
Discovery of Tertiary Sulfonamides as Potent Liver X Receptor Antagonists
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zuercher, William J.; Buckholz, Richard G.; Campobasso, Nino
2010-08-12
Tertiary sulfonamides were identified in a HTS as dual liver X receptor (LXR, NR1H2, and NR1H3) ligands, and the binding affinity of the series was increased through iterative analogue synthesis. A ligand-bound cocrystal structure was determined which elucidated key interactions for high binding affinity. Further characterization of the tertiary sulfonamide series led to the identification of high affinity LXR antagonists. GSK2033 (17) is the first potent cell-active LXR antagonist described to date. 17 may be a useful chemical probe to explore the cell biology of this orphan nuclear receptor.
-
Discovery of tertiary sulfonamides as potent liver X receptor antagonists.
Zuercher, William J; Buckholz, Richard G; Campobasso, Nino; Collins, Jon L; Galardi, Cristin M; Gampe, Robert T; Hyatt, Stephen M; Merrihew, Susan L; Moore, John T; Oplinger, Jeffrey A; Reid, Paul R; Spearing, Paul K; Stanley, Thomas B; Stewart, Eugene L; Willson, Timothy M
2010-04-22
Tertiary sulfonamides were identified in a HTS as dual liver X receptor (LXR, NR1H2, and NR1H3) ligands, and the binding affinity of the series was increased through iterative analogue synthesis. A ligand-bound cocrystal structure was determined which elucidated key interactions for high binding affinity. Further characterization of the tertiary sulfonamide series led to the identification of high affinity LXR antagonists. GSK2033 (17) is the first potent cell-active LXR antagonist described to date. 17 may be a useful chemical probe to explore the cell biology of this orphan nuclear receptor.
-
Neurophysiological testing in anorectal disorders
Remes-Troche, Jose M; Rao, Satish SC
2013-01-01
Neurophysiological tests of anorectal function can provide useful information regarding the integrity of neuronal innervation, as well as neuromuscular function. This information can give insights regarding the pathophysiological mechanisms that lead to several disorders of anorectal function, particularly fecal incontinence, pelvic floor disorders and dyssynergic defecation. Currently, several tests are available for the neurophysiological evaluation of anorectal function. These tests are mostly performed on patients referred to tertiary care centers, either following negative evaluations or when there is lack of response to conventional therapy. Judicious use of these tests can reveal significant and new understanding of the underlying mechanism(s) that could pave the way for better management of these disorders. In addition, these techniques are complementary to other modalities of investigation, such as pelvic floor imaging. The most commonly performed neurophysiological tests, along with their indications and clinical utility are discussed. Several novel techniques are evolving that may reveal new information on brain–gut interactions. PMID:19072383
-
NASA Astrophysics Data System (ADS)
Bhunia, A. K.; Kamilya, T.; Saha, S.
2017-10-01
In this paper, we have used spectroscopic and electron microscopic analysis to monitor the time evolution of the silver nanoparticles (Ag NP)-human hemoglobin (Hb) corona formation and to characterize the interaction of the Ag NPs with Hb. The time constants for surface plasmon resonance binding and reorganization are found to be 9.51 and 118.48 min, respectively. The drop of surface charge and the increase of the hydrodynamic diameter indicated the corona of Hb on the Ag NP surface. The auto correlation function is found to broaden with the increasing time of the corona formation. Surface zeta potential revealed that positively charged Hb interact electrostatically with negatively charged Ag NP surfaces. The change in α helix and β sheet depends on the corona formation time. The visualization of the Hb corona from HRTEM showed large number of Hb domains aggregate containing essentially Ag NPs and without Ag NPs. Emission study showed the tertiary deformation, energy transfer, nature of interaction and quenching under three different temperatures.
-
Bhunia, A K; Kamilya, T; Saha, S
2017-01-01
In this paper, we have used spectroscopic and electron microscopic analysis to monitor the time evolution of the silver nanoparticles (Ag NP)-human hemoglobin (Hb) corona formation and to characterize the interaction of the Ag NPs with Hb. The time constants for surface plasmon resonance binding and reorganization are found to be 9.51 and 118.48 min, respectively. The drop of surface charge and the increase of the hydrodynamic diameter indicated the corona of Hb on the Ag NP surface. The auto correlation function is found to broaden with the increasing time of the corona formation. Surface zeta potential revealed that positively charged Hb interact electrostatically with negatively charged Ag NP surfaces. The change in α helix and β sheet depends on the corona formation time. The visualization of the Hb corona from HRTEM showed large number of Hb domains aggregate containing essentially Ag NPs and without Ag NPs. Emission study showed the tertiary deformation, energy transfer, nature of interaction and quenching under three different temperatures.
-
Downey, Christopher D.; Fiore, Julie L.; Stoddard, Colby D.; Hodak, Jose H.; Nesbitt, David J.; Pardi, Arthur
2008-01-01
The GAAA tetraloop-receptor is a commonly occurring tertiary interaction motif in RNA. This motif usually occurs in combination with other tertiary interactions in complex RNA structures. Thus, it is difficult to measure directly the contribution that a single GAAA tetraloop-receptor interaction makes to the folding properties of an RNA. To investigate the kinetics and thermodynamics for the isolated interaction, a GAAA tetraloop domain and receptor domain were connected by a single-stranded A7 linker. Fluorescence resonance energy transfer (FRET) experiments were used to probe intramolecular docking of the GAAA tetraloop and receptor. Docking was induced using a variety of metal ions, where the charge of the ion was the most important factor in determining the concentration of the ion required to promote docking ([Co(NH3)63+] ≪ [Ca2+], [Mg2+], [Mn2+] ≪ [Na+], [K+]). Analysis of metal ion cooperativity yielded Hill coefficients of ≈ 2 for Na+- or K+-dependent docking versus ≈ 1 for the divalent ions and Co(NH3)63+. Ensemble stopped-flow FRET kinetic measurements yielded an apparent activation energy of 12.7 kcal/mol for GAAA tetraloop-receptor docking. RNA constructs with U7 and A14 single-stranded linkers were investigated by single-molecule and ensemble FRET techniques to determine how linker length and composition affect docking. These studies showed that the single-stranded region functions primarily as a flexible tether. Inhibition of docking by oligonucleotides complementary to the linker was also investigated. The influence of flexible versus rigid linkers on GAAA tetraloop-receptor docking is discussed. PMID:16533049
-
Automated and fast building of three-dimensional RNA structures.
Zhao, Yunjie; Huang, Yangyu; Gong, Zhou; Wang, Yanjie; Man, Jianfen; Xiao, Yi
2012-01-01
Building tertiary structures of non-coding RNA is required to understand their functions and design new molecules. Current algorithms of RNA tertiary structure prediction give satisfactory accuracy only for small size and simple topology and many of them need manual manipulation. Here, we present an automated and fast program, 3dRNA, for RNA tertiary structure prediction with reasonable accuracy for RNAs of larger size and complex topology.
-
Nandi, Sandip Kumar; Chakraborty, Ayon; Panda, Alok Kumar; Ray, Sougata Sinha; Kar, Rajiv Kumar; Bhunia, Anirban; Biswas, Ashis
2015-03-01
Adenosine-5'-triphosphate (ATP) is an important phosphate metabolite abundantly found in Mycobacterium leprae bacilli. This pathogen does not derive ATP from its host but has its own mechanism for the generation of ATP. Interestingly, this molecule as well as several antigenic proteins act as bio-markers for the detection of leprosy. One such bio-marker is the 18 kDa antigen. This 18 kDa antigen is a small heat shock protein (HSP18) whose molecular chaperone function is believed to help in the growth and survival of the pathogen. But, no evidences of interaction of ATP with HSP18 and its effect on the structure and chaperone function of HSP18 are available in the literature. Here, we report for the first time evidences of "HSP18-ATP" interaction and its consequences on the structure and chaperone function of HSP18. TNP-ATP binding experiment and surface plasmon resonance measurement showed that HSP18 interacts with ATP with a sub-micromolar binding affinity. Comparative sequence alignment between M. leprae HSP18 and αB-crystallin identified the sequence 49KADSLDIDIE58 of HSP18 as the Walker-B ATP binding motif. Molecular docking studies revealed that β4-β8 groove/strands as an ATP interactive region in M. leprae HSP18. ATP perturbs the tertiary structure of HSP18 mildly and makes it less susceptible towards tryptic cleavage. ATP triggers exposure of additional hydrophobic patches at the surface of HSP18 and induces more stability against chemical and thermal denaturation. In vitro aggregation and thermal inactivation assays clearly revealed that ATP enhances the chaperone function of HSP18. Our studies also revealed that the alteration in the chaperone function of HSP18 is reversible and is independent of ATP hydrolysis. As the availability and binding of ATP to HSP18 regulates its chaperone function, this functional inflection may play an important role in the survival of M. leprae in hosts.
-
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2014-01-01
The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683
-
Hostetler, Jessica B.; Sharma, Sumana; Bartholdson, S. Josefin; Wright, Gavin J.; Fairhurst, Rick M.; Rayner, Julian C.
2015-01-01
Background A vaccine targeting Plasmodium vivax will be an essential component of any comprehensive malaria elimination program, but major gaps in our understanding of P. vivax biology, including the protein-protein interactions that mediate merozoite invasion of reticulocytes, hinder the search for candidate antigens. Only one ligand-receptor interaction has been identified, that between P. vivax Duffy Binding Protein (PvDBP) and the erythrocyte Duffy Antigen Receptor for Chemokines (DARC), and strain-specific immune responses to PvDBP make it a complex vaccine target. To broaden the repertoire of potential P. vivax merozoite-stage vaccine targets, we exploited a recent breakthrough in expressing full-length ectodomains of Plasmodium proteins in a functionally-active form in mammalian cells and initiated a large-scale study of P. vivax merozoite proteins that are potentially involved in reticulocyte binding and invasion. Methodology/Principal Findings We selected 39 P. vivax proteins that are predicted to localize to the merozoite surface or invasive secretory organelles, some of which show homology to P. falciparum vaccine candidates. Of these, we were able to express 37 full-length protein ectodomains in a mammalian expression system, which has been previously used to express P. falciparum invasion ligands such as PfRH5. To establish whether the expressed proteins were correctly folded, we assessed whether they were recognized by antibodies from Cambodian patients with acute vivax malaria. IgG from these samples showed at least a two-fold change in reactivity over naïve controls in 27 of 34 antigens tested, and the majority showed heat-labile IgG immunoreactivity, suggesting the presence of conformation-sensitive epitopes and native tertiary protein structures. Using a method specifically designed to detect low-affinity, extracellular protein-protein interactions, we confirmed a predicted interaction between P. vivax 6-cysteine proteins P12 and P41, further suggesting that the proteins are natively folded and functional. This screen also identified two novel protein-protein interactions, between P12 and PVX_110945, and between MSP3.10 and MSP7.1, the latter of which was confirmed by surface plasmon resonance. Conclusions/Significance We produced a new library of recombinant full-length P. vivax ectodomains, established that the majority of them contain tertiary structure, and used them to identify predicted and novel protein-protein interactions. As well as identifying new interactions for further biological studies, this library will be useful in identifying P. vivax proteins with vaccine potential, and studying P. vivax malaria pathogenesis and immunity. Trial Registration ClinicalTrials.gov NCT00663546 PMID:26701602
-
Pley, H W; Flaherty, K M; McKay, D B
1994-11-03
In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.
-
Effect of Mass Flow on Stack Eductor Performance.
1984-06-01
absolute viscosity, lbf-sec/ft2 - density, Ibm/ft 3 "function of" ENGLISH LETTER SYMBOLS 2 A - area, in , ft B - atmospheric pressure, in Hg c - sonic... absolute temperature ratio T* - tertiary flow to primary flow absolute temperature t ratio - secondary -o primary mass flow rate ratio W* - tertiary to...secondary to primary absolute Tp temperature ratio TiL tertiary to primary absolute -TE temperature ratio secondary to primary flow density ratio
-
RNA chaperone StpA loosens interactions of the tertiary structure in the td group I intron in vivo
Waldsich, Christina; Grossberger, Rupert; Schroeder, Renée
2002-01-01
Efficient splicing of the td group I intron in vivo is dependent on the ribosome. In the absence of translation, the pre-mRNA is trapped in nonnative-splicing-incompetent conformations. Alternatively, folding of the pre-mRNA can be promoted by the RNA chaperone StpA or by the group I intron-specific splicing factor Cyt-18. To understand the mechanism of action of RNA chaperones, we probed the impact of StpA on the structure of the td intron in vivo. Our data suggest that StpA loosens tertiary interactions. The most prominent structural change was the opening of the base triples, which are involved in the correct orientation of the two major intron core domains. In line with the destabilizing activity of StpA, splicing of mutant introns with a reduced structural stability is sensitive to StpA. In contrast, Cyt-18 strengthens tertiary contacts, thereby rescuing splicing of structurally compromised td mutants in vivo. Our data provide direct evidence for protein-induced conformational changes within catalytic RNA in vivo. Whereas StpA resolves tertiary contacts enabling the RNA to refold, Cyt-18 contributes to the overall compactness of the td intron in vivo. PMID:12208852
-
Mahalingam, Bhuvaneshwari; Ajroud, Kaouther; Alonso, Jose Luis; Anand, Saurabh; Adair, Brian; Horenstein, Alberto L; Malavasi, Fabio; Xiong, Jian-Ping; Arnaout, M. Amin
2011-01-01
A central feature of integrin interaction with physiologic ligands is the monodentate binding of a ligand carboxylate to a Mg2+ ion hexacoordinated at the metal-ion-dependent-adhesion site (MIDAS) in the integrin A-domain. This interaction stabilizes the A-domain in the high-affinity state, which is distinguished from the default low-affinity state by tertiary changes in the domain that culminate in cell adhesion. Small molecule ligand-mimetic integrin antagonists act as partial agonists, eliciting similar activating conformational changes in the A-domain, which has contributed to paradoxical adhesion and increased patient mortality in large clinical trials. As with other ligand-mimetic integrin antagonists, the function-blocking monoclonal antibody (mAb) 107 binds MIDAS of integrin CD11b/CD18 A-domain (CD11bA), but in contrast, it favors the inhibitory Ca2+ ion over Mg2+ at MIDAS. We determined the crystal structures of the Fab fragment of mAb 107 complexed to the low- and high-affinity states of CD11bA. Favored binding of Ca2+ at MIDAS is caused by the unusual symmetric bidentate ligation of a Fab-derived ligand Asp to a heptacoordinated MIDAS Ca2+. Binding of Fab 107 to CD11bA did not trigger the activating tertiary changes in the domain or in the full-length integrin. These data show that denticity of the ligand Asp/Glu can modify divalent cation selectivity at MIDAS and hence integrin function. Stabilizing the Ca2+ ion at MIDAS by bidentate ligation to a ligand Asp/Glu may provide one approach for designing pure integrin antagonists. PMID:22095715
-
Huang, Cheng-Yen; Hsieh, Ming-Ching; Zhou, Qinwei
2017-04-01
Monoclonal antibodies have become the fastest growing protein therapeutics in recent years. The stability and heterogeneity pertaining to its physical and chemical structures remain a big challenge. Tryptophan fluorescence has been proven to be a versatile tool to monitor protein tertiary structure. By modeling the tryptophan fluorescence emission envelope with log-normal distribution curves, the quantitative measure can be exercised for the routine characterization of monoclonal antibody overall tertiary structure. Furthermore, the log-normal deconvolution results can be presented as a two-dimensional plot with tryptophan emission bandwidth vs. emission maximum to enhance the resolution when comparing samples or as a function of applied perturbations. We demonstrate this by studying four different monoclonal antibodies, which show the distinction on emission bandwidth-maximum plot despite their similarity in overall amino acid sequences and tertiary structures. This strategy is also used to demonstrate the tertiary structure comparability between different lots manufactured for one of the monoclonal antibodies (mAb2). In addition, in the unfolding transition studies of mAb2 as a function of guanidine hydrochloride concentration, the evolution of the tertiary structure can be clearly traced in the emission bandwidth-maximum plot.
-
National Rules for Drug–Drug Interactions: Are They Appropriate for Tertiary Hospitals?
2016-01-01
The application of appropriate rules for drug–drug interactions (DDIs) could substantially reduce the number of adverse drug events. However, current implementations of such rules in tertiary hospitals are problematic as physicians are receiving too many alerts, causing high override rates and alert fatigue. We investigated the potential impact of Korean national DDI rules in a drug utilization review program in terms of their severity coverage and the clinical efficiency of how physicians respond to them. Using lists of high-priority DDIs developed with the support of the U.S. government, we evaluated 706 contraindicated DDI pairs released in May 2015. We evaluated clinical log data from one tertiary hospital and prescription data from two other tertiary hospitals. The measured parameters were national DDI rule coverage for high-priority DDIs, alert override rate, and number of prescription pairs. The coverage rates of national DDI rules were 80% and 3.0% at the class and drug levels, respectively. The analysis of the system log data showed an overall override rate of 79.6%. Only 0.3% of all of the alerts (n = 66) were high-priority DDI rules. These showed a lower override rate of 51.5%, which was much lower than for the overall DDI rules. We also found 342 and 80 unmatched high-priority DDI pairs which were absent in national rules in inpatient orders from the other two hospitals. The national DDI rules are not complete in terms of their coverage of severe DDIs. They also lack clinical efficiency in tertiary settings, suggesting improved systematic approaches are needed. PMID:27822925
-
Cheng, Ai-Xia; Han, Xiao-Juan; Wu, Yi-Feng; Lou, Hong-Xiang
2014-01-01
Flavonoids are secondary metabolites derived from phenylalanine and acetate metabolism. They fulfil a variety of functions in plants and have health benefits for humans. During the synthesis of the tricyclic flavonoid natural products in plants, oxidative modifications to the central C ring are catalyzed by four of FeII and 2-oxoglutarate dependent (2-ODD) oxygenases, namely flavone synthase I (FNS I), flavonol synthase (FLS), anthocyanidin synthase (ANS) and flavanone 3β-hydroxylase (FHT). FNS I, FLS and ANS are involved in desaturation of C2–C3 of flavonoids and FHT in hydroxylation of C3. FNS I, which is restricted to the Apiaceae species and in rice, is predicted to have evolved from FHT by duplication. Due to their sequence similarity and substrate specificity, FLS and ANS, which interact with the α surface of the substrate, belong to a group of dioxygenases having a broad substrate specificity, while FNS I and FHT are more selective, and interact with the naringenin β surface. Here, we summarize recent findings regarding the function of the four 2-ODD oxygenases and the relationship between their catalytic activity, their polypeptide sequence and their tertiary structure. PMID:24434621
-
Roychowdhury-Saha, Manami; Burke, Donald H.
2007-01-01
Divalent ion sensitivity of hammerhead ribozymes is significantly reduced when the RNA structure includes appropriate tertiary stabilization. Therefore, we investigated the activity of the tertiary stabilized “RzB” hammerhead ribozyme in several nondivalent ions. Ribozyme RzB is active in spermidine and Na+ alone, although the cleavage rates are reduced by more than 1,000-fold relative to the rates observed in Mg2+ and in transition metal ions. The trivalent cobalt hexammine (CoHex) ion is often used as an exchange-inert analog of hydrated magnesium ion. Trans-cleavage rates exceeded 8 min−1 in 20 mM CoHex, which promoted cleavage through outersphere interactions. The stimulation of catalysis afforded by the tertiary structural interactions within RzB does not require Mg2+, unlike other extended hammerhead ribozymes. Site-specific interaction with at least one Mg2+ ion is suggested by CoHex competition experiments. In the presence of a constant, low concentration of Mg2+, low concentrations of CoHex decreased the rate by two to three orders of magnitude relative to the rate in Mg2+ alone. Cleavage rates increased as CoHex concentrations were raised further, but the final fraction cleaved was lower than what was observed in CoHex or Mg2+ alone. These observations suggest that Mg2+ and CoHex compete for binding and that they cause misfolded structures when they are together. The results of this study support the existence of an alternate catalytic mechanism used by nondivalent ions (especially CoHex) that is distinct from the one promoted by divalent metal ions, and they imply that divalent metals influence catalysis through a specific nonstructural role. PMID:17456566
-
Computer Modeling of Protocellular Functions: Peptide Insertion in Membranes
NASA Technical Reports Server (NTRS)
Rodriquez-Gomez, D.; Darve, E.; Pohorille, A.
2006-01-01
Lipid vesicles became the precursors to protocells by acquiring the capabilities needed to survive and reproduce. These include transport of ions, nutrients and waste products across cell walls and capture of energy and its conversion into a chemically usable form. In modem organisms these functions are carried out by membrane-bound proteins (about 30% of the genome codes for this kind of proteins). A number of properties of alpha-helical peptides suggest that their associations are excellent candidates for protobiological precursors of proteins. In particular, some simple a-helical peptides can aggregate spontaneously and form functional channels. This process can be described conceptually by a three-step thermodynamic cycle: 1 - folding of helices at the water-membrane interface, 2 - helix insertion into the lipid bilayer and 3 - specific interactions of these helices that result in functional tertiary structures. Although a crucial step, helix insertion has not been adequately studied because of the insolubility and aggregation of hydrophobic peptides. In this work, we use computer simulation methods (Molecular Dynamics) to characterize the energetics of helix insertion and we discuss its importance in an evolutionary context. Specifically, helices could self-assemble only if their interactions were sufficiently strong to compensate the unfavorable Free Energy of insertion of individual helices into membranes, providing a selection mechanism for protobiological evolution.
-
Educational Online Technologies in Blended Tertiary Environments: Experts' Perspectives
ERIC Educational Resources Information Center
Tuapawa, Kimberley
2017-01-01
Although educational online technologies (EOTs) present an extraordinary range of higher education opportunities, significant gaps in knowledge about their purpose and functionality may impede levels of adoption. As the demand for online learning grows, it is critical that tertiary education institutes (TEIs) address gaps in knowledge by…
-
Three critical hydrogen bonds determine the catalytic activity of the Diels–Alderase ribozyme
Kraut, Stefanie; Bebenroth, Dirk; Nierth, Alexander; Kobitski, Andrei Y.; Nienhaus, G. Ulrich; Jäschke, Andres
2012-01-01
Compared to protein enzymes, our knowledge about how RNA accelerates chemical reactions is rather limited. The crystal structures of a ribozyme that catalyzes Diels–Alder reactions suggest a rich tertiary architecture responsible for catalysis. In this study, we systematically probe the relevance of crystallographically observed ground-state interactions for catalytic function using atomic mutagenesis in combination with various analytical techniques. The largest energetic contribution apparently arises from the precise shape complementarity between transition state and catalytic pocket: A single point mutant that folds correctly into the tertiary structure but lacks one H-bond that normally stabilizes the pocket is completely inactive. In the rate-limiting chemical step, the dienophile is furthermore activated by two weak H-bonds that contribute ∼7–8 kJ/mol to transition state stabilization, as indicated by the 25-fold slower reaction rates of deletion mutants. These H-bonds are also responsible for the tight binding of the Diels–Alder product by the ribozyme that causes product inhibition. For high catalytic activity, the ribozyme requires a fine-tuned balance between rigidity and flexibility that is determined by the combined action of one inter-strand H-bond and one magnesium ion. A sharp 360° turn reminiscent of the T-loop motif observed in tRNA is found to be important for catalytic function. PMID:21976731
-
Allostery in the ferredoxin protein motif does not involve a conformational switch.
Nechushtai, Rachel; Lammert, Heiko; Michaeli, Dorit; Eisenberg-Domovich, Yael; Zuris, John A; Luca, Maria A; Capraro, Dominique T; Fish, Alex; Shimshon, Odelia; Roy, Melinda; Schug, Alexander; Whitford, Paul C; Livnah, Oded; Onuchic, José N; Jennings, Patricia A
2011-02-08
Regulation of protein function via cracking, or local unfolding and refolding of substructures, is becoming a widely recognized mechanism of functional control. Oftentimes, cracking events are localized to secondary and tertiary structure interactions between domains that control the optimal position for catalysis and/or the formation of protein complexes. Small changes in free energy associated with ligand binding, phosphorylation, etc., can tip the balance and provide a regulatory functional switch. However, understanding the factors controlling function in single-domain proteins is still a significant challenge to structural biologists. We investigated the functional landscape of a single-domain plant-type ferredoxin protein and the effect of a distal loop on the electron-transfer center. We find the global stability and structure are minimally perturbed with mutation, whereas the functional properties are altered. Specifically, truncating the L1,2 loop does not lead to large-scale changes in the structure, determined via X-ray crystallography. Further, the overall thermal stability of the protein is only marginally perturbed by the mutation. However, even though the mutation is distal to the iron-sulfur cluster (∼20 Å), it leads to a significant change in the redox potential of the iron-sulfur cluster (57 mV). Structure-based all-atom simulations indicate correlated dynamical changes between the surface-exposed loop and the iron-sulfur cluster-binding region. Our results suggest intrinsic communication channels within the ferredoxin fold, composed of many short-range interactions, lead to the propagation of long-range signals. Accordingly, protein interface interactions that involve L1,2 could potentially signal functional changes in distal regions, similar to what is observed in other allosteric systems.
-
Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Ray, Sougata Sinha; Biswas, Ashis
2015-01-01
Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31–43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25–43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min-1. Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18. PMID:26098662
-
Nandi, Sandip Kumar; Chakraborty, Ayon; Panda, Alok Kumar; Sinha Ray, Sougata; Kar, Rajiv Kumar; Bhunia, Anirban; Biswas, Ashis
2015-01-01
Adenosine-5’-triphosphate (ATP) is an important phosphate metabolite abundantly found in Mycobacterium leprae bacilli. This pathogen does not derive ATP from its host but has its own mechanism for the generation of ATP. Interestingly, this molecule as well as several antigenic proteins act as bio-markers for the detection of leprosy. One such bio-marker is the 18 kDa antigen. This 18 kDa antigen is a small heat shock protein (HSP18) whose molecular chaperone function is believed to help in the growth and survival of the pathogen. But, no evidences of interaction of ATP with HSP18 and its effect on the structure and chaperone function of HSP18 are available in the literature. Here, we report for the first time evidences of “HSP18-ATP” interaction and its consequences on the structure and chaperone function of HSP18. TNP-ATP binding experiment and surface plasmon resonance measurement showed that HSP18 interacts with ATP with a sub-micromolar binding affinity. Comparative sequence alignment between M. leprae HSP18 and αB-crystallin identified the sequence 49KADSLDIDIE58 of HSP18 as the Walker-B ATP binding motif. Molecular docking studies revealed that β4-β8 groove/strands as an ATP interactive region in M. leprae HSP18. ATP perturbs the tertiary structure of HSP18 mildly and makes it less susceptible towards tryptic cleavage. ATP triggers exposure of additional hydrophobic patches at the surface of HSP18 and induces more stability against chemical and thermal denaturation. In vitro aggregation and thermal inactivation assays clearly revealed that ATP enhances the chaperone function of HSP18. Our studies also revealed that the alteration in the chaperone function of HSP18 is reversible and is independent of ATP hydrolysis. As the availability and binding of ATP to HSP18 regulates its chaperone function, this functional inflection may play an important role in the survival of M. leprae in hosts. PMID:25811190
-
2-Aminoquinazolin-4(3H)-one as an Organocatalyst for the Synthesis of Tertiary Amines.
Thakur, Maheshwar S; Nayal, Onkar S; Upadhyay, Rahul; Kumar, Neeraj; Maurya, Sushil K
2018-03-02
The potential of 2-aminoquinazolin-4(3H)-one as an organocatalyst for the activation of aldehydes via noncovalent interaction for the synthesis of tertiary amines using formic acid as a reducing agent is reported for the first time. The developed protocol demonstrated a dilated substrate scope for aromatic and aliphatic amines with aromatic and aliphatic aldehydes. Furthermore, the current method was also fruitful for the derivatization of ciprofloxacin and its derivative in good to excellent yields.
-
Lambert, Dominic; Draper, David E.
2012-01-01
To investigate the mechanism by which urea destabilizes RNA structure, urea-induced unfolding of four different RNA secondary and tertiary structures was quantified in terms of an m-value, the rate at which the free energy of unfolding changes with urea molality. From literature data and our osmometric study of a backbone analog, we derived average interaction potentials (per Å2 of solvent accessible surface) between urea and three kinds of RNA surfaces: phosphate, ribose, and base. Estimates of the increases in solvent accessible surface areas upon RNA denaturation were based on a simple model of unfolded RNA as a combination of helical and single strand segments. These estimates, combined with the three interaction potentials and a term to account for urea interactions with released ions, yield calculated m-values in good agreement with experimental values (200 mm monovalent salt). Agreement was obtained only if single-stranded RNAs were modeled in a highly stacked, A form conformation. The primary driving force for urea induced denaturation is the strong interaction of urea with the large surface areas of bases that become exposed upon denaturation of either RNA secondary or tertiary structure, though urea interactions with backbone and released ions may account for up to a third of the m-value. Urea m-values for all four RNA are salt-dependent, which we attribute to an increased extension (or decreased charge density) of unfolded RNAs with increased urea concentration. The sensitivity of the urea m-value to base surface exposure makes it a potentially useful probe of the conformations of RNA unfolded states. PMID:23088364
-
Sohail, Aamir; Faraz, Mohd; Arif, Hussain; Bhat, Sheraz Ahmad; Siddiqui, Azad Alam; Bano, Bilqees
2017-02-01
ZnO-NPs have been widely used in biomedical fields such as therapeutics, cellular imaging, and drug delivery. However, the risk of exposure of nanoparticles to the biological system is not well understood. Nanoparticle-protein interaction is pivotal to understand their biological behavior and predict nanoparticle toxicity that is crucial for its safer applications. In the present study zinc oxide nanoparticles (ZnO-NPs) were synthesized and subjected to interact with buffalo heart cystatin (BHC), purified from buffalo heart, to assess the effect(s) of ZnO-NPs on the structure and function of BHC. In vitro toxicity assessments revealed that BHC, upon interaction with ZnO-NPs, led to the altered protein conformation and perturbed function. A decrease in the anti-papain activity of BHC was observed. Spectroscopic studies demonstrated that formation of BHC-ZnO-NPs complex accompanied by structural changes in BHC along with a significant decrease in its α-helical content. ITC determined the thermodynamic parameters of binding between ZnO-NPs and BHC quantitatively. Increased surface hydrophobicity (change in the tertiary structure) was observed by ANS fluorescence that demonstrated the formation of molten globular intermediates that were found to be stable without any signs of aggregation as depicted by ThT fluorescence. TEM images gave the physical evidence of the formation of ZnO-NPs-BHC corona. Copyright © 2016. Published by Elsevier B.V.
-
White, Neil A; Hoogstraten, Charles G
2017-09-01
The hairpin ribozyme consists of two RNA internal loops that interact to form the catalytically active structure. This docking transition is a rare example of intermolecular formation of RNA tertiary structure without coupling to helix annealing. We have used temperature-dependent surface plasmon resonance (SPR) to characterize the thermodynamics and kinetics of RNA tertiary structure formation for the junctionless form of the ribozyme, in which loops A and B reside on separate molecules. We find docking to be strongly enthalpy-driven and to be accompanied by substantial activation barriers for association and dissociation, consistent with the structural reorganization of both internal loops upon complex formation. Comparisons with the parallel analysis of a ribozyme variant carrying a 2'-O-methyl modification at the self-cleavage site and with published data in other systems reveal a surprising diversity of thermodynamic signatures, emphasizing the delicate balance of contributions to the free energy of formation of RNA tertiary structure. Copyright © 2017 Elsevier B.V. All rights reserved.
-
MEGADOCK: An All-to-All Protein-Protein Interaction Prediction System Using Tertiary Structure Data
Ohue, Masahito; Matsuzaki, Yuri; Uchikoga, Nobuyuki; Ishida, Takashi; Akiyama, Yutaka
2014-01-01
The elucidation of protein-protein interaction (PPI) networks is important for understanding cellular structure and function and structure-based drug design. However, the development of an effective method to conduct exhaustive PPI screening represents a computational challenge. We have been investigating a protein docking approach based on shape complementarity and physicochemical properties. We describe here the development of the protein-protein docking software package “MEGADOCK” that samples an extremely large number of protein dockings at high speed. MEGADOCK reduces the calculation time required for docking by using several techniques such as a novel scoring function called the real Pairwise Shape Complementarity (rPSC) score. We showed that MEGADOCK is capable of exhaustive PPI screening by completing docking calculations 7.5 times faster than the conventional docking software, ZDOCK, while maintaining an acceptable level of accuracy. When MEGADOCK was applied to a subset of a general benchmark dataset to predict 120 relevant interacting pairs from 120 x 120 = 14,400 combinations of proteins, an F-measure value of 0.231 was obtained. Further, we showed that MEGADOCK can be applied to a large-scale protein-protein interaction-screening problem with accuracy better than random. When our approach is combined with parallel high-performance computing systems, it is now feasible to search and analyze protein-protein interactions while taking into account three-dimensional structures at the interactome scale. MEGADOCK is freely available at http://www.bi.cs.titech.ac.jp/megadock. PMID:23855673
-
Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective
NASA Technical Reports Server (NTRS)
Gutell, R. R.; Larsen, N.; Woese, C. R.
1994-01-01
The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical modification (in the isolated rRNA), which suggests that considerable higher-order structure remains to be found (although all of it may not involve base-base interactions and so may not be detectable by comparative analysis). The agreement between the higher-order structure of the small-subunit rRNA and protection against chemical modification is not perfect, however; some bases shown to covary canonically are accessible to chemical modification (45).(ABSTRACT TRUNCATED AT 400 WORDS).
-
Hong, Zebin; De Meulemeester, Laura; Jacobi, Annemarie; Pedersen, Jan Skov; Morth, J Preben; Andreasen, Peter A; Jensen, Jan K
2016-07-01
Hepatocyte growth factor activator inhibitor-1 (HAI-1) is a type I transmembrane protein and inhibitor of several serine proteases, including hepatocyte growth factor activator and matriptase. The protein is essential for development as knock-out mice die in utero due to placental defects caused by misregulated extracellular proteolysis. HAI-1 contains two Kunitz-type inhibitor domains (Kunitz), which are generally thought of as a functionally self-contained protease inhibitor unit. This is not the case for HAI-1, where our results reveal how interdomain interactions have evolved to stimulate the inhibitory activity of an integrated Kunitz. Here we present an x-ray crystal structure of an HAI-1 fragment covering the internal domain and Kunitz-1. The structure reveals not only that the previously uncharacterized internal domain is a member of the polycystic kidney disease domain family but also how the two domains engage in interdomain interactions. Supported by solution small angle x-ray scattering and a combination of site-directed mutagenesis and functional assays, we show that interdomain interactions not only stabilize the fold of the internal domain but also stimulate the inhibitory activity of Kunitz-1. By completing our structural characterization of the previously unknown N-terminal region of HAI-1, we provide new insight into the interplay between tertiary structure and the inhibitory activity of a multidomain protease inhibitor. We propose a previously unseen mechanism by which the association of an auxiliary domain stimulates the inhibitory activity of a Kunitz-type inhibitor (i.e. the first structure of an intramolecular interaction between a Kunitz and another domain). © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Talk or Chat? Chatroom and Spoken Interaction in a Language Classroom
ERIC Educational Resources Information Center
Hamano-Bunce, Douglas
2011-01-01
This paper describes a study comparing chatroom and face-to-face oral interaction for the purposes of language learning in a tertiary classroom in the United Arab Emirates. It uses transcripts analysed for Language Related Episodes, collaborative dialogues, thought to be externally observable examples of noticing in action. The analysis is…
-
ERIC Educational Resources Information Center
Schonborn, Konrad J.; Bivall, Petter; Tibell, Lena A. E.
2011-01-01
This study explores tertiary students' interaction with a haptic virtual model representing the specific binding of two biomolecules, a core concept in molecular life science education. Twenty students assigned to a "haptics" (experimental) or "no-haptics" (control) condition performed a "docking" task where users sought the most favourable…
-
ERIC Educational Resources Information Center
Gan, Chin Lay; Balakrishnan, Vimala
2017-01-01
The current study sets out to identify determinants affecting tertiary students' behavioural intentions to use mobile technology in lectures. The study emphasises that the reason for using mobile technology in classrooms with large numbers of students is to facilitate interactions among students and lecturers. The proposed conceptual framework has…
-
2015-01-01
Chloramination of drinking waters has been associated with N-nitrosodimethylamine (NDMA) formation as a disinfection byproduct. NDMA is classified as a probable carcinogen and thus its formation during chloramination has recently become the focus of considerable research interest. In this study, the formation mechanisms of NDMA from ranitidine and trimethylamine (TMA), as models of tertiary amines, during chloramination were investigated by using density functional theory (DFT). A new four-step formation pathway of NDMA was proposed involving nucleophilic substitution by chloramine, oxidation, and dehydration followed by nitrosation. The results suggested that nitrosation reaction is the rate-limiting step and determines the NDMA yield for tertiary amines. When 45 other tertiary amines were examined, the proposed mechanism was found to be more applicable to aromatic tertiary amines, and there may be still some additional factors or pathways that need to be considered for aliphatic tertiary amines. The heterolytic ONN(Me)2–R+ bond dissociation energy to release NDMA and carbocation R+ was found to be a criterion for evaluating the reactivity of aromatic tertiary amines. A structure–activity study indicates that tertiary amines with benzyl, aromatic heterocyclic ring, and diene-substituted methenyl adjacent to the DMA moiety are potentially significant NDMA precursors. The findings of this study are helpful for understanding NDMA formation mechanism and predicting NDMA yield of a precursor. PMID:24968236
-
Liu, Yong Dong; Selbes, Meric; Zeng, Chengchu; Zhong, Rugang; Karanfil, Tanju
2014-01-01
Chloramination of drinking waters has been associated with N-nitrosodimethylamine (NDMA) formation as a disinfection byproduct. NDMA is classified as a probable carcinogen and thus its formation during chloramination has recently become the focus of considerable research interest. In this study, the formation mechanisms of NDMA from ranitidine and trimethylamine (TMA), as models of tertiary amines, during chloramination were investigated by using density functional theory (DFT). A new four-step formation pathway of NDMA was proposed involving nucleophilic substitution by chloramine, oxidation, and dehydration followed by nitrosation. The results suggested that nitrosation reaction is the rate-limiting step and determines the NDMA yield for tertiary amines. When 45 other tertiary amines were examined, the proposed mechanism was found to be more applicable to aromatic tertiary amines, and there may be still some additional factors or pathways that need to be considered for aliphatic tertiary amines. The heterolytic ONN(Me)2-R(+) bond dissociation energy to release NDMA and carbocation R(+) was found to be a criterion for evaluating the reactivity of aromatic tertiary amines. A structure-activity study indicates that tertiary amines with benzyl, aromatic heterocyclic ring, and diene-substituted methenyl adjacent to the DMA moiety are potentially significant NDMA precursors. The findings of this study are helpful for understanding NDMA formation mechanism and predicting NDMA yield of a precursor.
-
Izzo, Flavia; Schäfer, Martina; Lienau, Philip; Ganzer, Ursula; Stockman, Robert; Lücking, Ulrich
2018-05-04
An unprecedented set of structurally diverse sulfonimidamides (47 compounds) has been prepared by various N-functionalization reactions of tertiary =NH sulfonimidamide 2 aa. These N-functionalization reactions of model compound 2 aa include arylation, alkylation, trifluoromethylation, cyanation, sulfonylation, alkoxycarbonylation (carbamate formation) and aminocarbonylation (urea formation). Small molecule X-ray analyses of selected N-functionalized products are reported. To gain further insight into the properties of sulfonimidamides relevant to medicinal chemistry, a variety of structurally diverse reaction products were tested in selected in vitro assays. The described N-functionalization reactions provide a short and efficient approach to structurally diverse sulfonimidamides which have been the subject of recent, growing interest in the life sciences. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Heo, Jungwoo; Kim, Gi-Hwan; Jeong, Jaeki; Yoon, Yung Jin; Seo, Jung Hwa; Walker, Bright; Kim, Jin Young
2016-11-09
We report the preparation of Cu 2 S, In 2 S 3 , CuInS 2 and Cu(In,Ga)S 2 semiconducting films via the spin coating and annealing of soluble tertiary-alkyl thiolate complexes. The thiolate compounds are readily prepared via the reaction of metal bases and tertiary-alkyl thiols. The thiolate complexes are soluble in common organic solvents and can be solution processed by spin coating to yield thin films. Upon thermal annealing in the range of 200-400 °C, the tertiary-alkyl thiolates decompose cleanly to yield volatile dialkyl sulfides and metal sulfide films which are free of organic residue. Analysis of the reaction byproducts strongly suggests that the decomposition proceeds via an SN 1 mechanism. The composition of the films can be controlled by adjusting the amount of each metal thiolate used in the precursor solution yielding bandgaps in the range of 1.2 to 3.3 eV. The films form functioning p-n junctions when deposited in contact with CdS films prepared by the same method. Functioning solar cells are observed when such p-n junctions are prepared on transparent conducting substrates and finished by depositing electrodes with appropriate work functions. This method enables the fabrication of metal chalcogenide films on a large scale via a simple and chemically clear process.
-
NASA Astrophysics Data System (ADS)
Heo, Jungwoo; Kim, Gi-Hwan; Jeong, Jaeki; Yoon, Yung Jin; Seo, Jung Hwa; Walker, Bright; Kim, Jin Young
2016-11-01
We report the preparation of Cu2S, In2S3, CuInS2 and Cu(In,Ga)S2 semiconducting films via the spin coating and annealing of soluble tertiary-alkyl thiolate complexes. The thiolate compounds are readily prepared via the reaction of metal bases and tertiary-alkyl thiols. The thiolate complexes are soluble in common organic solvents and can be solution processed by spin coating to yield thin films. Upon thermal annealing in the range of 200-400 °C, the tertiary-alkyl thiolates decompose cleanly to yield volatile dialkyl sulfides and metal sulfide films which are free of organic residue. Analysis of the reaction byproducts strongly suggests that the decomposition proceeds via an SN1 mechanism. The composition of the films can be controlled by adjusting the amount of each metal thiolate used in the precursor solution yielding bandgaps in the range of 1.2 to 3.3 eV. The films form functioning p-n junctions when deposited in contact with CdS films prepared by the same method. Functioning solar cells are observed when such p-n junctions are prepared on transparent conducting substrates and finished by depositing electrodes with appropriate work functions. This method enables the fabrication of metal chalcogenide films on a large scale via a simple and chemically clear process.
-
Tandem catalytic allylic amination and [2,3]-Stevens rearrangement of tertiary amines.
Soheili, Arash; Tambar, Uttam K
2011-08-24
We have developed a catalytic allylic amination involving tertiary aminoesters and allylcarbonates, which is the first example of the use of tertiary amines as intermolecular nucleophiles in metal-catalyzed allylic substitution chemistry. This process is employed in a tandem ammonium ylide generation/[2,3]-rearrangement reaction, which formally represents a palladium-catalyzed Stevens rearrangement. Low catalyst loadings and mild reaction conditions are compatible with an unprecedented substrate scope for the ammonium ylide functionality, and products are generated in high yields and diastereoselectivities. Mechanistic studies suggested the reversible formation of an ammonium intermediate.
-
Geographical Detector-Based Risk Factors Assessment of the Hand-Foot-Mouth Disease in China
NASA Astrophysics Data System (ADS)
Huang, J.
2017-12-01
Background: Hand, foot and mouth disease(HFMD) is a common infectious disease, causing thousands of deaths among children in China. This study focused on analyzing the impacts of different populations and different industry structures on HFMD incidence in China. Methods: We collected HFMD cases from 2307 counties during May 2008 in China. The potential risk factors included: monthly mean temperature, monthly mean relative humidity, monthly precipitation, different population density, different industry structures. Geographical detector technique was used to analyze the main and interactive effect of potential risk factors on HFMD incidence. Result: Using risk detector, we found the most serious HFMD incidence mainly located in the Yangtze River delta and the Pearl River delta. When the temperature was high, the incidence of HFMD was also high. This finding indicates that there is a correlation between monthly mean temperature and the incidence of HFMD. Similar analysis was undertaken to analyze the correlation between other variables and the incidence of HFMD using the risk detector. Using factor detector, we found the effect of risk factors on the incidence of HFMD, and this was ranked by PD value as follows: density of children aged 0-9 years (0.25) > tertiary industry (0.23) > GDP (0.20) >middle school student density (0.13) > relative humidity (0.12) >average temperature (0.11) >first industry (0.05). Using ecological detector, we found that child density, tertiary industry, and GDP had a strong effect on the incidence of HFMD. Using interactive detector, we found that the interactive PD value of tertiary industry and child population density was 0.42, which of GDP and tertiary industry was 0.34, that of child population density and GDP was 0.35, and that of average temperature and relative humidity was 0.28. All of these interactive PD values appeared to be higher than any PD value of sole risk factors. The combinations of the above-mentioned risk factors could effectively explain spatial variability of the incidence of HFMD in China.
-
Day, Ryan; Joo, Hyun; Chavan, Archana; Lennox, Kristin P.; Chen, Ann; Dahl, David B.; Vannucci, Marina; Tsai, Jerry W.
2012-01-01
As an alternative to the common template based protein structure prediction methods based on main-chain position, a novel side-chain centric approach has been developed. Together with a Bayesian loop modeling procedure and a combination scoring function, the Stone Soup algorithm was applied to the CASP9 set of template based modeling targets. Although the method did not generate as large of perturbations to the template structures as necessary, the analysis of the results gives unique insights into the differences in packing between the target structures and their templates. Considerable variation in packing is found between target and template structures even when the structures are close, and this variation is found due to 2 and 3 body packing interactions. Outside the inherent restrictions in packing representation of the PDB, the first steps in correctly defining those regions of variable packing have been mapped primarily to local interactions, as the packing at the secondary and tertiary structure are largely conserved. Of the scoring functions used, a loop scoring function based on water structure exhibited some promise for discrimination. These results present a clear structural path for further development of a side-chain centered approach to template based modeling. PMID:23266765
-
Day, Ryan; Joo, Hyun; Chavan, Archana C; Lennox, Kristin P; Chen, Y Ann; Dahl, David B; Vannucci, Marina; Tsai, Jerry W
2013-02-01
As an alternative to the common template based protein structure prediction methods based on main-chain position, a novel side-chain centric approach has been developed. Together with a Bayesian loop modeling procedure and a combination scoring function, the Stone Soup algorithm was applied to the CASP9 set of template based modeling targets. Although the method did not generate as large of perturbations to the template structures as necessary, the analysis of the results gives unique insights into the differences in packing between the target structures and their templates. Considerable variation in packing is found between target and template structures even when the structures are close, and this variation is found due to 2 and 3 body packing interactions. Outside the inherent restrictions in packing representation of the PDB, the first steps in correctly defining those regions of variable packing have been mapped primarily to local interactions, as the packing at the secondary and tertiary structure are largely conserved. Of the scoring functions used, a loop scoring function based on water structure exhibited some promise for discrimination. These results present a clear structural path for further development of a side-chain centered approach to template based modeling. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Microstructural Characterization of Alloy 617 Crept into the Tertiary Regime
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lillo, Thomas Martin; Wright, Richard Neil
2015-07-01
The microstructure of Alloy 617 was characterized following creep tests interrupted at total creep strains ranging from 2-20%. A range of creep temperatures (750-1000oC) and initial creep stresses (10-145 MPa) produced creep test durations ranging from 1 to 5800 hours. Image analysis of optical photomicrographs on longitudinal sections of the gage length was used to document the fraction of creep porosity as a function of creep parameters. Creep porosity was negligible below tertiary creep strains of 10% and increased with tertiary creep strain, thereafter. For a given temperature and total creep strain, creep porosity increased with decreasing creep stress. Creepmore » porosity increased linearly with duration of the creep experiment. TEM performed on the gage sections did not reveal significant creep cavity formation on grain boundaries at the sub-micron level. It was concluded that the onset of tertiary creep did not result from creep cavitation and more likely arose due to the formation of low energy dislocation substructures with increasing tertiary strain.« less
-
Liu, X Y; Matherly, L H
2001-01-01
The human reduced folate carrier (hRFC) is an integral membrane protein that mediates cellular uptake of reduced folates and antifolates. hRFC contains several highly conserved charged residues predicted to lie in the transmembrane domains (TMDs). To explore the possible roles of the conserved arginine-133, located in TMD 4, in hRFC structure and function, this residue was systematically mutagenized to histidine, leucine, lysine and glutamate. When transfected into transport-impaired K562 cells, the mutant hRFC constructs were expressed at high levels; however, only lysine-133 hRFC was able to transport methotrexate and (6S)-5-formyl tetrahydrofolate. Substitution of aspartate-453 (in hRFC TMD 12) by valine largely preserved transport activity for both substrates. Although mutagenesis of aspartate-88 (in TMD 2) to leucine completely abolished transport activity in transfected cells, substitution with a glutamate preserved low levels ( approximately 12%) of transport. To assess the possibility that arginine-133 and aspartate-88 may form a charge-pair to stabilize hRFC tertiary structure, both charges were neutralized (by substituting leucine and valine, respectively) in the same construct. In contrast to the singly mutated hRFCs, the double mutant exhibited high levels of transport with both methotrexate and 5-formyl tetrahydrofolate. These results strongly suggest that arginine-133 and aspartate-88 form a charge-pair and that TMD 4 lies next to TMD 2 in the hRFC tertiary structure. PMID:11513752
-
Azido, triazolyl, and alkynyl complexes of gold(I): syntheses, structures, and ligand effects.
Robilotto, Thomas J; Deligonul, Nihal; Updegraff, James B; Gray, Thomas G
2013-08-19
Gold(I) triazolyl complexes are prepared in [3 + 2] cycloaddition reactions of (tertiary phosphine)gold(I) azides with terminal alkynes. Seven such triazolyl complexes, not previously prepared, are described. Reducible functional groups are accommodated. In addition, two new (N-heterocyclic carbene)gold(I) azides and two new gold(I) alkynyls are described. Eight complexes are crystallographically authenticated; aurophilic interactions appear in one structure only. The packing diagrams of gold(I) triazolyls all show intermolecular hydrogen bonding between N-1 of one molecule and N-3 of a neighbor. This hydrogen bonding permeates the crystal lattice. Density-functional theory calculations of (triphenylphosphine)gold(I) triazolyls and the corresponding alkynyls indicate that the triazolyl is a stronger trans-influencer than is the alkynyl, but the alkynyl is more electron-releasing. These results suggest that trans-influences in two-coordinate gold(I) complexes can be more than a simple matter of ligand donicity.
-
Disaster resilience in tertiary hospitals: a cross-sectional survey in Shandong Province, China
2014-01-01
Background Hospital disaster resilience can be defined as a hospital’s ability to resist, absorb, and respond to the shock of disasters while maintaining critical functions, and then to recover to its original state or adapt to a new one. This study aims to explore the status of resilience among tertiary hospitals in Shandong Province, China. Methods A stratified random sample (n = 50) was derived from tertiary A, tertiary B, and tertiary C hospitals in Shandong Province, and was surveyed by questionnaire. Data on hospital characteristics and 8 key domains of hospital resilience were collected and analysed. Variables were binary, and analysed using descriptive statistics such as frequencies. Results A response rate of 82% (n = 41) was attained. Factor analysis identified four key factors from eight domains which appear to reflect the overall level of disaster resilience. These were hospital safety, disaster management mechanisms, disaster resources and disaster medical care capability. The survey demonstrated that in regard to hospital safety, 93% had syndromic surveillance systems for infectious diseases and 68% had evaluated their safety standards. In regard to disaster management mechanisms, all had general plans, while only 20% had specific plans for individual hazards. 49% had a public communication protocol and 43.9% attended the local coordination meetings. In regard to disaster resources, 75.6% and 87.5% stockpiled emergency drugs and materials respectively, while less than a third (30%) had a signed Memorandum of Understanding with other hospitals to share these resources. Finally in regard to medical care, 66% could dispatch an on-site medical rescue team, but only 5% had a ‘portable hospital’ function and 36.6% and 12% of the hospitals could surge their beds and staff capacity respectively. The average beds surge capacity within 1 day was 13%. Conclusions This study validated the broad utility of a framework for understanding and measuring the level of hospital resilience. The survey demonstrated considerable variability in disaster resilience arrangements of tertiary hospitals in Shandong province, and the difference between tertiary A hospitals and tertiary B hospitals was also identified in essential areas. PMID:24661641
-
Disaster resilience in tertiary hospitals: a cross-sectional survey in Shandong Province, China.
Zhong, Shuang; Hou, Xiang-Yu; Clark, Michele; Zang, Yu-Li; Wang, Lu; Xu, Ling-Zhong; FitzGerald, Gerard
2014-03-25
Hospital disaster resilience can be defined as a hospital's ability to resist, absorb, and respond to the shock of disasters while maintaining critical functions, and then to recover to its original state or adapt to a new one. This study aims to explore the status of resilience among tertiary hospitals in Shandong Province, China. A stratified random sample (n = 50) was derived from tertiary A, tertiary B, and tertiary C hospitals in Shandong Province, and was surveyed by questionnaire. Data on hospital characteristics and 8 key domains of hospital resilience were collected and analysed. Variables were binary, and analysed using descriptive statistics such as frequencies. A response rate of 82% (n = 41) was attained. Factor analysis identified four key factors from eight domains which appear to reflect the overall level of disaster resilience. These were hospital safety, disaster management mechanisms, disaster resources and disaster medical care capability. The survey demonstrated that in regard to hospital safety, 93% had syndromic surveillance systems for infectious diseases and 68% had evaluated their safety standards. In regard to disaster management mechanisms, all had general plans, while only 20% had specific plans for individual hazards. 49% had a public communication protocol and 43.9% attended the local coordination meetings. In regard to disaster resources, 75.6% and 87.5% stockpiled emergency drugs and materials respectively, while less than a third (30%) had a signed Memorandum of Understanding with other hospitals to share these resources. Finally in regard to medical care, 66% could dispatch an on-site medical rescue team, but only 5% had a 'portable hospital' function and 36.6% and 12% of the hospitals could surge their beds and staff capacity respectively. The average beds surge capacity within 1 day was 13%. This study validated the broad utility of a framework for understanding and measuring the level of hospital resilience. The survey demonstrated considerable variability in disaster resilience arrangements of tertiary hospitals in Shandong province, and the difference between tertiary A hospitals and tertiary B hospitals was also identified in essential areas.
-
ERIC Educational Resources Information Center
Corriveau, Claudia
2017-01-01
This article addresses the issue of transition from secondary to post-secondary education through collaborative research with teachers from both levels. It takes into account implicit elements in this transition. Research on the transition in mathematics education tends to focus more on the tertiary level, studying difficulties encountered by…
-
Protein folding, misfolding and aggregation: The importance of two-electron stabilizing interactions
2017-01-01
Proteins associated with neurodegenerative diseases are highly pleiomorphic and may adopt an all-α-helical fold in one environment, assemble into all-β-sheet or collapse into a coil in another, and rapidly polymerize in yet another one via divergent aggregation pathways that yield broad diversity of aggregates’ morphology. A thorough understanding of this behaviour may be necessary to develop a treatment for Alzheimer’s and related disorders. Unfortunately, our present comprehension of folding and misfolding is limited for want of a physicochemical theory of protein secondary and tertiary structure. Here we demonstrate that electronic configuration and hyperconjugation of the peptide amide bonds ought to be taken into account to advance such a theory. To capture the effect of polarization of peptide linkages on conformational and H-bonding propensity of the polypeptide backbone, we introduce a function of shielding tensors of the Cα atoms. Carrying no information about side chain-side chain interactions, this function nonetheless identifies basic features of the secondary and tertiary structure, establishes sequence correlates of the metamorphic and pH-driven equilibria, relates binding affinities and folding rate constants to secondary structure preferences, and manifests common patterns of backbone density distribution in amyloidogenic regions of Alzheimer’s amyloid β and tau, Parkinson’s α-synuclein and prions. Based on those findings, a split-intein like mechanism of molecular recognition is proposed to underlie dimerization of Aβ, tau, αS and PrPC, and divergent pathways for subsequent association of dimers are outlined; a related mechanism is proposed to underlie formation of PrPSc fibrils. The model does account for: (i) structural features of paranuclei, off-pathway oligomers, non-fibrillar aggregates and fibrils; (ii) effects of incubation conditions, point mutations, isoform lengths, small-molecule assembly modulators and chirality of solid-liquid interface on the rate and morphology of aggregation; (iii) fibril-surface catalysis of secondary nucleation; and (iv) self-propagation of infectious strains of mammalian prions. PMID:28922400
-
Structure-Activity Relationship of the Antimalarial Ozonide Artefenomel (OZ439).
Dong, Yuxiang; Wang, Xiaofang; Kamaraj, Sriraghavan; Bulbule, Vivek J; Chiu, Francis C K; Chollet, Jacques; Dhanasekaran, Manickam; Hein, Christopher D; Papastogiannidis, Petros; Morizzi, Julia; Shackleford, David M; Barker, Helena; Ryan, Eileen; Scheurer, Christian; Tang, Yuanqing; Zhao, Qingjie; Zhou, Lin; White, Karen L; Urwyler, Heinrich; Charman, William N; Matile, Hugues; Wittlin, Sergio; Charman, Susan A; Vennerstrom, Jonathan L
2017-04-13
Building on insights gained from the discovery of the antimalarial ozonide arterolane (OZ277), we now describe the structure-activity relationship (SAR) of the antimalarial ozonide artefenomel (OZ439). Primary and secondary amino ozonides had higher metabolic stabilities than tertiary amino ozonides, consistent with their higher pK a and lower log D 7.4 values. For primary amino ozonides, addition of polar functional groups decreased in vivo antimalarial efficacy. For secondary amino ozonides, additional functional groups had variable effects on metabolic stability and efficacy, but the most effective members of this series also had the highest log D 7.4 values. For tertiary amino ozonides, addition of polar functional groups with H-bond donors increased metabolic stability but decreased in vivo antimalarial efficacy. Primary and tertiary amino ozonides with cycloalkyl and heterocycle substructures were superior to their acyclic counterparts. The high curative efficacy of these ozonides was most often associated with high and prolonged plasma exposure, but exposure on its own did not explain the presence or absence of either curative efficacy or in vivo toxicity.
-
Measuring the relative hydrogen-bonding strengths of alcohols in aprotic organic solvents.
Tessensohn, Malcolm E; Lee, Melvyn; Hirao, Hajime; Webster, Richard D
2015-01-12
Voltammetric experiments with 9,10-anthraquinone and 1,4-benzoquinone performed under controlled moisture conditions indicate that the hydrogen-bond strengths of alcohols in aprotic organic solvents can be differentiated by the electrochemical parameter ΔEp (red) =|Ep (red(1)) -Ep (red(2)) |, which is the potential separation between the two one-electron reduction processes. This electrochemical parameter is inversely related to the strength of the interactions and can be used to differentiate between primary, secondary, tertiary alcohols, and even diols, as it is sensitive to both their steric and electronic properties. The results are highly reproducible across two solvents with substantially different hydrogen-bonding properties (CH3 CN and CH2 Cl2 ) and are supported by density functional theory calculations. This indicates that the numerous solvent-alcohol interactions are less significant than the quinone-alcohol hydrogen-bonding interactions. The utility of ΔEp (red) was illustrated by comparisons between 1) 3,3,3-trifluoro-n-propanol and 1,3-difluoroisopropanol and 2) ethylene glycol and 2,2,2-trifluoroethanol. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Stereoinversion of tertiary alcohols to tertiary-alkyl isonitriles and amines.
Pronin, Sergey V; Reiher, Christopher A; Shenvi, Ryan A
2013-09-12
The SN2 reaction (bimolecular nucleophilic substitution) is a well-known chemical transformation that can be used to join two smaller molecules together into a larger molecule or to exchange one functional group for another. The SN2 reaction proceeds in a very predictable manner: substitution occurs with inversion of stereochemistry, resulting from the 'backside attack' of the electrophilic carbon by the nucleophile. A significant limitation of the SN2 reaction is its intolerance for tertiary carbon atoms: whereas primary and secondary alcohols are viable precursor substrates, tertiary alcohols and their derivatives usually either fail to react or produce stereochemical mixtures of products. Here we report the stereochemical inversion of chiral tertiary alcohols with a nitrogenous nucleophile facilitated by a Lewis-acid-catalysed solvolysis. The method is chemoselective against secondary and primary alcohols, thereby complementing the selectivity of the SN2 reaction. Furthermore, this method for carbon-nitrogen bond formation mimics a putative biosynthetic step in the synthesis of marine terpenoids and enables their preparation from the corresponding terrestrial terpenes. We expect that the general attributes of the methodology will allow chiral tertiary alcohols to be considered viable substrates for stereoinversion reactions.
-
Numerical Modelling of Tertiary Tides
NASA Astrophysics Data System (ADS)
Gao, Yan; Correia, Alexandre C. M.; Eggleton, Peter P.; Han, Zhanwen
2018-06-01
Stellar systems consisting of multiple stars tend to undergo tidal interactions when the separations between the stars are short. While tidal phenomena have been extensively studied, a certain tidal effect exclusive to hierarchical triples (triples in which one component star has a much wider orbit than the others) has hardly received any attention, mainly due to its complexity and consequent resistance to being modelled. This tidal effect is the tidal perturbation of the tertiary by the inner binary, which in turn depletes orbital energy from the inner binary, causing the inner binary separation to shrink. In this paper, we develop a fully numerical simulation of these "tertiary tides" by modifying established tidal models. We also provide general insight as to how close a hierarchical triple needs to be in order for such an effect to take place, and demonstrate that our simulations can effectively retrieve the orbital evolution for such systems. We conclude that tertiary tides are a significant factor in the evolution of close hierarchical triples, and strongly influence at least ˜1% of all multiple star systems.
-
Structural and functional changes in acute liver injury.
Smuckler, E A
1976-06-01
Carbon tetrachloride produces liver cell injury in a variety of animal species. The first structurally recognizable changes occur in the endoplasmic reticulum, with alteration in ribosome-membrane interactions. Later there is an increase in intracellular fat, and the formation of tangled nets of the ergastoplasm. At no time are there changes in mitochondria or single membrane limited bodies in cells with intact plasmalemma, although a relative increase in cell sap may appear. In dead cells (those with plasmalemma discontinuties) crystalline deposits of calcium phosphatase may be noted. Functional changes are related to the endoplasmic reticulum and the plasma membrane. An early decrease in protein synthesis takes place; an accumulation of neutral lipid is related to this change. Later alterations in the ergastoplasmic functions (e.g., mixed function oxidation) occurs. Carbon tetrachloride is not the active agent; rather, a product of its metabolism, probably the CC1, free radical, is. The mechanisms of injury include macromolecular adduction and peroxide propagation. A third possibility includes a cascade effect with the production of secondary and tertiary products, also toxic in nature, with the ability to produce more widespread damage to intracellular structures.
-
Huang, Yi-Fei; Golding, G Brian
2015-02-15
A number of statistical phylogenetic methods have been developed to infer conserved functional sites or regions in proteins. Many methods, e.g. Rate4Site, apply the standard phylogenetic models to infer site-specific substitution rates and totally ignore the spatial correlation of substitution rates in protein tertiary structures, which may reduce their power to identify conserved functional patches in protein tertiary structures when the sequences used in the analysis are highly similar. The 3D sliding window method has been proposed to infer conserved functional patches in protein tertiary structures, but the window size, which reflects the strength of the spatial correlation, must be predefined and is not inferred from data. We recently developed GP4Rate to solve these problems under the Bayesian framework. Unfortunately, GP4Rate is computationally slow. Here, we present an intuitive web server, FuncPatch, to perform a fast approximate Bayesian inference of conserved functional patches in protein tertiary structures. Both simulations and four case studies based on empirical data suggest that FuncPatch is a good approximation to GP4Rate. However, FuncPatch is orders of magnitudes faster than GP4Rate. In addition, simulations suggest that FuncPatch is potentially a useful tool complementary to Rate4Site, but the 3D sliding window method is less powerful than FuncPatch and Rate4Site. The functional patches predicted by FuncPatch in the four case studies are supported by experimental evidence, which corroborates the usefulness of FuncPatch. The software FuncPatch is freely available at the web site, http://info.mcmaster.ca/yifei/FuncPatch golding@mcmaster.ca Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
-
Yasuda, Makoto; Yamasaki, Satoshi; Onishi, Yoshiyuki; Baba, Akio
2004-06-16
The InCl3-catalyzed reaction of alcohols with chlorodimethylsilane (HSiMe2Cl) in the presence of benzil gave the corresponding organic chlorides under mild conditions. Benzil significantly changes the reaction course because the reducing product through dehydroxyhydration was obtained in the absence of benzil. The secondary or tertiary alcohols were effectively chlorinated. The substrates bearing acid-sensitive functional groups were also applied to this system. The highly selective chlorination of the tertiary site was observed in the competitive reaction between tertiary and primary alcohols. The highly coordinated hydrosilane generated from benzil and HSiMe2Cl is an important intermediate.
-
Solid-Phase Synthesis of Diverse Peptide Tertiary Amides By Reductive Amination
Pels, Kevin; Kodadek, Thomas
2015-01-01
The synthesis of libraries of conformationally-constrained peptide-like oligomers is an important goal in combinatorial chemistry. In this regard an attractive building block is the N-alkylated peptide, also known as peptide tertiary amide (PTA). PTAs are strongly biased conformationally due to allylic 1,3 strain interactions. We report here an improved synthesis of these species on solid supports through the use of reductive amination chemistry using amino acid-terminated, bead-displayed oligomers and diverse aldehydes. The utility of this chemistry is demonstrated by the synthesis of a library of 10,000 mixed peptoid-PTA oligomers. PMID:25695359
-
Solid-phase synthesis of diverse peptide tertiary amides by reductive amination.
Pels, Kevin; Kodadek, Thomas
2015-03-09
The synthesis of libraries of conformationally constrained peptide-like oligomers is an important goal in combinatorial chemistry. In this regard an attractive building block is the N-alkylated peptide, also known as a peptide tertiary amide (PTA). PTAs are conformationally constrained because of allylic 1,3 strain interactions. We report here an improved synthesis of these species on solid supports through the use of reductive amination chemistry using amino acid-terminated, bead-displayed oligomers and diverse aldehydes. The utility of this chemistry is demonstrated by the synthesis of a library of 10,000 mixed peptoid-PTA oligomers.
-
The role of atomic level steric effects and attractive forces in protein folding.
Lammert, Heiko; Wolynes, Peter G; Onuchic, José N
2012-02-01
Protein folding into tertiary structures is controlled by an interplay of attractive contact interactions and steric effects. We investigate the balance between these contributions using structure-based models using an all-atom representation of the structure combined with a coarse-grained contact potential. Tertiary contact interactions between atoms are collected into a single broad attractive well between the C(β) atoms between each residue pair in a native contact. Through the width of these contact potentials we control their tolerance for deviations from the ideal structure and the spatial range of attractive interactions. In the compact native state dominant packing constraints limit the effects of a coarse-grained contact potential. During folding, however, the broad attractive potentials allow an early collapse that starts before the native local structure is completely adopted. As a consequence the folding transition is broadened and the free energy barrier is decreased. Eventually two-state folding behavior is lost completely for systems with very broad attractive potentials. The stabilization of native-like residue interactions in non-perfect geometries early in the folding process frequently leads to structural traps. Global mirror images are a notable example. These traps are penalized by the details of the repulsive interactions only after further collapse. Successful folding to the native state requires simultaneous guidance from both attractive and repulsive interactions. Copyright © 2011 Wiley Periodicals, Inc.
-
Quantitative tests of a reconstitution model for RNA folding thermodynamics and kinetics.
Bisaria, Namita; Greenfeld, Max; Limouse, Charles; Mabuchi, Hideo; Herschlag, Daniel
2017-09-12
Decades of study of the architecture and function of structured RNAs have led to the perspective that RNA tertiary structure is modular, made of locally stable domains that retain their structure across RNAs. We formalize a hypothesis inspired by this modularity-that RNA folding thermodynamics and kinetics can be quantitatively predicted from separable energetic contributions of the individual components of a complex RNA. This reconstitution hypothesis considers RNA tertiary folding in terms of ΔG align , the probability of aligning tertiary contact partners, and ΔG tert , the favorable energetic contribution from the formation of tertiary contacts in an aligned state. This hypothesis predicts that changes in the alignment of tertiary contacts from different connecting helices and junctions (ΔG HJH ) or from changes in the electrostatic environment (ΔG +/- ) will not affect the energetic perturbation from a mutation in a tertiary contact (ΔΔG tert ). Consistent with these predictions, single-molecule FRET measurements of folding of model RNAs revealed constant ΔΔG tert values for mutations in a tertiary contact embedded in different structural contexts and under different electrostatic conditions. The kinetic effects of these mutations provide further support for modular behavior of RNA elements and suggest that tertiary mutations may be used to identify rate-limiting steps and dissect folding and assembly pathways for complex RNAs. Overall, our model and results are foundational for a predictive understanding of RNA folding that will allow manipulation of RNA folding thermodynamics and kinetics. Conversely, the approaches herein can identify cases where an independent, additive model cannot be applied and so require additional investigation.
-
Architecture of a Diels-Alderase ribozyme with a preformed catalytic pocket.
Keiper, Sonja; Bebenroth, Dirk; Seelig, Burckhard; Westhof, Eric; Jäschke, Andres
2004-09-01
Artificial ribozymes catalyze a variety of chemical reactions. Their structures and reaction mechanisms are largely unknown. We have analyzed a ribozyme catalyzing Diels-Alder cycloaddition reactions by comprehensive mutation analysis and a variety of probing techniques. New tertiary interactions involving base pairs between nucleotides of the 5' terminus and a large internal loop forming a pseudoknot fold were identified. The probing data indicate a preformed tertiary structure that shows no major changes on substrate or product binding. Based on these observations, a molecular architecture featuring a Y-shaped arrangement is proposed. The tertiary structure is formed in a rather unusual way; that is, the opposite sides of the asymmetric internal loop are clamped by the four 5'-terminal nucleotides, forming two adjacent two base-pair helices. It is proposed that the catalytic pocket is formed by a wedge within one of these helices.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiong, J.-P.; Stehle, T.; Zhang, R.
The structural basis for the divalent cation-dependent binding of heterodimeric alpha beta integrins to their ligands, which contain the prototypical Arg-Gly-Asp sequence, is unknown. Interaction with ligands triggers tertiary and quaternary structural rearrangements in integrins that are needed for cell signaling. Here we report the crystal structure of the extracellular segment of integrin alpha Vbeta 3 in complex with a cyclic peptide presenting the Arg-Gly-Asp sequence. The ligand binds at the major interface between the alpha V and beta 3 subunits and makes extensive contacts with both. Both tertiary and quaternary changes are observed in the presence of ligand. Themore » tertiary rearrangements take place in beta A, the ligand-binding domain of beta 3; in the complex, beta A acquires two cations, one of which contacts the ligand Asp directly and the other stabilizes the ligand-binding surface. Ligand binding induces small changes in the orientation of alpha V relative to beta 3.« less
-
Kwasigroch, Jean Marc; Rooman, Marianne
2006-07-15
Prelude&Fugue are bioinformatics tools aiming at predicting the local 3D structure of a protein from its amino acid sequence in terms of seven backbone torsion angle domains, using database-derived potentials. Prelude(&Fugue) computes all lowest free energy conformations of a protein or protein region, ranked by increasing energy, and possibly satisfying some interresidue distance constraints specified by the user. (Prelude&)Fugue detects sequence regions whose predicted structure is significantly preferred relative to other conformations in the absence of tertiary interactions. These programs can be used for predicting secondary structure, tertiary structure of short peptides, flickering early folding sequences and peptides that adopt a preferred conformation in solution. They can also be used for detecting structural weaknesses, i.e. sequence regions that are not optimal with respect to the tertiary fold. http://babylone.ulb.ac.be/Prelude_and_Fugue.
-
Nayar, Divya; Folberth, Angelina; van der Vegt, Nico F A
2017-07-19
Osmolytes affect hydrophobic collapse and protein folding equilibria. The underlying mechanisms are, however, not well understood. We report large-scale conformational sampling of two hydrophobic polymers with secondary and tertiary amide side chains using extensive molecular dynamics simulations. The calculated free energy of unfolding increases with urea for the secondary amide, yet decreases for the tertiary amide, in agreement with experiment. The underlying mechanism is rooted in opposing entropic driving forces: while urea screens the hydrophobic macromolecular interface and drives unfolding of the tertiary amide, urea's concomitant loss in configurational entropy drives collapse of the secondary amide. Only at sufficiently high urea concentrations bivalent urea hydrogen bonding interactions with the secondary amide lead to further stabilisation of its collapsed state. The observations provide a new angle on the interplay between side chain chemistry, urea hydrogen bonding, and the role of urea in attenuating or strengthening the hydrophobic effect.
-
Free Energy Landscape and Multiple Folding Pathways of an H-Type RNA Pseudoknot
Bian, Yunqiang; Zhang, Jian; Wang, Jun; Wang, Jihua; Wang, Wei
2015-01-01
How RNA sequences fold to specific tertiary structures is one of the key problems for understanding their dynamics and functions. Here, we study the folding process of an H-type RNA pseudoknot by performing a large-scale all-atom MD simulation and bias-exchange metadynamics. The folding free energy landscapes are obtained and several folding intermediates are identified. It is suggested that the folding occurs via multiple mechanisms, including a step-wise mechanism starting either from the first helix or the second, and a cooperative mechanism with both helices forming simultaneously. Despite of the multiple mechanism nature, the ensemble folding kinetics estimated from a Markov state model is single-exponential. It is also found that the correlation between folding and binding of metal ions is significant, and the bound ions mediate long-range interactions in the intermediate structures. Non-native interactions are found to be dominant in the unfolded state and also present in some intermediates, possibly hinder the folding process of the RNA. PMID:26030098
-
The pH-dependent tertiary structure of a designed helix-loop-helix dimer.
Dolphin, G T; Baltzer, L
1997-01-01
De novo designed helix-loop-helix motifs can fold into well-defined tertiary structures if residues or groups of residues are incorporated at the helix-helix boundary to form helix-recognition sites that restrict the conformational degrees of freedom of the helical segments. Understanding the relationship between structure and function of conformational constraints therefore forms the basis for the engineering of non-natural proteins. This paper describes the design of an interhelical HisH+-Asp- hydrogen-bonded ion pair and the conformational stability of the folded helix-loop-helix motif. GTD-C, a polypeptide with 43 amino acid residues, has been designed to fold into a hairpin helix-loop-helix motif that can dimerise to form a four-helix bundle. The folded motif is in slow conformational exchange on the NMR timescale and has a well-dispersed 1H NMR spectrum, a narrow temperature interval for thermal denaturation and a near-UV CD spectrum with some fine structure. The conformational stability is pH dependent with an optimum that corresponds to the pH for maximum formation of a hydrogen-bonded ion pair between HisH17+ in helix I and Asp27- in helix II. The formation of an interhelical salt bridge is strongly suggested by the pH dependence of a number of spectroscopic probes to generate a well-defined tertiary structure in a designed helix-loop-helix motif. The thermodynamic stability of the folded motif is not increased by the formation of the salt bridge, but neighbouring conformations are destabilised. The use of this novel design principle in combination with hydrophobic interactions that provide sufficient binding energy in the folded structure should be of general use in de novo design of native-like proteins.
-
ERIC Educational Resources Information Center
Rundgren, Carl-Johan; Hirsch, Richard; Tibell, Lena A. E.
2009-01-01
The study reported in this article investigated the use of metaphors by upper secondary and tertiary students while learning a specific content area in molecular life science, protein function. Terms and expressions in science can be used in such precise and general senses that they are totally dissociated from their metaphoric origins. Beginners…
-
Conformational and functional similarities between glutaredoxin and thioredoxins.
Eklund, H; Cambillau, C; Sjöberg, B M; Holmgren, A; Jörnvall, H; Höög, J O; Brändén, C I
1984-01-01
The tertiary structures of thioredoxin from Escherichia coli and bacteriophage T4 have been compared and aligned giving a common fold of 68 C alpha atoms with a root mean square difference of 2.6 A. The amino acid sequence of glutaredoxin has been aligned to those of the thioredoxins assuming that glutaredoxin has the same common fold. A model of the glutaredoxin molecule was built on a vector display using this alignment and the T4 thioredoxin tertiary structure. By comparison of the model with those of the thioredoxins, we have identified a molecular surface area on one side of the redox-active S-S bridge which we suggest is the binding area of these molecules for redox interactions with other proteins. This area comprises residues 33-34, 75-76 and 91-93 in E. coli thioredoxin; 15-16, 65-66 and 76-78 in T4 thioredoxin and 12-13, 59-60 and 69-71 in glutaredoxin. In all three molecules, this part of the surface is flat and hydrophobic. Charged groups are completely absent. In contrast, there is a cluster of charged groups on the other side of the S-S bridge which we suggest participates in the mechanisms of the redox reactions. In particular, a lysine residue close to an aromatic ring is conserved in all molecules. PMID:6378624
-
Functional-Group-Tolerant, Silver-Catalyzed N-N Bond Formation by Nitrene Transfer to Amines.
Maestre, Lourdes; Dorel, Ruth; Pablo, Óscar; Escofet, Imma; Sameera, W M C; Álvarez, Eleuterio; Maseras, Feliu; Díaz-Requejo, M Mar; Echavarren, Antonio M; Pérez, Pedro J
2017-02-15
Silver(I) promotes the highly chemoselective N-amidation of tertiary amines under catalytic conditions to form aminimides by nitrene transfer from PhI═NTs. Remarkably, this transformation proceeds in a selective manner in the presence of olefins and other functional groups without formation of the commonly observed aziridines or C-H insertion products. The methodology can be applied not only to rather simple tertiary amines but also to complex natural molecules such as brucine or quinine, where the products derived from N-N bond formation were exclusively formed. Theoretical mechanistic studies have shown that this selective N-amidation reaction proceeds through triplet silver nitrenes.
-
Final acceptance testing of the LSST monolithic primary/tertiary mirror
NASA Astrophysics Data System (ADS)
Tuell, Michael T.; Burge, James H.; Cuerden, Brian; Gressler, William; Martin, Hubert M.; West, Steven C.; Zhao, Chunyu
2014-07-01
The Large Synoptic Survey Telescope (LSST) is a three-mirror wide-field survey telescope with the primary and tertiary mirrors on one monolithic substrate1. This substrate is made of Ohara E6 borosilicate glass in a honeycomb sandwich, spin cast at the Steward Observatory Mirror Lab at The University of Arizona2. Each surface is aspheric, with the specification in terms of conic constant error, maximum active bending forces and finally a structure function specification on the residual errors3. There are high-order deformation terms, but with no tolerance, any error is considered as a surface error and is included in the structure function. The radii of curvature are very different, requiring two independent test stations, each with instantaneous phase-shifting interferometers with null correctors. The primary null corrector is a standard two-element Offner null lens. The tertiary null corrector is a phase-etched computer-generated hologram (CGH). This paper details the two optical systems and their tolerances, showing that the uncertainty in measuring the figure is a small fraction of the structure function specification. Additional metrology includes the radii of curvature, optical axis locations, and relative surface tilts. The methods for measuring these will also be described along with their tolerances.
-
Lane, Mariella M; Weidler, Erica M; Czyzewski, Danita I; Shulman, Robert J
2009-03-01
The objectives of this study were to (1) compare the cost of medical evaluation for children with functional abdominal pain or irritable bowel syndrome brought to a pediatric gastroenterologist versus children who remained in the care of their pediatrician, (2) compare symptom characteristics for the children in primary versus tertiary care, and (3) examine if symptom characteristics predicted the cost of medical evaluation. Eighty-nine children aged 7 to 10 years with functional abdominal pain or irritable bowel syndrome seen by a gastroenterologist (n = 46) or seen only by a pediatrician (n = 43) completed daily pain and stool diaries for 2 weeks. Mothers provided retrospective reports of their children's symptoms in the previous year. Cost of medical evaluation was calculated via chart review of diagnostic tests and application of prices as if the patients were self-pay. Child-reported diary data reflected no significant group differences with respect to pain, interference with activities, or stool characteristics. In contrast, mothers of children evaluated by a gastroenterologist viewed their children as having higher maximum pain intensity in the previous year. Excluding endoscopy costs, cost of medical evaluation was fivefold higher for children evaluated by a gastroenterologist, with higher cost across blood work, stool studies, breath testing, and diagnostic imaging. Symptom characteristics did not predict cost of care for either group. Despite the lack of difference in symptom characteristics between children in primary and tertiary care, a notable differential in cost of evaluation exists in accordance with level of care. Symptom characteristics do not seem to drive diagnostic evaluation in either primary or tertiary care. Given the lack of differences in child-reported symptoms and the maternal perspective that children evaluated by a gastroenterologist had more severe pain, we speculate that parent perception of child symptoms may be a primary factor in seeking tertiary care.
-
Rojas-Ortega, Erendira; Aguirre-López, Beatriz; Reyes-Vivas, Horacio; González-Andrade, Martín; Campero-Basaldúa, Jose C.; Pardo, Juan P.; González, Alicia
2018-01-01
Saccharomyces cerevisiae arose from an interspecies hybridization (allopolyploidiza-tion), followed by Whole Genome Duplication. Diversification analysis of ScAlt1/ScAlt2 indicated that while ScAlt1 is an alanine transaminase, ScAlt2 lost this activity, constituting an example in which one of the members of the gene pair lacks the apparent ancestral physiological role. This paper analyzes structural organization and pyridoxal phosphate (PLP) binding properties of ScAlt1 and ScAlt2 indicating functional diversification could have determined loss of ScAlt2 alanine transaminase activity and thus its role in alanine metabolism. It was found that ScAlt1 and ScAlt2 are dimeric enzymes harboring 67% identity and intact conservation of the catalytic residues, with very similar structures. However, tertiary structure analysis indicated that ScAlt2 has a more open conformation than that of ScAlt1 so that under physiological conditions, while PLP interaction with ScAlt1 allows the formation of two tautomeric PLP isomers (enolimine and ketoenamine) ScAlt2 preferentially forms the ketoenamine PLP tautomer, indicating a modified polarity of the active sites which affect the interaction of PLP with these proteins, that could result in lack of alanine transaminase activity in ScAlt2. The fact that ScAlt2 forms a catalytically active Schiff base with PLP and its position in an independent clade in “sensu strictu” yeasts suggests this protein has a yet undiscovered physiological function. PMID:29867852
-
Mariano, Micah Celine O; Maniego, John Christian M; Manila, Hariette Lou Marie D; Mapanoo, Ram Cedrick C; Maquiran, Kerwin Miguel A; Macindo, John Rey B; Tejero, Lourdes Marie S; Torres, Gian Carlo S
2018-04-01
Social media has become increasingly important over the past decades and has been integrated in various environments, including the healthcare setting. Yet, the influence of social media use on the social skills and nurse-patient interaction of nurses is an area in nursing that requires further studies. This study determined the interrelationships among social media use profile, social skills, and nurse-patient interaction of Registered Nurses in tertiary hospitals. Employing structural equation modeling, a descriptive-correlational study was conducted among 212 consecutively-selected nurses from two tertiary hospitals. Consenting respondents completed a two-part survey composed of the respondent profile sheet and the Social Skills Inventory. The respondent profile sheet assessed demographic profile and social media use profile in terms of the mode, frequency, and duration of utilization. Three trained team members observed each nurse-patient dyad and completed the Nurse-Patient Bonding Instrument. A good fit model illustrated the negative effects of frequent social media use to patient openness (β = -0.18, p < 0.05) and engagement (β = -0.11, p ≤ 0.05). Longer use of social media on a daily basis, however, positively affected both dimensions of social skills. Accessing social media platforms using non-handheld devices showed the most influential positive effects to social skills and nurse-patient interaction. Additionally, although verbal social skills positively affected most dimensions of nurse-patient interaction, non-verbal social skills negatively influenced patient engagement (β = -0.19, p = 0.019) and nurse openness (β = -0.38, p ≤ 0.05). The structural model illustrates the effects of using social media on the social skills and nurse-patient interaction of nurses and emphasizes the need for implementing institutional policies on the judicious use and application of social media in the workplace. Further, social skills development programs geared toward having a balanced social skill must be implemented. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Is the Conformational Ensemble of Alzheimer’s Aβ10-40 Peptide Force Field Dependent?
Siwy, Christopher M.
2017-01-01
By applying REMD simulations we have performed comparative analysis of the conformational ensembles of amino-truncated Aβ10-40 peptide produced with five force fields, which combine four protein parameterizations (CHARMM36, CHARMM22*, CHARMM22/cmap, and OPLS-AA) and two water models (standard and modified TIP3P). Aβ10-40 conformations were analyzed by computing secondary structure, backbone fluctuations, tertiary interactions, and radius of gyration. We have also calculated Aβ10-40 3JHNHα-coupling and RDC constants and compared them with their experimental counterparts obtained for the full-length Aβ1-40 peptide. Our study led us to several conclusions. First, all force fields predict that Aβ adopts unfolded structure dominated by turn and random coil conformations. Second, specific TIP3P water model does not dramatically affect secondary or tertiary Aβ10-40 structure, albeit standard TIP3P model favors slightly more compact states. Third, although the secondary structures observed in CHARMM36 and CHARMM22/cmap simulations are qualitatively similar, their tertiary interactions show little consistency. Fourth, two force fields, OPLS-AA and CHARMM22* have unique features setting them apart from CHARMM36 or CHARMM22/cmap. OPLS-AA reveals moderate β-structure propensity coupled with extensive, but weak long-range tertiary interactions leading to Aβ collapsed conformations. CHARMM22* exhibits moderate helix propensity and generates multiple exceptionally stable long- and short-range interactions. Our investigation suggests that among all force fields CHARMM22* differs the most from CHARMM36. Fifth, the analysis of 3JHNHα-coupling and RDC constants based on CHARMM36 force field with standard TIP3P model led us to an unexpected finding that in silico Aβ10-40 and experimental Aβ1-40 constants are generally in better agreement than these quantities computed and measured for identical peptides, such as Aβ1-40 or Aβ1-42. This observation suggests that the differences in the conformational ensembles of Aβ10-40 and Aβ1-40 are small and the former can be used as proxy of the full-length peptide. Based on this argument, we concluded that CHARMM36 force field with standard TIP3P model produces the most accurate representation of Aβ10-40 conformational ensemble. PMID:28085875
-
ERIC Educational Resources Information Center
Ezemenaka, Emeka
2013-01-01
The usage of Internet enabled phones has been a 21st century phenomenon that spreads for different purposes and functions. This study looks into the usage and perceived effect implications internet enabled phones have on the academic performance of the tertiary students using University of Ibadan students in Nigeria as a case study. The study was…
-
Numerical and behavioral effects within a pulse-driven system: consequences for shared prey.
Schmidt, Kenneth A; Ostfeld, Richard S
2008-03-01
Some of the clearest examples of the ramifying effects of resource pulses exist in deciduous forests dominated by mast-producing trees, such as oaks, beech, and hornbeam. Seed production in these forests represents only the first of several pulsed events. Secondary pulses emerge as mast-consuming small rodents numerically respond to seed production and tertiary pulses emerge as generalist predators numerically respond to rodents. Raptors may also respond behaviorally (i.e., diet shifts) to subsequent crashes in small rodents following the crash phase in seed production. In oak-dominated forest in the Hudson Valley, New York, these various pulse and crash phases act synergistically, although not simultaneously, to influence thrush population dynamics through predation on nests, juveniles, and adults. As a consequence, factors limiting population growth rate and their age-specific action vary as a function of past acorn production. We highlight these interactions based on our eight-year study of thrush demography, acorn production, and small mammal abundance coupled with information on regional adult thrush population trends from the Breeding Bird Survey. We use these data sets to demonstrate the sequence of primary to tertiary pulses and how they influence breeding thrush populations. To extend our discussion beyond masting phenomena in the eastern United States, we briefly review the literature of alternative avian prey within pulsed systems to show (1) numerical and behavioral responses by generalist predators are ubiquitous in pulsed systems, and this contributes to (2) variability in reproduction and survivorship of avian prey linked to the underlying dynamics of the pulse. We conclude by exploring the broad consequences of cascading resource pulses for alternative prey based upon the indirect interaction of apparent competition among shared prey and the nature of temporal variability on populations.
-
Crystal Structure of a Two-domain Fragment of Hepatocyte Growth Factor Activator Inhibitor-1
Hong, Zebin; De Meulemeester, Laura; Jacobi, Annemarie; Pedersen, Jan Skov; Morth, J. Preben; Andreasen, Peter A.; Jensen, Jan K.
2016-01-01
Hepatocyte growth factor activator inhibitor-1 (HAI-1) is a type I transmembrane protein and inhibitor of several serine proteases, including hepatocyte growth factor activator and matriptase. The protein is essential for development as knock-out mice die in utero due to placental defects caused by misregulated extracellular proteolysis. HAI-1 contains two Kunitz-type inhibitor domains (Kunitz), which are generally thought of as a functionally self-contained protease inhibitor unit. This is not the case for HAI-1, where our results reveal how interdomain interactions have evolved to stimulate the inhibitory activity of an integrated Kunitz. Here we present an x-ray crystal structure of an HAI-1 fragment covering the internal domain and Kunitz-1. The structure reveals not only that the previously uncharacterized internal domain is a member of the polycystic kidney disease domain family but also how the two domains engage in interdomain interactions. Supported by solution small angle x-ray scattering and a combination of site-directed mutagenesis and functional assays, we show that interdomain interactions not only stabilize the fold of the internal domain but also stimulate the inhibitory activity of Kunitz-1. By completing our structural characterization of the previously unknown N-terminal region of HAI-1, we provide new insight into the interplay between tertiary structure and the inhibitory activity of a multidomain protease inhibitor. We propose a previously unseen mechanism by which the association of an auxiliary domain stimulates the inhibitory activity of a Kunitz-type inhibitor (i.e. the first structure of an intramolecular interaction between a Kunitz and another domain). PMID:27189939
-
Genome Cyclization as Strategy for Flavivirus RNA Replication
Villordo, Sergio M.; Gamarnik, Andrea V.
2017-01-01
Long-range and local RNA-RNA contacts in viral RNA genomes result in tertiary structures that modulate the function of enhancers, promoters, and silencers during translation, RNA replication, and encapsidation. In the case of flaviviruses, the presence of inverted complementary sequences at the 5′ and 3′ ends of the genome mediate long-range RNA interactions and RNA cyclization. The circular conformation of flavivirus genomes was demonstrated to be essential for RNA amplification. New ideas about the mechanisms by which circular genomes participate in flavivirus replication have emerged in the last few years. Here, we will describe the latest information about cis-acting elements involved in flavivirus genome cyclization, RNA promoter elements required for viral polymerase recognition, and how these elements together coordinate viral RNA synthesis. PMID:18703097
-
Direct Observation of Insulin Association Dynamics with Time-Resolved X-ray Scattering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rimmerman, Dolev; Leshchev, Denis; Hsu, Darren J.
Biological functions frequently require protein-protein interactions that involve secondary and tertiary structural perturbation. Here we study protein-protein dissociation and reassociation dynamics in insulin, a model system for protein oligomerization. Insulin dimer dissociation into monomers was induced by a nanosecond temperature-jump (T-jump) of ~8 °C in aqueous solution, and the resulting protein and solvent dynamics were tracked by time-resolved X-ray solution scattering (TRXSS) on time scales of 10 ns to 100 ms. The protein scattering signals revealed the formation of five distinguishable transient species during the association process that deviate from simple two state kinetics. Our results show that the combinationmore » of T-jump pump coupled to TRXSS probe allows for direct tracking of structural dynamics in nonphotoactive proteins.« less
-
ERIC Educational Resources Information Center
June, Sethela; Yaacob, Aizan; Kheng, Yeoh Khar
2014-01-01
The purpose of this action research was to investigate the use of YouTube videos and interactive activities in stimulating critical thinking among students from a public university in Malaysia. There were 50 students of mixed background, comprised of local and foreign students who participated in this study which lasted for one semester. Data was…
-
Dudnik, Alexander S.
2012-01-01
Through the use of a catalyst formed in situ from NiBr2•diglyme and a pybox ligand (both of which are commercially available), we have achieved our first examples of coupling reactions of unactivated tertiary alkyl electrophiles, as well as our first success with nickel-catalyzed couplings that generate bonds other than C–C bonds. Specifically, we have determined that this catalyst accomplishes Miyaura-type borylations of unactivated tertiary, secondary, and primary alkyl halides with diboron reagents to furnish alkylboronates, a family of compounds with substantial (and expanding) utility, under mild conditions; indeed, the umpolung borylation of a tertiary alkyl bromide can be achieved at a temperature as low as −10 °C. The method exhibits good functional-group compatibility and is regiospecific, both of which can be issues with traditional approaches to the synthesis of alkylboronates. In contrast to seemingly related nickel-catalyzed C–C bond-forming processes, tertiary halides are more reactive than secondary or primary halides in this nickel-catalyzed C–B bond-forming reaction; this divergence is particularly noteworthy in view of the likelihood that both transformations follow an inner-sphere electron-transfer pathway for oxidative addition. PMID:22668072
-
Zhang, Wei; Liu, Na; Shi, Haigang; Liu, Jun; Shi, Lianxin; Zhang, Bo; Wang, Huaiyu; Ji, Junhui; Chu, Paul K.
2015-01-01
Positively-charged surfaces on implants have a similar potential to upregulate osteogenesis of bone marrow-derived mesenchymal stem cells (BMSCs) as electromagnetic therapy approved for bone regeneration. Generally, their osteogenesis functions are generally considered to stem from the charge-induced adhesion of extracellular matrix (ECM) proteins without exploring the underlying surface charge/cell signaling molecule pathways. Herein, a positively-charged surface with controllable tertiary amines is produced on a polymer implant by plasma surface modification. In addition to inhibiting the TNF-α expression, the positively-charged surface with tertiary amines exhibits excellent cytocompatibility as well as remarkably upregulated osteogenesis-related gene/protein expressions and calcification of the contacted BMSCs. Stimulated by the charged surface, these BMSCs display high iNOS expressions among the three NOS isoforms. Meanwhile, downregulation of the iNOS by L-Can or siRNA inhibit osteogenic differentiation in the BMSCs. These findings suggest that a positively-charged surface with tertiary amines induces osteogenesis of BMSCs via the surface charge/iNOS signaling pathway in addition to elevated ECM protein adhesion. Therefore, creating a positively-charged surface with tertiary amines is a promising approach to promote osseointegration with bone tissues. PMID:25791957
-
Thioesterases: A new perspective based on their primary and tertiary structures
Cantu, David C; Chen, Yingfei; Reilly, Peter J
2010-01-01
Thioesterases (TEs) are classified into EC 3.1.2.1 through EC 3.1.2.27 based on their activities on different substrates, with many remaining unclassified (EC 3.1.2.–). Analysis of primary and tertiary structures of known TEs casts a new light on this enzyme group. We used strong primary sequence conservation based on experimentally proved proteins as the main criterion, followed by verification with tertiary structure superpositions, mechanisms, and catalytic residue positions, to accurately define TE families. At present, TEs fall into 23 families almost completely unrelated to each other by primary structure. It is assumed that all members of the same family have essentially the same tertiary structure; however, TEs in different families can have markedly different folds and mechanisms. Conversely, the latter sometimes have very similar tertiary structures and catalytic mechanisms despite being only slightly or not at all related by primary structure, indicating that they have common distant ancestors and can be grouped into clans. At present, four clans encompass 12 TE families. The new constantly updated ThYme (Thioester-active enzYmes) database contains TE primary and tertiary structures, classified into families and clans that are different from those currently found in the literature or in other databases. We review all types of TEs, including those cleaving CoA, ACP, glutathione, and other protein molecules, and we discuss their structures, functions, and mechanisms. PMID:20506386
-
USDA-ARS?s Scientific Manuscript database
We sought to determine if CAM use was greater in children in tertiary vs. primary care, and whether child or parent report of pain characteristics, and/or child and mother's psychological characteristics differed between those who did/did not use CAM. We identified children 7-10 years of age with FA...
-
Interaction of tannase from Aspergillus niger with polycations applied to its primary recovery.
Durán, Luis V Rodríguez; Spelzini, Darío; Boeris, Valeria; Aguilar, Cristóbal N; Picó, Guillermo A
2013-10-01
The interaction of tannase (TAH) with chitosan, polyethyleneimine and Eudragit(®)E100 was studied. It was found that TAH selectively binds to these polycations (PC), probably due to the acid nature of the target protein. TAH could interact with these PC depending on the medium conditions. The effect of the interaction on the secondary and tertiary structure of TAH was assayed through circular dichroism and fluorescence spectroscopy. TAH was recovered from Aspergillus niger culture broth by means of precipitation and adsorption using chitosan. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Tan, Qinglong; Lu, Shanfu; Si, Jiangju; Wang, Haining; Wu, Chunxiao; Li, Xianfeng; Xiang, Yan
2017-04-01
Novel polysulfone membranes with bunch-like tertiary amine groups are synthesized with high ion selectivity and outstanding chemical stability for vanadium redox flow batteries (VRFBs). The bunch-like tertiary amine groups simultaneously act as an ionic conductor for proton hopping and vanadium ion transport obstacles. The performance of the membrane is tuned via controlling the grafting degree of the chloromethylated polysulfone. The results show that membranes show increasing proton over vanadium ion (σ/p) selectivity with increasing functional tertiary groups. VRFBs assembled with the prepared membranes demonstrate an impressive Coulombic efficiency of 98.9% and energy efficiency of 90.9% at a current density of 50 mA cm -2 . Furthermore, the prepared membrane reported in this work shows excellent stability in 1 m VO 2 + solution at 35 °C over 240 h. Overall, the synthesized polymers provide a new insight into the design of high-performance membranes toward VRFB applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Structure and Function of the Sterol Carrier Protein-2 N-Terminal Presequence†
Martin, Gregory G.; Hostetler, Heather A.; McIntosh, Avery L.; Tichy, Shane E.; Williams, Brad J.; Russell, David H.; Berg, Jeremy M.; Spencer, Thomas A.; Ball, Judith; Kier, Ann B.; Schroeder, Friedhelm
2008-01-01
Although sterol carrier protein-2 (SCP-2) is encoded as a precursor protein (proSCP-2), little is known regarding the structure and function of the 20-amino acid N-terminal presequence. As shown herein, the presequence contains significant secondary structure and alters SCP-2: (i) secondary structure (CD), (ii) tertiary structure (aqueous exposure of Trp shown by UV absorbance, fluorescence, fluorescence quenching), (iii) ligand binding site [Trp response to ligands, peptide cross-linked by photoactivatable free cholesterol (FCBP)], (iv) selectivity for interaction with anionic phospholipid-rich membranes, (v) interaction with a peroxisomal import protein [FRET studies of Pex5p(C) binding], the N-terminal presequence increased SCP-2’s affinity for Pex5p(C) by 10-fold, and (vi) intracellular targeting in living and fixed cells (confocal microscopy). Nearly 5-fold more SCP-2 than proSCP-2 colocalized with plasma membrane lipid rafts/caveolae (AF488-CTB), 2.8-fold more SCP-2 than proSCP-2 colocalized with a mitochondrial marker (Mitotracker), but nearly 2-fold less SCP-2 than proSCP-2 colocalized with peroxisomes (AF488-antibody to PMP70). These data indicate the importance of the N-terminal presequence in regulating SCP-2 structure, cholesterol localization within the ligand binding site, membrane association, and, potentially, intracellular targeting. PMID:18465878
-
Determinants of Effective Caregiver Communication After Adolescent Traumatic Brain Injury
Hobart-Porter, Laura; Wade, Shari; Minich, Nori; Kirkwood, Michael; Stancin, Terry; Taylor, Hudson Gerry
2017-01-01
Objective To characterize the effects of caregiver mental health and coping strategies on interactions with an injured adolescent acutely after traumatic brain injury (TBI). Design Multi-site, cross-sectional study. Setting Outpatient setting of 3 tertiary pediatric hospitals and 2 tertiary general medical centers. Participants Adolescents (N = 125) aged 12–17 years, 1–6 months after being hospitalized with complicated mild to severe TBI. Methods Data were collected as part of a multi-site clinical trial of family problem-solving therapy after TBI. Multiple regression analyses were used to examine the relationship of caregiver and environmental characteristics to the dimensions of effective communication, warmth, and negativity during caregiver-adolescent problem-solving discussions. Main Outcomes Measures Adolescent and caregiver interactions, as measured by the Iowa Family Interaction Rating Scales. Results Caregivers who utilized problem-focused coping strategies were rated as having higher levels of effective communication (P <.01), as were those with higher socioeconomic status (P <.01). Problem-focused coping style and higher socioeconomic status were also associated lower levels of negative interactions (P < .01 and P < .05, respectively). Female gender of the adolescent and fewer children in the home were associated with increased parental warmth during the interaction (P < .01 and P < .05, respectively). Neither adolescent TBI severity nor caregiver depression significantly influenced caregiver-teen interactions. Conclusions Problem-focused coping strategies are associated with higher levels of effective communication and lower levels of caregiver negativity during the initial months after adolescent TBI, suggesting that effective caregiver coping may facilitate better caregiver-adolescent interactions after TBI. PMID:25687111
-
Dinakaran, P; Mehrotra, Seema; Bharath, Srikala
2014-12-01
There are very few studies on user-perspectives about mental health care services that explore perspectives of family caregivers in India. An exploratory study was undertaken to understand the perceived importance of various aspects of interactions with mental health service providers during hospitalization, from the perspectives of family caregivers. In addition, it also aimed at documenting their actual experience of interactional aspects of care during the hospitalization of their relatives. The study was conducted on fifty family caregivers of patients with varied psychiatric diagnoses hospitalized in a tertiary psychiatric care setting in South India. Measures of Interactional aspects of care were developed to assess perceived importance of six different interactional domains of care and the actual experience of care in these domains. Provision of informational inputs and addressing of concerns raised emerged as the domains of care given highest importance. The item pertaining to 'sharing with the caregiver about different alternatives for treatment' received negative ratings in terms of actual experience by maximum number of participants (18%). Significant differences on perceived importance of four domains of interactional aspects of care (dignity, confidentiality and fairness, addressing concerns raised, informational inputs and prompt attention and consistent care) emerged between caregiver subgroups based on educational level of the caregiver, socio-economic status, hospitalization history and broad diagnostic categories. In addition, the care givers of patients with psychoses assigned significantly more positive ratings on actual experience for all the domains of interactional aspects of care. The findings have implications for further research and practice. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Determinants of Effective Caregiver Communication After Adolescent Traumatic Brain Injury.
Hobart-Porter, Laura; Wade, Shari; Minich, Nori; Kirkwood, Michael; Stancin, Terry; Taylor, Hudson Gerry
2015-08-01
To characterize the effects of caregiver mental health and coping strategies on interactions with an injured adolescent acutely after traumatic brain injury (TBI). Multi-site, cross-sectional study. Outpatient setting of 3 tertiary pediatric hospitals and 2 tertiary general medical centers. Adolescents (N = 125) aged 12-17 years, 1-6 months after being hospitalized with complicated mild to severe TBI. Data were collected as part of a multi-site clinical trial of family problem-solving therapy after TBI. Multiple regression analyses were used to examine the relationship of caregiver and environmental characteristics to the dimensions of effective communication, warmth, and negativity during caregiver-adolescent problem-solving discussions. Adolescent and caregiver interactions, as measured by the Iowa Family Interaction Rating Scales. Caregivers who utilized problem-focused coping strategies were rated as having higher levels of effective communication (P < .01), as were those with higher socioeconomic status (P < .01). Problem-focused coping style and higher socioeconomic status were also associated lower levels of negative interactions (P < .01 and P < .05, respectively). Female gender of the adolescent and fewer children in the home were associated with increased parental warmth during the interaction (P < .01 and P < .05, respectively). Neither adolescent TBI severity nor caregiver depression significantly influenced caregiver-teen interactions. Problem-focused coping strategies are associated with higher levels of effective communication and lower levels of caregiver negativity during the initial months after adolescent TBI, suggesting that effective caregiver coping may facilitate better caregiver-adolescent interactions after TBI. Copyright © 2015 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.
-
Shanghai: a study on the spatial growth of population and economy in a Chinese metropolitan area.
Zhu, J
1995-01-01
In this study of the growth in population and industry in Shanghai, China, between the 1982 and 1990 censuses, data on administrative divisions was normalized through digitization and spatial analysis. Analysis focused on spatial units, intensity of growth, time period, distance, rate of growth, and direction of spatial growth. The trisection method divided the city into city proper, outskirts, and suburbs. The distance function method considered the distance from center city as a function: exponential, power, trigonometric, logarithmic, and polynomial. Population growth and employment in all sectors increased in the outskirts and suburbs and decreased in the city proper except tertiary sectors. Primary sector employment decreased in all three sections. Employment in the secondary increased faster in the outskirts and suburbs than the total rate of growth of population and employment. In the city secondary sector employment rates decreased faster than total population and employment rates. The tertiary sector had the highest rate of growth in all sections, and employment grew faster than secondary sector rates. Tertiary growth was highest in real estate, finance, and insurance. Industrial growth in the secondary sector was 160.2% in the suburbs, 156.6% in the outskirts, and 80.9% in the city. In the distance function analysis, industry expanded further out than the entire secondary sector. Commerce grew the fastest in areas 15.4 km from center city. Economic growth was faster after economic reforms in 1978. Growth was led by industry and followed by the secondary sector, the tertiary sector, and population. Industrial expansion resulted from inner pressure, political factors controlling size, the social and economic system, and the housing construction and distribution system. Initially sociopsychological factors affected urban concentration.
-
ERIC Educational Resources Information Center
Garfield, Joan; Ben-Zvi, Dani
2009-01-01
This article describes a model for an interactive, introductory secondary- or tertiary-level statistics course that is designed to develop students' statistical reasoning. This model is called a "Statistical Reasoning Learning Environment" and is built on the constructivist theory of learning.
-
Enhanced Product Stability in the Hammerhead Ribozyme†
Shepotinovskaya, Irina; Uhlenbeck, Olke C.
2010-01-01
The rate of dissociation of P1, the 5′ product of hammerhead cleavage, is 100–300-fold slower in full-length hammerheads than in hammerheads that either lack or have disrupting mutations in the loop-loop tertiary interaction. The added stability requires the presence of residue 17 at the 3′ terminus of P1 but not the 2′, 3′ terminal phosphate. Since residue 17 is buried within the catalytic core of the hammerhead in the x-ray structure, we propose that the enhanced P1 stability is the result of the cooperative folding of the hammerhead around this residue. However, since the P1 is fully stabilized above 2.5 mM MgCl2 while hammerhead activity continues to increase with increasing MgCl2, it is clear that the hammerhead structure in the transition state must differ from that of the product complex. The product stabilization assay is used to test our earlier proposal that different tertiary interactions modulate the cleavage rate by differentially stabilizing the core. PMID:20423112
-
SURFACTANT - POLYMER INTERACTION FOR IMPROVED OIL RECOVERY
DOE Office of Scientific and Technical Information (OSTI.GOV)
Unknown
1998-10-01
The goal of this research is to use the interaction between a surfactant and a polymer for efficient displacement of tertiary oil by improving slug integrity, adsorption and mobility control. Surfactant--polymer flooding has been shown to be highly effective in laboratory-scale linear floods. The focus of this proposal is to design an inexpensive surfactant-polymer mixture that can efficiently recover tertiary oil by avoiding surfactant slug degradation high adsorption and viscous/heterogeneity fingering. A mixture comprising a ''pseudo oil'' with appropriate surfactant and polymer has been selected to study micellar-polymer chemical flooding. The physical properties and phase behavior of this system havemore » been determined. A surfactant-polymer slug has been designed to achieve high efficiency recovery by improving phase behavior and mobility control. Recovery experiments have been performed on linear cores and a quarter 5-spot. The same recovery experiments have been simulated using a commercially available simulator (UTCHEM). Good agreement between experimental data and simulation results has been achieved.« less
-
Nickel-Catalyzed Reductive Allylation of Tertiary Alkyl Halides with Allylic Carbonates.
Chen, Haifeng; Jia, Xiao; Yu, Yingying; Qian, Qun; Gong, Hegui
2017-10-09
The construction of all C(sp 3 ) quaternary centers has been successfully achieved under Ni-catalyzed cross-electrophile coupling of allylic carbonates with unactivated tertiary alkyl halides. For allylic carbonates bearing C1 or C3 substituents, the reaction affords excellent regioselectivity through the addition of alkyl groups to the unsubstituted allylic carbon terminus. The allylic alkylation method also exhibits excellent functional-group compatibility, and delivers the products with high E selectivity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Cui, Yanfang; Tae, Han-Shen; Norris, Nicole C; Karunasekara, Yamuna; Pouliquin, Pierre; Board, Philip G; Dulhunty, Angela F; Casarotto, Marco G
2009-03-01
The II-III loop of the dihydropyridine receptor (DHPR) alpha(1s) subunit is a modulator of the ryanodine receptor (RyR1) Ca(2+) release channel in vitro and is essential for skeletal muscle contraction in vivo. Despite its importance, the structure of this loop has not been reported. We have investigated its structure using a suite of NMR techniques which revealed that the DHPR II-III loop is an intrinsically unstructured protein (IUP) and as such belongs to a burgeoning structural class of functionally important proteins. The loop does not possess a stable tertiary fold: it is highly flexible, with a strong N-terminal helix followed by nascent helical/turn elements and unstructured segments. Its residual structure is loosely globular with the N and C termini in close proximity. The unstructured nature of the II-III loop may allow it to easily modify its interaction with RyR1 following a surface action potential and thus initiate rapid Ca(2+) release and contraction. The in vitro binding partner for the II-III was investigated. The II-III loop interacts with the second of three structurally distinct SPRY domains in RyR1, whose function is unknown. This interaction occurs through two preformed N-terminal alpha-helical regions and a C-terminal hydrophobic element. The A peptide corresponding to the helical N-terminal region is a common probe of RyR function and binds to the same SPRY domain as the full II-III loop. Thus the second SPRY domain is an in vitro binding site for the II-III loop. The possible in vivo role of this region is discussed.
-
ERIC Educational Resources Information Center
Lawrence, Sarah H.; Jaffe, Eileen K.
2008-01-01
A morpheein is a homo-oligomeric protein that can exist as an ensemble of physiologically significant and functionally distinct alternate quaternary assemblies. Morpheeins exist in nature and use conformational equilibria between different tertiary structures to form distinct oligomers as a means of regulating their function. Notably, alternate…
-
Du, Dongmei; Fu, Aiping; Qin, Mei; Zhou, Zheng-Yu; Zhu, Xiao
2015-08-01
The mechanism of SO2 capture by 1-(2-diethylaminoethyl)-3-methylimidazolium tetrazolate ([Et2NEMim][Tetz]) was investigated using B3LYP hybrid density functional methods at 6-31 + G(d,p) level. In order to find the origin of the high capacity of the subjected ionic liquids (IL) for SO2 capture, the 1: n (n = 1-5) complexes formed between [Et2NEMim][Tetz] and 1-5 SO2 molecules were optimized. Two interaction modes (π-hole interaction and hydrogen bond) were found in each 1: n (n = 1-5) complex; the second order perturbation stabilization energies, E(2)s, confirmed that the main interaction mode was a π-hole interaction. The calculated interaction energies indicated that the first SO2 absorption should be chemical absorption. The capture of the second and third SO2 should fall between chemical and physical interaction, and the fourth and fifth SO2 are incorporated by physical absorption. Thermodynamic analyses indicated that SO2 capture favors lower temperature and higher pressure. Owing to the interactions between SO2 and the [Tetz] anion or the [Et2NEMim] cation, the SOO asymmetric stretching frequency exhibits an obviously red shift in the complex. The strong absorptions of SOO asymmetric stretching in complex (1:5) appear at 1295 cm(-1) (interaction between SO2 and the [Tetz](-) anion) and 1247 cm(-1) (interaction between SO2 and the tertiary nitrogen on the cation). Graphical Abstract Geometric structures of the most stable [ET 2 NEMim][Tetz]ionic liquid (IL; left), and most stable SO2 complex (n = 1-5; right) optimized at the B3LYP/6-31+G (d,p) level (distances in angstroms).
-
Proton conducting membranes for high temperature fuel cells with solid state water free membranes
NASA Technical Reports Server (NTRS)
Narayanan, Sekharipuram R. (Inventor); Yen, Shiao-Pin S. (Inventor)
2006-01-01
A water free, proton conducting membrane for use in a fuel cell is fabricated as a highly conducting sheet of converted solid state organic amine salt, such as converted acid salt of triethylenediamine with two quaternized tertiary nitrogen atoms, combined with a nanoparticulate oxide and a stable binder combined with the converted solid state organic amine salt to form a polymeric electrolyte membrane. In one embodiment the membrane is derived from triethylenediamine sulfate, hydrogen phosphate or trifiate, an oxoanion with at least one ionizable hydrogen, organic tertiary amine bisulfate, polymeric quaternized amine bisulfate or phosphate, or polymeric organic compounds with quaternizable nitrogen combined with Nafion to form an intimate network with ionic interactions.
-
Matta, Stephanie; Chammas, Elie; Alraies, Chadi; Abchee, Antoine; AlJaroudi, Wael
2016-05-01
Sedentary lifestyle has become prevalent in our community. Recent data showed controversy on the effect of regular exercise on left ventricular compliance and myocardial relaxation. We sought to assess whether physical inactivity is an independent predictor of diastolic dysfunction in or community, after adjustment for several covariates. Consecutive outpatients presenting to the echocardiography laboratory between July 2013 and June 2014 were prospectively enrolled. Clinical variables were collected prospectively at enrollment. Patients were considered physically active if they exercised regularly ≥3× a week, ≥30 minutes each time. The primary endpoint was presence of diastolic dysfunction. The final cohort included 1356 patients (mean age [SD] 52.9 [17.4] years, 51.3% female). Compared with physically active patients, the 1009 (74.4%) physically inactive patients were older, more often female, and had more comorbidities and worse diastolic function (51.3% vs 38.3%; P < 0.001). On univariate analysis, physical inactivity was associated with 70% increased odds of having diastolic dysfunction (odds ratio: 1.70, 95% confidence interval: 1.32-2.18, P < 0.001). There was significant interaction between physical activity and left ventricular mass index (LVMI; P = 0.026). On multivariate analysis, patients who were physically inactive and had LVMI ≥ median had significantly higher odds of having diastolic dysfunction (odds ratio: 2.82, 95% confidence interval: 1.58-5.05, P < 0.001). In a large, prospectively enrolled cohort from a single tertiary center in the Middle East, physically inactive patients with increased LVMI had 2- to 3-fold increased odds of having diastolic dysfunction after multivariate adjustment. © 2016 Wiley Periodicals, Inc.
-
Distinct Stabilities of the Structurally Homologous Heptameric Co-Chaperonins GroES and gp31
NASA Astrophysics Data System (ADS)
Dyachenko, Andrey; Tamara, Sem; Heck, Albert J. R.
2018-05-01
The GroES heptamer is the molecular co-chaperonin that partners with the tetradecamer chaperonin GroEL, which assists in the folding of various nonnative polypeptide chains in Escherichia coli. Gp31 is a structural and functional analogue of GroES encoded by the bacteriophage T4, becoming highly expressed in T4-infected E. coli, taking over the role of GroES, favoring the folding of bacteriophage proteins. Despite being slightly larger, gp31 is quite homologous to GroES in terms of its tertiary and quaternary structure, as well as in its function and mode of interaction with the chaperonin GroEL. Here, we performed a side-by-side comparison of GroES and gp31 heptamer complexes by (ion mobility) tandem mass spectrometry. Surprisingly, we observed quite distinct fragmentation mechanisms for the GroES and gp31 heptamers, whereby GroES displays a unique and unusual bimodal charge distribution in its released monomers. Not only the gas-phase dissociation but also the gas-phase unfolding of GroES and gp31 were found to be very distinct. We rationalize these observations with the similar discrepancies we observed in the thermal unfolding characteristics and surface contacts within GroES and gp31 in the solution. From our data, we propose a model that explains the observed simultaneous dissociation pathways of GroES and the differences between GroES and gp31 gas-phase dissociation and unfolding. We conclude that, although GroES and gp31 exhibit high homology in tertiary and quaternary structure, they are quite distinct in their solution and gas-phase (un)folding characteristics and stability. [Figure not available: see fulltext.
-
Hati, Sanchita; Bhattacharyya, Sudeep
2016-01-01
A project-based biophysical chemistry laboratory course, which is offered to the biochemistry and molecular biology majors in their senior year, is described. In this course, the classroom study of the structure-function of biomolecules is integrated with the discovery-guided laboratory study of these molecules using computer modeling and simulations. In particular, modern computational tools are employed to elucidate the relationship between structure, dynamics, and function in proteins. Computer-based laboratory protocols that we introduced in three modules allow students to visualize the secondary, super-secondary, and tertiary structures of proteins, analyze non-covalent interactions in protein-ligand complexes, develop three-dimensional structural models (homology model) for new protein sequences and evaluate their structural qualities, and study proteins' intrinsic dynamics to understand their functions. In the fourth module, students are assigned to an authentic research problem, where they apply their laboratory skills (acquired in modules 1-3) to answer conceptual biophysical questions. Through this process, students gain in-depth understanding of protein dynamics-the missing link between structure and function. Additionally, the requirement of term papers sharpens students' writing and communication skills. Finally, these projects result in new findings that are communicated in peer-reviewed journals. © 2016 The International Union of Biochemistry and Molecular Biology.
-
Boys and "Second Chance" Education: Same Jeans, Different Consequences.
ERIC Educational Resources Information Center
McFadden, Mark G.
This paper examines the perceptions and interactions of disadvantaged young people returning to mainstream education through Street Kids Access Tertiary Education (SKATE), a university bridging program in Sydney, Australia. Although both males and females in the study shared common backgrounds of disadvantage, "second-chance" educational…
-
Preparing Students for the Global Workplace: The Impact of a Semester Abroad
ERIC Educational Resources Information Center
Jackson, Jane
2015-01-01
As the world becomes increasingly interconnected, employers are seeking "global-ready graduates," that is, individuals with an intercultural mindset, who can interact effectively and appropriately with people from diverse linguistic and cultural backgrounds. In response, tertiary institutions are creating more opportunities for…
-
NEUROBEHAVIORAL EVALUATIONS OF BINARY AND TERTIARY MIXTURES OF CHEMICALS: LESSIONS LEARNING.
The classical approach to the statistical analysis of binary chemical mixtures is to construct full dose-response curves for one compound in the presence of a range of doses of the second compound (isobolographic analyses). For interaction studies using more than two chemicals, ...
-
Zheng, Wenjun
2017-02-01
In the adaptive immune systems of many bacteria and archaea, the Cas9 endonuclease forms a complex with specific guide/scaffold RNA to identify and cleave complementary target sequences in foreign DNA. This DNA targeting machinery has been exploited in numerous applications of genome editing and transcription control. However, the molecular mechanism of the Cas9 system is still obscure. Recently, high-resolution structures have been solved for Cas9 in different structural forms (e.g., unbound forms, RNA-bound binary complexes, and RNA-DNA-bound tertiary complexes, corresponding to an inactive state, a pre-target-bound state, and a cleavage-competent or product state), which offered key structural insights to the Cas9 mechanism. To further probe the structural dynamics of Cas9 interacting with RNA and DNA at the amino-acid level of details, we have performed systematic coarse-grained modeling using an elastic network model and related analyses. Our normal mode analysis predicted a few key modes of collective motions that capture the observed conformational changes featuring large domain motions triggered by binding of RNA and DNA. Our flexibility analysis identified specific regions with high or low flexibility that coincide with key functional sites (such as DNA/RNA-binding sites, nuclease cleavage sites, and key hinges). We also identified a small set of hotspot residues that control the energetics of functional motions, which overlap with known functional sites and offer promising targets for future mutagenesis efforts to improve the specificity of Cas9. Finally, we modeled the conformational transitions of Cas9 from the unbound form to the binary complex and then the tertiary complex, and predicted a distinct sequence of domain motions. In sum, our findings have offered rich structural and dynamic details relevant to the Cas9 machinery, and will guide future investigation and engineering of the Cas9 systems. Proteins 2017; 85:342-353. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
-
Structural basis for the glucan phosphatase activity of Starch Excess4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vander Kooi, Craig W.; Taylor, Adam O.; Pace, Rachel M.
Living organisms utilize carbohydrates as essential energy storage molecules. Starch is the predominant carbohydrate storage molecule in plants while glycogen is utilized in animals. Starch is a water-insoluble polymer that requires the concerted activity of kinases and phosphatases to solubilize the outer surface of the glucan and mediate starch catabolism. All known plant genomes encode the glucan phosphatase Starch Excess4 (SEX4). SEX4 can dephosphorylate both the starch granule surface and soluble phosphoglucans and is necessary for processive starch metabolism. The physical basis for the function of SEX4 as a glucan phosphatase is currently unclear. Herein, we report the crystal structuremore » of SEX4, containing phosphatase, carbohydrate-binding, and C-terminal domains. The three domains of SEX4 fold into a compact structure with extensive interdomain interactions. The C-terminal domain of SEX4 integrally folds into the core of the phosphatase domain and is essential for its stability. The phosphatase and carbohydrate-binding domains directly interact and position the phosphatase active site toward the carbohydrate-binding site in a single continuous pocket. Mutagenesis of the phosphatase domain residue F167, which forms the base of this pocket and bridges the two domains, selectively affects the ability of SEX4 to function as a glucan phosphatase. Together, these results reveal the unique tertiary architecture of SEX4 that provides the physical basis for its function as a glucan phosphatase.« less
-
Abe-Yoshizumi, Rei; Kobayashi, Shiori; Gohara, Mizuki; Hayashi, Kokoro; Kojima, Chojiro; Kojima, Seiji; Sudo, Yuki; Asami, Yasuo; Homma, Michio
2013-01-01
Flagellar motors embedded in bacterial membranes are molecular machines powered by specific ion flows. Each motor is composed of a stator and a rotor and the interactions of those components are believed to generate the torque. Na+ influx through the PomA/PomB stator complex of Vibrio alginolyticus is coupled to torque generation and is speculated to trigger structural changes in the cytoplasmic domain of PomA that interacts with a rotor protein in the C-ring, FliG, to drive the rotation. In this study, we tried to overproduce the cytoplasmic loop of PomA (PomA-Loop), but it was insoluble. Thus, we made a fusion protein with a small soluble tag (GB1) which allowed us to express and characterize the recombinant protein. The structure of the PomA-Loop seems to be very elongated or has a loose tertiary structure. When the PomA-Loop protein was produced in E. coli, a slight dominant effect was observed on motility. We conclude that the cytoplasmic loop alone retains a certain function. PMID:27493537
-
Li, Lei; Quinlivan, Patricia A; Knappe, Detlef R U
2005-05-01
A method based on the Polanyi-Dubinin-Manes (PDM) model is presented to predict adsorption isotherms of aqueous organic contaminants on activated carbons. It was assumed that trace organic compound adsorption from aqueous solution is primarily controlled by nonspecific dispersive interactions while water adsorption is controlled by specific interactions with oxygen-containing functional groups on the activated carbon surface. Coefficients describing the affinity of water for the activated carbon surface were derived from aqueous-phase methyl tertiary-butyl ether (MTBE) and trichloroethene (TCE) adsorption isotherm data that were collected with 12 well-characterized activated carbons. Over the range of oxygen contents covered by the adsorbents (approximately 0.8-10 mmol O/g dry, ash-free activated carbon), a linear relationship between water affinity coefficients and adsorbent oxygen content was obtained. Incorporating water affinity coefficients calculated from the developed relationship into the PDM model, isotherm predictions resulted that agreed well with experimental data for three adsorbents and two adsorbates [tetrachloroethene (PCE), cis-1,2-dichloroethene (DCE)] that were not used to calibrate the model.
-
NASA Astrophysics Data System (ADS)
El Mahdy, A. M.; Halim, Shimaa Abdel; Taha, H. O.
2018-05-01
Density functional theory (DFT) and time-dependent DFT calculations have been employed to model metallotetraphenylporphyrin dyes and metallotetraphenylporphyrin -fullerene complexes in order to investigate the geometries, electronic structures, the density of states, non-linear optical properties (NLO), IR-vis spectra, molecular electrostatic potential contours, and electrophilicity. To calculate the excited states of the tetraphenyl porphyrin analogs, time-dependent density functional theory (TD-DFT) are used. Their UV-vis spectra were also obtained and a comparison with available experimental and theoretical results is included. The results reveal that the metal and the tertiary butyl groups of the dyes are electron donors, and the tetraphenylporphyrin rings are electron acceptors. The HOMOs of the dyes fall within the (TiO2)60 and Ti38O76 band gaps and support the issue of typical interfacial electron transfer reaction. The resulting potential drop of Mn-TPP-C60 increased by ca. 3.50% under the effect of the tertiary butyl groups. The increase in the potential drop indicates that the tertiary butyl complexes could be a better choice for the strong operation of the molecular rectifiers. The introduction of metal atom and tertiary butyl groups to the tetraphenyl porphyrin moiety leads to a stronger response to the external electric field and induces higher photo-to-current conversion efficiency. This also shifts the absorption in the dyes and makes them potential candidates for harvesting light in the entire visible and near IR region for photovoltaic applications.
-
Lee, Hyo Jung; Jang, Sung-In; Park, Eun-Cheol
2017-02-20
The Korean healthcare system is composed of costly and inefficient structures that fail to adequately divide the functions and roles of medical care organizations. To resolve this matter, the government reformed the cost-sharing policy in November of 2011 for the management of outpatients visiting general or tertiary hospitals with comparatively mild diseases. The purpose of the present study was to examine the impact of increasing the coinsurance rate of prescription drug costs for 52 mild diseases at general or tertiary hospitals on outpatient healthcare service utilization. The present study used health insurance claim data collected from 2010 to 2013. The study population consisted of 505,691 outpatients and was defined as those aged 20-64 years who had visited medical care organizations for the treatment of 52 diseases both before and after the program began. To examine the effect of the cost-sharing policy on outpatient healthcare service utilization (percentage of general or tertiary hospital utilization, number of outpatient visits, and outpatient medical costs), a segmented regression analysis was performed. After the policy to increase the coinsurance rate on prescription drug costs was implemented, the number of outpatient visits at general or tertiary hospitals decreased (β = -0.0114, p < 0.0001); however, the number increased at hospitals and clinics (β = 0.0580, p < 0.0001). Eventually, the number of outpatient visits to hospitals and clinics began to decrease after policy initiation (β = -0.0018, p < 0.0001). Outpatient medical costs decreased for both medical care organizations (general or tertiary hospitals: β = -2913.4, P < 0.0001; hospitals or clinics: β = -591.35, p < 0.0001), and this decreasing trend continued with time. It is not clear that decreased utilization of general or tertiary hospitals has transferred to that of clinics or hospitals due to the increased cost-sharing policy of prescription drug costs. This result indicates the cost-sharing policy, intended to change patient behaviors for healthcare service utilization, has had limited effects on rebuilding the healthcare system and the function of medical care organizations.
-
Developing Visualization Support System for Teaching/Learning Database Normalization
ERIC Educational Resources Information Center
Folorunso, Olusegun; Akinwale, AdioTaofeek
2010-01-01
Purpose: In tertiary institution, some students find it hard to learn database design theory, in particular, database normalization. The purpose of this paper is to develop a visualization tool to give students an interactive hands-on experience in database normalization process. Design/methodology/approach: The model-view-controller architecture…
-
ERIC Educational Resources Information Center
Zhao, Huahui; Sullivan, Kirk P. H.; Mellenius, Ingmarie
2014-01-01
A key reason for using asynchronous computer conferencing in instruction is its potential for supporting collaborative learning. However, few studies have examined collaboration in computer conferencing. This study examined collaboration in six peer review groups within an asynchronous computer conferencing. Eighteen tertiary students participated…
-
Concentration Dependent Speciation and Mass Transport Properties of Switchable Polarity Solvents
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aaron D. Wilson; Christopher J. Orme
2014-12-01
Tertiary amine switchable polarity solvents (SPS) consisting of predominantly water, tertiary amine, and tertiary ammonium and bicarbonate ions were produced at various concentrations for three different amines: N,N-dimethylcyclohexylamine, N,N-dimethyloctylamine, and 1 cyclohexylpiperidine. For all concentrations, physical properties were measured including viscosity, molecular diffusion coefficients, freezing point depression, and density. Based on these measurements a variation on the Mark Houwink equation was developed to predict the viscosity of any tertiary amine SPS as a function of concentration using the amine’s molecular mass. The observed physical properties allowed the identification of solution state speciation of non-osmotic SPS, where the amine to carbonicmore » acid ratio is significantly greater than one. These results indicate that at most concentrations the stoichiometric excess amine is involved in solvating a proton with two amines. The physical properties of osmotic SPS have consistent concentration dependence behavior over a wide range of concentrations; this consistence suggests osmotic pressures based on low concentrations freezing point studies can be reliably extrapolated to higher concentrations.« less
-
Circularization of the HIV-1 genome facilitates strand transfer during reverse transcription
Beerens, Nancy; Kjems, Jørgen
2010-01-01
Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer involves a jump from the 5′ to the 3′ terminal repeat (R) region positioned at each end of the viral genome. The process depends on base pairing between the cDNA synthesized from the 5′ R region and the 3′ R RNA. The tertiary conformation of the viral RNA genome may facilitate strand transfer by juxtaposing the 5′ R and 3′ R sequences that are 9 kb apart in the linear sequence. In this study, RNA sequences involved in an interaction between the 5′ and 3′ ends of the HIV-1 genome were mapped by mutational analysis. This interaction appears to be mediated mainly by a sequence in the extreme 3′ end of the viral genome and in the gag open reading frame. Mutation of 3′ R sequences was found to inhibit the 5′–3′ interaction, which could be restored by a complementary mutation in the 5′ gag region. Furthermore, we find that circularization of the HIV-1 genome does not affect the initiation of reverse transcription, but stimulates the first strand transfer during reverse transcription in vitro, underscoring the functional importance of the interaction. PMID:20430859
-
Araye, Anne; Goudet, Amélie; Barbier, Julien; Pichard, Sylvain; Baron, Bruno; England, Patrick; Pérez, Javier; Zinn-Justin, Sophie; Chenal, Alexandre; Gillet, Daniel
2016-01-01
Botulinum neurotoxin A (BoNT/A) is composed of three domains: a catalytic domain (LC), a translocation domain (HN) and a receptor-binding domain (HC). Like most bacterial toxins BoNT/A is an amphitropic protein, produced in a soluble form that is able to interact, penetrate and/or cross a membrane to achieve its toxic function. During intoxication BoNT/A is internalized by the cell by receptor-mediated endocytosis. Then, LC crosses the membrane of the endocytic compartment and reaches the cytosol. This translocation is initiated by the low pH found in this compartment. It has been suggested that LC passes in an unfolded state through a transmembrane passage formed by HN. We report here that acidification induces no major conformational change in either secondary or tertiary structures of LC and HN of BoNT/A in solution. GdnHCl-induced denaturation experiments showed that the stability of LC and HN increases as pH drops, and that HN further stabilizes LC. Unexpectedly we found that LC has a high propensity to interact with and permeabilize anionic lipid bilayers upon acidification without the help of HN. This property is downplayed when LC is linked to HN. HN thus acts as a chaperone for LC by enhancing its stability but also as a moderator of the membrane interaction of LC. PMID:27070312
-
Komaromy, Andras Z; Kulsing, Chadin; Boysen, Reinhard I; Hearn, Milton T W
2015-03-01
Key requirements of protein purification by hydrophobic interaction chromatography (HIC) are preservation of the tertiary/quaternary structure, maintenance of biological function, and separation of the correctly folded protein from its unfolded forms or aggregates. This study examines the relationship between the HIC retention behavior of hen egg white lysozyme (HEWL) in high concentrations of several kosmotropic salts and its conformation, assessed by circular dichroism (CD) spectroscopy. Further, the physicochemical properties of HEWL in the presence of high concentrations of ammonium sulfate, sodium chloride and magnesium chloride were investigated by small angle X-ray scattering (SAXS) at different temperatures. Radii of gyration were extrapolated from Guinier approximations and the indirect transform program GNOM with protein-protein interaction and contrast variation taken into account. A bead model simulation provided information on protein structural changes using ab initio reconstruction with GASBOR. These results correlated to the secondary structure content obtained from CD spectroscopy of HEWL. These changes in SAXS and CD data were consistent with heat capacity ΔCp -values obtained from van't Hoff plot analyses of the retention data. Collectively, these insights enable informed decisions to be made on the choice of chromatographic conditions, leading to improved separation selectivity and opportunities for innovative column-assisted protein refolding methods. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Matveev, Vladimir V
2010-06-09
According to the hypothesis explored in this paper, native aggregation is genetically controlled (programmed) reversible aggregation that occurs when interacting proteins form new temporary structures through highly specific interactions. It is assumed that Anfinsen's dogma may be extended to protein aggregation: composition and amino acid sequence determine not only the secondary and tertiary structure of single protein, but also the structure of protein aggregates (associates). Cell function is considered as a transition between two states (two states model), the resting state and state of activity (this applies to the cell as a whole and to its individual structures). In the resting state, the key proteins are found in the following inactive forms: natively unfolded and globular. When the cell is activated, secondary structures appear in natively unfolded proteins (including unfolded regions in other proteins), and globular proteins begin to melt and their secondary structures become available for interaction with the secondary structures of other proteins. These temporary secondary structures provide a means for highly specific interactions between proteins. As a result, native aggregation creates temporary structures necessary for cell activity."One of the principal objects of theoretical research in any department of knowledge is to find the point of view from which the subject appears in its greatest simplicity."Josiah Willard Gibbs (1839-1903).
-
Houston, Simon; Lithgow, Karen Vivien; Osbak, Kara Krista; Kenyon, Chris Richard; Cameron, Caroline E
2018-05-16
Syphilis continues to be a major global health threat with 11 million new infections each year, and a global burden of 36 million cases. The causative agent of syphilis, Treponema pallidum subspecies pallidum, is a highly virulent bacterium, however the molecular mechanisms underlying T. pallidum pathogenesis remain to be definitively identified. This is due to the fact that T. pallidum is currently uncultivatable, inherently fragile and thus difficult to work with, and phylogenetically distinct with no conventional virulence factor homologs found in other pathogens. In fact, approximately 30% of its predicted protein-coding genes have no known orthologs or assigned functions. Here we employed a structural bioinformatics approach using Phyre2-based tertiary structure modeling to improve our understanding of T. pallidum protein function on a proteome-wide scale. Phyre2-based tertiary structure modeling generated high-confidence predictions for 80% of the T. pallidum proteome (780/978 predicted proteins). Tertiary structure modeling also inferred the same function as primary structure-based annotations from genome sequencing pipelines for 525/605 proteins (87%), which represents 54% (525/978) of all T. pallidum proteins. Of the 175 T. pallidum proteins modeled with high confidence that were not assigned functions in the previously annotated published proteome, 167 (95%) were able to be assigned predicted functions. Twenty-one of the 175 hypothetical proteins modeled with high confidence were also predicted to exhibit significant structural similarity with proteins experimentally confirmed to be required for virulence in other pathogens. Phyre2-based structural modeling is a powerful bioinformatics tool that has provided insight into the potential structure and function of the majority of T. pallidum proteins and helped validate the primary structure-based annotation of more than 50% of all T. pallidum proteins with high confidence. This work represents the first T. pallidum proteome-wide structural modeling study and is one of few studies to apply this approach for the functional annotation of a whole proteome.
-
Rzayev, Zakir M O; Söylemez, A Ernur
2011-04-01
We have developed a new approach for the synthesis of polymer nanocomposites using a bifunctional reversible addition-fragmentation chain transfer (RAFT) agent, two types of organo-montmorillonites, such as a non-reactive dimethyldodecyl ammonium (DMDA)-MMT and a reactive octadecylamine (ODA)-MMT organoclays, and a radical initiator. The method includes the following stages: (1) synthesis of RAFT intercalated O-MMTs by a physical or chemical interaction of the RAFT agent having two pendant carboxylic groups [S,S-bis(alpha,alpha'-dimethyl-alpha"-acetic acid)trithiocarbonate] with surface alkyl amines of O-MMT containing tertiary ammonium cation or primary amine groups through strong H-bonding and complexing/amidization reactions, respectively, and (2) utilization of these well-dispersed and intercalated RAFT ... O-MMT complexes and their amide derivatives as new modified RAFT agents in radical-initiated interlamellar controlled/living copolymerization of itaconic acid (IA)-n-butylmethacrylate (BMA) monomer pair. The structure and compositions of the synthesized RAFT ... O-MMT complexes and functional copolymer/O-MMT hybrids were confirmed by FTIR, XRD, thermal (DSC-TGA), SEM and TEM morphology analyses. It was demonstrated that the degree of interaction/exfoliation, morphology and thermal behavior of nanocomposites significantly depended on the type of organoclay and in situ interaction, as well as on the content of flexible butyl-ester linkages as a internal plasticizer. The results of the comparative analysis of the nanocomposites structure-composition-property relations show that the functional copolymer-organoclay hybrids prepared with reactive RAFT ... ODA-MMT complex and containing a combination of partially intercalated and predominantly exfoliated nano-structures exhibit relatively higher thermal stability and fine dispersed morphology. These effects were explained by in situ interfacial chemical reactions through amidization of RAFT with surface alkyl amine of MMT clay in interlamellar copolymerization. This simple and versatile method can be applied to a wide range of functional monomer/comonomer systems and mono- and bifunctional RAFT compounds for preparation new generation of nanomaterials.
-
NASA Astrophysics Data System (ADS)
Kolos, N. N.; Paponov, B. V.; Orlov, V. D.; Lvovskaya, M. I.; Doroshenko, A. O.; Shishkin, O. V.
2006-03-01
1,5-diaminotetrazole at conditions of its interaction with chalcones (1,3-diphenylpropenones) in hot DMF undergoes Dimroth rearrangement to 5-tetrazolylhydrazine, which results in formation of 1-(5-tetrazolyl)-3,5-diaryl-Δ 2-pyrazolines ( I). Structure of the obtained products was confirmed by their parallel synthesis and X-ray structural analysis. Unusual fluorescence behavior of the tetrazolopyrazolynes in polar solvents was attributed to the dissociation of their highly acidic tetrazole N-H group. The last hypothesis was confirmed at the investigation of the protolytic interactions of I with tertiary amine.
-
Bifunctional anion-exchange resins with improved selectivity and exchange kinetics
Alexandratos, Spiro D.; Brown, Gilbert M.; Bonnesen, Peter V.; Moyer, Bruce A.
2000-01-01
Disclosed herein are a class of anion exchange resins containing two different exchange sites with improved selectivity and sorptive capability for chemical species in solution, such as heptavalent technetium (as pertechnetate anion, TcO.sub.4.sup.-). The resins are prepared by first reacting haloalkylated crosslinked copolymer beads with a large tertiary amine in a solvent in which the resin beads can swell, followed by reaction with a second, smaller, tertiary amine to more fully complete the functionalization of the resin. The resins have enhanced selectivity, capacity, and exchange kinetics.
-
Thermochemical properties for isooctane and carbon radicals: computational study.
Snitsiriwat, Suarwee; Bozzelli, Joseph W
2013-01-17
Thermochemical properties for isooctane, its internal rotation conformers, and radicals with corresponding bond energies are determined by use of computational chemistry. Enthalpies of formation are determined using isodesmic reactions with B3LYP density function theory and composite CBS-QB3 methods. Application of group additivity with comparison to calculated values is illustrated. Entropy and heat capacities are determined using geometric parameters, internal rotor potentials, and frequencies from B3LYP/6-31G(d,p) calculations for the lowest energy conformer. Internal rotor potentials are determined for the isooctane parent and for the primary, secondary, and tertiary radicals in order to identify isomer energies. Intramolecular interactions are shown to have a significant effect on the enthalpy of formation of the isooctane parent and its radicals. The computed standard enthalpy of formation for the lowest energy conformers of isooctane from this study is -54.40 ± 1.60 kcal mol(-1), which is 0.8 kcal mol(-1) lower than the evaluated experimental value -53.54 ± 0.36 kcal mol(-1). The standard enthalpy of formation for the primary radical for a methyl on the quaternary carbon is -5.00 ± 1.69 kcal mol(-1), for the primary radical on the tertiary carbon is -5.18 ± 1.69 kcal mol(-1), for the secondary isooctane radical is -9.03 ± 1.84 kcal mol(-1), and for the tertiary isooctane radical is -12.30 ± 2.02 kcal mol(-1). Bond energy values for the isooctane radicals are 100.64 ± 1.73, 100.46 ± 1.73, 96.41 ± 1.88 and 93.14 ± 2.05 kcal mol(-1) for C3•CCCC2, C3CCCC2•, C3CC•CC2, and C3CCC•C2, respectively. Entropy and heat capacity values are reported for the lowest energy homologues.
-
Godwin, Ryan C; Melvin, Ryan L; Gmeiner, William H; Salsbury, Freddie R
2017-01-31
Zinc-finger proteins are regulators of critical signaling pathways for various cellular functions, including apoptosis and oncogenesis. Here, we investigate how binding site protonation states and zinc coordination influence protein structure, dynamics, and ultimately function, as these pivotal regulatory proteins are increasingly important for protein engineering and therapeutic discovery. To better understand the thermodynamics and dynamics of the zinc finger of NEMO (NF-κB essential modulator), as well as the role of zinc, we present results of 20 μs molecular dynamics trajectories, 5 μs for each of four active site configurations. Consistent with experimental evidence, the zinc ion is essential for mechanical stabilization of the functional, folded conformation. Hydrogen bond motifs are unique for deprotonated configurations yet overlap in protonated cases. Correlated motions and principal component analysis corroborate the similarity of the protonated configurations and highlight unique relationships of the zinc-bound configuration. We hypothesize a potential mechanism for zinc binding from results of the thiol configurations. The deprotonated, zinc-bound configuration alone predominantly maintains its tertiary structure throughout all 5 μs and alludes rare conformations potentially important for (im)proper zinc-finger-related protein-protein or protein-DNA interactions.
-
Parathyroid Gland Function in Primary Aldosteronism.
Asbach, E; Bekeran, M; Reincke, M
2015-12-01
Primary aldosteronism (PA) is the most frequent cause of secondary arterial hypertension. Beyond its effects on intravascular volume and blood pressure, PA causes metabolic alterations and a higher cardiovascular morbidity, which is reduced by PA-directed therapy. Experimental studies demonstrated that mineralocorticoid excess may also influence mineral homeostasis. A role in cardiovascular disease has also been attributed to parathyroid hormone (PTH). Increasing evidence supports a bidirectional interaction between aldosterone and PTH.Primary hyperparathyroidism is associated with arterial hypertension and an increased cardiovascular morbidity and mortality, which might be associated to higher aldosterone values; parathyreoidectomy results in lowered aldosterone and blood pressure levels. PA leads to secondary hyperparathyroidism, which is reversible by PA-directed therapy. A lower bone mineral density and a higher fracture rate were also shown to be reversible by PA-directed therapy. There is a suspicion of a bidirectional interaction between aldosterone and PTH, which might lead to a higher cardiovascular risk. There are more and more reports about coincident PA and primary hyperparathyroidism. From a pathophysiologic point of view this constellation is best characterized as tertiary hyperparathyroidism. Future aspects should further clarify the extent of these endocrine interactions and analyze the influence of this interplay on cardiovascular morbidity and mortality and bone health. © Georg Thieme Verlag KG Stuttgart · New York.
-
Measurements and Predictions of the Noise from Three-Stream Jets
NASA Technical Reports Server (NTRS)
Henderson, Brenda S.; Leib, Stewart J.; Wernet, Mark P.
2015-01-01
An experimental and numerical investigation of the noise produced by high-subsonic and supersonic three-stream jets was conducted. The exhaust system consisted of externally-mixed-convergent nozzles and an external plug. Bypass- and tertiary-to-core area ratios between 1.0 and 2.5, and 0.4 and 1.0, respectively, were studied. Axisymmetric and offset tertiary nozzles were investigated for heated and unheated conditions. For axisymmetric configurations, the addition of the third stream was found to reduce peak- and high-frequency acoustic levels in the peak-jet-noise direction, with greater reductions at the lower bypass-to-core area ratios. For the offset configurations, an offset duct was found to decrease acoustic levels on the thick side of the tertiary nozzle relative to those produced by the simulated two-stream jet with up to 8 dB mid-frequency noise reduction at large angles to the jet inlet axis. Noise reduction in the peak-jet-noise direction was greater for supersonic core speeds than for subsonic core speeds. The addition of a tertiary nozzle insert used to divert the third-stream jet to one side of the nozzle system provided no noise reduction. Noise predictions are presented for selected cases using a method based on an acoustic analogy with mean flow interaction effects accounted for using a Green's function, computed in terms of its coupled azimuthal modes for the offset cases, and a source model previously used for round and rectangular jets. Comparisons of the prediction results with data show that the noise model predicts the observed increase in low-frequency noise with the introduction of a third, axisymmetric stream, but not the high-frequency reduction. For an offset third stream, the model predicts the observed trend of decreased sound levels on the thick side of the jet compared with the thin side, but the predicted azimuthal variations are much less than those seen in the data. Also, the shift of the spectral peak to lower frequencies with increasing polar angle is over-predicted. For an offset third stream with a heated core, it is shown that including the enthalpy-flux source terms in the acoustic analogy model improves predictions compared with those obtained using only the momentum flux.
-
Measurements and Predictions of the Noise from Three-Stream Jets
NASA Technical Reports Server (NTRS)
Henderson, Brenda S.; Leib, Stewart J.; Wernet, Mark P.
2015-01-01
An experimental and numerical investigation of the noise produced by high-subsonic and supersonic three-stream jets was conducted. The exhaust system consisted of externally-mixed-convergent nozzles and an external plug. Bypass- and tertiary- to-core area ratios between 1.0 and 2.5, and 0.4 and 1.0, respectively, were studied. Axisymmetric and offset tertiary nozzles were investigated for heated and unheated conditions. For axisymmetric configurations, the addition of the third stream was found to reduce peak- and high-frequency acoustic levels in the peak-jet-noise direction, with greater reductions at the lower bypass-to-core area ratios. For the offset configurations, an offset duct was found to decrease acoustic levels on the thick side of the tertiary nozzle relative to those produced by the simulated two-stream jet with up to 8 dB mid-frequency noise reduction at large angles to the jet inlet axis. Noise reduction in the peak-jet-noise direction was greater for supersonic core speeds than for subsonic core speeds. The addition of a tertiary nozzle insert used to divert the third-stream jet to one side of the nozzle system provided no noise reduction. Noise predictions are presented for selected cases using a method based on an acoustic analogy with mean flow interaction effects accounted for using a Green's function, computed in terms of its coupled azimuthal modes for the offset cases, and a source model previously used for round and rectangular jets. Comparisons of the prediction results with data show that the noise model predicts the observed increase in low-frequency noise with the introduction of a third, axisymmetric stream, but not the high-frequency reduction. For an offset third stream, the model predicts the observed trend of decreased sound levels on the thick side of the jet compared with the thin side, but the predicted azimuthal variations are much less than those seen in the data. Also, the shift of the spectral peak to lower frequencies with increasing polar angle is over-predicted. For an offset third stream with a heated core, it is shown that including the enthalpy-flux source terms in the acoustic analogy model improves predictions compared with those obtained using only the momentum- flux.
-
Selective rhodium-catalyzed reduction of tertiary amides in amino acid esters and peptides.
Das, Shoubhik; Li, Yuehui; Bornschein, Christoph; Pisiewicz, Sabine; Kiersch, Konstanze; Michalik, Dirk; Gallou, Fabrice; Junge, Kathrin; Beller, Matthias
2015-10-12
Efficient reduction of the tertiary amide bond in amino acid derivatives and peptides is described. Functional group selectivity has been achieved by applying a commercially available rhodium precursor and bis(diphenylphosphino)propane (dppp) ligand together with phenyl silane as a reductant. This methodology allows for specific reductive derivatization of biologically interesting peptides and offers straightforward access to a variety of novel peptide derivatives for chemical biology studies and potential pharmaceutical applications. The catalytic system tolerates a variety of functional groups including secondary amides, ester, nitrile, thiomethyl, and hydroxy groups. This convenient hydrosilylation reaction proceeds at ambient conditions and is operationally safe because no air-sensitive reagents or highly reactive metal hydrides are needed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Selbes, Meric; Kim, Daekyun; Ates, Nuray; Karanfil, Tanju
2013-02-01
N-nitrosodimethylamine (NDMA), a probable human carcinogen, is a disinfection by-product that has been detected in chloraminated and chlorinated drinking waters and wastewaters. Formation mechanisms and precursors of NDMA are still not well understood. The main objectives of this study were to systematically investigate (i) the effect of tertiary amine structure, (ii) the effect of background natural organic matter (NOM), and (iii) the roles of mono vs. dichloramine species on the NDMA formation. Dimethylamine (DMA) and 20 different tertiary aliphatic and aromatic amines were carefully examined based on their functional groups attached to the basic DMA structure. The wide range (0.02-83.9%) of observed NDMA yields indicated the importance of the structure of tertiary amines, and both stability and electron distribution of the leaving group of tertiary amines on NDMA formation. DMA associated with branched alkyl groups or benzyl like structures having only one carbon between the ring and DMA structure consistently gave higher NDMA yields. Compounds with electron withdrawing groups (EWG) reacted preferentially with monochloramine, whereas compounds with electron donating group (EDG) showed tendency to react with dichloramine to form NDMA. When the selected amines were present in NOM solutions, NDMA formation increased for compounds with EWG while decreased for compounds with EDG. This impact was attributed to the competitions between NOM and amines for chloramine species. The results provided additional information to the commonly accepted mechanism for NDMA formation including chloramine species reacting with tertiary amines and the role of the leaving group on overall NDMA conversion. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Undergraduate Mathematics Students' Understanding of the Concept of Function
ERIC Educational Resources Information Center
Bardini, Caroline; Pierce, Robyn; Vincent, Jill; King, Deborah
2014-01-01
Concern has been expressed that many commencing undergraduate mathematics students have mastered skills without conceptual understanding. A pilot study carried out at a leading Australian university indicates that a significant number of students, with high tertiary entrance ranks, have very limited understanding of the concept of function,…
-
Bruchas, Michael R.; Calo', Girolamo; Cox, Brian M.; Zaveri, Nurulain T.
2016-01-01
The NOP receptor (nociceptin/orphanin FQ opioid peptide receptor) is the most recently discovered member of the opioid receptor family and, together with its endogenous ligand, N/OFQ, make up the fourth members of the opioid receptor and opioid peptide family. Because of its more recent discovery, an understanding of the cellular and behavioral actions induced by NOP receptor activation are less well developed than for the other members of the opioid receptor family. All of these factors are important because NOP receptor activation has a clear modulatory role on mu opioid receptor-mediated actions and thereby affects opioid analgesia, tolerance development, and reward. In addition to opioid modulatory actions, NOP receptor activation has important effects on motor function and other physiologic processes. This review discusses how NOP pharmacology intersects, contrasts, and interacts with the mu opioid receptor in terms of tertiary structure and mechanism of receptor activation; location of receptors in the central nervous system; mechanisms of desensitization and downregulation; cellular actions; intracellular signal transduction pathways; and behavioral actions with respect to analgesia, tolerance, dependence, and reward. This is followed by a discussion of the agonists and antagonists that have most contributed to our current knowledge. Because NOP receptors are highly expressed in brain and spinal cord and NOP receptor activation sometimes synergizes with mu receptor-mediated actions and sometimes opposes them, an understanding of NOP receptor pharmacology in the context of these interactions with the opioid receptors will be crucial to the development of novel therapeutics that engage the NOP receptor. PMID:26956246
-
Dembkowski, D.J.; Miranda, L.E.
2012-01-01
River-floodplain ecosystems offer some of the most diverse and dynamic environments in the world. Accordingly, floodplain habitats harbor diverse fish assemblages. Fish biodiversity in floodplain lakes may be influenced by multiple variables operating on disparate scales, and these variables may exhibit a hierarchical organization depending on whether one variable governs another. In this study, we examined the interaction between primary variables descriptive of floodplain lake large-scale features, suites of secondary variables descriptive of water quality and primary productivity, and a set of tertiary variables descriptive of fish biodiversity across a range of floodplain lakes in the Mississippi Alluvial Valley of Mississippi and Arkansas (USA). Lakes varied considerably in their representation of primary, secondary, and tertiary variables. Multivariate direct gradient analyses indicated that lake maximum depth and the percentage of agricultural land surrounding a lake were the most important factors controlling variation in suites of secondary and tertiary variables, followed to a lesser extent by lake surface area. Fish biodiversity was generally greatest in large, deep lakes with lower proportions of watershed agricultural land. Our results may help foster a holistic approach to floodplain lake management and suggest the framework for a feedback model wherein primary variables can be manipulated for conservation and restoration purposes and secondary and tertiary variables can be used to monitor the success of such efforts. ?? 2011 Springer Science+Business Media B.V.
-
Factors affecting fish biodiversity in floodplain lakes of the Mississippi Alluvial Valley
Miranda, Leandro E.; Dembkowski, Daniel J.
2012-01-01
River-floodplain ecosystems offer some of the most diverse and dynamic environments in the world. Accordingly, floodplain habitats harbor diverse fish assemblages. Fish biodiversity in floodplain lakes may be influenced by multiple variables operating on disparate scales, and these variables may exhibit a hierarchical organization depending on whether one variable governs another. In this study, we examined the interaction between primary variables descriptive of floodplain lake large-scale features, suites of secondary variables descriptive of water quality and primary productivity, and a set of tertiary variables descriptive of fish biodiversity across a range of floodplain lakes in the Mississippi Alluvial Valley of Mississippi and Arkansas (USA). Lakes varied considerably in their representation of primary, secondary, and tertiary variables. Multivariate direct gradient analyses indicated that lake maximum depth and the percentage of agricultural land surrounding a lake were the most important factors controlling variation in suites of secondary and tertiary variables, followed to a lesser extent by lake surface area. Fish biodiversity was generally greatest in large, deep lakes with lower proportions of watershed agricultural land. Our results may help foster a holistic approach to floodplain lake management and suggest the framework for a feedback model wherein primary variables can be manipulated for conservation and restoration purposes and secondary and tertiary variables can be used to monitor the success of such efforts.
-
Effect of soaps and detergents on epidermal barrier function.
Wolf, Ronni; Parish, Lawrence Charles
2012-01-01
The past decade has witnessed an explosion of new impartial information about the complex interaction of the skin with topically applied substances, including soaps and detergents. Despite of all these new data, our knowledge on the exact pathomechanism and molecular events leading to detergent-induced barrier dysfunction remains incomplete and the answers continue to elude us. The longtime prevailing opinion which contends that the damaging effect of soaps and detergents is related to their property to extract and remove useful intercellular lipids has mostly been abandoned. Although this effect might be involved in the damaging effect, it is definitely not the sole mechanism, nor, indeed, is it even the main one. Skin proteins damage, the interaction with keratins and their denaturation, swelling of cell membranes and collagen fibers, cytotoxicity expressed with cellular lysis are other important mechanisms. One proposed mechanism is that an initial stratum corneum hyper-hydration results from a continuous disruption of the secondary and tertiary structures of keratin protein by surfactants, exposing new water-binding sites, thereby increasing the hydration of the membrane. Following evaporation of excess water, the denatured keratin possesses a decreased water-binding capacity and decreased ability to function as a barrier. Recent studies have also emphasized the effects of detergents on lipid synthesis, on lipid-metabolizing enzymes and on keratinocyte differentiation. Copyright © 2012 Elsevier Inc. All rights reserved.
-
Detection of functional protein domains by unbiased genome-wide forward genetic screening.
Herzog, Mareike; Puddu, Fabio; Coates, Julia; Geisler, Nicola; Forment, Josep V; Jackson, Stephen P
2018-04-18
Establishing genetic and chemo-genetic interactions has played key roles in elucidating mechanisms by which certain chemicals perturb cellular functions. In contrast to gene disruption/depletion strategies to identify mechanisms of drug resistance, searching for point-mutational genetic suppressors that can identify separation- or gain-of-function mutations has been limited. Here, by demonstrating its utility in identifying chemical-genetic suppressors of sensitivity to the DNA topoisomerase I poison camptothecin or the poly(ADP-ribose) polymerase inhibitor olaparib, we detail an approach allowing systematic, large-scale detection of spontaneous or chemically-induced suppressor mutations in yeast or haploid mammalian cells in a short timeframe, and with potential applications in other haploid systems. In addition to applications in molecular biology research, this protocol can be used to identify drug targets and predict drug-resistance mechanisms. Mapping suppressor mutations on the primary or tertiary structures of protein suppressor hits provides insights into functionally relevant protein domains. Importantly, we show that olaparib resistance is linked to missense mutations in the DNA binding regions of PARP1, but not in its catalytic domain. This provides experimental support to the concept of PARP1 trapping on DNA as the prime source of toxicity to PARP inhibitors, and points to a novel olaparib resistance mechanism with potential therapeutic implications.
-
Structural and functional changes in acute liver injury.
Smuckler, E A
1976-01-01
Carbon tetrachloride produces liver cell injury in a variety of animal species. The first structurally recognizable changes occur in the endoplasmic reticulum, with alteration in ribosome-membrane interactions. Later there is an increase in intracellular fat, and the formation of tangled nets of the ergastoplasm. At no time are there changes in mitochondria or single membrane limited bodies in cells with intact plasmalemma, although a relative increase in cell sap may appear. In dead cells (those with plasmalemma discontinuties) crystalline deposits of calcium phosphatase may be noted. Functional changes are related to the endoplasmic reticulum and the plasma membrane. An early decrease in protein synthesis takes place; an accumulation of neutral lipid is related to this change. Later alterations in the ergastoplasmic functions (e.g., mixed function oxidation) occurs. Carbon tetrachloride is not the active agent; rather, a product of its metabolism, probably the CC1, free radical, is. The mechanisms of injury include macromolecular adduction and peroxide propagation. A third possibility includes a cascade effect with the production of secondary and tertiary products, also toxic in nature, with the ability to produce more widespread damage to intracellular structures. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 11. PMID:1001290
-
ERIC Educational Resources Information Center
Majeika, Caitlyn E.; Walder, Jessica P.; Hubbard, Jessica P.; Steeb, Kelly M.; Ferris, Geoffrey J.; Oakes, Wendy P.; Lane, Kathleen Lynne
2011-01-01
A comprehensive, integrated, three-tiered model (CI3T) of prevention is a framework for proactively meeting students' academic, behavioral, and social skills. At the tertiary (Tier 3) level of prevention, functional-assessment based interventions (FABIs) may be used to identify, develop, and implement supports based on the function, or purpose, of…
-
Changing Relations between Learning and Work
ERIC Educational Resources Information Center
Jefferson, Anne L.; Levitan, Barbara
2006-01-01
The change in technology, in communications and in the dynamics of human and institutional interactions has created a need to shift relations between the world of learning and the world of work. New levers need to be added to those currently relied on. Consequently the learning-work relationship that exists between tertiary education institutions…
-
Achieving Digital Literacy through Game Development: An Authentic Learning Experience
ERIC Educational Resources Information Center
Frydenberg, Mark
2015-01-01
Purpose: This paper aims to argue that the process of making an original game develops digital literacy skills and provides an authentic learning experience as students create, publish and deploy interactive games. Teaching students to create computer games has become common in both K-12 and tertiary education to introducing programming concepts,…
-
Advanced IT Education for the Vision Impaired via e-Learning
ERIC Educational Resources Information Center
Armstrong, Helen L.
2009-01-01
Lack of accessibility in the design of e-learning courses continues to hinder students with vision impairment. E-learning materials are predominantly vision-centric, incorporating images, animation, and interactive media, and as a result students with acute vision impairment do not have equal opportunity to gain tertiary qualifications or skills…
-
Molecular crowding overcomes the destabilizing effects of mutations in a bacterial ribozyme
Lee, Hui-Ting; Kilburn, D.; Behrouzi, R.; ...
2014-12-05
The native structure of the Azoarcus group I ribozyme is stabilized by the cooperative formation of tertiary interactions between double helical domains. Thus, even single mutations that break this network of tertiary interactions reduce ribozyme activity in physiological Mg2+ concentrations. Here, we report that molecular crowding comparable to that in the cell compensates for destabilizing mutations in the Azoarcus ribozyme. Small angle X-ray scattering, native polyacrylamide gel electrophoresis and activity assays were used to compare folding free energies in dilute and crowded solutions containing 18% PEG1000. Crowder molecules allowed the wild-type and mutant ribozymes to fold at similarly low Mg2+more » concentrations and stabilized the active structure of the mutant ribozymes under physiological conditions. This compensation helps explains why ribozyme mutations are often less deleterious in the cell than in the test tube. Nevertheless, crowding did not rescue the high fraction of folded but less active structures formed by double and triple mutants. We conclude that crowding broadens the fitness landscape by stabilizing compact RNA structures without improving the specificity of self-assembly.« less
-
Molecular crowding overcomes the destabilizing effects of mutations in a bacterial ribozyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Hui-Ting; Kilburn, D.; Behrouzi, R.
The native structure of the Azoarcus group I ribozyme is stabilized by the cooperative formation of tertiary interactions between double helical domains. Thus, even single mutations that break this network of tertiary interactions reduce ribozyme activity in physiological Mg2+ concentrations. Here, we report that molecular crowding comparable to that in the cell compensates for destabilizing mutations in the Azoarcus ribozyme. Small angle X-ray scattering, native polyacrylamide gel electrophoresis and activity assays were used to compare folding free energies in dilute and crowded solutions containing 18% PEG1000. Crowder molecules allowed the wild-type and mutant ribozymes to fold at similarly low Mg2+more » concentrations and stabilized the active structure of the mutant ribozymes under physiological conditions. This compensation helps explains why ribozyme mutations are often less deleterious in the cell than in the test tube. Nevertheless, crowding did not rescue the high fraction of folded but less active structures formed by double and triple mutants. We conclude that crowding broadens the fitness landscape by stabilizing compact RNA structures without improving the specificity of self-assembly.« less
-
An Amino Acid Code for Irregular and Mixed Protein Packing
Joo, Hyun; Chavan, Archana; Fraga, Keith; Tsai, Jerry
2015-01-01
To advance our understanding of protein tertiary structure, the development of the knob-socket model is completed in an analysis of the packing in irregular coil and turn secondary structure packing as well as between mixed secondary structure. The knob-socket model simplifies packing based on repeated patterns of 2 motifs: a 3 residue socket for packing within 2° structure and a 4 residue knob-socket for 3° packing. For coil and turn secondary structure, knob-sockets allow identification of a correlation between amino acid composition and tertiary arrangements in space. Coil contributes almost as much as α-helices to tertiary packing. Irregular secondary structure involves 3 residue cliques of consecutive contacting residues or XYZ sockets. In irregular sockets, Gly, Pro, Asp and Ser are favored, while Cys, His, Met and Trp are not. For irregular knobs, the preference order is Arg, Asp, Pro, Asn, Thr, Leu, and Gly, while Cys, His, Met and Trp are not. In mixed packing, the knob amino acid preferences are a function of the socket that they are packing into, whereas the amino acid composition of the sockets does not depend on the secondary structure of the knob. A unique motif of a coil knob with an XYZ β-sheet socket may potentially function to inhibit β-sheet extension. In addition, analysis of the preferred crossing angles for strands within a β-sheet and mixed α-helices/β-sheets identifies canonical packing patterns useful in protein design. Lastly, the knob-socket model abstracts the complexity of protein tertiary structure into an intuitive packing surface topology map. PMID:26370334
-
2016-01-01
Background and Aims Functional constipation is very common with heterogeneous symptoms that have substantial impact on patient quality of life as well as medical resources which are rarely reported as life-threatening. The aim of this study is to examine the prevalence and symptoms characteristic of functional constipation (FC) by using Rome III diagnostic criteria among tertiary education students with an intention to introduce treatment in the future. Methods Demographic, socio-economics characteristics and symptoms of FC using the Rome III criteria were sought using a questionnaire administered to Malaysian students in a tertiary education setting. Other data obtained were the general health status, lifestyle factors and anthropometric measurements. Using a simple random sampling method, a total of 1662 students were recruited in the study with a response rate of 95.0%. Sampled data are presented as frequency and percentage and stratified accordingly into categories for Chi-square analysis. Results The prevalence of functional constipation among the students was 16.2%, with a significantly higher prevalence among women (17.4%) than men (12.5%). Hard or lumpy stool, incomplete evacuation, anorectal obstruction and straining were reported as the commonest symptoms experienced. Type 3 was the most frequent stool consistency experienced among the constipated individuals (35.2%). Only 4.4% of individuals reported having less than three defecations per week. Using univariable analysis, FC was significantly associated with sex (odds ratio: 1.48, 95% CI: 1.06–2.06) and age group (odds ratio: 1.34, 95% CI: 1.01–1.79) with P value < 0.05 significance level. In multivariate logistic regression analysis, only sex was found significantly associated with FC (adjusted odds ratio: 1.53, 95% CI: 1.08–2.17, P < 0.05). Conclusions Based on the prevalence rate, constipation is a common problem among tertiary education students (16.2%), with significantly more prevalence among the female respondents. Early detection of symptoms and further intervention studies focusing on treatment recommendation in improving the symptoms are essential. PMID:27997551
-
Studies on functional foods in Japan--state of the art.
Arai, S
1996-01-01
This paper pinpoints the "tertiary" function of foods which, different from the conventional "primary" and "secondary" functions that are related to nutrition and preference, respectively, is understood to be directly involved in the modulation of our physiological systems such as the immune, endocrine, nerve, circulatory, and digestive systems. Insights into this newly defined function are particularly important in that the intake of some physiologically functional constituents of foods could be effective in preventing diseases that may be caused by disorders in these physiological systems. Technologically, it has become feasible to design and produce physiologically functional foods (simply, functional foods) that are expected to satisfy in whole or in part a today's demand for disease prevention by eating. Such public expectations are reflected in the activation and development of systematic, large-scale studies on foods as seen in "Grant-in-Aid" research sponsored by the Ministry of Education, Science, and Culture. Meanwhile, the Ministry of Health and Welfare has initiated a policy of officially approving functional foods in terms of "foods for specified health uses" as defined by new legislation. Up to now (October 1995), 58 items have thus been approved. The first was a hypoallergenic rice product approved as of June 1, 1993. Here I discuss details of studies on rice-based functional foods. Other basic and applied studies directed toward the tertiary function, with future perspectives for functional foods, are also discussed.
-
Measuring case-mix complexity of tertiary care hospitals using DRGs.
Park, Hayoung; Shin, Youngsoo
2004-02-01
The objectives of the study were to develop a model that measures and evaluates case-mix complexity of tertiary care hospitals, and to examine the characteristics of such a model. Physician panels defined three classes of case complexity and assigned disease categories represented by Adjacent Diagnosis Related Groups (ADRGs) to one of three case complexity classes. Three types of scores, indicating proportions of inpatients in each case complexity class standardized by the proportions at the national level, were defined to measure the case-mix complexity of a hospital. Discharge information for about 10% of inpatient episodes at 85 hospitals with bed size larger than 400 and their input structure and research and education activity were used to evaluate the case-mix complexity model. Results show its power to predict hospitals with the expected functions of tertiary care hospitals, i.e. resource intensive care, expensive input structure, and high levels of research and education activities.
-
Anion-π Catalysis on Fullerenes.
López-Andarias, Javier; Frontera, Antonio; Matile, Stefan
2017-09-27
Anion-π interactions on fullerenes are about as poorly explored as the use of fullerenes in catalysis. However, strong exchange-correlation contributions and the localized π holes on their surface promise unique selectivities. To elaborate on this promise, tertiary amines are attached nearby. Dependent on their positioning, the resulting stabilization of anionic transition states on fullerenes is shown to accelerate disfavored enolate addition and exo Diels-Alder reactions enantioselectively. The found selectivities are consistent with computational simulations, particularly concerning the discrimination of differently planarized and charge-delocalized enolate tautomers by anion-π interactions. Enolate-π interactions on fullerenes are much shorter than standard π-π interactions and anion-π interactions on planar surfaces, and alternative cation-π interactions are not observed. These findings open new perspectives with regard to anion-π interactions in general and the use of carbon allotropes in catalysis.
-
Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin*♦
Bensing, Barbara A.; Loukachevitch, Lioudmila V.; McCulloch, Kathryn M.; Yu, Hai; Vann, Kendra R.; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M.; Iverson, T. M.
2016-01-01
Streptococcus sanguinis is a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets. S. sanguinis expresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. PMID:26833566
-
ProteMiner-SSM: a web server for efficient analysis of similar protein tertiary substructures.
Chang, Darby Tien-Hau; Chen, Chien-Yu; Chung, Wen-Chin; Oyang, Yen-Jen; Juan, Hsueh-Fen; Huang, Hsuan-Cheng
2004-07-01
Analysis of protein-ligand interactions is a fundamental issue in drug design. As the detailed and accurate analysis of protein-ligand interactions involves calculation of binding free energy based on thermodynamics and even quantum mechanics, which is highly expensive in terms of computing time, conformational and structural analysis of proteins and ligands has been widely employed as a screening process in computer-aided drug design. In this paper, a web server called ProteMiner-SSM designed for efficient analysis of similar protein tertiary substructures is presented. In one experiment reported in this paper, the web server has been exploited to obtain some clues about a biochemical hypothesis. The main distinction in the software design of the web server is the filtering process incorporated to expedite the analysis. The filtering process extracts the residues located in the caves of the protein tertiary structure for analysis and operates with O(nlogn) time complexity, where n is the number of residues in the protein. In comparison, the alpha-hull algorithm, which is a widely used algorithm in computer graphics for identifying those instances that are on the contour of a three-dimensional object, features O(n2) time complexity. Experimental results show that the filtering process presented in this paper is able to speed up the analysis by a factor ranging from 3.15 to 9.37 times. The ProteMiner-SSM web server can be found at http://proteminer.csie.ntu.edu.tw/. There is a mirror site at http://p4.sbl.bc.sinica.edu.tw/proteminer/.
-
Imprudent Gastro-protective Approach in Majority of Specialists’ Clinics of a Tertiary Hospital
Patel, Hardik Rameshbhai
2016-01-01
Introduction One out of four prescriptions in out-patient departments contains a gastro-protective drug (APUD) - PPI/ H2 Blockers/ Antacids/ Ulcer Protective’s. These drugs should be prescribed only when there is a justified indication. To assess the prescriptions of gastro-protective agents for appropriateness and rationality, in a tertiary care hospital setup. Materials and Methods It was a cross-sectional observational study conducted from Aug 2013 to Dec 2013 at OPDs of a Tertiary Care Teaching Hospital, Pune. A total of 260 prescriptions containing gastro-protective agents were analysed for appropriateness and rationality. Rationality of drug use was assessed by referring to standard textbooks and guidelines. Cost difference data was analysed by Wilcoxon signed rank test using GraphPad Prism 6. Results Most common class of gastro-protective agents was Proton pump inhibitors (PPIs)-73.77% (Pantoprazole & Dexrabeprazole). Only 37.3% prescriptions had an adequate indication for these drugs {GI prophylaxis (29.6%) and Acid Peptic Disease treatment (7.7%)}. Two irrational Fixed dose combinations found in the study were PPI with prokinetic agent (n=65) and Proton Pump Inhibitor + NSAID combination (n=2). Formulation, spelling and strength errors were found with 75 prescribed drugs. Medication instructions were lacking with most of the drugs. Drug interactions with co-prescribed drugs could be anticipated in 79 cases. Injudicious use of anti-peptic ulcer agents significantly increased the cost of prescriptions (p<0.0001). Conclusion Anti-ulcer drugs are overenthusiastically prescribed by all specialties which can predispose to adverse effects, drug interactions, increased cost and even erroneous prescriptions. PMID:27134889
-
Lang, Kathrin; Rieder, Renate; Micura, Ronald
2007-01-01
Riboswitches are genetic control elements within non-coding regions of mRNA. They consist of a metabolite-sensitive aptamer and an adjoining expression platform. Here, we describe ligand-induced folding of a thiamine pyrophosphate (TPP) responsive riboswitch from Escherichia coli thiM mRNA, using chemically labeled variants. Referring to a recent structure determination of the TPP/aptamer complex, each variant was synthesized with a single 2-aminopurine (AP) nucleobase replacement that was selected to monitor formation of tertiary interactions of a particular region during ligand binding in real time by fluorescence experiments. We have determined the rate constants for conformational adjustment of the individual AP sensors. From the 7-fold differentiation of these constants, it can be deduced that tertiary contacts between the two parallel helical domains (P2/J3-2/P3/L3 and P4/P5/L5) that grip the ligand's ends in two separate pockets, form significantly faster than the function-critical three-way junction with stem P1 fully developed. Based on these data, we characterize the process of ligand binding by an induced fit of the RNA and propose a folding model of the TPP riboswitch aptamer. For the full-length riboswitch domain and for shorter constructs that represent transcriptional intermediates, we have additionally evaluated ligand-induced folding via AP-modified variants and provide insights into the sequential folding pathway that involves a finely balanced equilibrium of secondary structures. PMID:17693433
-
Ultra-high frequency piezoelectric aptasensor for the label-free detection of cocaine.
Neves, Miguel A D; Blaszykowski, Christophe; Bokhari, Sumra; Thompson, Michael
2015-10-15
This paper describes a label-free and real-time piezoelectric aptasensor for the detection of cocaine. The acoustic wave sensing platform is a quartz substrate functionalized with an adlayer of S-(11-trichlorosilyl-undecanyl)-benzenethiosulfonate (BTS) cross-linker onto which the anti-cocaine MN4 DNA aptamer is next immobilized. Preparation of the sensor surface was monitored using X-ray photoelectron spectroscopy (XPS), while the binding of cocaine to surface-attached MN4 was evaluated using the electromagnetic piezoelectric acoustic sensor (EMPAS). The MN4 aptamer, unlike other cocaine aptamer variants, has its secondary structure preformed in the unbound state with only tertiary structure changes occurring during target binding. It is postulated that the highly sensitive EMPAS detected the binding of cocaine through target mass loading coupled to aptamer tertiary structure folding. The sensor achieved an apparent Kd of 45 ± 12 µM, and a limit of detection of 0.9 µM. Repeated regenerability of the sensor platform was also demonstrated. This work constitutes the first application of EMPAS technology in the field of aptasensors. Furthermore, it is so far one of the very few examples of a bulk acoustic wave aptasensor that is able to directly detect the binding interaction between an aptamer and a small molecule in a facile one-step protocol without the use of a complex assay or signal amplification step. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Teachers' Code-Switching in Bilingual Classrooms: Exploring Pedagogical and Sociocultural Functions
ERIC Educational Resources Information Center
Cahyani, Hilda; de Courcy, Michele; Barnett, Jenny
2018-01-01
The pedagogical and sociocultural functions of teachers' code-switching are an important factor in achieving the dual goals of content learning and language learning in bilingual programmes. This paper reports on an ethnographic case study investigating how and why teachers switched between languages in tertiary bilingual classrooms in Indonesia,…
-
Simpson, D G; Terracio, L; Terracio, M; Price, R L; Turner, D C; Borg, T K
1994-10-01
Cellular phenotype is the result of a dynamic interaction between a cell's intrinsic genetic program and the morphogenetic signals that serve to modulate the extent to which that program is expressed. In the present study we have examined how morphogenetic information might be stored in the extracellular matrix (ECM) and communicated to the neonatal heart cell (NHC) by the cardiac alpha 1 beta 1 integrin molecule. A thin film of type I collagen (T1C) was prepared with a defined orientation. This was achieved by applying T1C to the peripheral edge of a 100 mm culture dish. The T1C was then drawn across the surface of the dish in a continuous stroke with a sterile cell scraper and allowed to polymerize. When NHCs were cultured on this substrate, they spread, as a population, along a common axis in parallel with the gel lattice and expressed an in vivo-like phenotype. Individual NHCs displayed an elongated, rod-like shape and disclosed parallel arrays of myofibrils. These phenotypic characteristics were maintained for at least 4 weeks in primary culture. The evolution of this tissue-like organizational pattern was dependent upon specific interactions between the NHCs and the collagen-based matrix that were mediated by the cardiac alpha 1 beta 1 integrin complex. This conclusion was supported by a variety of experimental results. Altering the tertiary structure of the matrix or blocking the extracellular domains of either the cardiac alpha 1 or beta 1 integrin chain inhibited the expression of the tissue-like pattern of organization. Neither cell-to-cell contact or contractile function were necessary to induce the formation of the rod-like cell shape. However, beating activity was necessary for the assembly of a well-differentiated myofibrillar apparatus. These data suggest that the cardiac alpha 1 beta 1 integrin complex serves to detect and transduce phenotypic information stored within the tertiary structure of the surrounding matrix.
-
Kobayashi, Yuka; Watanabe, Takeshi
2016-01-01
We previously generated artificial lymph node-like tertiary lymphoid organs (artTLOs) in mice using lymphotoxin α-expressing stromal cells. Here, we show the construction of transplantable and functional artTLOs by applying soluble factors trapped in slow-releasing gels in the absence of lymphoid tissue organizer stromal cells. The resultant artTLOs were easily removable, transplantable, and were capable of attracting memory B and T cells. Importantly, artTLOs induced a powerful antigen-specific secondary immune response, which was particularly pronounced in immune-compromised hosts. Synthesis of functionally stable immune tissues/organs like those described here may be a first step to eventually develop immune system-based therapeutics. Although much needs to be learned from the precise mechanisms of action, they may offer ways in the future to reestablish immune functions to overcome hitherto untreatable diseases, including severe infection, cancer, autoimmune diseases, and various forms of immune deficiencies, including immune-senescence during aging.
-
Protein sectors: evolutionary units of three-dimensional structure
Halabi, Najeeb; Rivoire, Olivier; Leibler, Stanislas; Ranganathan, Rama
2011-01-01
Proteins display a hierarchy of structural features at primary, secondary, tertiary, and higher-order levels, an organization that guides our current understanding of their biological properties and evolutionary origins. Here, we reveal a structural organization distinct from this traditional hierarchy by statistical analysis of correlated evolution between amino acids. Applied to the S1A serine proteases, the analysis indicates a decomposition of the protein into three quasi-independent groups of correlated amino acids that we term “protein sectors”. Each sector is physically connected in the tertiary structure, has a distinct functional role, and constitutes an independent mode of sequence divergence in the protein family. Functionally relevant sectors are evident in other protein families as well, suggesting that they may be general features of proteins. We propose that sectors represent a structural organization of proteins that reflects their evolutionary histories. PMID:19703402
-
Li, Yi; Xu, Ming-Hua
2014-05-16
The first Rh-catalyzed asymmetric tandem cyclization of nitrogen- or oxygen-bridged 5-alkynones with arylboronic acids was achieved. The simple catalytic system involving a rhodium(I) complex with readily available chiral BINAP ligand promotes the reaction to proceed in a highly stereocontrolled manner. This protocol provides a very reliable and practical access to a variety of chiral heterocyclic tertiary allylic alcohols possessing a tetrasubstituted carbon stereocenter and an all-carbon tetrasubstituted olefin functionality in good yields with great enantioselectivities up to 99% ee.
-
ERIC Educational Resources Information Center
Ngotho, Muthoni; Fincham, Robert; Quinn, Nevil
2004-01-01
This paper focuses on the need to further environmental education research within a context in which local government, local business and tertiary institutions are viewed as interlinked components of the development process. Research and interaction with local stakeholders offers an opportunity to chart a path that intersects and then fuses…
-
ERIC Educational Resources Information Center
Dyrberg, Nadia Rahbek; Treusch, Alexander H.; Wiegand, Claudia
2017-01-01
Potential benefits of simulations and virtual laboratory exercises in natural sciences have been both theorised and studied recently. This study reports findings from a pilot study on student attitude, motivation and self-efficacy when using the virtual laboratory programme Labster. The programme allows interactive learning about the workflows and…
-
ERIC Educational Resources Information Center
Wang, Yuping; Chen, Nian-Shing; Levy, Mike
2010-01-01
This article discusses the learning process undertaken by language teachers in a cyber face-to-face teacher training program. Eight tertiary Chinese language teachers attended a 12-week training program conducted in an online synchronous learning environment characterized by multimedia-based, oral and visual interaction. The term "cyber…
-
Smart Board Technology Success in Tertiary Institutions: The Case of the UAE University
ERIC Educational Resources Information Center
Al-Qirim, Nabeel
2016-01-01
This research explores teaching-faculty's adoption and usage of the Interactive White Board Technology (IWBT) in UAE University (UAEU). The research findings suggested two perspectives concerning IWBT usage by teaching-faculty in UAEU. The first theme is concerned with IWBT's basic features where the IWBT proved its superiority when compared to…
-
The Effectiveness of a Web-Based Interactive Multimedia System in Tertiary Education.
ERIC Educational Resources Information Center
Nooriafshar, Mehryar
Many hundreds of hours have gone into the preparation of the multimedia system for the University of Southern Queensland (USQ) unit, Introduction to Management Science. This multimedia system is placed at the heart of a total technology approach to teaching (TTAT) which interlinks various technologies in delivering unit material to both internal…
-
ERIC Educational Resources Information Center
Abeysekera, Indra
2011-01-01
This study examines three instructional methods (traditional, interactive, and group case-based study), and student opinions on their preference for learning financial accounting in large classes at a metropolitan university in Sri Lanka. It analyses the results of a survey questionnaire of students, using quantitative techniques to determine the…
-
Managing CMC-Based Task through Text-Based Dialogue: An Exploratory Study in a Chinese EFL Context
ERIC Educational Resources Information Center
Yu, Lianfen; Zeng, Gang
2011-01-01
This paper examines EFL learners' dialogic interaction in the implementation of a computer-mediated communication (CMC) task. Within the framework of sociocultural theory, the research focuses on how learners working in pairs collaboratively perform task management and build relationship in the synchronous CMC context. Sixteen Chinese tertiary EFL…
-
ERIC Educational Resources Information Center
Loreman, Tim; Earle, Chris; Sharma, Umesh; Forlin, Chris
2007-01-01
This paper describes the development of an improved scale for measuring sentiments, attitudes and concerns about inclusive education in pre-service teachers based on an examination of data gathered from 996 pre-service teachers from five tertiary institutions using a modified version of the Interactions with People with Disabilities scale…
-
ERIC Educational Resources Information Center
Lu, Zhongshe; Liu, Meihua
2015-01-01
The present study explored the interrelations between foreign language (FL) reading anxiety, FL reading strategy use and their interactive effect on FL reading comprehension performance at the tertiary level in China. Analyses of the survey data collected from 1702 university students yielded the following results: (a) Both Foreign Language…
-
Topological Constraints and Their Conformational Entropic Penalties on RNA Folds.
Mak, Chi H; Phan, Ethan N H
2018-05-08
Functional RNAs can fold into intricate structures using a number of different secondary and tertiary structural motifs. Many factors contribute to the overall free energy of the target fold. This study aims at quantifying the entropic costs coming from the loss of conformational freedom when the sugar-phosphate backbone is subjected to constraints imposed by secondary and tertiary contacts. Motivated by insights from topology theory, we design a diagrammatic scheme to represent different types of RNA structures so that constraints associated with a folded structure may be segregated into mutually independent subsets, enabling the total conformational entropy loss to be easily calculated as a sum of independent terms. We used high-throughput Monte Carlo simulations to simulate large ensembles of single-stranded RNA sequences in solution to validate the assumptions behind our diagrammatic scheme, examining the entropic costs for hairpin initiation and formation of many multiway junctions. Our diagrammatic scheme aids in the factorization of secondary/tertiary constraints into distinct topological classes and facilitates the discovery of interrelationships among multiple constraints on RNA folds. This perspective, which to our knowledge is novel, leads to useful insights into the inner workings of some functional RNA sequences, demonstrating how they might operate by transforming their structures among different topological classes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.
-
Popp, Alexander; Scheerer, David; Chi, Heng; Keiderling, Timothy A; Hauser, Karin
2016-05-04
Turn residues and side-chain interactions play an important role for the folding of β-sheets. We investigated the conformational dynamics of a three-stranded β-sheet peptide ((D) P(D) P) and a two-stranded β-hairpin (WVYY-(D) P) by time-resolved temperature-jump (T-jump) infrared spectroscopy. Both peptide sequences contain (D) Pro-Gly residues that favor a tight β-turn. The three-stranded β-sheet (Ac-VFITS(D) PGKTYTEV(D) PGOKILQ-NH2 ) is stabilized by the turn sequences, whereas the β-hairpin (SWTVE(D) PGKYTYK-NH2 ) folding is assisted by both the turn sequence and hydrophobic cross-strand interactions. Relaxation times after the T-jump were monitored as a function of temperature and occur on a sub-microsecond time scale, (D) P(D) P being faster than WVYY-(D) P. The Xxx-(D) Pro tertiary amide provides a detectable IR band, allowing us to probe the dynamics site-specifically. The relative importance of the turn versus the intrastrand stability in β-sheet formation is discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Revealing the distinct folding phases of an RNA three-helix junction.
Plumridge, Alex; Katz, Andrea M; Calvey, George D; Elber, Ron; Kirmizialtin, Serdal; Pollack, Lois
2018-05-14
Remarkable new insight has emerged into the biological role of RNA in cells. RNA folding and dynamics enable many of these newly discovered functions, calling for an understanding of RNA self-assembly and conformational dynamics. Because RNAs pass through multiple structures as they fold, an ensemble perspective is required to visualize the flow through fleetingly populated sets of states. Here, we combine microfluidic mixing technology and small angle X-ray scattering (SAXS) to measure the Mg-induced folding of a small RNA domain, the tP5abc three helix junction. Our measurements are interpreted using ensemble optimization to select atomically detailed structures that recapitulate each experimental curve. Structural ensembles, derived at key stages in both time-resolved studies and equilibrium titrations, reproduce the features of known intermediates, and more importantly, offer a powerful new structural perspective on the time-progression of folding. Distinct collapse phases along the pathway appear to be orchestrated by specific interactions with Mg ions. These key interactions subsequently direct motions of the backbone that position the partners of tertiary contacts for later bonding, and demonstrate a remarkable synergy between Mg and RNA across numerous time-scales.
-
NASA Astrophysics Data System (ADS)
Makarska-Bialokoz, Magdalena
2017-09-01
The binding affinity between vitamin B12 (VitB12) and bovine serum albumin (BSA) has been investigated in aqueous solution at pH = 7.4, employing UV-vis absorption and steady-state, synchronous and three-dimensional fluorescence spectra techniques. Representative effects noted for BSA intrinsic fluorescence resulting from the interactions with VitB12 confirm the formation of π-π stacked non-covalent and non-fluorescent complexes in the system VitB12-BSA. All the determined parameters, the binding, fluorescence quenching and bimolecular quenching rate constants (of the order of 104 L mol- 1, 103 L mol- 1 and 1011 L mol- 1 s- 1, respectively), as well as Förster resonance energy transfer parameters validate the mechanism of static quenching. The interaction with VitB12 induces folding of the polypeptide chains around Trp residues of BSA, resulting in a more hydrophobic surrounding. Presented outcomes suggest that the addition of VitB12 can lead to the more organized BSA conformation and its more folded tertiary structure, what could influence the physiological functions of bovine serum albumin, notably in case of its overuse or abnormal metabolism.
-
Tasiemski, Aurélie; Jung, Sascha; Boidin-Wichlacz, Céline; Jollivet, Didier; Cuvillier-Hot, Virginie; Pradillon, Florence; Vetriani, Costantino; Hecht, Oliver; Sönnichsen, Frank D.; Gelhaus, Christoph; Hung, Chien-Wen; Tholey, Andreas; Leippe, Matthias; Grötzinger, Joachim; Gaill, Françoise
2014-01-01
The emblematic hydrothermal worm Alvinella pompejana is one of the most thermo tolerant animal known on Earth. It relies on a symbiotic association offering a unique opportunity to discover biochemical adaptations that allow animals to thrive in such a hostile habitat. Here, by studying the Pompeii worm, we report on the discovery of the first antibiotic peptide from a deep-sea organism, namely alvinellacin. After purification and peptide sequencing, both the gene and the peptide tertiary structures were elucidated. As epibionts are not cultivated so far and because of lethal decompression effects upon Alvinella sampling, we developed shipboard biological assays to demonstrate that in addition to act in the first line of defense against microbial invasion, alvinellacin shapes and controls the worm's epibiotic microflora. Our results provide insights into the nature of an abyssal antimicrobial peptide (AMP) and into the manner in which an extremophile eukaryote uses it to interact with the particular microbial community of the hydrothermal vent ecosystem. Unlike earlier studies done on hydrothermal vents that all focused on the microbial side of the symbiosis, our work gives a view of this interaction from the host side. PMID:24776651
-
Induced helical backbone conformations of self-organizable dendronized polymers.
Rudick, Jonathan G; Percec, Virgil
2008-12-01
Control of function through the primary structure of a molecule presents a significant challenge with valuable rewards for nanoscience. Dendritic building blocks encoded with information that defines their three-dimensional shape (e.g., flat-tapered or conical) and how they associate with each other are referred to as self-assembling dendrons. Self-organizable dendronized polymers possess a flat-tapered or conical self-assembling dendritic side chain on each repeat unit of a linear polymer backbone. When appended to a covalent polymer, the self-assembling dendrons direct a folding process (i.e., intramolecular self-assembly). Alternatively, intermolecular self-assembly of dendrons mediated by noncovalent interactions between apex groups can generate a supramolecular polymer backbone. Self-organization, as we refer to it, is the spontaneous formation of periodic and quasiperiodic arrays from supramolecular elements. Covalent and supramolecular polymers jacketed with self-assembling dendrons self-organize. The arrays are most often comprised of cylindrical or spherical objects. The shape of the object is determined by the primary structure of the dendronized polymer: the structure of the self-assembling dendron and the length of the polymer backbone. It is therefore possible to predictably generate building blocks for single-molecule nanotechnologies or arrays of supramolecules for bottom-up self-assembly. We exploit the self-organization of polymers jacketed with self-assembling dendrons to elucidate how primary structure determines the adopted conformation and fold (i.e., secondary and tertiary structure), how the supramolecules associate (i.e., quaternary structure), and their resulting functions. A combination of experimental techniques is employed to interrogate the primary, secondary, tertiary, and quaternary structure of the self-organizable dendronized polymers. We refer to the process by which we interpolate between the various levels of structural information to rationalize function as retrostructural analysis. Retrostructural analysis validates our hypothesis that the self-assembling dendrons induce a helical backbone conformation in cylindrical self-organizable dendronized polymers. This helical conformation mediates unprecedented functions. Self-organizable dendronized polymers have emerged as powerful building blocks for nanoscience by virtue of their dimensions and ability to self-organize. Discrete cylindrical and spherical structures with well-defined dimensions can be visualized and manipulated individually. More importantly, they provide a robust framework for elucidating functions available only at the nanoscale. This Account will highlight structures and functions generated from self-organizable dendronized polymers that enable integration of the nanoworld with its macroscopic universe. Emphasis is placed on those structures and functions derived from the induced helical backbone conformation of cylindrical self-organizable dendronized polymers.
-
ERIC Educational Resources Information Center
Oram, Lindsay; Owens, Sarah; Maras, Melissa
2016-01-01
A wealth of research highlights negative outcomes associated with mental and behavioral health problems in children and adolescents. Prevention-based frameworks have been developed to provide prevention and early intervention in the school setting. Tertiary behavioral supports often include the use of functional behavior assessments (FBAs) and…
-
Chan, Lai Gwen; Feinstein, Anthony
2015-01-01
To investigate the effect of sleep disturbances on functional and social outcomes after mild traumatic brain injury. Outpatient traumatic brain injury clinic in a tertiary trauma center. A total of 374 mild traumatic brain injury patients were assessed within 3 months of injury and followed up every 3 months for 1 year. Analysis of a historical cohort in a naturalistic clinical setting. At each visit, symptoms of concussion and psychological distress and indices of functional and social outcomes were measured with the Rivermead Postconcussion Questionnaire, 28-item General Health Questionnaire, and Rivermead Head Injury Follow-up Questionnaire, respectively. Changes in outcome scores over time were explored using repeated measures analysis of variance and compared between subjects with persistent (SD) and recovered (SR) sleep disturbances. Predictors of functional/social outcome were determined using linear regression. The percentages of subjects reporting sleep disturbances at each time point were 71.9%, 57.2%, 55.1%, and 53.7%, respectively. For functional and social outcomes, significant effects of time (F3,315 = 9.54; P < .001), group (SD vs SR) F1,317 = 5.32; P = .022, and time X group interaction F3,315 = 4.14; P = .007 were found. Persistent sleep disturbance (P = 0.011) and higher symptom burden at 6 months postinjury (P < .0001) were independent predictors of poorer outcome. Sleep disturbance, independent of psychological distress, is an important prognostic factor of functional and social outcomes after mild traumatic brain injury.
-
Structural specificity of Rn nuclease I as probed on yeast tRNA(Phe) and tRNA(Asp).
Przykorska, A; el Adlouni, C; Keith, G; Szarkowski, J W; Dirheimer, G
1992-01-01
A single-strand-specific nuclease from rye germ (Rn nuclease I) was characterized as a tool for secondary and tertiary structure investigation of RNAs. To test the procedure, yeast tRNA(Phe) and tRNA(Asp) for which the tertiary structures are known, as well as the 3'-half of tRNA(Asp) were used as substrates. In tRNA(Phe) the nuclease introduced main primary cuts at positions U33 and A35 of the anticodon loop and G18 and G19 of the D loop. No primary cuts were observed within the double stranded stems. In tRNA(Asp) the main cuts occurred at positions U33, G34, U35, C36 of the anticodon loop and G18 and C20:1 positions in the D loop. No cuts were observed in the T loop in intact tRNA(Asp) but strong primary cleavages occurred at positions psi 55, C56, A57 within that loop in the absence of the tertiary interactions between T and D loops (use of 3'-half tRNA(Asp)). These results show that Rn nuclease I is specific for exposed single-stranded regions. Images PMID:1542562
-
Dizer, H; Nasser, A; Lopez, J M
1984-01-01
The adsorption of several enteroviruses and rotavirus SA11 to sand from an aquifer in the Federal Republic of Germany was estimated in sand-filled columns loaded with ca. 10(7) PFU and run at a velocity of 2.5 m/day for 12 h. After either distilled water, groundwater, secondary effluent, or tertiary effluent was percolated, the sand core was slowly extruded out of the column and cut in 1-cm slices. The slices were eluted with nutrient broth, and the amount of viruses in the broth was estimated. The best adsorption was promoted by groundwater and tertiary effluent, followed by distilled water and secondary effluent. Similar experiments, carried out at different percolation rates, indicated that a 50-day underground stay of recharged water probably suffices to eliminate viruses in the groundwater-recharged tertiary effluent. However, when viruses and sand were incubated in the presence of the surfactants sodium dodecyl sulfate, nonyl phenol, dodigen 226, or alkylbenzylsulfonate, the adsorption of the viruses was substantially diminished. Experiments in the presence of nonyl phenol seem to indicate that hydrophobic interactions are involved in the adsorption of viruses to sand. PMID:6324676
-
Neglect Contributing to Tertiary Hospitalization in Childhood Asthma.
ERIC Educational Resources Information Center
Boxer, Gary H.; And Others
1988-01-01
The study examined the extent to which child neglect and family dysfunction have contributed to the need for hospitalization of asthmatic children. Using a measure of global functioning, psychologic morbidity is associated with medical neglect. (Author/DB)
-
Brain Vulnerability to Repeated Blast Overpressure and Polytrauma
2012-05-01
shock tube: distinguishing primary and tertiary blast injury mechanisms in rat TBI - Roles of polyunsaturated fatty acids in traumatic brain injury...vulnerabilities and resilience: evaluation of salutary effects of DHA supplementation using neurolipidomics and functional outcome assessments
-
Kakuchi, Ryohei; Theato, Patrick
2014-03-01
A Mitsunobu reaction of trifluoroacetamide (TFA amide) and alcohols is used in a postpolymerization modification process. The reaction is conducted on polystyrene (PSt) bearing 20 mol% TFA amide groups with 4-methyl benzyl alcohol in the presence of a N,N,N′,N ′-tetramethylazodicarboxamide and tributylphosphine as mediators. The Mitsunobu reaction on polymer proceeds efficiently, as confirmed by the obvious precipitation generation during the reaction and the conversion of TFA amide moiety reached 88.6% confirmed by 19 F NMR measurement, yielding PSt bearing tertiary TFA amide moieties. The obtained polymers featuring tertiary TFA amide moieties are deprotected in the presence of tetrabutylammonium hydroxide as a base to afford corresponding polymers featuring functionalized polyamine scaffolds with 92.5% conversion. In addition, the precise structural assignment is proven by synthesis and analysis of the model monomeric compounds and the respective model polymers.
-
Computer-Aided Design of RNA Origami Structures.
Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S
2017-01-01
RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.
-
Comprehensive comparison of two protein family of P-ATPases (13A1 and 13A3) in insects.
Seddigh, Samin
2017-06-01
The P-type ATPases (P-ATPases) are present in all living cells where they mediate ion transport across membranes on the expense of ATP hydrolysis. Different ions which are transported by these pumps are protons like calcium, sodium, potassium, and heavy metals such as manganese, iron, copper, and zinc. Maintenance of the proper gradients for essential ions across cellular membranes makes P-ATPases crucial for cell survival. In this study, characterization of two families of P-ATPases including P-ATPase 13A1 and P-ATPase 13A3 protein was compared in two different insect species from different orders. According to the conserved motifs found with MEME, nine motifs were shared by insects of 13A1 family but eight in 13A3 family. Seven different insect species from 13A1 and five samples from 13A3 family were selected as the representative samples for functional and structural analyses. The structural and functional analyses were performed with ProtParam, SOPMA, SignalP 4.1, TMHMM 2.0, ProtScale and ProDom tools in the ExPASy database. The tertiary structure of Bombus terrestris as a sample of each family of insects were predicted by the Phyre2 and TM-score servers and their similarities were verified by SuperPose server. The tertiary structures were predicted via the "c3b9bA" model (PDB Accession Code: 3B9B) in P-ATPase 13A1 family and "c2zxeA" model (PDB Accession Code: 2ZXE) in P-ATPase 13A3 family. A phylogenetic tree was constructed with MEGA 6.06 software using the Neighbor-joining method. According to the results, there was a high identity of P-ATPase families so that they should be derived from a common ancestor however they belonged to separate groups. In protein-protein interaction analysis by STRING 10.0, six common enriched pathways of KEGG were identified in B. terrestris in both families. The obtained data provide a background for bioinformatic studies of the function and evolution of other insects and organisms. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Clinical pathway across tertiary and community care after an interventional cardiology procedure.
Doran, K; Sampson, B; Staus, R; Ahern, C; Schiro, D
1997-01-01
Many patients who receive medical interventional cardiology procedures at a tertiary hospital live outside the metropolitan area and may experience fragmentation in care, less emotional support by family members, inaccurate and delayed communication, and lack of educational follow-up on discharge from the hospital. A clinical pathway titled "Heart Health Care Patterns" was developed to link acute phase, recovery phase, rehabilitation phase, and enhancement/maintenance phase. The 12-month clinical pathway combines Gordon's Functional Health Patterns and the Omaha System developed by the Omaha Visiting Nurse Association. The rating scale for outcomes assesses the patient at different phases to provide objective data and information throughout the year.
-
KISSELEVA, NATALIA; KHVOROVA, ANASTASIA; WESTHOF, ERIC; SCHIEMANN, OLAV
2005-01-01
Electron paramagnetic resonance (EPR) spectroscopy is used to study the binding of MnII ions to a tertiary stabilized hammer-head ribozyme (tsHHRz) and to compare it with the binding to the minimal hammerhead ribozyme (mHHRz). Continuous wave EPR measurements show that the tsHHRz possesses a single high-affinity MnII binding site with a KD of ≤10 nM at an NaCl concentration of 0.1 M. This dissociation constant is at least two orders of magnitude smaller than the KD determined previously for the single high-affinity MnII site in the mHHRz. In addition, whereas the high-affinity MnII is displaced from the mHHRz upon binding of the aminoglycoside antibiotic neomycin B, it is not from the tsHHRz. Despite these pronounced differences in binding, a comparison between the electron spin echo envelope modulation and hyperfine sublevel correlation spectra of the minimal and tertiary stabilized HHRz demonstrates that the structure of both binding sites is very similar. This suggests that the MnII is located in both ribozymes between the bases A9 and G10.1 of the sheared G · A tandem base pair, as shown previously and in detail for the mHHRz. Thus, the much stronger MnII binding in the tsHHRz is attributed to the interaction between the two external loops, which locks in the RNA fold, trapping the MnII in the tightly bound conformation, whereas the absence of long-range loop–loop interactions in the mHHRz leads to more dynamical and open conformations, decreasing MnII binding. PMID:15611296
-
Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K
1999-01-01
We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070
-
NASA Astrophysics Data System (ADS)
Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.
2017-03-01
Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.
-
Feinauer, Christoph; Procaccini, Andrea; Zecchina, Riccardo; Weigt, Martin; Pagnani, Andrea
2014-01-01
In the course of evolution, proteins show a remarkable conservation of their three-dimensional structure and their biological function, leading to strong evolutionary constraints on the sequence variability between homologous proteins. Our method aims at extracting such constraints from rapidly accumulating sequence data, and thereby at inferring protein structure and function from sequence information alone. Recently, global statistical inference methods (e.g. direct-coupling analysis, sparse inverse covariance estimation) have achieved a breakthrough towards this aim, and their predictions have been successfully implemented into tertiary and quaternary protein structure prediction methods. However, due to the discrete nature of the underlying variable (amino-acids), exact inference requires exponential time in the protein length, and efficient approximations are needed for practical applicability. Here we propose a very efficient multivariate Gaussian modeling approach as a variant of direct-coupling analysis: the discrete amino-acid variables are replaced by continuous Gaussian random variables. The resulting statistical inference problem is efficiently and exactly solvable. We show that the quality of inference is comparable or superior to the one achieved by mean-field approximations to inference with discrete variables, as done by direct-coupling analysis. This is true for (i) the prediction of residue-residue contacts in proteins, and (ii) the identification of protein-protein interaction partner in bacterial signal transduction. An implementation of our multivariate Gaussian approach is available at the website http://areeweb.polito.it/ricerca/cmp/code. PMID:24663061
-
ERIC Educational Resources Information Center
Ong, Alex
2010-01-01
The use of augmented reality (AR) tools, where virtual objects such as tables and graphs can be displayed and be interacted with in real scenes created from imaging devices, in mainstream school curriculum is uncommon, as they are potentially costly and sometimes bulky. Thus, such learning tools are mainly applied in tertiary institutions, such as…
-
ERIC Educational Resources Information Center
Tuapawa, Kimberley
2017-01-01
Through a phenomenological approach, this research aimed to make an interpretation of key stakeholders' [educational online technology] EOT experiences, to establish their current EOT needs and challenges, and provide a basis from which to recommend methods for effective EOT support. It analysed a range of students' and teachers' EOT experiences,…
-
ERIC Educational Resources Information Center
Tuapawa, Kimberley
2017-01-01
This research made a phenomenological interpretation of key stakeholders' experiences with educational online technologies (EOT), to determine their present EOT needs and challenges and provide a basis from which to propose methods for effective EOT support. It analysed the EOT experiences of 10 students and 10 teachers from New Zealand and…
-
2010-01-01
Background Protein-protein interaction (PPI) plays essential roles in cellular functions. The cost, time and other limitations associated with the current experimental methods have motivated the development of computational methods for predicting PPIs. As protein interactions generally occur via domains instead of the whole molecules, predicting domain-domain interaction (DDI) is an important step toward PPI prediction. Computational methods developed so far have utilized information from various sources at different levels, from primary sequences, to molecular structures, to evolutionary profiles. Results In this paper, we propose a computational method to predict DDI using support vector machines (SVMs), based on domains represented as interaction profile hidden Markov models (ipHMM) where interacting residues in domains are explicitly modeled according to the three dimensional structural information available at the Protein Data Bank (PDB). Features about the domains are extracted first as the Fisher scores derived from the ipHMM and then selected using singular value decomposition (SVD). Domain pairs are represented by concatenating their selected feature vectors, and classified by a support vector machine trained on these feature vectors. The method is tested by leave-one-out cross validation experiments with a set of interacting protein pairs adopted from the 3DID database. The prediction accuracy has shown significant improvement as compared to InterPreTS (Interaction Prediction through Tertiary Structure), an existing method for PPI prediction that also uses the sequences and complexes of known 3D structure. Conclusions We show that domain-domain interaction prediction can be significantly enhanced by exploiting information inherent in the domain profiles via feature selection based on Fisher scores, singular value decomposition and supervised learning based on support vector machines. Datasets and source code are freely available on the web at http://liao.cis.udel.edu/pub/svdsvm. Implemented in Matlab and supported on Linux and MS Windows. PMID:21034480
-
Nitrosamine formation in amine scrubbing at desorber temperatures.
Fine, Nathan A; Goldman, Mark J; Rochelle, Gary T
2014-01-01
Amine scrubbing is a thermodynamically efficient and industrially proven method for carbon capture, but amine solvents can nitrosate in the desorber, forming potentially carcinogenic nitrosamines. The kinetics of reactions involving nitrite and monoethanolamine (MEA), diethanolamine (DEA), methylethanolamine (MMEA), and methyldiethanolamine (MDEA) were determined under desorber conditions. The nitrosations of MEA, DEA, and MMEA are first order in nitrite, carbamate species, and hydronium ion. Nitrosation of MDEA, a tertiary amine, is not catalyzed by the addition of CO2 since it cannot form a stable carbamate. Concentrated and CO2 loaded MEA was blended with low concentrations of N-(2-hydroxyethyl) glycine (HeGly), hydroxyethyl-ethylenediamine (HEEDA), and DEA, secondary amines common in MEA degradation. Nitrosamine yield was proportional to the concentration of secondary amine and was a function of CO2 loading and temperature. Blends of tertiary amines with piperazine (PZ) showed n-nitrosopiperazine (MNPZ) yields close to unity, validating the slow nitrosation rates hypothesized for tertiary amines. These results provide a useful tool for estimating nitrosamine accumulation over a range of amine solvents.
-
An investigation of extensional tectonics of southern California
NASA Technical Reports Server (NTRS)
Richard, Steven M.; Crowell, John C.
1992-01-01
Geologic mapping and interpretation of Landsat TM imagery has filled in a significant gap in the geologic database for southwestern Arizona and southeastern California. The new data acquired, along with interpretation of existing data, forms the basis for a proposed reconstruction of late Tertiary faults in these regions. This reconstruction integrates available geological and geophysical data to define the eastern limit of deformation related to the San Andreas fault, and has significant implications for other recently proposed reconstructions of Tertiary deformation in the region. This progress in interpreting deformation during the last 10 Ma in the region forms a foundation for developing and testing models of older deformation in this region, including the initiation of San Andreas fault system, and the interaction of Early Miocene extension in the Basin and Range with the evolving San Andreas system.
-
ERIC Educational Resources Information Center
Rundgren, Carl-Johan; Hirsch, Richard; Chang Rundgren, Shu-Nu; Tibell, Lena A. E.
2012-01-01
This study examines how students explain their conceptual understanding of protein function using visualizations. Thirteen upper secondary students, four tertiary students (studying chemical biology), and two experts were interviewed in semi-structured interviews. The interviews were structured around 2D illustrations of proteins and an animated…
-
ERIC Educational Resources Information Center
Schärer, Rolf
2012-01-01
The European Language Portfolio (ELP) is based on principles which tend to challenge traditional learning and teaching practices and thus impact on education policy and systems. The primary owner of the ELP is the learner, and as a personal language learning companion, the ELP has three core functions: pedagogic, reporting and catalytic. For it to…
-
ERIC Educational Resources Information Center
Emilia, Emi; Hamied, Fuad Abdul
2015-01-01
This article reports on the results of a study aiming to investigate whether systemic functional linguistic genre pedagogy (SFL GP) can help students develop their writing ability in English and the students' opinions about the teaching program using SFL GP. The study was conducted in one semester with 19 student teachers taking a writing course…
-
ERIC Educational Resources Information Center
Suess, Alyssa N.; Romani, Patrick W.; Wacker, David P.; Dyson, Shannon M.; Kuhle, Jennifer L.; Lee, John F.; Lindgren, Scott D.; Kopelman, Todd G.; Pelzel, Kelly E.; Waldron, Debra B.
2014-01-01
We conducted a retrospective, descriptive evaluation of the fidelity with which parents of three children with autism spectrum disorders conducted functional communication training (FCT) in their homes. All training was provided to the parents via telehealth by a behavior consultant in a tertiary-level hospital setting. FCT trials coached by the…
-
Yuan, S J; Xu, F J; Pehkonen, S O; Ting, Y P; Neoh, K G; Kang, E T
2009-06-01
To enhance the biocorrosion resistance of stainless steel (SS) and to impart its surface with bactericidal function for inhibiting bacterial adhesion and biofilm formation, well-defined functional polymer brushes were grafted via surface-initiated atom transfer radical polymerization (ATRP) from SS substrates. The trichlorosilane coupling agent, containing the alkyl halide ATRP initiator, was first immobilized on the hydroxylated SS (SS-OH) substrates for surface-initiated ATRP of (2-dimethylamino)ethyl methacrylate (DMAEMA). The tertiary amino groups of covalently immobilized DMAEMA polymer or P(DMAEMA), brushes on the SS substrates were quaternized with benzyl halide to produce the biocidal functionality. Alternatively, covalent coupling of viologen moieties to the tertiary amino groups of P(DMAEMA) brushes on the SS surface resulted in an increase in surface concentration of quaternary ammonium groups, accompanied by substantially enhanced antibacterial and anticorrosion capabilities against Desulfovibrio desulfuricans in anaerobic seawater, as revealed by antibacterial assay and electrochemical studies. With the inherent advantages of high corrosion resistance of SS, and the good antibacterial and anticorrosion capabilities of the viologen-quaternized P(DMAEMA) brushes, the functionalized SS is potentially useful in harsh seawater environments and for desalination plants. Copyright 2009 Wiley Periodicals, Inc.
-
Antipas, Georgios S E; Germenis, Anastasios E
2015-06-01
The quantum state of functional avidity of the synapse formed between a peptide-Major Histocompatibility Complex (pMHC) and a T cell receptor (TCR) is a subject not previously touched upon. Here we present atomic pair correlation meta-data based on crystalized tertiary structures of the Tax (HTLV-1) peptide along with three artificially altered variants, all of which were presented by the (Class I) HLA-A201 protein in complexation with the human (CD8(+)) A6TCR. The meta-data reveal the existence of a direct relationship between pMHC-TCR functional avidity (agonist/antagonist) and peptide pair distribution function (PDF). In this context, antagonist peptides are consistently under-coordinated in respect to Tax. Moreover, Density Functional Theory (DFT) datasets in the BLYP/TZ2P level of theory resulting from relaxation of the H species on peptide tertiary structures reveal that the coordination requirement of agonist peptides is also expressed as a physical observable of the protonation state of their N termini: agonistic peptides are always found to retain a stable ammonium (NH3 (+)) terminal group while antagonist peptides are not.
-
Basile, Maria Assunta; d'Ayala, Giovanna Gomez; Laurienzo, Paola; Malinconico, Mario; Della Ragione, Fulvio; Oliva, Adriana
2012-01-01
In the framework of a project aiming to improve the properties of poly(ε-caprolactone) (PCL)-based devices, we prepared novel composites and tested their in vitro biocompatibility and osteogenic capacity on human mesenchymal stromal cells (MSC) from bone marrow. We prepared two functionalized derivatives, PCL-g-MAGMA and PCL-g-DMAEA, by insertion of anhydride groups by radical grafting of maleic anhydride (MA) and glycidyl-methacrylate (GMA) molecules, and by insertion of N-(dimethylamino)ethylacrylate (DMAEA) of tertiary amines groups, respectively. In addition, in order to improve the osteoconductive properties of the materials, we also prepared the corresponding composites containing the mineral component of bone, namely hydroxyapatite (HA). Mesenchymal stromal cells (MSC) derived from bone marrow were prepared, plated onto a number of discs obtained from these functionalized derivatives and tested in terms of adhesion and vitality (by MTT test and SEM observation), and the expression of alkaline phosphatase, the early marker of osteoblastic phenotype. The biological in vitro assessment of the functionalized materials, PCL-g-MAGMA and PCL-g-DMAEA, appeared promising only in part, in particular the cells exhibited very poor adhesion to PCL-g-MAGMA. On the contrary, the related composites, PCL-g-MAGMA-HA and PCL-g-DMAEA-HA clearly showed that the addition of HA greatly ameliorated the cell-material interaction. In particular, a surprisingly increased response characterized PCL-g-MAGMA-HA, either in terms of adhesion and vitality or in terms of alkaline phosphatase activity. Altogether these studies showed that the addition of HA nanowhiskers resulted for all basic materials, in particular PCL-g-MAGMA, in improved cell adhesion and performance.
-
PROPERTIES OF THE CLOSE-IN TERTIARY IN THE QUADRUPLE SYSTEM V401 CYG
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, L.-Y.; Qian, S.-B.; Zhou, X.
2013-08-01
V401 Cyg is a quadruple system in which the spectroscopic signature of a close-in tertiary and a distant visual companion star were reported. Orbital properties of the close-in companion should provide valuable information on the formation of close binaries and stellar dynamical interaction. By analyzing new times of minimum light together with those collected from the literature, we discovered that the observed-calculated (O - C) curve of V401 Cyg shows a cyclic change with a short period of 3.5 yr and a semi-amplitude of 0.00436 days while it undergoes an upward parabolic variation. Those photoelectric and CCD data covered moremore » than two cycles and were analyzed for the light-travel time effect via the presence of the tertiary companion. The mass of the third body was determined to be M{sub 3}sin i' = 0.65({+-} 0.08) M{sub Sun }, which is close to the value estimated from the spectroscopic data (M{sub 3} {approx} 0.64 M{sub Sun }). This reveals that the orbital inclination of the tertiary was about i' {approx} 90 Degree-Sign , indicating that the contact components of V401 Cyg have the possibility of being eclipsed by the tertiary at an orbital distance of about 3.0 AU, and it may be a triply eclipsing hierarchical triple system. The upward parabolic change indicates a period increase at a rate of (P-dot{sub 2} = 1.5 x 10{sup -7} revealing a mass transfer from the secondary to the primary (M-dot{sub 2} = 5.9 x 10{sup -8} M{sub Sun} yr{sup -1}). This is consistent with the predictions of the theory of thermal relaxation oscillation (TRO) suggesting that V401 Cyg is undergoing an expanding-orbit stage in the TRO cycles.« less
-
Early Tertiary Anaconda metamorphic core complex, southwestern Montana
O'Neill, J. M.; Lonn, J.D.; Lageson, D.R.; Kunk, Michael J.
2004-01-01
A sinuous zone of gently southeast-dipping low-angle Tertiary normal faults is exposed for 100 km along the eastern margins of the Anaconda and Flint Creek ranges in southwest Montana. Faults in the zone variously place Mesoproterozoic through Paleozoic sedimentary rocks on younger Tertiary granitic rocks or on sedimentary rocks older than the overlying detached rocks. Lower plate rocks are lineated and mylonitic at the main fault and, below the mylonitic front, are cut by mylonitic mesoscopic to microscopic shear zones. The upper plate consists of an imbricate stack of younger-on-older sedimentary rocks that are locally mylonitic at the main, lowermost detachment fault but are characteristically strongly brecciated or broken. Kinematic indicators in the lineated mylonite indicate tectonic transport to the east-southeast. Syntectonic sedimentary breccia and coarse conglomerate derived solely from upper plate rocks were deposited locally on top of hanging-wall rocks in low-lying areas between fault blocks and breccia zones. Muscovite occurs locally as mica fish in mylonitic quartzites at or near the main detachment. The 40Ar/39Ar age spectrum obtained from muscovite in one mylonitic quartzite yielded an age of 47.2 + 0.14 Ma, interpreted to be the age of mylonitization. The fault zone is interpreted as a detachment fault that bounds a metamorphic core complex, here termed the Anaconda metamorphic core complex, similar in age and character to the Bitterroot mylonite that bounds the Bitterroot metamorphic core complex along the Idaho-Montana state line 100 km to the west. The Bitterroot and Anaconda core complexes are likely components of a continuous, tectonically integrated system. Recognition of this core complex expands the region of known early Tertiary brittle-ductile crustal extension eastward into areas of profound Late Cretaceous contractile deformation characterized by complex structural interactions between the overthrust belt and Laramide basement uplifts, overprinted by late Tertiary Basin and Range faulting. ?? 2004 NRC Canada.
-
Turning limited experimental information into 3D models of RNA.
Flores, Samuel Coulbourn; Altman, Russ B
2010-09-01
Our understanding of RNA functions in the cell is evolving rapidly. As for proteins, the detailed three-dimensional (3D) structure of RNA is often key to understanding its function. Although crystallography and nuclear magnetic resonance (NMR) can determine the atomic coordinates of some RNA structures, many 3D structures present technical challenges that make these methods difficult to apply. The great flexibility of RNA, its charged backbone, dearth of specific surface features, and propensity for kinetic traps all conspire with its long folding time, to challenge in silico methods for physics-based folding. On the other hand, base-pairing interactions (either in runs to form helices or isolated tertiary contacts) and motifs are often available from relatively low-cost experiments or informatics analyses. We present RNABuilder, a novel code that uses internal coordinate mechanics to satisfy user-specified base pairing and steric forces under chemical constraints. The code recapitulates the topology and characteristic L-shape of tRNA and obtains an accurate noncrystallographic structure of the Tetrahymena ribozyme P4/P6 domain. The algorithm scales nearly linearly with molecule size, opening the door to the modeling of significantly larger structures.
-
Valencia, Marta; Pereira, Ana; Müller-Bunz, Helge; Belderraín, Tomás R; Pérez, Pedro J; Albrecht, Martin
2017-07-03
Two iridium(III) complexes containing a C,N-bidentate pyridyl-triazolylidene ligand were prepared that are structurally very similar but differ in their pendant substituent. Whereas complex 1 contains a non-coordinating pyridyl unit, complex 2 has a phenyl group on the triazolylidene substituent. The presence of the basic pyridyl unit has distinct effects on the catalytic activity of the complex in the oxidative dehydrogenation of benzylic amines, inducing generally higher rates, higher selectivity towards formation of imines versus secondary amines, and notable quantities of tertiary amines when compared to the phenyl-functionalized analogue. The role of the pyridyl functionality has been elucidated from a set of stoichiometric experiments, which demonstrate hydrogen bonding between the pendant pyridyl unit and the amine protons of the substrate. Such N pyr ⋅⋅⋅H-N interactions are demonstrated by X-ray diffraction analysis, 1 H NMR, and IR spectroscopy, and suggest a pathway of substrate bond-activation that involves concerted substrate binding through the Lewis acidic iridium center and the Lewis basic pyridyl site appended to the triazolylidene ligand, in agreement with ligand-metal cooperative substrate activation. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Venkataraman, Shrinivas; Tan, Jeremy P K; Ng, Victor W L; Tan, Eddy W P; Hedrick, James L; Yang, Yi Yan
2017-01-09
Introduction of hydrophilic components, particularly amines and zwitterions, onto a degradable polymer platform, while maintaining precise control over the polymer composition, has been a challenge. Recognizing the importance of these hydrophilic residues in multiple aspects of the nanobiomedicine field, herein, a straightforward synthetic route to access well-defined amphiphilic and hydrophilic degradable block copolymers from diethanolamine-derived functional eight-membered N-substituted aliphatic cyclic carbonates is reported. By this route, tertiary amine, secondary amine, and zwitterion residues can be incorporated across the polymer backbone. Demonstration of pH-responsiveness of these hydrophilic residues and their utility in the development of drug-delivery vehicles, catered for the specific requirements of respective model drugs (doxorubicin and diclofenac sodium salt) are shown. As hydrophilic components in degradable polymers play crucial roles in the biological interactions, these materials offers opportunities to expand the scope and applicability of aliphatic cyclic carbonates. Our approach to these functional polycarbonates will expand the range of biocompatible and biodegradable synthetic materials available for nanobiomedicine, including drug and gene delivery, antimicrobials, and hydrophilic polymers as poly(ethylene glycol) (PEG) alternatives.
-
Towards Long-Range RNA Structure Prediction in Eukaryotic Genes.
Pervouchine, Dmitri D
2018-06-15
The ability to form an intramolecular structure plays a fundamental role in eukaryotic RNA biogenesis. Proximate regions in the primary transcripts fold into a local secondary structure, which is then hierarchically assembled into a tertiary structure that is stabilized by RNA-binding proteins and long-range intramolecular base pairings. While the local RNA structure can be predicted reasonably well for short sequences, long-range structure at the scale of eukaryotic genes remains problematic from the computational standpoint. The aim of this review is to list functional examples of long-range RNA structures, to summarize current comparative methods of structure prediction, and to highlight their advances and limitations in the context of long-range RNA structures. Most comparative methods implement the “first-align-then-fold” principle, i.e., they operate on multiple sequence alignments, while functional RNA structures often reside in non-conserved parts of the primary transcripts. The opposite “first-fold-then-align” approach is currently explored to a much lesser extent. Developing novel methods in both directions will improve the performance of comparative RNA structure analysis and help discover novel long-range structures, their higher-order organization, and RNA⁻RNA interactions across the transcriptome.
-
ERIC Educational Resources Information Center
Ementa, Christiana Ngozi; Ile, Chika Madu
2015-01-01
There are diverse social networking sites which range from those that provide social sharing and interaction to those that provide networks for professionals within same and other fields. Social networking sites require a user to sign up, create a profile and begin sending short messages about what the user is doing or thinking. The study sought…
-
ERIC Educational Resources Information Center
Barrett, John, Ed.; Hedberg, John, Ed.
The 63 papers in this collection include two keynote addresses: "Patient Simulation Using Interactive Video: An Application" (Joseph V. Henderson), and "Intelligent Tutoring Systems: Practice Opportunities and Explanatory Models" (Alan Lesgold). The remaining papers are grouped under five topics: (1) Artificial Intelligence,…
-
Rouse, J J; Whateley, T L; Thomas, M; Eccleston, G M
2007-02-07
This work reports investigations into the interaction and adsorption of the hydrophilic polymer hyaluronic acid (HA) onto the surface of the hydrophobic corticosteroid drug fluticasone propionate (FP). The eventual aim is to formulate a bioadhesive pulmonary drug delivery system with prolonged action that avoids rapid clearance from the lungs by the mucociliary escalator. Adsorption isotherms detailing the adsorption of HA from aqueous HA solution concentrations ranging from 0.14 to 0.0008% (w/v) to a fixed FP particle concentration of 0.1% (w/v) were investigated. The method of preparing FP particles with HA molecules adsorbed on their surfaces (FP/HA particles) involved suspension of the FP either in hydrated HA solution or in water followed by addition of solid HA, centrifugation of the solids to form a pellet, washing the pellet several times with water until no HA was found in the supernatant and then freeze drying the suspension obtained by dispersing the final pellet. The freeze dried powder was then analysed for adsorbed HA using a Stains-all assay. The influence of order of addition of HA to FP, time for the adsorption process, and temperature of preparation on the adsorption isotherms was investigated. The non-equilibrium adsorption isotherms produced generally followed the same trend, in that as the HA solution concentration increased, the amount of HA adsorbed increased to a maximum at a solution concentration of approximately 0.1% (w/v) and then decreased. The maxima in the adsorption isotherms were close to the change from secondary to tertiary conformation in the HA solutions. Below the maxima, adsorption occurred via interaction of FP with the hydrophobic patches along the HA chains in the secondary structures. Above the maxima, secondary HA molecules aggregate in solution to form tertiary network structures. Adsorption from tertiary structure was reduced because strong interactions between the HA molecules limited the availability of hydrophobic patches for adsorption of HA onto FP. The influence of preparation variables on adsorption was also related to the availability of hydrophobic patches for adsorption.
-
Simulation of Different Truncated p16INK4a Forms and In Silico Study of Interaction with Cdk4
Fahham, Najmeh; Ghahremani, Mohammad Hossein; Sardari, Soroush; Vaziri, Behrouz; Ostad, Seyed Nasser
2008-01-01
Protein-protein interactions studies can greatly increase the amount of structural and functional information pertaining to biologically active molecules and processes. The information obtained from such studies can lead to design and application of new modification in order to obtain a desired bioactivity. Many application packages and servers performing docking, such as HEX, DOT, AUTODOCK, and ZDOCK are now available for predicting the lowest free energy state of a protein complex. In this study, we have focused on cyclin-dependent kinase 4 (Cdk4), a key molecule in the regulation of cell cycle progression at the G1-S phase restriction point and p16INK4a, a tumor suppressor which inhibits Cdk4 activity. Truncated structures were created to find the more critical regions of p16 for interaction. The tertiary structures were determined by ProSAL, GENO3D Web Server. We evaluated their interactions with Cdk4 using two docking systems, HEX 4.5 and DOT 1. Calculations were performed on a high-speed computer. Minimizations and visualizations were carried out by PdbViewer 3.7. Considering shape and shape/electrostatic total energy, structures containing ANK II, III and IV motifs that lack the N-terminal region of the full length p16 molecule showed the best fit complexes among the p16 truncated forms. The free energies were compatible with that of p16 full length original form, the full length. It seems that the N-terminal of the molecule is not crucial for the interaction since the truncated structure containing only this region did not show a good total energy. PMID:19352455
-
Ganguly, Debabani; Chen, Jianhan
2011-04-01
Coupled binding and folding is frequently involved in specific recognition of so-called intrinsically disordered proteins (IDPs), a newly recognized class of proteins that rely on a lack of stable tertiary fold for function. Here, we exploit topology-based Gō-like modeling as an effective tool for the mechanism of IDP recognition within the theoretical framework of minimally frustrated energy landscape. Importantly, substantial differences exist between IDPs and globular proteins in both amino acid sequence and binding interface characteristics. We demonstrate that established Gō-like models designed for folded proteins tend to over-estimate the level of residual structures in unbound IDPs, whereas under-estimating the strength of intermolecular interactions. Such systematic biases have important consequences in the predicted mechanism of interaction. A strategy is proposed to recalibrate topology-derived models to balance intrinsic folding propensities and intermolecular interactions, based on experimental knowledge of the overall residual structure level and binding affinity. Applied to pKID/KIX, the calibrated Gō-like model predicts a dominant multistep sequential pathway for binding-induced folding of pKID that is initiated by KIX binding via the C-terminus in disordered conformations, followed by binding and folding of the rest of C-terminal helix and finally the N-terminal helix. This novel mechanism is consistent with key observations derived from a recent NMR titration and relaxation dispersion study and provides a molecular-level interpretation of kinetic rates derived from dispersion curve analysis. These case studies provide important insight into the applicability and potential pitfalls of topology-based modeling for studying IDP folding and interaction in general. Copyright © 2011 Wiley-Liss, Inc.
-
Song, Yang; Zemlyanov, Dmitry; Chen, Xin; Nie, Haichen; Su, Ziyang; Fang, Ke; Yang, Xinghao; Smith, Daniel; Byrn, Stephen; Lubach, Joseph W
2016-02-01
This study investigates the potential drug-excipient interactions of polystyrene sulfonic acid (PSSA) and two weakly basic anticancer drugs, lapatinib (LB) and gefitinib (GB), in amorphous solid dispersions. Based on the strong acidity of the sulfonic acid functional group, PSSA was hypothesized to exhibit specific intermolecular acid-base interactions with both model basic drugs. Ultraviolet (UV) spectroscopy identified red shifts, which correlated well with the color change observed in lapatinib-PSSA solutions. Fourier transform infrared (FTIR) spectra suggest the protonation of the quinazoline nitrogen atom in both model compounds, which agrees well with data from the crystalline ditosylate salt of lapatinib. X-ray photoelectron spectroscopy (XPS) detected increases in binding energy of the basic nitrogen atoms in both lapatinib and gefitinib, strongly indicating protonation of these nitrogen atoms. (15)N solid-state NMR spectroscopy provided direct spectroscopic evidence for protonation of the quinazoline nitrogen atoms in both LB and GB, as well as the secondary amine nitrogen atom in LB and the tertiary amine nitrogen atom in GB. The observed chemical shifts in the LB-PSSA (15)N spectrum also agree very well with the lapatinib ditosylate salt where proton transfer is known. Additionally, the dissolution and physical stability behaviors of both amorphous solid dispersions were examined. PSSA was found to significantly improve the dissolution of LB and GB and effectively inhibit the crystallization of LB and GB under accelerated storage conditions due to the beneficial strong intermolecular acid-base interaction between the sulfonic acid groups and basic nitrogen centers.
-
Electrostatics, structure prediction, and the energy landscapes for protein folding and binding.
Tsai, Min-Yeh; Zheng, Weihua; Balamurugan, D; Schafer, Nicholas P; Kim, Bobby L; Cheung, Margaret S; Wolynes, Peter G
2016-01-01
While being long in range and therefore weakly specific, electrostatic interactions are able to modulate the stability and folding landscapes of some proteins. The relevance of electrostatic forces for steering the docking of proteins to each other is widely acknowledged, however, the role of electrostatics in establishing specifically funneled landscapes and their relevance for protein structure prediction are still not clear. By introducing Debye-Hückel potentials that mimic long-range electrostatic forces into the Associative memory, Water mediated, Structure, and Energy Model (AWSEM), a transferable protein model capable of predicting tertiary structures, we assess the effects of electrostatics on the landscapes of thirteen monomeric proteins and four dimers. For the monomers, we find that adding electrostatic interactions does not improve structure prediction. Simulations of ribosomal protein S6 show, however, that folding stability depends monotonically on electrostatic strength. The trend in predicted melting temperatures of the S6 variants agrees with experimental observations. Electrostatic effects can play a range of roles in binding. The binding of the protein complex KIX-pKID is largely assisted by electrostatic interactions, which provide direct charge-charge stabilization of the native state and contribute to the funneling of the binding landscape. In contrast, for several other proteins, including the DNA-binding protein FIS, electrostatics causes frustration in the DNA-binding region, which favors its binding with DNA but not with its protein partner. This study highlights the importance of long-range electrostatics in functional responses to problems where proteins interact with their charged partners, such as DNA, RNA, as well as membranes. © 2015 The Protein Society.
-
'Tertiary' nuclear burning - Neutron star deflagration?
NASA Technical Reports Server (NTRS)
Michel, F. Curtis
1988-01-01
A motivation is presented for the idea that dense nuclear matter can burn to a new class of stable particles. One of several possibilities is an 'octet' particle which is the 16 baryon extension of alpha particle, but now composed of a pair of each of the two nucleons, (3Sigma, Delta, and 2Xi). Such 'tertiary' nuclear burning (here 'primary' is H-He and 'secondary' is He-Fe) may lead to neutron star explosions rather than collapse to a black hole, analogous to some Type I supernovae models wherein accreting white dwarfs are pushed over the Chandrasekhar mass limit but explode rather than collapse to form neutron stars. Such explosions could possibly give gamma-ray bursts and power quasars, with efficient particle acceleration in the resultant relativistic shocks. The new stable particles themselves could possibly be the sought-after weakly interacting, massive particles (WIMPs) or 'dark' matter.
-
Transmembrane Segments Form Tertiary Hairpins in the Folding Vestibule of the Ribosome.
Tu, LiWei; Khanna, Pooja; Deutsch, Carol
2013-01-01
Folding of membrane proteins begins in the ribosome as the peptide is elongated. During this process, the nascent peptide navigates along 100 Å of tunnel from the peptidyltransferase center to the exit port. Proximal to the exit port is a ‘folding vestibule’ that permits the nascent peptide to compact and explore conformational space for potential tertiary folding partners. The latter occurs for cytosolic subdomains, but has not yet been shown for transmembrane segments. We now demonstrate, using an accessibility assay and an improved, intramolecular crosslinking assay, that the helical transmembrane S3b-S4 hairpin (‘paddle’) of a voltage-gated potassium (Kv) channel, a critical region of the Kv voltage sensor, forms in the vestibule. S3-S4 hairpin interactions are detected at an early stage of Kv biogenesis. Moreover, this vestibule hairpin is consistent with a closed-state conformation of the Kv channel in the plasma membrane. PMID:24055377
-
Paramagnetic NMR Investigation of Dendrimer-Based Host-Guest Interactions
Wang, Fei; Shao, Naimin; Cheng, Yiyun
2013-01-01
In this study, the host-guest behavior of poly(amidoamine) (PAMAM) dendrimers bearing amine, hydroxyl, or carboxylate surface functionalities were investigated by paramagnetic NMR studies. 2,2,6,6-Tetramethylpiperidinyloxy (TEMPO) derivatives were used as paramagnetic guest molecules. The results showed that TEMPO-COOH significantly broaden the 1H NMR peaks of amine- and hydroxyl-terminated PAMAM dendrimers. In comparison, no paramagnetic relaxation enhancement (PRE) was observed between TEMPO-NH2, TEMPO-OH and the three types of PAMAM dendrimers. The PRE phenomenon observed is correlated with the encapsulation of TEMPO-COOH within dendrimer pockets. Protonation of the tertiary amine groups within PAMAM dendrimers plays an important role during this process. Interestingly, the absence of TEMPO-COOH encapsulation within carboxylate-terminated PAMAM dendrimer is observed due to the repulsion of TEMPO-COO- anion and anionic dendrimer surface. The combination of paramagnetic probes and 1H NMR linewidth analysis can be used as a powerful tool in the analysis of dendrimer-based host-guest systems. PMID:23762249
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lubman, Olga Y.; Kopan, Raphael; Waksman, Gabriel
Folding and stability of proteins containing ankyrin repeats (ARs) is of great interest because they mediate numerous protein-protein interactions involved in a wide range of regulatory cellular processes. Notch, an ankyrin domain containing protein, signals by converting a transcriptional repression complex into an activation complex. The Notch ANK domain is essential for Notch function and contains seven ARs. Here, we present the 2.2 {angstrom} crystal structure of ARs 4-7 from mouse Notch 1 (m1ANK). These C-terminal repeats were resistant to degradation during crystallization, and their secondary and tertiary structures are maintained in the absence of repeats 1-3. The crystallized fragmentmore » adopts a typical ankyrin fold including the poorly conserved seventh AR, as seen in the Drosophila Notch ANK domain (dANK). The structural preservation and stability of the C-terminal repeats shed a new light onto the mechanism of hetero-oligomeric assembly during Notch-mediated transcriptional activation.« less
-
Quantitative theory of hydrophobic effect as a driving force of protein structure
Perunov, Nikolay; England, Jeremy L
2014-01-01
Various studies suggest that the hydrophobic effect plays a major role in driving the folding of proteins. In the past, however, it has been challenging to translate this understanding into a predictive, quantitative theory of how the full pattern of sequence hydrophobicity in a protein shapes functionally important features of its tertiary structure. Here, we extend and apply such a phenomenological theory of the sequence-structure relationship in globular protein domains, which had previously been applied to the study of allosteric motion. In an effort to optimize parameters for the model, we first analyze the patterns of backbone burial found in single-domain crystal structures, and discover that classic hydrophobicity scales derived from bulk physicochemical properties of amino acids are already nearly optimal for prediction of burial using the model. Subsequently, we apply the model to studying structural fluctuations in proteins and establish a means of identifying ligand-binding and protein–protein interaction sites using this approach. PMID:24408023
-
Crystal structures of the components of the Staphylococcus aureus leukotoxin ED
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nocadello, S.; Minasov, G.; Shuvalova, L.
Staphylococcal leukotoxins are a family of β-barrel, bicomponent, pore-forming toxins with membrane-damaging functions. These bacterial exotoxins share sequence and structural homology and target several host-cell types. Leukotoxin ED (LukED) is one of these bicomponent pore-forming toxins thatStaphylococcus aureusproduces in order to suppress the ability of the host to contain the infection. The recent delineation of the important role that LukED plays inS. aureuspathogenesis and the identification of its protein receptors, combined with its presence inS. aureusmethicillin-resistant epidemic strains, establish this leukocidin as a possible target for the development of novel therapeutics. Here, the crystal structures of the water-soluble LukE andmore » LukD components of LukED have been determined. Lastly, the two structures illustrate the tertiary-structural variability with respect to the other leukotoxins while retaining the conservation of the residues involved in the interaction of the protomers in the bipartite leukotoxin in the pore complex.« less
-
Crystal structures of the components of the Staphylococcus aureus leukotoxin ED
Nocadello, S.; Minasov, G.; Shuvalova, L.; ...
2016-01-01
Staphylococcal leukotoxins are a family of β-barrel, bicomponent, pore-forming toxins with membrane-damaging functions. These bacterial exotoxins share sequence and structural homology and target several host-cell types. Leukotoxin ED (LukED) is one of these bicomponent pore-forming toxins thatStaphylococcus aureusproduces in order to suppress the ability of the host to contain the infection. The recent delineation of the important role that LukED plays inS. aureuspathogenesis and the identification of its protein receptors, combined with its presence inS. aureusmethicillin-resistant epidemic strains, establish this leukocidin as a possible target for the development of novel therapeutics. Here, the crystal structures of the water-soluble LukE andmore » LukD components of LukED have been determined. Lastly, the two structures illustrate the tertiary-structural variability with respect to the other leukotoxins while retaining the conservation of the residues involved in the interaction of the protomers in the bipartite leukotoxin in the pore complex.« less
-
Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin.
Bensing, Barbara A; Loukachevitch, Lioudmila V; McCulloch, Kathryn M; Yu, Hai; Vann, Kendra R; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M; Iverson, T M
2016-04-01
Streptococcus sanguinisis a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets.S. sanguinisexpresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Niedrig, David; Maechler, Sarah; Hoppe, Liesa; Corti, Natascia; Kovari, Helen; Russmann, Stefan
2016-07-01
Some macrolide and quinolone antibiotics (MQABs) are associated with QT prolongation and life-threatening torsade de pointes (TdP) arrhythmia. MQAB may also inhibit cytochrome P450 isoenzymes and thereby cause pharmacokinetic drug interactions (DDIs). There is limited data on the frequency and management of such risks in clinical practice. We aimed to quantify co-administration of MQAB with interacting drugs and associated adverse drug reactions. We conducted an observational study within our pharmacoepidemiological database derived from electronic medical records of a tertiary care hospital. Among all users of MQAB associated with TdP, we determined the prevalence of additional QT-prolonging drugs and risk factors and identified contraindicated co-administrations of simvastatin, atorvastatin, or tizanidine. Electrocardiographic (ECG) monitoring and associated adverse events were validated in medical records. Among 3444 administered courses of clarithromycin, erythromycin, azithromycin, ciprofloxacin, levofloxacin, or moxifloxacin, there were 1332 (38.7 %) with concomitant use of additional QT-prolonging drugs. Among those, we identified seven cases of drug-related QT prolongation, but 49.1 % had no ECG monitoring. Of all MQAB users, 547 (15.9 %) had hypokalemia. Forty-four MQAB users had contraindicated co-administrations of simvastatin, atorvastatin, or tizanidine and three of those related adverse drug reactions. In the studied real-life setting, we found a considerable number of MQAB users with additional risk factors for TdP but no ECG monitoring. However, adverse drug reactions were rarely found, and costs vs. benefits of ECG monitoring have to be weighted. In contrast, avoidable risk factors and selected contraindicated pharmacokinetic interactions are clear targets for implementation as automated alerts in electronic prescribing systems.
-
Molecular basis for the Kallmann syndrome-linked fibroblast growth factor receptor mutation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thurman, Ryan D.; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy
Highlights: Black-Right-Pointing-Pointer The structural basis of the Kallmann syndrome is elucidated. Black-Right-Pointing-Pointer Kallmann syndrome mutation (A168S) induces a subtle conformational change(s). Black-Right-Pointing-Pointer Structural interactions mediated by beta-sheet G are most perturbed. Black-Right-Pointing-Pointer Ligand (FGF)-receptor interaction(s) is completely abolished by Kallmann mutation. Black-Right-Pointing-Pointer Kallmann mutation directly affects the FGF signaling process. -- Abstract: Kallmann syndrome (KS) is a developmental disease that expresses in patients as hypogonadotropic hypogonadism and anosmia. KS is commonly associated with mutations in the extracellular D2 domain of the fibroblast growth factor receptor (FGFR). In this study, for the first time, the molecular basis for the FGFR associatedmore » KS mutation (A168S) is elucidated using a variety of biophysical experiments, including multidimensional NMR spectroscopy. Secondary and tertiary structural analysis using far UV circular dichroism, fluorescence and limited trypsin digestion assays suggest that the KS mutation induces subtle tertiary structure change in the D2 domain of FGFR. Results of isothermal titration calorimetry experiments show the KS mutation causes a 10-fold decrease in heparin binding affinity and also a complete loss in ligand (FGF-1) binding. {sup 1}H-{sup 15}N chemical perturbation data suggest that complete loss in the ligand (FGF) binding affinity is triggered by a subtle conformational change that disrupts crucial structural interactions in both the heparin and the FGF binding sites in the D2 domain of FGFR. The novel findings reported in this study are expected to provide valuable clues toward a complete understanding of the other genetic diseases linked to mutations in the FGFR.« less
-
Unexpected Interactions of the Cyanobacterial Metallothionein SmtA with Uranium.
Acharya, Celin; Blindauer, Claudia A
2016-02-15
Molecules for remediating or recovering uranium from contaminated environmental resources are of high current interest, with protein-based ligands coming into focus recently. Metallothioneins either bind or redox-silence a range of heavy metals, conferring protection against metal stress in many organisms. Here, we report that the cyanobacterial metallothionein SmtA competes with carbonate for uranyl binding, leading to formation of heterometallic (UO2)(n)Zn4SmtA species, without thiol oxidation, zinc loss, or compromising secondary or tertiary structure of SmtA. In turn, only metalated and folded SmtA species were found to be capable of uranyl binding. (1)H NMR studies and molecular modeling identified Glu34/Asp38 and Glu12/C-terminus as likely adventitious, but surprisingly strong, bidentate binding sites. While it is unlikely that these interactions correspond to an evolved biological function of this metallothionein, their occurrence may offer new possibilities for designing novel multipurpose bacterial metallothioneins with dual ability to sequester both soft metal ions including Cu(+), Zn(2+), Cd(2+), Hg(2+), and Pb(2+) and hard, high-oxidation state heavy metals such as U(VI). The concomitant protection from the chemical toxicity of uranium may be valuable for the development of bacterial strains for bio-remediation.
-
Functional RNA elements in the dengue virus genome.
Gebhard, Leopoldo G; Filomatori, Claudia V; Gamarnik, Andrea V
2011-09-01
Dengue virus (DENV) genome amplification is a process that involves the viral RNA, cellular and viral proteins, and a complex architecture of cellular membranes. The viral RNA is not a passive template during this process; it plays an active role providing RNA signals that act as promoters, enhancers and/or silencers of the replication process. RNA elements that modulate RNA replication were found at the 5' and 3' UTRs and within the viral coding sequence. The promoter for DENV RNA synthesis is a large stem loop structure located at the 5' end of the genome. This structure specifically interacts with the viral polymerase NS5 and promotes RNA synthesis at the 3' end of a circularized genome. The circular conformation of the viral genome is mediated by long range RNA-RNA interactions that span thousands of nucleotides. Recent studies have provided new information about the requirement of alternative, mutually exclusive, structures in the viral RNA, highlighting the idea that the viral genome is flexible and exists in different conformations. In this article, we describe elements in the promoter SLA and other RNA signals involved in NS5 polymerase binding and activity, and provide new ideas of how dynamic secondary and tertiary structures of the viral RNA participate in the viral life cycle.
-
Salvetti, Natalia R; Panzani, Carolina G; Gimeno, Eduardo J; Neme, Leandro G; Alfaro, Natalia S; Ortega, Hugo H
2009-01-01
Background Cystic ovarian disease is an important cause of infertility that affects bovine, ovine, caprine and porcine species and even human beings. Alterations in the ovarian micro-environment of females with follicular cysts could alter the normal processes of proliferation and programmed cell death in ovarian cells. Thus, our objective was to evaluate apoptosis and proliferation in ovarian cystic follicles in rats in order to investigate the cause of cystic follicle formation and persistence. Methods We compared the number of in situ apoptotic cells by TUNEL assay, expression of active caspase-3 and members of Bcl-2 family by immunohistochemistry; and cell proliferation by the expression of the proliferation markers: PCNA and Ki-67. Results The proliferation index was low in granulosa of tertiary and cystic follicles of light exposed rats when compared with tertiary follicles of control animals, while in theca interna only cystic follicles presented low proliferation index when compared with tertiary follicles (p < 0.05). The granulosa of cysts exhibited a similar cell DNA fragmentation to early atretic follicles. In the granulosa and theca interna, active caspase-3 shown similar immunostaining levels in tertiary and cystic follicles (p < 0.05). The granulosa cells presented high expression of Bcl-2, Bcl-xL and Bcl-w in the tertiary and cystic follicles with diminishing intensity in the atretic follicles, except with Bcl-w where the intensity was maintained in the atretic follicles (p < 0.05). The expression of Bax was weak in the healthy and cystic follicles. In the theca interna, Bcl-2 expression was the same as the pattern found in the granulosa; no differences were found between tertiary and cystic follicles from both groups for Bcl-xL and Bcl-w. The expression of Bax in this layer was higher in the tertiary follicles of the treated animals (p < 0.05) while the values for cystic follicles were similar to those in the tertiary follicles of controls. The theca externa showed low expression of the pro and anti-apoptotic proteins. Conclusion These results show that the combination of weak proliferation indices and low apoptosis observed in follicular cysts, could explain the cause of the slow growth of cystic follicles and the maintenance of a static condition without degeneration, which leads to their persistence. These alterations may be due to structural and functional modifications that take place in these cells and could be related to hormonal changes in animals with this condition. PMID:19570211
-
Tertiary and quaternary effects in the allosteric regulation of animal hemoglobins.
Ronda, Luca; Bruno, Stefano; Bettati, Stefano
2013-09-01
In the last decade, protein allostery has experienced a major resurgence, boosted by the extension of the concept to systems of increasing complexity and by its exploitation for the development of drugs. Expansion of the field into new directions has not diminished the key role of hemoglobin as a test molecule for theory and experimental validation of allosteric models. Indeed, the diffusion of hemoglobins in all kingdoms of life and the variety of functions and of quaternary assemblies based on a common tertiary fold indicate that this superfamily of proteins is ideally suited for investigating the physical and molecular basis of allostery and firmly maintains its role as a main player in the field. This review is an attempt to briefly recollect common and different strategies adopted by metazoan hemoglobins, from monomeric molecules to giant complexes, exploiting homotropic and heterotropic allostery to increase their functional dynamic range. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Assessing the druggability of protein-protein interactions by a supervised machine-learning method.
Sugaya, Nobuyoshi; Ikeda, Kazuyoshi
2009-08-25
Protein-protein interactions (PPIs) are challenging but attractive targets of small molecule drugs for therapeutic interventions of human diseases. In this era of rapid accumulation of PPI data, there is great need for a methodology that can efficiently select drug target PPIs by holistically assessing the druggability of PPIs. To address this need, we propose here a novel approach based on a supervised machine-learning method, support vector machine (SVM). To assess the druggability of the PPIs, 69 attributes were selected to cover a wide range of structural, drug and chemical, and functional information on the PPIs. These attributes were used as feature vectors in the SVM-based method. Thirty PPIs known to be druggable were carefully selected from previous studies; these were used as positive instances. Our approach was applied to 1,295 human PPIs with tertiary structures of their protein complexes already solved. The best SVM model constructed discriminated the already-known target PPIs from others at an accuracy of 81% (sensitivity, 82%; specificity, 79%) in cross-validation. Among the attributes, the two with the greatest discriminative power in the best SVM model were the number of interacting proteins and the number of pathways. Using the model, we predicted several promising candidates for druggable PPIs, such as SMAD4/SKI. As more PPI data are accumulated in the near future, our method will have increased ability to accelerate the discovery of druggable PPIs.
-
VizieR Online Data Catalog: SNLS and SDSS SN surveys photometric calibration (Betoule+, 2013)
NASA Astrophysics Data System (ADS)
Betoule, M.; Marriner, J.; Regnault, N.; Cuillandre, J.-C.; Astier, P.; Guy, J.; Balland, C.; El, Hage P.; Hardin, D.; Kessler, R.; Le Guillou, L.; Mosher, J.; Pain, R.; Rocci, P.-F.; Sako, M.; Schahmaneche, K.
2012-11-01
We present a joined photometric calibration for the SNLS and the SDSS supernova surveys. Our main delivery are catalogs of natural AB magnitudes for a large set of selected tertiary standard stars covering the science field of both surveys. Those catalogs are calibrated to the AB flux scale through observations of 5 primary spectrophotometric standard stars, for which HST-STIS spectra are available in the CALSPEC database. The estimate of the uncertainties associated to this calibration are delivered as a single covariance matrix. We also provide a model of the transmission efficiency of the SNLS photometric instrument MegaCam. Those transmission functions are required for the interpretation of MegaCam natural magnitudes in term of physical fluxes. Similar curves for the SDSS photometric instrument have been published in Doi et al. (2010AJ....139.1628D). Last, we release the measured magnitudes of the five CALSPEC standard stars in the magnitude system of the tertiary catalogs. This makes it possible to update the calibration of the tertiary catalogs if CALSPEC spectra for the primary standards are revised. (11 data files).
-
Russ, Boris; Robb, Maxwell J.; Popere, Bhooshan C.; ...
2015-12-09
A scarcity of stable n-type doping strategies compatible with facile processing has been a major impediment to the advancement of organic electronic devices. Localizing dopants near the cores of conductive molecules can lead to improved efficacy of doping. We and others recently showed the effectiveness of tethering dopants covalently to an electron-deficient aromatic molecule using trimethylammonium functionalization with hydroxide counterions linked to a perylene diimide core by alkyl spacers. In this work, we demonstrate that, contrary to previous hypotheses, the main driver responsible for the highly effective doping observed in thin films is the formation of tethered tertiary amine moietiesmore » during thin film processing. Furthermore, we demonstrate that tethered tertiary amine groups are powerful and general n-doping motifs for the successful generation of free electron carriers in the solid-state, not only when coupled to the perylene diimide molecular core, but also when linked with other small molecule systems including naphthalene diimide, diketopyrrolopyrrole, and fullerene derivatives. Our findings help expand a promising molecular design strategy for future enhancements of n-type organic electronic materials.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Russ, Boris; Robb, Maxwell J.; Popere, Bhooshan C.
A scarcity of stable n-type doping strategies compatible with facile processing has been a major impediment to the advancement of organic electronic devices. Localizing dopants near the cores of conductive molecules can lead to improved efficacy of doping. We and others recently showed the effectiveness of tethering dopants covalently to an electron-deficient aromatic molecule using trimethylammonium functionalization with hydroxide counterions linked to a perylene diimide core by alkyl spacers. In this work, we demonstrate that, contrary to previous hypotheses, the main driver responsible for the highly effective doping observed in thin films is the formation of tethered tertiary amine moietiesmore » during thin film processing. Furthermore, we demonstrate that tethered tertiary amine groups are powerful and general n-doping motifs for the successful generation of free electron carriers in the solid-state, not only when coupled to the perylene diimide molecular core, but also when linked with other small molecule systems including naphthalene diimide, diketopyrrolopyrrole, and fullerene derivatives. Our findings help expand a promising molecular design strategy for future enhancements of n-type organic electronic materials.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1980-08-27
A site visit was made to the amine manufacturing facility of the Pennwalt Corporation, Wyandotte, Michigan, to evaluate the facility in regard to the Secondary and Tertiary Aliphatic Monoamines Criteria Document. A total of 21 people were directly in contact with the amine production process. Two to four of the maintenance personnel may also come in contact with the process. Maintenance workers ran the risk of exposure not only to primary, secondary and tertiary amine compounds, but also to several other chemicals being used in the process. The processes used to unload raw materials are described, along with reactor operations,more » decanter and recycling operations, distillation operations, product storage and shipping. Medical monitoring at the facility included chest x-ray, respiratory function tests, sight screening, urinalysis, and back x-rays. Restricted and potentially hazardous area signs were clearly posted. Employees wore hard hats and safety glasses on the job as well as gloves, rubber boots, face shields, goggles, and respirators as necessary. Emergency procedures are described, including fire protection. Sanitation and personal hygiene are discussed, along with monitoring of the workplace conditions.« less
-
Protein thermal denaturation is modulated by central residues in the protein structure network.
Souza, Valquiria P; Ikegami, Cecília M; Arantes, Guilherme M; Marana, Sandro R
2016-03-01
Network structural analysis, known as residue interaction networks or graphs (RIN or RIG, respectively) or protein structural networks or graphs (PSN or PSG, respectively), comprises a useful tool for detecting important residues for protein function, stability, folding and allostery. In RIN, the tertiary structure is represented by a network in which residues (nodes) are connected by interactions (edges). Such structural networks have consistently presented a few central residues that are important for shortening the pathways linking any two residues in a protein structure. To experimentally demonstrate that central residues effectively participate in protein properties, mutations were directed to seven central residues of the β-glucosidase Sfβgly (β-D-glucoside glucohydrolase; EC 3.2.1.21). These mutations reduced the thermal stability of the enzyme, as evaluated by changes in transition temperature (Tm ) and the denaturation rate at 45 °C. Moreover, mutations directed to the vicinity of a central residue also caused significant decreases in the Tm of Sfβgly and clearly increased the unfolding rate constant at 45 °C. However, mutations at noncentral residues or at surrounding residues did not affect the thermal stability of Sfβgly. Therefore, the data reported in the present study suggest that the perturbation of the central residues reduced the stability of the native structure of Sfβgly. These results are in agreement with previous findings showing that networks are robust, whereas attacks on central nodes cause network failure. Finally, the present study demonstrates that central residues underlie the functional properties of proteins. © 2016 Federation of European Biochemical Societies.
-
Banerjee, Arundhati; Ray, Sujay
2016-10-30
Human tyrosinase, is an important protein for biosynthetic pathway of melanin. It was studied to be phosphorylated and activated by protein kinase-C, β-subunit (PKC-β) through earlier experimentations with in vivo evidences. Documentation documents that mutation in two essentially vital serine residues in C-terminal end of tyrosinase leads to albinism. Due to the deficiency of protective shield like enzyme; melanin, albinos are at an increased peril for melanoma and other skin cancers. So, computational and residue-level insight including a mutational exploration with evolutionary importance into this mechanism lies obligatory for future pathological and therapeutic developments. Therefore, functional tertiary models of the relevant proteins were analyzed after satisfying their stereo-chemical features. Evolutionarily paramount residues for the activation of tyrosinase were perceived via multiple sequence alignment phenomena. Mutant-type tyrosinase protein (S98A and S102A) was thereby modeled, maintaining the wild-type proteins' functionality. Furthermore, this present comparative study discloses the variation in the stable residual participation (for mutant-type and wild-type tyrosinase-PKCβ complex). Mainly, an increased number of polar negatively charged residues from the wild-type tyrosinase participated with PKC-β, predominantly. Fascinatingly supported by evaluation of statistical significances, mutation even led to a destabilizing impact in tyrosinase accompanied by conformational switches with a helix-to-coil transition in the mutated protein. Even the allosteric sites in the protein got poorly hampered upon mutation leading to weaker tendency for binding partners to interact. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Synthetic approach to the AB ring system of ouabain.
Jung, Michael E; Piizzi, Grazia
2003-04-04
Several novel hydroxylated cis-decalin derivatives, potential intermediates for the synthesis of the AB ring system of the important cardiotonic steroid ouabain, have been synthesized from commercially available starting materials. The first step in the preparation of these highly functionalized intermediates is a Robinson annulation of the beta-keto ester 6 and the 4-silyl-3-buten-2-one 5 to furnish the octalone 4 with good diastereoselectivity in fair yield (due to competition with a novel silicon-to-carbon phenyl migration). Reduction of the epoxy alcohol 3 (derived from 4 in two high-yielding steps) with LiAlH(4) gave a mixture of the desired triol 11 along with the product of an unusual reductive opening at the tertiary carbon, namely the triol 12. A plausible mechanism for this unusual reduction is presented as are possible methods for avoiding it. In particular, reduction of the corrresponding epoxy ketone 15 with aluminum amalgam proceeded in good yield to give the hydroxy ketone 16. Also reduction of the epoxide ester having the inverted stereochemistry at C3 afforded the desired tertiary alcohol 33 in good yield. Another approach using the beta,gamma-unsaturated ketal 38 permitted the formation of the tertiary alcohol 40. Fleming oxidation of the related, very functionalized silane 39 afforded the desired 1beta-alcohol 41 in fair yield. Finally a novel rearrangement was observed when the epoxy alcohol 24 was treated with DIBAL to effect loss of the angular hydroxymethyl group to produce the tetrasubstitued alkene 29 in high yield.
-
De Pinto, Vito; Messina, Angela; Accardi, Rosita; Aiello, Rita; Guarino, Francesca; Tomasello, Marianna Flora; Tommasino, Massimo; Tasco, Gianluca; Casadio, Rita; Benz, Roland; De Giorgi, Francesca; Ichas, François; Baker, Mark; Lawen, Alfons
2003-03-01
Mitochondrial porin or VDAC (Voltage Dependent Anion selective Channels) was identified for the first time in 1976, on the basis of the evolutionary similarity between the gram negative and mitochondrial outer membranes. Since this achievement VDAC has been extensively investigated: its functional features have been sharply defined upon reconstitution in artificial membranes and its sequence has been determined in many genomes. Unfortunately the tertiary structure has not yet been solved, mainly because it proved to be very difficult to get suitable crystals. Despite this established knowledge, in the last few years this protein has attracted renewed interest. There are two main reasons for this interest: the discovery, in most eukaryotes, of a family of genes encoding VDAC isoforms and the claims of VDAC involvement in the intrinsic pathway of apoptosis and in particular in the mechanism of cytochrome c release from mitochondria. We can affirm that nowadays the eukaryotic porin (or VDAC) is studied in a more general cellular contest, looking at the interactions and integration with other molecules, since VDAC is in a crucial position in the cell, forming the main interface between the mitochondrial and the cellular metabolisms. In this minireview we will briefly focus our attention onto the following topics: 1) recent advances about the structure of VDAC; 2) the VDAC-related multigene families; 3) the presence, targeting and function of VDAC in various cell membranes.
-
Phosphorylation regulates the secondary structure and function of dentin phosphoprotein peptides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Villarreal-Ramirez, Eduardo; Eliezer, David; Garduño-Juarez, Ramon
Dentin phosphoprotein (DPP) is the most acidic protein in vertebrates and structurally is classified as an intrinsically disordered protein. Functionally, DPP is related to dentin and bone formation, however the specifics of such association remain unknown. Here, we used atomistic molecular dynamics simulations to screen selected binding domains of DPP onto hydroxyapatite (HA), which is one of its important interacting partners. From these results, we selected a functionally relevant peptide, Ace-SSDSSDSSDSSDSSD-NH2 (named P5) and its phosphorylated form (named P5P), for experimental characterization. SAXS experiments indicated that in solution P5 was disordered, possibly in an extended conformation while P5P displayed moremore » compact globular conformations. Circular dichroism and FTIR confirmed that, either in the presence or absence of Ca2 +/HA, P5 adopts a random coil structure, whereas its phosphorylated counterpart, P5P, has a more compact arrangement associated with conformations that display β-sheet and α-helix motifs when bound to HA. In solution, P5 inhibited HA crystal growth, whereas at similar concentrations, P5P stimulated it. These findings suggest that phosphorylation controls the transient formation of secondary and tertiary structure of DPP peptides, and, most likely of DPP itself, which in turn controls HA growth in solution and possibly HA growth in mineralized tissues.« less
-
Waris, Sana; Habib, Safia; Tantry, Irfan Qadir; Khan, Rizwan Hasan; Mahmood, Riaz; Ali, Asif
2018-07-01
Acetaldehyde is a reactive aldehyde produced as an intermediate of alcohol metabolism and tobacco pyrolysis. It has the potential to interact with different biomolecules in various tissues which results in the formation of stable, unstable and covalent adducts. This causes structural and functional modifications that may lead to severe complications such as cancer. This study has probed the structural modifications in human immunoglobulin G (IgG) as a function of different concentrations of acetaldehyde in the presence of reducing agent, sodium borohydride. Acetaldehyde mediated modifications in IgG have been characterised by various physicochemical techniques. UV-spectrophotometry showed that acetaldehyde modified IgG exhibited marked increase in hyperchromicity. Fluorescence studies revealed a significant quenching of tryptophan fluorescence which resulted in loss of β-sheet secondary structure that was confirmed by circular dichroic analysis. Gross structural changes in the morphology of IgG were confirmed by increase in mass and hydrodynamic radius of this glycoprotein along with the appearance of fibrillar structures in modified IgG, when compared to the granular structure of the native form of IgG observed by scanning electron microscope. The results indicate that acetaldehyde causes alterations in the secondary and tertiary structure of the protein leading to diminution of normal function of IgG molecule. Copyright © 2018 Elsevier B.V. All rights reserved.
-
Hurshman Babbes, Amy R.; Powers, Evan T.; Kelly, Jeffery W.
2009-01-01
Urea denaturation studies were carried out as a function of transthyretin (TTR) concentration to quantify the thermodynamically linked quaternary and tertiary structural stability and to better understand the relationship between mutant folding energetics and amyloid disease phenotype. Urea denaturation of TTR involves at least two equilibria—dissociation of tetramers into folded monomers, and monomer unfolding. To deal with the thermodynamic linkage of these equilibria, we analyzed concentration-dependent denaturation data by global fitting to an equation that simultaneously accounts for the two-step denaturation process. Using this method, the quaternary and tertiary structural stabilities of well-behaved TTR sequences, wild type (WT) TTR and the disease-associated variant V122I, were scrutinized. The V122I variant is linked to late onset familial amyloid cardiomyopathy, the most common familial TTR amyloid disease. V122I TTR exhibits a destabilized quaternary structure and a stable tertiary structure relative to WT TTR. Three other variants of TTR were also examined, L55P, V30M, and A25T TTR. The L55P mutation is associated with the most aggressive familial TTR amyloid disease. L55P TTR has a complicated denaturation pathway that includes dimers and trimers, and so globally fitting its concentration-dependent urea denaturation data yielded error-laden estimates of stability parameters. Nevertheless, it is clear that L55P TTR is substantially less stable than WT TTR, primarily because its tertiary structure is unstable, although its quaternary structure is destabilized as well. V30M is the most common mutation associated with neuropathic forms of TTR amyloid disease. V30M TTR is certainly destabilized relative to WT TTR, but like L55P TTR it has a complex denaturation pathway that cannot be fit to the aforementioned two-step denaturation model. Literature data suggest that V30M TTR has stable quaternary structure but unstable tertiary structure. The A25T mutant, associated with central nervous system amyloidosis, is highly aggregation-prone and exhibits drastically reduced quaternary and tertiary structural stability. The observed differences in stability amongst the disease-associated TTR variants highlight the complexity and the heterogeneity of TTR amyloid disease, an observation having important implications for the treatment of these diseases. PMID:18537267
-
Clinical Practice Improvement Approach in Multiple Sclerosis Rehabilitation: A Pilot Study
ERIC Educational Resources Information Center
Khan, Fary
2010-01-01
The objective of this study was to explore methods examining patient complexity and therapy interventions in relation to functional outcomes from an inpatient multiple sclerosis (MS) rehabilitation program. Retrospective and prospective data for 24 consecutive inpatients at a tertiary rehabilitation facility assessed (i)…
-
Agarwal, Shalini; Sharma, Vijeta; Phulera, Swastik; Abdin, M Z; Ayana, R; Singh, Shailja
2015-12-01
Carotenoids represent a diverse group of pigments derived from the common isoprenoid precursors and fulfill a variety of critical functions in plants and animals. Phytoene synthase (PSY), a transferase enzyme that catalyzes the first specific step in carotenoid biosynthesis plays a central role in the regulation of a number of essential functions mediated via carotenoids. PSYs have been deeply investigated in plants, bacteria and algae however in apicomplexans it is poorly studied. In an effort to characterize PSY in apicomplexans especially the malaria parasite Plasmodium falciparum (P. falciparum), a detailed bioinformatics analysis is undertaken. We have analysed the Phylogenetic relationship of PSY also referred to as octaprenyl pyrophosphate synthase (OPPS) in P. falciparum with other taxonomic groups. Further, we in silico characterized the secondary and tertiary structures of P. falciparum PSY/OPPS and compared the tertiary structures with crystal structure of Thermotoga maritima (T. maritima) OPPS. Our results evidenced the resemblance of P. falciparum PSY with the active site of T. maritima OPPS. Interestingly, the comparative structural analysis revealed an unconserved unique loop in P. falciparum OPPS/PSY. Such structural insights might contribute novel accessory functions to the protein thus, offering potential drug targets.
-
Consistent global structures of complex RNA states through multidimensional chemical mapping
Cheng, Clarence Yu; Chou, Fang-Chieh; Kladwang, Wipapat; Tian, Siqi; Cordero, Pablo; Das, Rhiju
2015-01-01
Accelerating discoveries of non-coding RNA (ncRNA) in myriad biological processes pose major challenges to structural and functional analysis. Despite progress in secondary structure modeling, high-throughput methods have generally failed to determine ncRNA tertiary structures, even at the 1-nm resolution that enables visualization of how helices and functional motifs are positioned in three dimensions. We report that integrating a new method called MOHCA-seq (Multiplexed •OH Cleavage Analysis with paired-end sequencing) with mutate-and-map secondary structure inference guides Rosetta 3D modeling to consistent 1-nm accuracy for intricately folded ncRNAs with lengths up to 188 nucleotides, including a blind RNA-puzzle challenge, the lariat-capping ribozyme. This multidimensional chemical mapping (MCM) pipeline resolves unexpected tertiary proximities for cyclic-di-GMP, glycine, and adenosylcobalamin riboswitch aptamers without their ligands and a loose structure for the recently discovered human HoxA9D internal ribosome entry site regulon. MCM offers a sequencing-based route to uncovering ncRNA 3D structure, applicable to functionally important but potentially heterogeneous states. DOI: http://dx.doi.org/10.7554/eLife.07600.001 PMID:26035425
-
Mechanoreceptor Cells on the Tertiary Pulvini of Mimosa pudica L.
Világi, Ildikó; Varró, Petra; Kristóf, Zoltán
2007-01-01
Special red cells were found on the adaxial surface of tertiary pulvini of Mimosa pudica and experiments performed to determine the origin and function of these cells. Using anatomical (light, scanning electron and transmission electron microscopy) and electrophysiological techniques, we have demonstrated that these red cells are real mechanoreceptor cells. They can generate receptor potential following mechanical stimuli and they are in connection with excitable motor cells (through plasmodesmata). We also provide evidence that these red cells are derived from stomatal subsidiary cells and not guard cells. As histochemical studies show red cells contain tannin, which is important in development of action potentials and movements of plants. These cells could be one of unidentified mechanoreceptors of mimosa. PMID:19517007
-
Santamaria, Eric; de la Concha, Erika
2016-10-01
Microsurgical reconstruction of complex midfacial and maxillectomy defects is among the most challenging procedures in plastic surgery, and it often requires composite flaps to improve functional and aesthetic results. Various factors have been identified as having influence in the outcome of microsurgical reconstruction. In this article, the authors present their experience with immediate and delayed reconstruction of complex maxillectomy defects in a tertiary center in Mexico. The authors present a total of 37 patients with microsurgical reconstruction of a complex maxillectomy defect; 13 patients had immediate and 24 had delayed reconstructions. The authors recommend doing immediate reconstruction when feasible. Copyright © 2016 Elsevier Inc. All rights reserved.
-
De Moura, Dref C; Bryksa, Brian C; Yada, Rickey Y
2014-01-01
The plant-specific insert is an approximately 100-residue domain found exclusively within the C-terminal lobe of some plant aspartic proteases. Structurally, this domain is a member of the saposin-like protein family, and is involved in plant pathogen defense as well as vacuolar targeting of the parent protease molecule. Similar to other members of the saposin-like protein family, most notably saposins A and C, the recently resolved crystal structure of potato (Solanum tuberosum) plant-specific insert has been shown to exist in a substrate-bound open conformation in which the plant-specific insert oligomerizes to form homodimers. In addition to the open structure, a closed conformation also exists having the classic saposin fold of the saposin-like protein family as observed in the crystal structure of barley (Hordeum vulgare L.) plant-specific insert. In the present study, the mechanisms of tertiary and quaternary conformation changes of potato plant-specific insert were investigated in silico as a function of pH. Umbrella sampling and determination of the free energy change of dissociation of the plant-specific insert homodimer revealed that increasing the pH of the system to near physiological levels reduced the free energy barrier to dissociation. Furthermore, principal component analysis was used to characterize conformational changes at both acidic and neutral pH. The results indicated that the plant-specific insert may adopt a tertiary structure similar to the characteristic saposin fold and suggest a potential new structural motif among saposin-like proteins. To our knowledge, this acidified PSI structure presents the first example of an alternative saposin-fold motif for any member of the large and diverse SAPLIP family.
-
RNA nanotechnology for computer design and in vivo computation
Qiu, Meikang; Khisamutdinov, Emil; Zhao, Zhengyi; Pan, Cheryl; Choi, Jeong-Woo; Leontis, Neocles B.; Guo, Peixuan
2013-01-01
Molecular-scale computing has been explored since 1989 owing to the foreseeable limitation of Moore's law for silicon-based computation devices. With the potential of massive parallelism, low energy consumption and capability of working in vivo, molecular-scale computing promises a new computational paradigm. Inspired by the concepts from the electronic computer, DNA computing has realized basic Boolean functions and has progressed into multi-layered circuits. Recently, RNA nanotechnology has emerged as an alternative approach. Owing to the newly discovered thermodynamic stability of a special RNA motif (Shu et al. 2011 Nat. Nanotechnol. 6, 658–667 (doi:10.1038/nnano.2011.105)), RNA nanoparticles are emerging as another promising medium for nanodevice and nanomedicine as well as molecular-scale computing. Like DNA, RNA sequences can be designed to form desired secondary structures in a straightforward manner, but RNA is structurally more versatile and more thermodynamically stable owing to its non-canonical base-pairing, tertiary interactions and base-stacking property. A 90-nucleotide RNA can exhibit 490 nanostructures, and its loops and tertiary architecture can serve as a mounting dovetail that eliminates the need for external linking dowels. Its enzymatic and fluorogenic activity creates diversity in computational design. Varieties of small RNA can work cooperatively, synergistically or antagonistically to carry out computational logic circuits. The riboswitch and enzymatic ribozyme activities and its special in vivo attributes offer a great potential for in vivo computation. Unique features in transcription, termination, self-assembly, self-processing and acid resistance enable in vivo production of RNA nanoparticles that harbour various regulators for intracellular manipulation. With all these advantages, RNA computation is promising, but it is still in its infancy. Many challenges still exist. Collaborations between RNA nanotechnologists and computer scientists are necessary to advance this nascent technology. PMID:24000362
-
An RNA internal loop acts as a hinge to facilitate ribozyme folding and catalysis.
Szewczak, A A; Cech, T R
1997-01-01
RNA molecules commonly consist of helical regions separated by internal loops, and in many cases these internal loops have been found to assume stable structures. We have examined the function and dynamics of an internal loop, J5/5a, that joins the two halves of the P4-P6 domain of the Tetrahymena self-splicing group I intron. P4-P6 RNAs with mutations in the J5/5a region showed nondenaturing gel electrophoretic mobilities and levels of Fe(II)-EDTA cleavage protection intermediate between those of wild-type RNA and a mutant incapable of folding into the native P4-P6 tertiary structure. Mutants with the least structured J5/5a loops behaved the most like wild-type P4-P6, and required smaller amounts of Mg2+ to rescue folding. The activity of reconstituted introns containing mutant P4-P6 RNAs correlated similarly with the nature of the J5/5a mutation. Our results suggest that, in solution, the P4-P6 RNA is in a two-state equilibrium between folded and unfolded states. We conclude that this internal loop mainly acts as a flexible hinge, allowing the coaxially stacked helical regions on either side of it to interact via specific tertiary contacts. To a lesser extent, the specific bases within the loop contribute to folding. Furthermore, it is crucial that the junction remain unstructured in the unfolded state. These conclusions cannot be derived from a simple examination of the P4-P6 crystal structure (Cate JH et al., 1996, Science 273:1678-1685), showing once again that structure determination must be supplemented with mutational and thermodynamic analysis to provide a complete picture of a folded macromolecule. PMID:9257643
-
Independent Structural Domains in Paramyxovirus Polymerase Protein*
Dochow, Melanie; Krumm, Stefanie A.; Crowe, James E.; Moore, Martin L.; Plemper, Richard K.
2012-01-01
All enzymatic activities required for genomic replication and transcription of nonsegmented negative strand RNA viruses (or Mononegavirales) are believed to be concentrated in the viral polymerase (L) protein. However, our insight into the organization of these different enzymatic activities into a bioactive tertiary structure remains rudimentary. Fragments of Mononegavirales polymerases analyzed to date cannot restore bioactivity through trans-complementation, unlike the related L proteins of segmented NSVs. We investigated the domain organization of phylogenetically diverse Paramyxovirus L proteins derived from measles virus (MeV), Nipah virus (NiV), and respiratory syncytial virus (RSV). Through a comprehensive in silico and experimental analysis of domain intersections, we defined MeV L position 615 as an interdomain candidate in addition to the previously reported residue 1708. Only position 1708 of MeV and the homologous positions in NiV and RSV L also tolerated the insertion of epitope tags. Splitting of MeV L at residue 1708 created fragments that were unable to physically interact and trans-complement, but strikingly, these activities were reconstituted by the addition of dimerization tags to the fragments. Equivalently split fragments of NiV, RSV, and MeV L oligomerized with comparable efficiency in all homo- and heterotypic combinations, but only the homotypic pairs were able to trans-complement. These results demonstrate that synthesis as a single polypeptide is not required for the Mononegavirales polymerases to adopt a proper tertiary conformation. Paramyxovirus polymerases are composed of at least two truly independent folding domains that lack a traditional interface but require molecular compatibility for bioactivity. The functional probing of the L domain architecture through trans-complementation is anticipated to be applicable to all Mononegavirales polymerases. PMID:22215662
-
RNA nanotechnology for computer design and in vivo computation.
Qiu, Meikang; Khisamutdinov, Emil; Zhao, Zhengyi; Pan, Cheryl; Choi, Jeong-Woo; Leontis, Neocles B; Guo, Peixuan
2013-10-13
Molecular-scale computing has been explored since 1989 owing to the foreseeable limitation of Moore's law for silicon-based computation devices. With the potential of massive parallelism, low energy consumption and capability of working in vivo, molecular-scale computing promises a new computational paradigm. Inspired by the concepts from the electronic computer, DNA computing has realized basic Boolean functions and has progressed into multi-layered circuits. Recently, RNA nanotechnology has emerged as an alternative approach. Owing to the newly discovered thermodynamic stability of a special RNA motif (Shu et al. 2011 Nat. Nanotechnol. 6, 658-667 (doi:10.1038/nnano.2011.105)), RNA nanoparticles are emerging as another promising medium for nanodevice and nanomedicine as well as molecular-scale computing. Like DNA, RNA sequences can be designed to form desired secondary structures in a straightforward manner, but RNA is structurally more versatile and more thermodynamically stable owing to its non-canonical base-pairing, tertiary interactions and base-stacking property. A 90-nucleotide RNA can exhibit 4⁹⁰ nanostructures, and its loops and tertiary architecture can serve as a mounting dovetail that eliminates the need for external linking dowels. Its enzymatic and fluorogenic activity creates diversity in computational design. Varieties of small RNA can work cooperatively, synergistically or antagonistically to carry out computational logic circuits. The riboswitch and enzymatic ribozyme activities and its special in vivo attributes offer a great potential for in vivo computation. Unique features in transcription, termination, self-assembly, self-processing and acid resistance enable in vivo production of RNA nanoparticles that harbour various regulators for intracellular manipulation. With all these advantages, RNA computation is promising, but it is still in its infancy. Many challenges still exist. Collaborations between RNA nanotechnologists and computer scientists are necessary to advance this nascent technology.
-
De Moura, Dref C.; Bryksa, Brian C.; Yada, Rickey Y.
2014-01-01
The plant-specific insert is an approximately 100-residue domain found exclusively within the C-terminal lobe of some plant aspartic proteases. Structurally, this domain is a member of the saposin-like protein family, and is involved in plant pathogen defense as well as vacuolar targeting of the parent protease molecule. Similar to other members of the saposin-like protein family, most notably saposins A and C, the recently resolved crystal structure of potato (Solanum tuberosum) plant-specific insert has been shown to exist in a substrate-bound open conformation in which the plant-specific insert oligomerizes to form homodimers. In addition to the open structure, a closed conformation also exists having the classic saposin fold of the saposin-like protein family as observed in the crystal structure of barley (Hordeum vulgare L.) plant-specific insert. In the present study, the mechanisms of tertiary and quaternary conformation changes of potato plant-specific insert were investigated in silico as a function of pH. Umbrella sampling and determination of the free energy change of dissociation of the plant-specific insert homodimer revealed that increasing the pH of the system to near physiological levels reduced the free energy barrier to dissociation. Furthermore, principal component analysis was used to characterize conformational changes at both acidic and neutral pH. The results indicated that the plant-specific insert may adopt a tertiary structure similar to the characteristic saposin fold and suggest a potential new structural motif among saposin-like proteins. To our knowledge, this acidified PSI structure presents the first example of an alternative saposin-fold motif for any member of the large and diverse SAPLIP family. PMID:25188221
-
“Click, Click, Cyclize”: A DOS Approach to Sultams Utilizing Vinyl Sulfonamide Linchpins
Zhou, Aihua; Rayabarapu, Dinesh; Hanson, Paul R.
2009-01-01
A diversity-oriented synthesis (DOS) strategy termed “Click, Click, Cyclize” is reported. This approach relies on functional group (FG) pairing between a vinyl sulfonamide and an array of functional groups to synthesize skeletally diverse sultams. Several FG pairing pathways on central tertiary vinyl sulfonamide linchpins have been developed including intramolecular Heck, aza-Michael, ring-closing enyne metathesis, Pauson—Khand, and chemoselective oxidation/Baylis—Hillman reactions. PMID:19115841
-
"Partners or Opponents": The Engagement of Students in a Compliance Driven Quality Assessment
ERIC Educational Resources Information Center
Shah, Mahsood; Hartman, Kylee; Hastings, Graham
2014-01-01
The Australian government recently established a national regulator with responsibilities of registration and accreditation of all kinds of higher education providers including universities. The Tertiary Education Quality and Standards Agency (TEQSA) subsumes the functions of the previous Australian Universities Quality Agency (AUQA) with…
-
The Importance of Production: An Expanding Focus in Secondary and Tertiary Science Instruction.
ERIC Educational Resources Information Center
Seale, T. S.
1983-01-01
Encourages science educators to consider engaging students in science projects resulting in socially useful products. Educational presentations meant to perform social functions (soft products) and preparation/execution of environmental manipulations (hard products) such as pollution analysis, plant breeding, or administering medical tests are…
-
The Functions of the Orbitofrontal Cortex
ERIC Educational Resources Information Center
Rolls, Edmund T.
2004-01-01
The orbitofrontal cortex contains the secondary taste cortex, in which the reward value of taste is represented. It also contains the secondary and tertiary olfactory cortical areas, in which information about the identity and also about the reward value of odours is represented. The orbitofrontal cortex also receives information about the sight…
-
CORNECI, Marioara; STANESCU, Bogdan; TRIFANESCU, Raluca; NEACSU, Elena; CORNECI, Dan; POIANA, Catalina; HORVAT, Teodor
2012-01-01
ABSTRACT Background: In patients with hyperparathyroidism, parathyroidectomy is the only curative therapy. Anaesthetic management differs function of etiology (primary vs. secondary or tertiary hyperparathyroidism) and surgical technique (minimally invasive or classic parathyroidectomy). Objectives: To evaluate peri-operative management (focusing on hemodynamic changes, cardiac arrhythmias and patients’ awakening quality) in parathyroidectomy for hyperparathyroidism of various etiologies, in a tertiary center. Material and methods: 292 patients who underwent surgery for hyperparathyroidism between 2000-2011 were retrospectively reviewed; 96 patients (19M/77F) presented with primary hyperparathyroidism (group A) and 196 (80M/116F) with secondary and tertiary hyperparathyroidism due to renal failure (group B). Biochemical parameters (serum calcium, phosphate, creatinine) were determined by automated standard laboratory methods. Serum intact PTH was measured by ELISA (iPTH - normal range: 15-65 pg/mL). Outcomes: Median surgery duration was 30 minutes in group A (minimally invasive or classic parathyroidectomy) and 75 minutes in group B (total parathyroidectomy and re implantation of a small parathyroid fragment into the sternocleidomastoid muscle). During anaesthesia induction, arterial hypotension developed significantly more frequent in group B (57 out of 196 pts, 29.1%) than in group A (8 out of 96 pts, 8.34%), p<0.0001, especially in patients receiving Fentanyl-Propofol. During surgery and anaesthesia maintenance, bradycardia was significantly more frequent in group A (67 out of 96 pts, 69.8%) than in group B (26 out of 196 pts, 13.3%), p<0.0001, especially during searching of parathyroid glands. By contrary, ventricular premature beats were less frequent in group A (25 out of 96 pts, 25.25%) than in group B (84 out of 196 pts, 42.85%), p=0.003. There were no statistically significant differences between the studied group regarding frequency of arterial hypertension and hypotension, paroxysmal atrial fibrillation. Conclusions: anaesthetic management in parathyroid surgery may be difficult because of cardiac arrhythmias (bradycardia in primary hyperparathyroidism and ventricular premature beats in secondary and tertiary hyperparathyroidism, respectively) and arterial hypotension during anaesthesia induction in patients with secondary and tertiary hyperparathyroidism. PMID:23399537
-
Impaired insulin signaling pathway in ovarian follicles of cows with cystic ovarian disease.
Hein, G J; Panzani, C G; Rodríguez, F M; Salvetti, N R; Díaz, P U; Gareis, N C; Benítez, G A; Ortega, H H; Rey, F
2015-05-01
Cystic ovarian disease (COD) is an important cause of infertility in dairy cattle. Follicular cell steroidogenesis and proliferation in ovulatory follicles is stimulated by hormones such as insulin and its necessary post-receptor response. The aim of this study was to determine the expression of insulin receptor (IR), IR substrate-1 (IRS1) and phosphatidylinositol 3-kinase (PI3K), key intermediates in the insulin pathway, in control cows and cows with spontaneous COD and ACTH-induced COD. IR and IRS1 mRNA levels were greater in granulosa cells and lower in follicular cysts than in control tertiary follicles. PI3K mRNA levels were similar in all follicles evaluated, whereas the expression of IR, IRS1 and PI3K was similar in theca cells. Protein expression of IR was higher in control tertiary follicles than in the same structures in animals with COD and with cysts. IRS1 and PI3K protein expression showed the same pattern in tertiary and cystic follicles. However, the protein expression of subunit alpha p85 of PI3K was greater in theca cells from tertiary follicles than in cystic follicles. These results provide new insights into the insulin response in cows with COD. The lower gene and protein expressions of some insulin downstream effectors at an early stage of the signaling pathway could negatively influence the functionality of ovaries and contribute to follicle persistence. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Liphardt, J; Napthine, S; Kontos, H; Brierley, I
1999-05-07
RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those pseudoknots with a short loop 2. Copyright 1999 Academic Press.
-
Trock, Bruce J; Guo, Charles C; Gonzalgo, Mark L; Magheli, Ahmed; Loeb, Stacy; Epstein, Jonathan I
2009-10-01
We investigated the relationship between the tertiary Gleason component in radical prostatectomy specimens and biochemical recurrence in what is to our knowledge the largest single institution cohort to date. We evaluated data on 3,230 men who underwent radical prostatectomy at our institution from 2000 to 2005. Tertiary Gleason component was defined as Gleason grade pattern 4 or greater for Gleason score 6 and Gleason grade pattern 5 for Gleason score 7 or 8. Biochemical recurrence curves for cancer with tertiary Gleason component were intermediate between those of cancer without a tertiary Gleason component in the same Gleason score category and cancer in the next higher Gleason score category. The only exception was that Gleason score 4 + 3 = 7 with a tertiary Gleason component behaved like Gleason score 8. The tertiary Gleason component independently predicted recurrence when factoring in radical prostatectomy Gleason score, radical prostatectomy stage and prostate specific antigen (HR 1.45, p = 0.029). Furthermore, the magnitude of the tertiary Gleason component effect on recurrence did not differ by Gleason score category (p = 0.593). Although the tertiary Gleason component is frequently included in pathology reports, it is routinely omitted in other situations, such as predictive nomograms, research studies and patient counseling. The current study adds to a growing body of evidence highlighting the importance of the tertiary Gleason component in radical prostatectomy specimens. Accordingly consideration should be given to a modified radical prostatectomy Gleason scoring system that incorporates tertiary Gleason component in intuitive fashion, including Gleason score 6, 6.5 (Gleason score 6 with tertiary Gleason component), 7 (Gleason score 3 + 4 = 7), 7.25 (Gleason score 3 + 4 = 7 with tertiary Gleason component), 7.5 (Gleason score 4 + 3), 8 (Gleason score 4 + 3 with tertiary Gleason component or Gleason score 8), 8.5 (Gleason score 8 with tertiary Gleason component), 9 (Gleason score 4 + 5 or 5 + 4) and 10.
-
Yang, A S; Hitz, B; Honig, B
1996-06-21
The stability of beta-turns is calculated as a function of sequence and turn type with a Monte Carlo sampling technique. The conformational energy of four internal hydrogen-bonded turn types, I, I', II and II', is obtained by evaluating their gas phase energy with the CHARMM force field and accounting for solvation effects with the Finite Difference Poisson-Boltzmann (FDPB) method. All four turn types are found to be less stable than the coil state, independent of the sequence in the turn. The free-energy penalties associated with turn formation vary between 1.6 kcal/mol and 7.7 kcal/mol, depending on the sequence and turn type. Differences in turn stability arise mainly from intraresidue interactions within the two central residues of the turn. For each combination of the two central residues, except for -Gly-Gly-, the most stable beta-turn type is always found to occur most commonly in native proteins. The fact that a model based on local interactions accounts for the observed preference of specific sequences suggests that long-range tertiary interactions tend to play a secondary role in determining turn conformation. In contrast, for beta-hairpins, long-range interactions appear to dominate. Specifically, due to the right-handed twist of beta-strands, type I' turns for -Gly-Gly- are found to occur with high frequency, even when local energetics would dictate otherwise. The fact that any combination of two residues is found able to adopt a relatively low-energy turn structure explains why the amino acid sequence in turns is highly variable. The calculated free-energy cost of turn formation, when combined with related numbers obtained for alpha-helices and beta-sheets, suggests a model for the initiation of protein folding based on metastable fragments of secondary structure.
-
El-Turk, Farah; Fauvet, Bruno; Ashrafi, Amer; Ouertatani-Sakouhi, Hajer; Cho, Min-Kyu; Neri, Marilisa; Cascella, Michele; Rothlisberger, Ursula; Pojer, Florence; Zweckstetter, Markus; Lashuel, Hilal
2012-01-01
Macrophage Migration Inhibitory Factor (MIF) is a key mediator of inflammatory responses and innate immunity and has been implicated in the pathogenesis of several inflammatory and autoimmune diseases. The oligomerization of MIF, more specifically trimer formation, is essential for its keto-enol tautomerase activity and probably mediates several of its interactions and biological activities, including its binding to its receptor CD74 and activation of certain signaling pathways. Therefore, understanding the molecular factors governing the oligomerization of MIF and the role of quaternary structure in modulating its structural stability and multifunctional properties is crucial for understanding the function of MIF in health and disease. Herein, we describe highly conserved intersubunit interactions involving the hydrophobic packing of the side chain of Leu46 onto the β-strand β3 of one monomer within a hydrophobic pocket from the adjacent monomer constituted by residues Arg11, Val14, Phe18, Leu19, Val39, His40, Val41, Val42, and Pro43. To elucidate the structural significance of these intersubunit interactions and their relative contribution to MIF’s trimerization, structural stability and catalytic activity, we generated three point mutations where Leu46 was replaced by glycine (L46G), alanine (L46A) and phenylalanine (L46F), and their structural properties, stability, oligomerization state, and catalytic activity were characterized using a battery of biophysical methods and X-ray crystallography. Our findings provide new insights into the role of the Leu46 hydrophobic pocket in stabilizing the conformational state of MIF in solution. Disrupting the Leu46 hydrophobic interaction perturbs the secondary and tertiary structure of the protein but has no effect on its oligomerization state. PMID:23028743
-
El-Turk, Farah; Fauvet, Bruno; Ashrafi, Amer; Ouertatani-Sakouhi, Hajer; Cho, Min-Kyu; Neri, Marilisa; Cascella, Michele; Rothlisberger, Ursula; Pojer, Florence; Zweckstetter, Markus; Lashuel, Hilal
2012-01-01
Macrophage Migration Inhibitory Factor (MIF) is a key mediator of inflammatory responses and innate immunity and has been implicated in the pathogenesis of several inflammatory and autoimmune diseases. The oligomerization of MIF, more specifically trimer formation, is essential for its keto-enol tautomerase activity and probably mediates several of its interactions and biological activities, including its binding to its receptor CD74 and activation of certain signaling pathways. Therefore, understanding the molecular factors governing the oligomerization of MIF and the role of quaternary structure in modulating its structural stability and multifunctional properties is crucial for understanding the function of MIF in health and disease. Herein, we describe highly conserved intersubunit interactions involving the hydrophobic packing of the side chain of Leu46 onto the β-strand β3 of one monomer within a hydrophobic pocket from the adjacent monomer constituted by residues Arg11, Val14, Phe18, Leu19, Val39, His40, Val41, Val42, and Pro43. To elucidate the structural significance of these intersubunit interactions and their relative contribution to MIF's trimerization, structural stability and catalytic activity, we generated three point mutations where Leu46 was replaced by glycine (L46G), alanine (L46A) and phenylalanine (L46F), and their structural properties, stability, oligomerization state, and catalytic activity were characterized using a battery of biophysical methods and X-ray crystallography. Our findings provide new insights into the role of the Leu46 hydrophobic pocket in stabilizing the conformational state of MIF in solution. Disrupting the Leu46 hydrophobic interaction perturbs the secondary and tertiary structure of the protein but has no effect on its oligomerization state.
-
García-Mayoral, María Flor; Treviño, Miguel Angel; Pérez-Piñar, Teresa; Caballero, María Luisa; Knaute, Tobias; Umpierrez, Ana
2014-01-01
Background Anisakiasis is a re-emerging global disease caused by consumption of raw or lightly cooked fish contaminated with L3 Anisakis larvae. This zoonotic disease is characterized by severe gastrointestinal and/or allergic symptoms which may misdiagnosed as appendicitis, gastric ulcer or other food allergies. The Anisakis allergen Ani s 5 is a protein belonging to the SXP/RAL-2 family; it is detected exclusively in nematodes. Previous studies showed that SXP/RAL-2 proteins are active antigens; however, their structure and function remain unknown. The aim of this study was to elucidate the three-dimensional structure of Ani s 5 and its main IgE and IgG4 binding regions. Methodology/Principal Findings The tertiary structure of recombinant Ani s 5 in solution was solved by nuclear magnetic resonance. Mg2+, but not Ca2+, binding was determined by band shift using SDS-PAGE. IgE and IgG4 epitopes were elucidated by microarray immunoassay and SPOTs membranes using sera from nine Anisakis allergic patients. The tertiary structure of Ani s 5 is composed of six alpha helices (H), with a Calmodulin like fold. H3 is a long, central helix that organizes the structure, with H1 and H2 packing at its N-terminus and H4 and H5 packing at its C-terminus. The orientation of H6 is undefined. Regarding epitopes recognized by IgE and IgG4 immunoglobulins, the same eleven peptides derived from Ani s 5 were bound by both IgE and IgG4. Peptides 14 (L40-K59), 26 (A76-A95) and 35 (I103-D122) were recognized by three out of nine sera. Conclusions/Significance This is the first reported 3D structure of an Anisakis allergen. Magnesium ion binding and structural resemblance to Calmodulin, suggest some putative functions for SXP/RAL-2 proteins. Furthermore, the IgE/IgG4 binding regions of Ani s 5 were identified as segments localized on its surface. These data will contribute towards a better understanding of the interactions that occur between immunoglobulins and allergens and, in turn, facilitate the design of novel diagnostic tests and immunotherapeutic strategies. PMID:24603892
-
Pazderková, Markéta; Profant, Václav; Hodačová, Jana; Sebestík, Jaroslav; Pazderka, Tomáš; Novotná, Pavlína; Urbanová, Marie; Safařík, Martin; Buděšínský, Miloš; Tichý, Miloš; Bednárová, Lucie; Baumruk, Vladimír; Maloň, Petr
2013-08-22
We investigate amide nonplanarity in vibrational optical activity (VOA) spectra of tricyclic spirodilactams 5,8-diazatricyclo[6,3,0,0(1,5)]undecan-4,9-dione (I) and its 6,6',7,7'-tetradeuterio derivative (II). These rigid molecules constrain amide groups to nonplanar geometries with twisted pyramidal arrangements of bonds to amide nitrogen atoms. We have collected a full range vibrational circular dichroism (VCD) and Raman optical activity (ROA) spectra including signals of C-H and C-D stretching vibrations. We report normal-mode analysis and a comparison of calculated to experimental VCD and ROA. The data provide band-to-band assignment and offer a possibility to evaluate roles of constrained nonplanar tertiary amide groups and rigid chiral skeletons. Nonplanarity shows as single-signed VCD and ROA amide I signals, prevailing the couplets expected to arise from the amide-amide interaction. Amide-amide coupling dominates amide II (mainly C'-N stretching, modified in tertiary amides by the absence of a N-H bond) transitions (strong couplet in VCD, no significant ROA) probably due to the close proximity of amide nitrogen atoms. At lower wavenumbers, ROA spectra exhibit another likely manifestation of amide nonplanarity, showing signals of amide V (δ(oop)(N-C) at ~570 cm(-1)) and amide VI (δ(oop)(C'═O) at ~700 cm(-1) and ~650 cm(-1)) vibrations.
-
Fate of human viruses in groundwater recharge systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vaughn, J.M.; Landry, E.F.
1980-03-01
The overall objective of this research program was to determine the ability of a well-managed tertiary effluent-recharge system to return virologically acceptable water to the groundwater aquifer. The study assessed the quality of waters renovated by indigenous recharge operations and investigated a number of virus-soil interrelationships. The elucidation of the interactions led to the establishment of basin operating criteria for optimizing virus removal. Raw influents, chlorinated tertiary effluents, and renovated wastewater from the aquifer directly beneath a uniquely designed recharge test basin were assayed on a weekly basis for the presence of human enteroviruses and coliform bacteria. High concentrations ofmore » viruses were routinely isolated from influents but were isolated only on four occasions from tertiary-treated sewage effluents. In spite of the high quality effluent being recharged, viruses were isolated from the groundwater observation well, indicating their ability to penetrate the unsaturated zone. Results of poliovirus seeding experiments carried out in the test basin clearly indicated the need to operate recharge basins at low (e.g. 1 cm/h) infiltration rates in areas having soil types similar to those found at the study site. The method selected for reducing the test basin infiltration rate involved clogging the basin surface with settled organic material from highly turbid effluent. Alternative methods for slowing infiltration rates are discussed in the text.« less
-
Increased helix and protein stability through the introduction of a new tertiary hydrogen bond.
Peterson, R W; Nicholson, E M; Thapar, R; Klevit, R E; Scholtz, J M
1999-03-12
In an effort to quantify the importance of hydrogen bonding and alpha-helix formation to protein stability, a capping box motif was introduced into the small phosphocarrier protein HPr. Previous studies had confirmed that Ser46, at the N-cap position of the short helix-B in HPr, serves as an N-cap in solution. Thus, only a single-site mutation was required to produce a canonical S-X-X-E capping box: Lys49 at the N3 position was substituted with a glutamic acid residue. Thermal and chemical denaturation studies on the resulting K49E HPr show that the designed variant is approximately 2 kcal mol-1 more stable than the wild-type protein. However, NMR studies indicate that the side-chain of Glu49 does not participate in the expected capping H-bond interaction, but instead forms a new tertiary H-bond that links helix-B to the four-stranded beta-sheet of HPr. Here, we demonstrate that a strategy in which new non-native H-bonds are introduced can generate proteins with increased stability. We discuss why the original capping box design failed, and compare the energetic consequences of the new tertiary side-chain to main-chain H-bond with a local (helix-capping) side-chain to main-chain H-bond on the protein's global stability. Copyright 1999 Academic Press.
-
Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J
2017-11-01
Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.
-
2013-01-01
Background The vitamins are important cofactors in various enzymatic-reactions. In past, many inhibitors have been designed against vitamin binding pockets in order to inhibit vitamin-protein interactions. Thus, it is important to identify vitamin interacting residues in a protein. It is possible to detect vitamin-binding pockets on a protein, if its tertiary structure is known. Unfortunately tertiary structures of limited proteins are available. Therefore, it is important to develop in-silico models for predicting vitamin interacting residues in protein from its primary structure. Results In this study, first we compared protein-interacting residues of vitamins with other ligands using Two Sample Logo (TSL). It was observed that ATP, GTP, NAD, FAD and mannose preferred {G,R,K,S,H}, {G,K,T,S,D,N}, {T,G,Y}, {G,Y,W} and {Y,D,W,N,E} residues respectively, whereas vitamins preferred {Y,F,S,W,T,G,H} residues for the interaction with proteins. Furthermore, compositional information of preferred and non-preferred residues along with patterns-specificity was also observed within different vitamin-classes. Vitamins A, B and B6 preferred {F,I,W,Y,L,V}, {S,Y,G,T,H,W,N,E} and {S,T,G,H,Y,N} interacting residues respectively. It suggested that protein-binding patterns of vitamins are different from other ligands, and motivated us to develop separate predictor for vitamins and their sub-classes. The four different prediction modules, (i) vitamin interacting residues (VIRs), (ii) vitamin-A interacting residues (VAIRs), (iii) vitamin-B interacting residues (VBIRs) and (iv) pyridoxal-5-phosphate (vitamin B6) interacting residues (PLPIRs) have been developed. We applied various classifiers of SVM, BayesNet, NaiveBayes, ComplementNaiveBayes, NaiveBayesMultinomial, RandomForest and IBk etc., as machine learning techniques, using binary and Position-Specific Scoring Matrix (PSSM) features of protein sequences. Finally, we selected best performing SVM modules and obtained highest MCC of 0.53, 0.48, 0.61, 0.81 for VIRs, VAIRs, VBIRs, PLPIRs respectively, using PSSM-based evolutionary information. All the modules developed in this study have been trained and tested on non-redundant datasets and evaluated using five-fold cross-validation technique. The performances were also evaluated on the balanced and different independent datasets. Conclusions This study demonstrates that it is possible to predict VIRs, VAIRs, VBIRs and PLPIRs from evolutionary information of protein sequence. In order to provide service to the scientific community, we have developed web-server and standalone software VitaPred (http://crdd.osdd.net/raghava/vitapred/). PMID:23387468
-
Panwar, Bharat; Gupta, Sudheer; Raghava, Gajendra P S
2013-02-07
The vitamins are important cofactors in various enzymatic-reactions. In past, many inhibitors have been designed against vitamin binding pockets in order to inhibit vitamin-protein interactions. Thus, it is important to identify vitamin interacting residues in a protein. It is possible to detect vitamin-binding pockets on a protein, if its tertiary structure is known. Unfortunately tertiary structures of limited proteins are available. Therefore, it is important to develop in-silico models for predicting vitamin interacting residues in protein from its primary structure. In this study, first we compared protein-interacting residues of vitamins with other ligands using Two Sample Logo (TSL). It was observed that ATP, GTP, NAD, FAD and mannose preferred {G,R,K,S,H}, {G,K,T,S,D,N}, {T,G,Y}, {G,Y,W} and {Y,D,W,N,E} residues respectively, whereas vitamins preferred {Y,F,S,W,T,G,H} residues for the interaction with proteins. Furthermore, compositional information of preferred and non-preferred residues along with patterns-specificity was also observed within different vitamin-classes. Vitamins A, B and B6 preferred {F,I,W,Y,L,V}, {S,Y,G,T,H,W,N,E} and {S,T,G,H,Y,N} interacting residues respectively. It suggested that protein-binding patterns of vitamins are different from other ligands, and motivated us to develop separate predictor for vitamins and their sub-classes. The four different prediction modules, (i) vitamin interacting residues (VIRs), (ii) vitamin-A interacting residues (VAIRs), (iii) vitamin-B interacting residues (VBIRs) and (iv) pyridoxal-5-phosphate (vitamin B6) interacting residues (PLPIRs) have been developed. We applied various classifiers of SVM, BayesNet, NaiveBayes, ComplementNaiveBayes, NaiveBayesMultinomial, RandomForest and IBk etc., as machine learning techniques, using binary and Position-Specific Scoring Matrix (PSSM) features of protein sequences. Finally, we selected best performing SVM modules and obtained highest MCC of 0.53, 0.48, 0.61, 0.81 for VIRs, VAIRs, VBIRs, PLPIRs respectively, using PSSM-based evolutionary information. All the modules developed in this study have been trained and tested on non-redundant datasets and evaluated using five-fold cross-validation technique. The performances were also evaluated on the balanced and different independent datasets. This study demonstrates that it is possible to predict VIRs, VAIRs, VBIRs and PLPIRs from evolutionary information of protein sequence. In order to provide service to the scientific community, we have developed web-server and standalone software VitaPred (http://crdd.osdd.net/raghava/vitapred/).
-
Family and sexual life in people with epilepsy.
Mameniškienė, Rūta; Guk, Jevgenija; Jatužis, Dalius
2017-01-01
Having epilepsy is much more than having seizures. Epilepsy can have a severe negative effect on quality of life, affecting social relationships, academic achievement, housing, employment, and the ability to live and function independently. We undertook a cross-sectional study in a tertiary epilepsy center in Lithuania, aiming to assess the influence of epilepsy and aspects relating to epilepsy (employment, stigma, anxiety) on patients and their families, and to estimate their quality of family life and sexual functioning. We asked patients to complete a questionnaire about their socio-demographic situation, their seizure types and antiepileptic medications, and their quality of family and sexual life. Our results confirmed that epilepsy seriously influences family life. One third of our patients are lonely and half are childless. Epilepsy leads to difficulty in finding a job, especially for men, and unemployment affects their status in the family. People with epilepsy are uncomfortable interacting with those of the opposite sex and tend to conceal their medical condition from their partner. One third have sexual dysfunction, yet only a quarter of them seek professional help. There is a clear need to improve self-confidence and to reduce social stigma in people with epilepsy, and to encourage them to discuss their problems with specialists. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Introduction to bioinformatics.
Can, Tolga
2014-01-01
Bioinformatics is an interdisciplinary field mainly involving molecular biology and genetics, computer science, mathematics, and statistics. Data intensive, large-scale biological problems are addressed from a computational point of view. The most common problems are modeling biological processes at the molecular level and making inferences from collected data. A bioinformatics solution usually involves the following steps: Collect statistics from biological data. Build a computational model. Solve a computational modeling problem. Test and evaluate a computational algorithm. This chapter gives a brief introduction to bioinformatics by first providing an introduction to biological terminology and then discussing some classical bioinformatics problems organized by the types of data sources. Sequence analysis is the analysis of DNA and protein sequences for clues regarding function and includes subproblems such as identification of homologs, multiple sequence alignment, searching sequence patterns, and evolutionary analyses. Protein structures are three-dimensional data and the associated problems are structure prediction (secondary and tertiary), analysis of protein structures for clues regarding function, and structural alignment. Gene expression data is usually represented as matrices and analysis of microarray data mostly involves statistics analysis, classification, and clustering approaches. Biological networks such as gene regulatory networks, metabolic pathways, and protein-protein interaction networks are usually modeled as graphs and graph theoretic approaches are used to solve associated problems such as construction and analysis of large-scale networks.
-
Lee, Myoung-Ro; Yoo, Won Gi; Kim, Yu Jung; Chung, Eun Ju; Cho, Shin-Hyeong; Ju, Jung-Won
2018-06-06
Venom allergen-like (VAL) proteins are important to host-parasite interactions. We previously demonstrated that a Clonorchis sinensis VAL (CsVAL) protein-derived synthetic peptide suppresses allergic and inflammatory responses. However, little is known regarding the physicochemical and antigenic properties of CsVAL proteins. Here, we identified a novel 194 amino acid VAL protein, named C. sinensis VAL 28 (CsVAL28), and characterized its functional motifs and structural details as a new member of the CAP superfamily. Unlike members of the Schistosoma mansoni VAL (SmVAL) family, CsVAL28 has a single CAP1 motif and six highly conserved disulfide bond-forming cysteines. Tertiary models of wild-type CsVAL28 and mutants were built using SmVAL4 as template via homology modeling. Normal mode analysis predicted that disulfide bond breaking by mutation of cysteine 124 to serine would greatly affect protein mobility. Four major immunoreactive linear epitopes were identified in the surface-exposed region or its vicinity via epitope mapping, using sera from clonorchiasis patients and healthy controls. Our findings provide in-depth knowledge on the structure-function properties of VAL proteins and may help determine highly antigenic regions for developing new diagnostic approaches.
-
A Comprehensive Study of Molecular Evolution at the Self-Incompatibility Locus of Rosaceae.
Ashkani, Jahanshah; Rees, D J G
2016-03-01
The family Rosaceae includes a range of important fruit trees, most of which have the S-RNase-based self-incompatibility (SI). Several models have been developed to explain how pollen (SLF) and pistil (S-RNase) components of the S-locus interact. It was discovered in 2010 that additional SLF proteins are involved in pollen specificity, and a Collaborative Non-Self Recognition model has been proposed for SI in Solanaceae; however, the validity of such model remains to be elucidated for other species. The results of this study support the divergent evolution of the S-locus genes from two Rosaceae subfamilies, Prunoideae/Amygdaloideae and Maloideae, The difference identified in the selective pressures between the two lineages provides evidence for positive selection at specific sites in both the S-RNase and the SLF proteins. The evolutionary findings of this study support the role of multiple SLF proteins leading to a Collaborative Non-Self Recognition model for SI in the Maloideae. Furthermore, the identification of the sites responsible for SI specificity determination and the mapping of these sites onto the modelled tertiary structure of ancestor proteins provide useful information for rational functional redesign and protein engineering for the future engineering of new functional alleles providing increased diversity in the SI system in the Maloideae.
-
Yakubchyk, Yury; Abramovici, Hanan; Maillet, Jean-Christian; Daher, Elias; Obagi, Christopher; Parks, Robin J.; Topham, Matthew K.; Gee, Stephen H.
2005-01-01
Syntrophins are scaffold proteins that regulate the subcellular localization of diacylglycerol kinase ζ (DGK-ζ), an enzyme that phosphorylates the lipid second-messenger diacylglycerol to yield phosphatidic acid. DGK-ζ and syntrophins are abundantly expressed in neurons of the developing and adult brain, but their function is unclear. Here, we show that they are present in cell bodies, neurites, and growth cones of cultured cortical neurons and differentiated N1E-115 neuroblastoma cells. Overexpression of DGK-ζ in N1E-115 cells induced neurite formation in the presence of serum, which normally prevents neurite outgrowth. This effect was independent of DGK-ζ kinase activity but dependent on a functional C-terminal PDZ-binding motif, which specifically interacts with syntrophin PDZ domains. DGK-ζ mutants with a blocked C terminus acted as dominant-negative inhibitors of outgrowth from serum-deprived N1E-115 cells and cortical neurons. Several lines of evidence suggest DGK-ζ promotes neurite outgrowth through association with the GTPase Rac1. DGK-ζ colocalized with Rac1 in neuronal processes and DGK-ζ-induced outgrowth was inhibited by dominant-negative Rac1. Moreover, DGK-ζ directly interacts with Rac1 through a binding site located within its C1 domains. Together with syntrophin, these proteins form a tertiary complex in N1E-115 cells. A DGK-ζ mutant that mimics phosphorylation of the MARCKS domain was unable to bind an activated Rac1 mutant (Rac1V12) and phorbol myristate acetate-induced protein kinase C activation inhibited the interaction of DGK-ζ with Rac1V12, suggesting protein kinase C-mediated phosphorylation of the MARCKS domain negatively regulates DGK-ζ binding to active Rac1. Collectively, these findings suggest DGK-ζ, syntrophin, and Rac1 form a regulated signaling complex that controls polarized outgrowth in neuronal cells. PMID:16055737
-
Labor, Marina; Vrbica, Žarko; Gudelj, Ivan; Labor, Slavica; Plavec, Davor
2016-08-19
COPD-6™ is a lung function testing device for a rapid pre-spirometry testing to screen-out at-risk individuals not having COPD and indicating those at risk. The aim of this study was to validate COPD-6™ lung function testing (index test) in general practice in discriminating patients with COPD out of the population at risk - smokers/ex-smokers with no previous diagnosis of COPD, using measurements at tertiary care as reference standard. Consecutive 227 subjects (115 women, 185 smokers/42 ex-smokers, ≥20 pack-years) with no previous diagnosis of COPD, aged 52.5 (SD 6.8) years from 26 general practitioners (GPs) were recruited, lung function tested with COPD-6™, referred to the tertiary institution for repeated COPD-6™ testing followed by spirometry with a bronchodilator (salbutamol), examination, and pulmonologist consultation for the diagnosis and severity of COPD. COPD was diagnosed in 43 subjects (18.9 %), with an AUC of 0.827 (95 % CI 0.769-0.875, P < 0.001) for the diagnosis of COPD when lung function was measured using COPD-6™ in GP's office with a specificity of 100 % (95 % CI, 97.95-100 %) but a very low sensitivity of 32.56 % (95 % CI, 20.49-47.48 %). Significant agreement for forced expiratory volume in 1 s measured at GP's office and at lung function lab was found (mean difference 0.01 L, p = 0.667) but not for other measured parameters (p < 0.001 for all). Our study results point out that active case finding in a population at risk for COPD should be instituted (almost 20 % of undiagnosed COPD). Based on our results lung function testing with COPD-6™ can substitute spirometry testing in cases where it is not readily available to the patient/physician taken into account that the traditional FEV1/FEV6 cutoff value of <0.7 is not the only criterion for diagnosis and/or further referral. ClinicalTrials.gov Identifier NCT01550679 Registered 28 September 2014, retrospectively registered.
-
De Jesus, Margarita C; Ingle, Brandall L; Barakat, Khaldoon A; Shrestha, Bisesh; Slavens, Kerri D; Cundari, Thomas R; Anderson, Mary E
2014-10-01
The obligate homodimer human glutathione synthetase (hGS) provides an ideal system for exploring the role of protein-protein interactions in the structural stability, activity and allostery of enzymes. The two active sites of hGS, which are 40 Å apart, display allosteric modulation by the substrate γ-glutamylcysteine (γ-GC) during the synthesis of glutathione, a key cellular antioxidant. The two subunits interact at a relatively small dimer interface dominated by electrostatic interactions between S42, R221, and D24. Alanine scans of these sites result in enzymes with decreased activity, altered γ-GC affinity, and decreased thermal stability. Molecular dynamics simulations indicate these mutations disrupt interchain bonding and impact the tertiary structure of hGS. While the ionic hydrogen bonds and salt bridges between S42, R221, and D24 do not mediate allosteric communication in hGS, these interactions have a dramatic impact on the activity and structural stability of the enzyme.
-
Hypotheses to explain the origin of species in Amazonia.
Haffer, J
2008-11-01
The main hypotheses proposed to explain barrier formation separating populations and causing the differentiation of species in Amazonia during the course of geological history are based on different factors, as follow: (1) Changes in the distribution of land and sea or in the landscape due to tectonic movements or sea level fluctuations (Paleogeography hypothesis), (2) the barrier effect of Amazonian rivers (River hypothesis), (3) a combination of the barrier effect of broad rivers and vegetational changes in northern and southern Amazonia (River-refuge hypothesis), (4) the isolation of humid rainforest blocks near areas of surface relief in the periphery of Amazonia separated by dry forests, savannas and other intermediate vegetation types during dry climatic periods of the Tertiary and Quaternary (Refuge hypothesis), (5) changes in canopy-density due to climatic reversals (Canopy-density hypothesis) (6) the isolation and speciation of animal populations in small montane habitat pockets around Amazonia due to climatic fluctuations without major vegetational changes (Museum hypothesis), (7) competitive species interactions and local species isolations in peripheral regions of Amazonia due to invasion and counterinvasion during cold/warm periods of the Pleistocene (Disturbance-vicariance hypothesis) and (8) parapatric speciation across steep environmental gradients without separation of the respective populations (Gradient hypothesis). Several of these hypotheses probably are relevant to a different degree for the speciation processes in different faunal groups or during different geological periods. The basic paleogeography model refers mainly to faunal differentiation during the Tertiary and in combination with the Refuge hypothesis. Milankovitch cycles leading to global main hypotheses proposed to explain barrier formation separating populations and causing the differentiation of species in Amazonia during the course of geological history are based on different factors, as follow: (1) Changes in the distribution of land and sea or in the landscape due to tectonic movements or sea level fluctuations (Paleogeography hypothesis), (2) the barrier effect of Amazonian rivers (River hypothesis), (3) a combination of the barrier effect of broad rivers and vegetational changes in northern and southern Amazonia (River-refuge hypothesis), (4) the isolation of humid rainforest blocks near areas of surface relief in the periphery of Amazonia separated by dry forests, savannas and other intermediate vegetation types during dry climatic periods of the Tertiary and Quaternary (Refuge hypothesis), (5) changes in canopy-density due to climatic reversals (Canopy-density hypothesis) (6) the isolation and speciation of animal populations in small montane habitat pockets around Amazonia due to climatic fluctuations without major vegetational changes (Museum hypothesis), (7) competitive species interactions and local species isolations in peripheral regions of Amazonia due to invasion and counterinvasion during cold/warm periods of the Pleistocene (Disturbance-vicariance hypothesis) and (8) parapatric speciation across steep environmental gradients without separation of the respective populations (Gradient hypothesis). Several of these hypotheses probably are relevant to a different degree for the speciation processes in different faunal groups or during different geological periods. The basic paleogeography model refers mainly to faunal differentiation during the Tertiary and in combination with the Refuge hypothesis. Milankovitch cycles leading to global climatic-vegetational changes affected the biomes of the world not only during the Pleistocene but also during the Tertiary and earlier geological periods. New geoscientific evidence for the effect of dry climatic periods in Amazonia supports the predictions of the Refuge hypothesis. The disturbance-vicariance hypothesis refers to the presumed effect of cold/warm climatic phases of the Pleistocene only and is of limited general relevance because most extant species originated earlier and probably through paleogeographic changes and the formation of ecological refuges during the Tertiary.
-
Thorn, Jennifer M.; Bhattacharya, Keshab; Crutcher, Renata; Sperry, Justin; Isele, Colleen; Kelly, Barbara; Yates, Libbey; Zobel, James; Zhang, Ningli; Davis, Heather L.; McCluskie, Michael J.
2017-01-01
Smoking remains one of the major causes of morbidity and mortality worldwide. One approach to assisting smoking cessation is via anti-nicotine vaccines, composed of nicotine-like haptens conjugated to a carrier protein plus adjuvant(s). We have previously shown that the carrier, hapten, linker, hapten load, degree of conjugate aggregation, and presence of adducts can each influence the function (nicotine-binding capacity) of the antibody (Ab) induced. Herein, we extend those findings and show that tertiary structure is also critical to the induction of functional immune responses and that this can be influenced by conjugation conditions. We evaluated immunogenicity in mice using six lots of NIC7-CRM, a conjugate of 5-aminoethoxy-nicotine (Hapten 7), and a single point (glycine 52 to glutamic acid) mutant nontoxic form of diphtheria toxin, cross-reactive material 197 (CRM197), which were synthesized under different reaction conditions resulting in conjugates with equivalent molecular characteristics (hapten load, aggregates, adducts), but a different tertiary structure. When tested in mice, better functional responses (reduced nicotine in the brain of immunized animals relative to non-immunized controls) were obtained with conjugates with a more closed structure than those with an open conformation. These studies highlight the need for a better understanding of the physicochemical properties of small molecule conjugate vaccines. PMID:28513561
-
Amino acid sequence analysis of the annexin super-gene family of proteins.
Barton, G J; Newman, R H; Freemont, P S; Crumpton, M J
1991-06-15
The annexins are a widespread family of calcium-dependent membrane-binding proteins. No common function has been identified for the family and, until recently, no crystallographic data existed for an annexin. In this paper we draw together 22 available annexin sequences consisting of 88 similar repeat units, and apply the techniques of multiple sequence alignment, pattern matching, secondary structure prediction and conservation analysis to the characterisation of the molecules. The analysis clearly shows that the repeats cluster into four distinct families and that greatest variation occurs within the repeat 3 units. Multiple alignment of the 88 repeats shows amino acids with conserved physicochemical properties at 22 positions, with only Gly at position 23 being absolutely conserved in all repeats. Secondary structure prediction techniques identify five conserved helices in each repeat unit and patterns of conserved hydrophobic amino acids are consistent with one face of a helix packing against the protein core in predicted helices a, c, d, e. Helix b is generally hydrophobic in all repeats, but contains a striking pattern of repeat-specific residue conservation at position 31, with Arg in repeats 4 and Glu in repeats 2, but unconserved amino acids in repeats 1 and 3. This suggests repeats 2 and 4 may interact via a buried saltbridge. The loop between predicted helices a and b of repeat 3 shows features distinct from the equivalent loop in repeats 1, 2 and 4, suggesting an important structural and/or functional role for this region. No compelling evidence emerges from this study for uteroglobin and the annexins sharing similar tertiary structures, or for uteroglobin representing a derivative of a primordial one-repeat structure that underwent duplication to give the present day annexins. The analyses performed in this paper are re-evaluated in the Appendix, in the light of the recently published X-ray structure for human annexin V. The structure confirms most of the predictions and shows the power of techniques for the determination of tertiary structural information from the amino acid sequences of an aligned protein family.
-
Harms, Anton; Heredia-Rizo, Alberto M; Moseley, G Lorimer; Hau, Raphael; Stanton, Tasha R
2018-06-11
To assess the feasibility and clinical impact of brain-targeted treatment (BT; aiming to target sensorimotor processing) in knee osteoarthritis patients attending tertiary care. Randomized replicated case series. The study involved three phases, each of 2 weeks duration: (1) no-treatment phase; (2) BT phase (left/right judgments and touch discrimination training); and (3) usual care (education, strengthening, and stretching training). Primary outcomes were: timely recruitment; number of participants completing the interventions; treatment compliance and barriers; follow-up rates; and treatment impact on pain and function. Fear-avoidance beliefs and clinical measures of cortical body representation (tactile acuity and left/right judgment performance) were secondary outcomes. A total of 5% (19/355) of all assessed patients were eligible to participate and of these, 58% (11/19) agreed to participate. Ten patients completed the study, and 9 were successfully followed up, with treatment compliance varying between interventions. Compliance was poor for the touch discrimination component of BT. No significant effects were observed for pain relief or knee function after any treatment. A positive impact of treatment was found for fear-avoidance beliefs (usual care vs. washout, p = 0.007; BT vs. washout, p = 0.029) and left/right judgment accuracy (usual care vs. washout; p = 0.006). Clear barriers were identified to implementing BT in tertiary care for knee osteoarthritis. Access to all available services (especially the use of interpreters), and treatment options that do not require additional assistance to perform (e.g., touch discrimination training) represent the main lessons learned.
-
The influence of attention on mathematical knowledge of teachers and lecturers: a comparison
NASA Astrophysics Data System (ADS)
Klymchuk, Sergiy; Thomas, Michael O. J.
2011-10-01
This article reports on some findings from the project 'Analysing the Transition from Secondary to Tertiary Education in Mathematics'. One of the key variables in the school to university transition is the teacher/lecturer, and here, we deal with the data analysing secondary teachers' and tertiary lecturers' responses to four mathematics questions. Elsewhere, we consider knowledge, preparedness, teaching style, etc., but this article tracks the ability to use mathematical procedures. We hypothesize that this is a function of what we pay attention to, as described in Mason's discipline of noticing. The results reveal that many teachers and lecturers fail to notice the necessary conditions for problems that imply that procedures are not always applicable. Possible reasons for this along with implications for student learning are discussed.
-
Kurk, Toby; Adams, David G; Connell, Simon D; Thomson, Neil H
2010-05-01
Imaging signals derived from the atomic force microscope (AFM) are typically presented as separate adjacent images with greyscale or pseudo-colour palettes. We propose that information-rich false-colour composites are a useful means of presenting three-channel AFM image data. This method can aid the interpretation of complex surfaces and facilitate the perception of information that is convoluted across data channels. We illustrate this approach with images of filamentous cyanobacteria imaged in air and under aqueous buffer, using both deflection-modulation (contact) mode and amplitude-modulation (tapping) mode. Topography-dependent contrast in the error and tertiary signals aids the interpretation of the topography signal by contributing additional data, resulting in a more detailed image, and by showing variations in the probe-surface interaction. Moreover, topography-independent contrast and topography-dependent contrast in the tertiary data image (phase or friction) can be distinguished more easily as a consequence of the three dimensional colour-space.
-
Woll, Matthew G; Hadley, Erik B; Mecozzi, Sandro; Gellman, Samuel H
2006-12-20
We report a systematic evaluation of phenylalanine-to-pentafluorophenylalanine (Phe --> F5-Phe) mutants for the 35-residue chicken villin headpiece subdomain (c-VHP), the hydrophobic core of which features a cluster of three Phe side chains (residues 6, 10, and 17). Phe --> F5-Phe mutations are interesting because aryl-perfluoroaryl interactions of optimal geometry are intrinsically more favorable than aryl-aryl interactions and because perfluoroaryl units are more hydrophobic than are analogous aryl units. One mutant, Phe-10 --> F5-Phe, provides enhanced tertiary structural stability relative to the native sequence. The other six mutants analyzed caused a decrease in stability.
-
Neurotoxic effects of gasoline and gasoline constituents.
Burbacher, T M
1993-01-01
This overview was developed as part of a symposium on noncancer end points of gasoline and key gasoline components. The specific components included are methyl tertiary butyl ether, ethyl tertiary butyl ether, tertiary amyl methyl ether, butadiene, benzene, xylene, toluene, methyl alcohol, and ethyl alcohol. The overview focuses on neurotoxic effects related to chronic low-level exposures. A few general conclusions and recommendations can be made based on the results of the studies to date. a) All the compounds reviewed are neuroactive and, as such, should be examined for their neurotoxicity. b) For most of the compounds, there is a substantial margin of safety between the current permissible exposure levels and levels that would be expected to cause overt signs of neurotoxicity in humans. This is not the case for xylene, toluene, and methanol, however, where neurologic effects are observed at or below the current Threshold Limit Value. c) For most of the compounds, the relationship between chronic low-level exposure and subtle neurotoxic effects has not been studied. Studies therefore should focus on examining the dose-response relationship between chronic low-level exposure and subtle changes in central nervous system function. PMID:8020437
-
Dermer, Juri; Fuchs, Georg
2012-01-01
Cholesterol is a ubiquitous hydrocarbon compound that can serve as substrate for microbial growth. This steroid and related cyclic compounds are recalcitrant due to their low solubility in water, complex ring structure, the presence of quaternary carbon atoms, and the low number of functional groups. Aerobic metabolism therefore makes use of reactive molecular oxygen as co-substrate of oxygenases to hydroxylate and cleave the sterane ring system. Consequently, anaerobic metabolism must substitute oxygenase-catalyzed steps by O2-independent hydroxylases. Here we show that one of the initial reactions of anaerobic cholesterol metabolism in the β-proteobacterium Sterolibacterium denitrificans is catalyzed by an unprecedented enzyme that hydroxylates the tertiary C25 atom of the side chain without molecular oxygen forming a tertiary alcohol. This steroid C25 dehydrogenase belongs to the dimethyl sulfoxide dehydrogenase molybdoenzyme family, the closest relative being ethylbenzene dehydrogenase. It is a heterotrimer, which is probably located at the periplasmic side of the membrane and contains one molybdenum cofactor, five [Fe-S] clusters, and one heme b. The draft genome of the organism contains several genes coding for related enzymes that probably replace oxygenases in steroid metabolism. PMID:22942275
-
E-learning Constructive Role Plays for EFL Learners in China's Tertiary Education
ERIC Educational Resources Information Center
Shen, Lin; Suwanthep, Jitpanat
2011-01-01
Recently, speaking has played an increasingly important role in second/foreign language settings. However, in many Chinese universities, EFL students rarely communicate in English with other people effectively. The existing behavioristic role plays on New Horizon College English (NHCE) e-learning do not function successfully in supplementing EFL…
-
Different Aspects of the Monotonicity of a Function
ERIC Educational Resources Information Center
Tossavainen, Timo; Haukkanen, Pentti; Pesonen, Martti
2013-01-01
In this paper, we investigate which aspects are overriding in the concept images of monotonicity of Finnish tertiary mathematics students, i.e., on which aspects of monotonicity they base their argument in different types of exercises related to that concept. Further, we examine the relationship between the quality of principal aspects and the…
-
Teaching Univariate Measures of Location-Using Loss Functions
ERIC Educational Resources Information Center
Paolino, Jon-Paul
2018-01-01
This article presents a new method for introductory teaching of the sample mean, median and mode(s) from a univariate dataset. These basic statistical concepts are taught at various levels of education from elementary school curriculums to courses at the tertiary level. These descriptive measures of location can be taught as optimized solutions to…
-
ERIC Educational Resources Information Center
Midic, Uros
2012-01-01
Intrinsic disorder (ID) is defined as a lack of stable tertiary and/or secondary structure under physiological conditions in vitro. Intrinsically disordered proteins (IDPs) are highly abundant in nature. IDPs possess a number of crucial biological functions, being involved in regulation, recognition, signaling and control, e.g. their functional…
-
Structural Biology for A-Level Students
ERIC Educational Resources Information Center
Philip, Judith
2013-01-01
The relationship between the structure and function of proteins is an important area in biochemistry. Pupils studying A-level Biology are introduced to the four levels of protein structure (primary, secondary, tertiary and quaternary) and how these can be used to describe the progressive folding of a chain of amino acid residues to a final,…
-
pH-sensitive methacrylic copolymers and the production thereof
Mallapragada, Surya K.; Anderson, Brian C.; Bloom, Paul D.; Sheares Ashby, Valerie V.
2006-02-14
The present invention provides novel multi-functional methacrylic copolymers that exhibit cationic pH-sensitive behavior as well as good water solubility under acidic conditions. The copolymers are constructed from tertiary amine methacrylates and poly(ethylene glycol) containing methacrylates. The copolymers are useful as gene vectors, pharmaceutical carriers, and in protein separation applications.
-
pH-sensitive methacrylic copolymers and the production thereof
Mallapragada, Surya K.; Anderson, Brian C.; Bloom, Paul D.; Sheares Ashby, Valerie V.
2007-01-09
The present invention provides novel multi-functional methacrylic copolymers that exhibit cationic pH-sensitive behavior as well as good water solubility under acidic conditions. The copolymers are constructed from tertiary amine methacrylates and poly(ethylene glycol) containing methacrylates. The copolymers are useful as gene vectors, pharmaceutical carriers, and in protein separation applications.
-
Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.
Harris, M E; Pace, N R
1995-01-01
The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250
-
Eyrich, V A; Standley, D M; Friesner, R A
1999-05-14
We report the tertiary structure predictions for 95 proteins ranging in size from 17 to 160 residues starting from known secondary structure. Predictions are obtained from global minimization of an empirical potential function followed by the application of a refined atomic overlap potential. The minimization strategy employed represents a variant of the Monte Carlo plus minimization scheme of Li and Scheraga applied to a reduced model of the protein chain. For all of the cases except beta-proteins larger than 75 residues, a native-like structure, usually 4-6 A root-mean-square deviation from the native, is located. For beta-proteins larger than 75 residues, the energy gap between native-like structures and the lowest energy structures produced in the simulation is large, so that low RMSD structures are not generated starting from an unfolded state. This is attributed to the lack of an explicit hydrogen bond term in the potential function, which we hypothesize is necessary to stabilize large assemblies of beta-strands. Copyright 1999 Academic Press.
-
Solution structure of a small protein containing a fluorinated side chain in the core
Cornilescu, Gabriel; Hadley, Erik B.; Woll, Matthew G.; Markley, John L.; Gellman, Samuel H.; Cornilescu, Claudia C.
2007-01-01
We report the first high-resolution structure for a protein containing a fluorinated side chain. Recently we carried out a systematic evaluation of phenylalanine to pentafluorophenylalanine (Phe → F5-Phe) mutants for the 35-residue chicken villin headpiece subdomain (c-VHP), the hydrophobic core of which features a cluster of three Phe side chains (residues 6, 10, and 17). Phe → F5-Phe mutations are interesting because aryl–perfluoroaryl interactions of optimal geometry are intrinsically more favorable than either aryl–aryl or perfluoroaryl–perfluoroaryl interactions, and because perfluoroaryl units are more hydrophobic than are analogous aryl units. Only one mutation, Phe10 → F5-Phe, was found to provide enhanced tertiary structural stability relative to the native core (by ∼1 kcal/mol, according to guanidinium chloride denaturation studies). The NMR structure of this mutant, described here, reveals very little variation in backbone conformation or side chain packing relative to the wild type. Thus, although Phe → F5-Phe mutations offer the possibility of greater tertiary structural stability from side chain–side chain attraction and/or side chain desolvation, the constraints associated with the native c-VHP fold apparently prevent the modified polypeptide from taking advantage of this possibility. Our findings are important because they complement several studies that have shown that fluorination of saturated side chain carbon atoms can provide enhanced conformational stability. PMID:17123960
-
Structure of the immature HIV-1 capsid in intact virus particles at 8.8 Å resolution
NASA Astrophysics Data System (ADS)
Schur, Florian K. M.; Hagen, Wim J. H.; Rumlová, Michaela; Ruml, Tomáš; Müller, Barbara; Kräusslich, Hans-Georg; Briggs, John A. G.
2015-01-01
Human immunodeficiency virus type 1 (HIV-1) assembly proceeds in two stages. First, the 55 kilodalton viral Gag polyprotein assembles into a hexameric protein lattice at the plasma membrane of the infected cell, inducing budding and release of an immature particle. Second, Gag is cleaved by the viral protease, leading to internal rearrangement of the virus into the mature, infectious form. Immature and mature HIV-1 particles are heterogeneous in size and morphology, preventing high-resolution analysis of their protein arrangement in situ by conventional structural biology methods. Here we apply cryo-electron tomography and sub-tomogram averaging methods to resolve the structure of the capsid lattice within intact immature HIV-1 particles at subnanometre resolution, allowing unambiguous positioning of all α-helices. The resulting model reveals tertiary and quaternary structural interactions that mediate HIV-1 assembly. Strikingly, these interactions differ from those predicted by the current model based on in vitro-assembled arrays of Gag-derived proteins from Mason-Pfizer monkey virus. To validate this difference, we solve the structure of the capsid lattice within intact immature Mason-Pfizer monkey virus particles. Comparison with the immature HIV-1 structure reveals that retroviral capsid proteins, while having conserved tertiary structures, adopt different quaternary arrangements during virus assembly. The approach demonstrated here should be applicable to determine structures of other proteins at subnanometre resolution within heterogeneous environments.
-
Halland, M; Ravi, K; Barlow, J; Arora, A
2016-01-01
Barium esophagrams are a frequently performed test, and radiological observations about potential abnormal esophageal motility, such as tertiary contractions, are commonly reported. We sought to assess the correlation between tertiary waves, and in particular isolated tertiary waves, on esophagrams and findings on non-synchronous high-resolution esophageal manometry. We retrospectively reviewed reports of esophagrams performed at a tertiary referral center and identified patients in whom tertiary waves were observed and a high-resolution esophageal manometry had been performed. We defined two groups; group 1 was defined as patients with isolated tertiary waves, whereas group 2 had tertiary waves and evidence of achalasia or an obstructing structural abnormality on the esophagram. We collected data on demographics, dysphagia score, associated findings on esophagram, and need for intervention. We reviewed the reports of 2100 esophagrams of which tertiary waves were noted as an isolated abnormality in 92, and in association with achalasia or a structural obstruction in 61. High-resolution manometry was performed in 17 patients in group 1, and five had evidence of a significant esophageal motility disorder and 4 required any intervention. Twenty-one patients in group 2 underwent manometry, and 18 had a significant esophageal motility disorder. An isolated finding of tertiary waves on an esophagram is rarely associated with a significant esophageal motility disorder that requires intervention. All patients with isolated tertiary waves who required intervention had a dysphagia to liquids. Tertiary contractions, in the absence of dysphagia to liquids, indicate no significant esophageal motility disorder. © 2014 International Society for Diseases of the Esophagus.
-
Worm-Smeitink, M; Nikolaus, S; Goldsmith, K; Wiborg, J; Ali, S; Knoop, H; Chalder, T
2016-08-01
Cognitive behaviour therapy (CBT) reduces fatigue and disability in chronic fatigue syndrome (CFS). However, outcomes vary between studies, possibly because of differences in patient characteristics, treatment protocols, diagnostic criteria and outcome measures. The objective was to compare outcomes after CBT in tertiary treatment centres in the Netherlands (NL) and the United Kingdom (UK), using different treatment protocols but identical outcome measures, while controlling for differences in patient characteristics and diagnostic criteria. Consecutively referred CFS patients who received CBT were included (NL: n=293, UK: n=163). Uncontrolled effect sizes for improvement in fatigue (Chalder Fatigue Questionnaire), physical functioning (SF-36 physical functioning subscale) and social functioning (Work and Social Adjustment Scale) were compared. Multiple regression analysis was used to examine whether patient differences explained outcome differences between centres. Effect sizes differed between centres for fatigue (Cohen's D NL=1.74, 95% CI=1.52-1.95; UK=0.99, CI=0.73-1.25), physical functioning (NL=0.99, CI=0.81-1.18; UK=0.33, CI=0.08-0.58) and social functioning (NL=1.47, CI=1.26-1.69; UK=0.61, CI=0.35-0.86). Patients in the UK had worse physical functioning at baseline and there were minor demographic differences. These could not explain differences in centre outcome. Effectiveness of CBT differed between treatment centres. Differences in treatment protocols may explain this and should be investigated to help further improve outcomes. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot
NASA Technical Reports Server (NTRS)
Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.
1999-01-01
Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.
-
Using Agent Based Modeling (ABM) to Develop Cultural Interaction Simulations
NASA Technical Reports Server (NTRS)
Drucker, Nick; Jones, Phillip N.
2012-01-01
Today, most cultural training is based on or built around "cultural engagements" or discrete interactions between the individual learner and one or more cultural "others". Often, success in the engagement is the end or the objective. In reality, these interactions usually involve secondary and tertiary effects with potentially wide ranging consequences. The concern is that learning culture within a strict engagement context might lead to "checklist" cultural thinking that will not empower learners to understand the full consequence of their actions. We propose the use of agent based modeling (ABM) to collect, store, and, simulating the effects of social networks, promulgate engagement effects over time, distance, and consequence. The ABM development allows for rapid modification to re-create any number of population types, extending the applicability of the model to any requirement for social modeling.
-
ALS-causing profilin-1-mutant forms a non-native helical structure in membrane environments.
Lim, Liangzhong; Kang, Jian; Song, Jianxing
2017-11-01
Despite having physiological functions completely different from superoxide dismutase 1 (SOD1), profilin 1 (PFN1) also carries mutations causing amyotrophic lateral sclerosis (ALS) with a striking similarity to that triggered by SOD1 mutants. Very recently, the C71G-PFN1 has been demonstrated to cause ALS by a gain of toxicity and the acceleration of motor neuron degeneration preceded the accumulation of its aggregates. Here by atomic-resolution NMR determination of conformations and dynamics of WT-PFN1 and C71G-PFN1 in aqueous buffers and in membrane mimetics DMPC/DHPC bicelle and DPC micelle, we deciphered that: 1) the thermodynamic destabilization by C71G transforms PFN1 into coexistence with the unfolded state, which is lacking of any stable tertiary/secondary structures as well as restricted ps-ns backbone motions, thus fundamentally indistinguishable from ALS-causing SOD1 mutants. 2) Most strikingly, while WT-PFN1 only weakly interacts with DMPC/DHPC bicelle without altering the native structure, C71G-PFN1 acquires abnormal capacity in strongly interacting with DMPC/DHPC bicelle and DPC micelle, energetically driven by transforming the highly disordered unfolded state into a non-native helical structure, similar to what has been previously observed on ALS-causing SOD1 mutants. Our results imply that one potential mechanism for C71G-PFN1 to initiate ALS might be the abnormal interaction with membranes as recently established for SOD1 mutants. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Lahari, Challa; Jasti, Lakshmi S; Fadnavis, Nitin W; Sontakke, Kalpana; Ingavle, Ganesh; Deokar, Sarika; Ponrathnam, Surendra
2010-01-19
Effects of changes in hydrophobicity of polymeric support on structure and activity of alpha-chymotrypsin (E.C. 3.4.21.1) have been studied with copolymers of allyl glycidyl ether (AGE) and ethylene glycol dimethacrylate (EGDM) with increasing molar ratio of EGDM to AGE (cross-link density 0.05 to 1.5). The enzyme is readily adsorbed from aqueous buffer at room temperature following Langmuir adsorption isotherms in unexpectedly large amounts (25% w/w). Relative hydrophobicity of the copolymers has been assessed by studying adsorption of naphthalene and Fmoc-methionine by the series of copolymers from aqueous solutions. Polymer hydrophobicity appears to increase linearly on increasing cross-link density from 0.05 to 0.25. Further increase in cross-link density causes a decrease in naphthalene binding but has little effect on binding of Fmoc-Met. Binding of alpha-chymotrypsin to these copolymers follow the trend for Fmoc-methionine binding, rather than naphthalene binding, indicating involvement of polar interactions along with hydrophobic interactions during binding of protein to the polymer. The adsorbed enzyme undergoes extensive denaturation (ca. 80%) with loss of both tertiary and secondary structure on contact with the copolymers as revealed by fluorescence, CD and Raman spectra of the adsorbed protein. Comparison of enzyme adsorption behavior with Eupergit C, macroporous Amberlite XAD-2, and XAD-7 suggests that polar interactions of the EGDM ester functional groups with the protein play a significant role in enzyme denaturation.
-
Experiences of employed women with attention deficit hyperactive disorder: A phenomenological study.
Schreuer, N; Dorot, R
2017-01-01
Employees with attention-deficit/hyperactivity disorder (ADHD) face various risks in the workplace. Little is known of the specific challenges women with ADHD experience. To explore the experiences of working women with ADHD and learn the strategies and accommodations that facilitate their maintaining employment. Qualitative phenomenological approach was used to echo women's subjective perceptions and experiences representing their daily interactions in their workplace. In-depth interviews were conducted with eleven tertiary-educated employed women (M = 33.5; SD = 6.61 years), diagnosed with ADHD and the transcripts were analyzed by three researchers, using the qualitative phenomenological approach. Most interviewed women with ADHD described interactions with their workplace as confusing, overwhelming, and chaotic. They perceived their ADHD as a significant obstacle to success in employment that also conferred some advantages. Three interview themes are explored here (1) challenges in coping with job demands and the workplace, including the disclosure dilemma; (2) personal coping strategies; (3) useful accommodations. For the women interviewed, employment was important for their self-identity, beyond simply making a living. Their experiences indicate impaired executive functioning and inhibition and sensory sensitivity, consistently with theoretical models for ADHD. They identified gender-specific issues, such as using medication during pregnancy, which led them to seek for non-pharmacological coping mechanisms. They contributed practical knowledge regarding employee-led adaptations and employer-provided workplace accommodations.
-
Zhou, Hongyuan; George, Saji; Hay, Crystal; Lee, Joel; Qian, He; Sun, Xiulan
2017-05-01
To understand the combinatorial toxicity of mycotoxins, we measured the effects of individual, binary and tertiary combinations of Aflatoxin B 1 (AFB 1 ), Deoxynivalenol (DON) and Zearalenone (ZEN) on the cell viability and cellular perturbations of HepG2 and RAW 264.7 cells. The nature of mycotoxins interactions was assessed using mathematical modeling (Chou-Talalay). Mechanisms of cytotoxicity were studied using high content screening (HCS) that probed cytotoxicity responses, such as changes in intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), intracellular calcium ([Ca 2+ ] i ) flux, and cell membrane damage. Our results showed that individual cytotoxicity of mycotoxins in a decreasing order was DON>AFB 1 >ZEN. Varying combinations of mycotoxins at differing concentrations showed different types of interactions. Most of the mixtures showed increasing toxic effects-synergism and/or addition while antagonistic effects were observed with combination of AFB 1 +ZEN. Generally, combination of mycotoxins showed significantly increased intracellular ROS production and [Ca 2+ ] i flux, and decreased MMP in both cell lines, showing that the synergistic and additive effects of mycotoxin combination originate from perturbations of multiple cellular functions. Additionally, this study demonstrated the applicability of HCS for gaining mechanistic understanding on the toxicity of individual as well as combinatorial mycotoxins, and also provided scientific bases for formulating regulatory policies. Copyright © 2017. Published by Elsevier Ltd.
-
Sharma, Ronesh; Bayarjargal, Maitsetseg; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-01-21
Intrinsically Disordered Proteins (IDPs) lack stable tertiary structure and they actively participate in performing various biological functions. These IDPs expose short binding regions called Molecular Recognition Features (MoRFs) that permit interaction with structured protein regions. Upon interaction they undergo a disorder-to-order transition as a result of which their functionality arises. Predicting these MoRFs in disordered protein sequences is a challenging task. In this study, we present MoRFpred-plus, an improved predictor over our previous proposed predictor to identify MoRFs in disordered protein sequences. Two separate independent propensity scores are computed via incorporating physicochemical properties and HMM profiles, these scores are combined to predict final MoRF propensity score for a given residue. The first score reflects the characteristics of a query residue to be part of MoRF region based on the composition and similarity of assumed MoRF and flank regions. The second score reflects the characteristics of a query residue to be part of MoRF region based on the properties of flanks associated around the given residue in the query protein sequence. The propensity scores are processed and common averaging is applied to generate the final prediction score of MoRFpred-plus. Performance of the proposed predictor is compared with available MoRF predictors, MoRFchibi, MoRFpred, and ANCHOR. Using previously collected training and test sets used to evaluate the mentioned predictors, the proposed predictor outperforms these predictors and generates lower false positive rate. In addition, MoRFpred-plus is a downloadable predictor, which makes it useful as it can be used as input to other computational tools. https://github.com/roneshsharma/MoRFpred-plus/wiki/MoRFpred-plus:-Download. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Antonucci, Alessandra; Kupis-Rozmysłowicz, Justyna; Boghossian, Ardemis A
2017-04-05
The exquisite structural and optical characteristics of single-walled carbon nanotubes (SWCNTs), combined with the tunable specificities of proteins and peptides, can be exploited to strongly benefit technologies with applications in fields ranging from biomedicine to industrial biocatalysis. The key to exploiting the synergism of these materials is designing protein/peptide-SWCNT conjugation schemes that preserve biomolecule activity while keeping the near-infrared optical and electronic properties of SWCNTs intact. Since sp 2 bond-breaking disrupts the optoelectronic properties of SWCNTs, noncovalent conjugation strategies are needed to interface biomolecules to the nanotube surface for optical biosensing and delivery applications. An underlying understanding of the forces contributing to protein and peptide interaction with the nanotube is thus necessary to identify the appropriate conjugation design rules for specific applications. This article explores the molecular interactions that govern the adsorption of peptides and proteins on SWCNT surfaces, elucidating contributions from individual amino acids as well as secondary and tertiary protein structure and conformation. Various noncovalent conjugation strategies for immobilizing peptides, homopolypeptides, and soluble and membrane proteins on SWCNT surfaces are presented, highlighting studies focused on developing near-infrared optical sensors and molecular scaffolds for self-assembly and biochemical analysis. The analysis presented herein suggests that though direct adsorption of proteins and peptides onto SWCNTs can be principally applied to drug and gene delivery, in vivo imaging and targeting, or cancer therapy, nondirect conjugation strategies using artificial or natural membranes, polymers, or linker molecules are often better suited for biosensing applications that require conservation of biomolecular functionality or precise control of the biomolecule's orientation. These design rules are intended to provide the reader with a rational approach to engineering biomolecule-SWCNT platforms, broadening the breadth and accessibility of both wild-type and engineered biomolecules for SWCNT-based applications.
-
Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors
Chikhi, Rayan; Sael, Lee; Kihara, Daisuke
2010-01-01
Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259
-
Real-time ligand binding pocket database search using local surface descriptors.
Chikhi, Rayan; Sael, Lee; Kihara, Daisuke
2010-07-01
Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.
-
Light-induced cross-linking and post-cross-linking modification of polyglycidol.
Marquardt, F; Bruns, M; Keul, H; Yagci, Y; Möller, M
2018-02-08
The photoinduced radical generation process has received renewed interest due to its economic and ecological appeal. Herein the light-induced cross-linking of functional polyglycidol and its post-cross-linking modification are presented. Linear polyglycidol was first functionalized with a tertiary amine in a two-step reaction. Dimethylaminopropyl functional polyglycidol was cross-linked in a UV-light mediated reaction with camphorquinone as a type II photoinitiator. The cross-linked polyglycidol was further functionalized by quaternization with various organoiodine compounds. Aqueous dispersions of the cross-linked polymers were investigated by means of DLS and zeta potential measurements. Polymer films were evaluated by DSC and XPS.
-
Coudray, Laëtitia
2012-01-01
Summary The reactions of phosphinylidene-containing compounds with unactivated unsaturated hydrocarbons are reviewed. The review is organized by phosphorus-containing functional group types. Free-radical and metal-catalyzed additions of R1R2P(O)H to alkenes, alkynes, and related compounds, deliver functionalized organophosphorus compounds RP(O)R1R2, including H-phosphinates, phosphinates, tertiary phosphine oxides, and phosphonates. The review covers the literature up to February 2008. PMID:23308039
-
Photochemical dimerization and functionalization of alkanes, ethers, primary alcohols and silanes
Crabtree, Robert H.; Brown, Stephen H.
1988-01-01
The space-time yield and/or the selectivity of the photochemical dimerization of alkanes, ethers, primary alcohols and tertiary silanes with Hg and U.V. light is enhanced by refluxing the substrate in the irradiated reaction zone at a temperature at which the dimer product condenses and remains condensed promptly upon its formation. Cross-dimerization of the alkanes, ethers and silanes with primary alcohols is disclosed, as is the functionalization to aldehydes of the alkanes with carbon monoxide.
-
Photochemical dimerization and functionalization of alkanes, ethers, primary alcohols and silanes
Crabtree, R.H.; Brown, S.H.
1988-02-16
The space-time yield and/or the selectivity of the photochemical dimerization of alkanes, ethers, primary alcohols and tertiary silanes with Hg and U.V. light is enhanced by refluxing the substrate in the irradiated reaction zone at a temperature at which the dimer product condenses and remains condensed promptly upon its formation. Cross-dimerization of the alkanes, ethers and silanes with primary alcohols is disclosed, as is the functionalization to aldehydes of the alkanes with carbon monoxide.
-
Investigation on potential enzyme toxicity of clenbuterol to trypsin
NASA Astrophysics Data System (ADS)
Chai, Jun; Xu, Qifei; Dai, Jinping; Liu, Rutao
2013-03-01
Clenbuterol (CLB) is a kind of β2-adrenergic agonists which was illegally used as feed additives nowadays. The toxic interaction of CLB with trypsin, an important digestive enzyme, was studied in vitro using multi-spectroscopic methods and molecular modeling methods. CLB was proved to bind with trypsin in S1 pocket, forming a complex driven by the dominant force of H-bond. The binding constant was calculated to be 1.79887 × 105 L mol-1 at 289 K and 0.32584 × 105 L mol-1 at 310 K, respectively. The skeleton of trypsin became loosened and unfolded with the amino residues microenvironment changed. The secondary and tertiary structure of trypsin also varied. Molecular modeling studies illustrated specific display of the binding information and explained most of the experiment phenomena. The binding site of CLB induced the fluorescence quenching as well as inhibition of enzyme activity of trypsin. The study confirmed that CLB had potential toxicity on both the structure and function of trypsin and the effects enhanced with the increasing concentration of CLB.
-
Compatibilizing Bulk Polymer Blends by Using Organoclays
NASA Astrophysics Data System (ADS)
Si, Mayu; Gersappe, Dilip; Zhang, Wenhua; Ade, Harald; Rafailovich, Miriam; Sokolov, Jonathan; Rudomen, Gregory; Schwartz, Bradley; Fisher, Robert
2004-03-01
We investigated the compatiblizing performance of organoclays on melt mixed binary and tertiary polymer blends, such as, PS/PMMA, PC/SAN, PS/PMMA/PVC and PS/PMMA/PE. These polymer blends were characterized by TEM, STXM, DSC and DMA. TEM and STXM photographs show that the addition of organoclays into polymer blends drastically reduces the average domain size of the component phases. And the organoclay goes to the interfacial region between the different polymers and effectively slows down the domain size increasing during high temperature annealing. DMA and DSC results show the effect of organoclays on the mechanical properties and glass transitions temperature, which indicates the compatibilization on the molecular level. The generalized compatibilization induced by the nanoscale fillers for blends can be explained in terms of mean field models where the reduction of interfacial tension induced by in-situ grafting is counterbalanced by the increased bending energy due to the rigidity of the filler. This in turn can be shown to be a function of the degree of exfoliation, aspect ratio, and polymer filler interactions. Supported by NSF funded MRSEC at Stony Brook
-
Koizumi, Taichi; Terada, Tohru; Nakajima, Ken-ichiro; Kojima, Masaki; Koshiba, Seizo; Matsumura, Yoshitaka; Kaneda, Kohei; Asakura, Tomiko; Shimizu-Ibuka, Akiko; Abe, Keiko; Misaka, Takumi
2015-01-01
Neoculin (NCL) is a heterodimeric protein isolated from the edible fruit of Curculigo latifolia. It exerts a taste-modifying activity by converting sourness to sweetness. We previously demonstrated that NCL changes its action on the human sweet receptor hT1R2-hT1R3 from antagonism to agonism as the pH changes from neutral to acidic values, and that the histidine residues of NCL molecule play critical roles in this pH-dependent functional change. Here, we comprehensively screened key amino acid residues of NCL using nuclear magnetic resonance (NMR) spectroscopy and alanine scanning mutagenesis. We found that the mutations of Arg48, Tyr65, Val72 and Phe94 of NCL basic subunit increased or decreased both the antagonist and agonist activities. The mutations had only a slight effect on the pH-dependent functional change. These residues should determine the affinity of NCL for the receptor regardless of pH. Their locations were separated from the histidine residues responsible for the pH-dependent functional change in the tertiary structure. From these results, we concluded that NCL interacts with hT1R2-hT1R3 through a pH-independent affinity interface including the four residues and a pH-dependent activation interface including the histidine residues. Thus, the receptor activation is induced by local structural changes in the pH-dependent interface. PMID:26263392
-
Computational-based structural, functional and phylogenetic analysis of Enterobacter phytases.
Pramanik, Krishnendu; Kundu, Shreyasi; Banerjee, Sandipan; Ghosh, Pallab Kumar; Maiti, Tushar Kanti
2018-06-01
Myo-inositol hexakisphosphate phosphohydrolases (i.e., phytases) are known to be a very important enzyme responsible for solubilization of insoluble phosphates. In the present study, Enterobacter phytases have characterized by different phylogenetic, structural and functional parameters using some standard bio-computational tools. Results showed that majority of the Enterobacter phytases are acidic in nature as most of the isoelectric points were under 7.0. The aliphatic indices predicted for the selected proteins were below 40 indicating their thermostable nature. The average molecular weight of the proteins was 48 kDa. The lower values of GRAVY of the said proteins implied that they have better interactions with water. Secondary structure prediction revealed that alpha-helical content was highest among the other forms such as sheets, coils, etc. Moreover, the predicted 3D structure of Enterobacter phytases divulged that the proteins consisted of four monomeric polypeptide chains i.e., it was a tetrameric protein. The predicted tertiary model of E. aerogenes (A0A0M3HCJ2) was deposited in Protein Model Database (Acc. No.: PM0080561) for further utilization after a thorough quality check from QMEAN and SAVES server. Functional analysis supported their classification as histidine acid phosphatases. Besides, multiple sequence alignment revealed that "DG-DP-LG" was the most highly conserved residues within the Enterobacter phytases. Thus, the present study will be useful in selecting suitable phytase-producing microbe exclusively for using in the animal food industry as a food additive.
-
Spatial pattern enhances ecosystem functioning in an African savanna.
Pringle, Robert M; Doak, Daniel F; Brody, Alison K; Jocqué, Rudy; Palmer, Todd M
2010-05-25
The finding that regular spatial patterns can emerge in nature from local interactions between organisms has prompted a search for the ecological importance of these patterns. Theoretical models have predicted that patterning may have positive emergent effects on fundamental ecosystem functions, such as productivity. We provide empirical support for this prediction. In dryland ecosystems, termite mounds are often hotspots of plant growth (primary productivity). Using detailed observations and manipulative experiments in an African savanna, we show that these mounds are also local hotspots of animal abundance (secondary and tertiary productivity): insect abundance and biomass decreased with distance from the nearest termite mound, as did the abundance, biomass, and reproductive output of insect-eating predators. Null-model analyses indicated that at the landscape scale, the evenly spaced distribution of termite mounds produced dramatically greater abundance, biomass, and reproductive output of consumers across trophic levels than would be obtained in landscapes with randomly distributed mounds. These emergent properties of spatial pattern arose because the average distance from an arbitrarily chosen point to the nearest feature in a landscape is minimized in landscapes where the features are hyper-dispersed (i.e., uniformly spaced). This suggests that the linkage between patterning and ecosystem functioning will be common to systems spanning the range of human management intensities. The centrality of spatial pattern to system-wide biomass accumulation underscores the need to conserve pattern-generating organisms and mechanisms, and to incorporate landscape patterning in efforts to restore degraded habitats and maximize the delivery of ecosystem services.
-
Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.
2015-01-01
In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258
-
Interactions and encapsulation of vitamins C, B3, and B6 with dendrimers in water.
Boisselier, Elodie; Liang, Liyuan; Dalko-Csiba, Maria; Ruiz, Jaime; Astruc, Didier
2010-05-25
Titrations of commercial diaminobutane (DAB) and polyamidoamine (PAMAM) dendrimers by vitamins C (ascorbic acid, AA), B(3) (nicotinic acid), and B(6) (pyridoxine) were monitored by (1)H NMR spectroscopy using the chemical shifts of both dendrimer and vitamin protons and analyzed by comparison with the titration of propylamine. Quaternarizations of the terminal primary amino groups and intradendritic tertiary amino groups, which are nearly quantitative with vitamin C, were characterized by more or less sharp variations (Deltadelta) of the (1)H chemical shift (delta) at the equivalence points. The peripheral primary amino groups of the DAB dendrimers were quaternarized first, but not selectively, whereas a sharp chemical-shift variation was recorded for the inner methylene protons near the tertiary amines, thereby indicating encapsulation, when all the dendritic amines were quaternarized. With DAB-G5-64-NH(2), some excess acid is required to protonate the inner amino groups, presumably because of basicity decrease due to excess charge repulsion. On the other hand, this selectivity was not observed with PAMAM dendrimers. The special case of the titration of the dendrimers by vitamin B(6) indicates only dominant supramolecular hydrogen-bonding interactions and no quaternarization, with core amino groups being privileged, which indicates the strong tendency to encapsulate vitamins. With vitamin B(3), a carboxylic acid, titration of DAB-G3-16-NH(2) shows that only six peripheral amino groups are protonated on average, even with excess vitamin B(3), because protonation is all the more difficult due to increased charge repulsion, as positive charges accumulate around the dendrimer. Inner amino groups interact with this vitamin, however, thus indicating encapsulation presumably with supramolecular hydrogen bonding without much charge transfer.
-
Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1
Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong; ...
2016-09-01
DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less
-
Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong
DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less
-
Managing vegetation in surface-flow wastewater-treatment wetlands for optimal treatment performance
Thullen, J.S.; Sartoris, J.J.; Nelson, S.M.
2005-01-01
Constructed wetlands that mimic natural marshes have been used as low-cost alternatives to conventional secondary or tertiary wastewater treatment in the U.S. for at least 30 years. However, the general level of understanding of internal treatment processes and their relation to vegetation and habitat quality has not grown in proportion to the popularity of these systems. We have studied internal processes in surface-flow constructed wastewater-treatment wetlands throughout the southwestern U.S. since 1990. At any given time, the water quality, hydraulics, water temperature, soil chemistry, available oxygen, microbial communities, macroinvertebrates, and vegetation each greatly affect the treatment capabilities of the wetland. Inside the wetland, each of these components plays a functional role and the treatment outcome depends upon how the various components interact. Vegetation plays a uniquely important role in water treatment due to the large number of functions it supports, particularly with regard to nitrogen transformations. However, it has been our experience that vegetation management is critical for achieving and sustaining optimal treatment function. Effective water treatment function and good wildlife quality within a surface-flow constructed wetland depend upon the health and sustainability of the vegetation. We suggest that an effective tool to manage and sustain healthy vegetation is the use of hummocks, which are shallow emergent plant beds within the wetland, positioned perpendicular to the water flow path and surrounded by water sufficiently deep to limit further emergent vegetation expansion. In this paper, we describe the use of a hummock configuration, in conjunction with seasonal water level fluctuations, to manage the vegetation and maintain the treatment function of wastewater-treatment wetlands on a sustainable basis.
-
The adaptive evolution of the mammalian mitochondrial genome
da Fonseca, Rute R; Johnson, Warren E; O'Brien, Stephen J; Ramos, Maria João; Antunes, Agostinho
2008-01-01
Background The mitochondria produce up to 95% of a eukaryotic cell's energy through oxidative phosphorylation. The proteins involved in this vital process are under high functional constraints. However, metabolic requirements vary across species, potentially modifying selective pressures. We evaluate the adaptive evolution of 12 protein-coding mitochondrial genes in 41 placental mammalian species by assessing amino acid sequence variation and exploring the functional implications of observed variation in secondary and tertiary protein structures. Results Wide variation in the properties of amino acids were observed at functionally important regions of cytochrome b in species with more-specialized metabolic requirements (such as adaptation to low energy diet or large body size, such as in elephant, dugong, sloth, and pangolin, and adaptation to unusual oxygen requirements, for example diving in cetaceans, flying in bats, and living at high altitudes in alpacas). Signatures of adaptive variation in the NADH dehydrogenase complex were restricted to the loop regions of the transmembrane units which likely function as protons pumps. Evidence of adaptive variation in the cytochrome c oxidase complex was observed mostly at the interface between the mitochondrial and nuclear-encoded subunits, perhaps evidence of co-evolution. The ATP8 subunit, which has an important role in the assembly of F0, exhibited the highest signal of adaptive variation. ATP6, which has an essential role in rotor performance, showed a high adaptive variation in predicted loop areas. Conclusion Our study provides insight into the adaptive evolution of the mtDNA genome in mammals and its implications for the molecular mechanism of oxidative phosphorylation. We present a framework for future experimental characterization of the impact of specific mutations in the function, physiology, and interactions of the mtDNA encoded proteins involved in oxidative phosphorylation. PMID:18318906
-
Buckets and Fire: Metaphors in Tertiary Teaching
ERIC Educational Resources Information Center
Emerson, Lisa; Mansvelt, Juliana
2015-01-01
This paper examines New Zealand tertiary teachers' use of metaphor and their attitudes to the consumer metaphor in relation to teaching. Based on interviews with 16 tertiary teachers, this study shows that although teachers believe the consumer metaphor is accepted by students, tertiary institutions and policy makers, and that it has affected…
-
Philippines: The Role of Language and Education in Globalization
ERIC Educational Resources Information Center
Quijano, Consuelo A.
2012-01-01
International education has never been discussed in-depth by many citizens of the Philippines. International education refers to a study abroad program or an approach to prepare students to function in a global society. The focus of discussion is more on primary, secondary, and tertiary education. In any level of education, language plays a vital…
-
USDA-ARS?s Scientific Manuscript database
Despite the fact that the American Academy of Pediatrics suggests that general pediatricians (PED) manage children with FAP/IBS without alarm signs many children are cared for by pediatric gastroenterologists (GI). In a longitudinal examination of physical symptoms, healthcare use, quality of life (...
-
ERIC Educational Resources Information Center
Davidowitz, B.; Schreiber, B.
2008-01-01
Several studies have emphasised the importance of addressing social and emotional factors in facilitating adjustment to tertiary education. This article describes the Skills for Success in Science programme at the University of Cape Town. The broad aims were life skills development and improved adjustment which are assumed to underpin academic…
-
Sarangapani, Prasad S; Weaver, Justin; Parupudi, Arun; Besong, Tabot M D; Adams, Gary G; Harding, Stephen E; Manikwar, Prakash; Castellanos, Maria M; Bishop, Steven M; Pathak, Jai A
2016-12-01
The role of antibody structure (conformation) in solution rheology is probed. It is demonstrated here that pH-dependent changes in the tertiary structure of 2 mAb solutions lead to viscoelasticity and not merely a shear viscosity (η) increase. Steady shear flow curves on mAb solutions are reported over broad pH (3.0 ≤ pH ≤ 8.7) and concentration (2 mg/mL ≤ c ≤ 120 mg/mL) ranges to comprehensively characterize their rheology. Results are interpreted using size exclusion chromatography, differential scanning calorimetry, analytical ultracentrifugation, near-UV circular dichroism, and dynamic light scattering. Changes in tertiary structure with concentration lead to elastic yield stress and increased solution viscosity in solution of "mAb1." These findings are supported by dynamic light scattering and differential scanning calorimetry, which show increased hydrodynamic radius of mAb1 at low pH and a reduced melting temperature T m , respectively. Conversely, another molecule at 120 mg/mL solution concentration is a strong viscoelastic gel due to perturbed tertiary structure (seen in circular dichroism) at pH 3.0, but the same molecule responds as a viscous liquid due to reversible self-association at pH 7.4 (verified by analytical ultracentrifugation). Both protein-protein interactions and structural perturbations govern pH-dependent viscoelasticity of mAb solutions. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
-
Nakajima, Minami; Oda, Yukiko; Wada, Takamasa; Minamikawa, Ryo; Shirokane, Kenji; Sato, Takaaki; Chida, Noritaka
2014-12-22
As the complexity of targeted molecules increases in modern organic synthesis, chemoselectivity is recognized as an important factor in the development of new methodologies. Chemoselective nucleophilic addition to amide carbonyl centers is a challenge because classical methods require harsh reaction conditions to overcome the poor electrophilicity of the amide carbonyl group. We have successfully developed a reductive nucleophilic addition of mild nucleophiles to tertiary amides, secondary amides, and N-methoxyamides that uses the Schwartz reagent [Cp2 ZrHCl]. The reaction took place in a highly chemoselective fashion in the presence of a variety of sensitive functional groups, such as methyl esters, which conventionally require protection prior to nucleophilic addition. The reaction will be applicable to the concise synthesis of complex natural alkaloids from readily available amide groups. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Peng, Yu; Luo, Long; Yan, Chang-Song; Zhang, Jian-Jian; Wang, Ya-Wen
2013-11-01
A room-temperature Ni-catalyzed reductive approach to homocoupling of unactivated primary, secondary, and tertiary alkyl bromides is described. The catalytic system can be easily generated from air-stable and cheap materials and demonstrates broad functional group tolerance, thus allowing facile access to useful dimeric triterpene and lignan-like molecules. Moreover, the dimerization of tertiary bromide 6 efficiently establishes sterically hindered vicinal quaternary carbons (C3a and C3a'), which is a key linkage of intriguing bispyrrolo[2,3-b]indoline alkaloids, thereby enabling us to complete the total syntheses of racemic chimonanthine (9) and folicanthine (10). In addition, this dimerization method can be expanded to the highly stereoselective synthesis of bisperhydrofuro[2,3-b]furan (5a) and the dimeric spiroketal 5b, signifying the involvement of possible radical species.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heltzel, J.; Scouten Ponticelli, S; Sanders, L
2009-01-01
Sliding clamp proteins topologically encircle DNA and play vital roles in coordinating the actions of various DNA replication, repair, and damage tolerance proteins. At least three distinct surfaces of the Escherichia coli {beta} clamp interact physically with the DNA that it topologically encircles. We utilized mutant {beta} clamp proteins bearing G66E and G174A substitutions ({beta}159), affecting the single-stranded DNA-binding region, or poly-Ala substitutions in place of residues 148-HQDVR-152 ({beta}148-152), affecting the double-stranded DNA binding region, to determine the biological relevance of clamp-DNA interactions. As part of this work, we solved the X-ray crystal structure of {beta}148-152, which verified that themore » poly-Ala substitutions failed to significantly alter the tertiary structure of the clamp. Based on functional assays, both {beta}159 and {beta}148-152 were impaired for loading and retention on a linear primed DNA in vitro. In the case of {beta}148-152, this defect was not due to altered interactions with the DnaX clamp loader, but rather was the result of impaired {beta}148-152-DNA interactions. Once loaded, {beta}148-152 was proficient for DNA polymerase III (Pol III) replication in vitro. In contrast, {beta}148-152 was severely impaired for Pol II and Pol IV replication and was similarly impaired for direct physical interactions with these Pols. Despite its ability to support Pol III replication in vitro, {beta}148-152 was unable to support viability of E. coli. Nevertheless, physiological levels of {beta}148-152 expressed from a plasmid efficiently complemented the temperature-sensitive growth phenotype of a strain expressing {beta}159 (dnaN159), provided that Pol II and Pol IV were inactivated. Although this strain was impaired for Pol V-dependent mutagenesis, inactivation of Pol II and Pol IV restored the Pol V mutator phenotype. Taken together, these results support a model in which a sophisticated combination of competitive clamp-DNA, clamp-partner, and partner-DNA interactions serve to manage the actions of the different E. coli Pols in vivo.« less
-
[Noncovalent cation-π interactions--their role in nature].
Fink, Krzysztof; Boratyński, Janusz
2014-11-07
Non-covalent interactions play an extremely important role in organisms. The main non-covalent interactions in nature are: ion-ion interactions, dipole-dipole interactions, hydrogen bonds, and van der Waals interactions. A new kind of intermolecular interactions--cation-π interactions--is gaining increasing attention. These interactions occur between a cation and a π system. The main contributors to cation-π interactions are electrostatic, polarization and, to a lesser extent, dispersion interactions. At first, cation-π interactions were studied in a gas phase, with metal cation-aromatic system complexes. The characteristics of these complexes are as follows: an increase of cation atomic number leads to a decrease of interaction energy, and an increase of cation charge leads to an increase of interaction energy. Aromatic amino acids bind with metal cations mainly through interactions with their main chain. Nevertheless, cation-π interaction with a hydrophobic side chain significantly enhances binding energy. In water solutions most cations preferentially interact with water molecules rather than aromatic systems. Cation-π interactions occur in environments with lower accessibility to a polar solvent. Cation-π interactions can have a stabilizing role on the secondary, tertiary and quaternary structure of proteins. These interactions play an important role in substrate or ligand binding sites in many proteins, which should be taken into consideration when the screening of effective inhibitors for these proteins is carried out. Cation-π interactions are abundant and play an important role in many biological processes.
-
Salamone, Michela; Mangiacapra, Livia; DiLabio, Gino A; Bietti, Massimo
2013-01-09
A time-resolved kinetic study on the effect of metal ions (M(n+)) on hydrogen abstraction reactions from C-H donor substrates by the cumyloxyl radical (CumO(•)) was carried out in acetonitrile. Metal salt addition was observed to increase the CumO(•) β-scission rate constant in the order Li(+) > Mg(2+) > Na(+). These effects were explained in terms of the stabilization of the β-scission transition state determined by Lewis acid-base interactions between M(n+) and the radical. When hydrogen abstraction from 1,4-cyclohexadiene was studied in the presence of LiClO(4) and Mg(ClO(4))(2), a slight increase in rate constant (k(H)) was observed indicating that interaction between M(n+) and CumO(•) can also influence, although to a limited extent, the hydrogen abstraction reactivity of alkoxyl radicals. With Lewis basic C-H donors such as THF and tertiary amines, a decrease in k(H) with increasing Lewis acidity of M(n+) was observed (k(H)(MeCN) > k(H)(Li(+)) > k(H)(Mg(2+))). This behavior was explained in terms of the stronger Lewis acid-base interaction of M(n+) with the substrate as compared to the radical. This interaction reduces the degree of overlap between the α-C-H σ* orbital and a heteroatom lone-pair, increasing the C-H BDE and destabilizing the carbon centered radical formed after abstraction. With tertiary amines, a >2-order of magnitude decrease in k(H) was measured after Mg(ClO(4))(2) addition up to a 1.5:1 amine/Mg(ClO(4))(2) ratio. At higher amine concentrations, very similar k(H) values were measured with and without Mg(ClO(4))(2). These results clearly show that with strong Lewis basic substrates variations in the nature and concentration of M(n+) can dramatically influence k(H), allowing for a fine control of the substrate hydrogen atom donor ability, thus providing a convenient method for C-H deactivation. The implications and generality of these findings are discussed.
-
Apker, Julie; Propp, Kathleen M; Zabava Ford, Wendy S; Hofmeister, Nancee
2006-01-01
This study explored how nurses communicate professionalism in interactions with members of their health care teams. Extant research show that effective team communication is a vital aspect of a positive nursing practice environment, a setting that has been linked to enhanced patient outcomes. Although communication principles are emphasized in nursing education as an important component of professional nursing practice, actual nurse interaction skills in team-based health care delivery remain understudied. Qualitative analysis of interview transcripts with 50 participants at a large tertiary hospital revealed four communicative skill sets exemplified by nursing professionals: collaboration, credibility, compassion, and coordination. Study findings highlight specific communicative behaviors associated with each skill set that exemplify nurse professionalism to members of health care teams. Theoretical and pragmatic conclusions are drawn regarding the communicative responsibilities of professional nurses in health care teams. Specific interaction techniques that nurses could use in nurse-team communication are then offered for use in baccalaureate curriculum and organizational in-service education.
-
Diversification Management at Tertiary Education Level: A Review
ERIC Educational Resources Information Center
Takwate, Kwaji Tizhe
2016-01-01
This paper examines the concept of management of diversification at tertiary education level in view of the growth of national secondary education system which vested high scramble for tertiary education was made in relation to question of access and expansion. This paper examines management of diversification at tertiary education level as a…
-
ERIC Educational Resources Information Center
AbdulAzeez, Abbas Tunde
2016-01-01
This research investigated total quality management practices and quality teacher education in public tertiary institutions in Lagos State. The study was therefore designed to analyse management practices in Lagos state tertiary institutions through total quality management structural framework. The selected public tertiary institutions in Lagos…
-
A New Synthesis of Tertiary Alkyl N-Arylcarbamates from Isocyanates.
ERIC Educational Resources Information Center
Bailey, William J.; Griffith, James R.
1978-01-01
The method involves the dissolution of a small piece of metallic lithium in a small quantity of tertiary alcohol followed by addition to a mixture of the isocyanate and the tertiary alcohol in ether. This should be useful in organic chemistry laboratory courses for the identification of tertiary alcohols. (Author/BB)
-
ERIC Educational Resources Information Center
Martins, Joaquim Oliveira; Boarini, Romina; Strauss, Hubert; de la Maisonneuve, Christine; Saadi, Clarice
2007-01-01
This paper assesses how policies and institutions affect private returns to invest in tertiary human capital, the ability of individuals to finance this investment and the institutional characteristics of tertiary education systems. Focusing on core tertiary education services, the paper presents new measures of private returns to tertiary…
-
Burke, Teresa A.; Doyle Brackley, Allison; Jeske, Nathaniel A.; Cleland, Jeffery M.; Lund, Brian J.
2017-01-01
Blast-associated sensory and cognitive trauma sustained by military service members is an area of extensively studied research. Recent studies in our laboratory have revealed that low-level blast exposure increased expression of transient receptor potential vanilloid 1 (TRPV1) and endothelin-1 (ET-1), proteins well characterized for their role in mediating pain transmission, in the cornea. Determining the functional consequences of these alterations in protein expression is critical to understanding blast-related sensory trauma. Thus, the purpose of this study was to examine TRPV1 and ET-1 expression in ocular associated sensory tissues following primary and tertiary blast. A rodent model of blast injury was used in which anesthetized animals, unrestrained or restrained, received a single or repeat blast (73.8 ± 5.5 kPa) from a compressed air shock tube once or daily for five consecutive days, respectively. Behavioral and functional analyses were conducted to assess blast effects on nocifensive behavior and TRPV1 activity. Immunohistochemistry and Western Blot were also performed with trigeminal ganglia (TG) to determine TRPV1, ET-1 and glial fibrillary associated protein (GFAP) expression following blast. Increased TRPV1, ET-1 and GFAP were detected in the TG of animals exposed to repeat blast. Increased nocifensive responses were also observed in animals exposed to repeat, tertiary blast as compared to single blast and control. Moreover, decreased TRPV1 desensitization was observed in TG neurons exposed to repeat blast. Repeat, tertiary blast resulted in increased TRPV1, ET-1 and GFAP expression in the TG, enhanced nociception and decreased TRPV1 desensitization. PMID:28797041
-
Jossinet, Fabrice; Ludwig, Thomas E; Westhof, Eric
2010-08-15
Assemble is an intuitive graphical interface to analyze, manipulate and build complex 3D RNA architectures. It provides several advanced and unique features within the framework of a semi-automated modeling process that can be performed by homology and ab initio with or without electron density maps. Those include the interactive editing of a secondary structure and a searchable, embedded library of annotated tertiary structures. Assemble helps users with performing recurrent and otherwise tedious tasks in structural RNA research. Assemble is released under an open-source license (MIT license) and is freely available at http://bioinformatics.org/assemble. It is implemented in the Java language and runs on MacOSX, Linux and Windows operating systems.
-
Pavani, R S; Fernandes, C; Perez, A M; Vasconcelos, E J R; Siqueira-Neto, J L; Fontes, M R; Cano, M I N
2014-12-20
Replication protein A-1 (RPA-1) is a single-stranded DNA-binding protein involved in DNA metabolism. We previously demonstrated the interaction between LaRPA-1 and telomeric DNA. Here, we expressed and purified truncated mutants of LaRPA-1 and used circular dichroism measurements and molecular dynamics simulations to demonstrate that the tertiary structure of LaRPA-1 differs from human and yeast RPA-1. LaRPA-1 interacts with telomeric ssDNA via its N-terminal OB-fold domain, whereas RPA from higher eukaryotes show different binding modes to ssDNA. Our results show that LaRPA-1 is evolutionary distinct from other RPA-1 proteins and can potentially be used for targeting trypanosomatid telomeres. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
-
Online problem-solving therapy for executive dysfunction after child traumatic brain injury.
Kurowski, Brad G; Wade, Shari L; Kirkwood, Michael W; Brown, Tanya M; Stancin, Terry; Taylor, H Gerry
2013-07-01
Executive dysfunction after traumatic brain injury (TBI) in children is common and leads to significant problems in functioning across multiple settings. The objective of this study was to evaluate the efficacy of a web-based counselor-assisted problem solving (CAPS) intervention compared with an Internet resource comparison (IRC) for treatment of executive dysfunction within 12 months after complicated mild to severe TBI in adolescents. We hypothesized that CAPS would significantly improve parent ratings of executive dysfunction compared with an IRC. Participants included 132 adolescents aged 12 to 17 years who sustained a complicated mild to severe TBI within 1 to 6 months before study enrollment. Study design was a multisite, assessor-blinded, randomized controlled trial. Study sites included 3 tertiary pediatric hospitals and 2 tertiary general medical centers. The main outcome measure was primary caregiver Behavioral Rating Inventory of Executive Function Global Executive Composite at baseline and 6-month follow-up. Generalized linear models that controlled for baseline scores were used to compare the CAPS and IRC scores. In older teens, the CAPS group showed significant improvement in executive function behaviors at 6-month follow-up compared with the IRC group (F = 6.74, P = .01, Cohen's d = 0.63). Findings indicate that web-based CAPS improves primary caregiver-rated executive functioning within the first 12 months after TBI in older adolescents. Future research needs to define the optimal timing after injury for delivery of CAPS and characteristics of individuals and families who are most likely to benefit from CAPS.
-
Adam, Benoit; Charloteaux, Benoit; Beaufays, Jerome; Vanhamme, Luc; Godfroid, Edmond; Brasseur, Robert; Lins, Laurence
2008-01-01
Background Lipocalins are widely distributed in nature and are found in bacteria, plants, arthropoda and vertebra. In hematophagous arthropods, they are implicated in the successful accomplishment of the blood meal, interfering with platelet aggregation, blood coagulation and inflammation and in the transmission of disease parasites such as Trypanosoma cruzi and Borrelia burgdorferi. The pairwise sequence identity is low among this family, often below 30%, despite a well conserved tertiary structure. Under the 30% identity threshold, alignment methods do not correctly assign and align proteins. The only safe way to assign a sequence to that family is by experimental determination. However, these procedures are long and costly and cannot always be applied. A way to circumvent the experimental approach is sequence and structure analyze. To further help in that task, the residues implicated in the stabilisation of the lipocalin fold were determined. This was done by analyzing the conserved interactions for ten lipocalins having a maximum pairwise identity of 28% and various functions. Results It was determined that two hydrophobic clusters of residues are conserved by analysing the ten lipocalin structures and sequences. One cluster is internal to the barrel, involving all strands and the 310 helix. The other is external, involving four strands and the helix lying parallel to the barrel surface. These clusters are also present in RaHBP2, a unusual "outlier" lipocalin from tick Rhipicephalus appendiculatus. This information was used to assess assignment of LIR2 a protein from Ixodes ricinus and to build a 3D model that helps to predict function. FTIR data support the lipocalin fold for this protein. Conclusion By sequence and structural analyzes, two conserved clusters of hydrophobic residues in interactions have been identified in lipocalins. Since the residues implicated are not conserved for function, they should provide the minimal subset necessary to confer the lipocalin fold. This information has been used to assign LIR2 to lipocalins and to investigate its structure/function relationship. This study could be applied to other protein families with low pairwise similarity, such as the structurally related fatty acid binding proteins or avidins. PMID:18190694
-
Unconstrained Structure Formation in Coarse-Grained Protein Simulations
NASA Astrophysics Data System (ADS)
Bereau, Tristan
The ability of proteins to fold into well-defined structures forms the basis of a wide variety of biochemical functions in and out of the cell membrane. Many of these processes, however, operate at time- and length-scales that are currently unattainable by all-atom computer simulations. To cope with this difficulty, increasingly more accurate and sophisticated coarse-grained models are currently being developed. In the present thesis, we introduce a solvent-free coarse-grained model for proteins. Proteins are modeled by four beads per amino acid, providing enough backbone resolution to allow for accurate sampling of local conformations. It relies on simple interactions that emphasize structure, such as hydrogen bonds and hydrophobicity. Realistic alpha/beta content is achieved by including an effective nearest-neighbor dipolar interaction. Parameters are tuned to reproduce both local conformations and tertiary structures. By studying both helical and extended conformations we make sure the force field is not biased towards any particular secondary structure. Without any further adjustments or bias a realistic oligopeptide aggregation scenario is observed. The model is subsequently applied to various biophysical problems: (i) kinetics of folding of two model peptides, (ii) large-scale amyloid-beta oligomerization, and (iii) protein folding cooperativity. The last topic---defined by the nature of the finite-size thermodynamic transition exhibited upon folding---was investigated from a microcanonical perspective: the accurate evaluation of the density of states can unambiguously characterize the nature of the transition, unlike its corresponding canonical analysis. Extending the results of lattice simulations and theoretical models, we find that it is the interplay between secondary structure and the loss of non-native tertiary contacts which determines the nature of the transition. Finally, we combine the peptide model with a high-resolution, solvent-free, lipid model. The lipid force field was systematically tuned to reproduce the structural and mechanical properties of phosphatidylcholine bilayers. The two models were cross-parametrized against atomistic potential of mean force curves for the insertion of single amino acid side chains into a bilayer. Coarse-grained transmembrane protein simulations were then compared with experiments and atomistic simulations to validate the force field. The transferability of the two models across amino acid sequences and lipid species permits the investigation of a wide variety of scenarios, while the absence of explicit solvent allows for studies of large-scale phenomena.
-
Policy Innovation and Tertiary Education Graduation Rates: A Cross-Country Analysis
ERIC Educational Resources Information Center
Delaney, Jennifer A.; Yu, Patricia
2013-01-01
This study extends Trow's theory of higher education development to examine changes in national-level tertiary education graduation rates. Applying Trow's framework we arrive at three stages: (1) elite systems with gross tertiary graduation rates less than 15%, (2) massified systems with gross tertiary graduation rates between 15% and 50%, and (3)…
-
A Comparison of Career Success between Graduates of Vocational and Academic Tertiary Education
ERIC Educational Resources Information Center
Backes-Gellner, Uschi; Geel, Regula
2014-01-01
This paper analyses whether tertiary education of different types, i.e., academic or vocational tertiary education, leads to more or less favorable labor market outcomes. We study the problem for Switzerland, where more than two thirds of the workforce gain vocational secondary degrees and a substantial number go on to a vocational tertiary degree…
-
Recently, two papers reported the use of solid-phase microextraction (SPME) with polydimethylsiloxane(PDMS)/Carboxen fibers to determine trace levels of methyl tertiary butyl ether (MTBE) and tertiary butyl alcohol (tBA) in water. Attempts were made to apply this technique to th...
-
ERIC Educational Resources Information Center
Štefánik, Miroslav; Horvát, Peter
2015-01-01
This article provides evidence about differences in the recent tertiary education expansion in Austria, Germany, the Czech Republic, Poland and Slovakia. Focusing on these differences, we have examined private returns to tertiary education acquired before and after the tertiary education expansion. We compare these returns as follows: Austria with…
-
Mishra, Arjun K; Agnihotri, Pragati; Srivastava, Vijay Kumar; Pratap, J Venkatesh
2015-01-09
Polyamine biosynthesis pathway has long been considered an essential drug target for trypanosomatids including Leishmania. S-adenosylmethionine decarboxylase (AdoMetDc) and spermidine synthase (SpdSyn) are enzymes of this pathway that catalyze successive steps, with the product of the former, decarboxylated S-adenosylmethionine (dcSAM), acting as an aminopropyl donor for the latter enzyme. Here we have explored the possibility of and identified the protein-protein interaction between SpdSyn and AdoMetDc. The protein-protein interaction has been identified using GST pull down assay. Isothermal titration calorimetry reveals that the interaction is thermodynamically favorable. Fluorescence spectroscopy studies also confirms the interaction, with SpdSyn exhibiting a change in tertiary structure with increasing concentrations of AdoMetDc. Size exclusion chromatography suggests the presence of the complex as a hetero-oligomer. Taken together, these results suggest that the enzymes indeed form a heteromer. Computational analyses suggest that this complex differs significantly from the corresponding human complex, implying that this complex could be a better therapeutic target than the individual enzymes. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Self-reported verbal abuse in 1300+ older women within a private, tertiary women's health clinic.
Sood, Richa; Novotny, Paul; Faubion, Stephanie S; Thielen, Jacqueline M; Shuster, Lynne T; Kuhle, Carol L; Kapoor, Ekta; Marnach, Mary; Barrette, Brigitte; Jatoi, Aminah
2016-01-01
Several studies describe "elder abuse" among residents of nursing homes, but this issue is less well studied among independently functioning, community-based women. The current study was undertaken to report rates of self-reported intimate partner violence - with a focus on verbal abuse - among older women within a private tertiary women's health clinic. This study focused on women who completed a questionnaire on domestic abuse. A total of 1389 women with a median age of 55 years (range: 50, 90) are the focus of this report. Most 1102 (79%) were married. Within this group, 100 (7%) women reported verbal abuse within the last year. Rates of physical and sexual abuse were much lower with 9 women (1%) and 2 (<1%), respectively. In univariate analyses, being divorced, being an alcoholic, and having suffered prior abuse were associated with reported verbal abuse. In multivariate analyses, self-reported alcoholism and physical abuse were independently associated with reported verbal abuse. This study found a notable rate of patient-reported verbal abuse in older women within a private, tertiary women's health clinic. This observation should prompt healthcare providers to ask about intimate partner violence - and specifically verbal abuse - regardless of healthcare setting. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
-
Kallam, Brianne; Pettitt-Schieber, Christie; Owen, Medge; Agyare Asante, Rebecca; Darko, Elizabeth; Ramaswamy, Rohit
2018-05-19
Low-resource clinical settings often face obstacles that challenge the implementation of recommended evidence-based practices (EBPs). Implementation science approaches are useful in identifying barriers and developing strategies to address them. Ridge Regional Hospital (RRH), a tertiary referral hospital in Accra, Ghana experienced a spike in rates of neonatal sepsis and launched a quality improvement (QI) initiative that identified poor adherence to hand hygiene in the neonatal intensive care unit as a potential source of infections. A multi-modal change package of World Health Organization-recommended solutions was created to address this issue. To ensure that the outputs of the QI effort were adopted within the organization, leaders at RRH and Kybele, Inc. used an implementation science framework called the 'Interactive Systems Framework for Dissemination and Implementation' (ISF) to create a package of locally acceptable implementation strategies. The ISF has never been used before to guide implementation in low-resource settings. Hand hygiene compliance rose from 67% to 92% overall, including a 36% increase during the night shifts-a group of healthcare workers with typically very low levels of compliance. The drastic improvement in adherence to hand hygiene suggests the potential value of the joint use of QI and implementation science to promote the creation and application of contextually appropriate EBPs in low-resource settings. Our results also suggest that using an implementation framework such as the ISF could rapidly increase the uptake of other evidence-based interventions in low-resource settings.
-
Impact of the structural integrity of the three-way junction of adenovirus VAI RNA on PKR inhibition
Dzananovic, Edis; Astha; Chojnowski, Grzegorz; Deo, Soumya; Booy, Evan P.; Padilla-Meier, Pauline; McEleney, Kevin; Bujnicki, Janusz M.; McKenna, Sean A.
2017-01-01
Highly structured RNA derived from viral genomes is a key cellular indicator of viral infection. In response, cells produce the interferon inducible RNA-dependent protein kinase (PKR) that, when bound to viral dsRNA, phosphorylates eukaryotic initiation factor 2α and attenuates viral protein translation. Adenovirus can evade this line of defence through transcription of a non-coding RNA, VAI, an inhibitor of PKR. VAI consists of three base-paired regions that meet at a three-way junction; an apical stem responsible for the interaction with PKR, a central stem required for inhibition, and a terminal stem. Recent studies have highlighted the potential importance of the tertiary structure of the three-way junction to PKR inhibition by enabling interaction between regions of the central and terminal stems. To further investigate the role of the three-way junction, we characterized the binding affinity and inhibitory potential of central stem mutants designed to introduce subtle alterations. These results were then correlated with small-angle X-ray scattering solution studies and computational tertiary structural models. Our results demonstrate that while mutations to the central stem have no observable effect on binding affinity to PKR, mutations that appear to disrupt the structure of the three-way junction prevent inhibition of PKR. Therefore, we propose that instead of simply sequestering PKR, a specific structural conformation of the PKR-VAI complex may be required for inhibition. PMID:29053745
-
Potential effects on health of global warming
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haines, A.; Parry, M.
1993-12-01
Prediction of the impacts of global climate change on health is complicated by a number of factors. These include: the difficulty in predicting regional changes in climate, the capacity for adaptation to climate change, the interactions between the effects of global climate change and a number of other key determinants of health, including population growth and poverty, and the availability of adequate preventive and curative facilities for diseases that may be effected by climate change. Nevertheless, it is of importance to consider the potential health impacts of global climate change for a number of reasons. It is also important tomore » monitor diseases which could be effected by climate change in order to detect changes in incidence as early as possible and study possible interactions with other factors. It seems likely that the possible impacts on health of climate change will be a major determinant of the degree to which policies aimed at reducing global warming are followed, as perceptions of the effect of climate change to human health and well-being are particularly likely to influence public opinion. The potential health impacts of climate change can be divided into direct (primary) and indirect (secondary and tertiary) effects. Primary effects are those related to the effect of temperature on human well-being and disease. Secondary effects include the impacts on health of changes in food production, availability of water and of sea level rise. A tertiary level of impacts can also be hypothesized.« less
-
Mechanisms for creating accommodation space during early Tertiary sedimentation in Tibet.
NASA Astrophysics Data System (ADS)
Studnicki-Gizbert, C.; Burchfiel, B. C.
2003-12-01
The Tibetan plateau is for the most part underlain by rocks of pre-Cenozoic age, a fact that has hindered the identification of Cenozoic shortening structures that can be unequivocally related to the effects of India-Asia collision. Notably, however, the Qiangtang block contains a number of small, short wavelength basins filled with terrestrial sediments of early Tertiary age. Where these basins have been well studied, sedimentation is recognized as having occurred coevally with compressional deformation. The classic treatment of compressional basins appeals to accommodation space created by the flexure of an elastic plate in response to loads created by adjacent thrust fault bound ranges. It is unlikely that the Tertiary basins of the Qiangtang block formed in this manner. The wavelength of a classically modelled flexural basin is a basically a function of the thickness of the elastic plate and the density difference between sedimentary fill and ductile material underlying the plate. Assuming a model of elastic flexure, the very small wavelengths (5 - 30km) characteristic of Qiangtang basins would then imply extremely thin (~ 1-5 km) effective elastic plate thicknesses. These very low values are difficult to reconcile with any reasonable characterization of crustal rheology. Instead, these relatively small basins likely record the creation of accommodation space created by differential uplift across the strike of folds and faults. Stratal geometries and sedimentation rates reflect the kinematics and geometries of local compressional structures and the mechanical basis for the creation of accommodation space remains uncertain. Finally, the origin of these basins makes it unlikely that early Tertiary sedimentation represents a significant fraction of the upper crust of Tibetan plateau.
-
Deegan, Brian J.; Bona, Anna M.; Bhat, Vikas; Mikles, David C.; McDonald, Caleb B.; Seldeen, Kenneth L.; Farooq, Amjad
2011-01-01
Estrogen receptor α (ERα) acts as a transcription factor by virtue of the ability of its DNA-binding (DB) domain, comprised of a tandem pair of zinc fingers, to recognize the estrogen response element (ERE) within the promoters of target genes. Herein, using an array of biophysical methods, we probe structural consequences of the replacement of zinc within the DB domain of ERα with various environmental metals and their effects on the thermodynamics of binding to DNA. Our data reveal that while the DB domain reconstituted with divalent ions of zinc, cadmium, mercury and cobalt binds to DNA with affinities in the nanomolar range, divalent ions of barium, copper, iron, lead, manganese, nickel and tin are unable to regenerate DB domain with DNA-binding potential though they can compete with zinc for coordinating the cysteine ligands within the zinc fingers. We also show that the metal-free DB domain is a homodimer in solution and that the binding of various metals only results in subtle secondary and tertiary structural changes, implying that metal-coordination may only be essential for DNA-binding. Collectively, our findings provide mechanistic insights into how environmental metals may modulate the physiological function of a key nuclear receptor involved in mediating a plethora of cellular functions central to human health and disease. PMID:22038807
-
Pavani, Raphael Souza; da Silva, Marcelo Santos; Fernandes, Carlos Alexandre Henrique; Morini, Flavia Souza; Araujo, Christiane Bezerra; Fontes, Marcos Roberto de Mattos; Sant'Anna, Osvaldo Augusto; Machado, Carlos Renato; Cano, Maria Isabel; Fragoso, Stenio Perdigão; Elias, Maria Carolina
2016-12-01
Replication Protein A (RPA), the major single stranded DNA binding protein in eukaryotes, is composed of three subunits and is a fundamental player in DNA metabolism, participating in replication, transcription, repair, and the DNA damage response. In human pathogenic trypanosomatids, only limited studies have been performed on RPA-1 from Leishmania. Here, we performed in silico, in vitro and in vivo analysis of Trypanosoma cruzi RPA-1 and RPA-2 subunits. Although computational analysis suggests similarities in DNA binding and Ob-fold structures of RPA from T. cruzi compared with mammalian and fungi RPA, the predicted tridimensional structures of T. cruzi RPA-1 and RPA-2 indicated that these molecules present a more flexible tertiary structure, suggesting that T. cruzi RPA could be involved in additional responses. Here, we demonstrate experimentally that the T. cruzi RPA complex interacts with DNA via RPA-1 and is directly related to canonical functions, such as DNA replication and DNA damage response. Accordingly, a reduction of TcRPA-2 expression by generating heterozygous knockout cells impaired cell growth, slowing down S-phase progression. Moreover, heterozygous knockout cells presented a better efficiency in differentiation from epimastigote to metacyclic trypomastigote forms and metacyclic trypomastigote infection. Taken together, these findings indicate the involvement of TcRPA in the metacyclogenesis process and suggest that a delay in cell cycle progression could be linked with differentiation in T. cruzi.
-
ERIC Educational Resources Information Center
Smith-Sherwood, Heather
2018-01-01
This qualitative multi-case study investigated three exemplary pre-service teacher education programs in Jamaica and Michigan in order to provide an account of how they are structured in different contexts of tertiary institutions and, to identify how they ensure that their graduates are prepared to function effectively in today's schools. Five…
-
"Playing It Like a Professional": Approaches to Ensemble Direction in Tertiary Institutions
ERIC Educational Resources Information Center
Harrison, Scott; O'Bryan, Jessica; Lebler, Don
2013-01-01
This article reports on a case study of three directors of large ensembles within a large conservatoire and the ways in which they attempted to scaffold their students into professional music careers. The core aim in this article is to respond to the question "What is the role and function of the ensemble experience on the training of the…
-
ERIC Educational Resources Information Center
Adebisi, M. A.; Akinkuowo, F. O.
2015-01-01
Learning at the tertiary level of education could be described as being effective and functional, if it results in bringing about the expected transformation in the lives of its graduates over a period of time. Moreover effective learning should produce graduates who are adequately informed and technically equipped to become productive workers and…
-
ERIC Educational Resources Information Center
Barra, Cristian; Zotti, Roberto
2017-01-01
The main purpose of the paper is to estimate the efficiency of a big public university in Italy using individual student-level data, modeling exogenous variables in human capital formation through a heteroscedastic stochastic frontier approach. Specifically, a production function for tertiary education has been estimated with emphasis on…
-
ERIC Educational Resources Information Center
Bunch-Crump, Kimberly R.; Lo, Ya-yu
2017-01-01
This study examined the effects of a multitiered system of support using Check-In Check-Out (CICO) as a secondary intervention and function-based self-monitoring (FBSM) as a tertiary intervention on the disruptive behavior and academic engagement of four elementary students identified as being in need of additional behavioral supports. A multiple…
-
A Study of Subject-Verb Agreement: From Novice Writers to Expert Writers
ERIC Educational Resources Information Center
Nayan, Surina; Jusoff, Kamaruzaman
2009-01-01
Students in higher learning institutions need to write lots of reports based on the projects done. Since they are at the tertiary level of education, they are required to use English in their reports. This is to ensure that they are able to function well in English later at the workplace. Writing requires students to apply rules regarding sentence…
-
USDA-ARS?s Scientific Manuscript database
The American Academy of Pediatrics suggests that children with recurrent abdominal pain without alarm signs be managed in pediatric rather than specialty care. However, many of these children are seen in tertiary care. In a longitudinal examination of physical and psychological symptoms, we hypothes...
-
Banerji, Biswadip; Chatterjee, Moumita; Pal, Uttam; Maiti, Nakul C
2017-07-06
Both hydrogen-bonding and hydrophobic interactions play a significant role in molecular assembly, including self-assembly of proteins and peptides. In this study, we report the formation of annular protofibrillar structure (diameter ∼500 nm) made of a newly synthesized s-benzyl-protected cysteine tripeptide, which was primarily stabilized by hydrogen-bonding and hydrophobic interactions. Atomic force microscopy and field emission scanning electron microscopy analyses found small oligomers (diameter ∼60 nm) to bigger annular (outer diameter ∼300 nm; inner diameter, 100 nm) and protofibrillar structures after 1-2 days of incubation. Rotating-frame Overhauser spectroscopic (ROESY) analysis revealed the presence of several nonbonded proton-proton interactions among the residues, such as amide protons with methylene group, aromatic protons with tertiary butyl group, and methylene protons with tertiary butyl group. These added significant stability to bring the peptides closer to form a well-ordered assembled structure. Hydrogen-deuterium exchange NMR measurement further suggested that two individual amide protons among the three amide groups were strongly engaged with the adjacent tripeptide via H-bond interaction. However, the remaining amide proton was found to be exposed to solvent and remained noninteracting with other tripeptide molecules. In addition to chemical shift values, a significant change in amide bond vibrations of the tripeptide was found due to the formation of the self-assembled structure. The amide I mode of vibrations involving two amide linkages appeared at 1641 and 1695 cm -1 in the solid state. However, in the assembled state, the stretching band at 1695 cm -1 became broad and slightly shifted to ∼1689 cm -1 . On the contrary, the band at 1641 cm -1 shifted to 1659 cm -1 and indicated that the -C═O bond associated with this vibration became stronger in the assembled state. These changes in Fourier transform infrared spectroscopy frequency clearly indicated changes in the amide backbone conformation and the associated hydrogen-bonding pattern due to the formation of the assembled structure. In addition to hydrogen bonding, molecular dynamics simulation indicated that the number of π-π interactions also increased with increasing number of tripeptides participated in the self-assembly process. Combined results envisaged a cross β-sheet assembly unit consisting of four intermolecular hydrogen bonds. Such noncovalent peptide assemblies glued by hydrogen-bonding and other weak forces may be useful in developing nanocapsule and related materials.
-
Neuropsychology Within a Tertiary Care Epilepsy Center.
Morrison, Chris E; MacAllister, William S; Barr, William B
2018-05-01
Epilepsy is a prevalent condition characterized by variations in its clinical presentation, etiology, and amenability to treatment. Through history, neuropsychologists have played a significant role in performing research studies on changes in language, memory, and executive functioning in patients with epilepsy, including those undergoing surgical treatment for medically refractory seizures. These studies provided a foundation for establishing neuropsychologists as critical members of interdisciplinary clinical teams specializing in evaluation and treatment of epilepsy. This article describes a number of elements of specialized neuropsychological practice that have evolved over the years within a tertiary care epilepsy center. Through diagnostic interview and objective testing, the neuropsychologist is able to provide a more complete and objective understanding of a patient's cognitive and behavioral functioning than what is obtained by other clinicians through brief office visits. While assessment of cognition, mood, and behavior is the most commonly provided service to patients with epilepsy from all age groups, there are many instances when neuropsychologists in surgical settings are called to perform more specialized procedures, including the intracarotid amytal (Wada) procedure, electrocortical stimulation mapping of language eloquent brain regions, and functional brain imaging procedures. While working as a neuropsychologist on an interdisciplinary epilepsy care team requires specialized knowledge and clinical training, it is extremely satisfying due to the diversity of the patient population and the particular challenges resulting from the often unique manner that cognition and behavior can be affected in patients with epilepsy across the lifespan.
-
Li, Li; Ai, Hua; Gao, Lei; Zhou, Hao; Liu, Xinyan; Zhang, Zhong; Sun, Tao; Fan, Lihua
2017-06-12
Work stress is a major problem for nurses and it can negatively influence job performance. Therefore, it is critical to explore variables that can reduce or buffer the negative effects of work stress. This study explores the moderating effects of coping strategies on the relationship between work stress and job performance for nurses in China. A cross-sectional survey of 852 nurses from four tertiary hospitals in Heilongjiang Province, China, was conducted in 2013. Descriptive statistics were reported for socioeconomic status and demographic characteristics, level of work stress, coping strategies, and job performance. Regression analysis was conducted to test the interaction between work stress and coping strategies on job performance. Three subscales of work stress were negatively related to job performance. Positive coping strategies moderated Patient Care and job performance while negative coping strategies moderated Workload and Time and performance, and between Working Environment and Resources and performance. Positive coping strategies reduce or buffer the negative effects of work stress on job performance and negative coping strategies increased the negative effects.
-
Principles of protein folding--a perspective from simple exact models.
Dill, K. A.; Bromberg, S.; Yue, K.; Fiebig, K. M.; Yee, D. P.; Thomas, P. D.; Chan, H. S.
1995-01-01
General principles of protein structure, stability, and folding kinetics have recently been explored in computer simulations of simple exact lattice models. These models represent protein chains at a rudimentary level, but they involve few parameters, approximations, or implicit biases, and they allow complete explorations of conformational and sequence spaces. Such simulations have resulted in testable predictions that are sometimes unanticipated: The folding code is mainly binary and delocalized throughout the amino acid sequence. The secondary and tertiary structures of a protein are specified mainly by the sequence of polar and nonpolar monomers. More specific interactions may refine the structure, rather than dominate the folding code. Simple exact models can account for the properties that characterize protein folding: two-state cooperativity, secondary and tertiary structures, and multistage folding kinetics--fast hydrophobic collapse followed by slower annealing. These studies suggest the possibility of creating "foldable" chain molecules other than proteins. The encoding of a unique compact chain conformation may not require amino acids; it may require only the ability to synthesize specific monomer sequences in which at least one monomer type is solvent-averse. PMID:7613459
-
Ghimici, Luminita; Constantin, Marieta
2018-04-14
Cationic pullulan derivatives have been synthesized and evaluated, for the first time, as flocculants for the separation of the commercial pesticides, Novadim Progress (organophosphoric type), Bordeax mixture and Karate Zeon (pyrethroid type) from synthetic wastewater. The investigated polymer samples contained either pendent tertiary amine or quaternary ammonium salts groups. The separation efficiency was followed by UV-Vis spectroscopy, while the information regarding the mechanism involved in the separation of pesticide particles have been obtained by zeta potential. UV-Vis spectroscopy data showed strong pesticide particles/polycation interactions in case of Novadim Progress and Bordeaux mixture (maximum pesticide removal between 90% and 98%). Good separation efficiency (around 80%) of Karate Zeon emulsion was also noticed. The zeta potential measurements indicated that the charge neutralization was the common flocculation mechanism for the removal of these pesticides. In addition, the hydrogen bondings and chelation of copper ions by amide and/or tertiary amino groups of the polycations had a noteworthy contribution to the pesticide removal. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Crabtree, Robert H.; Brown, Stephen H.
1989-01-01
The space-time yield and/or the selectivity of the photochemical dimerization of alkanes, ethers, primary and secondary alcohols, phosphine oxides and primary, secondary and tertiary silanes with Hg and U.V. light is enhanced by refluxing the substrate in the irradiated reaction zone at a temperature at which the dimer product condenses and remains condensed promptly upon its formation. Cross-dimerization of the alkanes, ethers and silanes with primary alcohols is disclosed, as is the functionalization to aldehydes of the alkanes with carbon monoxide.
-
Crabtree, R.H.; Brown, S.H.
1989-10-17
The space-time yield and/or the selectivity of the photochemical dimerization of alkanes, ethers, primary and secondary alcohols, phosphine oxides and primary, secondary and tertiary silanes with Hg and U.V. light is enhanced by refluxing the substrate in the irradiated reaction zone at a temperature at which the dimer product condenses and remains condensed promptly upon its formation. Cross-dimerization of the alkanes, ethers and silanes with primary alcohols is disclosed, as is the functionalization to aldehydes of the alkanes with carbon monoxide.
-
2014-01-01
Highly chemoselective direct reduction of primary, secondary, and tertiary amides to alcohols using SmI2/amine/H2O is reported. The reaction proceeds with C–N bond cleavage in the carbinolamine intermediate, shows excellent functional group tolerance, and delivers the alcohol products in very high yields. The expected C–O cleavage products are not formed under the reaction conditions. The observed reactivity is opposite to the electrophilicity of polar carbonyl groups resulting from the nX → π*C=O (X = O, N) conjugation. Mechanistic studies suggest that coordination of Sm to the carbonyl and then to Lewis basic nitrogen in the tetrahedral intermediate facilitate electron transfer and control the selectivity of the C–N/C–O cleavage. Notably, the method provides direct access to acyl-type radicals from unactivated amides under mild electron transfer conditions. PMID:24460078
-
[Prevention and regeneration of barrier disturbances in occupational dermatology].
Schürer, Nanna Y; Schwanitz, Hans J
2004-11-01
Over the past 10 years primary, secondary and tertiary prevention of occupational skin disorders has been shown to be successful, documented with appropriate statistical methods. Interventional strategies are the main features of secondary and tertiary prevention, now well-established in occupational dermatology. Primary prevention is best accomplished by health education measures, both in the form on individual counseling and seminars. This overview reviews the scientific background of hand eczema with respect to barrier damage and repair and then considers the options for individualized and focused prevention. Special anatomical features of the interdigital space and palms, as well as functional disorders, such as palmar hyperhidrosis, are discussed. The importance of barrier regeneration is considered in light of the role of an acid pH, the epidermal calcium gradient and aspects of percutaneous absorption. The effects of anti-oxidants are considered, and new bioengineering methods which rely on physiologic measuring techniques are reviewed.
-
NASA Astrophysics Data System (ADS)
Vázquez-Contreras, Edgar; Pérez Hernández, Gerardo; Sánchez-Rebollar, Brenda Guadalupe; Chánez-Cárdenas, María Elena
2005-04-01
The unfolding and refolding reactions of Trypanosoma cruzi triosephosphate isomerase (TcTIM) was studied under equilibrium conditions at increasing guanidinium hydrochloride concentrations. The changes in activity intrinsic fluorescence and far-ultraviolet circular dichroism as a function of denaturant were used as a quaternary, tertiary and secondary structural probes respectively. The change in extrinsic ANS fluorescence intensity was also investigated. The results show that the transition between the homodimeric native enzyme to the unfolded monomers (unfolding), and its inverse reaction (refolding) are described by similar pathways and two equilibrium intermediates were detected in both reactions. The mild denaturant concentrations intermediate is active and contains significant amount of secondary and tertiary structures. The medium denaturant concentrations intermediate is inactive and able to bind the fluorescent dye. This intermediates are maybe related with those observed in the denaturation pattern of TIMs from other species; the results are discussed in this context.
-
NASA Astrophysics Data System (ADS)
Cauchi, Marija; Aberle, O.; Assmann, R. W.; Bertarelli, A.; Carra, F.; Cornelis, K.; Dallocchio, A.; Deboy, D.; Lari, L.; Redaelli, S.; Rossi, A.; Salvachua, B.; Mollicone, P.; Sammut, N.
2014-02-01
The correct functioning of a collimation system is crucial to safely operate highly energetic particle accelerators, such as the Large Hadron Collider (LHC). The requirements to handle high intensity beams can be demanding. In this respect, investigating the consequences of LHC particle beams hitting tertiary collimators (TCTs) in the experimental regions is a fundamental issue for machine protection. An experimental test was designed to investigate the robustness and effects of beam accidents on a fully assembled collimator, based on accident scenarios in the LHC. This experiment, carried out at the CERN High-Radiation to Materials (HiRadMat) facility, involved 440 GeV proton beam impacts of different intensities on the jaws of a horizontal TCT. This paper presents the experimental setup and the preliminary results obtained, together with some first outcomes from visual inspection and a comparison of such results with numerical simulations.
-
Ghosh, Animesh; Mukherjee, Koushik; Jiang, Xinpeng; Zhou, Ying; McCarroll, Joshua; Qu, James; Swain, Pamela M.; Baigude, Huricha; Rana, Tariq M.
2010-01-01
RNA interference (RNAi), a gene-silencing phenomenon whereby double-stranded RNA (dsRNA) triggers the sequence-specific degradation of homologous mRNA. RNAi has been quickly and widely applied to discover gene functions and holds great potential to provide a new class of therapeutic agents. However, new chemistry and delivery approaches are greatly needed to silence disease-causing genes without toxic effects. We reasoned that conjugation of the cholesterol moiety to cationic lipids would enhance RNAi efficiencies and lower the toxic effects of lipid-mediated RNAi delivery. Here, we report the first design and synthesis of new cholesterol-conjugated cationic lipids for RNAi delivery using microwave-assisted quaternization (MAQ) of tertiary amines. This strategy can be employed to develop new classes of non-viral gene delivery agents under safe and fast reaction conditions. PMID:20722369
-
Functional Biomimetic Architectures
NASA Astrophysics Data System (ADS)
Levine, Paul M.
N-substituted glycine oligomers, or 'peptoids,' are a class of sequence--specific foldamers composed of tertiary amide linkages, engendering proteolytic stability and enhanced cellular permeability. Peptoids are notable for their facile synthesis, sequence diversity, and ability to fold into distinct secondary structures. In an effort to establish new functional peptoid architectures, we utilize the copper-catalyzed azide-alkyne [3+2] cycloaddition (CuAAC) reaction to generate peptidomimetic assemblies bearing bioactive ligands that specifically target and modulate Androgen Receptor (AR) activity, a major therapeutic target for prostate cancer. Additionally, we explore chemical ligation protocols to generate semi-synthetic hybrid biomacromolecules capable of exhibiting novel structures and functions not accessible to fully biosynthesized proteins.
-
[Interaction of protein with charged colloidal particles].
Durdenko, E V; Kuznetsova, S M; Basova, L V; Tikhonenko, S A; Saburova, E A
2011-01-01
The functional state of three proteins of different molecular weight (urease, lactate dehydrogenase, and hemoglobin) in the presence of the linear polyelectrolytes poly(allylamine hydrochloride) (PAA) and sodium poly(styrenesulfonate) (PSS) in the dissolved state and of the same polyelectrolytes bound to the surface of microspheres has been investigated. Microspheres were prepared by consecutive absorption of oppositely charged polyelectrolytes so that the outer layer of the shell was PAA for the acidic protein urease, and PSS for the alkaline proteins LDH and hemoglobin. It was shown that the dissolved polyelectrolyte completely inactivates all three proteins within one minute with a slight difference in the time constant. (By Hb inactivation are conventionally meant changes in the heme environment observed from the spectrum in the Soret band.) In the presence of microspheres, the proteins were adsorbed on their surface; in this case, more than 95% of the activity was retained within two hours. The proportion of the protein adsorbed on microspheres accounted for about 98% for urease, 72% for Hb, and 35% for LDH, as determined from the tryptophan fluorescence data. The interaction of hemoglobin with another type of charged colloidal particles, phospholipid vesicles, leads to the destruction of the tertiary structure of the protein, which made itself evident in the optical absorption spectra in the Soret band, as well as the spectra of tryptophan fluorescence and circular dichroism. In this case, according to circular dichroism, the percentage of alpha-helical structure of Hb was maintained. The differences in the physical and chemical mechanisms of interaction of proteins with these two types of charged colloidal particles that leads to differences in the degree of denaturing effects are discussed.
-
Coelho, Daniel H; Hammerschlag, Paul E; Bat-Chava, Yael; Kohan, Darius
2009-06-01
The Cochlear Implant Function Index (CIFI) is created to assess adult cochlear implant (CI) auditory effectiveness in real world situations. Our objective is to evaluate the CIFI as a reliable psychometric tool to assess 1) reliance on visual assistance, 2) telephone use, 3) communication at work, 4) 'hearing' in noise, 5) in groups, and 6) in large room settings. Based upon Guttman scaling properties, the CIFI elicits implanted respondent's functional level with auditory independence from Level 1 (still requiring signing) to level 4 (without any help beyond CI). A blinded, retrospective questionnaire is anonymously answered by cochlear implant recipients. CI centers of tertiary care medical centers, CI support group, and an interactive web page of a hearing and speech center in a large metropolitan region. 245 respondents from a varied adult CI population implanted for one month to 19 years prior to answering the questionnaire. An assessment tool of CI function. A coefficient of reproducibility (CR) for the Guttman scale format equal or greater than 0.90, indicating good scalability. CR in the CIFI was above 0.90. Effective scalability and mean scores from 2.5 to 3.5 for the six areas examined (1.00-4.00) were achieved. The psychometric properties of this user friendly survey demonstrate consistently good scalability. Based on these findings, the CIFI provides a validated tool that can be used for systematic comparisons between groups of patients or for follow-up outcomes in patients who use cochlear implants. Further study is indicated to correlate CIFI scores with sound and speech perception scores. Copyright 2009 John Wiley & Sons, Ltd.
-
Chessman, Julia C; Bowen, Jennifer R; Ford, Jane B
2017-05-01
To describe neonatal exchange transfusions in New South Wales (NSW) before and after release in January 2007 of a NSW Health guideline regarding exchange transfusions in tertiary and non-tertiary hospitals. The study population included neonates receiving exchange transfusion in NSW hospitals, 2001-2012. Linked birth and hospital data for mothers and babies were used to describe birth characteristics and maternal and neonatal conditions. Exchange transfusions were identified in hospital data and compared for 2001-2006 and 2007-2012. Maternal and neonatal characteristics were compared with χ 2 and Wilcoxon signed-rank tests. Between 2001 and 2012, there were 286 exchange transfusions performed for 281 neonates in NSW hospitals. The number of exchange transfusions decreased from 187 in 184 neonates for 2001-2006 to 99 in 97 neonates 2007-2012 (P < 0.001). The percentage of exchange transfusions performed at tertiary hospitals increased from 85% in 2001-2006 to 91% in 2007-2012, although this was not statistically significant (P = 0.16). Most neonates requiring exchange transfusion were born in tertiary hospitals: 62% for 2001-2006 and 69% for 2007-2012. Among those born in a non-tertiary hospital, the percentage transferred or admitted to a tertiary hospital for exchange transfusion was 63% in 2001-2006 and 77% in 2007-2012. Between 2001 and 2012, there was a decrease in neonatal exchange transfusions in NSW. After the 2007 guideline there was a non-significant increase in the proportion of exchange transfusions performed at tertiary hospitals. Although rare, exchange transfusions are still expected to occur occasionally in non-tertiary hospitals, requiring continuing support for this procedure in these settings. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).
-
Nasirudeen, A M A; Lee Chin Adeline, Lau; Wat Neo Josephine, Koh; Lay Seng, Lim; Wenjie, Li
2017-01-01
Many tertiary students access social networking sites on a daily basis. With the increased usage of smartphones, accessing social networking sites while commuting, in schools, waiting for friends, television commercial breaks has become prevalent among tertiary students. What started as a lifestyle choice has now become a daily necessity. Such behavior among tertiary students raises an important question for educators: how does social media usage affect tertiary students' sleep patterns and daytime sleepiness, their attention difficulties, especially in school? Thus, the aim of this study was to examine the relationships between tertiary students' self-reports of social media usage and daytime sleepiness. The design was a cross-sectional, quantitative research study. We used a survey that contained questions concerning demographic data, daytime sleepiness, total sleep time and social media usage and a version of the Cleveland Adolescent Sleepiness Questionnaire, modified for use in tertiary students, were used for data collection ( n = 969). The most preferred tool for accessing social networking sites was smartphones and WhatsApp was the most accessed site. Results indicated that nocturnal technology use has a weak, negative impact on tertiary students' quantity of sleep that may lead to daytime sleepiness. Local Singapore students spent significantly more time on social networking sites at night compared to foreign students. As a result, local students experienced more daytime sleepiness compared to foreign students. Prolonged social media usage, especially in bed, has a negative impact on tertiary students' daytime sleepiness. Since the technology is such an integral part of most tertiary students' lives, it is important to understand the impact it has on their sleep and daytime sleepiness.
-
ERIC Educational Resources Information Center
Golebiowski, Zofia, Ed.
This selection of papers from the First Conference on Tertiary Literacy, which examined the role of literacy as a foundation for knowledge acquisition and dissemination that influences the academic success of tertiary students, presents a number of case studies of policy and practice in Australian universities. Keynote addresses included:…
-
La Verde, Valentina; Trande, Matteo; D'Onofrio, Mariapina; Dominici, Paola; Astegno, Alessandra
2018-03-01
Calmodulin-like protein 19 (CML19) is an Arabidopsis centrin that modulates nucleotide excision repair (NER) by binding to RAD4 protein, the Arabidopsis homolog of human Xeroderma pigmentosum complementation group C protein. Although the necessity of CML19 as a part of the RAD4 plant recognition complex for functional NER is known at a cellular level, little is known at a molecular level. Herein, we used a combination of biophysical and biochemical approaches to investigate the structural and ion and target-peptide binding properties of CML19. We found that CML19 possesses four Ca 2+ -specific binding sites, two of high affinity in the N-terminal domain and two of low affinity in the C-terminal domain. Binding of Ca 2+ to CML19 increases its alpha-helix content, stabilizes the tertiary structure, and triggers a conformational change, resulting in the exposure of a hydrophobic patch instrumental for target protein recognition. Using bioinformatics tools we identified a CML19-binding site at the C-terminus of RAD4, and through in vitro binding experiments we analyzed the interaction between a 17-mer peptide representing this site and CML19. We found that the peptide shows a high affinity for CML19 in the presence of Ca 2+ (stoichiometry 1:1) and the interaction primarily involves the C-terminal half of CML19. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Carlson, J. Andrew; Dabiri, Ganary; Cribier, Bernard; Sell, Stewart
2013-01-01
Syphilis has plagued mankind for centuries and is currently resurgent in the Western hemisphere. While there has been a significant reduction of tertiary disease, and recognition of facilitative interactions with HIV infection, the natural history of syphilis has remained largely unchanged; thus, new strategies are required to more effectively combat this pathogen. The immunopathologic features of experimental syphilis in the rabbit; the course, stages, and pathology of human syphilis; and a comparison of human syphilis with leprosy suggest that the clinical course of syphilis and its tissue manifestations are determined by the balance between delayed type hypersensitivity (DTH) and humoral immunity to the causative agent, Treponema pallidum. A strong DTH response is associated with clearance of the infecting organisms in a well-developed chancre, whereas a cytotoxic T-cell response or strong humoral antibody response is associated with prolonged infection and progression to tertiary disease. Many of the protean symptoms/appearances of secondary and tertiary human syphilis are manifestations of immune reactions that fail to clear the organism, due to a lack of recruitment and more importantly, activation of macrophages by sensitized CD4 T-cells. The Bacillus Calmette Guerin (BCG) vaccination can enhance DTH and has been shown to produce a low, but measurable beneficial effect in the prevention of leprosy, a disease that shows a disease spectrum with characteristics in common with syphilis. In the prevention of syphilis, a potential vaccine protective against syphilis should be designed to augment the DTH response. PMID:21694502
-
A hybrid MD-kMC algorithm for folding proteins in explicit solvent.
Peter, Emanuel Karl; Shea, Joan-Emma
2014-04-14
We present a novel hybrid MD-kMC algorithm that is capable of efficiently folding proteins in explicit solvent. We apply this algorithm to the folding of a small protein, Trp-Cage. Different kMC move sets that capture different possible rate limiting steps are implemented. The first uses secondary structure formation as a relevant rate event (a combination of dihedral rotations and hydrogen-bonding formation and breakage). The second uses tertiary structure formation events through formation of contacts via translational moves. Both methods fold the protein, but via different mechanisms and with different folding kinetics. The first method leads to folding via a structured helical state, with kinetics fit by a single exponential. The second method leads to folding via a collapsed loop, with kinetics poorly fit by single or double exponentials. In both cases, folding times are faster than experimentally reported values, The secondary and tertiary move sets are integrated in a third MD-kMC implementation, which now leads to folding of the protein via both pathways, with single and double-exponential fits to the rates, and to folding rates in good agreement with experimental values. The competition between secondary and tertiary structure leads to a longer search for the helix-rich intermediate in the case of the first pathway, and to the emergence of a kinetically trapped long-lived molten-globule collapsed state in the case of the second pathway. The algorithm presented not only captures experimentally observed folding intermediates and kinetics, but yields insights into the relative roles of local and global interactions in determining folding mechanisms and rates.
-
A chiral aluminum solvating agent (CASA) for 1H NMR chiral analysis of alcohols at low temperature.
Seo, Min-Seob; Jang, Sumin; Kim, Hyunwoo
2018-03-16
A chiral aluminum solvating agent (CASA) was demonstrated to be a general and efficient reagent for 1H NMR chiral analysis of alcohols. The sodium salt of the CASA (CASA-Na) showed a complete baseline peak separation of the hydroxyl group for various chiral alcohols including primary, secondary, and tertiary alcohols with alkyl and aryl substituents in CD3CN. Due to the weak intermolecular interaction, 1H NMR measurement at low temperature (-40 to 10 °C) was required.
-
Time-Resolved Hydroxyl Radical Footprinting of RNA with X-Rays.
Hao, Yumeng; Bohon, Jen; Hulscher, Ryan; Rappé, Mollie C; Gupta, Sayan; Adilakshmi, Tadepalli; Woodson, Sarah A
2018-06-01
RNA footprinting by hydroxyl radical cleavage provides 'snapshots' of RNA tertiary structure or protein interactions that bury the RNA backbone. Generation of hydroxyl radicals with a high-flux synchrotron X-ray beam provides analysis on a short timescale (5-100 msec), which enables the structures of folding intermediates or other transient conformational states to be determined in biochemical solutions or cells. This article provides protocols for using synchrotron beamlines for hydroxyl radical footprinting. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.
-
Pritchard, Caroline; O'Connor, Gavin; Ashcroft, Alison E
2013-08-06
To achieve comparability of measurement results of protein amount of substance content between clinical laboratories, suitable reference materials are required. The impact on measurement comparability of potential differences in the tertiary and quaternary structure of protein reference standards is as yet not well understood. With the use of human growth hormone as a model protein, the potential of ion mobility spectrometry-mass spectrometry as a tool to assess differences in the structure of protein reference materials and their interactions with antibodies has been investigated here.
-
Interaction of pulsating and spinning waves in condensed phase combustion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Booty, M.R.; Margolis, S.B.; Matkowsky, B.J.
1986-10-01
The authors employ a nonlinear stability analysis in the neighborhood of a multiple bifurcation point to describe the interaction of pulsating and spinning modes of condensed phase combustion. Such phenomena occur in the synthesis of refractory materials. In particular, they consider the propagation of combustion waves in a long thermally insulated cylindrical sample and show that steady, planar combustion is stable for a modified activation energy/melting parameter less than a critical value. Above this critical value primary bifurcation states, corresponding to time-periodic pulsating and spinning modes of combustion, emanate from the steadily propagating solution. By varying the sample radius, themore » authors split a multiple bifurcation point to obtain bifurcation diagrams which exhibit secondary, tertiary, and quarternary branching to various types of quasi-periodic combustion waves.« less
-
Kim, Gwang Hoon; Jeong, Hae Jin; Yoo, Yeong Du; Kim, Sunju; Han, Ji Hee; Han, Jong Won; Zuccarello, Giuseppe C
2013-01-01
The loss of photosynthetic function should lead to the cessation of expression and finally loss of photosynthetic genes in the new heterotroph. Dinoflagellates are known to have lost their photosynthetic ability several times. Dinoflagellates have also acquired photosynthesis from other organisms, either on a long-term basis or as "kleptoplastids" multiple times. The fate of photosynthetic gene expression in heterotrophs can be informative into evolution of gene expression patterns after functional loss, and the dinoflagellates ability to acquire new photosynthetic function through additional endosymbiosis. To explore this we analyzed a large-scale EST database consisting of 151,091 unique sequences (29,170 contigs, 120,921 singletons) obtained from 454 pyrosequencing of the heterotrophic dinoflagellate Pfiesteria piscicida. About 597 contigs from P. piscicida showed significant homology (E-value
-
Chan, S C C; Chan, A P S
2005-08-01
Retrospective descriptive analysis of data of patients with traumatic spinal cord injury (SCI) in a tertiary SCI centre. To identify the characteristics of the rehabilitation outcomes of patients with different levels of traumatic SCI and to compare the results with data reported in the American Consortium for Spinal Cord Medicine. A newly established tertiary SCI centre in Tai Po Hospital, Tai Po, Hong Kong. A total of 33 patients with traumatic SCI admitted in 2002 were included in the study. They were classified into different ASIA subgroups based on their levels and completeness of injury. The functional status changes measured by the Functional Independence Measure (FIM) (on admission, placement and upon discharge, and at 1 and 3 months post discharge) and discharge placement were recorded as rehabilitation outcomes. A total, 24 patients were tetraplegic while nine were paraplegic. Seven and two from tetraplegic and paraplegic groups were readmitted with late complications due to urinary tract infection, spasticity and/or occurrence of pressure sores. The mean age was found to be 48.36 (SD=15.64) years. In all, 16 (48.48%) sustained the injury from falling from height. The trend of FIM motor scores at discharge across different ASIA subgroups appeared to be comparable to those reported in the American Consortium for Spinal Cord Medicine with scores generally lower. Significant functional improvements during the hospital phase were found in the two tetraplegic and paraplegic ASIA D subgroups (t3=3.430, P<0.05; t2=4.083, P=0.55, respectively). Significant differences were also revealed among subgroups (F(7,32)=6.625, P<0.0005) with lower level tetraplegic groups appearing to stay much longer in the rehabilitation centre. In all, 64.5% of newly diagnosed patients returned to live in the community. This report gives a preliminary overview on the characteristics of rehabilitation outcomes in one of the SCI centres in Hong Kong in relation to the international standard. Longitudinal study with larger population and community integration outcomes might be included in the future to reveal a better picture in the SCI rehabilitation in Hong Kong.
-
Imanian, Behzad; Keeling, Patrick J
2007-01-01
Background The dinoflagellates Durinskia baltica and Kryptoperidinium foliaceum are distinguished by the presence of a tertiary plastid derived from a diatom endosymbiont. The diatom is fully integrated with the host cell cycle and is so altered in structure as to be difficult to recognize it as a diatom, and yet it retains a number of features normally lost in tertiary and secondary endosymbionts, most notably mitochondria. The dinoflagellate host is also reported to retain mitochondrion-like structures, making these cells unique in retaining two evolutionarily distinct mitochondria. This redundancy raises the question of whether the organelles share any functions in common or have distributed functions between them. Results We show that both host and endosymbiont mitochondrial genomes encode genes for electron transport proteins. We have characterized cytochrome c oxidase 1 (cox1), cytochrome oxidase 2 (cox2), cytochrome oxidase 3 (cox3), cytochrome b (cob), and large subunit of ribosomal RNA (LSUrRNA) of endosymbiont mitochondrial ancestry, and cox1 and cob of host mitochondrial ancestry. We show that all genes are transcribed and that those ascribed to the host mitochondrial genome are extensively edited at the RNA level, as expected for a dinoflagellate mitochondrion-encoded gene. We also found evidence for extensive recombination in the host mitochondrial genes and that recombination products are also transcribed, as expected for a dinoflagellate. Conclusion Durinskia baltica and K. foliaceum retain two mitochondria from evolutionarily distinct lineages, and the functions of these organelles are at least partially overlapping, since both express genes for proteins in electron transport. PMID:17892581
-
2014-01-01
Background Proper management of Biomedical waste (BMW) generated in a healthcare facility is one of the most important functions of a healthcare worker (HCW) as its improper management not only poses risk to human beings and environment, but may also invite legal action against HCW as well as hospital administration. This study was carried out to evaluate quality of BMW management in 1100-bedded hospital attached to a tertiary care public institute in North India. Methods A checklist, including 29 parameters related to various functions to be carried out at source of generation by a HCW for BMW management was prepared by researcher and used after validation to record observations in all the 70 areas of hospital. A total of 6 visits were made to each area and mean percentage score was calculated for each area and each category of waste management. Results It was found that summated mean percentage score of ‘Treatment Room of Wards’, which were used exclusively by resident doctors, was significantly lower than Operation Theatres (p value: 0.033) and ‘Central Waste Collection Points of Wards’ (p value: 0.018) for the function of ‘mutilation of recyclable waste’ and it was significantly lower than all other areas (p value: 0.006 to 0.017) for the function of ‘disinfection of waste’. Conclusion It is concluded that more emphasis needs to be laid on ‘mutilation of recyclable waste’ and disinfection of waste’ by HCWs especially resident doctors. PMID:24742274
-
ERIC Educational Resources Information Center
Hore, Terry, Ed.; And Others
Proceedings are presented of a conference that examined the purposes and setting of tertiary education in Australia in the changing social order of the 1980s, the future roles for tertiary education in Australia, and the pattern and form of accountability appropriate to Australian tertiary education in the late twentieth century. Papers and…
-
Lee, Richmond; Gryn'ova, Ganna; Ingold, K U; Coote, Michelle L
2016-08-24
High-level ab initio calculations are used to identify the mechanism of secondary (and primary) alkylperoxyl radical termination and explain why their reactions are much faster than their tertiary counterparts. Contrary to existing literature, the decomposition of both tertiary and non-tertiary tetroxides follows the same asymmetric two-step bond cleavage pathway to form a caged intermediate of overall singlet multiplicity comprising triplet oxygen and two alkoxyl radicals. The alpha hydrogen atoms of non-tertiary species facilitate this process by forming unexpected CHO hydrogen bonds to the evolving O2. For non-tertiary peroxyls, subsequent alpha hydrogen atom transfer then yields the experimentally observed non-radical products, ketone, alcohol and O2, whereas for tertiary species, this reaction is precluded and cage escape of the (unpaired) alkoxyl radicals is a likely outcome with important consequences for autoxidation.
-
Physicians' perceptions of physician-nurse interactions and information needs in China.
Wen, Dong; Guan, Pengcheng; Zhang, Xingting; Lei, Jianbo
2018-01-01
Good communication between physicians and nurses is important for the understanding of disease status and treatment feedback; however, certain issues in Chinese hospitals could lead to suboptimal physician-nurse communication in clinical work. Convenience sampling was used to recruit participants. Questionnaires were sent to clinical physicians in three top tertiary Grade-A teaching hospitals in China and six hundred and seventeen physicians participated in the survey. (1) Common physician-nurse interactions were shift-change reports and provisional reports when needed, and interactions expected by physicians included face-to-face reports and communication via a phone or mobile device. (2) Most respondents believed that the need for information in physician-nurse interactions was high, information was moderately accurate and timely, and feedback regarding interaction time and satisfaction indicated that they were only average and required improvement. (3) Information needs in physician-nurse interactions differed significantly according to hospital category, role, workplace, and educational background (p < .05). There was a considerable need for information within physician-nurse interactions, and the level of satisfaction with the information obtained was average; requirements for the improvement of communication differed between physicians and nurses because of differences in their characteristics. Currently, the use of information technology in physician-nurse communication was less common but was highly expected by physicians.
-
Horizontal functional gene transfer from bacteria to fishes.
Sun, Bao-Fa; Li, Tong; Xiao, Jin-Hua; Jia, Ling-Yi; Liu, Li; Zhang, Peng; Murphy, Robert W; He, Shun-Min; Huang, Da-Wei
2015-12-22
Invertebrates can acquire functional genes via horizontal gene transfer (HGT) from bacteria but fishes are not known to do so. We provide the first reliable evidence of one HGT event from marine bacteria to fishes. The HGT appears to have occurred after emergence of the teleosts. The transferred gene is expressed and regulated developmentally. Its successful integration and expression may change the genetic and metabolic repertoire of fishes. In addition, this gene contains conserved domains and similar tertiary structures in fishes and their putative donor bacteria. Thus, it may function similarly in both groups. Evolutionary analyses indicate that it evolved under purifying selection, further indicating its conserved function. We document the first likely case of HGT of functional gene from prokaryote to fishes. This discovery certifies that HGT can influence vertebrate evolution.
-
Organisational reform in healthcare in China: impacts on the social functions of public hospitals.
Shi, Guang; O'Rourke, Michael; Liu, Jinfeng; Zhong, Dongbo; Liu, Xiuying; Li, Jing
2003-01-01
Public hospital reform in China since the mid 1980s has had detrimental effects on hospitals' social functions, especially the provision of care for poor people. This study of hospitals in Northern China, using a range of economic measurements, indicated that there has been an overall decline in social functions since 1985, especially in secondary and tertiary level hospitals. Reason for this include the increasingly competitive medical market in China and, under the decentralisation reforms, the imperative for hospitals to generate revenue. We put forward policies to strengthen hospital social functions, including funding for essential packages of services to specifically benefit the poor and vulnerable, and increased government subsidies to support social functions in primary level hospitals where care can be more easily accessed.
-
Mood disorders and sexual functioning in women with functional hypothalamic amenorrhea.
Dundon, Carolyn M; Rellini, Alessandra H; Tonani, Silvia; Santamaria, Valentina; Nappi, Rosella
2010-11-01
To investigate the sexual function of women with functional hypothalamic amenorrhea (FHA) and to test the mediating effects of depression and anxiety on the sexual functioning of women with FHA. In this cross-sectional study, participants completed questionnaires on sexual function, depression, and anxiety. Tertiary care university hospital. Women with (n=41) and without (n=39) FHA recruited from a gynecologic endocrinology unit. None. The McCoy Female Sexuality Questionnaire assessed sexual function, and the Zung Scale measured depression and anxiety. Women with FHA experienced more sexual function problems and significantly higher depression and anxiety compared to women without menstrual dysfunction. In addition, depression offered a significant explanation for the sexual problems experienced by women with FHA. The psychologic symptoms that contribute to the onset of FHA partially mediate the relationship between FHA and sexual dysfunction. Copyright © 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamdani, Hazrina Yusof, E-mail: hazrina@mfrlab.org; Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Kepala Batas; Artymiuk, Peter J., E-mail: p.artymiuk@sheffield.ac.uk
A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graphmore » theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods.« less
-
Mixed La-Li heterobimetallic complexes for tertiary nitroaldol resolution.
Tosaki, Shin-ya; Hara, Keiichi; Gnanadesikan, Vijay; Morimoto, Hiroyuki; Harada, Shinji; Sugita, Mari; Yamagiwa, Noriyuki; Matsunaga, Shigeki; Shibasaki, Masakatsu
2006-09-13
A kinetic resolution of tertiary nitroaldols derived from simple ketones is described. Mixed BINOL/biphenol La-Li heterobimetallic complexes gave the best selectivity in retro-nitroaldol reactions of racemic tertiary nitroaldols. By using a mixture of La-Li3-(1a)3 complex (LLB 2a) and La-Li3-(1b)3 (LLB* 2b) complex in a ratio of 2/1, chiral tertiary nitroaldols were obtained in 80-97% ee and 30-47% recovery yield.
-
Primary, secondary, and tertiary amines for CO2 capture: designing for mesoporous CO2 adsorbents.
Ko, Young Gun; Shin, Seung Su; Choi, Ung Su
2011-09-15
CO(2) emissions, from fossil-fuel-burning power plants, the breathing, etc., influence the global worming on large scale and the man's work efficiency on small scale. The reversible capture of CO(2) is a prominent feature of CO(2) organic-inorganic hybrid adsorbent to sequester CO(2). Herein, (3-aminopropyl) trimethoxysilane (APTMS), [3-(methylamino)propyl] trimethoxysilane (MAPTMS), and [3-(diethylamino) propyl] trimethoxysilane (DEAPTMS) are immobilized on highly ordered mesoporous silicas (SBA-15) to catch CO(2) as primary, secondary, and tertiary aminosilica adsorbents. X-ray photoelectron spectroscopy was used to analyze the immobilized APTMS, MAPTMS, and DEAPTMS on the SBA-15. We report an interesting discovery that the CO(2) adsorption and desorption on the adsorbent depend on the amine type of the aminosilica adsorbent. The adsorbed CO(2) was easily desorbed from the adsorbent with the low energy consumption in the order of tertiary, secondary, and primary amino-adsorbents while the adsorption amount and the bonding-affinity increased in the reverse order. The effectiveness of amino-functionalized (1(o), 2(o), and 3(o) amines) SBA-15s as a CO(2) capturing agent was investigated in terms of adsorption capacity, adsorption-desorption kinetics, and thermodynamics. This work demonstrates apt amine types to catch CO(2) and regenerate the adsorbent, which may open new avenues to designing "CO(2) basket". Copyright © 2011. Published by Elsevier Inc.
-
3DProIN: Protein-Protein Interaction Networks and Structure Visualization.
Li, Hui; Liu, Chunmei
2014-06-14
3DProIN is a computational tool to visualize protein-protein interaction networks in both two dimensional (2D) and three dimensional (3D) view. It models protein-protein interactions in a graph and explores the biologically relevant features of the tertiary structures of each protein in the network. Properties such as color, shape and name of each node (protein) of the network can be edited in either 2D or 3D views. 3DProIN is implemented using 3D Java and C programming languages. The internet crawl technique is also used to parse dynamically grasped protein interactions from protein data bank (PDB). It is a java applet component that is embedded in the web page and it can be used on different platforms including Linux, Mac and Window using web browsers such as Firefox, Internet Explorer, Chrome and Safari. It also was converted into a mac app and submitted to the App store as a free app. Mac users can also download the app from our website. 3DProIN is available for academic research at http://bicompute.appspot.com.
-
A Real-Time All-Atom Structural Search Engine for Proteins
Gonzalez, Gabriel; Hannigan, Brett; DeGrado, William F.
2014-01-01
Protein designers use a wide variety of software tools for de novo design, yet their repertoire still lacks a fast and interactive all-atom search engine. To solve this, we have built the Suns program: a real-time, atomic search engine integrated into the PyMOL molecular visualization system. Users build atomic-level structural search queries within PyMOL and receive a stream of search results aligned to their query within a few seconds. This instant feedback cycle enables a new “designability”-inspired approach to protein design where the designer searches for and interactively incorporates native-like fragments from proven protein structures. We demonstrate the use of Suns to interactively build protein motifs, tertiary interactions, and to identify scaffolds compatible with hot-spot residues. The official web site and installer are located at http://www.degradolab.org/suns/ and the source code is hosted at https://github.com/godotgildor/Suns (PyMOL plugin, BSD license), https://github.com/Gabriel439/suns-cmd (command line client, BSD license), and https://github.com/Gabriel439/suns-search (search engine server, GPLv2 license). PMID:25079944
-
A real-time all-atom structural search engine for proteins.
Gonzalez, Gabriel; Hannigan, Brett; DeGrado, William F
2014-07-01
Protein designers use a wide variety of software tools for de novo design, yet their repertoire still lacks a fast and interactive all-atom search engine. To solve this, we have built the Suns program: a real-time, atomic search engine integrated into the PyMOL molecular visualization system. Users build atomic-level structural search queries within PyMOL and receive a stream of search results aligned to their query within a few seconds. This instant feedback cycle enables a new "designability"-inspired approach to protein design where the designer searches for and interactively incorporates native-like fragments from proven protein structures. We demonstrate the use of Suns to interactively build protein motifs, tertiary interactions, and to identify scaffolds compatible with hot-spot residues. The official web site and installer are located at http://www.degradolab.org/suns/ and the source code is hosted at https://github.com/godotgildor/Suns (PyMOL plugin, BSD license), https://github.com/Gabriel439/suns-cmd (command line client, BSD license), and https://github.com/Gabriel439/suns-search (search engine server, GPLv2 license).
-
Automated 3D structure composition for large RNAs
Popenda, Mariusz; Szachniuk, Marta; Antczak, Maciej; Purzycka, Katarzyna J.; Lukasiak, Piotr; Bartol, Natalia; Blazewicz, Jacek; Adamiak, Ryszard W.
2012-01-01
Understanding the numerous functions that RNAs play in living cells depends critically on knowledge of their three-dimensional structure. Due to the difficulties in experimentally assessing structures of large RNAs, there is currently great demand for new high-resolution structure prediction methods. We present the novel method for the fully automated prediction of RNA 3D structures from a user-defined secondary structure. The concept is founded on the machine translation system. The translation engine operates on the RNA FRABASE database tailored to the dictionary relating the RNA secondary structure and tertiary structure elements. The translation algorithm is very fast. Initial 3D structure is composed in a range of seconds on a single processor. The method assures the prediction of large RNA 3D structures of high quality. Our approach needs neither structural templates nor RNA sequence alignment, required for comparative methods. This enables the building of unresolved yet native and artificial RNA structures. The method is implemented in a publicly available, user-friendly server RNAComposer. It works in an interactive mode and a batch mode. The batch mode is designed for large-scale modelling and accepts atomic distance restraints. Presently, the server is set to build RNA structures of up to 500 residues. PMID:22539264
-
Response to unfairness across the suicide risk spectrum.
Carbajal, Jessica M; Gamboa, Jorge L; Moore, Jordan; Smith, Favrin; Ann Eads, Lou; Clothier, Jeffrey L; Cáceda, Ricardo
2017-12-01
Suicidal behavior is frequently triggered by social crises, such as familial, romantic, social or work-related conflict. A variety of cognitive and social functioning impairments has been associated with suicidal thoughts and acts. One of the precipitating and perpetuating factors of social conflict is the desire for retribution after a perceived offense, even at one's own detriment. We utilized the Ultimatum Game-a behavioral economic task which examines the behavioral response to perceived unfairness-in order to characterize the response to unfairness across the acute suicide risk spectrum. We examined five groups of adult individuals of both genders (n = 204): High- and Low-Lethality recent Suicide Attempters, Suicidal Ideators, Non-Suicidal Depressed Patients; and Healthy Controls. We also measured demographic and clinical variables. Even though all depressed groups showed similar rejection rates in the Ultimatum Game, there was a higher likelihood of rejecting offers in the low stakes condition in all acutely suicidal groups compared with healthy controls. Stake size, offer, education, and gender of the proposer were significantly associated with rejection rates. Acutely suicidal patients may be more vulnerable to adverse interpersonal interactions. Further characterization of social behavior may provide targets for secondary and tertiary prevention for high-risk individuals. Published by Elsevier B.V.
-
CHALMERS, IAIN W.; HOFFMANN, KARL F.
2012-01-01
SUMMARY During platyhelminth infection, a cocktail of proteins is released by the parasite to aid invasion, initiate feeding, facilitate adaptation and mediate modulation of the host immune response. Included amongst these proteins is the Venom Allergen-Like (VAL) family, part of the larger sperm coating protein/Tpx-1/Ag5/PR-1/Sc7 (SCP/TAPS) superfamily. To explore the significance of this protein family during Platyhelminthes development and host interactions, we systematically summarize all published proteomic, genomic and immunological investigations of the VAL protein family to date. By conducting new genomic and transcriptomic interrogations to identify over 200 VAL proteins (228) from species in all 4 traditional taxonomic classes (Trematoda, Cestoda, Monogenea and Turbellaria), we further expand our knowledge related to platyhelminth VAL diversity across the phylum. Subsequent phylogenetic and tertiary structural analyses reveal several class-specific VAL features, which likely indicate a range of roles mediated by this protein family. Our comprehensive analysis of platyhelminth VALs represents a unifying synopsis for understanding diversity within this protein family and a firm context in which to initiate future functional characterization of these enigmatic members. PMID:22717097
-
Intracranial Cortical Responses during Visual–Tactile Integration in Humans
Quinn, Brian T.; Carlson, Chad; Doyle, Werner; Cash, Sydney S.; Devinsky, Orrin; Spence, Charles; Halgren, Eric
2014-01-01
Sensory integration of touch and sight is crucial to perceiving and navigating the environment. While recent evidence from other sensory modality combinations suggests that low-level sensory areas integrate multisensory information at early processing stages, little is known about how the brain combines visual and tactile information. We investigated the dynamics of multisensory integration between vision and touch using the high spatial and temporal resolution of intracranial electrocorticography in humans. We present a novel, two-step metric for defining multisensory integration. The first step compares the sum of the unisensory responses to the bimodal response as multisensory responses. The second step eliminates the possibility that double addition of sensory responses could be misinterpreted as interactions. Using these criteria, averaged local field potentials and high-gamma-band power demonstrate a functional processing cascade whereby sensory integration occurs late, both anatomically and temporally, in the temporo–parieto–occipital junction (TPOJ) and dorsolateral prefrontal cortex. Results further suggest two neurophysiologically distinct and temporally separated integration mechanisms in TPOJ, while providing direct evidence for local suppression as a dominant mechanism for synthesizing visual and tactile input. These results tend to support earlier concepts of multisensory integration as relatively late and centered in tertiary multimodal association cortices. PMID:24381279
-
Antunes, Deborah; Jorge, Natasha A. N.; Caffarena, Ernesto R.; Passetti, Fabio
2018-01-01
RNA molecules are essential players in many fundamental biological processes. Prokaryotes and eukaryotes have distinct RNA classes with specific structural features and functional roles. Computational prediction of protein structures is a research field in which high confidence three-dimensional protein models can be proposed based on the sequence alignment between target and templates. However, to date, only a few approaches have been developed for the computational prediction of RNA structures. Similar to proteins, RNA structures may be altered due to the interaction with various ligands, including proteins, other RNAs, and metabolites. A riboswitch is a molecular mechanism, found in the three kingdoms of life, in which the RNA structure is modified by the binding of a metabolite. It can regulate multiple gene expression mechanisms, such as transcription, translation initiation, and mRNA splicing and processing. Due to their nature, these entities also act on the regulation of gene expression and detection of small metabolites and have the potential to helping in the discovery of new classes of antimicrobial agents. In this review, we describe software and web servers currently available for riboswitch aptamer identification and secondary and tertiary structure prediction, including applications. PMID:29403526
-
Probing the mechanism of insulin fibril formation with insulin mutants.
Nielsen, L; Frokjaer, S; Brange, J; Uversky, V N; Fink, A L
2001-07-27
The molecular basis of insulin fibril formation was investigated by studying the structural properties and kinetics of fibril formation of 20 different human insulin mutants at both low pH (conditions favoring monomer/dimer) and at pH 7.4 (conditions favoring tetramer/hexamer). Small-angle X-ray scattering showed insulin to be monomeric in 20% acetic acid, 0.1 M NaCl, pH 2. The secondary structure of the mutants was assessed using far-UV circular dichroism, and the tertiary structure was determined using near-UV circular dichroism, quenching of intrinsic fluorescence by acrylamide and interactions with the hydrophobic probe 1-anilino-8-naphthalene-sulfonic acid (ANS). The kinetics of fibril formation were monitored with the fluorescent dye, Thioflavin T. The results indicate that the monomer is the state from which fibrils arise, thus under some conditions dissociation of hexamers may be rate limiting or partially rate limiting. The insulin mutants were found to retain substantial nativelike secondary and tertiary structure under all conditions studied. The results suggest that fibril formation of the insulin mutants is controlled by specific molecular interactions that are sensitive to variations in the primary structure. The observed effects of several mutations on the rate of fibril formation are inconsistent with a previously suggested model for fibrillation [Brange, J., Whittingham, J., Edwards, D., Youshang, Z., Wollmer, A., Brandenburg, D., Dodson, G., and Finch, J. (1997) Curr. Sci. 72, 470-476]. Two surfaces on the insulin monomer are identified as potential interacting sites in insulin fibrils, one consisting of the residues B10, B16, and B17 and the other consisting of at least the residues A8 and B25. The marked increase in the lag time for fibril formation with mutations to more polar residues, as well as mutations to charged residues, demonstrates the importance of both hydrophobic and electrostatic interactions in the initial stages of fibrillation. A model for insulin fibril formation is proposed in which the formation of a partially folded intermediate is the precursor for associated species on the pathway to fibril formation.
-
Saito, Amornrat; Creedy, Debra; Cooke, Marie; Chaboyer, Wendy
2013-01-01
We investigated the effects of physical, psychological, and sexual violence on the health status of women attending antenatal clinics at two tertiary hospitals in rural Thailand. We asked 421 pregnant women at 32 weeks gestation or later to complete a survey questionnaire. Participants reported high rates of psychological abuse (53.7%); threats, acts of physical abuse, or both (26.6%); and sexual violence (19.2%). Women abused during pregnancy had poorer health compared with nonabused women, in role emotional functioning, vitality, bodily pain, mental health, and social functioning. Given the high prevalence of violence and poor health status, routine screenings by maternity services is urgently required.
-
Depasquale, Roberto; Lee, Sau L; Saluja, Bhawana; Shur, Jagdeep; Price, Robert
2015-06-01
This study investigated the structural relaxation of micronized fluticasone propionate (FP) under different lagering conditions and its influence on aerodynamic particle size distribution (APSD) of binary and tertiary carrier-based dry powder inhaler (DPI) formulations. Micronized FP was lagered under low humidity (LH 25 C, 33% RH [relative humidity]), high humidity (HH 25°C, 75% RH) for 30, 60, and 90 days, respectively, and high temperature (HT 60°C, 44% RH) for 14 days. Physicochemical, surface interfacial properties via cohesive-adhesive balance (CAB) measurements and amorphous disorder levels of the FP samples were characterized. Particle size, surface area, and rugosity suggested minimal morphological changes of the lagered FP samples, with the exception of the 90-day HH (HH90) sample. HH90 FP samples appeared to undergo surface reconstruction with a reduction in surface rugosity. LH and HH lagering reduced the levels of amorphous content over 90-day exposure, which influenced the CAB measurements with lactose monohydrate and salmeterol xinafoate (SX). CAB analysis suggested that LH and HH lagering led to different interfacial interactions with lactose monohydrate but an increasing adhesive affinity with SX. HT lagering led to no detectable levels of the amorphous disorder, resulting in an increase in the adhesive interaction with lactose monohydrate. APSD analysis suggested that the fine particle mass of FP and SX was affected by the lagering of the FP. In conclusion, environmental conditions during the lagering of FP may have a profound effect on physicochemical and interfacial properties as well as product performance of binary and tertiary carrier-based DPI formulations.
-
Goth, Ursula Småland; Bergsli, Oddhild; Johanesen, Else Marie
2017-01-28
To determine how to enhance integration of minority students in health education, and thereby improve intercultural communication skills and cultural sensitivity in a sample of health teacher students in Norway. After a group-work intervention and for a period of six months afterwards we followed an "action research" approach and observed 47 health teachers-in-training in their first year at the Oslo and Akershus University College during classroom interactions. Data were qualitative and comprised student self-reports and survey results along with observations from three teachers, the authors of the study. Data were analyzed using a constant comparative approach with opinion categorization and an open coding procedure, with separate analyses performed on observations from minority students, majority students, and teachers. Both ethnic majority and minority students experienced an increase in intercultural knowledge and problem-solving ability after the experience of an early intervention in their first academic year of tertiary education. Students reacted favorably to the intervention and noted in class assessments both the challenges and rewards of overcoming cultural barriers. Teacher observation notes confirmed that early intervention led to an increase in interaction and cross-cultural engagement between minority and majority students compared to previous years' classes without the intervention. Early classroom intervention to promote intercultural engagement can prevent clique formation along majority/minority lines. The method used here, tailored group assignments in ethnically diverse working groups at the very beginning of students' tertiary academic career, can be an effective approach to cultivating attitudes and skills fostering intercultural awareness and sensitivity.
-
A kinetic and thermodynamic framework for the Azoarcus group I ribozyme reaction
Gleitsman, Kristin R.
2014-01-01
Determination of quantitative thermodynamic and kinetic frameworks for ribozymes derived from the Azoarcus group I intron and comparisons to their well-studied analogs from the Tetrahymena group I intron reveal similarities and differences between these RNAs. The guanosine (G) substrate binds to the Azoarcus and Tetrahymena ribozymes with similar equilibrium binding constants and similar very slow association rate constants. These and additional literature observations support a model in which the free ribozyme is not conformationally competent to bind G and in which the probability of assuming the binding-competent state is determined by tertiary interactions of peripheral elements. As proposed previously, the slow binding of guanosine may play a role in the specificity of group I intron self-splicing, and slow binding may be used analogously in other biological processes. The internal equilibrium between ribozyme-bound substrates and products is similar for these ribozymes, but the Azoarcus ribozyme does not display the coupling in the binding of substrates that is observed with the Tetrahymena ribozyme, suggesting that local preorganization of the active site and rearrangements within the active site upon substrate binding are different for these ribozymes. Our results also confirm the much greater tertiary binding energy of the 5′-splice site analog with the Azoarcus ribozyme, binding energy that presumably compensates for the fewer base-pairing interactions to allow the 5′-exon intermediate in self splicing to remain bound subsequent to 5′-exon cleavage and prior to exon ligation. Most generally, these frameworks provide a foundation for design and interpretation of experiments investigating fundamental properties of these and other structured RNAs. PMID:25246656
-
Pokharel, R; Lama, S; Adhikari, B R
2016-09-01
Hopelessness is thought to result from a negative appraisal system and interacts with, and worsens, appraisals of defeat and trap which in turn interact with suicide schema and lead to suicidal behaviour. This study was intended to assess hopelessness and suicidal ideation among patients with depression and neurotic disorders at tertiary care centre of eastern Nepal. A cross sectional design included 70 respondents by purposive sampling technique. Beck Hopelessness Scale and Scale of Suicidal Ideation were used to measure hopelessness and suicidal ideation, respectively. Data were analyzed using SPSS statistical software. Pearson chi-square, binary logistic regression and Spearmans' rho, test were applied at 95% confidence interval. Mean ± SD age was 32.8 ± 13.5 years. Most (62.8%) of the patients were female and with the diagnosis of depression. Majority (66%) of the patients had hopelessness. There was no significant difference in hopelessness among patients with depression and neurotic disorders. About 17% respondents had suicidal ideation, among them 82.4% were female. There was no significant difference of suicidal ideation among patients with depression and neurotic disorders (p=0.013). Significant positive correlation between hopelessness and suicidal ideation was found (p=0.001). Binary logistic regression revealed hopelessness was independently related to income and family history of mental illness. Similarly, suicidal ideation was independently related to depression and family history of mental illness. Female respondents, people living under poverty and positive family history of mental illness had more hopelessness and suicidal ideation.
-
Bergsli, Oddhild; Johanesen, Else Marie
2017-01-01
Objectives To determine how to enhance integration of minority students in health education, and thereby improve intercultural communication skills and cultural sensitivity in a sample of health teacher students in Norway. Methods After a group-work intervention and for a period of six months afterwards we followed an “action research” approach and observed 47 health teachers-in-training in their first year at the Oslo and Akershus University College during classroom interactions. Data were qualitative and comprised student self-reports and survey results along with observations from three teachers, the authors of the study. Data were analyzed using a constant comparative approach with opinion categorization and an open coding procedure, with separate analyses performed on observations from minority students, majority students, and teachers. Results Both ethnic majority and minority students experienced an increase in intercultural knowledge and problem-solving ability after the experience of an early intervention in their first academic year of tertiary education. Students reacted favorably to the intervention and noted in class assessments both the challenges and rewards of overcoming cultural barriers. Teacher observation notes confirmed that early intervention led to an increase in interaction and cross-cultural engagement between minority and majority students compared to previous years’ classes without the intervention. Conclusions Early classroom intervention to promote intercultural engagement can prevent clique formation along majority/minority lines. The method used here, tailored group assignments in ethnically diverse working groups at the very beginning of students’ tertiary academic career, can be an effective approach to cultivating attitudes and skills fostering intercultural awareness and sensitivity. PMID:28132033
-
Characterization of protein-folding pathways by reduced-space modeling.
Kmiecik, Sebastian; Kolinski, Andrzej
2007-07-24
Ab initio simulations of the folding pathways are currently limited to very small proteins. For larger proteins, some approximations or simplifications in protein models need to be introduced. Protein folding and unfolding are among the basic processes in the cell and are very difficult to characterize in detail by experiment or simulation. Chymotrypsin inhibitor 2 (CI2) and barnase are probably the best characterized experimentally in this respect. For these model systems, initial folding stages were simulated by using CA-CB-side chain (CABS), a reduced-space protein-modeling tool. CABS employs knowledge-based potentials that proved to be very successful in protein structure prediction. With the use of isothermal Monte Carlo (MC) dynamics, initiation sites with a residual structure and weak tertiary interactions were identified. Such structures are essential for the initiation of the folding process through a sequential reduction of the protein conformational space, overcoming the Levinthal paradox in this manner. Furthermore, nucleation sites that initiate a tertiary interactions network were located. The MC simulations correspond perfectly to the results of experimental and theoretical research and bring insights into CI2 folding mechanism: unambiguous sequence of folding events was reported as well as cooperative substructures compatible with those obtained in recent molecular dynamics unfolding studies. The correspondence between the simulation and experiment shows that knowledge-based potentials are not only useful in protein structure predictions but are also capable of reproducing the folding pathways. Thus, the results of this work significantly extend the applicability range of reduced models in the theoretical study of proteins.
-
Boerschmann, H; Walter, M; Achenbach, P; Ziegler, A-G
2010-02-01
Immunomodulatory strategies in the management of type 1 diabetes mellitus (T1DM) have as their primary target the prevention of initiating islet autoimmunity (primary-), the secondary one is the progression to diabetes (secondary-) in non-diabetic persons at risk, and the decline of beta-cell function in new-onset patients (tertiary-prevention). This article reviews four recent immunointervention trials in patients with T1DM. (1) The Pre-POINT study is a primary prevention trial that will test whether vaccination with oral or nasal insulin can prevent the progression of islet autoimmunity and of T1DM in autoantibody-negative children who are genetically at high diabetes risk. (2) The Cord Blood study is a tertiary immunointervention trial that will test whether administration of autologous umbilical cord blood to children with T1DM can lead to regeneration of pancreatic islet insulin-producing beta-cells and improved blood glucose control. (3) The GAD Vaccination study will test whether vaccination with alum-formulated rhGAD65 (recombinant human glutamic acid decarboxylate) can preserve beta-cell function in 320 children with newly diagnosed T1DM, as has been suggested in a recent phase II study. (4) The AIDA study will test the beta-cell protective effect of interleukin-1-receptor antagonist Anakinra in 80 patients with T1DM, which has recently been shown to improve beta-cell function in patients with type 2 diabetes. Copyright Georg Thieme Verlag KG Stuttgart . New York.
-
Reyes-López, Alfonso; Garduño-Espinosa, Juan; Muñoz-Hernández, Onofre
2018-01-01
Background Drug-drug interactions (DDIs) detected in a patient may not be clinically apparent (potential DDIs), and when they occur, they produce adverse drug reactions (ADRs), toxicity or loss of treatment efficacy. In pediatrics, there are only few publications assessing potential DDIs and their risk factors. There are no studies in children admitted to emergency departments (ED). The present study estimates the prevalence and describes the characteristics of potential DDIs in patients admitted to an ED from a tertiary care hospital in Mexico; in addition, potential DDI-associated risk factors are investigated. Methods A secondary analysis of data from 915 patients admitted to the ED of the Hospital Infantil de México “Federico Gómez” was conducted. The Medscape Drug Interaction Checker software was used to identify potential DDIs. The results are expressed as number of cases (%), means (95% CI) and medians (25-75th percentiles). Count data regressions for number of total and severity-stratified potential DDIs were performed adjusting for patient characteristics, number of administered drugs, days of stay, presence of ADRs and diagnoses. Results The prevalence of potential DDIs was 61%, with a median of 4 (2–8). A proportion of 0.2% of potential DDIs was “Contraindicated”, 7.5% were classified as “Serious”, 62.8% as “Significant” and 29.5% as “Minor”. Female gender, age, days of stay, number of administered drugs and diagnoses of Neoplasms (C00-D48), Congenital malformations (Q00-Q99), Diseases of the Blood, Blood-forming Organs and Immunity (D50-D89) and Diseases of the nervous system (G00-G99) were significantly associated with potential DDIs. Conclusion The prevalence of potential DDIs in the ED is high, and strategies should therefore be established to monitor patients’ safety during their stay, in addition to conducting investigations to estimate the real harm potential DDIs inflict on patients. PMID:29304072
-
Brocher, T.M.; Hunter, W.C.; Langenheim, V.E.
1998-01-01
Seismic reflection and gravity profiles collected across Yucca Mountain, Nevada, together with geologic data, provide evidence against proposed active detachment faults at shallow depth along the pre-Tertiary-Tertiary contact beneath this potential repository for high-level nuclear waste. The new geophysical data show that the inferred pre-Tertiary-Tertiary contact is offset by moderate- to high-angle faults beneath Crater Flat and Yucca Mountain, and thus this shallow surface cannot represent an active detachment surface. Deeper, low-angle detachment surface(s) within Proterozoic-Paleozoic bedrock cannot be ruled out by our geophysical data, but are inconsistent with other geologic and geophysical observations in this vicinity. Beneath Crater Flat, the base of the seismogenic crust at 12 km depth is close to the top of the reflective (ductile) lower crust at 14 to 15 km depth, where brittle fault motions in the upper crust may be converted to pure shear in the ductile lower crust. Thus, our preferred interpretation of these geophysical data is that moderate- to high-angle faults extend to 12-15-km depth beneath Yucca Mountain and Crater Flat, with only modest changes in dip. The reflection lines reveal that the Amargosa Desert rift zone is an asymmetric half-graben having a maximum depth of about 4 km and a width of about 25 km. The east-dipping Bare Mountain fault that bounds this graben to the west can be traced by seismic reflection data to a depth of at least 3.5 km and possibly as deep as 6 km, with a constant dip of 64????5??. Within Crater Flat, east-dipping high-angle normal faults offset the pre-Tertiary-Tertiary contact as well as a reflector within the Miocene tuff sequence, tilting both to the west. The diffuse eastern boundary of the Amargosa Desert rift zone is formed by a broad series of high-angle down-to-the-west normal faults extending eastward across Yucca Mountain. Along our profile the transition from east- to west-dipping faults occurs at or just west of the Solitario Canyon fault, which bounds the western side of Yucca Mountain. The interaction at depth of these east- and west-dipping faults, having up to hundreds of meters offset, is not imaged by the seismic reflection profile. Understanding potential seismic hazards at Yucca Mountain requires knowledge of the subsurface geometry of the faults near Yucca Mountain, since earthquakes generally nucleate and release the greatest amount of their seismic energy at depth. The geophysical data indicate that many fault planes near the potential nuclear waste facility dip toward Yucca Mountain, including the Bare Mountain range-front fault and several west-dipping faults east of Yucca Mountain. Thus, earthquake ruptures along these faults would lie closer to Yucca Mountain than is often estimated from their surface locations and could therefore be more damaging.
-
Fernandes, Christabelle E G; Malik, Ashish; Jineesh, V K; Fernandes, Sheryl O; Das, Anindita; Pandey, Sunita S; Kanolkar, Geeta; Sujith, P P; Velip, Dhillan M; Shaikh, Shagufta; Helekar, Samita; Gonsalves, Maria Judith; Nair, Shanta; LokaBharathi, P A
2015-08-01
The coastal waters of Goa and Ratnagiri lying on the West coast of India are influenced by terrestrial influx. However, Goa is influenced anthropogenically by iron-ore mining, while Ratnagiri is influenced by deposition of heavy minerals containing iron brought from the hinterlands. We hypothesize that there could be a shift in biological response along with changes in network of interactions between environmental and biological variables in these mining and non-mining impacted regions, lying 160 nmi apart. Biological and environmental parameters were analyzed during pre-monsoon season. Except silicates, the measured parameters were higher at Goa and related significantly, suggesting bacteria centric, detritus-driven region. At Ratnagiri, phytoplankton biomass related positively with silicate suggesting a region dominated by primary producers. This dominance perhaps got reflected as a higher tertiary yield. Thus, even though the regions are geographically proximate, the different biological response could be attributed to the differences in the web of interactions between the measured variables.
-
Mapping the Interactions between Shocks and Mixing Layers in a 3-Stream Supersonic Jet
NASA Astrophysics Data System (ADS)
Lewalle, Jacques; Ruscher, Christopher; Kan, Pinqing; Tenney, Andrew; Gogineni, Sivaram; Kiel, Barry
2015-11-01
Pressure is obtained from an LES calculation of the supersonic jet (Ma1 = 1 . 6) issuing from a rectangular nozzle in a low-subsonic co-flow; a tertiary flow, also rectangular with Ma3 = 1 insulates the primary jet from an aft-deck plate. The developing jet exhibits complex three-dimensional interactions between oblique shocks, multiple mixing layers and corner vortices, which collectively act as a skeleton for the flow. Our study is based on several plane sections through the pressure field, with short signals (0.1 s duration at 80 kHz sampling rate). Using wavelet-based band-pass filtering and cross-correlations, we map the directions of propagation of information among the various ``bones'' in the skeleton. In particular, we identify upstream propagation in some frequency bands, 3-dimensional interactions between the various shear layers, and several key bones from which the pressure signals, when taken as reference, provide dramatic phase-locking for parts of the skeleton. We acknowledge the support of AFRL through an SBIR grant.
-
Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.
Ikawa, Y; Shiraishi, H; Inoue, T
1999-01-01
The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996
-
Tertiary Education and Training in Australia, 2010
ERIC Educational Resources Information Center
National Centre for Vocational Education Research (NCVER), 2012
2012-01-01
This publication presents information on tertiary education and training during 2010, including statistics on participation and outcomes. The definition of tertiary education and training adopted for this publication is formal study in vocational education and training (VET) and higher education, including enrolments in Australian Qualifications…
-
ERIC Educational Resources Information Center
Rolin-Ianziti, Jeanne; Varshney, Rachel
2008-01-01
The present study investigates the functions that language learners attribute to the first language (L1) within a teaching context that maximizes the target language (TL). Beginners of French in an Australian university (N = 52) completed a questionnaire consisting of 21 closed questions on their views on L1/TL use and two open questions on the…
-
2012-03-01
blast injury mechanisms in rat TBI - Roles of polyunsaturated fatty acids in traumatic brain injury vulnerabilities and resilience: evaluation of...salutary effects of DHA supplementation using neurolipidomics and functional outcome assessments - Diagnostic and Therapeutic Targeting of...immunohistochemical assessments reveal greater glial fibrillary acidic protein (GFAP) and IBa1 immunoreactivity in rats subjected to combined injuries than are
-
ERIC Educational Resources Information Center
Szili, Gertrude; Sobels, Jonathan
2011-01-01
The dynamism of Environmental Management in the 21st century has predicted the need for students to emerge from tertiary programmes with a set of skills that are functional and more widely applicable in the contemporary workplace. To foster the development of such tools and skill sets, there has been an increasing trend amongst teaching…
-
The common causes leading to pancytopenia in patients presenting to tertiary care hospital.
Das Makheja, Kirpal; Kumar Maheshwari, Bharat; Arain, Shafique; Kumar, Suneel; Kumari, Sangeeta; Vikash
2013-09-01
The objective of this study was to determine the frequency of common causes leading to Pancytopenia in patients presenting to tertiary care hospital at Karachi. A total of 62 patients with the diagnosis of Pancytopenia of more than one week duration were enrolled in the study. All patients underwent a detailed medical history and full physical examination followed by blood sampling for the investigations i.e. complete blood count with peripheral film, erythrocyte sedimentation rate (ESR), Malarial parasites (MP), liver function test, Renal function tests, PT and viral profile (HBsAg, Anti-HCV), Ultrasonography of abdomen. All patients underwent bone marrow aspiration and trephine biopsy for reporting and interpretation. Duration of study was six months, from May 2010 to November 2010. The average age of the patients was 37.76 ± 16.38years. Out of 62 patients, 36 (58%) were male and 26 (42%) were female. Megaloblastic anemia was the commonest cause that was observed in 41.9% cases followed by acute myeloid leukemia 27.4%, aplastic anemia 19.4% and erythroid hyperplasia 11.3%. Conclusion : This study concluded that most common cause of pancytopenia is Megaloblastic anemia, followed by acute myeloid leukemia and aplastic anemia. Bone marrow examination is a single useful investigation which reveals the underlying cause in patients with pancytopenia.
-
Villani, Rehan; Hodgson, Samantha; Legrand, Julien; Greaney, Jessica; Wong, Ho Yi; Pichol-Thievend, Cathy; Adolphe, Christelle; Wainwight, Brandon; Francois, Mathias; Khosrotehrani, Kiarash
2017-05-15
SOX family proteins SOX2 and SOX18 have been reported as being essential in determining hair follicle type; however, the role they play during development remains unclear. Here, we demonstrate that Sox18 regulates the normal differentiation of the dermal papilla of all hair types. In guard (primary) hair dermal condensate (DC) cells, we identified transient Sox18 in addition to SOX2 expression at E14.5, which allowed fate tracing of primary DC cells until birth. Similarly, expression of Sox18 was detected in the DC cells of secondary hairs at E16.5 and in tertiary hair at E18.5. Dominant-negative Sox18 mutation (opposum) did not prevent DC formation in any hair type. However, it affected dermal papilla differentiation, restricting hair formation especially in secondary and tertiary hairs. This Sox18 mutation also prevented neonatal dermal cells or dermal papilla spheres from inducing hair in regeneration assays. Microarray expression studies identified WNT5A and TNC as potential downstream effectors of SOX18 that are important for epidermal WNT signalling. In conclusion, SOX18 acts as a mesenchymal molecular switch necessary for the formation and function of the dermal papilla in all hair types. © 2017. Published by The Company of Biologists Ltd.
-
Fast protein tertiary structure retrieval based on global surface shape similarity.
Sael, Lee; Li, Bin; La, David; Fang, Yi; Ramani, Karthik; Rustamov, Raif; Kihara, Daisuke
2008-09-01
Characterization and identification of similar tertiary structure of proteins provides rich information for investigating function and evolution. The importance of structure similarity searches is increasing as structure databases continue to expand, partly due to the structural genomics projects. A crucial drawback of conventional protein structure comparison methods, which compare structures by their main-chain orientation or the spatial arrangement of secondary structure, is that a database search is too slow to be done in real-time. Here we introduce a global surface shape representation by three-dimensional (3D) Zernike descriptors, which represent a protein structure compactly as a series expansion of 3D functions. With this simplified representation, the search speed against a few thousand structures takes less than a minute. To investigate the agreement between surface representation defined by 3D Zernike descriptor and conventional main-chain based representation, a benchmark was performed against a protein classification generated by the combinatorial extension algorithm. Despite the different representation, 3D Zernike descriptor retrieved proteins of the same conformation defined by combinatorial extension in 89.6% of the cases within the top five closest structures. The real-time protein structure search by 3D Zernike descriptor will open up new possibility of large-scale global and local protein surface shape comparison. 2008 Wiley-Liss, Inc.
-
Martínez-Montiel, Nancy; Morales-Lara, Laura; Hernández-Pérez, Julio M; Martínez-Contreras, Rebeca D
2016-01-01
The molecular mechanisms regulating the accuracy of gene expression are still not fully understood. Among these mechanisms, Nonsense-mediated Decay (NMD) is a quality control process that detects post-transcriptionally abnormal transcripts and leads them to degradation. The UPF1 protein lays at the heart of NMD as shown by several structural and functional features reported for this factor mainly for Homo sapiens and Saccharomyces cerevisiae. This process is highly conserved in eukaryotes but functional diversity can be observed in various species. Ustilago maydis is a basidiomycete and the best-known smut, which has become a model to study molecular and cellular eukaryotic mechanisms. In this study, we performed in silico analysis to investigate the structural and biochemical properties of the putative UPF1 homolog in Ustilago maydis. The putative homolog for UPF1 was recognized in the annotated genome for the basidiomycete, exhibiting 66% identity with its human counterpart at the protein level. The known structural and functional domains characteristic of UPF1 homologs were also found. Based on the crystal structures available for UPF1, we constructed different three-dimensional models for umUPF1 in order to analyze the secondary and tertiary structural features of this factor. Using these models, we studied the spatial arrangement of umUPF1 and its capability to interact with UPF2. Moreover, we identified the critical amino acids that mediate the interaction of umUPF1 with UPF2, ATP, RNA and with UPF1 itself. Mutating these amino acids in silico showed an important effect over the native structure. Finally, we performed molecular dynamic simulations for UPF1 proteins from H. sapiens and U. maydis and the results obtained show a similar behavior and physicochemical properties for the protein in both organisms. Overall, our results indicate that the putative UPF1 identified in U. maydis shows a very similar sequence, structural organization, mechanical stability, physicochemical properties and spatial organization in comparison to the NMD factor depicted for Homo sapiens. These observations strongly support the notion that human and fungal UPF1 could perform equivalent biological activities.
-
Diversification of Tertiary Education in Switzerland.
ERIC Educational Resources Information Center
Crausaz, Roselyne
The structure of Switzerland's educational system is described including the types of secondary schools and/or courses and the system of tertiary education. Fields of study, types of institutions, and characteristics of tertiary education in Switzerland are discussed. The chapter on students covers admission procedures, trends in enrollment,…
-
Towards the 21st Century. Facilities for Tertiary Education.
ERIC Educational Resources Information Center
Corbett, Anne, Ed.
This report presents observations of experts in planning, design, construction or management of tertiary educational facilities about the emerging issues and the appropriate planning and architectural solutions for higher education facilities as the new millennium approaches. Specific topics discuss the current context of tertiary education…
-
Cho, June; Holditch-Davis, Diane; Su, Xiaogang; Phillips, Vivien; Biasini, Fred; Carlo, Waldemar A
Male infants are more prone to health problems and developmental delays than female infants. On the basis of theories of gender differences in brain development and social relationships, we explored associations between testosterone and cortisol levels with infant cognitive, motor, and language development ("infant development") in very low birth weight (VLBW) infants, controlling for mother-infant interactions, characteristics of mothers and infants, and days of saliva collection after birth. A total of 62 mother-VLBW infant pairs were recruited from the newborn intensive care unit of a tertiary medical center in the Southeast United States. Data were collected through infant medical record review, biochemical measurement, observation of mother-infant interactions, and standard questionnaires. Infant development was assessed at 6 months corrected age (CA), and mother-infant interactions were observed at 3 and 6 months CA. General linear regression with separate analyses for each infant gender showed that high testosterone levels were positively associated with language development of male infants after controlling for mother-infant interactions and other covariates, whereas high cortisol levels were negatively associated with motor development of female infants after controlling for mother-infant interactions. Steroid hormonal levels may well be more fundamental factors for assessing infant development than infant gender or mother-infant interactions at 6 months CA.
-
Piazzoli, Andrea; Breider, Florian; Aquillon, Caroline Gachet; Antonelli, Manuela; von Gunten, Urs
2018-05-15
N-nitrosamines are a group of potent human carcinogens that can be formed during oxidative treatment of drinking water and wastewater. Many tertiary and quaternary amines present in consumer products (e.g., pharmaceuticals, personal care and household products) are known to be N-nitrosodimethylamine (NDMA) precursors during chloramination, but the formation of other N-nitrosamines has been rarely studied. This study investigates the specific and total N-nitrosamine (TONO) formation potential (FP) of various precursors from nitrogen-containing micropollutants (chlorhexidine, metformin, benzalkonium chloride and cetyltrimethylammonium chloride) and tertiary and quaternary model amines (trimethyl amine, N,N-dimethylbutyl amine, N,N-dimethylbenzyl amine and tetramethyl ammonium). All the studied nitrogenous micropollutants displayed quantifiable TONO FP, with molar yields in the range 0.04-11.92%. However, the observed TONO pools constituted mostly of uncharacterized species, not included in US-EPA 8270 N-nitrosamines standard mix. Only the quaternary ammonium compound benzalkonium chloride showed quantifiable NDMA FP (0.56% molar yield), however, explaining only a minor fraction of the observed TONO FP. The studied model amines showed molar NDMA yields from 0.10% (trimethyl amine) to 5.05% (N,N-dimethylbenzyl amine), very similar to the molar TONO yields. The comparison of the FPs of micropollutants and model compounds showed that the presence of electron donating functional groups (such as a benzyl group) in tertiary and quaternary amine precursors leads to a higher formation of NDMA and uncharacterized N-nitrosamines, respectively. LC-qTOF screening of a list of proposed N-nitrosamine structures has enabled to identify a novel N-nitrosamine (N-nitroso-N-methyldodecylamine) from the chloramination of benzalkonium chloride. This finding supports the hypothesis that different functional groups in quaternary amines can act as leaving groups during chloramination and form differing N-nitrosamine structures at significant yield. Molar TONO yields determined for micropollutants were finally validated under experimental conditions closer to real water matrices, confirming their representativeness also for lower concentration ranges. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Use of lean sigma principles in a tertiary care otolaryngology clinic to improve efficiency.
Lin, Sandra Y; Gavney, Dean; Ishman, Stacey L; Cady-Reh, Julie
2013-11-01
To apply Lean Sigma, a quality-improvement strategy supported by tactical tools to eliminate waste and reduce variation, to improve efficiency of patient flow in a large tertiary otolaryngology clinic. The project goals were to decrease overall lead time from patient arrival to start of interaction with care provider, improve on-time starts of patient visits, and decrease excess staff/patient motion. Prospective observational study. Patient flow was mapped through the clinic, including preregistration processes. A time-stamp observation study was performed on 188 patient visits over 5 days. Using Lean Sigma principles, time stamps were analyzed to identify patient flow constraints and areas for potential interventions. Interventions were evaluated and adjusted based on feedback from shareholders: removal of bottlenecks in clinic flow, elimination of non-value added registration staff tasks, and alignment of staff hours to accommodate times of high patient census. A postintervention time observation study of 141 patients was performed 5 months later. Patient lead time from clinic arrival to exam start time decreased by 12.2% on average (P = .042). On-time starts for patient exams improved by 34% (χ(2) = 16.091, P < .001). Excess patient motion was reduced by 74 feet per patient, which represents a 34% reduction in motion per visit. Use of Lean Sigma principles in a large tertiary otolaryngology clinic led to decreased patient wait time and significant improvements in on-time patient exam start time. Process mapping, engagement of leadership and staff, and elimination of non-value added steps or processes were key to improvement. Copyright © 2013 The American Laryngological, Rhinological and Otological Society, Inc.
-
Protein-protein docking using region-based 3D Zernike descriptors
2009-01-01
Background Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. Results We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-αRMSD ≤ 2.5 Å) within the top 1000 ranks. For unbound docking, among the 60 complexes for which our algorithm returned at least one hit, 60% of the cases were ranked within the top 2000. Comparison with existing shape-based docking algorithms shows that our method has a better performance than the others in unbound docking while remaining competitive for bound docking cases. Conclusion We show for the first time that the 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for protein docking prediction. Rigorous benchmark studies show that our docking approach has a superior performance compared to existing methods. PMID:20003235
-
Protein-protein docking using region-based 3D Zernike descriptors.
Venkatraman, Vishwesh; Yang, Yifeng D; Sael, Lee; Kihara, Daisuke
2009-12-09
Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-alphaRMSD < or = 2.5 A) within the top 1000 ranks. For unbound docking, among the 60 complexes for which our algorithm returned at least one hit, 60% of the cases were ranked within the top 2000. Comparison with existing shape-based docking algorithms shows that our method has a better performance than the others in unbound docking while remaining competitive for bound docking cases. We show for the first time that the 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for protein docking prediction. Rigorous benchmark studies show that our docking approach has a superior performance compared to existing methods.
-
Kurowski, Brad G; Wade, Shari L; Kirkwood, Michael W; Brown, Tanya M; Stancin, Terry; Taylor, H Gerry
2013-12-01
To characterize utilization of mental health services and determine the ability of a behavior problem and clinical functioning assessment to predict utilization of such services within the first 6 months after moderate and severe traumatic brain injury in a large cohort of adolescents. Multicenter cross-sectional study. Outpatient setting of 4 tertiary pediatric hospitals, 2 tertiary general medical centers, and 1 specialized children's hospital. Adolescents age 12-17 years (n = 132), 1-6 months after moderate-to-severe traumatic brain injury. Logistic regression was used to determine the association of mental health service utilization with clinical functioning as assessed by the Child and Adolescent Functional Assessment Scale and behavior problems assessed by the Child Behavioral Checklist. Mental health service utilization measured by the Service Assessment for Children and Adolescents. Behavioral or functional impairment occurred in 37%-56%. Of the total study population, 24.2% reported receiving outpatient mental health services, 8.3% reported receiving school services, and 28.8% reported receiving any type of mental health service. Use of any (school or outpatient) mental health service was associated with borderline to impaired total Child and Adolescent Functional Assessment Scale (odds ratio 3.50 [95% confidence interval, 1.46-8.40]; P < .01) and the Child Behavioral Checklist Total Competence (odds ratio 5.08 [95% confidence interval, 2.02-12.76]; P < .01). A large proportion of participants had unmet mental health needs. Both the Child and Adolescent Functional Assessment Scale and the Child Behavioral Checklist identified individuals who would likely benefit from mental health services in outpatient or school settings. Future research should focus on methods to ensure early identification by health care providers of adolescents with traumatic brain injury in need of mental health services. Copyright © 2013 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.
-
An Investigation of Tertiary-Level Learning in Some Practical Physics Courses
ERIC Educational Resources Information Center
Wang, Weili; Coll, Richard K.
2005-01-01
Experimental physics is seen as an essential part of tertiary physics education. Students are supposed to develop practical skills and advance from closed "cookbook" experiments to open experiment and design experiment procedures independently. As a consequence tertiary practical physics courses increase in the level of challenge…
-
Diversification of Tertiary Education in Norway, Case Study.
ERIC Educational Resources Information Center
Ottosen, Kristian
The educational system of Norway, which is organized into primary, secondary and higher education, is reviewed. Types of schools and/or courses in secondary education are listed including present enrollment figures by main types of secondary education and transfer rates of secondary to tertiary education. The system of tertiary education is…
-
Evaluation of the Special Tertiary Admissions Test (STAT)
ERIC Educational Resources Information Center
Coates, Hamish; Friedman, Tim
2010-01-01
This paper reports findings from the first national Australian study of the predictive validity of the Special Tertiary Admissions Test (STAT). Background on tertiary admissions procedures in Australia is presented, followed by information on STAT and the research methods. The results affirm that STAT, through the provision of baseline and…
-
Changing Tertiary Education in Modern European Society.
ERIC Educational Resources Information Center
Council for Cultural Cooperation, Strasbourg (France).
Reports on recent developments and problems in the diversification of tertiary education in seven Western European countries are presented by members of the Working Party on the Diversification of Tertiary Education. Policy analysis and evaluation and recommendations for future policy are also provided. As a policy, diversification refers to the…