Kumwenda, Benjamin; Litthauer, Derek; Reva, Oleg
2014-09-25
Bacteria of genus Thermus inhabit both man-made and natural thermal environments. Several Thermus species have shown biotechnological potential such as reduction of heavy metals which is essential for eradication of heavy metal pollution; removing of organic contaminants in water; opening clogged pipes, controlling global warming among many others. Enzymes from thermophilic bacteria have exhibited higher activity and stability than synthetic or enzymes from mesophilic organisms. Using Meiothermus silvanus DSM 9946 as a reference genome, high level of coordinated rearrangements has been observed in extremely thermophilic Thermus that may imply existence of yet unknown evolutionary forces controlling adaptive re-organization of whole genomes of thermo-extremophiles. However, no remarkable differences were observed across species on distribution of functionally related genes on the chromosome suggesting constraints imposed by metabolic networks. The metabolic network exhibit evolutionary pressures similar to levels of rearrangements as measured by the cross-clustering index. Using stratigraphic analysis of donor-recipient, intensive gene exchanges were observed from Meiothermus species and some unknown sources to Thermus species confirming a well established DNA uptake mechanism as previously proposed. Global genome rearrangements were found to play an important role in the evolution of Thermus bacteria at both genomic and metabolic network levels. Relatively higher level of rearrangements was observed in extremely thermophilic Thermus strains in comparison to the thermo-tolerant Thermus scotoductus. Rearrangements did not significantly disrupt operons and functionally related genes. Thermus species appeared to have a developed capability for acquiring DNA through horizontal gene transfer as shown by the donor-recipient stratigraphic analysis.
Recent applications of THERMUS
NASA Astrophysics Data System (ADS)
Wheaton, S.; Hauer, M.
2011-12-01
Some of the most recent applications of the statistical-thermal model package, THERMUS, are reviewed. These applications focus on fluctuation and correlation observables in an ideal particle and anti-particle gas in limited momentum space segments, as well as in a hadron resonance gas. In the case of the latter, a Monte Carlo event generator, utilising THERMUS functionality and assuming thermal production of hadrons, is discussed. The system under consideration is sampled grand canonically in the Boltzmann approximation. A re-weighting scheme is then introduced to account for conservation of charges (baryon number, strangeness, electric charge) and energy and momentum, effectively allowing for extrapolation of grand canonical results to the micro canonical limit. The approach utilised in this and other applications suggests improvements to existing THERMUS calculations.
CarD uses a minor groove wedge mechanism to stabilize the RNA polymerase open promoter complex.
Bae, Brian; Chen, James; Davis, Elizabeth; Leon, Katherine; Darst, Seth A; Campbell, Elizabeth A
2015-09-08
A key point to regulate gene expression is at transcription initiation, and activators play a major role. CarD, an essential activator in Mycobacterium tuberculosis, is found in many bacteria, including Thermus species, but absent in Escherichia coli. To delineate the molecular mechanism of CarD, we determined crystal structures of Thermus transcription initiation complexes containing CarD. The structures show CarD interacts with the unique DNA topology presented by the upstream double-stranded/single-stranded DNA junction of the transcription bubble. We confirm that our structures correspond to functional activation complexes, and extend our understanding of the role of a conserved CarD Trp residue that serves as a minor groove wedge, preventing collapse of the transcription bubble to stabilize the transcription initiation complex. Unlike E. coli RNAP, many bacterial RNAPs form unstable promoter complexes, explaining the need for CarD.
THERMUS—A thermal model package for ROOT
NASA Astrophysics Data System (ADS)
Wheaton, S.; Cleymans, J.; Hauer, M.
2009-01-01
THERMUS is a package of C++ classes and functions allowing statistical-thermal model analyses of particle production in relativistic heavy-ion collisions to be performed within the ROOT framework of analysis. Calculations are possible within three statistical ensembles; a grand-canonical treatment of the conserved charges B, S and Q, a fully canonical treatment of the conserved charges, and a mixed-canonical ensemble combining a canonical treatment of strangeness with a grand-canonical treatment of baryon number and electric charge. THERMUS allows for the assignment of decay chains and detector efficiencies specific to each particle yield, which enables sensible fitting of model parameters to experimental data. Program summaryProgram title: THERMUS, version 2.1 Catalogue identifier: AEBW_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEBW_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 17 152 No. of bytes in distributed program, including test data, etc.: 93 581 Distribution format: tar.gz Programming language: C++ Computer: PC, Pentium 4, 1 GB RAM (not hardware dependent) Operating system: Linux: FEDORA, RedHat, etc. Classification: 17.7 External routines: Numerical Recipes in C [1], ROOT [2] Nature of problem: Statistical-thermal model analyses of heavy-ion collision data require the calculation of both primordial particle densities and contributions from resonance decay. A set of thermal parameters (the number depending on the particular model imposed) and a set of thermalized particles, with their decays specified, is required as input to these models. The output is then a complete set of primordial thermal quantities for each particle, together with the contributions to the final particle yields from resonance decay. In many applications of statistical-thermal models it is required to fit experimental particle multiplicities or particle ratios. In such analyses, the input is a set of experimental yields and ratios, a set of particles comprising the assumed hadron resonance gas formed in the collision and the constraints to be placed on the system. The thermal model parameters consistent with the specified constraints leading to the best-fit to the experimental data are then output. Solution method: THERMUS is a package designed for incorporation into the ROOT [2] framework, used extensively by the heavy-ion community. As such, it utilizes a great deal of ROOT's functionality in its operation. ROOT features used in THERMUS include its containers, the wrapper TMinuit implementing the MINUIT fitting package, and the TMath class of mathematical functions and routines. Arguably the most useful feature is the utilization of CINT as the control language, which allows interactive access to the THERMUS objects. Three distinct statistical ensembles are included in THERMUS, while additional options to include quantum statistics, resonance width and excluded volume corrections are also available. THERMUS provides a default particle list including all mesons (up to the K4∗ (2045)) and baryons (up to the Ω) listed in the July 2002 Particle Physics Booklet [3]. For each typically unstable particle in this list, THERMUS includes a text-file listing its decays. With thermal parameters specified, THERMUS calculates primordial thermal densities either by performing numerical integrations or else, in the case of the Boltzmann approximation without resonance width in the grand-canonical ensemble, by evaluating Bessel functions. Particle decay chains are then used to evaluate experimental observables (i.e. particle yields following resonance decay). Additional detector efficiency factors allow fine-tuning of the model predictions to a specific detector arrangement. When parameters are required to be constrained, use is made of the 'Numerical Recipes in C' [1] function which applies the Broyden globally convergent secant method of solving nonlinear systems of equations. Since the NRC software is not freely-available, it has to be purchased by the user. THERMUS provides the means of imposing a large number of constraints on the chosen model (amongst others, THERMUS can fix the baryon-to-charge ratio of the system, the strangeness density of the system and the primordial energy per hadron). Fits to experimental data are accomplished in THERMUS by using the ROOT TMinuit class. In its default operation, the standard χ function is minimized, yielding the set of best-fit thermal parameters. THERMUS allows the assignment of separate decay chains to each experimental input. In this way, the model is able to match the specific feed-down corrections of a particular data set. Running time: Depending on the analysis required, run-times vary from seconds (for the evaluation of particle multiplicities given a set of parameters) to several minutes (for fits to experimental data subject to constraints). References:W.H. Press, S.A. Teukolsky, W.T. Vetterling, B.P. Flannery, Numerical Recipes in C: The Art of Scientific Computing, Cambridge University Press, Cambridge, 2002. R. Brun, F. Rademakers, Nucl. Inst. Meth. Phys. Res. A 389 (1997) 81. See also http://root.cern.ch/. K. Hagiwara et al., Phys. Rev. D 66 (2002) 010001.
Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.
Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A
1991-06-01
The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2009-04-01
The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.
Diverse Thermus species inhabit a single hot spring microbial mat
NASA Technical Reports Server (NTRS)
Nold, S. C.; Ward, D. M.
1995-01-01
Through an effort to characterize aerobic chemoorganotrophic bacteria in the Octopus Spring cyano-bacterial mat community, we cultivated four Thermus isolates with unique 16S rRNA sequences. Isolates clustered within existing Thermus clades, including those containing Thermus ruber, Thermus aquaticus, and a subgroup closely related to T. aquaticus. One Octopus Spring isolate is nearly identical (99.9% similar) to isolates from Iceland, and two others are closely related to a T. ruber isolated from Russia. Octopus Spring isolates similar to T. aquaticus and T. ruber exhibited optimal growth rates at high (65-70 degrees C) and low (50 degrees C) temperatures, respectively, with the most abundant species best adapted to the temperature of the habitat (50-55 degrees C). Our results display a diversity of Thermus genotypes defined by 16S rRNA within one hot spring microbial community. We suggest that specialization to temperature and perhaps other local environmental features controls the abundance of Thermus populations.
The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.
Dong, Yongsheng; Ma, Lei; Duan, Yuanliang
2016-01-01
To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.
Sequence of the hyperplastic genome of the naturally competent Thermus scotoductus SA-01
2011-01-01
Background Many strains of Thermus have been isolated from hot environments around the world. Thermus scotoductus SA-01 was isolated from fissure water collected 3.2 km below surface in a South African gold mine. The isolate is capable of dissimilatory iron reduction, growth with oxygen and nitrate as terminal electron acceptors and the ability to reduce a variety of metal ions, including gold, chromate and uranium, was demonstrated. The genomes from two different Thermus thermophilus strains have been completed. This paper represents the completed genome from a second Thermus species - T. scotoductus. Results The genome of Thermus scotoductus SA-01 consists of a chromosome of 2,346,803 bp and a small plasmid which, together are about 11% larger than the Thermus thermophilus genomes. The T. thermophilus megaplasmid genes are part of the T. scotoductus chromosome and extensive rearrangement, deletion of nonessential genes and acquisition of gene islands have occurred, leading to a loss of synteny between the chromosomes of T. scotoductus and T. thermophilus. At least nine large inserts of which seven were identified as alien, were found, the most remarkable being a denitrification cluster and two operons relating to the metabolism of phenolics which appear to have been acquired from Meiothermus ruber. The majority of acquired genes are from closely related species of the Deinococcus-Thermus group, and many of the remaining genes are from microorganisms with a thermophilic or hyperthermophilic lifestyle. The natural competence of Thermus scotoductus was confirmed experimentally as expected as most of the proteins of the natural transformation system of Thermus thermophilus are present. Analysis of the metabolic capabilities revealed an extensive energy metabolism with many aerobic and anaerobic respiratory options. An abundance of sensor histidine kinases, response regulators and transporters for a wide variety of compounds are indicative of an oligotrophic lifestyle. Conclusions The genome of Thermus scotoductus SA-01 shows remarkable plasticity with the loss, acquisition and rearrangement of large portions of its genome compared to Thermus thermophilus. Its ability to naturally take up foreign DNA has helped it adapt rapidly to a subsurface lifestyle in the presence of a dense and diverse population which acted as source of nutrients. The genome of Thermus scotoductus illustrates how rapid adaptation can be achieved by a highly dynamic and plastic genome. PMID:22115438
Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers
Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie
2013-01-01
The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915
Angov, E; Camerini-Otero, R D
1994-01-01
We have cloned, expressed, and purified the RecA analog from the thermophilic eubacterium Thermus aquaticus YT-1. Analysis of the deduced amino acid sequence indicates that the T. aquaticus RecA is structurally similar to the Escherichia coli RecA and suggests that RecA-like function has been conserved in thermophilic organisms. Preliminary biochemical analysis indicates that the protein has an ATP-dependent single-stranded DNA binding activity and can pair and carry out strand exchange to form a heteroduplex DNA under reaction conditions previously described for E. coli RecA, but at 55 to 65 degrees C. Further characterization of a thermophilically derived RecA protein should yield important information concerning DNA-protein interactions at high temperatures. In addition, a thermostable RecA protein may have some general applicability in stabilizing DNA-protein interactions in reactions which occur at high temperatures by increasing the specificity (stringency) of annealing reactions. Images PMID:8113181
Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.
Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki
2007-05-01
The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2012-11-01
Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.
Thermus arciformis sp. nov., a thermophilic species from a geothermal area.
Zhang, Xin-Qi; Ying, Yi; Ye, Ying; Xu, Xue-Wei; Zhu, Xu-Fen; Wu, Min
2010-04-01
Two aerobic, Gram-negative, non-motile, non-sporulating, yellow-pigmented bacteria, strains TH92(T) and TH91, were isolated from a hot spring located in Laibin, Guangxi, in the south-eastern geothermal area of China. The isolates grew at 40-77 degrees C (optimally at 70 degrees C) and at pH 6.0-9.5 (optimally at pH 7.5-8.0). Phylogenetic analysis of 16S rRNA gene sequences and levels of DNA-DNA relatedness together indicated that the new isolates represented a novel species of the genus Thermus with closest affinity to Thermus aquaticus, Thermus igniterrae and Thermus thermophilus. Compared with their closest relatives, strains TH92( T) and TH91 were able to assimilate a wider range of carbohydrates, amino acids and organic acids as sole carbon sources for growth, such as lactose and melibiose. The new isolates had lower combined levels of C(16 : 0 ) and iso-C(16 : 0) compared with their closest relatives. On the basis of polyphasic taxonomic characterization, strains TH92(T) and TH91 are considered to represent a single novel species of the genus Thermus, for which the name Thermus arciformis sp. nov. is proposed. The type strain is TH92(T) (=CGMCC 1.6992(T) =JCM 15153(T)).
Tripathi, Charu; Mishra, Harshita; Khurana, Himani; Dwivedi, Vatsala; Kamra, Komal; Negi, Ram K.; Lal, Rup
2017-01-01
Thermophilic environments represent an interesting niche. Among thermophiles, the genus Thermus is among the most studied genera. In this study, we have sequenced the genome of Thermus parvatiensis strain RL, a thermophile isolated from Himalayan hot water springs (temperature >96°C) using PacBio RSII SMRT technique. The small genome (2.01 Mbp) comprises a chromosome (1.87 Mbp) and a plasmid (143 Kbp), designated in this study as pTP143. Annotation revealed a high number of repair genes, a squeezed genome but containing highly plastic plasmid with transposases, integrases, mobile elements and hypothetical proteins (44%). We performed a comparative genomic study of the group Thermus with an aim of analysing the phylogenetic relatedness as well as niche specific attributes prevalent among the group. We compared the reference genome RL with 16 Thermus genomes to assess their phylogenetic relationships based on 16S rRNA gene sequences, average nucleotide identity (ANI), conserved marker genes (31 and 400), pan genome and tetranucleotide frequency. The core genome of the analyzed genomes contained 1,177 core genes and many singleton genes were detected in individual genomes, reflecting a conserved core but adaptive pan repertoire. We demonstrated the presence of metagenomic islands (chromosome:5, plasmid:5) by recruiting raw metagenomic data (from the same niche) against the genomic replicons of T. parvatiensis. We also dissected the CRISPR loci wide all genomes and found widespread presence of this system across Thermus genomes. Additionally, we performed a comparative analysis of competence loci wide Thermus genomes and found evidence for recent horizontal acquisition of the locus and continued dispersal among members reflecting that natural competence is a beneficial survival trait among Thermus members and its acquisition depicts unending evolution in order to accomplish optimal fitness. PMID:28798737
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.
Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian
2005-10-01
Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.
Sharp, Richard J.; Williams, Ralph A. D.
1988-01-01
Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714
Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei
2011-07-01
ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.
Ohto, C; Ishida, C; Koike-Takeshita, A; Yokoyama, K; Muramatsu, M; Nishino, T; Obata, S
1999-02-01
A geranylgeranyl diphosphate (GGPP) synthase gene of an extremely thermophilic bacterium, Thermus thermophilus, was cloned and sequenced. T. thermophilus GGPP synthase, overexpressed in Escherichia coli cells as a glutathione S-transferase fusion protein, was purified and characterized. The fusion protein, retaining thermostability, formed a homodimer, and showed higher specific activity than did a partially purified thermostable enzyme previously reported. Optimal reaction conditions and kinetic parameters were also examined. The deduced amino acid sequence indicated that T. thermophilus GGPP synthase was excluded from the group of bacterial type GGPP synthases and lacked the insertion amino acid residues in the first aspartate-rich motif as do archaeal and eukaryotic short-chain prenyltransferases.
Tomoike, Fumiaki; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2011-05-31
The salvage pathways of nucleotide biosynthesis are more diverse and are less well understood as compared with de novo pathways. Uridine-cytidine kinase (UCK) is the rate-limiting enzyme in the pyrimidine-nucleotide salvage pathway. In this study, we have characterized a UCK homologue of Thermus thermophilus HB8 (ttCK) biochemically and structurally. Unlike other UCKs, ttCK had substrate specificity toward only cytidine and showed no inhibition by UTP, suggesting uridine does not bind to ttCK as substrate. Structural analysis revealed that the histidine residue located near the functional group at position 4 of cytidine or uridine in most UCKs is substituted with tyrosine, Tyr93, in ttCK. Replacement of Tyr93 by histidine or glutamine endowed ttCK with phosphorylation activity toward uridine. These results suggested that a single amino acid residue, Tyr93, gives cytidine-limited specificity to ttCK. However, replacement of Tyr93 by Phe or Leu did not change the substrate specificity of ttCK. Therefore, we conclude that a residue at this position is essential for the recognition of uridine by UCK. In addition, thymidine phosphorylase from T. thermophilus HB8 was equally active with thymidine and uridine, which indicates that this protein is the sole enzyme metabolizing uridine in T. Thermophilus HB8. On the basis of these results, we discuss the pyrimidine-salvage pathway in T. thermophilus HB8.
Chang, Hsin-Yang; Choi, Sylvia K.; Vakkasoglu, Ahmet Selim; Chen, Ying; Hemp, James; Fee, James A.; Gennis, Robert B.
2012-01-01
The heme-copper oxygen reductases are redox-driven proton pumps. In the current work, the effects of mutations in a proposed exit pathway for pumped protons are examined in the ba3-type oxygen reductase from Thermus thermophilus, leading from the propionates of heme a3 to the interface between subunits I and II. Recent studies have proposed important roles for His376 and Asp372, both of which are hydrogen-bonded to propionate-A of heme a3, and for Glu126II (subunit II), which is hydrogen-bonded to His376. Based on the current results, His376, Glu126II, and Asp372 are not essential for either oxidase activity or proton pumping. In addition, Tyr133, which is hydrogen-bonded to propionate-D of heme a3, was also shown not to be essential for function. However, two mutations of the residues hydrogen-bonded to propionate-A, Asp372Ile and His376Asn, retain high electron transfer activity and normal spectral features but, in different preparations, either do not pump protons or exhibit substantially diminished proton pumping. It is concluded that either propionate-A of heme a3 or possibly the cluster of groups centered about the conserved water molecule that hydrogen-bonds to both propionates-A and -D of heme a3 is a good candidate to be the proton loading site. PMID:22431640
Chang, Hsin-Yang; Choi, Sylvia K; Vakkasoglu, Ahmet Selim; Chen, Ying; Hemp, James; Fee, James A; Gennis, Robert B
2012-04-03
The heme-copper oxygen reductases are redox-driven proton pumps. In the current work, the effects of mutations in a proposed exit pathway for pumped protons are examined in the ba(3)-type oxygen reductase from Thermus thermophilus, leading from the propionates of heme a(3) to the interface between subunits I and II. Recent studies have proposed important roles for His376 and Asp372, both of which are hydrogen-bonded to propionate-A of heme a(3), and for Glu126(II) (subunit II), which is hydrogen-bonded to His376. Based on the current results, His376, Glu126(II), and Asp372 are not essential for either oxidase activity or proton pumping. In addition, Tyr133, which is hydrogen-bonded to propionate-D of heme a(3), was also shown not to be essential for function. However, two mutations of the residues hydrogen-bonded to propionate-A, Asp372Ile and His376Asn, retain high electron transfer activity and normal spectral features but, in different preparations, either do not pump protons or exhibit substantially diminished proton pumping. It is concluded that either propionate-A of heme a(3) or possibly the cluster of groups centered about the conserved water molecule that hydrogen-bonds to both propionates-A and -D of heme a(3) is a good candidate to be the proton loading site.
Isolation of Thermus strains from hot composts (60 to 80 degrees C).
Beffa, T; Blanc, M; Lyon, P F; Vogt, G; Marchiani, M; Fischer, J L; Aragno, M
1996-01-01
High numbers (10(7) to 10(10) cells per g [dry weight]) of heterotrophic, gram-negative, rod-shaped, non-sporeforming, aerobic, thermophilic bacteria related to the genus Thermus were isolated from thermogenic composts at temperatures between 65 and 82 degrees C. These bacteria were present in different types of wastes (garden and kitchen wastes and sewage sludge) and in all the industrial composting systems studied (open-air windows, boxes with automated turning and aeration, and closed bioreactors with aeration). Isolates grew fast on a rich complex medium at temperatures between 40 and 80 degrees C, with optimum growth between 65 and 75 degrees C. Nutritional characteristics, total protein profiles, DNA-DNA hybridization (except strain JT4), and restriction fragment length polymorphism profiles of the DNAs coding for the 16S rRNAs (16S rDNAs) showed that Thermus strains isolated from hot composts were closely related to Thermus thermophilus HB8. These newly isolated T. thermophilus strains have probably adapted to the conditions in the hot-compost ecosystem. Heterotrophic, ovalspore-forming, thermophilic bacilli were also isolated from hot composts, but none of the isolates was able to grow at temperatures above 70 degrees C. This is the first report of hot composts as habitats for a high number of thermophilic bacteria related to the genus Thermus. Our study suggests that Thermus strains play an important role in organic-matter degradation during the thermogenic phase (65 to 80 degrees C) of the composting process. PMID:8633870
Leis, Benedikt; Angelov, Angel; Mientus, Markus; Li, Haijuan; Pham, Vu T T; Lauinger, Benjamin; Bongen, Patrick; Pietruszka, Jörg; Gonçalves, Luís G; Santos, Helena; Liebl, Wolfgang
2015-01-01
Functional metagenomic screening strategies, which are independent of known sequence information, can lead to the identification of truly novel genes and enzymes. Since E. coli has been used exhaustively for this purpose as a host, it is important to establish alternative expression hosts and to use them for functional metagenomic screening for new enzymes. In this study we show that Thermus thermophilus HB27 is an excellent screening host and can be used as an alternative provider of truly novel biocatalysts. In a previous study we constructed mutant strain BL03 with multiple markerless deletions in genes for major extra- and intracellular lipolytic activities. This esterase-diminished strain was no longer able to grow on defined minimal medium supplemented with tributyrin as the sole carbon source and could be used as a host to screen for metagenomic DNA fragments that could complement growth on tributyrin. Several thousand single fosmid clones from thermophilic metagenomic libraries from heated compost and hot spring water samples were subjected to a comparative screening for esterase activity in both T. thermophilus strain BL03 and E. coli EPI300. We scored a greater number of active esterase clones in the thermophilic bacterium than in the mesophilic E. coli. From several thousand functionally screened clones only two thermostable α/β-fold hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes were identifiable in E. coli. In contrast, five further fosmids were found that conferred lipolytic activities in T. thermophilus only. Four open reading frames (ORFs) were found which did not share significant similarity to known esterase enzymes but contained the conserved GXSXG motif regularly found in lipolytic enzymes. Two of the genes were expressed in both hosts and the novel thermophilic esterases, which based on their primary structures could not be assigned to known esterase or lipase families, were purified and preliminarily characterized. Our work underscores the benefit of using additional screening hosts other than E. coli for the identification of novel biocatalysts with industrial relevance.
Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A
2010-04-01
The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.
Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.
Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip
2014-04-01
Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.
Verbauwhede, Annelien E; Lambrecht, Marlies A; Fierens, Ellen; Hermans, Senne; Shegay, Oksana; Brijs, Kristof; Delcour, Jan A
2018-10-30
The thermo-active serine peptidase aqualysin 1 (Aq1) of Thermus aquaticus was applied in bread making to study the relative contribution of thermoset gluten to bread crumb texture. Aq1 is active between 30 °C and 90 °C with an optimum activity temperature of around 65 °C. It is inhibited by wheat endogenous serine peptidase inhibitors during dough mixing and fermentation and starts hydrolyzing gluten proteins during baking above 80 °C when the enzyme is no longer inhibited and most of the starch is gelatinized and contributes to structure formation. Aq1 activity reduced the molecular weight of gluten proteins and significantly increased their extractability in sodium dodecyl sulfate containing medium. While it had no impact on the specific bread volume and only limited impact on hardness, cohesiveness, springiness, resilience and chewiness, it impacted bread crumb coherence. We conclude that starch has a greater impact on crumb texture than thermoset gluten. Copyright © 2018 Elsevier Ltd. All rights reserved.
Griffiths, Emma; Gupta, Radhey S.
2004-01-01
The Deinococcus-Thermus group of species is currently recognized as a distinct phylum solely on the basis of their branching in 16S rRNA trees. No unique biochemical or molecular characteristics that can distinguish this group from all other bacteria are known at present. In this work, we describe eight conserved indels (viz., inserts or deletions) in seven widely distributed proteins that are distinctive characteristics of the Deinococcus-Thermus phylum but are not found in any other group of bacteria. The identified signatures include a 7-amino-acid (aa) insert in threonyl-tRNA synthetase, 1- and 3-aa inserts in the RNA polymerase β′ subunit, a 5-aa deletion in signal recognition particle (Ffh/SR54), a 2-aa insert in major sigma factor 70 (σ70), a 2-aa insert in seryl-tRNA synthetase (SerRS), a 1-aa insert in ribosomal protein L1, and a 2-aa insert in UvrA homologs. By using PCR primers for conserved regions, fragments of these genes were amplified from a number of Deinococcus-Thermus species, and all such fragments (except SerRS in Deinococcus proteolyticus) were found to contain the indicated signatures. The presence of these signatures in various species from all three known genera within this phylum, viz., Deinococcus, Thermus, and Meiothermus, provide evidence that they are likely distinctive characteristics of the entire phylum which were introduced in a common ancestor of this group. The signature in SerRS, which is absent in D. proteolyticus, was likely introduced after the branching of this species. Phylogenetic studies as well as the nature of the inserts in some of these proteins (viz., σ70 and SerRS) also support a sister group relationship between the Thermus and the Meiothermus genera. The identified signatures provide strong evidence for the monophyletic nature of the Deinococcus-Thermus phylum. These molecular markers should prove very useful in the identification of new species related to this group. PMID:15126471
Yu, Tian-Tian; Yao, Ji-Cheng; Ming, Hong; Yin, Yi-Rui; Zhou, En-Min; Liu, Min-Jiao; Tang, Shu-Kun; Li, Wen-Jun
2013-03-01
A Gram-stain negative aerobic bacterium, designated YIM 77924(T), was isolated from a geothermally heated soil sample collected at Rehai National Park, Tengchong, Yunnan province, south-west China. Growth was found to occur from 55 to 75 °C (optimum 65 °C), pH 6.0-8.0 (optimum pH 7.0) and 0-1 % NaCl (w/v). Cells were observed to be rod-shaped and the colonies convex, circular, smooth, yellow and non-transparent. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain YIM 77924(T) belongs to the genus Thermus. The 16S rRNA gene sequence similarity values between strain YIM 77924(T) and other species of the genus Thermus were all below 97 %. The polar lipids of strain YIM 77924(T) were determined to be aminophospholipid, phospholipid and glycolipid. The predominant respiratory quinone was determined to be MK-8 and the G+C content was 66.64 mol%. The major fatty acids identified were iso-C(16:0), iso-C(15:0), iso-C(17:0) and C(16:0). On the basis of the morphological and chemotaxonomic characteristics as well as genotypic data, strain YIM 77924(T) is proposed to represent a novel species, Thermus tengchongensis sp. nov., in the genus Thermus. The type strain is YIM 77924(T) (=KCTC 32025(T) = CCTCC AB2012063(T)).
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
NASA Astrophysics Data System (ADS)
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
Funatogawa, Chie; Li, Yang; Chen, Ying; McDonald, William; Szundi, Istvan; Fee, James A; Stout, C David; Einarsdóttir, Ólöf
2017-01-10
Knowledge of the role of conserved residues in the ligand channel of heme-copper oxidases is critical for understanding how the protein scaffold modulates the function of these enzymes. In this study, we investigated the role of the conserved valine 236 in the ligand channel of ba 3 cytochrome c oxidase from Thermus thermophilus by mutating the residue to a more polar (V236T), smaller (V236A), or larger (V236I, V236N, V236L, V236M, and V236F) residue. The crystal structures of the mutants were determined, and the effects of the mutations on the rates of CO, O 2 , and NO binding were investigated. O 2 reduction and NO binding were unaffected in V236T, while the oxidation of heme b during O-O bond cleavage was not detected in V236A. The V236A results are attributed to a decrease in the rate of electron transfer between heme b and heme a 3 during O-O bond cleavage in V236A, followed by faster re-reduction of heme b by Cu A . This interpretation is supported by classical molecular dynamics simulations of diffusion of O 2 to the active site in V236A that indicated a larger distance between the two hemes compared to that in the wild type and increased contact of heme a 3 with water and weakened interactions with residues R444 and R445. As the size of the mutant side chain increased and protruded more into the ligand cavity, the rates of ligand binding decreased correspondingly. These results demonstrate the importance of V236 in facilitating access of ligands to the active site in T. thermophilus ba 3 .
Thermus and the Pink Discoloration Defect in Cheese
Quigley, Lisa; O’Sullivan, Daniel J.; Daly, David; O’Sullivan, Orla; Burdikova, Zuzana; Vana, Rostislav; Beresford, Tom P.; Ross, R. Paul; Fitzgerald, Gerald F.; McSweeney, Paul L. H.; Giblin, Linda
2016-01-01
ABSTRACT A DNA sequencing-based strategy was applied to study the microbiology of Continental-type cheeses with a pink discoloration defect. The basis for this phenomenon has remained elusive, despite decades of research. The bacterial composition of cheese containing the defect was compared to that of control cheese using 16S rRNA gene and shotgun metagenomic sequencing as well as quantitative PCR (qPCR). Throughout, it was apparent that Thermus, a carotenoid-producing genus, was present at higher levels in defect-associated cheeses than in control cheeses. Prompted by this finding and data confirming the pink discoloration to be associated with the presence of a carotenoid, a culture-based approach was employed, and Thermus thermophilus was successfully cultured from defect-containing cheeses. The link between Thermus and the pinking phenomenon was then established through the cheese defect equivalent of Koch’s postulates when the defect was recreated by the reintroduction of a T. thermophilus isolate to a test cheese during the manufacturing process. IMPORTANCE Pink discoloration in cheese is a defect affecting many cheeses throughout the world, leading to significant financial loss for the dairy industry. Despite decades of research, the cause of this defect has remained elusive. The advent of high-throughput, next-generation sequencing has revolutionized the field of food microbiology and, with respect to this study, provided a means of testing a possible microbial basis for this defect. In this study, a combined 16S rRNA, whole-genome sequencing, and quantitative PCR approach was taken. This resulted in the identification of Thermus, a carotenoid-producing thermophile, in defect-associated cheeses and the recreation of the problem in cheeses to which Thermus was added. This finding has the potential to lead to new strategies to eliminate this defect, and our method represents an approach that can be employed to investigate the role of microbes in other food defects of unknown origin. PMID:27822529
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Thermus thermophilus as a Source of Thermostable Lipolytic Enzymes
López-López, Olalla; Cerdán, María-Esperanza; González-Siso, María-Isabel
2015-01-01
Lipolytic enzymes, esterases (EC 3.1.1.1) and lipases (EC 3.1.1.3), catalyze the hydrolysis of ester bonds between alcohols and carboxylic acids, and its formation in organic media. At present, they represent about 20% of commercialized enzymes for industrial use. Lipolytic enzymes from thermophilic microorganisms are preferred for industrial use to their mesophilic counterparts, mainly due to higher thermostability and resistance to several denaturing agents. However, the production at an industrial scale from the native organisms is technically complicated and expensive. The thermophilic bacterium Thermus thermophilus (T. thermophilus) has high levels of lipolytic activity, and its whole genome has been sequenced. One esterase from the T. thermophilus strain HB27 has been widely characterized, both in its native form and in recombinant forms, being expressed in mesophilic microorganisms. Other putative lipases/esterases annotated in the T. thermophilus genome have been explored and will also be reviewed in this paper. PMID:27682117
Thermus caliditerrae sp. nov., a novel thermophilic species isolated from a geothermal area.
Ming, Hong; Yin, Yi-Rui; Li, Shuai; Nie, Guo-Xing; Yu, Tian-Tian; Zhou, En-Min; Liu, Lan; Dong, Lei; Li, Wen-Jun
2014-02-01
Two thermophilic bacterial strains, designated YIM 77925(T) and YIM 77777, were isolated from two hot springs, one in the Hydrothermal Explosion (Shuirebaozhaqu) area and Frog Mouth Spring in Tengchong county, Yunnan province, south-western China. The taxonomic positions of the two isolates were investigated by a polyphasic approach. Cells of the two strains were Gram-stain-negative, aerobic and rod-shaped. They were able to grow at 50-70 °C, pH 6.0-8.0 and with a NaCl tolerance up to 0.5% (w/v). Colonies are circular, convex, non-transparent and produce yellow pigment. Phylogenetic analyses based on 16S rRNA gene sequences comparison clearly demonstrated that strains YIM 77925(T) and YIM 77777 represent members of the genus Thermus, and they also detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. Their predominant menaquinone was MK-8. The genomic DNA G+C contents of strains YIM 77925(T) and YIM 77777 were 65.6 mol% and 67.2 mol%, respectively. Based on the results of physiological and biochemical tests and phylogenetic analyses, strains YIM 77925(T) and YIM 77777 could not be classified as representing any species of the genus Thermus with a validly published name. Thus the two strains are considered to represent a novel species of the genus Thermus, for which the name Thermus caliditerrae sp. nov. is proposed. The type strain is YIM 77925(T) ( = DSM 25901(T) = CCTCC 2012061(T)).
Draft Genome Sequence of the Deinococcus-Thermus Bacterium Meiothermus ruber Strain A
Thiel, Vera; Tomsho, Lynn P.; Burhans, Richard; ...
2015-03-26
The draft genome sequence of the Deinococcus-Thermus group bacterium Meiothermus ruber strain A, isolated from a cyanobacterial enrichment culture obtained from Octopus Spring (Yellowstone National Park, WY), comprises 2,968,099 bp in 170 contigs. It is predicted to contain 2,895 protein-coding genes, 44 tRNA-coding genes, and 2 rRNA operons.
Baek, Jin-Sook; Kim, Hye-Young; Abbott, Thomas P; Moon, Tae-Wha; Lee, Soo-Bok; Park, Cheon-Seok; Park, Kwan-Hwa
2003-03-01
Simmondsin was modified with acarviosine-glucose using the transglycosylation activity of Thermus maltogenic amylase to synthesize a novel compound with both antiobesity and hypoglycemic activity. The LC/MS and 13C NMR analyses confirmed that the structure of the major transglycosylation product was acarviosine-simmondsin (Acv-simmondsin), in which acarviosine was attached to the glucose moiety of simmondsin by an alpha-(1,6)-glycosidic linkage. It was found that Acv-simmondsin was a potent competitive inhibitor of alpha-glucosidase with the Ki value of 0.69 microM and a mixed type inhibitor of alpha-amylase with the Ki and KI of 20.78 microM and 26.31 microM, respectively. The administration of Acv-simmondsin (0.1 g/100 g diet/day) to mice for 5 days significantly reduced food intake by 35%, compared to 25% with simmondsin in control obese mice. Acv-simmondsin (50 mg/kg BW) suppressed the postprandial blood glucose response to sucrose (1 g/kg BW) by 74%, compared to 71% with acarbose, in normal rats.
Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant
Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya
2017-01-01
ABSTRACT Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. PMID:28153912
Saghatelyan, Ani; Poghosyan, Lianna
2015-01-01
The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. PMID:26564055
Mefferd, Chrisabelle C.; Zhou, En-Min; Yu, Tian-Tian; ...
2016-04-28
The draft genomes ofThermus tengchongensisYIM 77401 andT. caliditerraeYIM 77777 are 2,562,314 and 2,218,114 bp and encode 2,726 and 2,305 predicted genes, respectively. Gene content and growth experiments demonstrate broad metabolic capacity, including starch hydrolysis, thiosulfate oxidation, arsenite oxidation, incomplete denitrification, and polysulfide reduction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.
2017-01-15
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less
NASA Astrophysics Data System (ADS)
Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.
2017-01-01
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.
Saghatelyan, Ani; Poghosyan, Lianna; Panosyan, Hovik; Birkeland, Nils-Kåre
2015-11-12
The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. Copyright © 2015 Saghatelyan et al.
Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant.
Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya; Doi, Katsumi
2017-02-02
Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. Copyright © 2017 Fujino et al.
Synthesis of rare sugars with L-fuculose-1-phosphate aldolase (FucA) from Thermus thermophilus HB8.
Li, Zijie; Cai, Li; Qi, Qingsheng; Styslinger, Thomas J; Zhao, Guohui; Wang, Peng George
2011-09-01
We report herein a one-pot four-enzyme approach for the synthesis of the rare sugars d-psicose, d-sorbose, l-tagatose, and l-fructose with aldolase FucA from a thermophilic source (Thermus thermophilus HB8). Importantly, the cheap starting material DL-GP (DL-glycerol 3-phosphate), was used to significantly reduce the synthetic cost. Copyright © 2011 Elsevier Ltd. All rights reserved.
Nicolaus, Barbara; Poli, Annarita; Di Donato, Paola; Romano, Ida; Laezza, Giusi; Gioiello, Alessia; Ulgiati, Sergio; Fratianni, Florinda; Nazzaro, Filomena; Orlando, Pierangelo; Dumontet, Stefano
2016-01-01
Extremophiles are organisms able to thrive in extreme environmental conditions and some of them show the ability to survive high doses of heavy metals thanks to defensive mechanisms provided by primary and secondary metabolic products, i.e., extremolytes, lipids, and extremozymes. This is why there is a growing scientific and industrial interest in the use of thermophilic bacteria in a host of tasks, from the environmental detoxification of heavy metal to industrial activities, such as bio-machining and bio-metallurgy. In this work Thermus thermophilus was challenged against increasing Pb2+ concentrations spanning from 0 to 300 ppm in order to ascertain the sensitiveness of this bacteria to the Pb environmental pollution and to give an insight on its heavy metal resistance mechanisms. Analysis of growth parameters, enzyme activities, protein profiles, and lipid membrane modifications were carried out. In addition, genotyping analysis of bacteria grown in the presence of Pb2+, using random amplified polymorphic DNA-PCR and DNA melting evaluation, were also performed. A better knowledge of the response of thermophilic bacteria to the different pollutants, as heavy metals, is necessary for optimizing their use in remediation or decontamination processes. PMID:27929414
Dwivedi, Vatsala; Sangwan, Naseer; Nigam, Aeshna; Garg, Nidhi; Niharika, Neha; Khurana, Paramjit; Khurana, Jitendra P.
2012-01-01
Thermus sp. strain RL was isolated from a hot water spring (90°C to 98°C) at Manikaran, Himachal Pradesh, India. Here we report the draft genome sequence (20,36,600 bp) of this strain. The draft genome sequence consists of 17 contigs and 1,986 protein-coding sequences and has an average G+C content of 68.77%. PMID:22689228
Wang, Yejing; He, Huawei; Liu, Lina; Gao, Chunyan; Xu, Shui; Zhao, Ping; Xia, Qingyou
2014-01-01
The effects of urea and guanidine hydrochloride (GdnHCl) on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase), a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV) circular dichroism (CD), Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS) fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase.
Liu, Lina; Gao, Chunyan; Xu, Shui; Zhao, Ping; Xia, Qingyou
2014-01-01
The effects of urea and guanidine hydrochloride (GdnHCl) on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase), a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV) circular dichroism (CD), Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS) fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase. PMID:25255086
Vian, A; Carrascosa, A V; García, J L; Cortés, E
1998-06-01
The nucleotide sequence of both the bgaA gene, coding for a thermostable beta-galactosidase of Thermus sp. strain T2, and its flanking regions was determined. The deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (Mr, 73,595). Comparative analysis of the open reading frames located in the flanking regions of the bgaA gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. The observed homology between the deduced amino acid sequences of BgaA and the beta-galactosidase of Bacillus stearothermophilus allows us to classify the new enzyme within family 42 of glycosyl hydrolases. BgaA was overexpressed in its active form in Escherichia coli, but more interestingly, an active chimeric beta-galactosidase was constructed by fusing the BgaA protein to the choline-binding domain of the major pneumococcal autolysin. This chimera illustrates a novel approach for producing an active and thermostable hybrid enzyme that can be purified in a single step by affinity chromatography on DEAE-cellulose, retaining the catalytic properties of the native enzyme. The chimeric enzyme showed a specific activity of 191,000 U/mg at 70 degrees C and a Km value of 1.6 mM with o-nitrophenyl-beta-D-galactopyranoside as a substrate, and it retained 50% of its initial activity after 1 h of incubation at 70 degrees C.
Ilag, Leopold L; Videler, Hortense; McKay, Adam R; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H; Robinson, Carol V
2005-06-07
Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus.
Ilag, Leopold L.; Videler, Hortense; McKay, Adam R.; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H.; Robinson, Carol V.
2005-01-01
Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus. PMID:15923259
The Core of Allosteric Motion in Thermus caldophilus l-Lactate Dehydrogenase*
Ikehara, Yoko; Arai, Kazuhito; Furukawa, Nayuta; Ohno, Tadashi; Miyake, Tatsuya; Fushinobu, Shinya; Nakajima, Masahiro; Miyanaga, Akimasa; Taguchi, Hayao
2014-01-01
For Thermus caldophilus l-lactate dehydrogenase (TcLDH), fructose 1,6-bisphosphate (FBP) reduced the pyruvate S0.5 value 103-fold and increased the Vmax value 4-fold at 30 °C and pH 7.0, indicating that TcLDH has a much more T state-sided allosteric equilibrium than Thermus thermophilus l-lactate dehydrogenase, which has only two amino acid replacements, A154G and H179Y. The inactive (T) and active (R) state structures of TcLDH were determined at 1.8 and 2.0 Å resolution, respectively. The structures indicated that two mobile regions, MR1 (positions 172–185) and MR2 (positions 211–221), form a compact core for allosteric motion, and His179 of MR1 forms constitutive hydrogen bonds with MR2. The Q4(R) mutation, which comprises the L67E, H68D, E178K, and A235R replacements, increased Vmax 4-fold but reduced pyruvate S0.5 only 5-fold in the reaction without FBP. In contrast, the P2 mutation, comprising the R173Q and R216L replacements, did not markedly increase Vmax, but 102-reduced pyruvate S0.5, and additively increased the FBP-independent activity of the Q4(R) enzyme. The two types of mutation consistently increased the thermal stability of the enzyme. The MR1-MR2 area is a positively charged cluster, and its center approaches another positively charged cluster (N domain cluster) across the Q-axis subunit interface by 5 Å, when the enzyme undergoes the T to R transition. Structural and kinetic analyses thus revealed the simple and unique allosteric machinery of TcLDH, where the MR1-MR2 area pivotally moves during the allosteric motion and mediates the allosteric equilibrium through electrostatic repulsion within the protein molecule. PMID:25258319
Sharma, Reetu; Sastry, G Narahari
2015-01-01
Thermus thermophilius isopropylmalate dehydrogenase catalyzes oxidative decarboxylation and dehydrogenation of isopropylmalate. Substitution of leucine to alanine at position 172 enhances the thermal stability among the known point mutants. Exploring the dynamic properties of non-covalent interactions such as saltbridges, hydrogen bonds and hydrophobic interactions to explain thermal stability of a protein is interesting in its own right. In this study dynamic changes in the non-covalent interactions are studied to decipher the deterministic features of thermal stability of a protein considering a case study of a point mutant in Thermus thermophilus isopropylmalate dehydrogenase. A total of four molecular dynamic simulations of 0.2 μs were carried out on wild type and mutant's functional dimers at 300 K and 337 K. Higher thermal stability of the mutant as compared to wild type is revealed by root mean square deviation, root mean square fluctuations and Cα-Cα distance with an increase in temperature from 300 K to 337 K. Most of the regions of wild type fluctuate higher than the corresponding regions of mutant with an increase in temperature. Cα-Cα distance analysis suggests that long distance networks are significantly affected in wild type as compared to the mutant. Short lived contacts are higher in wild type, while long lived contacts are lost at 337 K. The mutant forms less hydrogen bonds with water as compared to wild type at 337 K. In contrast to wild type, the mutant shows significant increase in unique saltbridges, hydrogen bonds and hydrophobic contacts at 337 K. The current study indicates that there is a strong inter-dependence of thermal stability on the way in which non-covalent interactions reorganize, and it is rewarding to explore this connection in single mutant studies.
Adjustment of Conformational Flexibility is a Key Event in the Thermal Adaptation of Proteins
NASA Astrophysics Data System (ADS)
Zavodszky, Peter; Kardos, Jozsef; Svingor, Adam; Petsko, Gregory A.
1998-06-01
3-Isopropylmalate dehydrogenase (IPMDH, E.C. 1.1.1.85) from the thermophilic bacterium Thermus thermophilus HB8 is homologous to IPMDH from the mesophilic Escherichia coli, but has an approximately 17 degrees C higher melting temperature. Its temperature optimum is 22-25 degrees C higher than that of the E. coli enzyme; however, it is hardly active at room temperature. The increased conformational rigidity required to stabilize the thermophilic enzyme against heat denaturation might explain its different temperature-activity profile. Hydrogen/deuterium exchange studies were performed on this thermophilic-mesophilic enzyme pair to compare their conformational flexibilities. It was found that Th. thermophilus IPMDH is significantly more rigid at room temperature than E. coli IPMDH, whereas the enzymes have nearly identical flexibilities under their respective optimal working conditions, suggesting that evolutionary adaptation tends to maintain a ``corresponding state'' regarding conformational flexibility. These observations confirm that conformational fluctuations necessary for catalytic function are restricted at room temperature in the thermophilic enzyme, suggesting a close relationship between conformational flexibility and enzyme function.
Thermus anatoliensis sp. nov., a thermophilic bacterium from geothermal waters of Buharkent, Turkey.
Kacagan, Murat; Inan, Kadriye; Canakci, Sabriye; Guler, Halil Ibrahim; Belduz, Ali Osman
2015-12-01
A Gram-stain-negative, lack of motility, catalase- and oxidase- positive bacterium (strain MT1(T)) was isolated from Buharkent hot spring in Aydin, Turkey. Its taxonomy was investigated using a polyphasic approach. The strain was able to grow at 45-80 °C, pH 5.5-10.5 and with a NaCI tolerance up to 2.0% (w/v). Strain MT1(T) was able to utilize d-mannitol and l-arabinose, not able to utilize d-cellobiose as sole carbon source. 16S rRNA gene sequence analysis revealed that the strain belonged to the genus Thermus; strain MT1(T) detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. The predominant fatty acids of strain MT1(T) were iso-C(15:0) (43.0%) and iso-C(17:0) (27.4%). Polar lipid analysis revealed a major phospholipid, one major glycolipid, one major aminophospholipid, two minor aminolipids, one minor phospholipid, and several minor glycolipids. The major isoprenoid quinone was MK-8. The DNA G+C content of MT1(T) was 69.6 mol%. On the basis of a taxonomic study using a polyphasic approach, strain MT1(T) is considered to represent a novel species of the genus Thermus, for which the name Thermus anatoliensis sp. nov. is proposed. The type strain is MT1(T) (=NCCB 100425(T) =LMG 26880(T)). © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yanli; Juranek, Stefan; Li, Haitao
Here we report on a 3.0 {angstrom} crystal structure of a ternary complex of wild-type Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-nucleotide guide DNA and a 20-nucleotide target RNA containing cleavage-preventing mismatches at the 10-11 step. The seed segment (positions 2 to 8) adopts an A-helical-like Watson-Crick paired duplex, with both ends of the guide strand anchored in the complex. An arginine, inserted between guide-strand bases 10 and 11 in the binary complex, locking it in an inactive conformation, is released on ternary complex formation. The nucleic-acid-binding channel between the PAZ- and PIWI-containing lobes of argonaute widens on formationmore » of a more open ternary complex. The relationship of structure to function was established by determining cleavage activity of ternary complexes containing position-dependent base mismatch, bulge and 2'-O-methyl modifications. Consistent with the geometry of the ternary complex, bulges residing in the seed segments of the target, but not the guide strand, were better accommodated and their complexes were catalytically active.« less
Rayevsky, Alexey; Sharifi, Mohsen; Tukalo, Michael
2018-06-18
The accuracy of protein synthesis is provided by the editing functions of aminoacyl-tRNA synthetases (aaRSs), a mechanism that eliminates misactivated amino acids or mischarged tRNAs. Despite research efforts, some molecular bases of these mechanisms are still unclear. The post-transfer editing pathway of leucyl-tRNA synthetase (LeuRS) carried out in a special insertion domain (the Connective Polypeptide 1 or CP1), as editing domain. Recently, it was shown by in vivo studies and was supported by mutagenesis, and the kinetics approaches that the CP1 domain of LeuRS has discriminatory power for different substrates. The goal of this work is to investigate the structural basis for amino acid recognition of LeuRS post-transfer editing processes with molecular dynamics (MD) simulation method. To pursue this aim, the molecular modeling studies on Thermus thermophiles LeuRS (LeuRSTT) with two post-transfer substrates (norvalyl-tRNA Leu and isoleucyl-tRNA Leu ) was performed. Our results revealed that post-transfer substrate norvalyl-tRNA Leu is more favorable. Moreover, the MD simulations show that branched side chain of Ile-A76 cannot allow water molecules to get close, which leads to a significant decrease in the rate of hydrolysis. Finally, the study showed that site mutation Asp347Ala has elucidated a number of fine structural differences in the binding mode of two post-transfer substrates to the active centre of LeuRS editing domain and two conserved threonines, namely Thr247 and Thr248, are responsible for the amino acid selection through the interaction with substrates. Copyright © 2018 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okai, Masahiko; Tokyo University of Marine Science and Technology, 4-5-7 Konan, Minato-ku, Tokyo 108-8477; Yamamura, Akihiro
Carboxypeptidase cleaves the C-terminal amino acid residue from proteins and peptides. Here, we report the functional and structural characterizations of carboxypeptidase belonging to the M32 family from the thermophilic bacterium Thermus thermophilus HB8 (TthCP). TthCP exhibits a relatively broad specificity for both hydrophilic (neutral and basic) and hydrophobic (aliphatic and aromatic) residues at the C-terminus and shows optimal activity in the temperature range of 75–80 °C and in the pH range of 6.8–7.2. Enzyme activity was significantly enhanced by cobalt or cadmium and was moderately inhibited by Tris at 25 °C. We also determined the crystal structure of TthCP at 2.6 Å resolution.more » Two dimer types of TthCP are present in the crystal. One type consists of two subunits in different states, open and closed, with a C{sup α} RMSD value of 2.2 Å; the other type consists of two subunits in the same open state. This structure enables us to compare the open and closed states of an M32 carboxypeptidase. The TthCP subunit can be divided into two domains, L and S, which are separated by a substrate-binding groove. The L and S domains in the open state are almost identical to those in the closed state, with C{sup α} RMSD values of 0.84 and 0.53 Å, respectively, suggesting that the transition between the open and closed states proceeds with a large hinge-bending motion. The superimposition between the closed states of TthCP and BsuCP, another M32 family member, revealed that most putative substrate-binding residues in the grooves are oriented in the same direction. - Highlights: • The enzyme activity of TthCP was inhibited moderately by Tris molecule. • We solved the crystal structure of TthCP at 2.6 Å resolution. • The crystal structure of TthCP revealed both the open and closed conformations.« less
Nagayoshi, Yuko; Kumagae, Kenta; Mori, Kazuki; Tashiro, Kosuke; Nakamura, Ayano; Fujino, Yasuhiro; Hiromasa, Yasuaki; Iwamoto, Takeo; Kuhara, Satoru; Ohshima, Toshihisa; Doi, Katsumi
2016-01-01
A filamentous bacteriophage, φOH3, was isolated from hot spring sediment in Obama hot spring in Japan with the hyperthermophilic bacterium Thermus thermophilus HB8 as its host. Phage φOH3, which was classified into the Inoviridae family, consists of a flexible filamentous particle 830 nm long and 8 nm wide. φOH3 was stable at temperatures ranging from 70 to 90°C and at pHs ranging from 6 to 9. A one-step growth curve of the phage showed a 60-min latent period beginning immediately postinfection, followed by intracellular virus particle production during the subsequent 40 min. The released virion number of φOH3 was 109. During the latent period, both single stranded DNA (ssDNA) and the replicative form (RF) of phage DNA were multiplied from min 40 onward. During the release period, the copy numbers of both ssDNA and RF DNA increased sharply. The size of the φOH3 genome is 5688 bp, and eight putative open reading frames (ORFs) were annotated. These ORFs were encoded on the plus strand of RF DNA and showed no significant homology with any known phage genes, except ORF 5, which showed 60% identity with the gene VIII product of the Thermus filamentous phage PH75. All the ORFs were similar to predicted genes annotated in the Thermus aquaticus Y51MC23 and Meiothermus timidus DSM 17022 genomes at the amino acid sequence level. This is the first report of the whole genome structure and DNA multiplication of a filamentous T. thermophilus phage within its host cell.
Rocha-Martín, Javier; Vega, Daniel; Bolivar, Juan M; Hidalgo, Aurelio; Berenguer, José; Guisán, José M; López-Gallego, Fernando
2012-01-01
The use of dehydrogenases in asymmetric chemistry has exponentially grown in the last decades facilitated by the genome mining. Here, a new short-chain alcohol dehydrogenase from Thermus thermophilus HB27 has been expressed, purified, characterized and stabilized by immobilization on solid supports. The enzyme catalyzes both oxidative and reductive reactions at neutral pH with a broad range of substrates. Its highest activity was found towards the reduction of 2,2',2″-trifluoroacetophenone (85 U/mg at 65 °C and pH 7). Moreover, the enzyme was stabilized more than 200-fold by multipoint covalent immobilization on agarose matrixes via glyoxyl chemistry. Such heterogeneous catalyst coupled to an immobilized cofactor recycling partner performed the quantitative asymmetric reduction of 2,2',2″-trifluoroacetophenone and rac-2-phenylpropanal to (S)-(+)-α-(trifluoromethyl)benzyl alcohol and (R)-2-phenyl-1-propanol with enantiomeric excesses of 96% and 71%, respectively. To our knowledge this is the first alcohol dehydrogenase from a thermophilic source with anti-Prelog selectivity for aryl ketones and that preferentially produces R-profens. Copyright © 2011 Elsevier Ltd. All rights reserved.
Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus
Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.
2013-01-01
A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966
NASA Astrophysics Data System (ADS)
Garber, M. B.; Agalarov, S. Ch.; Eliseikina, I. A.; Sedelnikova, S. E.; Tishchenko, S. V.; Shirokov, V. A.; Yusupov, M. M.; Reshetnikova, L. S.; Trakhanov, S. D.; Tukalo, M. A.; Yaremchuk, A. D.
1991-03-01
An extreme thermophilic bacterium Thermus thermophilus has been chosen as a source for the isolation of components of the protein-synthesizing system to investigate their structures by X-ray crystallographic methods. The scheme of simultaneous isolation of ribosomes, tRNA, three elongation factors, several aminoacyl-tRNA synthetases and several enzymes has been developed. Methods of purification of ribosomes and individual ribosomal proteins without denaturation were elaborated. Crystals of the elongation factor G, the 70S ribosome, the 30S ribosomal subunit, six ribosomal proteins and three aminoacyl-tRNA synthetases have been obtained. Structural investigations of EF-G and the 70S ribosome are underway.
Fujino, Yasuhiro; Nagayoshi, Yuko; Iwase, Makoto; Yokoyama, Takushi; Ohshima, Toshihisa
2016-01-01
ABSTRACT Thermus thermophilus HB8 expresses silica-induced protein (Sip) when cultured in medium containing supersaturated silicic acids. Using genomic information, Sip was identified as a Fe3+-binding ABC transporter. Detection of a 1-kb hybridized band in Northern analysis revealed that sip transcription is monocistronic and that sip has its own terminator and promoter. The sequence of the sip promoter showed homology with that of the σA-dependent promoter, which is known as a housekeeping promoter in HB8. Considering that sip is transcribed when supersaturated silicic acids are added, the existence of a repressor is presumed. DNA microarray analysis suggested that supersaturated silicic acids and iron deficiency affect Thermus cells similarly, and enhanced sip transcription was detected under both conditions. This suggested that sip transcription was initiated by iron deficiency and that the ferric uptake regulator (Fur) controlled the transcription. Three Fur gene homologues (TTHA0255, TTHA0344, and TTHA1292) have been annotated in the HB8 genome, and electrophoretic mobility shift assays revealed that the TTHA0344 product interacts with the sip promoter region. In medium containing supersaturated silicic acids, free Fe3+ levels were decreased due to Fe3+ immobilization on colloidal silica. This suggests that, because Fe3+ ions are captured by colloidal silica in geothermal water, Thermus cells are continuously exposed to the risk of iron deficiency. Considering that Sip is involved in iron acquisition, Sip production may be a strategy to survive under conditions of low iron availability in geothermal water. IMPORTANCE The thermophilic bacterium Thermus thermophilus HB8 produces silica-induced protein (Sip) in the presence of supersaturated silicic acids. Sip has homology with iron-binding ABC transporter; however, the mechanism by which Sip expression is induced by silicic acids remains unexplained. We demonstrate that Sip captures iron and its transcription is regulated by the repressor ferric uptake regulator (Fur). This implies that Sip is expressed with iron deficiency. In addition, it is suggested that negatively charged colloidal silica in supersaturated solution absorbs Fe3+ ions and decreases iron availability. Considering that geothermal water contains ample silicic acids, it is suggested that thermophilic bacteria are always facing iron starvation. Sip production may be a strategy for surviving under conditions of low iron availability in geothermal water. PMID:26994077
2012-01-01
Background Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Results Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of the enzyme at this temperature was 9.2 h. Conclusions This is the first report concerning the heterologous expression of a pac gene from a thermophilic microorganism in the mesophilic host E. coli. The recombinant protein was identified as a penicillin K-deacylating thermozyme. PMID:22876915
Torres, Leticia L; Ferreras, Eloy R; Cantero, Angel; Hidalgo, Aurelio; Berenguer, José
2012-08-09
Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of the enzyme at this temperature was 9.2 h. This is the first report concerning the heterologous expression of a pac gene from a thermophilic microorganism in the mesophilic host E. coli. The recombinant protein was identified as a penicillin K-deacylating thermozyme.
Vazquez-Tello, Alejandro; Castán, Pablo; Moreno, Renata; Smith, James M.; Berenguer, José; Cedergren, Robert
2002-01-01
The catalytic hammerhead structure has been found in association with repetitive DNA from several animals, including salamanders, crickets and schistosomes, and functions to process in cis the long multimer transcripts into monomer RNA in vivo. The cellular role of these repetitive elements and their transcripts is unknown. Moreover, none of these natural hammerheads have been shown to trans-cleave a host mRNA in vivo. We analyzed the cis- and trans-cleavage properties of the hammerhead ribozyme associated with the SMα DNA family from the human parasite Schistosoma mansoni. The efficiency of trans-cleavage of a target RNA in vitro was affected mainly by both the temperature-dependent chemical step and the ribozyme–product dissociation step. The optimal temperature for trans-cleavage was 70°C. This result was confirmed when both the SMα1 ribozyme and the target RNA were expressed in the extreme thermophile Thermus thermophilus. Moreover, SMα1 RNA showed a remarkable thermostability, equal or superior to that of the most stable RNAs in this species, suggesting that SMα1 RNA has been selected for stability. Computer analysis predicts that the monomer and multimer transcripts fold into highly compact secondary structures, which may explain their exceptional stability in vivo. PMID:11917021
Role of disulphide bonds in a thermophilic serine protease aqualysin I from Thermus aquaticus YT-1.
Sakaguchi, Masayoshi; Takezawa, Makoto; Nakazawa, Rie; Nozawa, Kazutaka; Kusakawa, Taro; Nagasawa, Takeshi; Sugahara, Yasusato; Kawakita, Masao
2008-05-01
A thermophilic serine protease, Aqualysin I, from Thermus aquaticus YT-1 has two disulphide bonds, which are also found in a psychrophilic serine protease from Vibrio sp. PA-44 and a proteinase K-like enzyme from Serratia sp. at corresponding positions. To understand the significance of these disulphide bonds in aqualysin I, we prepared mutants C99S, C194S and C99S/C194S (WSS), in which Cys69-Cys99, Cys163-Cys194 and both of these disulphide bonds, respectively, were disrupted by replacing Cys residues with Ser residues. All mutants were expressed stably in Escherichia coli. The C99S mutant was 68% as active as the wild-type enzyme at 40 degrees C in terms of k(cat) value, while C194S and WSS were only 6 and 3%, respectively, as active, indicating that disulphide bond Cys163-Cys194 is critically important for maintaining proper catalytic site conformation. Mutants C194S and WSS were less thermostable than wild-type enzyme, with a half-life at 90 degrees C of 10 min as compared to 45 min of the latter and with transition temperatures on differential scanning calorimetry of 86.7 degrees C and 86.9 degrees C, respectively. Mutant C99S was almost as stable as the wild-type aqualysin I. These results indicate that the disulphide bond Cys163-Cys194 is more important for catalytic activity and conformational stability of aqualysin I than Cys67-Cys99.
Silva, Zélia; Alarico, Susana; da Costa, Milton S
2005-02-01
The genes for trehalose synthesis in Thermus thermophilus RQ-1, namely otsA [trehalose-phosphate synthase (TPS)], otsB [trehalose-phosphate phosphatase (TPP)], and treS [trehalose synthase (maltose converting) (TreS)] genes are structurally linked. The TPS/TPP pathway plays a role in osmoadaptation, since mutants unable to synthesize trehalose via this pathway were less osmotolerant, in trehalose-deprived medium, than the wild-type strain. The otsA and otsB genes have now been individually cloned and overexpressed in Escherichia coli and the corresponding recombinant enzymes purified. The apparent molecular masses of TPS and TPP were 52 and 26 kDa, respectively. The recombinant TPS utilized UDP-glucose, TDP-glucose, ADP-glucose, or GDP-glucose, in this order as glucosyl donors, and glucose-6-phosphate as the glucosyl acceptor to produce trehalose-6-phosphate (T6P). The recombinant TPP catalyzed the dephosphorylation of T6P to trehalose. This enzyme also dephosphorylated G6P, and this activity was enhanced by NDP-glucose. TPS had an optimal activity at about 98 degrees C and pH near 6.0; TPP had a maximal activity near 70 degrees C and at pH 7.0. The enzymes were extremely thermostable: at 100 degrees C, TPS had a half-life of 31 min, and TPP had a half-life of 40 min. The enzymes did not require the presence of divalent cations for activity; however, the presence of Co2+ and Mg2+ stimulates both TPS and TPP. This is the first report of the characterization of TPS and TPP from a thermophilic organism.
Cusick, Kathleen D.; Lin, Baochuan; Malanoski, Anthony P.; Strycharz-Glaven, Sarah M.; Cockrell-Zugell, Allison; Fitzgerald, Lisa A.; Cramer, Jeffrey A.; Barlow, Daniel E.; Boyd, Thomas J.
2016-01-01
ABSTRACT The effect of microwave frequency electromagnetic fields on living microorganisms is an active and highly contested area of research. One of the major drawbacks to using mesophilic organisms to study microwave radiation effects is the unavoidable heating of the organism, which has limited the scale (<5 ml) and duration (<1 h) of experiments. However, the negative effects of heating a mesophile can be mitigated by employing thermophiles (organisms able to grow at temperatures of >60°C). This study identified changes in global gene expression profiles during the growth of Thermus scotoductus SA-01 at 65°C using dielectric (2.45 GHz, i.e., microwave) heating. RNA sequencing was performed on cultures at 8, 14, and 24 h after inoculation to determine the molecular mechanisms contributing to long-term cellular growth and survival under microwave heating conditions. Over the course of growth, genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. Genes involved in cell wall biogenesis and elongation were also upregulated, consistent with the distinct elongated cell morphology observed after 24 h using microwave heating. Analysis of the global differential gene expression data enabled the identification of molecular processes specific to the response of T. scotoductus SA-01 to dielectric heating during growth. IMPORTANCE The residual heating of living organisms in the microwave region of the electromagnetic spectrum has complicated the identification of radiation-only effects using microorganisms for 50 years. A majority of the previous experiments used either mature cells or short exposure times with low-energy high-frequency radiation. Using global differential gene expression data, we identified molecular processes unique to dielectric heating using Thermus scotoductus SA-01 cultured over 30 h in a commercial microwave digestor. Genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. These findings serve as a platform for future studies with mesophiles in order to better understand the response of microorganisms to microwave radiation. PMID:27520819
Radzi Noor, Mohamed; Soulimane, Tewfik
2012-04-01
Seven years into the completion of the genome sequencing projects of the thermophilic bacterium Thermus thermophilus strains HB8 and HB27, many questions remain on its bioenergetic mechanisms. A key fact that is occasionally overlooked is that oxygen has a very limited solubility in water at high temperatures. The HB8 strain is a facultative anaerobe whereas its relative HB27 is strictly aerobic. This has been attributed to the absence of nitrate respiration genes from the HB27 genome that are carried on a mobilizable but highly-unstable plasmid. In T. thermophilus, the nitrate respiration complements the primary aerobic respiration. It is widely known that many organisms encode multiple biochemically-redundant components of the respiratory complexes. In this minireview, the presence of the two cytochrome c oxidases (CcO) in T. thermophilus, the ba(3)- and caa(3)-types, is outlined along with functional considerations. We argue for the distinct evolutionary histories of these two CcO including their respective genetic and molecular organizations, with the caa(3)-oxidase subunits having been initially 'fused'. Coupled with sequence analysis, the ba(3)-oxidase crystal structure has provided evolutionary and functional information; for example, its subunit I is more closely related to archaeal sequences than bacterial and the substrate-enzyme interaction is hydrophobic as the elevated growth temperature weakens the electrostatic interactions common in mesophiles. Discussion on the role of cofactors in intra- and intermolecular electron transfer and proton pumping mechanism is also included. Copyright © 2011 Elsevier B.V. All rights reserved.
Proteogenomic Analysis of a Thermophilic Bacterial Consortium Adapted to Deconstruct Switchgrass
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'haeseleer, Patrik; Gladden, John M.; Allgaier, Martin
2013-07-19
Thermophilic bacteria are a potential source of enzymes for the deconstruction of lignocellulosic biomass. However, the complement of proteins used to deconstruct biomass and the specific roles of different microbial groups in thermophilic biomass deconstruction are not well-explored. Here we report on the metagenomic and proteogenomic analyses of a compost-derived bacterial consortium adapted to switchgrass at elevated temperature with high levels of glycoside hydrolase activities. Near-complete genomes were reconstructed for the most abundant populations, which included composite genomes for populations closely related to sequenced strains of Thermus thermophilus and Rhodothermus marinus, and for novel populations that are related to thermophilicmore » Paenibacilli and an uncultivated subdivision of the littlestudied Gemmatimonadetes phylum. Partial genomes were also reconstructed for a number of lower abundance thermophilic Chloroflexi populations. Identification of genes for lignocellulose processing and metabolic reconstructions suggested Rhodothermus, Paenibacillus and Gemmatimonadetes as key groups for deconstructing biomass, and Thermus as a group that may primarily metabolize low molecular weight compounds. Mass spectrometry-based proteomic analysis of the consortium was used to identify .3000 proteins in fractionated samples from the cultures, and confirmed the importance of Paenibacillus and Gemmatimonadetes to biomass deconstruction. These studies also indicate that there are unexplored proteins with important roles in bacterial lignocellulose deconstruction.« less
Fujita, Satomi; Cho, Su-Hee; Yoshida, Ayako; Hasebe, Fumihito; Tomita, Takeo; Kuzuyama, Tomohisa; Nishiyama, Makoto
2017-09-16
LysK is an M20 peptidase family enzyme that hydrolyzes the isopeptide bond between the carrier protein LysW and lysine in order to release lysine, which is the last step of lysine biosynthesis in Thermus thermophilus. In the present study, we determined the crystal structure of LysK in complex with lysine at a resolution of 2.4 Å. The α-amino group of the bound lysine was oriented toward the catalytic center, which was composed of the residues coordinating divalent metal ions for the hydrolysis of the isopeptide bond. An 11 Å-long path was observed from the active site binding lysine to the protein surface, which may be responsible for recognizing the C-terminal extension domain of LysW with the conserved EDWGE sequence. A positively-charged surface region was detected around the exit of the path, similar to other lysine biosynthetic enzymes using LysW as the carrier protein. Mutational studies of the surface residues provided a plausible model for the electrostatic interaction with LysW. Copyright © 2017 Elsevier Inc. All rights reserved.
Jia, Dong-Xu; Zhou, Lin; Zheng, Yu-Guo
2017-04-01
Glucose isomerase (GI) is used in vitro to convert d-glucose to d-fructose, which is capable of commercial producing high fructose corn syrup (HFCS). To manufacture HFCS at elevated temperature and reduce the cost of enriching syrups, novel refractory GIs from Thermoanaerobacterium xylanolyticum (TxGI), Thermus oshimai (ToGI), Geobacillus thermocatenulatus (GtGI) and Thermoanaerobacter siderophilus (TsGI) were screened via genome mining approach. The enzymatic characteristics research showed that ToGI had higher catalytic efficiency and superior thermostability toward d-glucose among the screened GIs. Its optimum temperature reached 95°C and could retain more than 80% of initial activity in the presence of 20mM Mn 2+ at 85°C for 48h. The K m and k cat /K m values for ToGI were 81.46mM and 21.77min -1 mM -1 , respectively. Furthermore, the maximum conversion yield of 400g/L d-glucose to d-fructose at 85°C was 52.16%. Considering its excellent high thermostability and ameliorable application performance, ToGI might be promising for realization of future industrial production of HFCS at elevated temperature. Copyright © 2017 Elsevier Inc. All rights reserved.
Structural basis for gene regulation by a B12-dependent photoreceptor
Jost, Marco; Fernández-Zapata, Jésus; Polanco, María Carmen; Ortiz-Guerrero, Juan Manuel; Chen, Percival Yang-Ting; Kang, Gyunghoon; Padmanabhan, S.; Elías-Arnanz, Montserrat; Drennan, Catherine L.
2015-01-01
Summary Photoreceptor proteins enable organisms to sense and respond to light. The newly discovered CarH-type photoreceptors use a vitamin B12 derivative, adenosylcobalamin, as the light-sensing chromophore to mediate light-dependent gene regulation. Here, we present crystal structures of Thermus thermophilus CarH in all three relevant states: in the dark, both free and bound to operator DNA, and after light exposure. These structures provide a visualization of how adenosylcobalamin mediates CarH tetramer formation in the dark, how this tetramer binds to the promoter −35 element to repress transcription, and how light exposure leads to a large-scale conformational change that activates transcription. In addition to the remarkable functional repurposing of adenosylcobalamin from an enzyme cofactor to a light sensor, we find that nature also repurposed two independent protein modules in assembling CarH. These results expand the biological role of vitamin B12 and provide fundamental insight into a new mode of light-dependent gene regulation. PMID:26416754
Chen, Luan; Shi, Ke; Yin, Zhiqi; Aihara, Hideki
2013-01-07
Holliday junction (HJ) resolvases are structure-specific endonucleases that cleave four-way DNA junctions (HJs) generated during DNA recombination and repair. Bacterial RuvC, a prototypical HJ resolvase, functions as homodimer and nicks DNA strands precisely across the junction point. To gain insights into the mechanisms underlying symmetrical strand cleavages by RuvC, we performed crystallographic and biochemical analyses of RuvC from Thermus thermophilus (T.th. RuvC). The crystal structure of T.th. RuvC shows an overall protein fold similar to that of Escherichia coli RuvC, but T.th. RuvC has a more tightly associated dimer interface possibly reflecting its thermostability. The binding mode of a HJ-DNA substrate can be inferred from the shape/charge complementarity between the T.th. RuvC dimer and HJ-DNA, as well as positions of sulfate ions bound on the protein surface. Unexpectedly, the structure of T.th. RuvC homodimer refined at 1.28 Å resolution shows distinct asymmetry near the dimer interface, in the region harboring catalytically important aromatic residues. The observation suggests that the T.th. RuvC homodimer interconverts between two asymmetric conformations, with alternating subunits switched on for DNA strand cleavage. This model provides a structural basis for the 'nick-counter-nick' mechanism in HJ resolution, a mode of HJ processing shared by prokaryotic and eukaryotic HJ resolvases.
Schep, Daniel G.; Rubinstein, John L.
2016-01-01
Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669
Visualizing the phage T4 activated transcription complex of DNA and E. coli RNA polymerase
James, Tamara D.; Cardozo, Timothy; Abell, Lauren E.; Hsieh, Meng-Lun; Jenkins, Lisa M. Miller; Jha, Saheli S.; Hinton, Deborah M.
2016-01-01
The ability of RNA polymerase (RNAP) to select the right promoter sequence at the right time is fundamental to the control of gene expression in all organisms. However, there is only one crystallized structure of a complete activator/RNAP/DNA complex. In a process called σ appropriation, bacteriophage T4 activates a class of phage promoters using an activator (MotA) and a co-activator (AsiA), which function through interactions with the σ70 subunit of RNAP. We have developed a holistic, structure-based model for σ appropriation using multiple experimentally determined 3D structures (Escherichia coli RNAP, the Thermus aquaticus RNAP/DNA complex, AsiA /σ70 Region 4, the N-terminal domain of MotA [MotANTD], and the C-terminal domain of MotA [MotACTD]), molecular modeling, and extensive biochemical observations indicating the position of the proteins relative to each other and to the DNA. Our results visualize how AsiA/MotA redirects σ, and therefore RNAP activity, to T4 promoter DNA, and demonstrate at a molecular level how the tactful interaction of transcriptional factors with even small segments of RNAP can alter promoter specificity. Furthermore, our model provides a rational basis for understanding how a mutation within the β subunit of RNAP (G1249D), which is far removed from AsiA or MotA, impairs σ appropriation. PMID:27458207
Running, William E; Reilly, James P
2010-10-01
Ribosomes occupy a central position in cellular metabolism, converting stored genetic information into active cellular machinery. Ribosomal proteins modulate both the intrinsic function of the ribosome and its interaction with other cellular complexes, such as chaperonins or the signal recognition particle. Chemical modification of proteins combined with mass spectrometric detection of the extent and position of covalent modifications is a rapid, sensitive method for the study of protein structure and flexibility. By altering the pH of the solution, we have induced non-denaturing changes in the structure of bacterial ribosomal proteins and detected these conformational changes by covalent labeling. Changes in ribosomal protein modification across a pH range from 6.6 to 8.3 are unique to each protein, and correlate with their structural environment in the ribosome. Lysine residues whose extent of modification increases as a function of increasing pH are on the surface of proteins, but in close proximity either to glutamate and aspartate residues, or to rRNA backbone phosphates. Increasing pH disrupts tertiary and quaternary interactions mediated by hydrogen bonding or ionic interactions, and regions of protein structure whose conformations are sensitive to these changes are of potential importance in modulating the flexibility of the ribosome or its interaction with other cellular complexes.
Pennacchio, Angela; Pucci, Biagio; Secundo, Francesco; La Cara, Francesco; Rossi, Mosè; Raia, Carlo A
2008-07-01
The gene encoding a novel alcohol dehydrogenase (ADH) that belongs to the short-chain dehydrogenase/reductase (SDR) superfamily was identified in the extremely thermophilic, halotolerant gram-negative eubacterium Thermus thermophilus HB27. The T. thermophilus ADH gene (adh(Tt)) was heterologously overexpressed in Escherichia coli, and the protein (ADH(Tt)) was purified to homogeneity and characterized. ADH(Tt) is a tetrameric enzyme consisting of identical 26,961-Da subunits composed of 256 amino acids. The enzyme has remarkable thermophilicity and thermal stability, displaying activity at temperatures up to approximately 73 degrees C and a 30-min half-inactivation temperature of approximately 90 degrees C, as well as good tolerance to common organic solvents. ADH(Tt) has a strict requirement for NAD(H) as the coenzyme, a preference for reduction of aromatic ketones and alpha-keto esters, and poor activity on aromatic alcohols and aldehydes. This thermophilic enzyme catalyzes the following reactions with Prelog specificity: the reduction of acetophenone, 2,2,2-trifluoroacetophenone, alpha-tetralone, and alpha-methyl and alpha-ethyl benzoylformates to (S)-(-)-1-phenylethanol (>99% enantiomeric excess [ee]), (R)-alpha-(trifluoromethyl)benzyl alcohol (93% ee), (S)-alpha-tetralol (>99% ee), methyl (R)-(-)-mandelate (92% ee), and ethyl (R)-(-)-mandelate (95% ee), respectively, by way of an efficient in situ NADH-recycling system involving 2-propanol and a second thermophilic ADH. This study further supports the critical role of the D37 residue in discriminating NAD(H) from NADP(H) in members of the SDR superfamily.
Yamasaki, Takashi; Oohata, Yukiko; Nakamura, Toshiki; Watanabe, Yo-hei
2015-04-10
The ClpB/Hsp104 chaperone solubilizes and reactivates protein aggregates in cooperation with DnaK/Hsp70 and its cofactors. The ClpB/Hsp104 protomer has two AAA+ modules, AAA-1 and AAA-2, and forms a homohexamer. In the hexamer, these modules form a two-tiered ring in which each tier consists of homotypic AAA+ modules. By ATP binding and its hydrolysis at these AAA+ modules, ClpB/Hsp104 exerts the mechanical power required for protein disaggregation. Although ATPase cycle of this chaperone has been studied by several groups, an integrated understanding of this cycle has not been obtained because of the complexity of the mechanism and differences between species. To improve our understanding of the ATPase cycle, we prepared many ordered heterohexamers of ClpB from Thermus thermophilus, in which two subunits having different mutations were cross-linked to each other and arranged alternately and measured their nucleotide binding, ATP hydrolysis, and disaggregation abilities. The results indicated that the ATPase cycle of ClpB proceeded as follows: (i) the 12 AAA+ modules randomly bound ATP, (ii) the binding of four or more ATP to one AAA+ ring was sensed by a conserved Arg residue and converted another AAA+ ring into the ATPase-active form, and (iii) ATP hydrolysis occurred cooperatively in each ring. We also found that cooperative ATP hydrolysis in at least one ring was needed for the disaggregation activity of ClpB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L
1988-01-01
Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437
Crystal structure of a transfer-ribonucleoprotein particle that promotes asparagine formation
Blaise, Mickaël; Bailly, Marc; Frechin, Mathieu; Behrens, Manja Annette; Fischer, Frédéric; Oliveira, Cristiano L P; Becker, Hubert Dominique; Pedersen, Jan Skov; Thirup, Søren; Kern, Daniel
2010-01-01
Four out of the 22 aminoacyl-tRNAs (aa-tRNAs) are systematically or alternatively synthesized by an indirect, two-step route requiring an initial mischarging of the tRNA followed by tRNA-dependent conversion of the non-cognate amino acid. During tRNA-dependent asparagine formation, tRNAAsn promotes assembly of a ribonucleoprotein particle called transamidosome that allows channelling of the aa-tRNA from non-discriminating aspartyl-tRNA synthetase active site to the GatCAB amidotransferase site. The crystal structure of the Thermus thermophilus transamidosome determined at 3 Å resolution reveals a particle formed by two GatCABs, two dimeric ND-AspRSs and four tRNAsAsn molecules. In the complex, only two tRNAs are bound in a functional state, whereas the two other ones act as an RNA scaffold enabling release of the asparaginyl-tRNAAsn without dissociation of the complex. We propose that the crystal structure represents a transient state of the transamidation reaction. The transamidosome constitutes a transfer-ribonucleoprotein particle in which tRNAs serve the function of both substrate and structural foundation for a large molecular machine. PMID:20717102
Specificity and Catalytic Mechanism in Family 5 Uracil DNA Glycosylase*
Xia, Bo; Liu, Yinling; Li, Wei; Brice, Allyn R.; Dominy, Brian N.; Cao, Weiguo
2014-01-01
UDGb belongs to family 5 of the uracil DNA glycosylase (UDG) superfamily. Here, we report that family 5 UDGb from Thermus thermophilus HB8 is not only a uracil DNA glycosyase acting on G/U, T/U, C/U, and A/U base pairs, but also a hypoxanthine DNA glycosylase acting on G/I, T/I, and A/I base pairs and a xanthine DNA glycosylase acting on all double-stranded and single-stranded xanthine-containing DNA. Analysis of potentials of mean force indicates that the tendency of hypoxanthine base flipping follows the order of G/I > T/I, A/I > C/I, matching the trend of hypoxanthine DNA glycosylase activity observed in vitro. Genetic analysis indicates that family 5 UDGb can also act as an enzyme to remove uracil incorporated into DNA through the existence of dUTP in the nucleotide pool. Mutational analysis coupled with molecular modeling and molecular dynamics analysis reveals that although hydrogen bonding to O2 of uracil underlies the UDG activity in a dissociative fashion, Tth UDGb relies on multiple catalytic residues to facilitate its excision of hypoxanthine and xanthine. This study underscores the structural and functional diversity in the UDG superfamily. PMID:24838246
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo
2015-01-01
The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de; Brosi, Richard W. W.; Steinmetz, Andrea
2013-08-01
The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein,more » but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.« less
Cusick, Kathleen D; Lin, Baochuan; Malanoski, Anthony P; Strycharz-Glaven, Sarah M; Cockrell-Zugell, Allison; Fitzgerald, Lisa A; Cramer, Jeffrey A; Barlow, Daniel E; Boyd, Thomas J; Biffinger, Justin C
2016-10-15
The effect of microwave frequency electromagnetic fields on living microorganisms is an active and highly contested area of research. One of the major drawbacks to using mesophilic organisms to study microwave radiation effects is the unavoidable heating of the organism, which has limited the scale (<5 ml) and duration (<1 h) of experiments. However, the negative effects of heating a mesophile can be mitigated by employing thermophiles (organisms able to grow at temperatures of >60°C). This study identified changes in global gene expression profiles during the growth of Thermus scotoductus SA-01 at 65°C using dielectric (2.45 GHz, i.e., microwave) heating. RNA sequencing was performed on cultures at 8, 14, and 24 h after inoculation to determine the molecular mechanisms contributing to long-term cellular growth and survival under microwave heating conditions. Over the course of growth, genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. Genes involved in cell wall biogenesis and elongation were also upregulated, consistent with the distinct elongated cell morphology observed after 24 h using microwave heating. Analysis of the global differential gene expression data enabled the identification of molecular processes specific to the response of T. scotoductus SA-01 to dielectric heating during growth. The residual heating of living organisms in the microwave region of the electromagnetic spectrum has complicated the identification of radiation-only effects using microorganisms for 50 years. A majority of the previous experiments used either mature cells or short exposure times with low-energy high-frequency radiation. Using global differential gene expression data, we identified molecular processes unique to dielectric heating using Thermus scotoductus SA-01 cultured over 30 h in a commercial microwave digestor. Genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. These findings serve as a platform for future studies with mesophiles in order to better understand the response of microorganisms to microwave radiation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.
2016-11-01
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshida, Ayako; Tomita, Takeo; Kuzuyama, Tomohisa
2007-02-01
To elucidate the mechanism of regulation of aspartate kinase, the regulatory subunit (the β subunit of T. thermophilus aspartate kinase) was crystallized in the presence of the inhibitor threonine. Aspartate kinase (AK) from Thermus thermophilus, which catalyzes the first step of threonine and methionine biosynthesis, is regulated via feedback inhibition by the end product threonine. To elucidate the mechanism of regulation of AK, the regulatory subunit (the β subunit of T. thermophilus AK) was crystallized in the presence of the inhibitor threonine. Diffraction data were collected to 2.15 Å at a synchrotron source. The crystal belongs to the cubic spacemore » group P4{sub 3}32 or P4{sub 1}32, with unit-cell parameters a = b = c = 141.8 Å.« less
Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji
2017-01-01
ABSTRACT NAD (NAD+) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD+ from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD+ de novo synthesis pathway. Herein, we report the importance of the NAD+ salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD+ salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide (Km of 17 μM, kcat of 50 s−1, kcat/Km of 3.0 × 103 s−1 · mM−1). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD+ salvage pathway in T. thermophilus. Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD+ and NADH. IMPORTANCE NAD+ and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD+ decomposition is, in general, more rapid. This study emphasizes that NAD+ instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. PMID:28630126
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji; Honda, Kohsuke
2017-09-01
NAD (NAD + ) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD + from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD + de novo synthesis pathway. Herein, we report the importance of the NAD + salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD + salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide ( K m of 17 μM, k cat of 50 s -1 , k cat / K m of 3.0 × 10 3 s -1 · mM -1 ). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD + salvage pathway in T. thermophilus Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD + and NADH. IMPORTANCE NAD + and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD + decomposition is, in general, more rapid. This study emphasizes that NAD + instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. Copyright © 2017 American Society for Microbiology.
Tomikawa, Chie; Yokogawa, Takashi; Kanai, Tamotsu; Hori, Hiroyuki
2010-01-01
N(7)-methylguanine at position 46 (m(7)G46) in tRNA is produced by tRNA (m(7)G46) methyltransferase (TrmB). To clarify the role of this modification, we made a trmB gene disruptant (DeltatrmB) of Thermus thermophilus, an extreme thermophilic eubacterium. The absence of TrmB activity in cell extract from the DeltatrmB strain and the lack of the m(7)G46 modification in tRNA(Phe) were confirmed by enzyme assay, nucleoside analysis and RNA sequencing. When the DeltatrmB strain was cultured at high temperatures, several modified nucleotides in tRNA were hypo-modified in addition to the lack of the m(7)G46 modification. Assays with tRNA modification enzymes revealed hypo-modifications of Gm18 and m(1)G37, suggesting that the m(7)G46 positively affects their formations. Although the lack of the m(7)G46 modification and the hypo-modifications do not affect the Phe charging activity of tRNA(Phe), they cause a decrease in melting temperature of class I tRNA and degradation of tRNA(Phe) and tRNA(Ile). (35)S-Met incorporation into proteins revealed that protein synthesis in DeltatrmB cells is depressed above 70 degrees C. At 80 degrees C, the DeltatrmB strain exhibits a severe growth defect. Thus, the m(7)G46 modification is required for cell viability at high temperatures via a tRNA modification network, in which the m(7)G46 modification supports introduction of other modifications.
The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction
NASA Technical Reports Server (NTRS)
Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.
1989-01-01
Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.
Confounders of mutation-rate estimators: selection and phenotypic lag in Thermus thermophilus
Kissling, Grace E.; Grogan, Dennis W.; Drake, John W.
2015-01-01
In a recent description of the rate and character of spontaneous mutation in the hyperthermophilic bacterium Thermus thermophilus, the mutation rate was observed to be substantially lower than seen in several mesophiles. Subsequently, a report appeared indicating that this bacterium maintains an average of about 4.5 genomes per cell. This number of genomes might result in a segregation lag for the expression of a recessive mutation and might therefore lead to an underestimate of the rate of mutation. Here we describe some kinds of problems that may arise when estimating mutation rates and outline ways to adjust the rates accordingly. The emphasis is mainly on differential rates of growth of mutants versus their parents and on various kinds of phenotypic lag. We then apply these methods to the T. thermophilus data and conclude that there is as yet no reliable impact on a previously described rate. PMID:23916418
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.
2016-11-15
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less
NASA Astrophysics Data System (ADS)
Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; Casale, Sandra; De Stefano, Luca
2015-10-01
The thermophilic bacterium Thermus thermophilus HB27 encodes chromosomal arsenate reductase (TtArsC), the enzyme responsible for resistance to the harmful effects of arsenic. We report on adsorption of TtArsC onto gold nanoparticles for naked-eye monitoring of biomolecular interaction between the enzyme and arsenic species. Synthesis of hybrid biological-metallic nanoparticles has been characterized by transmission electron microscopy (TEM), ultraviolet-visible (UV-vis), dynamic light scattering (DLS) and phase modulated infrared reflection absorption (PM-IRRAS) spectroscopies. Molecular interactions have been monitored by UV-vis and Fourier transform-surface plasmon resonance (FT-SPR). Due to the nanoparticles’ aggregation on exposure to metal salts, pentavalent and trivalent arsenic solutions can be clearly distinguished by naked-eye assay, even at 85 μM concentration. Moreover, the assay shows partial selectivity against other heavy metals.
Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli
2014-01-01
We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628
Molecular Basis of ADP Inhibition of Vacuolar (V)-type ATPase/Synthase*
Kishikawa, Jun-ichi; Nakanishi, Atsuko; Furuike, Shou; Tamakoshi, Masatada; Yokoyama, Ken
2014-01-01
Reduction of ATP hydrolysis activity of vacuolar-type ATPase/synthase (V0V1) as a result of ADP inhibition occurs as part of the normal mechanism of V0V1 of Thermus thermophilus but not V0V1 of Enterococcus hirae or eukaryotes. To investigate the molecular basis for this difference, domain-swapped chimeric V1 consisting of both T. thermophilus and E. hirae enzymes were generated, and their function was analyzed. The data showed that the interaction between the nucleotide binding and C-terminal domains of the catalytic A subunit from E. hirae V1 is central to increasing binding affinity of the chimeric V1 for phosphate, resulting in reduction of the ADP inhibition. These findings together with a comparison of the crystal structures of T. thermophilus V1 with E. hirae V1 strongly suggest that the A subunit adopts a conformation in T. thermophilus V1 different from that in E. hirae V1. This key difference results in ADP inhibition of T. thermophilus V1 by abolishing the binding affinity for phosphate during ATP hydrolysis. PMID:24247239
Liu, Huiping; Zhu, Yanyun; Yang, Xiaorong; Lin, Ying
2018-05-01
The multicopper oxidases catalyze 1-electron oxidation of four substrate molecules and concomitantly 4-electron reduction of dioxygen to water. The substrate loses the electrons at the type 1 copper (T1 Cu) site of the enzyme, while the dioxygen is reduced to water at the trinuclear copper center. A highly conserved Glu residue, which is at the dioxygen-entering channel, shuttles the proton to break the O-O bond of dioxygen. At the water-leaving channel, an Asp residue was found to be important in the protonation mechanism. In this study, laccase from Thermus thermophilus SG0.5JP17-16 (lacTT) was investigated to address how four second-sphere residues E356, E456, D106, and D423 affect the activity of the enzyme. Kinetic data indicate that catalytic activities of the enzyme are altered by site-directed mutagenesis on four second-sphere residues. The structural model of lacTT was generated by homology modeling. Structural and spectral data indicate that the E356 residue is situated at the substrate-binding site, responsible for the binding of the substrate and the geometry of the T1 Cu site by hydrogen-bonding networks; the E456 residue, located at the dioxygen-entering channel, plays a critical role in stabilizing the structure of all active copper centers and shuttling the proton to the trinuclear copper cluster (TNC) for the reductive reaction of dioxygen; the D106 and D423 residues are at the water-leaving channel, and they are important for the essential geometry of the TNC and the release of the water molecules. Altogether, this study contributes to the further understanding of the basic mechanism involving the oxidation of the substrate, electron transfer, and the reduction of dioxygen in lacTT.
Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong
2017-01-01
The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.
Transferable Denitrification Capability of Thermus thermophilus
Alvarez, Laura; Bricio, Carlos; Blesa, Alba; Hidalgo, Aurelio
2014-01-01
Laboratory-adapted strains of Thermus spp. have been shown to require oxygen for growth, including the model strains T. thermophilus HB27 and HB8. In contrast, many isolates of this species that have not been intensively grown under laboratory conditions keep the capability to grow anaerobically with one or more electron acceptors. The use of nitrogen oxides, especially nitrate, as electron acceptors is one of the most widespread capabilities among these facultative strains. In this process, nitrate is reduced to nitrite by a reductase (Nar) that also functions as electron transporter toward nitrite and nitric oxide reductases when nitrate is scarce, effectively replacing respiratory complex III. In many T. thermophilus denitrificant strains, most electrons for Nar are provided by a new class of NADH dehydrogenase (Nrc). The ability to reduce nitrite to NO and subsequently to N2O by the corresponding Nir and Nor reductases is also strain specific. The genes encoding the capabilities for nitrate (nar) and nitrite (nir and nor) respiration are easily transferred between T. thermophilus strains by natural competence or by a conjugation-like process and may be easily lost upon continuous growth under aerobic conditions. The reason for this instability is apparently related to the fact that these metabolic capabilities are encoded in gene cluster islands, which are delimited by insertion sequences and integrated within highly variable regions of easily transferable extrachromosomal elements. Together with the chromosomal genes, these plasmid-associated genetic islands constitute the extended pangenome of T. thermophilus that provides this species with an enhanced capability to adapt to changing environments. PMID:24141123
Characterization of Thermostable Cellulases Produced by Bacillus and Geobacillus Strains
USDA-ARS?s Scientific Manuscript database
Bacterial community composition of thermophilic (60 deg C) mixed cellulose-enrichment cultures was examined by constructing a 16S rDNA clone library which demonstrated major lineages affiliated to Actinobacteria, Bacteroidetes, Chloroflexi, Deinococcus-Thermus, Firmicutes, and Proteobacteria. A tot...
Wang, Jinpeng; Wei, Ren; Tian, Yaoqi; Yang, Na; Xu, Xueming; Zimmermann, Wolfgang; Jin, Zhengyu
2015-05-20
Large-ring cyclodextrins (LR-CDs) have a number of intriguing properties for potential use in pharmaceutical and food industry. To date, no colorimetric method has been reported for LR-CD content quantification. In this study, triple wavelength colorimetry (TWC) and orthogonal-function spectrophotometry (OFS) have been successfully applied to determine ingredient concentrations in a mixture of amylose and LR-CDs. Both TWC and OFS yielded precise amylose content data in good agreement with expected values. For quantification of LR-CD content, OFS provided a higher accuracy than TWC, which resulted in a slight over-determination. As a comparison, single-wavelength colorimetry performed at the corresponding absorption maximum led to a significant over-determination of both amylose and LR-CD contents. The validity of TWC and OFS allowed their application for discriminative detection of the cyclization and total activity of a 4-α-glucanotransferase (4 αGTase) from Thermus aquaticus regarding the synthesis of LR-CDs and the conversion of amylose to small molecules, respectively. High pressure size exclusion chromatography analysis of the post-reaction mixtures following 4 αGTase-catalyzed conversion of amylose revealed the presence of linear malto-oligosaccharides in the LR-CD fraction. By introduction of a correction factor, the interference caused by linear malto-oligosaccharides was eliminated for a more accurate determination of LR-CD cyclization activity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Purification and Characterization of a Novel Thermo-Alkali-Stable Catalase from Thermus brockianus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thompson, Vicki Sue; Schaller, Kastli Dianne; Apel, William Arnold
2003-10-01
A novel thermo-alkali-stable catalase from Thermus brockianus was purified and characterized. The protein was purified from a T. brockianus cell extract in a three-step procedure that resulted in 65-fold purification to a specific activity of 5300 U/mg. The enzyme consisted of four identical subunits of 42.5 kDa as determined by SDS-PAGE and a total molecular mass measured by gel filtration of 178 kDa. The catalase was active over a temperature range from 30 to 94 C and a pH range from 6 to 10, with optimum activity occurring at 90 C and pH 8. At pH 8, the enzyme wasmore » extremely stable at elevated temperatures with half-lives of 330 h at 80 C and 3 h at 90 C. The enzyme also demonstrated excellent stability at 70 C and alkaline pH with measured half-lives of 510 h and 360 h at pHs of 9 and 10, respectively. The enzyme had an unusual pyridine hemochrome spectrum and appears to utilize eight molecules of heme c per tetramer rather than protoheme IX present in the majority of catalases studied to date. The absorption spectrum suggested that the heme iron of the catalase was in a 6-coordinate low spin state rather than the typical 5-coordinate high spin state. A Km of 35.5 mM and a Vmax of 20.3 mM/min·mg protein for hydrogen peroxide was measured, and the enzyme was not inhibited by hydrogen peroxide at concentrations up to 450 mM. The enzyme was strongly inhibited by cyanide and the traditional catalase inhibitor 3-amino-1,2,4-triazole. The enzyme also showed no peroxidase activity to peroxidase substrates o-dianisidine and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), a trait of typical monofunctional catalases. However, unlike traditional monofunctional catalases, the T. brockianus catalase was easily reduced by dithionite, a characteristic of catalase-peroxidases. The above properties indicate that this catalase has potential for applications in industrial bleaching processes to remove residual hydrogen peroxide from process streams.« less
Krefft, Daria; Papkov, Aliaksei; Zylicz-Stachula, Agnieszka; Skowron, Piotr M
2017-01-01
Obtaining thermostable enzymes (thermozymes) is an important aspect of biotechnology. As thermophiles have adapted their genomes to high temperatures, their cloned genes' expression in mesophiles is problematic. This is mainly due to their high GC content, which leads to the formation of unfavorable secondary mRNA structures and codon usage in Escherichia coli (E. coli). RM.TthHB27I is a member of a family of bifunctional thermozymes, containing a restriction endonuclease (REase) and a methyltransferase (MTase) in a single polypeptide. Thermus thermophilus HB27 (T. thermophilus) produces low amounts of RM.TthHB27I with a unique DNA cleavage specificity. We have previously cloned the wild type (wt) gene into E. coli, which increased the production of RM.TthHB27I over 100-fold. However, its enzymatic activities were extremely low for an ORF expressed under a T7 promoter. We have designed and cloned a fully synthetic tthHB27IRM gene, using a modified 'codon randomization' strategy. Codons with a high GC content and of low occurrence in E. coli were eliminated. We incorporated a stem-loop circuit, devised to negatively control the expression of this highly toxic gene by partially hiding the ribosome-binding site (RBS) and START codon in mRNA secondary structures. Despite having optimized 59% of codons, the amount of produced RM.TthHB27I protein was similar for both recombinant tthHB27IRM gene variants. Moreover, the recombinant wt RM.TthHB27I is very unstable, while the RM.TthHB27I resulting from the expression of the synthetic gene exhibited enzymatic activities and stability equal to the native thermozyme isolated from T. thermophilus. Thus, we have developed an efficient purification protocol using the synthetic tthHB27IRM gene variant only. This suggests the effect of co-translational folding kinetics, possibly affected by the frequency of translational errors. The availability of active RM.TthHB27I is of practical importance in molecular biotechnology, extending the palette of available REase specificities.
Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; De Stefano, Luca
2016-10-01
Water sources pollution by arsenic ions is a serious environmental problem all around the world. Arsenate reductase enzyme (TtArsC) from Thermus thermophilus extremophile bacterium, naturally binds arsenic ions, As(V) and As (III), in aqueous solutions. In this research, TtArsC enzyme adsorption onto hybrid polyethylene glycol-stabilized gold nanoparticles (AuNPs) was studied at different pH values as an innovative nanobiosystem for metal concentration monitoring. Characterizations were performed by UV/Vis and circular dichroism spectroscopies, TEM images and in terms of surface charge changes. The molecular interaction between arsenic ions and the TtArsC-AuNPs nanobiosystem was also monitored at all pH values considered by UV/Vis spectroscopy. Tests performed revealed high sensitivities and limits of detection equal to 10 ± 3 M -12 and 7.7 ± 0.3 M -12 for As(III) and As(V), respectively. © 2016 The Author(s).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, En -Min; Murugapiran, Senthil K.; Mefferd, Chrisabelle C.
Thermus amyloliquefaciens type strain YIM 77409 T is a thermophilic, Gram-negative, non-motile and rod-shaped bacterium isolated from Niujie Hot Spring in Eryuan County, Yunnan Province, southwest China. In the present study we describe the features of strain YIM 77409 T together with its genome sequence and annotation. The genome is 2,160,855 bp long and consists of 6 scaffolds with 67.4 % average GC content. A total of 2,313 genes were predicted, comprising 2,257 protein-coding and 56 RNA genes. The genome is predicted to encode a complete glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle. Additionally, a large number of transportersmore » and enzymes for heterotrophy highlight the broad heterotrophic lifestyle of this organism. Furthermore, a denitrification gene cluster included genes predicted to encode enzymes for the sequential reduction of nitrate to nitrous oxide, consistent with the incomplete denitrification phenotype of this strain.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Yuzo; Yanai, Hisaaki; Kanagawa, Mayumi
2016-07-27
The crystal structures of a subunit of the formylglycinamide ribonucleotide amidotransferase, PurS, fromThermus thermophilus,Sulfolobus tokodaiiandMethanocaldococcus jannaschiiwere determined and their structural characteristics were analyzed. For PurS fromT. thermophilus, two structures were determined using two crystals that were grown in different conditions. The four structures in the dimeric form were almost identical to one another despite their relatively low sequence identities. This is also true for all PurS structures determined to date. A few residues were conserved among PurSs and these are located at the interaction site with PurL and PurQ, the other subunits of the formylglycinamide ribonucleotide amidotransferase. Molecular-dynamics simulations ofmore » the PurS dimer as well as a model of the complex of the PurS dimer, PurL and PurQ suggest that PurS plays some role in the catalysis of the enzyme by its bending motion.« less
Zhou, En -Min; Murugapiran, Senthil K.; Mefferd, Chrisabelle C.; ...
2016-02-27
Thermus amyloliquefaciens type strain YIM 77409 T is a thermophilic, Gram-negative, non-motile and rod-shaped bacterium isolated from Niujie Hot Spring in Eryuan County, Yunnan Province, southwest China. In the present study we describe the features of strain YIM 77409 T together with its genome sequence and annotation. The genome is 2,160,855 bp long and consists of 6 scaffolds with 67.4 % average GC content. A total of 2,313 genes were predicted, comprising 2,257 protein-coding and 56 RNA genes. The genome is predicted to encode a complete glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle. Additionally, a large number of transportersmore » and enzymes for heterotrophy highlight the broad heterotrophic lifestyle of this organism. Furthermore, a denitrification gene cluster included genes predicted to encode enzymes for the sequential reduction of nitrate to nitrous oxide, consistent with the incomplete denitrification phenotype of this strain.« less
Kumwenda, Benjamin; Litthauer, Derek; Bishop, Özlem Tastan; Reva, Oleg
2013-01-01
Elucidation of evolutionary factors that enhance protein thermostability is a critical problem and was the focus of this work on Thermus species. Pairs of orthologous sequences of T. scotoductus SA-01 and T. thermophilus HB27, with the largest negative minimum folding energy (MFE) as predicted by the UNAFold algorithm, were statistically analyzed. Favored substitutions of amino acids residues and their properties were determined. Substitutions were analyzed in modeled protein structures to determine their locations and contribution to energy differences using PyMOL and FoldX programs respectively. Dominant trends in amino acid substitutions consistent with differences in thermostability between orthologous sequences were observed. T. thermophilus thermophilic proteins showed an increase in non-polar, tiny, and charged amino acids. An abundance of alanine substituted by serine and threonine, as well as arginine substituted by glutamine and lysine was observed in T. thermophilus HB27. Structural comparison showed that stabilizing mutations occurred on surfaces and loops in protein structures. PMID:24023508
Structure of caa(3) cytochrome c oxidase--a nature-made enzyme-substrate complex.
Noor, Mohamed Radzi; Soulimane, Tewfik
2013-05-01
Aerobic respiration, the energetically most favorable metabolic reaction, depends on the action of terminal oxidases that include cytochrome c oxidases. The latter forms a part of the heme-copper oxidase superfamily and consists of three different families (A, B, and C types). The crystal structures of all families have now been determined, allowing a detailed structural comparison from evolutionary and functional perspectives. The A2-type oxidase, exemplified by the Thermus thermophilus caa(3) oxidase, contains the substrate cytochrome c covalently bound to the enzyme complex. In this article, we highlight the various features of caa(3) enzyme and provide a discussion of their importance, including the variations in the proton and electron transfer pathways.
Mulepati, Sabin; Bailey, Scott
2011-09-09
RNA transcribed from clustered regularly interspaced short palindromic repeats (CRISPRs) protects many prokaryotes from invasion by foreign DNA such as viruses, conjugative plasmids, and transposable elements. Cas3 (CRISPR-associated protein 3) is essential for this CRISPR protection and is thought to mediate cleavage of the foreign DNA through its N-terminal histidine-aspartate (HD) domain. We report here the 1.8 Å crystal structure of the HD domain of Cas3 from Thermus thermophilus HB8. Structural and biochemical studies predict that this enzyme binds two metal ions at its active site. We also demonstrate that the single-stranded DNA endonuclease activity of this T. thermophilus domain is activated not by magnesium but by transition metal ions such as manganese and nickel. Structure-guided mutagenesis confirms the importance of the metal-binding residues for the nuclease activity and identifies other active site residues. Overall, these results provide a framework for understanding the role of Cas3 in the CRISPR system.
Kim, Tae-Jip; Kim, Myo-Jeong; Kim, Byung-Cheon; Kim, Jae-Cherl; Cheong, Tae-Kyou; Kim, Jung-Wan; Park, Kwan-Hwa
1999-01-01
A maltogenic amylase gene was cloned in Escherichia coli from a gram-negative thermophilic bacterium, Thermus strain IM6501. The gene encoded an enzyme (ThMA) with a molecular mass of 68 kDa which was expressed by the expression vector p6xHis119. The optimal temperature of ThMA was 60°C, which was higher than those of other maltogenic amylases reported so far. Thermal inactivation kinetic analysis of ThMA indicated that it was stabilized in the presence of 10 mM EDTA. ThMA harbored both hydrolysis and transglycosylation activities. It hydrolyzed β-cyclodextrin and starch mainly to maltose and pullulan to panose. ThMA not only hydrolyzed acarbose, an amylase inhibitor, to glucose and pseudotrisaccharide (PTS) but also transferred PTS to 17 sugar acceptors, including glucose, fructose, maltose, cellobiose, etc. Structural analysis of acarbose transfer products by using methylation, thin-layer chromatography, high-performance ion chromatography, and nuclear magnetic resonance indicated that PTS was transferred primarily to the C-6 of the acceptors and at lower degrees to the C-3 and/or C-4. The transglycosylation of sugar to methyl-α-d-glucopyranoside by forming an α-(1,3)-glycosidic linkage was demonstrated for the first time by using acarbose and ThMA. Kinetic analysis of the acarbose transfer products showed that the C-4 transfer product formed most rapidly but readily hydrolyzed, while the C-6 transfer product was stable and accumulated in the reaction mixture as the main product. PMID:10103262
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thoden, James B.; Holden, Hazel M.
2011-12-22
The unusual sugar 2,3-diacetamido-2,3-dideoxy-d-mannuronic acid, or ManNAc3NAcA, has been observed in the lipopolysaccharides of both pathogenic and nonpathogenic Gram-negative bacteria. It is added to the lipopolysaccharides of these organisms by glycosyltransferases that use as substrates UDP-ManNAc3NAcA. Five enzymes are ultimately required for the biosynthesis of UDP-ManNAc3NAcA starting from UDP-N-acetylglucosamine. The second enzyme in the pathway, encoded by the wlba gene and referred to as WlbA, catalyzes the NAD-dependent oxidation of the C-3' hydroxyl group of the UDP-linked sugar. Here we describe a combined structural and functional investigation of the WlbA enzymes from Bordetella pertussis and Chromobacterium violaceum. For this investigation,more » ternary structures were determined in the presence of NAD(H) and substrate to 2.13 and 1.5 {angstrom} resolution, respectively. Both of the enzymes display octameric quaternary structures with their active sites positioned far apart. The octamers can be envisioned as tetramers of dimers. Kinetic studies demonstrate that the reaction mechanisms for these enzymes are sequential and that they do not require {alpha}-ketoglutarate for activity. These results are in sharp contrast to those recently reported for the WlbA enzymes from Pseudomonas aeruginosa and Thermus thermophilus, which function via ping-pong mechanisms that involve {alpha}-ketoglutarate. Taken together, the results reported here demonstrate that there are two distinct families of WlbA enzymes, which differ with respect to amino acid sequences, quaternary structures, active site architectures, and kinetic mechanisms.« less
Thoden, James B.; Holden, Hazel M.
2011-01-01
The unusual sugar 2,3-diacetamido-2,3-dideoxy-d-mannuronic acid, or ManNAc3NAcA1, has been observed in the lipopolysaccharides of both pathogenic and nonpathogenic Gram-negative bacteria. It is added to the lipopolysaccharides of these organisms by glycosyltransferases that use as substrates, UDP-ManNAc3NAcA. Five enzymes are ultimately required for the biosynthesis of UDP-ManNAc3NAcA starting from UDP-N-acetylglucosamine. The second enzyme in the pathway, encoded by the wlba gene and referred to as WlbA, catalyzes the NAD-dependent oxidation of the C-3' hydroxyl group of the UDP-linked sugar. Here we describe a combined structural and functional investigation of the WlbA enzymes from Bordetella pertussis and Chromobacterium violaceum. For this investigation, ternary structures were determined in the presence of NAD(H) and substrate to 2.13 Å and 1.5 Å resolution, respectively. Both of the enzymes display octameric quaternary structures with their active sites positioned far apart. The octamers can be envisioned as tetramers of dimers. Kinetic studies demonstrate that the reaction mechanisms for these enzymes are sequential and that they do not require α-ketoglutarate for activity. These results are in sharp contrast to those recently reported for the WlbA enzymes from Pseudomonas aeruginosa and Thermus thermophilus, which function via ping-pong mechanisms that involve α-ketoglutarate. Taken together the results reported here demonstrate that there are two distinct families of WlbA enzymes, which differ with respect to amino acid sequences, quaternary structures, active site architectures, and kinetic mechanisms. PMID:21241053
Chatelle, Claire; Ochoa-Fernandez, Rocio; Engesser, Raphael; Schneider, Nils; Beyer, Hannes M; Jones, Alex R; Timmer, Jens; Zurbriggen, Matias D; Weber, Wilfried
2018-05-18
The ever-increasing complexity of synthetic gene networks and applications of synthetic biology requires precise and orthogonal gene expression systems. Of particular interest are systems responsive to light as they enable the control of gene expression dynamics with unprecedented resolution in space and time. While broadly used in mammalian backgrounds, however, optogenetic approaches in plant cells are still limited due to interference of the activating light with endogenous photoreceptors. Here, we describe the development of the first synthetic light-responsive system for the targeted control of gene expression in mammalian and plant cells that responds to the green range of the light spectrum in which plant photoreceptors have minimal activity. We first engineered a system based on the light-sensitive bacterial transcription factor CarH and its cognate DNA operator sequence CarO from Thermus thermophilus to control gene expression in mammalian cells. The system was functional in various mammalian cell lines, showing high induction (up to 350-fold) along with low leakiness, as well as high reversibility. We quantitatively described the systems characteristics by the development and experimental validation of a mathematical model. Finally, we transferred the system into A. thaliana protoplasts and demonstrated gene repression in response to green light. We expect that this system will provide new opportunities in applications based on synthetic gene networks and will open up perspectives for optogenetic studies in mammalian and plant cells.
López-López, Olalla; Knapik, Kamila; Cerdán, Maria-Esperanza; González-Siso, María-Isabel
2015-01-01
A fosmid library was constructed with the metagenomic DNA from the water of the Lobios hot spring (76°C, pH = 8.2) located in Ourense (Spain). Metagenomic sequencing of the fosmid library allowed the assembly of 9722 contigs ranging in size from 500 to 56,677 bp and spanning ~18 Mbp. 23,207 ORFs (Open Reading Frames) were predicted from the assembly. Biodiversity was explored by taxonomic classification and it revealed that bacteria were predominant, while the archaea were less abundant. The six most abundant bacterial phyla were Deinococcus-Thermus, Proteobacteria, Firmicutes, Acidobacteria, Aquificae, and Chloroflexi. Within the archaeal superkingdom, the phylum Thaumarchaeota was predominant with the dominant species "Candidatus Caldiarchaeum subterraneum." Functional classification revealed the genes associated to one-carbon metabolism as the most abundant. Both taxonomic and functional classifications showed a mixture of different microbial metabolic patterns: aerobic and anaerobic, chemoorganotrophic and chemolithotrophic, autotrophic and heterotrophic. Remarkably, the presence of genes encoding enzymes with potential biotechnological interest, such as xylanases, galactosidases, proteases, and lipases, was also revealed in the metagenomic library. Functional screening of this library was subsequently done looking for genes encoding lipolytic enzymes. Six genes conferring lipolytic activity were identified and one was cloned and characterized. This gene was named LOB4Est and it was expressed in a yeast mesophilic host. LOB4Est codes for a novel esterase of family VIII, with sequence similarity to β-lactamases, but with unusual wide substrate specificity. When the enzyme was purified from the mesophilic host it showed half-life of 1 h and 43 min at 50°C, and maximal activity at 40°C and pH 7.5 with p-nitrophenyl-laurate as substrate. Interestingly, the enzyme retained more than 80% of maximal activity in a broad range of pH from 6.5 to 8.
NASA Astrophysics Data System (ADS)
Powers, Nathan Lee
2008-10-01
The [Fe2S2]2+/[Fe2S 2]+ electronic structure of seven Rieske protein active sites (bovine mitochondrial cytochrome bc1 complex, spinach chloroplast cytochrome b6f complex, Rieske-type ferredoxin associated with biphenyl dioxygenase from Burkholderia cepacia, yeast cytochrome bcl complex from Saccharomyces cerevisiae, Rieske subunit of arsenite oxidase from Alcaligenes faecalis, respiratory-type Rieske protein from Thermus thermophilus, and Rieske protein II (soxF) from Sulfolobus acidocaldarius), which lie in a reduction potential range from -150 mV to 375 mV, have been studied by both single and multi-determinant quantum mechanical methods. Calculated reduction potentials and magnetic properties are found comparable to experimental values.
Cheng, Maria; Yoshiyasu, Hayato; Okano, Kenji; Ohtake, Hisao; Honda, Kohsuke
2016-01-01
Acetolactate synthase and pyruvate decarboxylase are thiamine pyrophosphate-dependent enzymes that convert pyruvate into acetolactate and acetaldehyde, respectively. Although the former are encoded in the genomes of many thermophiles and hyperthermophiles, the latter has been found only in mesophilic organisms. In this study, the reaction specificity of acetolactate synthase from Thermus thermophilus was redirected to catalyze acetaldehyde formation to develop a thermophilic pyruvate decarboxylase. Error-prone PCR and mutant library screening led to the identification of a quadruple mutant with 3.1-fold higher acetaldehyde-forming activity than the wild-type. Site-directed mutagenesis experiments revealed that the increased activity of the mutant was due to H474R amino acid substitution, which likely generated two new hydrogen bonds near the thiamine pyrophosphate-binding site. These hydrogen bonds might result in the better accessibility of H+ to the substrate-cofactor-enzyme intermediate and a shift in the reaction specificity of the enzyme. PMID:26731734
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Surerus, K K; Oertling, W A; Fan, C; Gurbiel, R J; Einarsdóttir, O; Antholine, W E; Dyer, R B; Hoffman, B M; Woodruff, W H; Fee, J A
1992-01-01
Cytochrome ba3 from Thermus thermophilus reacts slowly with excess HCN at pH 7.4 to create a form of the enzyme in which CuA, cytochrome b, and CuB remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. We have examined this form of the enzyme by UV-visible, resonance Raman, EPR, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13C- and 15N-labeled cyanide. The results support a model in which one CN- binds through the carbon atom to ferrous a3, supporting a low-spin (S = 0) configuration on the Fe; bridging by this cyanide to the CuB is weak or absent. Four 14N atoms, presumably donated by histidine residues of the protein, provide a strong equatorial ligand field about CuB; a second CN- is coordinated through the carbon atom to CuB in an axial position. PMID:1314380
Furuike, Shou; Nakano, Masahiro; Adachi, Kengo; Noji, Hiroyuki; Kinosita, Kazuhiko; Yokoyama, Ken
2011-01-01
Vacuole-type ATPases (VoV1) and FoF1 ATP synthases couple ATP hydrolysis/synthesis in the soluble V1 or F1 portion with proton (or Na+) flow in the membrane-embedded Vo or Fo portion through rotation of one common shaft. Here we show at submillisecond resolutions the ATP-driven rotation of isolated V1 and the whole VoV1 from Thermus thermophilus, by attaching a 40-nm gold bead for which viscous drag is almost negligible. V1 made 120° steps, commensurate with the presence of three catalytic sites. Dwells between the steps involved at least two events other than ATP binding, one likely to be ATP hydrolysis. VoV1 exhibited 12 dwell positions per revolution, consistent with the 12-fold symmetry of the Vo rotor in T. thermophilus. Unlike F1 that undergoes 80°–40° substepping, chemo-mechanical checkpoints in isolated V1 are all at the ATP-waiting position, and Vo adds further bumps through stator–rotor interactions outside and remote from V1. PMID:21407199
Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki
2006-01-01
Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489
Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying
2015-01-01
Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.
Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying
2015-01-01
Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466
The Effect of Different Oceanic Abiotic Factors on Prokaryotic Body Sizes
NASA Astrophysics Data System (ADS)
Pidathala, S.; Bellon, M.; Heim, N.; Payne, J.
2016-12-01
We are studying the impact of abiotic factors in the Pacific and Atlantic on prokaryotic body sizes and genome sizes because we are interested in the manner in which abiotic factors influence genome sizes independent of their influence on body sizes. Some research has been done in the past on marine bacterial evolution, including data collection on marine ecology in relation to bacterial body sizes (Straza 2009). We are using the abiotic factors: temperature, salinity, and pH to compare the biovolumes/genome sizes of different phyla by using R. We made 9 scatter plots to model these relationships. Regardless of the phyla or the ocean, we found that there is no relation between pH, temperature, and body size, with several exceptions: Deinococcus. thermus has an indirect relationship with size in respect to temperature; size only correlates to temperature for phyla that are thermophiles. We also found that bacteria like D. thermus and Thermotogae are taxa only found in higher temperatures. Additionally, almost all phyla have genome sizes restricted by certain pH levels:, Proteobacteria only reach genomes with acidity levels greater than 6. In terms of salinity levels, certain bacteria are only found within a small range, and others, like Proteobacteria, can only reach genomes at low salinity levels. Finally, Proteobacteria have large genome sizes between 30 and 40 °, and Crenarchaeota have constant genome sizes in higher temperatures. Conclusively, we discovered that these abiotic factors generally do not affect body size, with the exception of D. thermus' indirect relationship to temperature due to its small biovolume in high temperatures. However, we determined that these abiotic factors have a great impact on genome sizes. This is due to genome size independence from body size. Also, genome size could have served as an adaptive feature for bacteria in marine environments, explaining why different phyla may have diverged to accommodate their lifestyles.
Du, Wen-Ge Han; Noodleman, Louis
2013-12-16
Strong electron density for a peroxide type dioxygen species bridging the Fea3 and CuB dinuclear center (DNC) was observed in the high-resolution (1.8 Å) X-ray crystal structures (PDB entries 3S8G and 3S8F) of ba3 cytochrome c oxidase (CcO) from Thermus thermophilus. The crystals represent the as-isolated X-ray photoreduced CcO structures. The bridging peroxide was proposed to arise from the recombination of two radiation-produced HO(•) radicals formed either very near to or even in the space between the two metals of the DNC. It is unclear whether this peroxide species is in the O2(2-), O2(•)(-), HO2(-), or the H2O2 form and what is the detailed electronic structure and binding geometry including the DNC. In order to answer what form of this dioxygen species was observed in the DNC of the 1.8 Å X-ray CcO crystal structure (3S8G), we have applied broken-symmetry density functional theory (BS-DFT) geometric and energetic calculations (using OLYP potential) on large DNC cluster models with different Fea3-CuB oxidation and spin states and with O2(2-), O2(•)(-), HO2(-), or H2O2 in the bridging position. By comparing the DFT optimized geometries with the X-ray crystal structure (3S8G), we propose that the bridging peroxide is HO2(-). The X-ray crystal structure is likely to represent the superposition of the Fea3(2+)-(HO2(-))-CuB(+) DNC's in different states (Fe(2+) in low spin (LS), intermediate spin (IS), or high spin (HS)) with the majority species having the proton of the HO2(-) residing on the oxygen atom (O1) which is closer to the Fea3(2+) site in the Fea3(2+)-(HO-O)(-)-CuB(+) conformation. Our calculations show that the side chain of Tyr237 is likely trapped in the deprotonated Tyr237(-) anion form in the 3S8G X-ray crystal structure.
Okochi, Mina; Matsuzaki, Hiroki; Nomura, Tomoko; Ishii, Noriyuki; Yohda, Masafumi
2005-04-01
The group II chaperonin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 (PhCPN) and its functional cooperation with the cognate prefoldin were investigated. PhCPN existed as a homo-oligomer in a double-ring structure, which protected the citrate synthase of a porcine heart from thermal aggregation at 45 degrees C, and did the same on the isopropylmalate dehydrogenase (IPMDH) of a thermophilic bacterium, Thermus thermophilus HB8, at 90 degrees C. PhCPN also enhanced the refolding of green fluorescent protein (GFP), which had been unfolded by low pH, in an ATP-dependent manner. Unexpectedly, functional cooperation between PhCPN and Pyrococcus prefoldin (PhPFD) in the refolding of GFP was not observed. Instead, cooperation between PhCPN and PhPFD was observed in the refolding of IPMDH unfolded with guanidine hydrochloride. Although PhCPN alone was not effective in the refolding of IPMDH, the refolding efficiency was enhanced by the cooperation of PhCPN with PhPFD.
Acoustic vibrations contribute to the diffuse scatter produced by ribosome crystals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Polikanov, Yury S.; Moore, Peter B.
2015-09-26
The diffuse scattering pattern produced by frozen crystals of the 70S ribosome fromThermus thermophilusis as highly structured as it would be if it resulted entirely from domain-scale motions within these particles. However, the qualitative properties of the scattering pattern suggest that acoustic displacements of the crystal lattice make a major contribution to it.
ERIC Educational Resources Information Center
Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.
2010-01-01
We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simonetti, Angelita; Marzi, Stefano; Fabbretti, Attilio
2013-06-01
The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2more » is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Evdokimov, Artem G.; Mekel, Marlene; Hutchings, Kim
2008-07-08
In this article, we describe for the first time the high-resolution crystal structure of a phenylalanine tRNA synthetase from the pathogenic bacterium Staphylococcus haemolyticus. We demonstrate the subtle yet important structural differences between this enzyme and the previously described Thermus thermophilus ortholog. We also explain the structure-activity relationship of several recently reported inhibitors. The native enzyme crystals were of poor quality -- they only diffracted X-rays to 3--5 {angstrom} resolution. Therefore, we have executed a rational surface mutagenesis strategy that has yielded crystals of this 2300-amino acid multidomain protein, diffracting to 2 {angstrom} or better. This methodology is discussed andmore » contrasted with the more traditional domain truncation approach.« less
Nakamura, Akira; Takakura, Yasuaki; Sugimoto, Naohisa; Takaya, Naoki; Shiraki, Kentaro; Hoshino, Takayuki
2008-09-01
An Escherichia coli hygromycin B phosphotransferase (HPH) and its thermostabilized mutant protein, HPH5, containing five amino acid substitutions, D20G, A118V, S225P, Q226L, and T246A (Nakamura et al., J. Biosci. Bioeng., 100, 158-163 (2005)), obtained by an in vivo directed evolution procedure in Thermus thermophilus, were produced and purified from E. coli recombinants, and enzymatic comparisons were performed. The optimum temperatures for enzyme activity were 50 and 55 degrees C for HPH and HPH5 respectively, but the thermal stability of the enzyme activity and the temperature for protein denaturation of HPH5 increased, from 36 and 37.2 degrees C of HPH to 53 and 58.8 degrees C respectively. Specific activities and steady-state kinetics measured at 25 degrees C showed only slight differences between the two enzymes. From these results we concluded that HPH5 was thermostabilized at the protein level, and that the mutations introduced did not affect its enzyme activity, at least under the assay conditions.
Tsukamoto, Takashi; Inoue, Keiichi; Kandori, Hideki; Sudo, Yuki
2013-01-01
So far retinylidene proteins (∼rhodopsin) have not been discovered in thermophilic organisms. In this study we investigated and characterized a microbial rhodopsin derived from the extreme thermophilic bacterium Thermus thermophilus, which lives in a hot spring at around 75 °C. The gene for the retinylidene protein, named thermophilic rhodopsin (TR), was chemically synthesized with codon optimization. The codon optimized TR protein was functionally expressed in the cell membranes of Escherichia coli cells and showed active proton transport upon photoillumination. Spectroscopic measurements revealed that the purified TR bound only all-trans-retinal as a chromophore and showed an absorption maximum at 530 nm. In addition, TR exhibited both photocycle kinetics and pH-dependent absorption changes, which are characteristic of rhodopsins. Of note, time-dependent thermal denaturation experiments revealed that TR maintained its absorption even at 75 °C, and the denaturation rate constant of TR was much lower than those of other proton pumping rhodopsins such as archaerhodopsin-3 (200 ×), Haloquadratum walsbyi bacteriorhodopsin (by 10-times), and Gloeobacter rhodopsin (100 ×). Thus, these results suggest that microbial rhodopsins are also distributed among thermophilic organisms and have high stability. TR should allow the investigation of the molecular mechanisms of ion transport and protein folding. PMID:23740255
Tsukamoto, Takashi; Inoue, Keiichi; Kandori, Hideki; Sudo, Yuki
2013-07-26
So far retinylidene proteins (∼rhodopsin) have not been discovered in thermophilic organisms. In this study we investigated and characterized a microbial rhodopsin derived from the extreme thermophilic bacterium Thermus thermophilus, which lives in a hot spring at around 75 °C. The gene for the retinylidene protein, named thermophilic rhodopsin (TR), was chemically synthesized with codon optimization. The codon optimized TR protein was functionally expressed in the cell membranes of Escherichia coli cells and showed active proton transport upon photoillumination. Spectroscopic measurements revealed that the purified TR bound only all-trans-retinal as a chromophore and showed an absorption maximum at 530 nm. In addition, TR exhibited both photocycle kinetics and pH-dependent absorption changes, which are characteristic of rhodopsins. Of note, time-dependent thermal denaturation experiments revealed that TR maintained its absorption even at 75 °C, and the denaturation rate constant of TR was much lower than those of other proton pumping rhodopsins such as archaerhodopsin-3 (200 ×), Haloquadratum walsbyi bacteriorhodopsin (by 10-times), and Gloeobacter rhodopsin (100 ×). Thus, these results suggest that microbial rhodopsins are also distributed among thermophilic organisms and have high stability. TR should allow the investigation of the molecular mechanisms of ion transport and protein folding.
Pathak, Ashish; Green, Stefan J.; Joshi, Amit; Chauhan, Ashvini
2015-01-01
Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat. PMID:25700403
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.
Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I
2016-01-01
We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.
Peeters, Karolien; Ertz, Damien; Willems, Anne
2011-07-01
We studied the culturable heterotrophic bacterial diversity present at the site of the new Princess Elisabeth Station at Utsteinen (Dronning Maud Land, East Antarctica) before construction. About 800 isolates were picked from two terrestrial microbial mat samples after incubation on several growth media at different temperatures. They were grouped using rep-PCR fingerprinting and partial 16S rRNA gene sequencing. Phylogenetic analysis of the complete 16S rRNA gene sequences of 93 representatives showed that the isolates belonged to five major phyla: Actinobacteria, Bacteroidetes, Proteobacteria, Firmicutes and Deinococcus-Thermus. Isolates related to the genus Arthrobacter were the most prevalent whereas the genera Hymenobacter, Deinococcus, Cryobacterium and Sphingomonas were also recovered in high numbers in both samples. A total of 35 different genera were found, the majority of which has previously been reported from Antarctica. For the genera Aeromicrobium, Aurantimonas, Rothia, Subtercola, Tessaracoccus and Xylophilus, this is the first report in Antarctica. In addition, numerous potential new species and new genera were recovered; many of them currently restricted to Antarctica, particularly in the phyla Bacteroidetes and Deinococcus-Thermus. Copyright © 2011 Elsevier GmbH. All rights reserved.
Beerens, Koen; Soetaert, Wim; Desmet, Tom
2013-09-01
UDP-hexose 4-epimerases are important enzymes that play key roles in various biological pathways, including lipopolysaccharide biosynthesis, galactose metabolism through the Leloir pathway, and biofilm formation. Unfortunately, the determinants of their substrate specificity are not yet fully understood. They can be classified into three groups, with groups 1 and 3 preferring non-acetylated and acetylated UDP-hexoses, respectively, whereas members of group 2 are equally active on both types of substrates. In this study, the UDP-Glc(NAc) 4-epimerase from Marinithermus hydrothermalis (mGalE) was functionally expressed in Escherichia coli and thoroughly characterized. The enzyme was found to be thermostable, displaying its highest activity at 70 °C and having a half-life of 23 min at 60 °C. Activity could be detected on both acetylated and non-acetylated UDP-hexoses, meaning that this epimerase belongs to group 2. This observation correlates well with the identity of the so-called "gatekeeper" residue (Ser279), which has previously been suggested to influence substrate specificity (Schulz et al., J Biol Chem 279:32796-32803, 2004). Furthermore, substituting this serine to a tyrosine brings about a significant preference for non-acetylated sugars, thereby demonstrating that a single residue can determine substrate specificity among type 1 and type 2 epimerases. In addition, two consecutive glycine residues (Gly118 and Gly119) were identified as a unique feature of GalE enzymes from Thermus species, and their importance for activity as well as affinity was confirmed by mutagenesis. Finally, homology modeling and mutational analysis has revealed that the enzyme's catalytic triad contains a threonine residue (Thr117) instead of the usual serine.
Dutta, Saheb; Kundu, Soumya; Saha, Amrita; Nandi, Nilashis
2018-03-01
Aminoacylation reaction is the first step of protein biosynthesis. The catalytic reorganization at the active site of aminoacyl tRNA synthetases (aaRSs) is driven by the loop motions. There remain lacunae of understanding concerning the catalytic loop dynamics in aaRSs. We analyzed the functional loop dynamics in seryl tRNA synthetase from Methanopyrus kandleri ( mk SerRS) and histidyl tRNA synthetases from Thermus thermophilus ( tt HisRS), respectively, using molecular dynamics. Results confirm that the motif 2 loop and other active site loops are flexible spots within the catalytic domain. Catalytic residues of the loops form a network of interaction with the substrates to form a reactive state. The loops undergo transitions between closed state and open state and the relaxation of the constituent residues occurs in femtosecond to nanosecond time scale. Order parameters are higher for constituent catalytic residues which form a specific network of interaction with the substrates to form a reactive state compared to the Gly residues within the loop. The development of interaction is supported from mutation studies where the catalytic domain with mutated loop exhibits unfavorable binding energy with the substrates. During the open-close motion of the loops, the catalytic residues make relaxation by ultrafast librational motion as well as fast diffusive motion and subsequently relax rather slowly via slower diffusive motion. The Gly residues act as a hinge to facilitate the loop closing and opening by their faster relaxation behavior. The role of bound water is analyzed by comparing implicit solvent-based and explicit solvent-based simulations. Loops fail to form catalytically competent geometry in absence of water. The present result, for the first time reveals the nature of the active site loop dynamics in aaRS and their influence on catalysis.
Autonomous generation and loading of DNA guides by bacterial Argonaute
Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John
2018-01-01
Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506
Presence of Thermophilic Bacteria in Laundry and Domestic Hot-Water Heaters
Brock, Thomas D.; Boylen, Kathryn L.
1973-01-01
Thermophilic bacteria resembling Thermus aquaticus were isolated from hot water taken from domestic and commercial hot-water tanks. Cold water from the same locations never yielded thermophilic bacteria, suggesting that the bacteria were growing in the tanks. In contrast to the T. aquaticus isolates from hot springs, the present isolates were rarely pigmented. In general, the hotter sources more frequently yielded bacteria. PMID:4568892
Iwamoto, Seishi; Motomura, Kei; Shinoda, Yasuharu; Urata, Masaaki; Kato, Junichi; Takiguchi, Noboru; Ohtake, Hisao; Hirota, Ryuichi; Kuroda, Akio
2007-01-01
Heat-treated Escherichia coli producing Thermus polyphosphate kinase regenerated ATP by using exogenous polyphosphate. This recombinant could be used as a platform to produce valuable compounds in combination with thermostable phosphorylating or energy-requiring enzymes. In this work, we demonstrated the production of fructose 1,6-diphosphate from fructose and polyphosphate. PMID:17616610
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yanli; Sheng, Gang; Juranek, Stefan
The slicer activity of the RNA-induced silencing complex is associated with argonaute, the RNase H-like PIWI domain of which catalyses guide-strand-mediated sequence-specific cleavage of target messenger RNA. Here we report on the crystal structure of Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-base DNA guide strand, thereby identifying the nucleic-acid-binding channel positioned between the PAZ- and PIWI-containing lobes, as well as the pivot-like conformational changes associated with complex formation. The bound guide strand is anchored at both of its ends, with the solvent-exposed Watson-Crick edges of stacked bases 2 to 6 positioned for nucleation with the mRNA target, whereas twomore » critically positioned arginines lock bases 10 and 11 at the cleavage site into an unanticipated orthogonal alignment. Biochemical studies indicate that key amino acid residues at the active site and those lining the 5'-phosphate-binding pocket made up of the Mid domain are critical for cleavage activity, whereas alterations of residues lining the 2-nucleotide 3'-end-binding pocket made up of the PAZ domain show little effect.« less
Modeling dioxygen reduction at multicopper oxidase cathodes.
Agbo, Peter; Heath, James R; Gray, Harry B
2014-10-01
We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate.
Alternative ground states enable pathway switching in biological electron transfer
Abriata, Luciano A.; Alvarez-Paggi, Damian; Ledesma, Gabirela N.; ...
2012-10-10
Electron transfer is the simplest chemical reaction and constitutes the basis of a large variety of biological processes, such as photosynthesis and cellular respiration. Nature has evolved specific proteins and cofactors for these functions. The mechanisms optimizing biological electron transfer have been matter of intense debate, such as the role of the protein milieu between donor and acceptor sites. Here we propose a mechanism regulating long-range electron transfer in proteins. Specifically, we report a spectroscopic, electrochemical, and theoretical study on WT and single-mutant CuA redox centers from Thermus thermophilus, which shows that thermal fluctuations may populate two alternative ground-state electronicmore » wave functions optimized for electron entry and exit, respectively, through two different and nearly perpendicular pathways. In conclusion, these findings suggest a unique role for alternative or “invisible” electronic ground states in directional electron transfer. Moreover, it is shown that this energy gap and, therefore, the equilibrium between ground states can be fine-tuned by minor perturbations, suggesting alternative ways through which protein–protein interactions and membrane potential may optimize and regulate electron–proton energy transduction.« less
A Metagenomic Analysis of Microbial Contamination in Aviation Fuels
2009-03-01
classification by the RDP Classifier, sequences similar to members of the Acidobacteria, Actinobacteria , Bacteroidetes, Chloroflexi, Cyanobacteria... Actinobacteria 85 63 4 152 Bacteroidetes 5 0 0 5 Chloroflexi 7 0 0 7 Cyanobacteria 56 0 0 56 Deinococcus-Thermus 2 0 0 2 Firmicutes 83 99 2 184...Members of the Proteobacteria, Firmicutes and Actinobacteria were represented in all three fuel types; in Jet A and Biodiesel they were the only
Microbiological investigations on the water of a thermal bath at Budapest.
Szuróczki, Sára; Kéki, Zsuzsa; Káli, Szandra; Lippai, Anett; Márialigeti, Károly; Tóth, Erika
2016-06-01
Thermal baths are unique aquatic environments combining a wide variety of natural and anthropogenic ecological factors, which also appear in their microbiological state. There is limited information on the microbiology of thermal baths in their complexity, tracking community shifts from the thermal wells to the pools. In the present study, the natural microbial community of well and pool waters in Gellért bath was studied in detail by cultivation-based techniques. To isolate bacteria, 10% R2A and minimal synthetic media (with "bath water") with agar-agar and gellan gum were used after prolonged incubation time; moreover, polyurethane blocks covered with media were also applied. Strains were identified by sequencing their 16S rRNA gene after grouping them by amplified rDNA restriction analysis. From each sample, the dominance of Alphaproteobacteria was characteristic though their diversity differed among samples. Members of Actinobacteria, Firmicutes, Beta- and Gamma-proteobacteria, Deinococcus-Thermus, and Bacteroidetes were also identified. Representatives of Deinococcus-Thermus phylum appeared only in the pool water. The largest groups in the pool water belonged to the Tistrella and Chelatococcus genera. The most dominant member in the well water was a new taxon, its similarity to Hartmannibacter diazotrophicus as closest relative was 93.93%.
Timing of electron and proton transfer in the ba(3) cytochrome c oxidase from Thermus thermophilus.
von Ballmoos, Christoph; Lachmann, Peter; Gennis, Robert B; Ädelroth, Pia; Brzezinski, Peter
2012-06-05
Heme-copper oxidases are membrane-bound proteins that catalyze the reduction of O(2) to H(2)O, a highly exergonic reaction. Part of the free energy of this reaction is used for pumping of protons across the membrane. The ba(3) oxidase from Thermus thermophilus presumably uses a single proton pathway for the transfer of substrate protons used during O(2) reduction as well as for the transfer of the protons that are pumped across the membrane. The pumping stoichiometry (0.5 H(+)/electron) is lower than that of most other (mitochondrial-like) oxidases characterized to date (1 H(+)/electron). We studied the pH dependence and deuterium isotope effect of the kinetics of electron and proton transfer reactions in the ba(3) oxidase. The results from these studies suggest that the movement of protons to the catalytic site and movement to a site located some distance from the catalytic site [proposed to be a "proton-loading site" (PLS) for pumped protons] are separated in time, which allows individual investigation of these reactions. A scenario in which the uptake and release of a pumped proton occurs upon every second transfer of an electron to the catalytic site would explain the decreased proton pumping stoichiometry compared to that of mitochondrial-like oxidases.
Plants of the fynbos biome harbour host species-specific bacterial communities.
Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel
2016-08-01
The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Gao, Xin; Wang, Yanli; Huang, Xuhui
2016-03-17
Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Ago's but rigid for eukaryotic Ago's.
Structural Studies on Cytosolic Domain of Magnesium Transporter MgtE from Enterococcus faecalis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ragumani, S.; Sauder, J; Burley, S
2009-01-01
Magnesium (Mg{sup 2+}) is an essential element for growth and maintenance of living cells. It acts as a cofactor for many enzymes and is also essential for stability of the plasma membrane. There are two distinct classes of magnesium transporters identified in bacteria that convey Mg{sup 2+} from periplasm to cytoplasm [ATPase-dependent (MgtA and MgtB) and constitutively active (CorA and MgtE)]. Previously published work on Mg{sup 2+} transporters yielded structures of full length MgtE from Thermus thermophilus, determined at 3.5 {angstrom} resolution, and its cytoplasmic domain with and without bond Mg{sup 2+} determined at 2.3 and 3.9 {angstrom} resolution, respectively.more » Here, they report the crystal structure of the Mg{sup 2+} bound form of the cytosolic portion of MgtE (residues 6-262) from Enterococcus faecalis at 2.2 {angstrom} resolution. The present structure and magnesium bound cytosolic domain structure from T. thermophilus (PDB ID: 2YVY) are structurally similar. Three magnesium binding sites are common to both MgtE full length and the present structure. Their work revealed an additional Mg{sup 2+} binding site in the E. faecalis structure. In this report, they discuss the functional significance of Mg{sup 2+} binding sites in the cytosolic domains of MgtE transporters.« less
Single-molecule Analysis of Inhibitory Pausing States of V1-ATPase*
Uner, Naciye Esma; Nishikawa, Yoshihiro; Okuno, Daichi; Nakano, Masahiro; Yokoyama, Ken; Noji, Hiroyuki
2012-01-01
V1-ATPase, the hydrophilic V-ATPase domain, is a rotary motor fueled by ATP hydrolysis. Here, we found that Thermus thermophilus V1-ATPase shows two types of inhibitory pauses interrupting continuous rotation: a short pause (SP, 4.2 s) that occurred frequently during rotation, and a long inhibitory pause (LP, >30 min) that terminated all active rotations. Both pauses occurred at the same angle for ATP binding and hydrolysis. Kinetic analysis revealed that the time constants of inactivation into and activation from the SP were too short to represent biochemically predicted ADP inhibition, suggesting that SP is a newly identified inhibitory state of V1-ATPase. The time constant of inactivation into LP was 17 min, consistent with one of the two time constants governing the inactivation process observed in bulk ATPase assay. When forcibly rotated in the forward direction, V1 in LP resumed active rotation. Solution ADP suppressed the probability of mechanical activation, suggesting that mechanical rotation enhanced inhibitory ADP release. These features were highly consistent with mechanical activation of ADP-inhibited F1, suggesting that LP represents the ADP-inhibited state of V1-ATPase. Mechanical activation largely depended on the direction and angular displacement of forced rotation, implying that V1-ATPase rotation modulates the off rate of ADP. PMID:22736762
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan
We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).
Sierra, Raymond G; Gati, Cornelius; Laksmono, Hartawan; Dao, E Han; Gul, Sheraz; Fuller, Franklin; Kern, Jan; Chatterjee, Ruchira; Ibrahim, Mohamed; Brewster, Aaron S; Young, Iris D; Michels-Clark, Tara; Aquila, Andrew; Liang, Mengning; Hunter, Mark S; Koglin, Jason E; Boutet, Sébastien; Junco, Elia A; Hayes, Brandon; Bogan, Michael J; Hampton, Christina Y; Puglisi, Elisabetta V; Sauter, Nicholas K; Stan, Claudiu A; Zouni, Athina; Yano, Junko; Yachandra, Vittal K; Soltis, S Michael; Puglisi, Joseph D; DeMirci, Hasan
2016-01-01
We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).
Honda, Kohsuke; Maya, Shohei; Omasa, Takeshi; Hirota, Ryuichi; Kuroda, Akio; Ohtake, Hisao
2010-08-02
Six thermophilic enzymes from Thermus thermophilus were used to construct an 'artificial bio-synthetic pathway' for the production of 2-deoxyribose 5-phosphate from fructose. By a simple operation using six recombinant Escherichia coli strains producing the thermophilic enzymes, respectively, fructose was converted to 2-deoxyribose 5-phosphate with a molar yield of 55%. Copyright 2010 Elsevier B.V. All rights reserved.
Del Arco, J; Cejudo-Sanches, J; Esteban, I; Clemente-Suárez, V J; Hormigo, D; Perona, A; Fernández-Lucas, J
2017-12-15
Traditionally, enzymatic synthesis of nucleoside-5'-monophosphates (5'-NMPs) using low water-soluble purine bases has been described as less efficient due to their low solubility in aqueous media. The use of enzymes from extremophiles, such as thermophiles or alkaliphiles, offers the potential to increase solubilisation of these bases by employing high temperatures or alkaline pH. This study describes the cloning, expression and purification of hypoxanthine-guanine-xanthine phosphoribosyltransferase from Thermus thermophilus (TtHGXPRT). Biochemical characterization indicates TtHGXPRT as a homotetramer with excellent activity and stability across a broad range of temperatures (50-90°C) and ionic strengths (0-500mMNaCl), but it also reveals an unusually high activity and stability under alkaline conditions (pH range 8-11). In order to explore the potential of TtHGXPRT as an industrial biocatalyst, enzymatic production of several dietary 5'-NMPs, such as 5'-GMP and 5'-IMP, was carried out at high concentrations of guanine and hypoxanthine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Osmoregulated TAQ polymerase gene expression in Escherichia coli.
Cabrera Artiles, Yeosvany; Martínez García, Duniesky; Pérez Cruz, Enrique R; Márquez Perera, Gabriel J; Feble, Manuel Luis
2002-01-01
The Thermus aquaticus DNA Polymerase I (Taq Pol I) gene was cloned into the pOSEX4 plasmid under the osmo-inducible promoter proU and subsequently expressed into the Escherichia coli MKH13 strain. The suitability of the enzyme in polymerase assays was determined in standard 35S dATP incorporation tests and by PCR. The Taq Pol I expression in this system, which is under the control of the osmotic pressure in the growth medium, was analyzed in different media and in different sodium chloride concentrations. A study of the osmolarity effects in the growth of the strain and in Taq Pol I expression shows that an increase in sodium chloride concentration limits the growth. At 0.25 M of NaCl maximum activity was observed; at higher values of osmolarity, we found an unexpected decline of activity. This is the first report of using the pOSEX vector for the expression of an heterologous protein and it is very advantageous to make a regulated, non toxic, simple and cost-effective manner of induction in a biotechnology process using just NaCl or other non-permeable osmolyte.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan
In this paper, we describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. Finally, we used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).
Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan; ...
2015-11-30
In this paper, we describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. Finally, we used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).
Cockrell, Allison L; Fitzgerald, Lisa A; Cusick, Kathleen D; Barlow, Daniel E; Tsoi, Stanislav D; Soto, Carissa M; Baldwin, Jeffrey W; Dale, Jason R; Morris, Robert E; Little, Brenda J; Biffinger, Justin C
2015-09-01
A thermophile, Thermus scotoductus SA-01, was cultured within a constant-temperature (65°C) microwave (MW) digester to determine if MW-specific effects influenced the growth and physiology of the organism. As a control, T. scotoductus cells were also cultured using convection heating at the same temperature as the MW studies. Cell growth was analyzed by optical density (OD) measurements, and cell morphologies were characterized using electron microscopy imaging (scanning electron microscopy [SEM] and transmission electron microscopy [TEM]), dynamic light scattering (DLS), and atomic force microscopy (AFM). Biophysical properties (i.e., turgor pressure) were also calculated with AFM, and biochemical compositions (i.e., proteins, nucleic acids, fatty acids) were analyzed by attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy. Gas chromatography-mass spectrometry (GC-MS) was used to analyze the fatty acid methyl esters extracted from cell membranes. Here we report successful cultivation of a thermophile with only dielectric heating. Under the MW conditions for growth, cell walls remained intact and there were no indications of membrane damage or cell leakage. Results from these studies also demonstrated that T. scotoductus cells grown with MW heating exhibited accelerated growth rates in addition to altered cell morphologies and biochemical compositions compared with oven-grown cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Nakamura, Akira; Takakura, Yasuaki; Kobayashi, Hideo; Hoshino, Takayuki
2005-08-01
An in vivo-directed evolutionary strategy was used to obtain a thermostabilized Escherichia coli hygromycin B phosphotransferase, using a host-vector system of Thermus thermophilus. Introduction of the mutant gene containing two amino acid substitutions, S52T and W238C, which was previously reported by Cannio et al. [J. Bacteriol., 180, 3237-3240 (1998)], did not confer hygromycin resistance on T. thermophilus cells at 55 degrees C; however, five spontaneously-generated independent mutants were obtained by selection of the transformants at this temperature. Each mutant gene contained one amino acid substitution of either A118V or T246A. Further selection with increasing temperature, at 58 degrees C and then 61 degrees C, led to acquisition of three more substitutions: D20G, S225P and Q226L. These mutations cumulatively influenced the maximum growth temperature of the T. thermophilus transformants in the presence of hygromycin; T. thermophilus carrying a mutant gene containing all the five substitutions was able to grow at up to 67 degrees C. This mutant gene, hph5, proved useful as a selection marker in the T. thermophilus host-vector system, either on the plasmid or by genome integration, at temperatures up to 65 degrees C.
Prokaryotic Ubiquitin-Like Protein Modification
Maupin-Furlow, Julie A.
2016-01-01
Prokaryotes form ubiquitin (Ub)-like isopeptide bonds on the lysine residues of proteins by at least two distinct pathways that are reversible and regulated. In mycobacteria, the C-terminal Gln of Pup (prokaryotic ubiquitin-like protein) is deamidated and isopeptide linked to proteins by a mechanism distinct from ubiquitylation in enzymology yet analogous to ubiquitylation in targeting proteins for destruction by proteasomes. Ub-fold proteins of archaea (SAMPs, small archaeal modifier proteins) and Thermus (TtuB, tRNA-two-thiouridine B) that differ from Ub in amino acid sequence, yet share a common β-grasp fold, also form isopeptide bonds by a mechanism that appears streamlined compared with ubiquitylation. SAMPs and TtuB are found to be members of a small group of Ub-fold proteins that function not only in protein modification but also in sulfur-transfer pathways associated with tRNA thiolation and molybdopterin biosynthesis. These multifunctional Ub-fold proteins are thought to be some of the most ancient of Ub-like protein modifiers. PMID:24995873
Sugimoto, Naohisa; Takakura, Yasuaki; Shiraki, Kentaro; Honda, Shinya; Takaya, Naoki; Hoshino, Takayuki; Nakamura, Akira
2013-01-01
To obtain a selection marker gene functional in a thermophilic bacterium, Thermus thermophilus, an in vivo-directed evolutionary strategy was conducted on a hygromycin B phosphotransferase gene (hyg) from Streptomyces hygroscopicus. The expression of wild-type hyg in T. thermophilus provided hygromycin B (HygB) resistance up to 60 °C. Through selection of mutants showing HygB resistance at higher temperatures, eight amino acid substitutions and the duplication of three amino acids were identified. A variant containing seven substitutions and the duplication (HYG10) showed HygB resistance at a highest temperature of 74 °C. Biochemical and biophysical analyses of recombinant HYG and HYG10 revealed that HYG10 was in fact thermostabilized. Modeling of the three-dimensional structure of HYG10 suggests the possible roles of the various substitutions and the duplication on thermostabilization, of which three substitutions and the duplication located at the enzyme surface suggested that these mutations made the enzyme more hydrophilic and provided increased stability in aqueous solution.
Structural basis for gene regulation by a B 12-dependent photoreceptor
Jost, Marco; Fernández-Zapata, Jésus; Polanco, María Carmen; ...
2015-09-28
Photoreceptor proteins enable organisms to sense and respond to light. The newly discovered CarH-type photoreceptors use a vitamin B 12 derivative, adenosylcobalamin, as the light-sensing chromophore to mediate light-dependent gene regulation. Here in this paper, we present crystal structures of Thermus thermophilus CarH in all three relevant states: in the dark, both free and bound to operator DNA, and after light exposure. These structures provide visualizations of how adenosylcobalamin mediates CarH tetramer formation in the dark, how this tetramer binds to the promoter -35 element to repress transcription, and how light exposure leads to a large-scale conformational change that activatesmore » transcription. In addition to the remarkable functional repurposing of adenosylcobalamin from an enzyme cofactor to a light sensor, we find that nature also repurposed two independent protein modules in assembling CarH. Finally, these results expand the biological role of vitamin B 12 and provide fundamental insight into a new mode of light-dependent gene regulation.« less
Nitric Oxide Accumulation: The Evolutionary Trigger for Phytopathogenesis
Santana, Margarida M.; Gonzalez, Juan M.; Cruz, Cristina
2017-01-01
Many publications highlight the importance of nitric oxide (NO) in plant–bacteria interactions, either in the promotion of health and plant growth or in pathogenesis. However, the role of NO in the signaling between bacteria and plants and in the fate of their interaction, as well as the reconstruction of their interactive evolution, remains largely unknown. Despite the complexity of the evolution of life on Earth, we explore the hypothesis that denitrification and aerobic respiration were responsible for local NO accumulation, which triggered primordial antagonistic biotic interactions, namely the first phytopathogenic interactions. N-oxides, including NO, could globally accumulate via lightning synthesis in the early anoxic ocean and constitute pools for the evolution of denitrification, considered an early step of the biological nitrogen cycle. Interestingly, a common evolution may be proposed for components of denitrification and aerobic respiration pathways, namely for NO and oxygen reductases, a theory compatible with the presence of low amounts of oxygen before the great oxygenation event (GOE), which was generated by Cyanobacteria. During GOE, the increase in oxygen caused the decrease of Earth’s temperature and the consequent increase of oxygen dissolution and availability, making aerobic respiration an increasingly dominant trait of the expanding mesophilic lifestyle. Horizontal gene transfer was certainly important in the joint expansion of mesophily and aerobic respiration. First denitrification steps lead to NO formation through nitrite reductase activity, and NO may further accumulate when oxygen binds NO reductase, resulting in denitrification blockage. The consequent transient NO surplus in an oxic niche could have been a key factor for a successful outcome of an early denitrifying prokaryote able to scavenge oxygen by NO/oxygen reductase or by an independent heterotrophic aerobic respiration pathway. In fact, NO surplus could result in toxicity causing “the first disease” in oxygen-producing Cyanobacteria. We inspected in bacteria the presence of sequences similar to the NO-producing nitrite reductase nirS gene of Thermus thermophilus, an extreme thermophilic aerobe of the Thermus/Deinococcus group, which constitutes an ancient lineage related to Cyanobacteria. In silico analysis revealed the relationship between the presence of nirS genes and phytopathogenicity in Gram-negative bacteria. PMID:29067010
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vorontsov, Ivan I.; Minasov, George; Kiryukhina, Olga
2012-06-19
The EF1143 protein from Enterococcus faecalis is a distant homolog of deoxynucleotide triphosphate triphosphohydrolases (dNTPases) from Escherichia coli and Thermus thermophilus. These dNTPases are important components in the regulation of the dNTP pool in bacteria. Biochemical assays of the EF1143 dNTPase activity demonstrated nonspecific hydrolysis of all canonical dNTPs in the presence of Mn{sup 2+}. In contrast, with Mg{sup 2+} hydrolysis required the presence of dGTP as an effector, activating the degradation of dATP and dCTP with dGTP also being consumed in the reaction with dATP. The crystal structure of EF1143 and dynamic light scattering measurements in solution revealed amore » tetrameric oligomer as the most probable biologically active unit. The tetramer contains four dGTP specific allosteric regulatory sites and four active sites. Examination of the active site with the dATP substrate suggests an in-line nucleophilic attack on the {alpha}-phosphate center as a possible mechanism of the hydrolysis and two highly conserved residues, His-129 and Glu-122, as an acid-base catalytic dyad. Structural differences between EF1143 apo and holo forms revealed mobility of the {alpha}3 helix that can regulate the size of the active site binding pocket and could be stabilized in the open conformation upon formation of the tetramer and dGTP effector binding.« less
NASA Astrophysics Data System (ADS)
Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.
2017-07-01
Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).
Single mutations that redirect internal proton transfer in the ba3 oxidase from Thermus thermophilus
Smirnova, Irina; Chang, Hsin-Yang; von Ballmoos, Christoph; Ädelroth, Pia; Gennis, Robert B.; Brzezinski, Peter
2014-01-01
The ba3-type cytochrome c oxidase from Thermus thermophilus is a membrane-bound proton pump. Results from earlier studies have shown that with the aa3-type oxidases proton uptake to the catalytic site and “pump site” occur simultaneously. However, with the ba3 oxidase the pump site is loaded before proton transfer to the catalytic site because the proton transfer to the latter is slower than with the aa3 oxidases. In addition, the timing of formation and decay of catalytic intermediates is different in the two types of oxidases. In the present study, we have investigated two mutant ba3 CytcOs in which residues of the proton pathway leading to the catalytic site as well as the pump site were exchanged, Thr312Val and Tyr244Phe. Even though the ba3 CytcO uses only a single proton pathway for transfer of the substrate and “pumped” protons, the amino-acid residue substitutions had distinctly different effects on the kinetics of proton transfer to the catalytic site and the pump site, respectively. The results indicate that the rates of these reactions can be modified independently by replacement of single residues within the proton pathway. Furthermore, the data suggest that the Thr312Val and Tyr244Phe mutations interfere with a structural rearrangement in the proton pathway that is rate limiting for proton transfer to the catalytic site. PMID:24004023
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less
Structural Basis for NADH/NAD+ Redox Sensing by a Rex Family Repressor
DOE Office of Scientific and Technical Information (OSTI.GOV)
McLaughlin, K.J.; Soares, A.; Strain-Damerell, C. M.
2010-05-28
Nicotinamide adenine dinucleotides have emerged as key signals of the cellular redox state. Yet the structural basis for allosteric gene regulation by the ratio of reduced NADH to oxidized NAD{sup +} is poorly understood. A key sensor among Gram-positive bacteria, Rex represses alternative respiratory gene expression until a limited oxygen supply elevates the intracellular NADH:NAD{sup +} ratio. Here we investigate the molecular mechanism for NADH/NAD{sup +} sensing among Rex family members by determining structures of Thermus aquaticus Rex bound to (1) NAD{sup +}, (2) DNA operator, and (3) without ligand. Comparison with the Rex/NADH complex reveals that NADH releases Rexmore » from the DNA site following a 40{sup o} closure between the dimeric subunits. Complementary site-directed mutagenesis experiments implicate highly conserved residues in NAD-responsive DNA-binding activity. These rare views of a redox sensor in action establish a means for slight differences in the nicotinamide charge, pucker, and orientation to signal the redox state of the cell.« less
Jia, Dong-Xu; Wang, Teng; Liu, Zi-Jian; Jin, Li-Qun; Li, Jia-Jia; Liao, Cheng-Jun; Chen, De-Shui; Zheng, Yu-Guo
2018-04-04
Glucose isomerase (GI) responsible for catalyzing the isomerization from d-glucose to d-fructose, was an important enzyme for producing high fructose corn syrup (HFCS). In a quest to prepare HFCS at elevated temperature and facilitate enzymatic recovery, an effective procedure for whole cell immobilization of refractory Thermus oshimai glucose isomerase (ToGI) onto Celite 545 using tris(hydroxymethyl)phosphine (THP) as crosslinker was established. The immobilized biocatalyst showed an activity of approximate 127.3 U/(g·immobilized product) via optimization in terms of cells loading, crosslinker concentration and crosslinking time. The pH optimum of the immobilized biocatalyst was displaced from pH 8.0 of native enzyme to neutral pH 7.0. Compared with conventional glutaraldehyde (GLU)-immobilized cells, it possessed the enhanced thermostability with 70.1% residual activity retaining after incubation at 90°C for 72 h. Moreover, the THP-immobilized biocatalyst exhibited superior operational stability, in which it retained 85.8% of initial activity after 15 batches of bioconversion at 85°C. This study paved a way for reducing catalysis cost for upscale preparation of HFCS with higher d-fructose concentration. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
The distribution of active β-glucosidase-producing microbial communities in composting.
Zang, Xiangyun; Liu, Meiting; Wang, Han; Fan, Yihong; Zhang, Haichang; Liu, Jiawen; Xing, Enlu; Xu, Xiuhong; Li, Hongtao
2017-12-01
The composting ecosystem is a suitable source for the discovery of novel microorganisms and secondary metabolites. Cellulose degradation is an important part of the global carbon cycle, and β-glucosidases complete the final step of cellulose hydrolysis by converting cellobiose to glucose. This work analyzes the succession of β-glucosidase-producing microbial communities that persist throughout cattle manure - rice straw composting, and evaluates their metabolic activities and community advantage during the various phases of composting. Fungal and bacterial β-glucosidase genes belonging to glycoside hydrolase families 1 and 3 (GH1 and GH3) amplified from DNA were classified and gene abundance levels were analyzed. The major reservoirs of β-glucosidase genes were the fungal phylum Ascomycota and the bacterial phyla Firmicutes, Actinobacteria, Proteobacteria, and Deinococcus-Thermus. This indicates that a diverse microbial community utilizes cellobiose. The succession of dominant bacteria was also detected during composting. Firmicutes was the dominant bacteria in the thermophilic phase of composting; there was a shift to Actinomycetes in the maturing stage. Proteobacteria accounted for the highest proportions during the heating and thermophilic phases of composting. By contrast, the fungal phylum Ascomycota was a minor microbial community constituent in thermophilic phase of composting. Combined with the analysis of the temperature, cellulose degradation rate and the carboxymethyl cellulase and β-glucosidase activities showed that the bacterial GH1 family β-glucosidase genes make greater contribution in cellulose degradation at the later thermophilic stage of composting. In summary, even GH1 bacteria families β-glucosidase genes showing low abundance in DNA may be functionally important in the later thermophilic phase of composting. The results indicate that a complex community of bacteria and fungi expresses β-glucosidases in compost. Several β-glucosidase-producing bacteria and fungi identified in this study may represent potential indicators of composting in cellulose degradation.
Glycoside hydrolase activities of thermophilic bacterial consortia adapted to switchgrass.
Gladden, John M; Allgaier, Martin; Miller, Christopher S; Hazen, Terry C; VanderGheynst, Jean S; Hugenholtz, Philip; Simmons, Blake A; Singer, Steven W
2011-08-15
Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60°C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80°C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.
Structural insights into electron transfer in caa3-type cytochrome oxidase
Lyons, Joseph A.; Aragão, David; Slattery, Orla; Pisliakov, Andrei V.; Soulimane, Tewfik; Caffrey, Martin
2012-01-01
Summary Paragraph Cytochrome c oxidase is a member of the heme copper oxidase superfamily (HCO)1. HCOs function as the terminal enzymes in the respiratory chain of mitochondria and aerobic prokaryotes, coupling molecular oxygen reduction to transmembrane proton pumping. Integral to the enzyme’s function is the transfer of electrons from cytochrome c to the oxidase via a transient association of the two proteins. Electron entry and exit are proposed to occur from the same site on cytochrome c2–4. Here we report the crystal structure of the caa3-type cytochrome oxidase from Thermus thermophilus, which has a covalently tethered cytochrome c domain. Crystals were grown in a bicontinuous mesophase using a synthetic short-chain monoacylglycerol as the hosting lipid. From the electron density map, at 2.36 Å resolution, a novel integral membrane subunit and a native glycoglycerophospholipid embedded in the complex were identified. Contrary to previous electron transfer mechanisms observed for soluble cytochrome c, the structure reveals the architecture of the electron transfer complex for the fused cupredoxin/cytochrome c domain which implicates different sites on cytochrome c for electron entry and exit. Support for an alternative to the classical proton gate characteristic of this HCO class is presented. PMID:22763450
Okochi, Mina; Yoshida, Takao; Maruyama, Tadashi; Kawarabayasi, Yutaka; Kikuchi, Hisashi; Yohda, Masafumi
2002-03-08
A molecular chaperone prefoldin/GimC from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 was characterized. Pyrococcus prefoldin protected porcine heart citrate synthase from thermal aggregation whereas each subunit alone afforded little protection. It also arrested the spontaneous refolding of acid-denatured green fluorescent protein and then transferred it not only to a group II chaperonin from the hyperthermophilic archaeum Thermococcus sp. strain KS-1, but also to a group I chaperonin from the thermophilic bacterium Thermus thermophilus HB8 for subsequent ATP dependent refolding.
Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini
2015-09-01
The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.
Detecting protein-protein interactions in the intact cell of Bacillus subtilis (ATCC 6633).
Winters, Michael S; Day, R A
2003-07-01
The salt bridge, paired group-specific reagent cyanogen (ethanedinitrile; C(2)N(2)) converts naturally occurring pairs of functional groups into covalently linked products. Cyanogen readily permeates cell walls and membranes. When the paired groups are shared between associated proteins, isolation of the covalently linked proteins allows their identity to be assigned. Examination of organisms of known genome sequence permits identification of the linked proteins by mass spectrometric techniques applied to peptides derived from them. The cyanogen-linked proteins were isolated by polyacrylamide gel electrophoresis. Digestion of the isolated proteins with proteases of known specificity afforded sets of peptides that could be analyzed by mass spectrometry. These data were compared with those derived theoretically from the Swiss Protein Database by computer-based comparisons (Protein Prospector; http://prospector.ucsf.edu). Identification of associated proteins in the ribosome of Bacillus subtilis strain ATCC 6633 showed that there is an association homology with the association patterns of the ribosomal proteins of Haloarcula marismortui and Thermus thermophilus. In addition, other proteins involved in protein biosynthesis were shown to be associated with ribosomal proteins.
Detecting Protein-Protein Interactions in the Intact Cell of Bacillus subtilis (ATCC 6633)
Winters, Michael S.; Day, R. A.
2003-01-01
The salt bridge, paired group-specific reagent cyanogen (ethanedinitrile; C2N2) converts naturally occurring pairs of functional groups into covalently linked products. Cyanogen readily permeates cell walls and membranes. When the paired groups are shared between associated proteins, isolation of the covalently linked proteins allows their identity to be assigned. Examination of organisms of known genome sequence permits identification of the linked proteins by mass spectrometric techniques applied to peptides derived from them. The cyanogen-linked proteins were isolated by polyacrylamide gel electrophoresis. Digestion of the isolated proteins with proteases of known specificity afforded sets of peptides that could be analyzed by mass spectrometry. These data were compared with those derived theoretically from the Swiss Protein Database by computer-based comparisons (Protein Prospector; http://prospector.ucsf.edu). Identification of associated proteins in the ribosome of Bacillus subtilis strain ATCC 6633 showed that there is an association homology with the association patterns of the ribosomal proteins of Haloarcula marismortui and Thermus thermophilus. In addition, other proteins involved in protein biosynthesis were shown to be associated with ribosomal proteins. PMID:12837803
Hernández-García, Juan Alfredo; Briones-Roblero, Carlos Iván; Rivera-Orduña, Flor N; Zúñiga, Gerardo
2017-10-24
Dendroctonus bark beetles comprise 20 taxonomically recognized species, which are one of the most destructive pine forest pests in North and Central America, and Eurasia. The aims of this study were to characterize the gut bacterial diversity, to determine the core bacteriome and to explore the ecological association between these bacteria and bark beetles. A total of five bacterial phyla were identified in the gut of 13 Dendroctonus species; Proteobacteria was the most abundant, followed by Firmicutes, Fusobacteria, Actinobacteria and Deinococcus-Thermus. The α-diversity was low as demonstrated in previous studies and significant differences in β-diversity were observed. The core bacteriome was composed of Enterobacter, Pantoea, Pseudomonas, Rahnella, Raoultella, and Serratia. The tanglegram between bacteria and bark beetles suggests that members of bacterial community are acquired from the environment, possibly from the host tree. These findings improve the knowledge about the bacterial community composition, and provide the bases to study the metabolic functions of these bacteria, as well as their interaction with these bark beetles.
NASA Astrophysics Data System (ADS)
Li, J.; Peng, X.; Zhang, L.
2014-12-01
Ten sediment samples collected from one acidic and three alkaline high temperature hot springs at Tengchong terrestrial geothermal field, Southwest China, were examined by the mineralogical, geochemical, and molecular biological techniques. The mineralogical and geochemical analyses suggested that these hot springs contain relative high concentrations of S, Fe and N chemical species. Specifically, the acidic hot spring was rich in Fe2+, SO42- and NH4+, while the alkaline hot springs were high in NO3-, H2S and S2O3-. Analyses of 16S rRNA sequences showed their bacterial communities were dominated by Aquificae, Cyanobacteria, Deinococci-Thermus, Firmicutes, Proteobacteria, and Thermodesulfobacteria, while the archeal clone libraries were dominated by Desulfurococcales, Sulfolobales, and Thermoproteales. Among them, the potential S-, N- and Fe-related oxidizing and reducing prokaryote were presenting as a relative high proportion but with a great difference in diversity and metabolic approaches of each sample. These findings provide some significant implications for the microbial function in element biogeochemical cycles within the Tengchong geothermal environments: i). the distinct differences in abundance and diversity of microbial communities of geothermal sediments were related to in situ different physicochemical conditions; ii). the S-, N- and Fe-related prokaryote would take advantage of the strong chemical disequilibria in the hot springs; iii). in return, their metabolic activities can promote the transformation of S, Fe and N chemical species, thus founded the bases of biogeochemical cycles in the terrestrial geothermal environments.
Antonucci, Immacolata; Gallo, Giovanni; Limauro, Danila; Contursi, Patrizia; Ribeiro, Ana Luisa; Blesa, Alba; Berenguer, José; Bartolucci, Simonetta; Fiorentino, Gabriella
2018-05-18
The characterization of the molecular determinants of metal resistance has potential biotechnological application in biosensing and bioremediation. In this context, the bacterium Thermus thermophilus HB27 is a metal tolerant thermophile containing a set of genes involved in arsenic resistance which, differently from other microbes, are not organized into a single operon. They encode the proteins: arsenate reductase, TtArsC, arsenic efflux membrane transporter, TtArsX, and transcriptional repressor, TtSmtB. In this work we show that the arsenic efflux protein TtArsX and the arsenic responsive transcriptional repressor TtSmtB are required to provide resistance to cadmium. We analyzed the sensitivity to Cd(II) of mutants lacking TtArsX, finding that they are more sensitive to this metal than the wild type strain. In addition, using promoter probe reporter plasmids, we show that the transcription of TtarsX is also stimulated by the presence of Cd(II) in a TtSmtB-dependent way. Actually, a regulatory circuit composed of TtSmtB and a reporter gene expressed from the TtarsX promoter responds to variation in Cd(II), As(III) and As(V) concentrations. Our results demonstrate that the system composed by TtSmtB and TtArsX is responsible for both the arsenic and cadmium resistance in T. thermophilus. The data also support the use of T. thermophilus as a suitable chassis for the design and development of As-Cd biosensors.
Siletsky, Sergey A; Belevich, Ilya; Belevich, Nikolai P; Soulimane, Tewfik; Verkhovsky, Michael I
2011-09-01
The oxidative part of the catalytic cycle of the caa(3)-type cytochrome c oxidase from Thermus thermophilus was followed by time-resolved optical spectroscopy. Rate constants, chemical nature and the spectral properties of the catalytic cycle intermediates (Compounds A, P, F) reproduce generally the features typical for the aa(3)-type oxidases with some distinctive peculiarities caused by the presence of an additional 5-th redox-center-a heme center of the covalently bound cytochrome c. Compound A was formed with significantly smaller yield compared to aa(3) oxidases in general and to ba(3) oxidase from the same organism. Two electrons, equilibrated between three input redox-centers: heme a, Cu(A) and heme c are transferred in a single transition to the binuclear center during reduction of the compound F, converting the binuclear center through the highly reactive O(H) state into the final product of the reaction-E(H) (one-electron reduced) state of the catalytic site. In contrast to previous works on the caa(3)-type enzymes, we concluded that the finally produced E(H) state of caa(3) oxidase is characterized by the localization of the fifth electron in the binuclear center, similar to the O(H)→E(H) transition of the aa(3)-type oxidases. So, the fully-reduced caa(3) oxidase is competent in rapid electron transfer from the input redox-centers into the catalytic heme-copper site. 2011 Elsevier B.V. All rights reserved.
Crystallization screening test for the whole-cell project on Thermus thermophilus HB8
Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki
2008-01-01
It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056
Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini
2015-01-01
The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche. PMID:26484255
System and method for introduction and stabilization of genes in Thermus sp.
Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.
2005-03-01
A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia
2015-11-26
During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O 2 to 2H 2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth -MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O 2 reduction was found in a double conformation: Glu451a (~7 Åmore » from the TNC) and Glu451b (~4.5 Å from the TNC). A positive peak of electron density above 3.5σ in anF o-F c map for Glu451a O ε2 indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth -MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth -MCO-C1–8) with different X-ray-absorbed doses allowed the observation of different O 2-reduction states, and a total depletion of T2Cu at doses higher than 0.2 MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure.« less
Integrating mass spectrometry with MD simulations reveals the role of lipids in Na+/H+ antiporters
NASA Astrophysics Data System (ADS)
Landreh, Michael; Marklund, Erik G.; Uzdavinys, Povilas; Degiacomi, Matteo T.; Coincon, Mathieu; Gault, Joseph; Gupta, Kallol; Liko, Idlir; Benesch, Justin L. P.; Drew, David; Robinson, Carol V.
2017-01-01
Na+/H+ antiporters are found in all kingdoms of life and exhibit catalysis rates that are among the fastest of all known secondary-active transporters. Here we combine ion mobility mass spectrometry and molecular dynamics simulations to study the conformational stability and lipid-binding properties of the Na+/H+ exchanger NapA from Thermus thermophilus and compare this to the prototypical antiporter NhaA from Escherichia coli and the human homologue NHA2. We find that NapA and NHA2, but not NhaA, form stable dimers and do not selectively retain membrane lipids. By comparing wild-type NapA with engineered variants, we show that the unfolding of the protein in the gas phase involves the disruption of inter-domain contacts. Lipids around the domain interface protect the native fold in the gas phase by mediating contacts between the mobile protein segments. We speculate that elevator-type antiporters such as NapA, and likely NHA2, use a subset of annular lipids as structural support to facilitate large-scale conformational changes within the membrane.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mancl, Jordan M.; Black, Wesley P.; Robinson, Howard
Type IV pili (T4P) mediate bacterial motility and virulence. The PilB/GspE family ATPases power the assembly of T4P and type 2 secretion systems. We determined the structure of the ATPase region of PilB (PilB ATP) in complex with ATPγS to provide a model of a T4P assembly ATPase and a view of a PilB/GspE family hexamer at better than 3-Å resolution. Spatial positioning and conformations of the protomers suggest a mechanism of force generation. All six PilB ATP protomers contain bound ATPγS. Two protomers form a closed conformation poised for ATP hydrolysis. The other four molecules assume an open conformationmore » but separate into two pairs with distinct active-site accessibilities. We propose that one pair represents the post-hydrolysis phase while the other pair appears poised for ADP/ATP exchange. In conclusion, collectively, the data suggest that T4P assembly is powered by coordinating concurrent substrate binding with ATP hydrolysis across the PilB hexamer.« less
Mancl, Jordan M.; Black, Wesley P.; Robinson, Howard; ...
2016-09-22
Type IV pili (T4P) mediate bacterial motility and virulence. The PilB/GspE family ATPases power the assembly of T4P and type 2 secretion systems. We determined the structure of the ATPase region of PilB (PilB ATP) in complex with ATPγS to provide a model of a T4P assembly ATPase and a view of a PilB/GspE family hexamer at better than 3-Å resolution. Spatial positioning and conformations of the protomers suggest a mechanism of force generation. All six PilB ATP protomers contain bound ATPγS. Two protomers form a closed conformation poised for ATP hydrolysis. The other four molecules assume an open conformationmore » but separate into two pairs with distinct active-site accessibilities. We propose that one pair represents the post-hydrolysis phase while the other pair appears poised for ADP/ATP exchange. In conclusion, collectively, the data suggest that T4P assembly is powered by coordinating concurrent substrate binding with ATP hydrolysis across the PilB hexamer.« less
Molecular mechanism and evolution of guanylate kinase regulation by (p)ppGpp
Liu, Kuanqing; Myers, Angela R.; Pisithkul, Tippapha; ...
2015-02-05
The nucleotide (p)ppGpp mediates bacterial stress responses, but its targets and underlying mechanisms of action vary among bacterial species and remain incompletely understood. In this paper, we characterize the molecular interaction between (p)ppGpp and guanylate kinase (GMK), revealing the importance of this interaction in adaptation to starvation. Combining structural and kinetic analyses, we show that (p)ppGpp binds the GMK active site and competitively inhibits the enzyme. The (p)ppGpp-GMK interaction prevents the conversion of GMP to GDP, resulting in GMP accumulation upon amino acid downshift. Abolishing this interaction leads to excess (p)ppGpp and defective adaptation to amino acid starvation. A surveymore » of GMKs from phylogenetically diverse bacteria shows that the (p)ppGpp-GMK interaction is conserved in members of Firmicutes, Actinobacteria, and Deinococcus-Thermus, but not in Proteobacteria, where (p)ppGpp regulates RNA polymerase (RNAP). Finally, we propose that GMK is an ancestral (p)ppGpp target and RNAP evolved more recently as a direct target in Proteobacteria.« less
NASA Astrophysics Data System (ADS)
Aleksandrovich Yuriev, Denis; Viktorovna Zaitseva, Svetlana; Olegovna Zhdanova, Galina; Yurievich Tolstoy, Mikhail; Dondokovna Barkhutova, Darima; Feodorovna Vyatchina, Olga; Yuryevna Konovalova, Elena; Iosifovich Stom, Devard
2018-02-01
Electrogenic, molecular and some other properties of a microbial mat isolated from the Kuchiger hot spring (Kurumkansky District, Republic of Buryatia) were studied. Molecular analysis showed that representatives of Proteobacteria (85.5 % of the number of classified bacterial sequences) prevailed in the microbial mat of the Kuchiger springs, among which sulfur bacteria of the genus Thiothrix were the most numerous. In the microbial mat there were bacteria from the families Rhodocyclaceae, Comamonadaceae and Flavobacteriaceae. Phylum Bacteroidetes, Cyanobacteria/Chloroplast, Fusobacteria, Fibrobacteres, Acidobacteria, Chlorobi, Spirochaetes, Verrucomicrobia, Firmicutes, Deinococcus-Thermus, Chloroflexi and Actinobacteria are also noted in the composition of the microbial mat. Under the experimental conditions using Kuchiger-mat 16 as bioagents, glucose and peptone as substrates, the power of BFC was 240 and 221 mW / m2, respectively. When replacing the substrate with sodium acetate, the efficiency of the BFC was reduced by a factor of 10 (20 mW / m2). The prospects of using a microbial mat “Kuchiger-16” as an electrogen in BFC when utilizing alkaline waste water components to generate electricity are discussed.
Kishikawa, Jun-ichi; Ibuki, Tatsuya; Nakamura, Shuichi; Nakanishi, Astuko; Minamino, Tohru; Miyata, Tomoko; Namba, Keiichi; Konno, Hiroki; Ueno, Hiroshi; Imada, Katsumi; Yokoyama, Ken
2013-01-01
The V1- and F1- rotary ATPases contain a rotor that rotates against a catalytic A3B3 or α3β3 stator. The rotor F1-γ or V1-DF is composed of both anti-parallel coiled coil and globular-loop parts. The bacterial flagellar type III export apparatus contains a V1/F1-like ATPase ring structure composed of FliI6 homo-hexamer and FliJ which adopts an anti-parallel coiled coil structure without the globular-loop part. Here we report that FliJ of Salmonella enterica serovar Typhimurium shows a rotor like function in Thermus thermophilus A3B3 based on both biochemical and structural analysis. Single molecular analysis indicates that an anti-parallel coiled-coil structure protein (FliJ structure protein) functions as a rotor in A3B3. A rotary ATPase possessing an F1-γ-like protein generated by fusion of the D and F subunits of V1 rotates, suggesting F1-γ could be the result of a fusion of the genes encoding two separate rotor subunits. Together with sequence comparison among the globular part proteins, the data strongly suggest that the rotor domains of the rotary ATPases and the flagellar export apparatus share a common evolutionary origin. PMID:23724081
Effect of light wavelength on hot spring microbial mat biodiversity
Nishida, Akifumi; Thiel, Vera; Nakagawa, Mayuko; Ayukawa, Shotaro
2018-01-01
Hot spring associated phototrophic microbial mats are purely microbial communities, in which phototrophic bacteria function as primary producers and thus shape the community. The microbial mats at Nakabusa hot springs in Japan harbor diverse photosynthetic bacteria, mainly Thermosynechococcus, Chloroflexus, and Roseiflexus, which use light of different wavelength for energy conversion. The aim of this study was to investigate the effect of the phototrophs on biodiversity and community composition in hot spring microbial mats. For this, we specifically activated the different phototrophs by irradiating the mats with different wavelengths in situ. We used 625, 730, and 890 nm wavelength LEDs alone or in combination and confirmed the hypothesized increase in relative abundance of different phototrophs by 16S rRNA gene sequencing. In addition to the increase of the targeted phototrophs, we studied the effect of the different treatments on chemotrophic members. The specific activation of Thermosynechococcus led to increased abundance of several other bacteria, whereas wavelengths specific to Chloroflexus and Roseiflexus induced a decrease in >50% of the community members as compared to the dark conditions. This suggests that the growth of Thermosynechococcus at the surface layer benefits many community members, whereas less benefit is obtained from an increase in filamentous anoxygenic phototrophs Chloroflexus and Roseiflexus. The increases in relative abundance of chemotrophs under different light conditions suggest a relationship between the two groups. Aerobic chemoheterotrophs such as Thermus sp. and Meiothermus sp. are thought to benefit from aerobic conditions and organic carbon in the form of photosynthates by Thermosynechococcus, while the oxidation of sulfide and production of elemental sulfur by filamentous anoxygenic phototrophs benefit the sulfur-disproportionating Caldimicrobium thiodismutans. In this study, we used an experimental approach under controlled environmental conditions for the analysis of natural microbial communities, which proved to be a powerful tool to study interspecies relationships in the microbiome. PMID:29381713
Effect of light wavelength on hot spring microbial mat biodiversity.
Nishida, Akifumi; Thiel, Vera; Nakagawa, Mayuko; Ayukawa, Shotaro; Yamamura, Masayuki
2018-01-01
Hot spring associated phototrophic microbial mats are purely microbial communities, in which phototrophic bacteria function as primary producers and thus shape the community. The microbial mats at Nakabusa hot springs in Japan harbor diverse photosynthetic bacteria, mainly Thermosynechococcus, Chloroflexus, and Roseiflexus, which use light of different wavelength for energy conversion. The aim of this study was to investigate the effect of the phototrophs on biodiversity and community composition in hot spring microbial mats. For this, we specifically activated the different phototrophs by irradiating the mats with different wavelengths in situ. We used 625, 730, and 890 nm wavelength LEDs alone or in combination and confirmed the hypothesized increase in relative abundance of different phototrophs by 16S rRNA gene sequencing. In addition to the increase of the targeted phototrophs, we studied the effect of the different treatments on chemotrophic members. The specific activation of Thermosynechococcus led to increased abundance of several other bacteria, whereas wavelengths specific to Chloroflexus and Roseiflexus induced a decrease in >50% of the community members as compared to the dark conditions. This suggests that the growth of Thermosynechococcus at the surface layer benefits many community members, whereas less benefit is obtained from an increase in filamentous anoxygenic phototrophs Chloroflexus and Roseiflexus. The increases in relative abundance of chemotrophs under different light conditions suggest a relationship between the two groups. Aerobic chemoheterotrophs such as Thermus sp. and Meiothermus sp. are thought to benefit from aerobic conditions and organic carbon in the form of photosynthates by Thermosynechococcus, while the oxidation of sulfide and production of elemental sulfur by filamentous anoxygenic phototrophs benefit the sulfur-disproportionating Caldimicrobium thiodismutans. In this study, we used an experimental approach under controlled environmental conditions for the analysis of natural microbial communities, which proved to be a powerful tool to study interspecies relationships in the microbiome.
Siletsky, Sergey A; Belevich, Ilya; Soulimane, Tewfik; Verkhovsky, Michael I; Wikström, Mårten
2013-01-01
The time-resolved kinetics of membrane potential generation coupled to oxidation of the fully reduced (five-electron) caa(3) cytochrome oxidase from Thermus thermophilus by oxygen was studied in a single-turnover regime. In order to calibrate the number of charges that move across the vesicle membrane in the different reaction steps, the reverse electron transfer from heme a(3) to heme a and further to the cytochrome c/Cu(A) has been resolved upon photodissociation of CO from the mixed valence enzyme in the absence of oxygen. The reverse electron transfer from heme a(3) to heme a and further to the cytochrome c/Cu(A) pair is resolved as a single transition with τ~40 μs. In the reaction of the fully reduced cytochrome caa(3) with oxygen, the first electrogenic phase (τ~30 μs) is linked to OO bond cleavage and generation of the P(R) state. The next electrogenic component (τ~50 μs) is associated with the P(R)→F transition and together with the previous reaction step it is coupled to translocation of about two charges across the membrane. The three subsequent electrogenic phases, with time constants of ~0.25 ms, ~1.4 ms and ~4 ms, are linked to the conversion of the binuclear center through the F→O(H)→E(H) transitions, and result in additional transfer of four charges through the membrane dielectric. This indicates that the delivery of the fifth electron from heme c to the binuclear center is coupled to pumping of an additional proton across the membrane. Copyright © 2012 Elsevier B.V. All rights reserved.
Mallik, Saurav; Kundu, Sudip
2013-01-01
Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, S.M.; Pampa, K.J.; Manjula, M.
2014-06-20
Highlights: • We determined the structure of isocitrate dehydrogenase with citrate and cofactor. • The structure reveals a unique novel terminal domain involved in dimerization. • Clasp domain shows significant difference, and catalytic residues are conserved. • Oligomerization of the enzyme is quantized with subunit-subunit interactions. • Novel domain of this enzyme is classified as subfamily of the type IV. - Abstract: NADP{sup +} dependent isocitrate dehydrogenase (IDH) is an enzyme catalyzing oxidative decarboxylation of isocitrate into oxalosuccinate (intermediate) and finally the product α-ketoglutarate. The crystal structure of Thermus thermophilus isocitrate dehydrogenase (TtIDH) ternary complex with citrate and cofactor NADP{supmore » +} was determined using X-ray diffraction method to a resolution of 1.80 Å. The overall fold of this protein was resolved into large domain, small domain and a clasp domain. The monomeric structure reveals a novel terminal domain involved in dimerization, very unique and novel domain when compared to other IDH’s. And, small domain and clasp domain showing significant differences when compared to other IDH’s of the same sub-family. The structure of TtIDH reveals the absence of helix at the clasp domain, which is mainly involved in oligomerization in other IDH’s. Also, helices/beta sheets are absent in the small domain, when compared to other IDH’s of the same sub family. The overall TtIDH structure exhibits closed conformation with catalytic triad residues, Tyr144-Asp248-Lys191 are conserved. Oligomerization of the protein is quantized using interface area and subunit–subunit interactions between protomers. Overall, the TtIDH structure with novel terminal domain may be categorized as a first structure of subfamily of type IV.« less
Selvarajan, Ramganesh; Sibanda, Timothy; Tekere, Memory
2018-04-01
Microbial mats are occasionally reported in thermal springs and information on such mats is very scarce. In this study, microbial mats were collected from two hot springs (Brandvlei (BV) and Calitzdorp (CA)), South Africa and subjected to scanning electron microscopy (SEM) and targeted 16S rRNA gene amplicon analysis using Next Generation Sequencing (NGS). Spring water temperature was 55°C for Brandvlei and 58°C for Calitzdorp while the pH of both springs was slightly acidic, with an almost identical pH range (6.2-6.3). NGS analysis resulted in a total of 4943 reads, 517 and 736 OTUs for BV and CA at, respectively, a combined total of 14 different phyla in both samples, 88 genera in CA compared to 45 in BV and 37.64% unclassified sequences in CA compared to 27.32% recorded in BV. Dominant bacterial genera in CA microbial mat were Proteobacteria (29.19%), Bacteroidetes (9.41%), Firmicutes (9.01%), Cyanobacteria (6.89%), Actinobacteria (2.65%), Deinococcus-Thermus (2.57%), and Planctomycetes (1.94%) while the BV microbial mat was dominated by Bacteroidetes (47.3%), Deinococcus-Thermus (12.35%), Proteobacteria (7.98%), and Planctomycetes (2.97%). Scanning electron microscopy results showed the presence of microbial filaments possibly resembling cyanobacteria, coccids, rod-shaped bacteria and diatoms in both microbial mats. Dominant genera that were detected in this study have been linked to different biotechnological applications including hydrocarbon degradation, glycerol fermentation, anoxic-fermentation, dehalogenation, and biomining processes. Overall, the results of this study exhibited thermophilic bacterial community structures with high diversity in microbial mats, which have a potential for biotechnological exploitation. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Correlated Mutation in the Evolution of Catalysis in Uracil DNA Glycosylase Superfamily
NASA Astrophysics Data System (ADS)
Xia, Bo; Liu, Yinling; Guevara, Jose; Li, Jing; Jilich, Celeste; Yang, Ye; Wang, Liangjiang; Dominy, Brian N.; Cao, Weiguo
2017-04-01
Enzymes in Uracil DNA glycosylase (UDG) superfamily are essential for the removal of uracil. Family 4 UDGa is a robust uracil DNA glycosylase that only acts on double-stranded and single-stranded uracil-containing DNA. Based on mutational, kinetic and modeling analyses, a catalytic mechanism involving leaving group stabilization by H155 in motif 2 and water coordination by N89 in motif 3 is proposed. Mutual Information analysis identifies a complexed correlated mutation network including a strong correlation in the EG doublet in motif 1 of family 4 UDGa and in the QD doublet in motif 1 of family 1 UNG. Conversion of EG doublet in family 4 Thermus thermophilus UDGa to QD doublet increases the catalytic efficiency by over one hundred-fold and seventeen-fold over the E41Q and G42D single mutation, respectively, rectifying the strong correlation in the doublet. Molecular dynamics simulations suggest that the correlated mutations in the doublet in motif 1 position the catalytic H155 in motif 2 to stabilize the leaving uracilate anion. The integrated approach has important implications in studying enzyme evolution and protein structure and function.
Quéméneur, Marianne; Bes, Méline; Postec, Anne; Mei, Nan; Hamelin, Jérôme; Monnin, Christophe; Chavagnac, Valérie; Payri, Claude; Pelletier, Bernard; Guentas-Dombrowsky, Linda; Gérard, Martine; Pisapia, Céline; Gérard, Emmanuelle; Ménez, Bénédicte; Ollivier, Bernard; Erauso, Gaël
2014-12-01
The shallow submarine hydrothermal field of the Prony Bay (New Caledonia) discharges hydrogen- and methane-rich fluids with low salinity, temperature (< 40°C) and high pH (11) produced by the serpentinization reactions of the ultramafic basement into the lagoon seawater. They are responsible for the formation of carbonate chimneys at the lagoon seafloor. Capillary electrophoresis single-strand conformation polymorphism fingerprinting, quantitative polymerase chain reaction and sequence analysis of 16S rRNA genes revealed changes in microbial community structure, abundance and diversity depending on the location, water depth, and structure of the carbonate chimneys. The low archaeal diversity was dominated by few uncultured Methanosarcinales similar to those found in other serpentinization-driven submarine and subterrestrial ecosystems (e.g. Lost City, The Cedars). The most abundant and diverse bacterial communities were mainly composed of Chloroflexi, Deinococcus-Thermus, Firmicutes and Proteobacteria. Functional gene analysis revealed similar abundance and diversity of both Methanosarcinales methanoarchaea, and Desulfovibrionales and Desulfobacterales sulfate-reducers in the studied sites. Molecular studies suggest that redox reactions involving hydrogen, methane and sulfur compounds (e.g. sulfate) are the energy driving forces of the microbial communities inhabiting the Prony hydrothermal system.
Evolving a polymerase for hydrophobic base analogues.
Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp
2009-10-21
Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.
Abhinand, P A; Shaikh, Faraz; Bhakat, Soumendranath; Radadiya, Ashish; Bhaskar, L V K S; Shah, Anamik; Ragunath, P K
2016-01-01
Methylenetetrahydrofolate reductase (MTHFR) protein catalyzes the only biochemical reaction which produces methyltetrahydrofolate, the active form of folic acid essential for several molecular functions. The Ala222Val polymorphism of human MTHFR encodes a thermolabile protein associated with increased risk of neural tube defects and cardiovascular disease. Experimental studies have shown that the mutation does not affect the kinetic properties of MTHFR, but inactivates the protein by increasing flavin adenine dinucleotide (FAD) loss. The lack of completely solved crystal structure of MTHFR is an impediment in understanding the structural perturbations caused by the Ala222Val mutation; computational modeling provides a suitable alternative. The three-dimensional structure of human MTHFR protein was obtained through homology modeling, by taking the MTHFR structures from Escherichia coli and Thermus thermophilus as templates. Subsequently, the modeled structure was docked with FAD using Glide, which revealed a very good binding affinity, authenticated by a Glide XP score of -10.3983 (kcal mol(-1)). The MTHFR was mutated by changing Alanine 222 to Valine. The wild-type MTHFR-FAD complex and the Ala222Val mutant MTHFR-FAD complex were subjected to molecular dynamics simulation over 50 ns period. The average difference in backbone root mean square deviation (RMSD) between wild and mutant variant was found to be ~.11 Å. The greater degree of fluctuations in the mutant protein translates to increased conformational stability as a result of mutation. The FAD-binding ability of the mutant MTHFR was also found to be significantly lowered as a result of decreased protein grip caused by increased conformational flexibility. The study provides insights into the Ala222Val mutation of human MTHFR that induces major conformational changes in the tertiary structure, causing a significant reduction in the FAD-binding affinity.
Badhai, Jhasketan; Ghosh, Tarini S.; Das, Subrata K.
2015-01-01
This study describes microbial diversity in four tropical hot springs representing moderately thermophilic environments (temperature range: 40–58°C; pH: 7.2–7.4) with discrete geochemistry. Metagenome sequence data showed a dominance of Bacteria over Archaea; the most abundant phyla were Chloroflexi and Proteobacteria, although other phyla were also present, such as Acetothermia, Nitrospirae, Acidobacteria, Firmicutes, Deinococcus-Thermus, Bacteroidetes, Thermotogae, Euryarchaeota, Verrucomicrobia, Ignavibacteriae, Cyanobacteria, Actinobacteria, Planctomycetes, Spirochaetes, Armatimonadetes, Crenarchaeota, and Aquificae. The distribution of major genera and their statistical correlation analyses with the physicochemical parameters predicted that the temperature, aqueous concentrations of ions (such as sodium, chloride, sulfate, and bicarbonate), total hardness, dissolved solids and conductivity were the main environmental variables influencing microbial community composition and diversity. Despite the observed high taxonomic diversity, there were only little variations in the overall functional profiles of the microbial communities in the four springs. Genes involved in the metabolism of carbohydrates and carbon fixation were the most abundant functional class of genes present in these hot springs. The distribution of genes involved in carbon fixation predicted the presence of all the six known autotrophic pathways in the metagenomes. A high prevalence of genes involved in membrane transport, signal transduction, stress response, bacterial chemotaxis, and flagellar assembly were observed along with genes involved in the pathways of xenobiotic degradation and metabolism. The analysis of the metagenomic sequences affiliated to the candidate phylum Acetothermia from spring TB-3 provided new insight into the metabolism and physiology of yet-unknown members of this lineage of bacteria. PMID:26579081
Badhai, Jhasketan; Ghosh, Tarini S; Das, Subrata K
2015-01-01
This study describes microbial diversity in four tropical hot springs representing moderately thermophilic environments (temperature range: 40-58°C; pH: 7.2-7.4) with discrete geochemistry. Metagenome sequence data showed a dominance of Bacteria over Archaea; the most abundant phyla were Chloroflexi and Proteobacteria, although other phyla were also present, such as Acetothermia, Nitrospirae, Acidobacteria, Firmicutes, Deinococcus-Thermus, Bacteroidetes, Thermotogae, Euryarchaeota, Verrucomicrobia, Ignavibacteriae, Cyanobacteria, Actinobacteria, Planctomycetes, Spirochaetes, Armatimonadetes, Crenarchaeota, and Aquificae. The distribution of major genera and their statistical correlation analyses with the physicochemical parameters predicted that the temperature, aqueous concentrations of ions (such as sodium, chloride, sulfate, and bicarbonate), total hardness, dissolved solids and conductivity were the main environmental variables influencing microbial community composition and diversity. Despite the observed high taxonomic diversity, there were only little variations in the overall functional profiles of the microbial communities in the four springs. Genes involved in the metabolism of carbohydrates and carbon fixation were the most abundant functional class of genes present in these hot springs. The distribution of genes involved in carbon fixation predicted the presence of all the six known autotrophic pathways in the metagenomes. A high prevalence of genes involved in membrane transport, signal transduction, stress response, bacterial chemotaxis, and flagellar assembly were observed along with genes involved in the pathways of xenobiotic degradation and metabolism. The analysis of the metagenomic sequences affiliated to the candidate phylum Acetothermia from spring TB-3 provided new insight into the metabolism and physiology of yet-unknown members of this lineage of bacteria.
Dégut, Clément; Ponchon, Luc; Folly-Klan, Marcia; Barraud, Pierre; Tisné, Carine
2016-03-01
The enzymes of the TrmI family catalyze the formation of the m(1)A58 modification in tRNA. We previously solved the crystal structure of the Thermus thermophilus enzyme and conducted a biophysical study to characterize the interaction between TrmI and tRNA. TrmI enzymes are active as a tetramer and up to two tRNAs can bind to TrmI simultaneously. In this paper, we present the structures of two TrmI mutants (D170A and Y78A). These residues are conserved in the active site of TrmIs and their mutations result in a dramatic alteration of TrmI activity. Both structures of TrmI mutants revealed the flexibility of the N-terminal domain that is probably important to bind tRNA. The structure of TrmI Y78A catalytic domain is unmodified regarding the binding of the SAM co-factor and the conformation of residues potentially interacting with the substrate adenine. This structure reinforces the previously proposed role of Y78, i.e. stabilize the conformation of the A58 ribose needed to hold the adenosine in the active site. The structure of the D170A mutant shows a flexible active site with one loop occupying in part the place of the co-factor and the second loop moving at the entrance to the active site. This structure and recent data confirms the central role of D170 residue binding the amino moiety of SAM and the exocyclic amino group of adenine. Possible mechanisms for methyl transfer are then discussed. Copyright © 2015 Elsevier B.V. All rights reserved.
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity
Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.
2016-01-01
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; ...
2016-01-24
Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.
Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less
Moldes, Cristina; García, José L; García, Pedro
2004-08-01
The thermophilic inorganic pyrophosphatase (Pyr) from Thermus thermophilus has been produced in Escherichia coli fused to the C terminus of the choline-binding tag (ChB tag) derived from the choline-binding domain (ChBD) of pneumococcal LytA autolysin. The chimeric ChBD-Pyr protein retains its thermostable activity and can be purified in a single step by DEAE-cellulose affinity chromatography. Pyr can be further released from the ChBD by thrombin, using the specific protease recognition site incorporated in the C terminus of this tag. Remarkably, the ChB tag provides a selective and very strong thermostable noncovalent immobilization of ChBD-Pyr in the DEAE-cellulose matrix. The binding of choline or choline analogues, such as DEAE, confers a high thermal stability to this tag; therefore, the immobilized chimeric enzyme can be assayed at high temperature without protein leakage, demonstrating the usefulness of the ChB tag for noncovalent immobilization of thermophilic proteins. Moreover, ChBD-Pyr can be purified and immobilized in a single step on commercial DEAE-cellulose paper. The affinity of the ChB tag for this versatile solid support can be very helpful in developing many biotechnological applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ni, Shuisong; Robinson, Howard; Marsing, Gregory C.
2004-11-01
1. Introduction Enzymes in the non-mevalonate pathway for isoprenoid synthesis have gained recent attention because of their potential value as targets for antibiotic drug development. 2C-methyl-D-erythritol-2,4 cyclophosphate (MECDP) synthase is the fifth enzyme in the seven enzyme non-mevalonate pathway for synthesis of isopentenyl diphosphate. Four groups have published structures of MECDP synthase at resolutions varying from 1.6Å to 2.8Å, either in the presence or absence of substrate from Escherichia coli (Richard et al., 2002; Kemp et al., 2002; Steinbacher et al., 2002) or from Thermus thermophilus (Kishida et al., 2003). Among these structures, the protein always exists as a homotrimermore » either with a crystallographic or a non-crystallographic three-fold symmetry axis and an active site formed in a cleft between adjacent monomers. While the overall shape of the proteins is highly similar among these structures, each of the four reported structures contain different combinations of metal ions in the active site including a Zn2+ ion only (Steinbacher et al., 2002), a Mn2+ ion only (Richard et al., 2002), Zn2+ and Mn2+ ions (Kemp et al., 2002) or two Mg2+ ions (Kishida et al., 2003). Furthermore, two of the structures are reported to contain a hydrophobic channel along the three-fold symmetry axis that is capped by a cluster of three arginine side chains (one from each monomer) at one end of the cavity and a cluster of three glutamic acid side chains (one from each monomer) at the other side of the cavity. In a 1.8Å resolution structure, Kemp et al. (2002) reported a sulfate ion coordinated to the arginine cap and solvent trapped in a hydrophobic cavity. In a lower 2.8Å resolution structure, Richard et al. (2002) concluded that geranyl diphosphate, GPP, was most likely trapped by the arginine cap and hydrophobic cavity (Richard et al., 2002), however, the low resolution of the data together with the presence of the crystallographic symmetry axis prohibited a definitive analysis of the identity and mode of binding of the bound molecule. Kishida et al. (2003) reported that no cavity existed in a 1.6Å structure of the SO3437 homolog from Thermus thermophilus, presumably due to tighter packing of the protein from the thermophilic organism. Steinbacher et al. (2002) make no description of a hydrophobic cavity in a lower resolution (2.5-3.2Å) of the Escherichia coli protein. Here, we report a high-resolution (1.6Å) structure of MECDP synthase from Shewanella oneidensis in the absence of substrate in the active site. We provide unambiguous data that confirms the presence of Zn2+ in one of the metal binding sites and observe what appears to be farnesyl diphosphate (FPP) bound in the hydrophobic cavity along the non-crystallographic three-fold symmetry axis of the homotrimer. The high-resolution structure clarifies the mode of binding of the pyrophosphate of FPP in the arginine cluster that caps the hydrophobic cavity.« less
Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation
Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; ...
2016-11-24
Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. A multitude of technologies, abstractions, and interpretive frameworks have emerged to answer the challenges presented by genome function and regulatory network inference. Here, we propose a new approach for producing biologically meaningful clusters of coexpressed genes, called Atomic Regulons (ARs), based on expression data, gene context, and functional relationships. We demonstrate this new approach by computing ARs for Escherichia coli, which we compare with the coexpressed gene clusters predicted by two prevalent existing methods: hierarchical clustering and k-meansmore » clustering. We test the consistency of ARs predicted by all methods against expected interactions predicted by the Context Likelihood of Relatedness (CLR) mutual information based method, finding that the ARs produced by our approach show better agreement with CLR interactions. We then apply our method to compute ARs for four other genomes: Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus. We compare the AR clusters from all genomes to study the similarity of coexpression among a phylogenetically diverse set of species, identifying subsystems that show remarkable similarity over wide phylogenetic distances. We also study the sensitivity of our method for computing ARs to the expression data used in the computation, showing that our new approach requires less data than competing approaches to converge to a near final configuration of ARs. We go on to use our sensitivity analysis to identify the specific experiments that lead most rapidly to the final set of ARs for E. coli. As a result, this analysis produces insights into improving the design of gene expression experiments.« less
Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.
Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. A multitude of technologies, abstractions, and interpretive frameworks have emerged to answer the challenges presented by genome function and regulatory network inference. Here, we propose a new approach for producing biologically meaningful clusters of coexpressed genes, called Atomic Regulons (ARs), based on expression data, gene context, and functional relationships. We demonstrate this new approach by computing ARs for Escherichia coli, which we compare with the coexpressed gene clusters predicted by two prevalent existing methods: hierarchical clustering and k-meansmore » clustering. We test the consistency of ARs predicted by all methods against expected interactions predicted by the Context Likelihood of Relatedness (CLR) mutual information based method, finding that the ARs produced by our approach show better agreement with CLR interactions. We then apply our method to compute ARs for four other genomes: Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus. We compare the AR clusters from all genomes to study the similarity of coexpression among a phylogenetically diverse set of species, identifying subsystems that show remarkable similarity over wide phylogenetic distances. We also study the sensitivity of our method for computing ARs to the expression data used in the computation, showing that our new approach requires less data than competing approaches to converge to a near final configuration of ARs. We go on to use our sensitivity analysis to identify the specific experiments that lead most rapidly to the final set of ARs for E. coli. As a result, this analysis produces insights into improving the design of gene expression experiments.« less
Proton transfer in the K-channel analog of B-type Cytochrome c oxidase from Thermus thermophilus.
Woelke, Anna Lena; Wagner, Anke; Galstyan, Gegham; Meyer, Tim; Knapp, Ernst-Walter
2014-11-04
A key enzyme in aerobic metabolism is cytochrome c oxidase (CcO), which catalyzes the reduction of molecular oxygen to water in the mitochondrial and bacterial membranes. Substrate electrons and protons are taken up from different sides of the membrane and protons are pumped across the membrane, thereby generating an electrochemical gradient. The well-studied A-type CcO uses two different entry channels for protons: the D-channel for all pumped and two consumed protons, and the K-channel for the other two consumed protons. In contrast, the B-type CcO uses only a single proton input channel for all consumed and pumped protons. It has the same location as the A-type K-channel (and thus is named the K-channel analog) without sharing any significant sequence homology. In this study, we performed molecular-dynamics simulations and electrostatic calculations to characterize the K-channel analog in terms of its energetic requirements and functionalities. The function of Glu-15B as a proton sink at the channel entrance is demonstrated by its rotational movement out of the channel when it is deprotonated and by its high pKA value when it points inside the channel. Tyr-244 in the middle of the channel is identified as the valve that ensures unidirectional proton transfer, as it moves inside the hydrogen-bond gap of the K-channel analog only while being deprotonated. The electrostatic energy landscape was calculated for all proton-transfer steps in the K-channel analog, which functions via proton-hole transfer. Overall, the K-channel analog has a very stable geometry without large energy barriers.
Proton Transfer in the K-Channel Analog of B-Type Cytochrome c Oxidase from Thermus thermophilus
Woelke, Anna Lena; Wagner, Anke; Galstyan, Gegham; Meyer, Tim; Knapp, Ernst-Walter
2014-01-01
A key enzyme in aerobic metabolism is cytochrome c oxidase (CcO), which catalyzes the reduction of molecular oxygen to water in the mitochondrial and bacterial membranes. Substrate electrons and protons are taken up from different sides of the membrane and protons are pumped across the membrane, thereby generating an electrochemical gradient. The well-studied A-type CcO uses two different entry channels for protons: the D-channel for all pumped and two consumed protons, and the K-channel for the other two consumed protons. In contrast, the B-type CcO uses only a single proton input channel for all consumed and pumped protons. It has the same location as the A-type K-channel (and thus is named the K-channel analog) without sharing any significant sequence homology. In this study, we performed molecular-dynamics simulations and electrostatic calculations to characterize the K-channel analog in terms of its energetic requirements and functionalities. The function of Glu-15B as a proton sink at the channel entrance is demonstrated by its rotational movement out of the channel when it is deprotonated and by its high pKA value when it points inside the channel. Tyr-244 in the middle of the channel is identified as the valve that ensures unidirectional proton transfer, as it moves inside the hydrogen-bond gap of the K-channel analog only while being deprotonated. The electrostatic energy landscape was calculated for all proton-transfer steps in the K-channel analog, which functions via proton-hole transfer. Overall, the K-channel analog has a very stable geometry without large energy barriers. PMID:25418102
Aerobic microbial taxa dominate deep subsurface cores from the Alberta oil sands.
Ridley, Christina M; Voordouw, Gerrit
2018-06-01
Little is known about the microbial ecology of the subsurface oil sands in Northern Alberta, Canada. Biodegradation of low molecular weight hydrocarbons by indigenous microbes has enriched high molecular weight hydrocarbons, resulting in highly viscous bitumen. This extreme subsurface environment is further characterized by low nutrient availability and limited access to water, thus resulting in low microbial biomass. Improved DNA isolation protocols and increasingly sensitive sequencing methods have allowed an in-depth investigation of the microbial ecology of this unique subsurface environmental niche. Community analysis was performed on core samples (n = 62) that were retrieved from two adjacent sites located in the Athabasca Oil Sands at depths from 220 to 320 m below the surface. Microbial communities were dominated by aerobic taxa, including Pseudomonas and Acinetobacter. Only one core sample microbial community was dominated by anaerobic taxa, including the methanogen Methanoculleus, as well as Desulfomicrobium and Thauera. Although the temperature of the bitumen-containing subsurface is low (8°C), two core samples had high fractions of the potentially thermophilic taxon, Thermus. Predominance of aerobic taxa in the subsurface suggests the potential for in situ aerobic hydrocarbon degradation; however, more studies are required to determine the functional role of these taxa within this unique environment.
Phylogeny of Rieske/cytb Complexes with a Special Focus on the Haloarchaeal Enzymes
Baymann, Frauke; Schoepp-Cothenet, Barbara; Lebrun, Evelyne; van Lis, Robert; Nitschke, Wolfgang
2012-01-01
Rieske/cytochrome b (Rieske/cytb) complexes are proton pumping quinol oxidases that are present in most bacteria and Archaea. The phylogeny of their subunits follows closely the 16S-rRNA phylogeny, indicating that chemiosmotic coupling was already present in the last universal common ancestor of Archaea and bacteria. Haloarchaea are the only organisms found so far that acquired Rieske/cytb complexes via interdomain lateral gene transfer. They encode two Rieske/cytb complexes in their genomes; one of them is found in genetic context with nitrate reductase genes and has its closest relatives among Actinobacteria and the Thermus/Deinococcus group. It is likely to function in nitrate respiration. The second Rieske/cytb complex of Haloarchaea features a split cytochrome b sequence as do Cyanobacteria, chloroplasts, Heliobacteria, and Bacilli. It seems that Haloarchaea acquired this complex from an ancestor of the above-mentioned phyla. Its involvement in the bioenergetic reaction chains of Haloarchaea is unknown. We present arguments in favor of the hypothesis that the ancestor of Haloarchaea, which relied on a highly specialized bioenergetic metabolism, that is, methanogenesis, and was devoid of quinones and most enzymes of anaerobic or aerobic bioenergetic reaction chains, integrated laterally transferred genes into its genome to respond to a change in environmental conditions that made methanogenesis unfavorable. PMID:22798450
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, Jaslyn E. M. M.; Midtgaard, Søren Roi; Gysel, Kira
The crystal and solution structures of the T. thermophilus NlpC/P60 d, l-endopeptidase as well as the co-crystal structure of its N-terminal LysM domains bound to chitohexaose allow a proposal to be made regarding how the enzyme recognizes peptidoglycan. LysM domains, which are frequently present as repetitive entities in both bacterial and plant proteins, are known to interact with carbohydrates containing N-acetylglucosamine (GlcNAc) moieties, such as chitin and peptidoglycan. In bacteria, the functional significance of the involvement of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of themore » Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering solution studies of this endopeptidase revealed the presence of a homodimer. The structure of the two LysM domains co-crystallized with N-acetyl-chitohexaose revealed a new intermolecular binding mode that may explain the differential interaction between LysM domains and short or long chitin oligomers. By combining the structural information with the three-dimensional model of peptidoglycan, a model suggesting how protein dimerization enhances the recognition of peptidoglycan is proposed.« less
Schubotz, Florence; Hays, Lindsay E; Meyer-Dombard, D'Arcy R; Gillespie, Aimee; Shock, Everett L; Summons, Roger E
2015-01-01
Streamer biofilm communities (SBC) are often observed within chemosynthetic zones of Yellowstone hot spring outflow channels, where temperatures exceed those conducive to photosynthesis. Nearest the hydrothermal source (75-88°C) SBC comprise thermophilic Archaea and Bacteria, often mixed communities including Desulfurococcales and uncultured Crenarchaeota, as well as Aquificae and Thermus, each carrying diagnostic membrane lipid biomarkers. We tested the hypothesis that SBC can alternate their metabolism between autotrophy and heterotrophy depending on substrate availability. Feeding experiments were performed at two alkaline hot springs in Yellowstone National Park: Octopus Spring and "Bison Pool," using various (13)C-labeled substrates (bicarbonate, formate, acetate, and glucose) to determine the relative uptake of these different carbon sources. Highest (13)C uptake, at both sites, was from acetate into almost all bacterial fatty acids, particularly into methyl-branched C15, C17 and C19 fatty acids that are diagnostic for Thermus/Meiothermus, and some Firmicutes as well as into universally common C16:0 and C18:0 fatty acids. (13)C-glucose showed a similar, but a 10-30 times lower uptake across most fatty acids. (13)C-bicarbonate uptake, signifying the presence of autotrophic communities was only significant at "Bison Pool" and was observed predominantly in non-specific saturated C16, C18, C20, and C22 fatty acids. Incorporation of (13)C-formate occurred only at very low rates at "Bison Pool" and was almost undetectable at Octopus Spring, suggesting that formate is not an important carbon source for SBC. (13)C-uptake into archaeal lipids occurred predominantly with (13)C-acetate, suggesting also that archaeal communities at both springs have primarily heterotrophic carbon assimilation pathways. We hypothesize that these communities are energy-limited and predominantly nurtured by input of exogenous organic material, with only a small fraction being sustained by autotrophic growth.
Togawa, Yoichiro; Nunoshiba, Tatsuo; Hiratsu, Keiichiro
2018-02-01
Markerless gene-disruption technology is particularly useful for effective genetic analyses of Thermus thermophilus (T. thermophilus), which have a limited number of selectable markers. In an attempt to develop a novel system for the markerless disruption of genes in T. thermophilus, we applied a Cre/lox system to construct a triple gene disruptant. To achieve this, we constructed two genetic tools, a loxP-htk-loxP cassette and cre-expressing plasmid, pSH-Cre, for gene disruption and removal of the selectable marker by Cre-mediated recombination. We found that the Cre/lox system was compatible with the proliferation of the T. thermophilus HB27 strain at the lowest growth temperature (50 °C), and thus succeeded in establishing a triple gene disruptant, the (∆TTC1454::loxP, ∆TTC1535KpnI::loxP, ∆TTC1576::loxP) strain, without leaving behind a selectable marker. During the process of the sequential disruption of multiple genes, we observed the undesired deletion and inversion of the chromosomal region between multiple loxP sites that were induced by Cre-mediated recombination. Therefore, we examined the effects of a lox66-htk-lox71 cassette by exploiting the mutant lox sites, lox66 and lox71, instead of native loxP sites. We successfully constructed a (∆TTC1535::lox72, ∆TTC1537::lox72) double gene disruptant without inducing the undesired deletion of the 0.7-kbp region between the two directly oriented lox72 sites created by the Cre-mediated recombination of the lox66-htk-lox71 cassette. This is the first demonstration of a Cre/lox system being applicable to extreme thermophiles in a genetic manipulation. Our results indicate that this system is a powerful tool for multiple markerless gene disruption in T. thermophilus.
Krefft, Daria; Papkov, Aliaksei; Prusinowski, Maciej; Zylicz-Stachula, Agnieszka; Skowron, Piotr M
2018-05-11
Acoustic or hydrodynamic shearing, sonication and enzymatic digestion are used to fragment DNA. However, these methods have several disadvantages, such as DNA damage, difficulties in fragmentation control, irreproducibility and under-representation of some DNA segments. The DNA fragmentation tool would be a gentle enzymatic method, offering cleavage frequency high enough to eliminate DNA fragments distribution bias and allow for easy control of partial digests. Only three such frequently cleaving natural restriction endonucleases (REases) were discovered: CviJI, SetI and FaiI. Therefore, we have previously developed two artificial enzymatic specificities, cleaving DNA approximately every ~ 3-bp: TspGWI/sinefungin (SIN) and TaqII/SIN. In this paper we present the third developed specificity: TthHB27I/SIN(SAM) - a new genomic tool, based on Type IIS/IIC/IIG Thermus-family REases-methyltransferases (MTases). In the presence of dimethyl sulfoxide (DMSO) and S-adenosyl-L-methionine (SAM) or its analogue SIN, the 6-bp cognate TthHB27I recognition sequence 5'-CAARCA-3' is converted into a combined 3.2-3.0-bp 'site' or its statistical equivalent, while a cleavage distance of 11/9 nt is retained. Protocols for various modes of limited DNA digestions were developed. In the presence of DMSO and SAM or SIN, TthHB27I is transformed from rare 6-bp cutter to a very frequent one, approximately 3-bp. Thus, TthHB27I/SIN(SAM) comprises a new tool in the very low-represented segment of such prototype REases specificities. Moreover, this modified TthHB27I enzyme is uniquely suited for controlled DNA fragmentation, due to partial DNA cleavage, which is an inherent feature of the Thermus-family enzymes. Such tool can be used for quasi-random libraries generation as well as for other DNA manipulations, requiring high frequency cleavage and uniform distribution of cuts along DNA.
Complete Genome of the Starch-Degrading Myxobacteria Sandaracinus amylolyticus DSM 53668T
Sharma, Gaurav; Khatri, Indu; Subramanian, Srikrishna
2016-01-01
Myxobacteria are members of δ-proteobacteria and are typified by large genomes, well-coordinated social behavior, gliding motility, and starvation-induced fruiting body formation. Here, we report the 10.33 Mb whole genome of a starch-degrading myxobacterium Sandaracinus amylolyticus DSM 53668T that encodes 8,962 proteins, 56 tRNA, and two rRNA operons. Phylogenetic analysis, in silico DNA-DNA hybridization and average nucleotide identity reveal its divergence from other myxobacterial species and support its taxonomic characterization into a separate family Sandaracinaceae, within the suborder Sorangiineae. Sequence similarity searches using the Carbohydrate-active enzymes (CAZyme) database help identify the enzyme repertoire of S. amylolyticus involved in starch, agar, chitin, and cellulose degradation. We identified 16 α-amylases and two γ-amylases in the S. amylolyticus genome that likely play a role in starch degradation. While many of the amylases are seen conserved in other δ-proteobacteria, we notice several novel amylases acquired via horizontal transfer from members belonging to phylum Deinococcus-Thermus, Acidobacteria, and Cyanobacteria. No agar degrading enzyme(s) were identified in the S. amylolyticus genome. Interestingly, several putative β-glucosidases and endoglucanases proteins involved in cellulose degradation were identified. However, the absence of cellobiohydrolases/exoglucanases corroborates with the lack of cellulose degradation by this bacteria. PMID:27358428
Bacterial and archaeal diversities in Yunnan and Tibetan hot springs, China.
Song, Zhao-Qi; Wang, Feng-Ping; Zhi, Xiao-Yang; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Tang, Shu-Kun; Jiang, Hong-Chen; Zhang, Chuanlun L; Dong, Hailiang; Li, Wen-Jun
2013-04-01
Thousands of hot springs are located in the north-eastern part of the Yunnan-Tibet geothermal zone, which is one of the most active geothermal areas in the world. However, a comprehensive and detailed understanding of microbial diversity in these hot springs is still lacking. In this study, bacterial and archaeal diversities were investigated in 16 hot springs (pH 3.2-8.6; temperature 47-96°C) in Yunnan Province and Tibet, China by using a barcoded 16S rRNA gene-pyrosequencing approach. Aquificae, Proteobacteria, Firmicutes, Deinococcus-Thermus and Bacteroidetes comprised the large portion of the bacterial communities in acidic hot springs. Non-acidic hot springs harboured more and variable bacterial phyla than acidic springs. Desulfurococcales and unclassified Crenarchaeota were the dominated groups in archaeal populations from most of the non-acidic hot springs; whereas, the archaeal community structure in acidic hot springs was simpler and characterized by Sulfolobales and Thermoplasmata. The phylogenetic analyses showed that Aquificae and Crenarchaeota were predominant in the investigated springs and possessed many phylogenetic lineages that have never been detected in other hot springs in the world. Thus findings from this study significantly improve our understanding of microbial diversity in terrestrial hot springs. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Kaluarachchi, Harini; Altenstein, Matthias; Sugumar, Sonia R; Balbach, Jochen; Zamble, Deborah B; Haupt, Caroline
2012-03-16
SlyD (sensitive to lysis D) is a nickel metallochaperone involved in the maturation of [NiFe]-hydrogenases in Escherichia coli (E. coli) and specifically contributes to the nickel delivery step during enzyme biosynthesis. This protein contains a C-terminal metal-binding domain that is rich in potential metal-binding residues that enable SlyD to bind multiple nickel ions with high affinity. The SlyD homolog from Thermus thermophilus does not contain the extended cysteine- and histidine-rich C-terminal tail of the E. coli protein, yet it binds a single Ni(II) ion tightly. To investigate whether a single metal-binding motif can functionally replace the full-length domain, we generated a truncation of E. coli SlyD, SlyD155. Ni(II) binding to SlyD155 was investigated by using isothermal titration calorimetry, NMR and electrospray ionization mass spectrometry measurements. This in vitro characterization revealed that SlyD155 contains a single metal-binding motif with high affinity for nickel. Structural characterization by X-ray absorption spectroscopy and NMR indicated that nickel was coordinated in an octahedral geometry with at least two histidines as ligands. Heterodimerization between SlyD and another hydrogenase accessory protein, HypB, is essential for optimal hydrogenase maturation and was confirmed for SlyD155 via cross-linking experiments and NMR titrations, as were conserved chaperone and peptidyl-prolyl isomerase activities. Although these properties of SlyD are preserved in the truncated version, it does not modulate nickel binding to HypB in vitro or contribute to the maturation of [NiFe]-hydrogenases in vivo, unlike the full-length protein. This study highlights the importance of the unusual metal-binding domain of E. coli SlyD in hydrogenase biogenesis. Copyright © 2012 Elsevier Ltd. All rights reserved.
Restiawaty, Elvi; Honda, Kohsuke; Okano, Kenji; Hirota, Ryuichi; Omasa, Takeshi; Kuroda, Akio; Ohtake, Hisao
2012-04-01
We previously demonstrated the stoichiometric conversion of glycerol to glycerol-3-phosphate (G3P) using Escherichia coli recombinants producing the ATP-dependent glycerol kinase of the hyperthermophile Thermococcus kodakaraensis (TkGK) and the polyphosphate kinase of Thermus thermophilus HB27 (TtPPK). TtPPK was associated with the membrane fraction of E. coli recombinants, whereas TkGK was released from the cells during the reaction at 70°C. In this study, TkGK was fused with either TtPPK or an E. coli membrane-intrinsic protein, YedZ, to minimize the heat-induced leakage of TkGK. When the E. coli recombinants having these fusion proteins were incubated at 70°C for 2h, more than 80% of TkGK activity was retained in the heated E. coli cells. However, the yields of G3P production by E. coli having the fusion proteins of TtPPK and TkGK were only less than 35%. Polyphosphate is a strong chelator for metal ions and has an inhibitory effect on TkGK which requires magnesium. Insufficient space between TtPPK and TkGK might enhance the inhibitory effect of polyphosphate on TkGK activity of the fusion protein. The mixture of E. coli cells having TtPPK and those having TkGK fused with YedZ converted 80% of glycerol into G3P. These recombinant cells could be easily recovered from the reaction mixture by centrifugation and repeatedly used without a significant loss of enzyme activities. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Essentiality of threonylcarbamoyladenosine (t6A), a universal tRNA modification, in bacteria
Thiaville, Patrick C.; Yacoubi, Basma El; Köhrer, Caroline; Thiaville, Jennifer J.; Deutsch, Chris; Iwata-Reuyl, Dirk; Bacusmo, Jo Marie; Armengaud, Jean; Bessho, Yoshitaka; Wetzel, Collin; Cao, Xiaoyu; Limbach, Patrick A.; RajBhandary, Uttam L.; de Crécy-Lagard, Valérie
2016-01-01
Threonylcarbamoyladenosine (t6A) is a modified nucleoside universally conserved in tRNAs in all three kingdoms of life. The recently discovered genes for t6A synthesis, including tsaC and tsaD, are essential in model prokaryotes but not essential in yeast. These genes had been identified as antibacterial targets even before their functions were known. However, the molecular basis for this prokaryotic-specific essentiality has remained a mystery. Here, we show that t6A is a strong positive determinant for aminoacylation of tRNA by bacterial-type but not by eukaryotic-type isoleucyl-tRNA synthetases and might also be a determinant for the essential enzyme tRNAIle-lysidine synthetase. We confirm that t6A is essential in Escherichia coli and a survey of genome-wide essentiality studies shows that genes for t6A synthesis are essential in most prokaryotes. This essentiality phenotype is not universal in Bacteria as t6A is dispensable in Deinococcus radiodurans, Thermus thermophilus, Synechocystis PCC6803 and Streptococcus mutans. Proteomic analysis of t6A- D. radiodurans strains revealed an induction of the proteotoxic stress response and identified genes whose translation is most affected by the absence of t6A in tRNAs. Thus, although t6A is universally conserved in tRNAs, its role in translation might vary greatly between organisms. PMID:26337258
Guymon, Rebecca; Pomerantz, Steven C.; Ison, J. Nicholas; Crain, Pamela F.; McCloskey, James A.
2007-01-01
Post-transcriptional modifications of RNA are nearly ubiquitous in the principal RNAs involved in translation. However, in the case of rRNA the functional roles of modification are far less established than for tRNA, and are subject to less knowledge in terms of specific nucleoside identities and their sequence locations. Post-transcriptional modifications have been studied in the SSU rRNA from Thermotoga maritima (optimal growth 80°C), one of the most deeply branched organisms in the Eubacterial phylogenetic tree. A total of 10 different modified nucleosides were found, the greatest number reported for bacterial SSU rRNA, occupying a net of ∼14 sequence sites, compared with a similar number of sites recently reported for Thermus thermophilus and 11 for Escherichia coli. The relatively large number of modifications in Thermotoga offers modest support for the notion that thermophile rRNAs are more extensively modified than those from mesophiles. Seven of the Thermotoga modified sites are identical (location and identity) to those in E. coli. An unusual derivative of cytidine was found, designated N-330 (M r 330.117), and was sequenced to position 1404 in the decoding region of the rRNA. It was unexpectedly found to be identical to an earlier reported nucleoside of unknown structure at the same location in the SSU RNA of the archaeal mesophile Haloferax volcanii. PMID:17255199
Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp
2006-08-18
DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.
Coupling of anaerobic waste treatment to produce protein- and lipid-rich bacterial biomass.
Steinberg, Lisa M; Kronyak, Rachel E; House, Christopher H
2017-11-01
Future long-term manned space missions will require effective recycling of water and nutrients as part of a life support system. Biological waste treatment is less energy intensive than physicochemical treatment methods, yet anaerobic methanogenic waste treatment has been largely avoided due to slow treatment rates and safety issues concerning methane production. However, methane is generated during atmosphere regeneration on the ISS. Here we propose waste treatment via anaerobic digestion followed by methanotrophic growth of Methylococcus capsulatus to produce a protein- and lipid-rich biomass that can be directly consumed, or used to produce other high-protein food sources such as fish. To achieve more rapid methanogenic waste treatment, we built and tested a fixed-film, flow-through, anaerobic reactor to treat an ersatz wastewater. During steady-state operation, the reactor achieved a 97% chemical oxygen demand (COD) removal rate with an organic loading rate of 1740 g d -1 m -3 and a hydraulic retention time of 12.25 d. The reactor was also tested on three occasions by feeding ca. 500 g COD in less than 12 h, representing 50x the daily feeding rate, with COD removal rates ranging from 56-70%, demonstrating the ability of the reactor to respond to overfeeding events. While investigating the storage of treated reactor effluent at a pH of 12, we isolated a strain of Halomonas desiderata capable of acetate degradation under high pH conditions. We then tested the nutritional content of the alkaliphilic Halomonas desiderata strain, as well as the thermophile Thermus aquaticus, as supplemental protein and lipid sources that grow in conditions that should preclude pathogens. The M. capsulatus biomass consisted of 52% protein and 36% lipids, the H. desiderata biomass consisted of 15% protein and 7% lipids, and the Thermus aquaticus biomass consisted of 61% protein and 16% lipids. This work demonstrates the feasibility of rapid waste treatment in a compact reactor design, and proposes recycling of nutrients back into foodstuffs via heterotrophic (including methanotrophic, acetotrophic, and thermophilic) microbial growth. Copyright © 2017. Published by Elsevier Ltd.
Coupling of anaerobic waste treatment to produce protein- and lipid-rich bacterial biomass
NASA Astrophysics Data System (ADS)
Steinberg, Lisa M.; Kronyak, Rachel E.; House, Christopher H.
2017-11-01
Future long-term manned space missions will require effective recycling of water and nutrients as part of a life support system. Biological waste treatment is less energy intensive than physicochemical treatment methods, yet anaerobic methanogenic waste treatment has been largely avoided due to slow treatment rates and safety issues concerning methane production. However, methane is generated during atmosphere regeneration on the ISS. Here we propose waste treatment via anaerobic digestion followed by methanotrophic growth of Methylococcus capsulatus to produce a protein- and lipid-rich biomass that can be directly consumed, or used to produce other high-protein food sources such as fish. To achieve more rapid methanogenic waste treatment, we built and tested a fixed-film, flow-through, anaerobic reactor to treat an ersatz wastewater. During steady-state operation, the reactor achieved a 97% chemical oxygen demand (COD) removal rate with an organic loading rate of 1740 g d-1 m-3 and a hydraulic retention time of 12.25 d. The reactor was also tested on three occasions by feeding ca. 500 g COD in less than 12 h, representing 50x the daily feeding rate, with COD removal rates ranging from 56-70%, demonstrating the ability of the reactor to respond to overfeeding events. While investigating the storage of treated reactor effluent at a pH of 12, we isolated a strain of Halomonas desiderata capable of acetate degradation under high pH conditions. We then tested the nutritional content of the alkaliphilic Halomonas desiderata strain, as well as the thermophile Thermus aquaticus, as supplemental protein and lipid sources that grow in conditions that should preclude pathogens. The M. capsulatus biomass consisted of 52% protein and 36% lipids, the H. desiderata biomass consisted of 15% protein and 7% lipids, and the Thermus aquaticus biomass consisted of 61% protein and 16% lipids. This work demonstrates the feasibility of rapid waste treatment in a compact reactor design, and proposes recycling of nutrients back into foodstuffs via heterotrophic (including methanotrophic, acetotrophic, and thermophilic) microbial growth.
Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation
Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert D.; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron A.; DeJongh, Matthew; Tintle, Nathan L.; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.
2016-01-01
Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. An important step toward meeting the challenge of understanding gene function and regulation is the identification of sets of genes that are always co-expressed. These gene sets, Atomic Regulons (ARs), represent fundamental units of function within a cell and could be used to associate genes of unknown function with cellular processes and to enable rational genetic engineering of cellular systems. Here, we describe an approach for inferring ARs that leverages large-scale expression data sets, gene context, and functional relationships among genes. We computed ARs for Escherichia coli based on 907 gene expression experiments and compared our results with gene clusters produced by two prevalent data-driven methods: Hierarchical clustering and k-means clustering. We compared ARs and purely data-driven gene clusters to the curated set of regulatory interactions for E. coli found in RegulonDB, showing that ARs are more consistent with gold standard regulons than are data-driven gene clusters. We further examined the consistency of ARs and data-driven gene clusters in the context of gene interactions predicted by Context Likelihood of Relatedness (CLR) analysis, finding that the ARs show better agreement with CLR predicted interactions. We determined the impact of increasing amounts of expression data on AR construction and find that while more data improve ARs, it is not necessary to use the full set of gene expression experiments available for E. coli to produce high quality ARs. In order to explore the conservation of co-regulated gene sets across different organisms, we computed ARs for Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus, each of which represents increasing degrees of phylogenetic distance from E. coli. Comparison of the organism-specific ARs showed that the consistency of AR gene membership correlates with phylogenetic distance, but there is clear variability in the regulatory networks of closely related organisms. As large scale expression data sets become increasingly common for model and non-model organisms, comparative analyses of atomic regulons will provide valuable insights into fundamental regulatory modules used across the bacterial domain. PMID:27933038
Zhu, Hu; Liu, Jianguo; Qu, Jianbo; Gao, Xinliang; Pan, Tao; Cui, Zhanfeng; Zhao, Xiubo; Lu, Jian R
2013-11-01
In this study, we explored how ammonium and metal ion stresses affected the production of recombinant hyperthermostable manganese superoxide dismutase (Mn-SOD). To improve Mn-SOD production, fed-batch culture in shake flasks and bioreactor fermentation were undertaken to examine the effects of [Formula: see text] and Mn(2+) feeding. Under the optimized feeding time and concentrations of [Formula: see text] and Mn(2+), the maximal SOD activity obtained from bioreactor fermentation reached some 480 U/ml, over 4 times higher than that in batch cultivation (113 U/ml), indicating a major enhancement of the concentration of Mn-SOD in the scale-up of hyperthermostable Mn-SOD production. In contrast, when the fed-batch culture with appropriate [Formula: see text] and Mn(2+) feeding was carried out in the same 5-L stirred tank bioreactor, a maximal SOD concentration of some 450 U/ml was obtained, again indicating substantial increase in SOD activity as a result of [Formula: see text] and Mn(2+) feeding. The isoelectric point (pI) of the sample was found to be 6.2. It was highly stable at 90 °C and circular dichroism measurements indicated a high α-helical content of 70 % as well, consistent with known SOD properties. This study indicates that [Formula: see text] and Mn(2+) play important roles in Mn-SOD expression. Stress fermentation strategies established in this study are useful for large-scale efficient production of hyperthermostable Mn-SOD and may also be valuable for the scale-up of other extremozymes.
Thomas, Pious; Sekhar, Aparna C; Shaik, Sadiq Pasha
2017-11-01
Molecular and microscopic analyses reveal enormous non-cultivable endophytic bacteria in grapevine field shoots with functional significance. Diverse bacteria enter tissue cultures through surface-sterilized tissues and survive surreptitiously with varying taxonomic realignments. The study was envisaged to assess the extent of endophytic bacterial association with field shoot tissues of grapevine and the likelihood of introduction of such internally colonizing bacteria in vitro adopting molecular techniques targeting the non-cultivable bacterial community. PowerFood ® -kit derived DNA from surface-sterilized field shoot tips of grapevine Flame Seedless was employed in a preliminary bacterial class-specific PCR screening proving positive for major prokaryotic taxa including Archaea. Taxonomic and functional diversity were analyzed through whole metagenome profiling (WMG) which revealed predominantly phylum Actinobacteria, Proteobacteria, and minor shares of Firmicutes, Bacteroidetes, and Deinococcus-Thermus with varying functional roles ascribable to the whole bacterial community. Field shoot tip tissues and callus derived from stem segments were further employed in 16S rRNA V3-V4 amplicon taxonomic profiling. This revealed elevated taxonomic diversity in field shoots over WMG, predominantly Proteobacteria succeeded by Actinobacteria, Firmicutes, Bacteroidetes, and 15 other phyla including several candidate phyla (135 families, 179 genera). Callus stocks also displayed broad bacterial diversity (16 phyla; 96 families; 141 genera) bearing resemblance to field tissues with Proteobacterial dominance but a reduction in its share, enrichment of Actinobacteria and Firmicutes, disappearance of some field-associated phyla and detection of a few additional taxonomic groups over field community. Similar results were documented during 16S V3-V4 amplicon taxonomic profiling on Thompson Seedless field shoot tip and callus tissues. Video microscopy on tissue homogenates corroborated enormous endophytic bacteria. This study elucidates a vast diversity of cultivation-recalcitrant endophytic bacteria prevailing in grapevine field shoots, their in vitro introduction, and unsuspecting sustenance with possible silent participation in tissue culture processes.
Bacterial Composition and Survival on Sahara Dust Particles Transported to the European Alps
Meola, Marco; Lazzaro, Anna; Zeyer, Josef
2015-01-01
Deposition of Sahara dust (SD) particles is a frequent phenomenon in Europe, but little is known about the viability and composition of the bacterial community transported with SD. The goal of this study was to characterize SD-associated bacteria transported to the European Alps, deposited and entrapped in snow. During two distinct events in February and May 2014, SD particles were deposited and promptly covered by falling snow, thus preserving them in distinct ochre layers within the snowpack. In June 2014, we collected samples at different depths from a snow profile at the Jungfraujoch (Swiss Alps; 3621 m a.s.l.). After filtration, we performed various microbiological and physicochemical analyses of the snow and dust particles therein that originated in Algeria. Our results show that bacteria survive and are metabolically active after the transport to the European Alps. Using high throughput sequencing, we observed distinct differences in bacterial community composition and structure in SD-layers as compared to clean snow layers. Sporulating bacteria were not enriched in the SD-layers; however, phyla with low abundance such as Gemmatimonadetes and Deinococcus-Thermus appeared to be specific bio-indicators for SD. Since many members of these phyla are known to be adapted to arid oligotrophic environments and UV radiation, they are well suited to survive the harsh conditions of long-range airborne transport. PMID:26733988
Tsukamoto, Takashi; Mizutani, Kenji; Hasegawa, Taisuke; Takahashi, Megumi; Honda, Naoya; Hashimoto, Naoki; Shimono, Kazumi; Yamashita, Keitaro; Yamamoto, Masaki; Miyauchi, Seiji; Takagi, Shin; Hayashi, Shigehiko; Murata, Takeshi; Sudo, Yuki
2016-06-03
Thermophilic rhodopsin (TR) is a photoreceptor protein with an extremely high thermal stability and the first characterized light-driven electrogenic proton pump derived from the extreme thermophile Thermus thermophilus JL-18. In this study, we confirmed its high thermal stability compared with other microbial rhodopsins and also report the potential availability of TR for optogenetics as a light-induced neural silencer. The x-ray crystal structure of TR revealed that its overall structure is quite similar to that of xanthorhodopsin, including the presence of a putative binding site for a carotenoid antenna; but several distinct structural characteristics of TR, including a decreased surface charge and a larger number of hydrophobic residues and aromatic-aromatic interactions, were also clarified. Based on the crystal structure, the structural changes of TR upon thermal stimulation were investigated by molecular dynamics simulations. The simulations revealed the presence of a thermally induced structural substate in which an increase of hydrophobic interactions in the extracellular domain, the movement of extracellular domains, the formation of a hydrogen bond, and the tilting of transmembrane helices were observed. From the computational and mutational analysis, we propose that an extracellular LPGG motif between helices F and G plays an important role in the thermal stability, acting as a "thermal sensor." These findings will be valuable for understanding retinal proteins with regard to high protein stability and high optogenetic performance. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
A selection that reports on protein–protein interactions within a thermophilic bacterium
Nguyen, Peter Q.; Silberg, Jonathan J.
2010-01-01
Many proteins can be split into fragments that exhibit enhanced function upon fusion to interacting proteins. While this strategy has been widely used to create protein-fragment complementation assays (PCAs) for discovering protein–protein interactions within mesophilic organisms, similar assays have not yet been developed for studying natural and engineered protein complexes at the temperatures where thermophilic microbes grow. We describe the development of a selection for protein–protein interactions within Thermus thermophilus that is based upon growth complementation by fragments of Thermotoga neapolitana adenylate kinase (AKTn). Complementation studies with an engineered thermophile (PQN1) that is not viable above 75°C because its adk gene has been replaced by a Geobacillus stearothermophilus ortholog revealed that growth could be restored at 78°C by a vector that coexpresses polypeptides corresponding to residues 1–79 and 80–220 of AKTn. In contrast, PQN1 growth was not complemented by AKTn fragments harboring a C156A mutation within the zinc-binding tetracysteine motif unless these fragments were fused to Thermotoga maritima chemotaxis proteins that heterodimerize (CheA and CheY) or homodimerize (CheX). This enhanced complementation is interpreted as arising from chemotaxis protein–protein interactions, since AKTn-C156A fragments having only one polypeptide fused to a chemotaxis protein did not complement PQN1 to the same extent. This selection increases the maximum temperature where a PCA can be used to engineer thermostable protein complexes and to map protein–protein interactions. PMID:20418388
A selection that reports on protein-protein interactions within a thermophilic bacterium.
Nguyen, Peter Q; Silberg, Jonathan J
2010-07-01
Many proteins can be split into fragments that exhibit enhanced function upon fusion to interacting proteins. While this strategy has been widely used to create protein-fragment complementation assays (PCAs) for discovering protein-protein interactions within mesophilic organisms, similar assays have not yet been developed for studying natural and engineered protein complexes at the temperatures where thermophilic microbes grow. We describe the development of a selection for protein-protein interactions within Thermus thermophilus that is based upon growth complementation by fragments of Thermotoga neapolitana adenylate kinase (AK(Tn)). Complementation studies with an engineered thermophile (PQN1) that is not viable above 75 degrees C because its adk gene has been replaced by a Geobacillus stearothermophilus ortholog revealed that growth could be restored at 78 degrees C by a vector that coexpresses polypeptides corresponding to residues 1-79 and 80-220 of AK(Tn). In contrast, PQN1 growth was not complemented by AK(Tn) fragments harboring a C156A mutation within the zinc-binding tetracysteine motif unless these fragments were fused to Thermotoga maritima chemotaxis proteins that heterodimerize (CheA and CheY) or homodimerize (CheX). This enhanced complementation is interpreted as arising from chemotaxis protein-protein interactions, since AK(Tn)-C156A fragments having only one polypeptide fused to a chemotaxis protein did not complement PQN1 to the same extent. This selection increases the maximum temperature where a PCA can be used to engineer thermostable protein complexes and to map protein-protein interactions.
Splitting of the O–O bond at the heme-copper catalytic site of respiratory oxidases
Poiana, Federica; von Ballmoos, Christoph; Gonska, Nathalie; Blomberg, Margareta R. A.; Ädelroth, Pia; Brzezinski, Peter
2017-01-01
Heme-copper oxidases catalyze the four-electron reduction of O2 to H2O at a catalytic site that is composed of a heme group, a copper ion (CuB), and a tyrosine residue. Results from earlier experimental studies have shown that the O–O bond is cleaved simultaneously with electron transfer from a low-spin heme (heme a/b), forming a ferryl state (PR; Fe4+=O2−, CuB2+–OH−). We show that with the Thermus thermophilus ba3 oxidase, at low temperature (10°C, pH 7), electron transfer from the low-spin heme b to the catalytic site is faster by a factor of ~10 (τ ≅ 11 μs) than the formation of the PR ferryl (τ ≅110 μs), which indicates that O2 is reduced before the splitting of the O–O bond. Application of density functional theory indicates that the electron acceptor at the catalytic site is a high-energy peroxy state [Fe3+–O−–O−(H+)], which is formed before the PR ferryl. The rates of heme b oxidation and PR ferryl formation were more similar at pH 10, indicating that the formation of the high-energy peroxy state involves proton transfer within the catalytic site, consistent with theory. The combined experimental and theoretical data suggest a general mechanism for O2 reduction by heme-copper oxidases. PMID:28630929
The Role of +4U as an Extended Translation Termination Signal in Bacteria
Wei, Yulong; Xia, Xuhua
2017-01-01
Termination efficiency of stop codons depends on the first 3′ flanking (+4) base in bacteria and eukaryotes. In both Escherichia coli and Saccharomyces cerevisiae, termination read-through is reduced in the presence of +4U; however, the molecular mechanism underlying +4U function is poorly understood. Here, we perform comparative genomics analysis on 25 bacterial species (covering Actinobacteria, Bacteriodetes, Cyanobacteria, Deinococcus-Thermus, Firmicutes, Proteobacteria, and Spirochaetae) with bioinformatics approaches to examine the influence of +4U in bacterial translation termination by contrasting highly- and lowly-expressed genes (HEGs and LEGs, respectively). We estimated gene expression using the recently formulated Index of Translation Elongation, ITE, and identified stop codon near-cognate transfer RNAs (tRNAs) from well-annotated genomes. We show that +4U was consistently overrepresented in UAA-ending HEGs relative to LEGs. The result is consistent with the interpretation that +4U enhances termination mainly for UAA. Usage of +4U decreases in GC-rich species where most stop codons are UGA and UAG, with few UAA-ending genes, which is expected if UAA usage in HEGs drives up +4U usage. In HEGs, +4U usage increases significantly with abundance of UAA nc_tRNAs (near-cognate tRNAs that decode codons differing from UAA by a single nucleotide), particularly those with a mismatch at the first stop codon site. UAA is always the preferred stop codon in HEGs, and our results suggest that UAAU is the most efficient translation termination signal in bacteria. PMID:27903612
Xing, Zhilin; Zhao, Tiantao; Bai, Weiyang; Yang, Xu; Liu, Shuai; Zhang, Lijie
2018-09-30
The microbiome in artificial lake water and its impact on mercury (Hg) methylation remain largely unknown. We selected the largest artificial lake in southeastern china, Changshou Lake (CSL), which has high background levels of Hg, for our investigation of Hg transformation microorganisms. Five different sections of the water column of CSL were sampled during four seasons. The water samples were subjected to analysis of geochemical parameters, various Hg species and microbiome information. High concentrations of total mercury (THg) were detected in CSL in comparison with those found in natural lakes. Significant differences in microbial community structure and Hg species abundance existed among seasons. High dissolved methyl mercury (DMeHg) formation and high bacterial richness and diversity occurred in the fall. The microbiome was dominated by Proteobacteria, Actinobacteria, Bacteroidetes, Deinococcus-Thermus and many unclassified bacteria. Significant correlations were found between seasonal bacterial communities and Hg levels. Hg methylation was strongly linked to the abundance of Cyanobacteria. Methylators, including Syntrophus, Desulfovibrio and Desulfomonile species, were detected only in samples collected in the fall. The results of enzyme functional analyses revealed that many unknown types of bacteria could also be responsible for Hg transformation. This study was the first to investigate the impact of various Hg species on the microbiome of artificial lake water. The findings of this study illuminate the role of seasonal bacteria in Hg transformation. Copyright © 2018 Elsevier Inc. All rights reserved.
Yamamoto, Junpei; Loakes, David; Masutani, Chikahide; Simmyo, Shizu; Urabe, Kumiko; Hanaoka, Fumio; Holliger, Philipp; Iwai, Shigenori
2008-01-01
We analyzed the translesion synthesis across the UV-induced lesions, the (6-4) photoproduct and its Dewar valence isomer, by using human DNA polymerases eta and iota in vitro. The primer extension experiments revealed that pol eta tended to incorporate dG opposite the 3' component of both lesions, but the incorporation efficiency for the Dewar isomer was higher than that for the (6-4) photoproduct. On the other hand, pol iota was likely to incorporate dA opposite the 3' components of the (6-4) photoproduct and its Dewar isomer with a similar efficiency. Elongation after the incorporation opposite the UV lesions was not observed for these Y-family polymerases. We further analyzed the bypass ability of an engineered polymerase developed from Thermus DNA polymerase for the amplification of ancient DNA. This polymerase could bypass the Dewar isomer more efficiently than the (6-4) photoproduct.
Förster, C; Limmer, S; Zeidler, W; Sprinzl, M
1994-01-01
tRNA(Val) from Escherichia coli was aminoacylated with [1-13C]valine and its complex with Thermus thermophilus elongation factor EF-Tu.GTP was analyzed by 13C NMR spectroscopy. The results suggest that the aminoacyl residue of the valyl-tRNA in ternary complex with bacterial EF-Tu and GTP is not attached to tRNA by a regular ester bond to either a 2'- or 3'-hydroxyl group; instead, an intermediate orthoester acid structure with covalent linkage to both vicinal hydroxyls of the terminal adenosine-76 is formed. Mutation of arginine-59 located in the effector region of EF-Tu, a conserved residue in protein elongation factors and the alpha subunits of heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins), abolishes the stabilization of the orthoester acid structure of aminoacyl-tRNA. PMID:8183898
The dynamic stator stalk of rotary ATPases
Stewart, Alastair G.; Lee, Lawrence K.; Donohoe, Mhairi; Chaston, Jessica J.; Stock, Daniela
2012-01-01
Rotary ATPases couple ATP hydrolysis/synthesis with proton translocation across biological membranes and so are central components of the biological energy conversion machinery. Their peripheral stalks are essential components that counteract torque generated by rotation of the central stalk during ATP synthesis or hydrolysis. Here we present a 2.25-Å resolution crystal structure of the peripheral stalk from Thermus thermophilus A-type ATPase/synthase. We identify bending and twisting motions inherent within the structure that accommodate and complement a radial wobbling of the ATPase headgroup as it progresses through its catalytic cycles, while still retaining azimuthal stiffness necessary to counteract rotation of the central stalk. The conformational freedom of the peripheral stalk is dictated by its unusual right-handed coiled-coil architecture, which is in principle conserved across all rotary ATPases. In context of the intact enzyme, the dynamics of the peripheral stalks provides a potential mechanism for cooperativity between distant parts of rotary ATPases. PMID:22353718
Nema, Vijay; Pal, Sudhir Kumar
2013-01-01
This study was conducted to find the best suited freely available software for modelling of proteins by taking a few sample proteins. The proteins used were small to big in size with available crystal structures for the purpose of benchmarking. Key players like Phyre2, Swiss-Model, CPHmodels-3.0, Homer, (PS)2, (PS)(2)-V(2), Modweb were used for the comparison and model generation. Benchmarking process was done for four proteins, Icl, InhA, and KatG of Mycobacterium tuberculosis and RpoB of Thermus Thermophilus to get the most suited software. Parameters compared during analysis gave relatively better values for Phyre2 and Swiss-Model. This comparative study gave the information that Phyre2 and Swiss-Model make good models of small and large proteins as compared to other screened software. Other software was also good but is often not very efficient in providing full-length and properly folded structure.
Diversity of bacteria in surface ice of Austre Lovénbreen glacier, Svalbard.
Zeng, Yin-Xin; Yan, Ming; Yu, Yong; Li, Hui-Rong; He, Jian-Feng; Sun, Kun; Zhang, Fang
2013-05-01
Two 16S rRNA gene clone libraries Cores 1U and 2U were constructed using two ice core samples collected from Austre Lovénbreen glacier in Svalbard. The two libraries yielded a total of 262 clones belonging to 59 phylotypes. Sequences fell into 10 major lineages of the domain Bacteria, including Proteobacteria (alpha, beta, gamma and delta subdivisions), Bacteroidetes, Actinobacteria, Firmicutes, Acidobacteria, Deinococcus-Thermus, Chloroflexi, Planctomycetes, Cyanobacteria and candidate division TM7. Among them, Bacteroidetes, Actinobacteria, Alphaproteobacteria and Cyanobacteria were most abundant. UniFrac data showed no significant differences in community composition between the two ice cores. A total of nineteen bacterial strains from the genera Pseudoalteromonas and Psychrobacter were isolated from the ice cores. Phylogenetic and phenotypic analyses revealed a close relationship between the ice core isolates and bacteria in marine environments, indicating a wide distribution of some bacterial phylotypes in both terrestrial and marine ecosystems.
Farías, María E; Rascovan, Nicolás; Toneatti, Diego M; Albarracín, Virginia H; Flores, María R; Poiré, Daniel G; Collavino, Mónica M; Aguilar, O Mario; Vazquez, Martin P; Polerecky, Lubos
2013-01-01
We describe stromatolites forming at an altitude of 3570 m at the shore of a volcanic lake Socompa, Argentinean Andes. The water at the site of stromatolites formation is alkaline, hypersaline, rich in inorganic nutrients, very rich in arsenic, and warm (20-24°C) due to a hydrothermal input. The stromatolites do not lithify, but form broad, rounded and low-domed bioherms dominated by diatom frustules and aragonite micro-crystals agglutinated by extracellular substances. In comparison to other modern stromatolites, they harbour an atypical microbial community characterized by highly abundant representatives of Deinococcus-Thermus, Rhodobacteraceae, Desulfobacterales and Spirochaetes. Additionally, a high proportion of the sequences that could not be classified at phylum level showed less than 80% identity to the best hit in the NCBI database, suggesting the presence of novel distant lineages. The primary production in the stromatolites is generally high and likely dominated by Microcoleus sp. Through negative phototaxis, the location of these cyanobacteria in the stromatolites is controlled by UV light, which greatly influences their photosynthetic activity. Diatoms, dominated by Amphora sp., are abundant in the anoxic, sulfidic and essentially dark parts of the stromatolites. Although their origin in the stromatolites is unclear, they are possibly an important source of anaerobically degraded organic matter that induces in situ aragonite precipitation. To the best of our knowledge, this is so far the highest altitude with documented actively forming stromatolites. Their generally rich, diverse and to a large extent novel microbial community likely harbours valuable genetic and proteomic reserves, and thus deserves active protection. Furthermore, since the stromatolites flourish in an environment characterized by a multitude of extremes, including high exposure to UV radiation, they can be an excellent model system for studying microbial adaptations under conditions that, at least in part, resemble those during the early phase of life evolution on Earth.
Farías, María E.; Rascovan, Nicolás; Toneatti, Diego M.; Albarracín, Virginia H.; Flores, María R.; Poiré, Daniel G.; Collavino, Mónica M.; Aguilar, O. Mario; Vazquez, Martin P.; Polerecky, Lubos
2013-01-01
We describe stromatolites forming at an altitude of 3570 m at the shore of a volcanic lake Socompa, Argentinean Andes. The water at the site of stromatolites formation is alkaline, hypersaline, rich in inorganic nutrients, very rich in arsenic, and warm (20–24°C) due to a hydrothermal input. The stromatolites do not lithify, but form broad, rounded and low-domed bioherms dominated by diatom frustules and aragonite micro-crystals agglutinated by extracellular substances. In comparison to other modern stromatolites, they harbour an atypical microbial community characterized by highly abundant representatives of Deinococcus-Thermus, Rhodobacteraceae, Desulfobacterales and Spirochaetes. Additionally, a high proportion of the sequences that could not be classified at phylum level showed less than 80% identity to the best hit in the NCBI database, suggesting the presence of novel distant lineages. The primary production in the stromatolites is generally high and likely dominated by Microcoleus sp. Through negative phototaxis, the location of these cyanobacteria in the stromatolites is controlled by UV light, which greatly influences their photosynthetic activity. Diatoms, dominated by Amphora sp., are abundant in the anoxic, sulfidic and essentially dark parts of the stromatolites. Although their origin in the stromatolites is unclear, they are possibly an important source of anaerobically degraded organic matter that induces in situ aragonite precipitation. To the best of our knowledge, this is so far the highest altitude with documented actively forming stromatolites. Their generally rich, diverse and to a large extent novel microbial community likely harbours valuable genetic and proteomic reserves, and thus deserves active protection. Furthermore, since the stromatolites flourish in an environment characterized by a multitude of extremes, including high exposure to UV radiation, they can be an excellent model system for studying microbial adaptations under conditions that, at least in part, resemble those during the early phase of life evolution on Earth. PMID:23308236
The formation of illite from nontronite by mesophilic and thermophilic bacterial reaction
Jaisi, Deb P.; Eberl, Dennis D.; Dong, Hailiang; Kim, Jinwook
2011-01-01
The formation of illite through the smectite-to-illite (S-I) reaction is considered to be one of the most important mineral reactions occurring during diagenesis. In biologically catalyzed systems, however, this transformation has been suggested to be rapid and to bypass the high temperature and long time requirements. To understand the factors that promote the S-I reaction, the present study focused on the effects of pH, temperature, solution chemistry, and aging on the S-I reaction in microbially mediated systems. Fe(III)-reduction experiments were performed in both growth and non-growth media with two types of bacteria: mesophilic (Shewanella putrefaciens CN32) and thermophilic (Thermus scotoductus SA-01). Reductive dissolution of NAu-2 was observed and the formation of illite in treatment with thermophilic SA-01 was indicated by X-ray diffraction (XRD) and high-resolution transmission electron microscopy (HRTEM). A basic pH (8.4) and high temperature (65°C) were the most favorable conditions for the formation of illite. A long incubation time was also found to enhance the formation of illite. K-nontronite (non-permanent fixation of K) was also detected and differentiated from the discrete illite in the XRD profiles. These results collectively suggested that the formation of illite associated with the biologically catalyzed smectite-to-illite reaction pathway may bypass the prolonged time and high temperature required for the S-I reaction in the absence of microbial activity.
Engineering an ATP-dependent D-Ala:D-Ala ligase for synthesizing amino acid amides from amino acids.
Miki, Yuta; Okazaki, Seiji; Asano, Yasuhisa
2017-05-01
We successfully engineered a new enzyme that catalyzes the formation of D-Ala amide (D-AlaNH 2 ) from D-Ala by modifying ATP-dependent D-Ala:D-Ala ligase (EC 6.3.2.4) from Thermus thermophilus, which catalyzes the formation of D-Ala-D-Ala from two molecules of D-Ala. The new enzyme was created by the replacement of the Ser293 residue with acidic amino acids, as it was speculated to bind to the second D-Ala of D-Ala-D-Ala. In addition, a replacement of the position with Glu performed better than that with Asp with regards to specificity for D-AlaNH 2 production. The S293E variant, which was selected as the best enzyme for D-AlaNH 2 production, exhibited an optimal activity at pH 9.0 and 40 °C for D-AlaNH 2 production. The apparent K m values of this variant for D-Ala and NH 3 were 7.35 mM and 1.58 M, respectively. The S293E variant could catalyze the synthesis of 9.3 and 35.7 mM of D-AlaNH 2 from 10 and 50 mM D-Ala and 3 M NH 4 Cl with conversion yields of 93 and 71.4 %, respectively. This is the first report showing the enzymatic formation of amino acid amides from amino acids.
Lou, Xiangdi; Ran, Tingting; Han, Ning; Gao, Yanyan; He, Jianhua; Tang, Lin; Xu, Dongqing; Wang, Weiwu
2014-04-25
Prodigiosin, a tripyrrole red pigment synthesized by Serratia and some other microbes through a bifurcated biosynthesis pathway, MBC (4-methoxy-2,2'-bipyrrole-5-carbaldehyde) and MAP (2-methyl-3-n-amyl-pyrrole) are synthesized separately and then condensed by PigC to form prodigiosin. MAP is synthesized sequentially by PigD, PigE and PigB. PigE catalyzes the transamination of an amino group to the aldehyde group of 3-acetyloctanal, resulting in an aminoketone, which spontaneously cyclizes to form H2MAP. Here we report the crystal structure of the catalytic domain of PigE which involved in the biosynthesis of prodigiosin precursor MAP for the first time to a resolution of 2.3Å with a homodimer in the asymmetric unit. The monomer of PigE catalytic domain is composed of three domains with PLP as cofactor: a small N-terminal domain connecting the catalytic domain with the front part of PigE, a large PLP-binding domain and a C-terminal domain. The residues from both monomers build the PLP binding site at the interface of the dimer which resembles the other PLP-dependent enzymes. Structural comparison of PigE with Thermus thermophilus AcOAT showed a higher hydrophobic and smaller active site of PigE, these differences may be the reason for substrate specificity. Copyright © 2014 Elsevier Inc. All rights reserved.
Zhao, Yuzheng; Wang, Aoxue; Zou, Yejun; Su, Ni; Loscalzo, Joseph; Yang, Yi
2016-08-01
NADH and its oxidized form NAD(+) have a central role in energy metabolism, and their concentrations are often considered to be among the most important readouts of metabolic state. Here, we present a detailed protocol to image and monitor NAD(+)/NADH redox state in living cells and in vivo using a highly responsive, genetically encoded fluorescent sensor known as SoNar (sensor of NAD(H) redox). The chimeric SoNar protein was initially developed by inserting circularly permuted yellow fluorescent protein (cpYFP) into the NADH-binding domain of Rex protein from Thermus aquaticus (T-Rex). It functions by binding to either NAD(+) or NADH, thus inducing protein conformational changes that affect its fluorescent properties. We first describe steps for how to establish SoNar-expressing cells, and then discuss how to use the system to quantify the intracellular redox state. This approach is sensitive, accurate, simple and able to report subtle perturbations of various pathways of energy metabolism in real time. We also detail the application of SoNar to high-throughput chemical screening of candidate compounds targeting cell metabolism in a microplate-reader-based assay, along with in vivo fluorescence imaging of tumor xenografts expressing SoNar in mice. Typically, the approximate time frame for fluorescence imaging of SoNar is 30 min for living cells and 60 min for living mice. For high-throughput chemical screening in a 384-well-plate assay, the whole procedure generally takes no longer than 60 min to assess the effects of 380 compounds on cell metabolism.
Ochi, Anna; Makabe, Koki; Yamagami, Ryota; Hirata, Akira; Sakaguchi, Reiko; Hou, Ya-Ming; Watanabe, Kazunori; Nureki, Osamu; Kuwajima, Kunihiro; Hori, Hiroyuki
2013-01-01
A conserved guanosine at position 18 (G18) in the D-loop of tRNAs is often modified to 2′-O-methylguanosine (Gm). Formation of Gm18 in eubacterial tRNA is catalyzed by tRNA (Gm18) methyltransferase (TrmH). TrmH enzymes can be divided into two types based on their substrate tRNA specificity. Type I TrmH, including Thermus thermophilus TrmH, can modify all tRNA species, whereas type II TrmH, for example Escherichia coli TrmH, modifies only a subset of tRNA species. Our previous crystal study showed that T. thermophilus TrmH is a class IV S-adenosyl-l-methionine-dependent methyltransferase, which maintains a topological knot structure in the catalytic domain. Because TrmH enzymes have short stretches at the N and C termini instead of a clear RNA binding domain, these stretches are believed to be involved in tRNA recognition. In this study, we demonstrate by site-directed mutagenesis that both N- and C-terminal regions function in tRNA binding. However, in vitro and in vivo chimera protein studies, in which four chimeric proteins of type I and II TrmHs were used, demonstrated that the catalytic domain discriminates substrate tRNAs from nonsubstrate tRNAs. Thus, the N- and C-terminal regions do not function in the substrate tRNA discrimination process. Pre-steady state analysis of complex formation between mutant TrmH proteins and tRNA by stopped-flow fluorescence measurement revealed that the C-terminal region works in the initial binding process, in which nonsubstrate tRNA is not excluded, and that structural movement of the motif 2 region of the catalytic domain in an induced-fit process is involved in substrate tRNA discrimination. PMID:23867454
[Phylogenetic diversity of airborne microbes in Qingdao downtown in autumn].
Wang, Lin; Song, Zhi-wen; Xu, Ai-ling; Wu, Deng-deng; Xia, Yan
2015-04-01
To determine the community structure of airborne microbes in Qingdao downtown in autumn, the airborne bacteria and fungi were collected by the KC-6120 air sampler and analyzed using the 16S/18S rDNA gene clone library method. Phylogenetic analysis of airborne bacteria showed that they belonged to six major phylogenetic groups: Proteobacteria (78. 8%), Firmicutes (14.6%), Actinobacteria (4.0%), Planctomycetes (1.3%), Cyanobacteria (0.7%), and Deinococcus-Thermus (0.7%). The dominant genera of airborne bacteria included Acinetobacter (39.7%), Staphylococcus (11.3%), Sphingomonas (8.6%), Paracoccus (6.0%) and Massilia (5.3%). The main types of airborne fungi were Ascomycota (97.5%) and Basidiomycota (2.5%). Dominant genera of airborne fungi included Pyrenophora (76.5%), Xylaria (13.6%) and Exophiala (2.5%). The pathogens or conditioned pathogens, such as Acinetobacter, Staphylococcus, or Sphingomonas were detected in the airborne bacteria, whereas certain kinds of fungi, such as P. graminea, X. hypoxylon and Zasmidium angulare that could cause a variety of crop diseases were also detected.
Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.
Odelberg, S J; Weiss, R B; Hata, A; White, R
1995-01-01
Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836
Jang, Hyun Min; Park, Sang Kyu; Ha, Jeong Hyub; Park, Jong Moon
2013-10-01
An effective two-stage sewage sludge digestion process, consisting of thermophilic aerobic digestion (TAD) followed by mesophilic anaerobic digestion (MAD), was developed for efficient sludge reduction and methane production. Using TAD as a biological pretreatment, the total volatile suspended solid reduction (VSSR) and methane production rate (MPR) in the MAD reactor were significantly improved. According to denaturing gradient gel electrophoresis (DGGE) analysis, the results indicated that the dominant bacteria species such as Ureibacillus thermophiles and Bacterium thermus in TAD were major routes for enhancing soluble organic matter. TAD pretreatment using a relatively short SRT of 1 day showed highly increased soluble organic products and positively affected an increment of bacteria populations which performed interrelated microbial metabolisms with methanogenic species in the MAD; consequently, a quantitative real-time PCR indicated greatly increased Methanosarcinales (acetate-utilizing methanogens) in the MAD, resulting in enhanced methane production. Copyright © 2013 Elsevier Ltd. All rights reserved.
Extremophiles in Household Water Heaters
NASA Astrophysics Data System (ADS)
Wilpiszeski, R.; House, C. H.
2016-12-01
A significant fraction of Earth's microbial diversity comes from species living in extreme environments, but natural extreme environments can be difficult to access. Manmade systems like household water heaters serve as an effective proxy for thermophilic environments that are otherwise difficult to sample directly. As such, we are investigating the biogeography, taxonomic distribution, and evolution of thermophiles growing in domestic water heaters. Citizen scientists collected hot tap water culture- and filter- samples from 101 homes across the United States. We recovered a single species of thermophilic heterotroph from culture samples inoculated from water heaters across the United States, Thermus scotoductus. Whole-genome sequencing was conducted to better understand the distribution and evolution of this single species. We have also sequenced hyper-variable regions of the 16S rRNA gene from whole-community filter samples to identify the broad diversity and distribution of microbial cells captured from each water heater. These results shed light on the processes that shape thermophilic populations and genomes at a spatial resolution that is difficult to access in naturally occurring extreme ecosystems.
Nema, Vijay; Pal, Sudhir Kumar
2013-01-01
Aim: This study was conducted to find the best suited freely available software for modelling of proteins by taking a few sample proteins. The proteins used were small to big in size with available crystal structures for the purpose of benchmarking. Key players like Phyre2, Swiss-Model, CPHmodels-3.0, Homer, (PS)2, (PS)2-V2, Modweb were used for the comparison and model generation. Results: Benchmarking process was done for four proteins, Icl, InhA, and KatG of Mycobacterium tuberculosis and RpoB of Thermus Thermophilus to get the most suited software. Parameters compared during analysis gave relatively better values for Phyre2 and Swiss-Model. Conclusion: This comparative study gave the information that Phyre2 and Swiss-Model make good models of small and large proteins as compared to other screened software. Other software was also good but is often not very efficient in providing full-length and properly folded structure. PMID:24023424
Evidence for rotation of V1-ATPase
Imamura, Hiromi; Nakano, Masahiro; Noji, Hiroyuki; Muneyuki, Eiro; Ohkuma, Shoji; Yoshida, Masasuke; Yokoyama, Ken
2003-01-01
VoV1-ATPase is responsible for acidification of eukaryotic intracellular compartments and ATP synthesis of Archaea and some eubacteria. From the similarity to FoF1-ATP synthase, VoV1-ATPase has been assumed to be a rotary motor, but to date there are no experimental data to support this. Here we visualized the rotation of single molecules of V1-ATPase, a catalytic subcomplex of VoV1-ATPase. V1-ATPase from Thermus thermophilus was immobilized onto a glass surface, and a bead was attached to the D or F subunit through the biotin-streptavidin linkage. In both cases we observed ATP-dependent rotations of beads, the direction of which was always counterclockwise viewed from the membrane side. Given that three ATP molecules are hydrolyzed per one revolution, rates of rotation agree consistently with rates of ATP hydrolysis at saturating ATP concentrations. This study provides experimental evidence that VoV1-ATPase is a rotary motor and that both D and F subunits constitute a rotor shaft. PMID:12598655
Copeland, Alex; Gu, Wei; Yasawong, Montri; Lapidus, Alla; Lucas, Susan; Deshpande, Shweta; Pagani, Ioanna; Tapia, Roxanne; Cheng, Jan-Fang; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Pan, Chongle; Brambilla, Evelyne-Marie; Rohde, Manfred; Tindall, Brian J.; Sikorski, Johannes; Göker, Markus; Detter, John C.; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Woyke, Tanja
2012-01-01
Marinithermus hydrothermalis Sako et al. 2003 is the type species of the monotypic genus Marinithermus. M. hydrothermalis T1T was the first isolate within the phylum “Thermus-Deinococcus” to exhibit optimal growth under a salinity equivalent to that of sea water and to have an absolute requirement for NaCl for growth. M. hydrothermalis T1T is of interest because it may provide a new insight into the ecological significance of the aerobic, thermophilic decomposers in the circulation of organic compounds in deep-sea hydrothermal vent ecosystems. This is the first completed genome sequence of a member of the genus Marinithermus and the seventh sequence from the family Thermaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,269,167 bp long genome with its 2,251 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:22675595
Structural Insight into Amino Group-carrier Protein-mediated Lysine Biosynthesis
Yoshida, Ayako; Tomita, Takeo; Fujimura, Tsutomu; Nishiyama, Chiharu; Kuzuyama, Tomohisa; Nishiyama, Makoto
2015-01-01
In the biosynthesis of lysine by Thermus thermophilus, the metabolite α-ketoglutarate is converted to the intermediate α-aminoadipate (AAA), which is protected by the 54-amino acid acidic protein LysW. In this study, we determined the crystal structure of LysZ from T. thermophilus (TtLysZ), an amino acid kinase that catalyzes the second step in the AAA to lysine conversion, which was in a complex with LysW at a resolution of 1.85 Å. A crystal analysis coupled with isothermal titration calorimetry of the TtLysZ mutants for TtLysW revealed tight interactions between LysZ and the globular and C-terminal extension domains of the LysW protein, which were mainly attributed to electrostatic forces. These results provided structural evidence for LysW acting as a protecting molecule for the α-amino group of AAA and also as a carrier protein to guarantee better recognition by biosynthetic enzymes for the efficient biosynthesis of lysine. PMID:25392000
2012-01-01
Background During elongation, multi-subunit RNA polymerases (RNAPs) cycle between phosphodiester bond formation and nucleic acid translocation. In the conformation associated with catalysis, the mobile “trigger loop” of the catalytic subunit closes on the nucleoside triphosphate (NTP) substrate. Closing of the trigger loop is expected to exclude water from the active site, and dehydration may contribute to catalysis and fidelity. In the absence of a NTP substrate in the active site, the trigger loop opens, which may enable translocation. Another notable structural element of the RNAP catalytic center is the “bridge helix” that separates the active site from downstream DNA. The bridge helix may participate in translocation by bending against the RNA/DNA hybrid to induce RNAP forward movement and to vacate the active site for the next NTP loading. The transition between catalytic and translocation conformations of RNAP is not evident from static crystallographic snapshots in which macromolecular motions may be restrained by crystal packing. Results All atom molecular dynamics simulations of Thermus thermophilus (Tt) RNAP reveal flexible hinges, located within the two helices at the base of the trigger loop, and two glycine hinges clustered near the N-terminal end of the bridge helix. As simulation progresses, these hinges adopt distinct conformations in the closed and open trigger loop structures. A number of residues (described as “switch” residues) trade atomic contacts (ion pairs or hydrogen bonds) in response to changes in hinge orientation. In vivo phenotypes and in vitro activities rendered by mutations in the hinge and switch residues in Saccharomyces cerevisiae (Sc) RNAP II support the importance of conformational changes predicted from simulations in catalysis and translocation. During simulation, the elongation complex with an open trigger loop spontaneously translocates forward relative to the elongation complex with a closed trigger loop. Conclusions Switching between catalytic and translocating RNAP forms involves closing and opening of the trigger loop and long-range conformational changes in the atomic contacts of amino acid side chains, some located at a considerable distance from the trigger loop and active site. Trigger loop closing appears to support chemistry and the fidelity of RNA synthesis. Trigger loop opening and limited bridge helix bending appears to promote forward nucleic acid translocation. PMID:22676913
Bonch-Osmolovskaya, Elizaveta A.; Miroshnichenko, Margarita L.; Lebedinsky, Alexander V.; Chernyh, Nikolai A.; Nazina, Tamara N.; Ivoilov, Valery S.; Belyaev, Sergey S.; Boulygina, Eugenia S.; Lysov, Yury P.; Perov, Alexander N.; Mirzabekov , Andrei D.; Hippe, Hans; Stackebrandt, Erko; L'Haridon, Stéphane; Jeanthon, Christian
2003-01-01
Activity measurements by radioisotopic methods and cultural and molecular approaches were used in parallel to investigate the microbial biodiversity and its physiological potential in formation waters of the Samotlor high-temperature oil reservoir (Western Siberia, Russia). Sulfate reduction with rates not exceeding 20 nmol of H2S liter−1 day−1 occurred at 60 and 80°C. In upper horizons (AB, A, and B), methanogenesis (lithotrophic and/or acetoclastic) was detected only in wells in which sulfate reduction did not occur. In some of the wells from deeper (J) horizons, high-temperature sulfate reduction and methanogenesis occurred simultaneously, the rate of lithotrophic methanogenesis exceeding 80 nmol of CH4 liter−1 day−1. Enrichment cultures indicated the presence of diverse physiological groups representing aerobic and anaerobic thermophiles and hyperthermophiles; fermentative organotrophs were predominant. Phylogenetic analyses of 15 isolates identified representatives of the genera Thermotoga, Thermoanaerobacter, Geobacillus, Petrotoga, Thermosipho, and Thermococcus, the latter four being represented by new species. Except for Thermosipho, the isolates were members of genera recovered earlier from similar habitats. DNA obtained from three samples was hybridized with a set of oligonucleotide probes targeting selected microbial groups encompassing key genera of thermophilic bacteria and archaea. Oligonucleotide microchip analyses confirmed the cultural data but also revealed the presence of several groups of microorganisms that escaped cultivation, among them representatives of the Aquificales/Desulfurobacterium-Thermovibrio cluster and of the genera Desulfurococcus and Thermus, up to now unknown in this habitat. The unexpected presence of these organisms suggests that their distribution may be much wider than suspected. PMID:14532074
Unexpected diversity during community succession in the apple flower microbiome.
Shade, Ashley; McManus, Patricia S; Handelsman, Jo
2013-02-26
Despite its importance to the host, the flower microbiome is poorly understood. We report a culture-independent, community-level assessment of apple flower microbial diversity and dynamics. We collected flowers from six apple trees at five time points, starting before flowers opened and ending at petal fall. We applied streptomycin to half of the trees when flowers opened. Assessment of microbial diversity using tag pyrosequencing of 16S rRNA genes revealed that the apple flower communities were rich and diverse and dominated by members of TM7 and Deinococcus-Thermus, phyla about which relatively little is known. From thousands of taxa, we identified six successional groups with coherent dynamics whose abundances peaked at different times before and after bud opening. We designated the groups Pioneer, Early, Mid, Late, Climax, and Generalist communities. The successional pattern was attributed to a set of prevalent taxa that were persistent and gradually changing in abundance. These taxa had significant associations with other community members, as demonstrated with a cooccurrence network based on local similarity analysis. We also detected a set of less-abundant, transient taxa that contributed to general tree-to-tree variability but not to the successional pattern. Communities on trees sprayed with streptomycin had slightly lower phylogenetic diversity than those on unsprayed trees but did not differ in structure or succession. Our results suggest that changes in apple flower microbial community structure are predictable over the life of the flower, providing a basis for ecological understanding and disease management. Flowering plants (angiosperms) represent a diverse group of an estimated 400,000 species, and their successful cultivation is essential to agriculture. Yet fundamental knowledge of flower-associated microbiotas remains largely unknown. Even less well understood are the changes that flower microbial communities experience through time. Flowers are particularly conducive to comprehensive temporal studies because they are, by nature, ephemeral organs. Here, we present the first culture-independent time series of bacterial and archaeal communities associated with the flowers of apple, an economically important crop. We found unexpected diversity on apple flowers, including a preponderance of taxa affiliated with Deinococcus-Thermus and TM7, phyla that are understudied but thought to be tolerant to an array of environmental stresses. Our results also suggest that changes in microbial community structure on the apple flower may be predictable over the life of the flower, providing the basis for ecological understanding and disease management.
Liu, Bin; Zhang, Yang; Sage, J. Timothy; Soltis, S. Michael; Doukov, Tzanko; Chen, Ying; Stout, C. David; Fee, James A.
2012-01-01
The purpose of the work was to provide a crystallographic demonstration of the venerable idea that CO photolyzed from ferrous heme-a3 moves to the nearby cuprous ion in the cytochrome c oxidases. Crystal structures of CO-bound cytochrome ba3-oxidase from Thermus thermophilus, determined at ~ 2.8 – 3.2 Å resolution, reveal a Fe-C distance of ~2.0 Å, a Cu-O distance of 2.4 Å and a Fe-C-O angle of ~126°. Upon photodissociation at 100 K, X-ray structures indicate loss of Fea3-CO and appearance of CuB-CO having a Cu-C distance of ~1.9 Å and an O-Fe distance of ~2.3 Å. Absolute FTIR spectra recorded from single crystals of reduced ba3–CO that had not been exposed to X-ray radiation, showed several peaks around 1975 cm−1; after photolysis at 100 K, the absolute FTIR spectra also showed a significant peak at 2050 cm−1. Analysis of the “light’ minus ‘dark’ difference spectra showed four very sharp CO stretching bands at 1970 cm−1, 1977 cm−1, 1981 cm−1, and 1985 cm−1, previously assigned to the Fea3-CO complex, and a significantly broader CO stretching band centered at ~2050 cm−1, previously assigned to the CO stretching frequency of CuB bound CO. As expected for light propagating along the tetragonal axis of the P43212 space group, the single crystal spectra exhibit negligible dichroism. Absolute FTIR spectrometry of a CO-laden ba3 crystal, exposed to an amount of X-ray radiation required to obtain structural data sets before FTIR characterization, showed a significant signal due to photogenerated CO2 at 2337 cm−1 and one from traces of CO at 2133 cm−1; while bands associated with CO bound to either Fea3 or to CuB in “light” minus “dark” FTIR difference spectra shifted and broadened in response to X-ray exposure. In spite of considerable radiation damage to the crystals, both X-ray analysis at 2.8 and 3.2 Å and FTIR spectra support the long-held position that photolysis of Fea3-CO in cytochrome c oxidases leads to significant trapping of the CO on the CuB atom; Fea3 and CuB ligation, at the resolutions reported here, are otherwise unaltered. PMID:22226917
Jeanguenin, Linda; Lara-Núñez, Aurora; Rodionov, Dmitry A; Osterman, Andrei L; Komarova, Nataliya Y; Rentsch, Doris; Gregory, Jesse F; Hanson, Andrew D
2012-03-01
The transporter(s) that mediate uptake of nicotinate and its N-methyl derivative trigonelline are not known in plants, and certain mammalian nicotinate transporters also remain unidentified. Potential candidates for these missing transporters include proteins from the ubiquitous NiaP family. In bacteria, niaP genes often belong to NAD-related regulons, and genetic evidence supports a role for Bacillus subtilis and Acinetobacter baumannii NiaP proteins in uptake of nicotinate or nicotinamide. Other bacterial niaP genes are, however, not in NAD-related regulons but cluster on the chromosome with choline-related (e.g., Ralstonia solanacearum and Burkholderia xenovorans) or thiamin-related (e.g., Thermus thermophilus) genes, implying that they might encode transporters for these compounds. Radiometric uptake assays using Lactococcus lactis cells expressing NiaP proteins showed that B. subtilis, R. solanacearum, and B. xenovorans NiaP transport nicotinate via an energy-dependent mechanism. Likewise, NiaP proteins from maize (GRMZM2G381453, GRMZM2G066801, and GRMZM2G081774), Arabidopsis (At3g13050), and mouse (SVOP) transported nicotinate; the Arabidopsis protein also transported trigonelline. In contrast, T. thermophilus NiaP transported only thiamin. None of the proteins tested transported choline or the thiazole and pyrimidine products of thiamin breakdown. The maize and Arabidopsis NiaP proteins are the first nicotinate transporters reported in plants, the Arabidopsis protein is the first trigonelline transporter, and mouse SVOP appears to represent a novel type of mammalian nicotinate transporter. More generally, these results indicate that specificity for nicotinate is conserved widely, but not absolutely, among pro- and eukaryotic NiaP family proteins.
The role of interfacial lipids in stabilizing membrane protein oligomers.
Gupta, Kallol; Donlan, Joseph A C; Hopper, Jonathan T S; Uzdavinys, Povilas; Landreh, Michael; Struwe, Weston B; Drew, David; Baldwin, Andrew J; Stansfeld, Phillip J; Robinson, Carol V
2017-01-19
Oligomerization of membrane proteins in response to lipid binding has a critical role in many cell-signalling pathways but is often difficult to define or predict. Here we report the development of a mass spectrometry platform to determine simultaneously the presence of interfacial lipids and oligomeric stability and to uncover how lipids act as key regulators of membrane-protein association. Evaluation of oligomeric strength for a dataset of 125 α-helical oligomeric membrane proteins reveals an absence of interfacial lipids in the mass spectra of 12 membrane proteins with high oligomeric stability. For the bacterial homologue of the eukaryotic biogenic transporters (LeuT, one of the proteins with the lowest oligomeric stability), we found a precise cohort of lipids within the dimer interface. Delipidation, mutation of lipid-binding sites or expression in cardiolipin-deficient Escherichia coli abrogated dimer formation. Molecular dynamics simulation revealed that cardiolipin acts as a bidentate ligand, bridging across subunits. Subsequently, we show that for the Vibrio splendidus sugar transporter SemiSWEET, another protein with low oligomeric stability, cardiolipin shifts the equilibrium from monomer to functional dimer. We hypothesized that lipids are essential for dimerization of the Na + /H + antiporter NhaA from E. coli, which has the lowest oligomeric strength, but not for the substantially more stable homologous Thermus thermophilus protein NapA. We found that lipid binding is obligatory for dimerization of NhaA, whereas NapA has adapted to form an interface that is stable without lipids. Overall, by correlating interfacial strength with the presence of interfacial lipids, we provide a rationale for understanding the role of lipids in both transient and stable interactions within a range of α-helical membrane proteins, including G-protein-coupled receptors.
The role of interfacial lipids in stabilising membrane protein oligomers
Uzdavinys, Povilas; Landreh, Michael; Struwe, Weston B.; Drew, David; Baldwin, Andrew J.; Stansfeld, Phillip J.; Robinson, Carol V.
2017-01-01
Oligomerisation of membrane proteins in response to lipid binding plays a critical role in many cell-signaling pathways 1 but is often difficult to define 2 or predict 3. Here we develop a mass spectrometry platform to determine simultaneously presence of interfacial lipids and oligomeric stability and discover how lipids act as key regulators of membrane protein association. Evaluation of oligomeric strength for a dataset of 125 α-helical oligomeric membrane proteins revealed an absence of interfacial lipids in the mass spectra of 12 membrane proteins with high oligomeric stability. For the bacterial homologue of the eukaryotic biogenic transporters (LeuT) 4 one of the proteins with the lowest oligomeric stability, we found a precise cohort of lipids within the dimer interface. Delipidation, mutation of lipid binding sites or expression in cardiolipin (CDL) deficient Escherichia coli, abrogated dimer formation. Molecular dynamics simulation revealed that CDL acts as a bidentate ligand bridging across subunits. Subsequently, we show that for the sugar transporter SemiSWEET from Vibrio splendidus 5, another protein with low oligomeric stability, cardiolipin shifts the equilibrium from monomer to functional dimer. We hypothesised that lipids would be essential for dimerisation of the Na+/H+ antiporter NhaA from E. coli, which has the lowest oligomeric strength, but not for substantially more stable, homologous NapA from Thermus thermophilus. We found that lipid binding is obligatory for dimerisation of NhaA, whereas NapA has adapted to form an interface that is stable without lipids. Overall, by correlating interfacial strength with the presence of interfacial lipids we provide a rationale for understanding the role of lipids in both transient and stable interactions within a range of α-helical membrane proteins, including GPCRs. PMID:28077870
Long, Minnan; Liu, Jingjing; Chen, Zhifeng; Bleijlevens, Boris; Roseboom, Winfried; Albracht, Simon P J
2007-01-01
A soluble hydrogenase from Allochromatium vinosum was purified. It consisted of a large (M (r) = 52 kDa) and a small (M (r) = 23 kDa) subunit. The genes encoding for both subunits were identified. They belong to an open reading frame where they are preceded by three more genes. A DNA fragment containing all five genes was cloned and sequenced. The deduced amino acid sequences of the products characterized the complex as a member of the HoxEFUYH type of [NiFe] hydrogenases. Detailed sequence analyses revealed binding sites for eight Fe-S clusters, three [2Fe-2S] clusters and five [4Fe-4S] clusters, six of which are also present in homologous subunits of [FeFe] hydrogenases and NADH:ubiquione oxidoreductases (complex I). This makes the HoxEFUYH type of hydrogenases the one that is evolutionary closest to complex I. The relative positions of six of the potential Fe-S clusters are predicted on the basis of the X-ray structures of the Clostridium pasteurianum [FeFe] hydrogenase I and the hydrophilic domain of complex I from Thermus thermophilus. Although the HoxF subunit contains binding sites for flavin mononucleotide and NAD(H), cell-free extracts of A. vinosum did not catalyse a H(2)-dependent reduction of NAD(+). Only the hydrogenase module (HoxYH) could be purified. Its electron paramagnetic resonance (EPR) and IR spectral properties showed the presence of a Ni-Fe active site and a [4Fe-4S] cluster. Its activity was sensitive to carbon monoxide. No EPR signals from a light-sensitive Ni(a)-C* state could be observed. This study presents the first IR spectroscopic data on the HoxYH module of a HoxEFUYH type of [NiFe] hydrogenase.
Polynucleotide 3′-terminal Phosphate Modifications by RNA and DNA Ligases
Zhelkovsky, Alexander M.; McReynolds, Larry A.
2014-01-01
RNA and DNA ligases catalyze the formation of a phosphodiester bond between the 5′-phosphate and 3′-hydroxyl ends of nucleic acids. In this work, we describe the ability of the thermophilic RNA ligase MthRnl from Methanobacterium thermoautotrophicum to recognize and modify the 3′-terminal phosphate of RNA and single-stranded DNA (ssDNA). This ligase can use an RNA 3′p substrate to generate an RNA 2′,3′-cyclic phosphate or convert DNA3′p to ssDNA3′pp5′A. An RNA ligase from the Thermus scotoductus bacteriophage TS2126 and a predicted T4 Rnl1-like protein from Thermovibrio ammonificans, TVa, were also able to adenylate ssDNA 3′p. These modifications of RNA and DNA 3′-phosphates are similar to the activities of RtcA, an RNA 3′-phosphate cyclase. The initial step involves adenylation of the enzyme by ATP, which is then transferred to either RNA 3′p or DNA 3′p to generate the adenylated intermediate. For RNA 3′pp5′A, the third step involves attack of the adjacent 2′ hydroxyl to generate the RNA 2′,3′-cyclic phosphate. These steps are analogous to those in classical 5′ phosphate ligation. MthRnl and TS2126 RNA ligases were not able to modify a 3′p in nicked double-stranded DNA. However, T4 DNA ligase and RtcA can use 3′-phosphorylated nicks in double-stranded DNA to produce a 3′-adenylated product. These 3′-terminal phosphate-adenylated intermediates are substrates for deadenylation by yeast 5′Deadenylase. Our findings that classic ligases can duplicate the adenylation and phosphate cyclization activity of RtcA suggests that they have an essential role in metabolism of nucleic acids with 3′-terminal phosphates. PMID:25324547
Yakimov, Michail M; Giuliano, Laura; Cappello, Simone; Denaro, Renata; Golyshin, Peter N
2007-04-01
The composition of a metabolically active prokaryotic community thriving in hydrothermal mud fluids of the deep-sea hypersaline anoxic Western Urania Basin was characterized using rRNA-based phylogenetic analysis of a clone library. The physiologically active prokaryotic assemblage in this extreme environment showed a great genetic diversity. Most members of the microbial community appeared to be affiliated to yet uncultured organisms from similar ecosystems, i.e., deep-sea hypersaline basins and hydrothermal vents. The bacterial clone library was dominated by phylotypes affiliated with the epsilon-Proteobacteria subdivision recognized as an ecologically significant group of bacteria inhabiting deep-sea hydrothermal environments. Almost 18% of all bacterial clones were related to delta-Proteobacteria, suggesting that sulfate reduction is one of the dominant metabolic processes occurring in warm mud fluids. The remaining bacterial phylotypes were related to alpha- and beta-Proteobacteria, Actinobacteria, Bacteroides, Deinococcus-Thermus, KB1 and OP-11 candidate divisions. Moreover, a novel monophyletic clade, deeply branched with unaffiliated 16S rDNA clones was also retrieved from deep-sea sediments and halocline of Urania Basin. Archaeal diversity was much lower and detected phylotypes included organisms affiliated exclusively with the Euryarchaeota. More than 96% of the archaeal clones belonged to the MSBL-1 candidate order recently found in hypersaline anoxic environments, such as endoevaporitic microbial mats, Mediterranean deep-sea mud volcanoes and anoxic basins. Two phylotypes, represented by single clones were related to uncultured groups DHVE-1 and ANME-1. Thus, the hydrothermal mud of hypersaline Urania Basin seems to contain new microbial diversity. The prokaryotic community was significantly different from that occurring in the upper layers of the Urania Basin since 60% of all bacterial and 40% of all archaeal phylotypes were obtained only from mud fluids. The uniqueness of the composition of the active prokaryotic community could be explained by the complex environmental conditions at the site. The interaction of oxygenated warm mud fluids with the cold hypersaline brine of the Urania Basin seems to simultaneously select for various metabolic processes, such as aerobic and anaerobic heterotrophy, sulfide- and methane-dependent chemotrophy along with anaerobic oxidation of methane, sulfate- and metal-reduction.
Lopez-Fernandez, Margarita; Cherkouk, Andrea; Vilchez-Vargas, Ramiro; Jauregui, Ruy; Pieper, Dietmar; Boon, Nico; Sanchez-Castro, Ivan; Merroun, Mohamed L
2015-11-01
The long-term disposal of radioactive wastes in a deep geological repository is the accepted international solution for the treatment and management of these special residues. The microbial community of the selected host rocks and engineered barriers for the deep geological repository may affect the performance and the safety of the radioactive waste disposal. In this work, the bacterial population of bentonite formations of Almeria (Spain), selected as a reference material for bentonite-engineered barriers in the disposal of radioactive wastes, was studied. 16S ribosomal RNA (rRNA) gene-based approaches were used to study the bacterial community of the bentonite samples by traditional clone libraries and Illumina sequencing. Using both techniques, the bacterial diversity analysis revealed similar results, with phylotypes belonging to 14 different bacterial phyla: Acidobacteria, Actinobacteria, Armatimonadetes, Bacteroidetes, Chloroflexi, Cyanobacteria, Deinococcus-Thermus, Firmicutes, Gemmatimonadetes, Planctomycetes, Proteobacteria, Nitrospirae, Verrucomicrobia and an unknown phylum. The dominant groups of the community were represented by Proteobacteria and Bacteroidetes. A high diversity was found in three of the studied samples. However, two samples were less diverse and dominated by Betaproteobacteria.
Sheng, Gang; Gogakos, Tasos; Wang, Jiuyu; Zhao, Hongtu; Serganov, Artem; Juranek, Stefan
2017-01-01
Abstract We have undertaken a systematic structural study of Thermus thermophilus Argonaute (TtAgo) ternary complexes containing single-base bulges positioned either within the seed segment of the guide or target strands and at the cleavage site. Our studies establish that single-base bulges 7T8, 5A6 and 4A5 on the guide strand are stacked-into the duplex, with conformational changes localized to the bulge site, thereby having minimal impact on the cleavage site. By contrast, single-base bulges 6’U7’ and 6’A7’ on the target strand are looped-out of the duplex, with the resulting conformational transitions shifting the cleavable phosphate by one step. We observe a stable alignment for the looped-out 6’N7’ bulge base, which stacks on the unpaired first base of the guide strand, with the looped-out alignment facilitated by weakened Watson–Crick and reversed non-canonical flanking pairs. These structural studies are complemented by cleavage assays that independently monitor the impact of bulges on TtAgo-mediated cleavage reaction. PMID:28911094
2005-01-01
Extreme thermophiles produce two types of unusual polyamine: long linear polyamines such as caldopentamine and caldohexamine, and branched polyamines such as quaternary ammonium compounds [e.g. tetrakis(3-aminopropyl)ammonium]. To clarify the physiological roles of long linear and branched polyamines in thermophiles, we synthesized them chemically and tested their effects on the stability of ds (double-stranded) and ss (single-stranded) DNAs and tRNA in response to thermal denaturation, as measured by differential scanning calorimetry. Linear polyamines stabilized dsDNA in proportion to the number of amino nitrogen atoms within their molecular structure. We used the empirical results to derive formulae that estimate the melting temperature of dsDNA in the presence of polyamines of a particular molecular composition. ssDNA and tRNA were stabilized more effectively by tetrakis(3-aminopropyl)ammonium than any of the other polyamines tested. We propose that long linear polyamines are effective to stabilize DNA, and tetrakis(3-aminopropyl)ammonium plays important roles in stabilizing RNAs in thermophile cells. PMID:15673283
Zhao, Chao; Chu, Yanan; Li, Yanhong; Yang, Chengfeng; Chen, Yuqing; Wang, Xumin; Liu, Bin
2017-01-01
To analyze the microbial diversity and gene content of a thermophilic cellulose-degrading consortium from hot springs in Xiamen, China using 454 pyrosequencing for discovering cellulolytic enzyme resources. A thermophilic cellulose-degrading consortium, XM70 that was isolated from a hot spring, used sugarcane bagasse as sole carbon and energy source. DNA sequencing of the XM70 sample resulted in 349,978 reads with an average read length of 380 bases, accounting for 133,896,867 bases of sequence information. The characterization of sequencing reads and assembled contigs revealed that most microbes were derived from four phyla: Geobacillus (Firmicutes), Thermus, Bacillus, and Anoxybacillus. Twenty-eight homologous genes belonging to 15 glycoside hydrolase families were detected, including several cellulase genes. A novel hot spring metagenome-derived thermophilic cellulase was expressed and characterized. The application value of thermostable sugarcane bagasse-degrading enzymes is shown for production of cellulosic biofuel. The practical power of using a short-read-based metagenomic approach for harvesting novel microbial genes is also demonstrated.
NASA Astrophysics Data System (ADS)
Peng, Xiaotong; Chen, Shun; Xu, Hengchao
2013-12-01
small hot spring that is informally called "Fe-waterfall spring" and is located in the Rehai geothermal area discharges hot (42 to 73°C), near-neutral (pH = 7.65) Fe-rich water. Submerged reddish precipitates are composed largely of ferrihydrite, goethite, lepidocrocite, opal-A, quartz, and anorthite, as revealed by X-ray diffraction (XRD) and Mössbauer spectroscopy. Molecular phylogenetic analysis demonstrates that the bacterial community in these precipitates is mainly composed of Cyanobacteria, Planctomycetes, β-proteobacteria, Deinococci-Thermus, and Chlorobi. Scanning electron microscopy and high-resolution transmission electron microscopy examinations show that abundant sheath-like Fe oxyhydroxides, which exhibit different morphologies and sizes, are present in Fe-rich precipitates. These sheath-like structures are composed of ferrihydrite rather than more crystalline lepidocrocite or goethite. Energy-dispersive X-ray spectrometer, scanning transmission electron microscopy, and nano secondary ion mass spectrometry reveal that they are mainly composed of Fe, Si, and O, together with some trace elements. Most of the sheath-like structures are not morphologically comparable to biogenic Fe oxyhydroxides produced by known chemolithotrophic Fe oxidizers, which is consistent with the fact that no chemolithotrophic Fe oxidizers were identified by molecular analysis in the precipitates. We suggest that the sheath-like Fe oxyhydroxides are formed through passive Fe sorption and nucleation onto the cell walls of various thermophiles rather than by the direct metabolic activities of chemolithotrophic Fe oxidizers. Biogenic sheath-like Fe oxyhydroxides in Fe-waterfall spring have important implications for geochemical cycles driven by microorganisms, the origin of microfossils, and the formation of banded iron formations (BIFs) in the Archean ocean.
Profile Changes in the Soil Microbial Community When Desert Becomes Oasis
Li, Chen-hua; Tang, Li-song; Jia, Zhong-jun; Li, Yan
2015-01-01
The conversion of virgin desert into oasis farmland creates two contrasting types of land-cover. During oasis formation with irrigation and fertilizer application, however, the changes in the soil microbial population, which play critical roles in the ecosystem, remain poorly understood. We applied high-throughput pyrosequencing to investigate bacterial and archaeal communities throughout the profile (0–3 m) in an experimental field, where irrigation and fertilization began in 1990 and cropped with winter wheat since then. To assess the effects of cultivation, the following treatments were compared with the virgin desert: CK (no fertilizer), PK, NK, NP, NPK, NPKR, and NPKM (R: straw residue; M: manure fertilizer). Irrigation had a greater impact on the overall microbial community than fertilizer application. The greatest impact occurred in topsoil (0–0.2 m), e.g., Cyanobacteria (25% total abundance) were most abundant in desert soil, while Actinobacteria (26%) were most abundant in oasis soil. The proportions of extremophilic and photosynthetic groups (e.g., Deinococcus-Thermus and Cyanobacteria) decreased, while the proportions of R-strategy (e.g., Gammaproteobacteria including Xanthomonadales), nitrifying (e.g., Nitrospirae), and anaerobic bacteria (e.g., Anaerolineae) increased throughout the oasis profile. Archaea occurred only in oasis soil. The impact of fertilizer application was mainly reflected in the non-dominant communities or finer taxonomic divisions. Oasis formation led to a dramatic shift in microbial community and enhanced soil enzyme activities. The rapidly increased soil moisture and decreased salt caused by irrigation were responsible for this shift. Furthermore, difference in fertilization and crop growth altered the organic carbon contents in the soil, which resulted in differences of microbial communities within oasis. PMID:26426279
Crystal structure of homoisocitrate dehydrogenase from Schizosaccharomyces pombe
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulfer, Stacie L.; Hendershot, Jenna M.; Trievel, Raymond C.
Lysine biosynthesis in fungi, euglena, and certain archaebacteria occurs through the {alpha}-aminoadipate pathway. Enzymes in the first steps of this pathway have been proposed as potential targets for the development of antifungal therapies, as they are absent in animals but are conserved in several pathogenic fungi species, including Candida, Cryptococcus, and Aspergillus. One potential antifungal target in the {alpha}-aminoadipate pathway is the third enzyme in the pathway, homoisocitrate dehydrogenase (HICDH), which catalyzes the divalent metal-dependent conversion of homoisocitrate to 2-oxoadipate (2-OA) using nicotinamide adenine dinucleotide (NAD{sup +}) as a cofactor. HICDH belogns to a family of {beta}-hydroxyacid oxidative decarboxylases thatmore » includes malate dehydrogenase, tartrate dehydrogenase, 6-phosphogluconate dehydrogenase, isocitrate dehydrogenase (ICDH), and 3-isopropylmalte dehydrogenase (IPMDH). ICDH and IPMDH are well-characterized enzymes that catalyze the decarboxylation of isocitrate to yield 2-oxoglutarate (2-OG) in the citric acid cycle and the conversion of 3-isopropylmalate to 2-oxoisovalerate in the leucine biosynthetic pathway, respectively. Recent structural and biochemical studies of HICDH reveal that this enzyme shares sequence, structural, and mechanistic homology with ICDH and IPMDH. To date, the only published structures of HICDH are from the archaebacteria Thermus thermophilus (TtHICDH). Fungal HICDHs diverge from TtHICDH in several aspects, including their thermal stability, oligomerization state, and substrate specificity, thus warranting further characterization. To gain insights into these differences, they determined crystal structures of a fungal Schizosaccharomyces pombe HICDH (SpHICDH) as an apoenzyme and as a binary complex with additive tripeptide glycyl-glycyl-glycine (GGG) to 1.55 {angstrom} and 1.85 {angstrom} resolution, respectively. Finally, a comparison of the SpHICDH and TtHICDH structures reveal differences in their active sites that help explain the variations in their respective substrate specificities.« less
Yang, Longhua; Skjevik, Åge A; Han Du, Wen-Ge; Noodleman, Louis; Walker, Ross C; Götz, Andreas W
2016-09-01
Cytochrome c oxidase (CcO) is a vital enzyme that catalyzes the reduction of molecular oxygen to water and pumps protons across mitochondrial and bacterial membranes. While proton uptake channels as well as water exit channels have been identified for A-type CcOs, the means by which water and protons exit B-type CcOs remain unclear. In this work, we investigate potential mechanisms for proton transport above the dinuclear center (DNC) in ba3-type CcO of Thermus thermophilus. Using long-time scale, all-atom molecular dynamics (MD) simulations for several relevant protonation states, we identify a potential mechanism for proton transport that involves propionate A of the active site heme a3 and residues Asp372, His376 and Glu126(II), with residue His376 acting as the proton-loading site. The proposed proton transport process involves a rotation of residue His376 and is in line with experimental findings. We also demonstrate how the strength of the salt bridge between residues Arg225 and Asp287 depends on the protonation state and that this salt bridge is unlikely to act as a simple electrostatic gate that prevents proton backflow. We identify two water exit pathways that connect the water pool above the DNC to the outer P-side of the membrane, which can potentially also act as proton exit transport pathways. Importantly, these water exit pathways can be blocked by narrowing the entrance channel between residues Gln151(II) and Arg449/Arg450 or by obstructing the entrance through a conformational change of residue Tyr136, respectively, both of which seem to be affected by protonation of residue His376. Copyright © 2016 Elsevier B.V. All rights reserved.
Kutyavin, Igor V.
2010-01-01
The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection. PMID:19969535
Complex sputum microbial composition in patients with pulmonary tuberculosis
2012-01-01
Background An increasing number of studies have implicated the microbiome in certain diseases, especially chronic diseases. In this study, the bacterial communities in the sputum of pulmonary tuberculosis patients were explored. Total DNA was extracted from sputum samples from 31 pulmonary tuberculosis patients and respiratory secretions of 24 healthy participants. The 16S rRNA V3 hyper-variable regions were amplified using bar-coded primers and pyro-sequenced using Roche 454 FLX. Results The results showed that the microbiota in the sputum of pulmonary tuberculosis patients were more diverse than those of healthy participants (p<0.05). The sequences were classified into 24 phyla, all of which were found in pulmonary tuberculosis patients and 17 of which were found in healthy participants. Furthermore, many foreign bacteria, such as Stenotrophomonas, Cupriavidus, Pseudomonas, Thermus, Sphingomonas, Methylobacterium, Diaphorobacter, Comamonas, and Mobilicoccus, were unique to pulmonary tuberculosis patients. Conclusions This study concluded that the microbial composition of the respiratory tract of pulmonary tuberculosis patients is more complicated than that of healthy participants, and many foreign bacteria were found in the sputum of pulmonary tuberculosis patients. The roles of these foreign bacteria in the onset or development of pulmonary tuberculosis shoud be considered by clinicians. PMID:23176186
Chuvochina, Maria S; Marie, Dominique; Chevaillier, Servanne; Petit, Jean-Robert; Normand, Philippe; Alekhina, Irina A; Bulat, Sergey A
2011-01-01
Microorganisms uplifted during dust storms survive long-range transport in the atmosphere and could colonize high-altitude snow. Bacterial communities in alpine snow on a Mont Blanc glacier, associated with four depositions of Saharan dust during the period 2006-2009, were studied using 16S rRNA gene sequencing and flow cytometry. Also, sand from the Tunisian Sahara, Saharan dust collected in Grenoble and Mont Blanc snow containing no Saharan dust (one sample of each) were analyzed. The bacterial community composition varied significantly in snow containing four dust depositions over a 3-year period. Out of 61 phylotypes recovered from dusty snow, only three phylotypes were detected in more than one sample. Overall, 15 phylotypes were recognized as potential snow colonizers. For snow samples, these phylotypes belonged to Actinobacteria, Proteobacteria and Cyanobacteria, while for Saharan sand/dust samples they belonged to Actinobacteria, Bacteroidetes, Deinococcus-Thermus and Proteobacteria. Thus, regardless of the time-scale, Saharan dust events can bring different microbiota with no common species set to alpine glaciers. This seems to be defined more by event peculiarities and aeolian transport conditions than by the bacterial load from the original dust source.
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes.
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui
2017-09-01
At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.
Köberl, Martina; Müller, Henry; Ramadan, Elshahat M; Berg, Gabriele
2011-01-01
To convert deserts into arable, green landscapes is a global vision, and desert farming is a strong growing area of agriculture world-wide. However, its effect on diversity of soil microbial communities, which are responsible for important ecosystem services like plant health, is still not known. We studied the impact of long-term agriculture on desert soil in one of the most prominent examples for organic desert farming in Sekem (Egypt). Using a polyphasic methodological approach to analyse microbial communities in soil as well as associated with cultivated plants, drastic effects caused by 30 years of agriculture were detected. Analysing bacterial fingerprints, we found statistically significant differences between agricultural and native desert soil of about 60%. A pyrosequencing-based analysis of the 16S rRNA gene regions showed higher diversity in agricultural than in desert soil (Shannon diversity indices: 11.21/7.90), and displayed structural differences. The proportion of Firmicutes in field soil was significantly higher (37%) than in the desert (11%). Bacillus and Paenibacillus play the key role: they represented 96% of the antagonists towards phytopathogens, and identical 16S rRNA sequences in the amplicon library and for isolates were detected. The proportion of antagonistic strains was doubled in field in comparison to desert soil (21.6%/12.4%); disease-suppressive bacteria were especially enriched in plant roots. On the opposite, several extremophilic bacterial groups, e.g., Acidimicrobium, Rubellimicrobium and Deinococcus-Thermus, disappeared from soil after agricultural use. The N-fixing Herbaspirillum group only occurred in desert soil. Soil bacterial communities were strongly driven by the a-biotic factors water supply and pH. After long-term farming, a drastic shift in the bacterial communities in desert soil was observed. Bacterial communities in agricultural soil showed a higher diversity and a better ecosystem function for plant health but a loss of extremophilic bacteria. Interestingly, we detected that indigenous desert microorganisms promoted plant health in desert agro-ecosystems.
2008-01-01
Background The phosphoenolpyruvate phosphotransferase system (PTS) plays a major role in sugar transport and in the regulation of essential physiological processes in many bacteria. The PTS couples solute transport to its phosphorylation at the expense of phosphoenolpyruvate (PEP) and it consists of general cytoplasmic phosphoryl transfer proteins and specific enzyme II complexes which catalyze the uptake and phosphorylation of solutes. Previous studies have suggested that the evolution of the constituents of the enzyme II complexes has been driven largely by horizontal gene transfer whereas vertical inheritance has been prevalent in the general phosphoryl transfer proteins in some bacterial groups. The aim of this work is to test this hypothesis by studying the evolution of the phosphoryl transfer proteins of the PTS. Results We have analyzed the evolutionary history of the PTS phosphoryl transfer chain (PTS-ptc) components in 222 complete genomes by combining phylogenetic methods and analysis of genomic context. Phylogenetic analyses alone were not conclusive for the deepest nodes but when complemented with analyses of genomic context and functional information, the main evolutionary trends of this system could be depicted. Conclusion The PTS-ptc evolved in bacteria after the divergence of early lineages such as Aquificales, Thermotogales and Thermus/Deinococcus. The subsequent evolutionary history of the PTS-ptc varied in different bacterial lineages: vertical inheritance and lineage-specific gene losses mainly explain the current situation in Actinobacteria and Firmicutes whereas horizontal gene transfer (HGT) also played a major role in Proteobacteria. Most remarkably, we have identified a HGT event from Firmicutes or Fusobacteria to the last common ancestor of the Enterobacteriaceae, Pasteurellaceae, Shewanellaceae and Vibrionaceae. This transfer led to extensive changes in the metabolic and regulatory networks of these bacteria including the development of a novel carbon catabolite repression system. Hence, this example illustrates that HGT can drive major physiological modifications in bacteria. PMID:18485189
Microbiological monitoring in geothermal plants and a cold storage
NASA Astrophysics Data System (ADS)
Alawi, Mashal; Lerm, Stephanie; Vieth, Andrea; Vetter, Alexandra; Miethling-Graff, Rona; Seibt, Andrea; Wolfgramm, Markus; Würdemann, Hilke
2010-05-01
Enhanced process understanding of engineered geothermal systems is mandatory to optimize plant reliability and economy. In the scope of the research project 'AquiScreen' we investigated geothermally used groundwater systems under microbial, geochemical, mineralogical and petrological aspects. Geothermal systems located in the North German Basin and the Molasse Basin were analyzed by sampling of fluids and solid phases. The investigated sites were characterized by different temperatures, salinities and potential microbial substrates. The microbial population was analyzed by the use of genetic fingerprinting techniques based on PCR-amplified 16S rRNA genes. Sequencing of dominant bands of fingerprints from different sites and the subsequent comparison on public databases enables a correlation to metabolic classes and provides information about the biochemical processes. In all investigated geothermal plants covering a temperature range from 45° to 120° C microorganisms were found. Phylogenetic gene analyses indicate a broad diversity of microorganisms adapted to the specific conditions in the engineered system. Beside characterized bacteria like Thermus scotoductus, Siderooxidans lithoautotrophicus and the archaeon Methanothermobacter thermoautotrophicus a high number of so far uncultivated microorganisms was detected. As it is known that -in addition to abiotic factors- microbes like sulfate-reducing bacteria (SRB) are involved in the processes of corrosion and scaling in plant components we identified SRB by specific analyses of dissimilatoric sulfite reductase genes. The SRB detected are closely related to thermotolerant and thermophilic species of Desulfotomaculum, Thermodesulfovibrio and Thermodesulfobacterium, respectively. Overall, the detection of microbes known to be involved in biocorrosion and examined precipitation products like iron sulfides are indicating that microorganisms play an important role for the understanding of processes in engineered geothermal systems. Furthermore, an observed reduction of the filter operation times in a cold storage could be traced back to an enhanced growth of a filamentous iron-oxidizing bacterium related to Thiotrix. The further identificaton of crucial process parameters that are influencing microbial activities will help developing appropriate counter measures against microbial induced clogging and corrosion.
Microbiological Monitoring in Geothermal Plants
NASA Astrophysics Data System (ADS)
Alawi, M.; Lerm, S.; Linder, R.; Vetter, A.; Vieth-Hillebrand, A.; Miethling-Graff, R.; Seibt, A.; Wolfgramm, M.; Wuerdemann, H.
2010-12-01
In the scope of the research projects “AquiScreen” and “MiProTherm” we investigated geothermally used groundwater systems under microbial, geochemical, mineralogical and petrological aspects. On one side an enhanced process understanding of engineered geothermal systems is mandatory to optimize plant reliability and economy, on the other side this study provides insights into the microbiology of terrestrial thermal systems. Geothermal systems located in the North German Basin and the Molasse Basin were analyzed by sampling of fluids and solid phases. The investigated sites were characterized by different temperatures, salinities and potential microbial substrates. The microbial population was monitored by the use of genetic fingerprinting techniques and PCR-cloning based on PCR-amplified 16S rRNA and dissimilatory sulfite reductase (DSR) genes. DNA-sequences of fingerprints and cloned PCR-products were compared to public databases and correlated with metabolic classes to provide information about the biogeochemical processes. In all investigated geothermal plants, covering a temperature range from 5° to 120°C, microorganisms were found. Phylogenetic gene analyses indicate a broad diversity of microorganisms adapted to the specific conditions in the engineered system. Beside characterized bacteria like Thermus scotoductus, Siderooxidans lithoautotrophicus and the archaeon Methanothermobacter thermoautotrophicus a high number of so far uncultivated microorganisms was detected. As it is known that - in addition to abiotic factors - microbes like sulfate-reducing bacteria (SRB) are involved in the processes of corrosion and scaling in plant components, we identified SRB by specific analyses of DSR genes. The SRB detected are closely related to thermotolerant and thermophilic species of Desulfotomaculum, Thermodesulfovibrio, Desulfohalobium and Thermodesulfobacterium, respectively. Overall, the detection of microbes known to be involved in biocorrosion and the examined precipitation products like iron sulfides are indicating that microorganisms play an important role for the understanding of processes in engineered geothermal systems. The further identification of crucial process parameters influencing microbial activities will help to develop appropriate counter measures against microbial induced clogging and corrosion.
Woo, Patrick C Y; Lau, Susanna K P; Tse, Herman; Teng, Jade L L; Curreem, Shirly O T; Tsang, Alan K L; Fan, Rachel Y Y; Wong, Gilman K M; Huang, Yi; Loman, Nicholas J; Snyder, Lori A S; Cai, James J; Huang, Jian-Dong; Mak, William; Pallen, Mark J; Lok, Si; Yuen, Kwok-Yung
2009-03-01
Laribacter hongkongensis is a newly discovered Gram-negative bacillus of the Neisseriaceae family associated with freshwater fish-borne gastroenteritis and traveler's diarrhea. The complete genome sequence of L. hongkongensis HLHK9, recovered from an immunocompetent patient with severe gastroenteritis, consists of a 3,169-kb chromosome with G+C content of 62.35%. Genome analysis reveals different mechanisms potentially important for its adaptation to diverse habitats of human and freshwater fish intestines and freshwater environments. The gene contents support its phenotypic properties and suggest that amino acids and fatty acids can be used as carbon sources. The extensive variety of transporters, including multidrug efflux and heavy metal transporters as well as genes involved in chemotaxis, may enable L. hongkongensis to survive in different environmental niches. Genes encoding urease, bile salts efflux pump, adhesin, catalase, superoxide dismutase, and other putative virulence factors-such as hemolysins, RTX toxins, patatin-like proteins, phospholipase A1, and collagenases-are present. Proteomes of L. hongkongensis HLHK9 cultured at 37 degrees C (human body temperature) and 20 degrees C (freshwater habitat temperature) showed differential gene expression, including two homologous copies of argB, argB-20, and argB-37, which encode two isoenzymes of N-acetyl-L-glutamate kinase (NAGK)-NAGK-20 and NAGK-37-in the arginine biosynthesis pathway. NAGK-20 showed higher expression at 20 degrees C, whereas NAGK-37 showed higher expression at 37 degrees C. NAGK-20 also had a lower optimal temperature for enzymatic activities and was inhibited by arginine probably as negative-feedback control. Similar duplicated copies of argB are also observed in bacteria from hot springs such as Thermus thermophilus, Deinococcus geothermalis, Deinococcus radiodurans, and Roseiflexus castenholzii, suggesting that similar mechanisms for temperature adaptation may be employed by other bacteria. Genome and proteome analysis of L. hongkongensis revealed novel mechanisms for adaptations to survival at different temperatures and habitats.
Kusumi, Asako; Li, Xianshu; Osuga, Yu; Kawashima, Arata; Gu, Ji-Dong; Nasu, Masao; Katayama, Yoko
2013-01-01
The Bayon temple in Angkor Thom, Cambodia has shown serious deterioration and is subject to the formation of various pigmented biofilms. Because biofilms are damaging the bas-reliefs, low reliefs engraved on the surface of sandstone, information about the microbial community within them is indispensable to control biofilm colonization. PCR-denaturing gradient gel electrophoresis (DGGE) analysis of biofilm samples from the pigmented sandstone surfaces showed that the bacterial community members in the biofilms differed clearly from those in the air and had low sequence similarity to database sequences. Non-destructive sampling of biofilm revealed novel bacterial groups of predominantly Rubrobacter in salmon pink biofilm, Cyanobacteria in chrome green biofilm, Cyanobacteria and Chloroflexi in signal violet biofilm, Chloroflexi in black gray biofilm, and Deinococcus-Thermus, Cyanobacteria, and Rubrobacter in blue green biofilm. Serial peeling-off of a thick biofilm by layers with adhesive sheets revealed a stratified structure: the blue-green biofilm, around which there was serious deterioration, was very rich in Cyanobacteria near the surface and Chloroflexi in deep layer below. Nitrate ion concentrations were high in the blue-green biofilm. The characteristic distribution of bacteria at different biofilm depths provides valuable information on not only the biofilm formation process but also the sandstone weathering process in the tropics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
López, José L.; Golemba, Marcelo; Hernández, Edgardo
Rhodopsins are broadly distributed. In this work, we analyzed 23 metagenomes corresponding to marine sediment samples from four regions that share cold climate conditions (Norway; Sweden; Argentina and Antarctica). In order to investigate the genes evolution of viral rhodopsins, an initial set of 6224 bacterial rhodopsin sequences according to COG5524 were retrieved from the 23 metagenomes. After selection by the presence of transmembrane domains and alignment, 123 viral (51) and non-viral (72) sequences (>50 amino acids) were finally included in further analysis. Viral rhodopsin genes were homologs of Phaeocystis globosa virus and Organic lake Phycodnavirus. Non-viral microbial rhodopsin genes weremore » ascribed to Bacteroidetes, Planctomycetes, Firmicutes, Actinobacteria, Cyanobacteria, Proteobacteria, Deinococcus-Thermus and Cryptophyta and Fungi. A rescreening using Blastp, using as queries the viral sequences previously described, retrieved 30 sequences (>100 amino acids). Phylogeographic analysis revealed a geographical clustering of the sequences affiliated to the viral group. This clustering was not observed for the microbial non-viral sequences. The phylogenetic reconstruction allowed us to propose the existence of a putative ancestor of viral rhodopsin genes related to Actinobacteria and Chloroflexi. This is the first report about the existence of a phylogeographic association of the viral rhodopsin sequences from marine sediments.« less
Changes in the Bacterial Community of Soil from a Neutral Mine Drainage Channel
Pereira, Letícia Bianca; Vicentini, Renato; Ottoboni, Laura M. M.
2014-01-01
Mine drainage is an important environmental disturbance that affects the chemical and biological components in natural resources. However, little is known about the effects of neutral mine drainage on the soil bacteria community. Here, a high-throughput 16S rDNA pyrosequencing approach was used to evaluate differences in composition, structure, and diversity of bacteria communities in samples from a neutral drainage channel, and soil next to the channel, at the Sossego copper mine in Brazil. Advanced statistical analyses were used to explore the relationships between the biological and chemical data. The results showed that the neutral mine drainage caused changes in the composition and structure of the microbial community, but not in its diversity. The Deinococcus/Thermus phylum, especially the Meiothermus genus, was in large part responsible for the differences between the communities, and was positively associated with the presence of copper and other heavy metals in the environmental samples. Other important parameters that influenced the bacterial diversity and composition were the elements potassium, sodium, nickel, and zinc, as well as pH. The findings contribute to the understanding of bacterial diversity in soils impacted by neutral mine drainage, and demonstrate that heavy metals play an important role in shaping the microbial population in mine environments. PMID:24796430
Forget, Nathalie L; Kim Juniper, S
2013-01-01
We systematically studied free-living bacterial diversity within aggregations of the vestimentiferan tubeworm Ridgeia piscesae sampled from two contrasting flow regimes (High Flow and Low Flow) in the Endeavour Hydrothermal Vents Marine Protected Area (MPA) on the Juan de Fuca Ridge (Northeast Pacific). Eight samples of particulate detritus were recovered from paired tubeworm grabs from four vent sites. Most sequences (454 tag and Sanger methods) were affiliated to the Epsilonproteobacteria, and the sulfur-oxidizing genus Sulfurovum was dominant in all samples. Gammaproteobacteria were also detected, mainly in Low Flow sequence libraries, and were affiliated with known methanotrophs and decomposers. The cooccurrence of sulfur reducers from the Deltaproteobacteria and the Epsilonproteobacteria suggests internal sulfur cycling within these habitats. Other phyla detected included Bacteroidetes, Actinobacteria, Chloroflexi, Firmicutes, Planctomycetes, Verrucomicrobia, and Deinococcus–Thermus. Statistically significant relationships between sequence library composition and habitat type suggest a predictable pattern for High Flow and Low Flow environments. Most sequences significantly more represented in High Flow libraries were related to sulfur and hydrogen oxidizers, while mainly heterotrophic groups were more represented in Low Flow libraries. Differences in temperature, available energy for metabolism, and stability between High Flow and Low Flow habitats potentially explain their distinct bacterial communities. PMID:23401293
Microbiological studies of hot springs in India: a review.
Poddar, Abhijit; Das, Subrata K
2018-01-01
The earliest microbiological studies on hot springs in India date from 2003, a much later date compared to global attention in this striking field of study. As of today, 28 out of 400 geothermal springs have been explored following both culturable and non-culturable approaches. The temperatures and pH of the springs are 37-99 °C and 6.8-10, respectively. Several studies have been performed on the description of novel genera and species, characterization of different bio-resources, metagenomics of hot spring microbiome and whole genome analysis of few isolates. 17 strains representing novel species and many thermostable enzymes, including lipase, protease, chitinase, amylase, etc. with potential biotechnological applications have been reported by several authors. Influence of physico-chemical conditions, especially that of temperature, on shaping the hot spring microbiome has been established by metagenomic investigations. Bacteria are the predominant life forms in all the springs with an abundance of phyla Firmicutes, Proteobacteria, Actinobacteria, Thermi, Bacteroidetes, Deinococcus-Thermus and Chloroflexi. In this review, we have discussed the findings on all microbiological studies that have been carried out to date, on the 28 hot springs. Further, the possibilities of extrapolating these studies for practical applications and environmental impact assessment towards protection of natural ecosystem of hot springs have also been discussed.
O'Sullivan, Daniel J.; O'Sullivan, Orla; McSweeney, Paul L. H.; Sheehan, Jeremiah J.
2015-01-01
We sought to determine if the time, within a production day, that a cheese is manufactured has an influence on the microbial community present within that cheese. To facilitate this, 16S rRNA amplicon sequencing was used to elucidate the microbial community dynamics of brine-salted continental-type cheese in cheeses produced early and late in the production day. Differences in the microbial composition of the core and rind of the cheese were also investigated. Throughout ripening, it was apparent that cheeses produced late in the day had a more diverse microbial population than their early equivalents. Spatial variation between the cheese core and rind was also noted in that cheese rinds were initially found to have a more diverse microbial population but thereafter the opposite was the case. Interestingly, the genera Thermus, Pseudoalteromonas, and Bifidobacterium, not routinely associated with a continental-type cheese produced from pasteurized milk, were detected. The significance, if any, of the presence of these genera will require further attention. Ultimately, the use of high-throughput sequencing has facilitated a novel and detailed analysis of the temporal and spatial distribution of microbes in this complex cheese system and established that the period during a production cycle at which a cheese is manufactured can influence its microbial composition. PMID:25636841
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387
Demina, Tatiana A; Pietilä, Maija K; Svirskaitė, Julija; Ravantti, Janne J; Atanasova, Nina S; Bamford, Dennis H; Oksanen, Hanna M
2017-02-18
Members of the virus family Sphaerolipoviridae include both archaeal viruses and bacteriophages that possess a tailless icosahedral capsid with an internal membrane. The genera Alpha- and Betasphaerolipovirus comprise viruses that infect halophilic euryarchaea, whereas viruses of thermophilic Thermus bacteria belong to the genus Gammasphaerolipovirus . Both sequence-based and structural clustering of the major capsid proteins and ATPases of sphaerolipoviruses yield three distinct clades corresponding to these three genera. Conserved virion architectural principles observed in sphaerolipoviruses suggest that these viruses belong to the PRD1-adenovirus structural lineage. Here we focus on archaeal alphasphaerolipoviruses and their related putative proviruses. The highest sequence similarities among alphasphaerolipoviruses are observed in the core structural elements of their virions: the two major capsid proteins, the major membrane protein, and a putative packaging ATPase. A recently described tailless icosahedral haloarchaeal virus, Haloarcula californiae icosahedral virus 1 (HCIV-1), has a double-stranded DNA genome and an internal membrane lining the capsid. HCIV-1 shares significant similarities with the other tailless icosahedral internal membrane-containing haloarchaeal viruses of the family Sphaerolipoviridae . The proposal to include a new virus species, Haloarcula virus HCIV1 , into the genus Alphasphaerolipovirus was submitted to the International Committee on Taxonomy of Viruses (ICTV) in 2016.
Wang, Shang; Dong, Hailiang; Hou, Weiguo; Jiang, Hongchen; Huang, Qiuyuan; Briggs, Brandon R.; Huang, Liuqin
2014-01-01
Temporal variation in geochemistry can cause changes in microbial community structure and diversity. Here we studied temporal changes of microbial communities in Tengchong hot springs of Yunnan Province, China in response to geochemical variations by using microbial and geochemical data collected in January, June and August of 2011. Greater temporal variations were observed in individual taxa than at the whole community structure level. Water and sediment communities exhibited different temporal variation patterns. Water communities were largely stable across three sampling times and dominated by similar microbial lineages: Hydrogenobaculum in moderate-temperature acidic springs, Sulfolobus in high-temperature acidic springs, and Hydrogenobacter in high-temperature circumneutral to alkaline springs. Sediment communities were more diverse and responsive to changing physicochemical conditions. Most of the sediment communities in January and June were similar to those in waters. However, the August sediment community was more diverse and contained more anaerobic heterotrophs than the January and June: Desulfurella and Acidicaldus in moderate-temperature acidic springs, Ignisphaera and Desulfurococcus in high-temperature acidic springs, the candidate division OP1 and Fervidobacterium in alkaline springs, and Thermus and GAL35 in neutral springs. Temporal variations in physicochemical parameters including temperature, pH, and dissolved organic carbon may have triggered the observed microbial community shifts. PMID:25524763
Yim, Lau Chui; Hongmei, Jing; Aitchison, Jonathan C; Pointing, Stephen B
2006-07-01
We report an assessment of whole-community diversity for an extremely isolated geothermal location with considerable phylogenetic and phylogeographic novelty. We further demonstrate, using multiple statistical analyses of sequence data, that the response of community diversity is not monotonic to thermal stress along a gradient of 52-83 degrees C. A combination of domain- and division-specific PCR was used to obtain a broad spectrum of community phylotypes, which were resolved by denaturing gradient gel electrophoresis. Among 58 sequences obtained from microbial mats and streamers, some 95% suggest novel archaeal and bacterial diversity at the species level or higher. Moreover, new phylogeographic and thermally defined lineages among the Cyanobacteria, Chloroflexi, Eubacterium and Thermus are identified. Shannon-Wiener diversity estimates suggest that mats at 63 degrees C supported highest diversity, but when alternate models were applied [Average Taxonomic Distinctness (AvTD) and Variation in Taxonomic Distinctness (VarTD)] that also take into account the phylogenetic relationships between phylotypes, it is evident that greatest taxonomic diversity (AvTD) occurred in streamers at 65-70 degrees C, whereas greatest phylogenetic distance between taxa (VarTD) occurred in streamers of 83 degrees C. All models demonstrated that diversity is not related to thermal stress in a linear fashion.
Guo, Yong; Fujimura, Reiko; Sato, Yoshinori; Suda, Wataru; Kim, Seok-won; Oshima, Kenshiro; Hattori, Masahira; Kamijo, Takashi; Narisawa, Kazuhiko; Ohta, Hiroyuki
2014-01-01
The 2000 eruption of Mount Oyama on the island of Miyake (Miyake-jima) created a unique opportunity to study the early ecosystem development on newly exposed terrestrial substrates. In this study, bacterial and fungal communities on 9- and 11-year-old volcanic deposits at poorly to fully vegetation-recovered sites in Miyake-jima, Japan, were characterized by conventional culture-based methods and pyrosequencing of 16S rRNA and 18S rRNA genes. Despite the differences in the vegetation cover, the upper volcanic deposit layer samples displayed low among-site variation for chemical properties (pH, total organic carbon, and total nitrogen) and microbial population densities (total direct count and culturable count). Statistical analyses of pyrosequencing data revealed that the microbial communities of volcanic deposit samples were phylogenetically diverse, in spite of very low-carbon environmental conditions, and their diversity was comparable to that in the lower soil layer (buried soil) samples. Comparing with the microbial communities in buried soil, the volcanic deposit communities were characterized by the presence of Betaproteobacteria and Gammaproteobacteria as the main bacterial class, Deinococcus- Thermus as the minor bacterial phyla, and Ascomycota as the major fungal phyla. Multivariate analysis revealed that several bacterial families and fungal classes correlated positively or negatively with plant species. PMID:24463576
Lin, Wenfang; Yu, Zhisheng; Chen, Xi; Liu, Ruyin; Zhang, Hongxun
2013-09-01
Microorganism in drinking water distribution system may colonize in biofilms. Bacterial 16S rRNA gene diversities were analyzed in both water and biofilms grown on taps with three different materials (polyvinyl chloride (PVC), stainless steel, and cast iron) from a local drinking water distribution system. In total, five clone libraries (440 sequences) were obtained. The taxonomic composition of the microbial communities was found to be dominated by members of Proteobacteria (65.9-98.9 %), broadly distributed among the classes Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Other bacterial groups included Firmicutes, Acidobacteria, Bacteroidetes, Cyanobacteria, and Deinococcus-Thermus. Moreover, a small proportion of unclassified bacteria (3.5-10.6 %) were also found. This investigation revealed that the bacterial communities in biofilms appeared much more diversified than expected and more care should be taken to the taps with high bacterial diversity. Also, regular monitor of outflow water would be useful as potentially pathogenic bacteria were detected. In addition, microbial richness and diversity in taps ranked in the order as: PVC < stainless steel < cast iron. All the results interpreted that PVC would be a potentially suitable material for use as tap component in drinking water distribution system.
Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals
Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...
2015-04-30
In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less
Development of a continuous bioconversion system using a thermophilic whole-cell biocatalyst.
Ninh, Pham Huynh; Honda, Kohsuke; Yokohigashi, Yukako; Okano, Kenji; Omasa, Takeshi; Ohtake, Hisao
2013-03-01
The heat treatment of recombinant mesophilic cells having heterologous thermophilic enzymes results in the denaturation of indigenous mesophilic enzymes and the elimination of undesired side reactions; therefore, highly selective whole-cell catalysts comparable to purified enzymes can be readily prepared. However, the thermolysis of host cells leads to the heat-induced leakage of thermophilic enzymes, which are produced as soluble proteins, limiting the exploitation of their excellent stability in repeated and continuous reactions. In this study, Escherichia coli cells having the thermophilic fumarase from Thermus thermophilus (TtFTA) were treated with glutaraldehyde to prevent the heat-induced leakage of the enzyme, and the resulting cells were used as a whole-cell catalyst in repeated and continuous reactions. Interestingly, although electron microscopic observations revealed that the cellular structure of glutaraldehyde-treated E. coli was not apparently changed by the heat treatment, the membrane permeability of the heated cells to relatively small molecules (up to at least 3 kDa) was significantly improved. By applying the glutaraldehyde-treated E. coli having TtFTA to a continuous reactor equipped with a cell-separation membrane filter, the enzymatic hydration of fumarate to malate could be operated for more than 600 min with a molar conversion yield of 60% or higher.
Development of a Continuous Bioconversion System Using a Thermophilic Whole-Cell Biocatalyst
Ninh, Pham Huynh; Yokohigashi, Yukako; Okano, Kenji; Omasa, Takeshi; Ohtake, Hisao
2013-01-01
The heat treatment of recombinant mesophilic cells having heterologous thermophilic enzymes results in the denaturation of indigenous mesophilic enzymes and the elimination of undesired side reactions; therefore, highly selective whole-cell catalysts comparable to purified enzymes can be readily prepared. However, the thermolysis of host cells leads to the heat-induced leakage of thermophilic enzymes, which are produced as soluble proteins, limiting the exploitation of their excellent stability in repeated and continuous reactions. In this study, Escherichia coli cells having the thermophilic fumarase from Thermus thermophilus (TtFTA) were treated with glutaraldehyde to prevent the heat-induced leakage of the enzyme, and the resulting cells were used as a whole-cell catalyst in repeated and continuous reactions. Interestingly, although electron microscopic observations revealed that the cellular structure of glutaraldehyde-treated E. coli was not apparently changed by the heat treatment, the membrane permeability of the heated cells to relatively small molecules (up to at least 3 kDa) was significantly improved. By applying the glutaraldehyde-treated E. coli having TtFTA to a continuous reactor equipped with a cell-separation membrane filter, the enzymatic hydration of fumarate to malate could be operated for more than 600 min with a molar conversion yield of 60% or higher. PMID:23335777
Ribosome reinitiation at leader peptides increases translation of bacterial proteins.
Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A
2016-04-16
Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.
Pagaling, Eulyn; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun
2012-07-01
We investigated the bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong in the Yunnan Province, China, using direct molecular analyses. The Langpu (LP) laminated mat was found by the side of a boiling pool with temperature of 60-65 °C and a pH of 8.5, while the Tengchong (TC) streamer mat consisted of white streamers in a slightly acidic (pH 6.5) hot pool outflow with a temperature of 72 °C. Four 16S rRNA gene clone libraries were constructed and restriction enzyme analysis of the inserts was used to identify unique sequences and clone frequencies. From almost 200 clones screened, 55 unique sequences were retrieved. Phylogenetic analysis showed that the LP mat consisted of a diverse bacterial population [Cyanobacteria, Chloroflexi, Chlorobia, Nitrospirae, 'Deinococcus-Thermus', Proteobacteria (alpha, beta and delta subdivisions), Firmicutes, Bacteroidetes and Actinobacteria], while the archaeal population was dominated by methanogenic Euryarchaeota and Crenarchaeota. In contrast, the TC streamer mat consisted of a bacterial population dominated by Aquificae, while the archaeal population also contained Korarchaeota as well as Crenarchaeota and methanogenic Euryarchaeota. These mats harboured clone sequences affiliated to unidentified lineages, suggesting that they are a potential source for discovering novel bacteria and archaea.
NASA Astrophysics Data System (ADS)
Müller, C. S.; Auerbach, H.; Stegmaier, K.; Wolny, J. A.; Schünemann, V.; Pierik, A. J.
2017-11-01
The Thermus thermophilus Rieske protein ( TtRP) contains a 2Fe-2S cluster with one iron (Fe-Cys) coordinated by four sulfur atoms (2xS2- and 2xCys) and one iron (Fe-His) by two sulfur and two nitrogen atoms (2xS2-, His134 and His154). Here, the protein is investigated at three pH values (6.0, 8.5 and 10.5) in order to elucidate the protonation states of the His-ligands. Examination of the effect of protonation on the electronic structure of the cluster via Mössbauer spectroscopy gives a deeper understanding of the coupling of electron transfer to the protonation state of the His-ligands. Two components (1 referring to Fe-Cys and 2 to Fe-His) with parameters typical for a diamagnetic [2Fe-2S]2+ cluster are detected. The Mössbauer parameters and the protonation state clearly correlate: while δ remains almost pH-independent with δ 1 (pH6.0) = 0.23 (± 0.01) mms- 1 and δ 1 (pH10.5) = 0.24 (± 0.01) mms- 1 for Fe-Cys, it decreases for Fe-His from δ 2 (pH6.0) = 0.34 (± 0.01) mms- 1 to δ 2 (pH10.5) = 0.28 (± 0.01) mms- 1. Δ E Q changes from Δ E Q1 (pH6.0) = 0.57 (± 0.01) mms- 1 to Δ E Q1 (pH10.5) = 0.45 (± 0.01) mms- 1 and from Δ E Q2 (pH6.0) = 1.05 (± 0.01) mms- 1 to Δ E Q2 (pH10.5) = 0.71 (± 0.01) mms- 1. Density functional theory (DFT)-calculations based on the crystal structure (pdb 1NYK) (Hunsicker-Wang et al. Biochemistry 42, 7303, 2003) have been performed for the Rieske-cluster with different His-ligand protonation states, reproducing the experimentally observed trend.
Köberl, Martina; Müller, Henry; Ramadan, Elshahat M.; Berg, Gabriele
2011-01-01
Background To convert deserts into arable, green landscapes is a global vision, and desert farming is a strong growing area of agriculture world-wide. However, its effect on diversity of soil microbial communities, which are responsible for important ecosystem services like plant health, is still not known. Methodology/Principal Findings We studied the impact of long-term agriculture on desert soil in one of the most prominent examples for organic desert farming in Sekem (Egypt). Using a polyphasic methodological approach to analyse microbial communities in soil as well as associated with cultivated plants, drastic effects caused by 30 years of agriculture were detected. Analysing bacterial fingerprints, we found statistically significant differences between agricultural and native desert soil of about 60%. A pyrosequencing-based analysis of the 16S rRNA gene regions showed higher diversity in agricultural than in desert soil (Shannon diversity indices: 11.21/7.90), and displayed structural differences. The proportion of Firmicutes in field soil was significantly higher (37%) than in the desert (11%). Bacillus and Paenibacillus play the key role: they represented 96% of the antagonists towards phytopathogens, and identical 16S rRNA sequences in the amplicon library and for isolates were detected. The proportion of antagonistic strains was doubled in field in comparison to desert soil (21.6%/12.4%); disease-suppressive bacteria were especially enriched in plant roots. On the opposite, several extremophilic bacterial groups, e.g., Acidimicrobium, Rubellimicrobium and Deinococcus-Thermus, disappeared from soil after agricultural use. The N-fixing Herbaspirillum group only occurred in desert soil. Soil bacterial communities were strongly driven by the a-biotic factors water supply and pH. Conclusions/Significance After long-term farming, a drastic shift in the bacterial communities in desert soil was observed. Bacterial communities in agricultural soil showed a higher diversity and a better ecosystem function for plant health but a loss of extremophilic bacteria. Interestingly, we detected that indigenous desert microorganisms promoted plant health in desert agro-ecosystems. PMID:21912695
Lecomte, S; Hilleriteau, C; Forgerit, J P; Revault, M; Baron, M H; Hildebrandt, P; Soulimane, T
2001-03-02
The structural changes of cytochrome c(552) bound to anionic and hydrophobic clay surfaces have been investigated by Fourier transform infrared spectroscopy. Binding to the anionic surface of montmorillonite is controlled by electrostatic interactions since addition of electrolyte (0.5 mol L(-1) KCl) causes desorption of more than 2/3 of the protein molecules. Electrostatic binding occurs through the back side of the protein (i.e., remote from the heme site) and is associated only with subtle changes of the secondary structure. In contrast, adsorption to the hydrophobic surface of talc leads to a decrease in alpha-helical structure by ca. 5% and an increase in beta-sheet structure by ca. 6%. These structural changes are attributed to a hydrophobic region on the front surface of cytochrome c(552) close to the partially exposed heme edge. This part on the protein surface is identified as the interaction domain for talc and most likely also serves for binding to the natural reaction partner, a ba(3)-oxidase. Fourier transform infrared spectra of cytochrome c(552) and the clay-cytochrome c(552) complexes have been measured as a function of time following dissolution and suspension in deuterated buffer, respectively. A two-dimensional correlation analysis was applied to these spectra to investigate the dynamics of the structural changes in the protein. For both complexes, adsorption and subsequent unfolding processes in the binding domains are faster than the time resolution of the spectroscopic experiments. Thus, the processes that could be monitored are refolding of peptide segments and side chain rearrangements following the adsorption-induced perturbation of the protein structure and the solvation of the adsorbed protein. In each case, side chain alterations of solvent-exposed tyrosine, aspartate, and glutamate residues were observed. For the cytochrome c(552)-talc complex, these changes are followed by a slow refolding of the peptide chain in the binding domain and, subsequently, a further H/D exchange of amide group protons.
O'Sullivan, Daniel J; Cotter, Paul D; O'Sullivan, Orla; Giblin, Linda; McSweeney, Paul L H; Sheehan, Jeremiah J
2015-04-01
We sought to determine if the time, within a production day, that a cheese is manufactured has an influence on the microbial community present within that cheese. To facilitate this, 16S rRNA amplicon sequencing was used to elucidate the microbial community dynamics of brine-salted continental-type cheese in cheeses produced early and late in the production day. Differences in the microbial composition of the core and rind of the cheese were also investigated. Throughout ripening, it was apparent that cheeses produced late in the day had a more diverse microbial population than their early equivalents. Spatial variation between the cheese core and rind was also noted in that cheese rinds were initially found to have a more diverse microbial population but thereafter the opposite was the case. Interestingly, the genera Thermus, Pseudoalteromonas, and Bifidobacterium, not routinely associated with a continental-type cheese produced from pasteurized milk, were detected. The significance, if any, of the presence of these genera will require further attention. Ultimately, the use of high-throughput sequencing has facilitated a novel and detailed analysis of the temporal and spatial distribution of microbes in this complex cheese system and established that the period during a production cycle at which a cheese is manufactured can influence its microbial composition. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Foong, Choon Pin; Wong Vui Ling, Clemente Michael; González, Marcelo
2010-08-01
There is little information on the bacterial diversity of the Fildes Peninsula, King George Island. Hence, this study was conducted to determine the bacterial population of sediments and soils from the lakes, river, glacier and an abandoned oil tank area in the Fildes Peninsula, using a metagenomic approach. DNA was extracted from the sediment and soil samples, and analyzed using the 16S rDNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). A total of 299 DNA fragments resolved using the DGGE were sequenced. The results of the analysis provided an overview of the predominant groups of bacteria and the diversity of the bacterial communities. The most abundant phyla of bacteria in Fildes Peninsula were Bacteroidetes, Proteobacteria, Acidobacteria, Gemmatimonadetes, Nitrospira, Firmicutes, Actinobacteria, Chloroflexi, Cyanobacteria, Spirochaetes, Deinococcus-Thermus, WS3 and BRC1. All of the sediment samples from the lakes had different representatives of dominant bacterial species. Interestingly, 15% of the operational taxonomic units (OTUs) did not group into any of the existing phyla in the Ribosomal Database Project (RDP). One of the OTUs had a similarity of <0.90 when compared to the GenBank sequences and probably was a novel bacterium specific to that location. The majority of the bacterial 16S rDNA sequences were found to be closely related to those found elsewhere.
Natarajaseenivasan, Kalimuthusamy; Shanmughapriya, Santhanam; Velineni, Sridhar; Artiushin, Sergey C; Timoney, John F
2011-10-01
Leptospirosis is an infectious bacterial disease caused by Leptospira species. In this study, we cloned and sequenced the gene encoding the immunodominant protein GroEL from L. interrogans serovar Autumnalis strain N2, which was isolated from the urine of a patient during an outbreak of leptospirosis in Chennai, India. This groEL gene encodes a protein of 60 kDa with a high degree of homology (99% similarity) to those of other leptospiral serovars. Recombinant GroEL was overexpressed in Escherichia coli. Immunoblot analysis indicated that the sera from confirmed leptospirosis patients showed strong reactivity with the recombinant GroEL while no reactivity was observed with the sera from seronegative control patient. In addition, the 3D structure of GroEL was constructed using chaperonin complex cpn60 from Thermus thermophilus as template and validated. The results indicated a Z-score of -8.35, which is in good agreement with the expected value for a protein. The superposition of the Ca traces of cpn60 structure and predicted structure of leptospiral GroEL indicates good agreement of secondary structure elements with an RMSD value of 1.5 Å. Further study is necessary to evaluate GroEL for serological diagnosis of leptospirosis and for its potential as a vaccine component. Copyright © 2011 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.
X-ray Crystallographic Structure of Thermophilic Rhodopsin
Tsukamoto, Takashi; Mizutani, Kenji; Hasegawa, Taisuke; Takahashi, Megumi; Honda, Naoya; Hashimoto, Naoki; Shimono, Kazumi; Yamashita, Keitaro; Yamamoto, Masaki; Miyauchi, Seiji; Takagi, Shin; Hayashi, Shigehiko; Murata, Takeshi; Sudo, Yuki
2016-01-01
Thermophilic rhodopsin (TR) is a photoreceptor protein with an extremely high thermal stability and the first characterized light-driven electrogenic proton pump derived from the extreme thermophile Thermus thermophilus JL-18. In this study, we confirmed its high thermal stability compared with other microbial rhodopsins and also report the potential availability of TR for optogenetics as a light-induced neural silencer. The x-ray crystal structure of TR revealed that its overall structure is quite similar to that of xanthorhodopsin, including the presence of a putative binding site for a carotenoid antenna; but several distinct structural characteristics of TR, including a decreased surface charge and a larger number of hydrophobic residues and aromatic-aromatic interactions, were also clarified. Based on the crystal structure, the structural changes of TR upon thermal stimulation were investigated by molecular dynamics simulations. The simulations revealed the presence of a thermally induced structural substate in which an increase of hydrophobic interactions in the extracellular domain, the movement of extracellular domains, the formation of a hydrogen bond, and the tilting of transmembrane helices were observed. From the computational and mutational analysis, we propose that an extracellular LPGG motif between helices F and G plays an important role in the thermal stability, acting as a “thermal sensor.” These findings will be valuable for understanding retinal proteins with regard to high protein stability and high optogenetic performance. PMID:27129243
Jiang, Zhou; Li, Ping; Van Nostrand, Joy D; Zhang, Ping; Zhou, Jizhong; Wang, Yanhong; Dai, Xinyue; Zhang, Rui; Jiang, Dawei; Wang, Yanxin
2016-04-29
Alkaline sulfide-rich hot springs provide a unique environment for microbial community and arsenic (As) biogeochemistry. In this study, a representative alkaline sulfide-rich hot spring, Zimeiquan in the Tengchong geothermal area, was chosen to study arsenic geochemistry and microbial community using Illumina MiSeq sequencing. Over 0.26 million 16S rRNA sequence reads were obtained from 5-paired parallel water and sediment samples along the hot spring's outflow channel. High ratios of As(V)/AsSum (total combined arsenate and arsenite concentrations) (0.59-0.78), coupled with high sulfide (up to 5.87 mg/L), were present in the hot spring's pools, which suggested As(III) oxidation occurred. Along the outflow channel, AsSum increased from 5.45 to 13.86 μmol/L, and the combined sulfide and sulfate concentrations increased from 292.02 to 364.28 μmol/L. These increases were primarily attributed to thioarsenic transformation. Temperature, sulfide, As and dissolved oxygen significantly shaped the microbial communities between not only the pools and downstream samples, but also water and sediment samples. Results implied that the upstream Thermocrinis was responsible for the transformation of thioarsenic to As(III) and the downstream Thermus contributed to derived As(III) oxidation. This study improves our understanding of microbially-mediated As transformation in alkaline sulfide-rich hot springs.
Jiang, Zhou; Li, Ping; Van Nostrand, Joy D.; Zhang, Ping; Zhou, Jizhong; Wang, Yanhong; Dai, Xinyue; Zhang, Rui; Jiang, Dawei; Wang, Yanxin
2016-01-01
Alkaline sulfide-rich hot springs provide a unique environment for microbial community and arsenic (As) biogeochemistry. In this study, a representative alkaline sulfide-rich hot spring, Zimeiquan in the Tengchong geothermal area, was chosen to study arsenic geochemistry and microbial community using Illumina MiSeq sequencing. Over 0.26 million 16S rRNA sequence reads were obtained from 5-paired parallel water and sediment samples along the hot spring’s outflow channel. High ratios of As(V)/AsSum (total combined arsenate and arsenite concentrations) (0.59–0.78), coupled with high sulfide (up to 5.87 mg/L), were present in the hot spring’s pools, which suggested As(III) oxidation occurred. Along the outflow channel, AsSum increased from 5.45 to 13.86 μmol/L, and the combined sulfide and sulfate concentrations increased from 292.02 to 364.28 μmol/L. These increases were primarily attributed to thioarsenic transformation. Temperature, sulfide, As and dissolved oxygen significantly shaped the microbial communities between not only the pools and downstream samples, but also water and sediment samples. Results implied that the upstream Thermocrinis was responsible for the transformation of thioarsenic to As(III) and the downstream Thermus contributed to derived As(III) oxidation. This study improves our understanding of microbially-mediated As transformation in alkaline sulfide-rich hot springs. PMID:27126380
Microbial community biofabrics in a geothermal mine adit.
Spear, John R; Barton, Hazel A; Robertson, Charles E; Francis, Christopher A; Pace, Norman R
2007-10-01
Speleothems such as stalactites and stalagmites are usually considered to be mineralogical in composition and origin; however, microorganisms have been implicated in the development of some speleothems. We have identified and characterized the biological and mineralogical composition of mat-like biofabrics in two novel kinds of speleothems from a 50 degrees C geothermal mine adit near Glenwood Springs, CO. One type of structure consists of 2- to 3-cm-long, 3- to 4-mm-wide, leather-like, hollow, soda straw stalactites. Light and electron microscopy indicated that the stalactites are composed of a mineralized biofabric with several cell morphotypes in a laminated form, with gypsum and sulfur as the dominant mineral components. A small-subunit rRNA gene phylogenetic community analysis along the stalactite length yielded a diverse gradient of organisms, with a relatively simple suite of main constituents: Thermus spp., crenarchaeotes, Chloroflexi, and Gammaproteobacteria. PCR analysis also detected putative crenarchaeal ammonia monooxygenase subunit A (amoA) genes in this community, the majority related to sequences from other geothermal systems. The second type of speleothem, dumpling-like rafts floating on a 50 degrees C pool on the floor of the adit, showed a mat-like fabric of evidently living organisms on the outside of the dumpling, with a multimineral, amorphous, gypsum-based internal composition. These two novel types of biofabrics are examples of the complex roles that microbes can play in mineralization, weathering, and deposition processes in karst environments.
Eichorst, Stephanie A; Joshua, Chijioke; Sathitsuksanoh, Noppadon; Singh, Seema; Simmons, Blake A; Singer, Steven W
2014-12-01
Microbial communities that deconstruct plant biomass have broad relevance in biofuel production and global carbon cycling. Biomass pretreatments reduce plant biomass recalcitrance for increased efficiency of enzymatic hydrolysis. We exploited these chemical pretreatments to study how thermophilic bacterial consortia adapt to deconstruct switchgrass (SG) biomass of various compositions. Microbial communities were adapted to untreated, ammonium fiber expansion (AFEX)-pretreated, and ionic-liquid (IL)-pretreated SG under aerobic, thermophilic conditions using green waste compost as the inoculum to study biomass deconstruction by microbial consortia. After microbial cultivation, gravimetric analysis of the residual biomass demonstrated that both AFEX and IL pretreatment enhanced the deconstruction of the SG biomass approximately 2-fold. Two-dimensional nuclear magnetic resonance (2D-NMR) experiments and acetyl bromide-reactive-lignin analysis indicated that polysaccharide hydrolysis was the dominant process occurring during microbial biomass deconstruction, and lignin remaining in the residual biomass was largely unmodified. Small-subunit (SSU) rRNA gene amplicon libraries revealed that although the dominant taxa across these chemical pretreatments were consistently represented by members of the Firmicutes, the Bacteroidetes, and Deinococcus-Thermus, the abundance of selected operational taxonomic units (OTUs) varied, suggesting adaptations to the different substrates. Combining the observations of differences in the community structure and the chemical and physical structure of the biomass, we hypothesize specific roles for individual community members in biomass deconstruction. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Wang, Hai-liang; Sun, Li
2018-04-01
In this study, metagenomic analysis was performed to investigate the taxonomic compositions and metabolic profiles of the microbial communities inhabiting the sediments in the surroundings of Iheya North and Iheya Ridge hydrothermal fields. The microbial communities in four different samples were found to be dominated by bacteria and, to a much lesser extent, archaea belonging to the phyla Proteobacteria, Actinobacteria, Planctomycetes, Firmicutes, Deinococcus-Thermus, and Nitrospirae, which play important roles in the cycling of carbon, nitrogen, and sulfur. All four microbial communities (i) contained chemoautotrophs and heterotrophs, the former probably fixed CO2 via various carbon fixation pathways, and the latter may degrade organic matters using nitrate and sulfate as electron acceptors, (ii) exhibited an abundance of DNA repair genes and bacterial sulfur oxidation mediated by reverse sulfate reduction, and (iii) harbored bacteria and archaea involved in anaerobic methane oxidation via intra-aerobic denitrification and reverse methanogenesis, which were found for the first time in hydrothermal areas. Furthermore, genes involved in DNA repair, reductive acetyl-CoA pathway, and ammonia metabolism were possibly affected by distance to the vent fields. These findings facilitate our understanding of the strategies of the microbial communities to adapt to the environments in deep sea areas associated with hydrothermal vents.
Dodsworth, Jeremy A; Hungate, Bruce A; Hedlund, Brian P
2011-08-01
Many thermophiles catalyse free energy-yielding redox reactions involving nitrogenous compounds; however, little is known about these processes in natural thermal environments. Rates of ammonia oxidation, denitrification and dissimilatory nitrate reduction to ammonium (DNRA) were measured in source water and sediments of two ≈ 80°C springs in the US Great Basin. Ammonia oxidation and denitrification occurred mainly in sediments. Ammonia oxidation rates measured using (15)N-NO(3)(-) pool dilution ranged from 5.5 ± 0.8 to 8.6 ± 0.9 nmol N g(-1) h(-1) and were unaffected or only mildly stimulated by amendment with NH(4) Cl. Denitrification rates measured using acetylene block ranged from 15.8 ± 0.7 to 51 ± 12 nmol N g(-1) h(-1) and were stimulated by amendment with NO(3)(-) and complex organic compounds. The DNRA rate in one spring sediment measured using an (15)N-NO(3)(-) tracer was 315 ± 48 nmol N g(-1) h(-1). Both springs harboured distinct planktonic and sediment microbial communities. Close relatives of the autotrophic, ammonia-oxidizing archaeon 'Candidatus Nitrosocaldus yellowstonii' represented the most abundant OTU in both spring sediments by 16S rRNA gene pyrotag analysis. Quantitative PCR (qPCR) indicated that 'Ca. N. yellowstonii'amoA and 16S rRNA genes were present at 3.5-3.9 × 10(8) and 6.4-9.0 × 10(8) copies g(-1) sediment. Potential denitrifiers included members of the Aquificales and Thermales. Thermus spp. comprised <1% of 16S rRNA gene pyrotags in both sediments and qPCR for T. thermophilus narG revealed sediment populations of 1.3-1.7 × 10(6) copies g(-1) sediment. These data indicate a highly active nitrogen cycle (N-cycle) in these springs and suggest that ammonia oxidation may be a major source of energy fuelling primary production. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Solving the Mechanism of Na+/H+ Antiporters Using Molecular Dynamics Simulations
NASA Astrophysics Data System (ADS)
Dotson, David L.
Na+/H+ antiporters are vital membrane proteins for cell homeostasis, transporting Na+ ions in exchange for H+ across the lipid bilayer. In humans, dysfunction of these transporters are implicated in hypertension, heart failure, epilepsy, and autism, making them well-established drug targets. Although experimental structures for bacterial homologs of the human Na+/H+ have been obtained, the detailed mechanism for ion transport is still not well-understood. The most well-studied of these transporters, Escherichia coli NhaA, known to transport 2 H+ for every Na+ extruded, was recently shown to bind H+ and Na+ at the same binding site, for which the two ion species compete. Using molecular dynamics simulations, the work presented in this dissertation shows that Na+ binding disrupts a previously-unidentified salt bridge between two conserved residues, suggesting that one of these residues, Lys300, may participate directly in transport of H+. This work also demonstrates that the conformational change required for ion translocation in a homolog of NhaA, Thermus thermophilus NapA, thought by some to involve only small helical movements at the ion binding site, is a large-scale, rigid-body movement of the core domain relative to the dimerization domain. This elevator-like transport mechanism translates a bound Na+ up to 10 A across the membrane. These findings constitute a major shift in the prevailing thought on the mechanism of these transporters, and serve as an exciting launchpad for new developments toward understanding that mechanism in detail.
Unexpected Diversity during Community Succession in the Apple Flower Microbiome
Shade, Ashley; McManus, Patricia S.; Handelsman, Jo
2013-01-01
ABSTRACT Despite its importance to the host, the flower microbiome is poorly understood. We report a culture-independent, community-level assessment of apple flower microbial diversity and dynamics. We collected flowers from six apple trees at five time points, starting before flowers opened and ending at petal fall. We applied streptomycin to half of the trees when flowers opened. Assessment of microbial diversity using tag pyrosequencing of 16S rRNA genes revealed that the apple flower communities were rich and diverse and dominated by members of TM7 and Deinococcus-Thermus, phyla about which relatively little is known. From thousands of taxa, we identified six successional groups with coherent dynamics whose abundances peaked at different times before and after bud opening. We designated the groups Pioneer, Early, Mid, Late, Climax, and Generalist communities. The successional pattern was attributed to a set of prevalent taxa that were persistent and gradually changing in abundance. These taxa had significant associations with other community members, as demonstrated with a cooccurrence network based on local similarity analysis. We also detected a set of less-abundant, transient taxa that contributed to general tree-to-tree variability but not to the successional pattern. Communities on trees sprayed with streptomycin had slightly lower phylogenetic diversity than those on unsprayed trees but did not differ in structure or succession. Our results suggest that changes in apple flower microbial community structure are predictable over the life of the flower, providing a basis for ecological understanding and disease management. PMID:23443006
Gupta, R S
1998-12-01
The presence of shared conserved insertion or deletions (indels) in protein sequences is a special type of signature sequence that shows considerable promise for phylogenetic inference. An alternative model of microbial evolution based on the use of indels of conserved proteins and the morphological features of prokaryotic organisms is proposed. In this model, extant archaebacteria and gram-positive bacteria, which have a simple, single-layered cell wall structure, are termed monoderm prokaryotes. They are believed to be descended from the most primitive organisms. Evidence from indels supports the view that the archaebacteria probably evolved from gram-positive bacteria, and I suggest that this evolution occurred in response to antibiotic selection pressures. Evidence is presented that diderm prokaryotes (i.e., gram-negative bacteria), which have a bilayered cell wall, are derived from monoderm prokaryotes. Signature sequences in different proteins provide a means to define a number of different taxa within prokaryotes (namely, low G+C and high G+C gram-positive, Deinococcus-Thermus, cyanobacteria, chlamydia-cytophaga related, and two different groups of Proteobacteria) and to indicate how they evolved from a common ancestor. Based on phylogenetic information from indels in different protein sequences, it is hypothesized that all eukaryotes, including amitochondriate and aplastidic organisms, received major gene contributions from both an archaebacterium and a gram-negative eubacterium. In this model, the ancestral eukaryotic cell is a chimera that resulted from a unique fusion event between the two separate groups of prokaryotes followed by integration of their genomes.
Gupta, Radhey S.
1998-01-01
The presence of shared conserved insertion or deletions (indels) in protein sequences is a special type of signature sequence that shows considerable promise for phylogenetic inference. An alternative model of microbial evolution based on the use of indels of conserved proteins and the morphological features of prokaryotic organisms is proposed. In this model, extant archaebacteria and gram-positive bacteria, which have a simple, single-layered cell wall structure, are termed monoderm prokaryotes. They are believed to be descended from the most primitive organisms. Evidence from indels supports the view that the archaebacteria probably evolved from gram-positive bacteria, and I suggest that this evolution occurred in response to antibiotic selection pressures. Evidence is presented that diderm prokaryotes (i.e., gram-negative bacteria), which have a bilayered cell wall, are derived from monoderm prokaryotes. Signature sequences in different proteins provide a means to define a number of different taxa within prokaryotes (namely, low G+C and high G+C gram-positive, Deinococcus-Thermus, cyanobacteria, chlamydia-cytophaga related, and two different groups of Proteobacteria) and to indicate how they evolved from a common ancestor. Based on phylogenetic information from indels in different protein sequences, it is hypothesized that all eukaryotes, including amitochondriate and aplastidic organisms, received major gene contributions from both an archaebacterium and a gram-negative eubacterium. In this model, the ancestral eukaryotic cell is a chimera that resulted from a unique fusion event between the two separate groups of prokaryotes followed by integration of their genomes. PMID:9841678
Balakrishna, Asha Manikkoth; Hunke, Cornelia; Grüber, Gerhard
2012-07-13
A(1)A(O) ATP synthases are the major energy converters of archaea. They are composed of an A(1) region that synthesizes ATP and an integral part A(O) that conducts ions. Subunit E is a component of the peripheral stalk that links the A(1) with the A(O) part of the A-ATP synthase. We have determined the crystal structure of the entire subunit E (PhE) of the Pyrococcus horikoshii OT3 A-ATP synthase at 3.6 Å resolution. The structure reveals an extended S-shaped N-terminal α-helix with 112.29 Å in length, followed by a globular head group. The S-shaped feature, common in elastic connectors and spacers, would facilitate the storage of transient elastic energy during rotary motion in the enzyme. The structure has been superimposed into the asymmetric peripheral stalks of the three-dimensional reconstruction of the Pyrococcus furiosus enzyme, revealing that the S-shaped subunit PhE fits well into the bent peripheral stalk, whereas the previously solved E subunit structure (3.1 Å resolution) of Thermus thermophilus A-ATP synthase is well accommodated in the density of the straight stator domain. The different features of the two stalk subunits are discussed in light of a novel coupling mechanism in A-ATP synthases proposed to differ from the Wankel engine of F-ATP synthases. Copyright © 2012 Elsevier Ltd. All rights reserved.
Diversity of ionizing radiation-resistant bacteria obtained from the Taklimakan Desert.
Yu, Li Zhi-Han; Luo, Xue-Song; Liu, Ming; Huang, Qiaoyun
2015-01-01
So far, little is known about the diversity of the radiation-resistant microbes of the hyperarid Taklimakan Desert. In this study, ionizing radiation (IR)-resistant bacteria from two sites in Xinjiang were investigated. After exposing the arid (water content of 0.8 ± 0.3%) and non-arid (water content of 21.3 ± 0.9%) sediment samples to IR of 3000 Gy using a (60)Co source, a total of 52 γ-radiation-resistant bacteria were isolated from the desert sample. The 16S rRNA genes of all isolates were sequenced. The phylogenetic tree places these isolates into five groups: Cytophaga-Flavobacterium-Bacteroides, Proteobacteria, Deinococcus-Thermus, Firmicutes, and Actinobacteria. Interestingly, this is the first report of radiation-resistant bacteria belonging to the genera Knoellia, Lysobacter, Nocardioides, Paracoccus, Pontibacter, Rufibacter and Microvirga. The 16s rRNA genes of four isolates showed low sequence similarities to those of the published species. Phenotypic analysis showed that all bacteria in this study are able to produce catalase, suggesting that these bacteria possess reactive oxygen species (ROS)-scavenging enzymes. These radiation-resistant bacteria also displayed diverse metabolic properties. Moreover, their radiation resistances were found to differ. The diversity of the radiation-resistant bacteria in the desert provides further ecological support for the hypothesis that the ionizing-radiation resistance phenotype is a consequence of the evolution of ROS-scavenging systems that protect cells against oxidative damage caused by desiccation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Suflita, Joseph M; Aktas, Deniz F; Oldham, Athenia L; Perez-Ibarra, Beatriz Monica; Duncan, Kathleen
2012-01-01
Investigating the susceptibility of various fuels to anaerobic biodegradation has become complicated with the recognition that the fuels themselves are not sterile. Bacterial DNA could be obtained when various fuels were filtered through a hydrophobic teflon (0.22 μm) membrane filter. Bacterial 16S rRNA genes from these preparations were PCR amplified, cloned, and the resulting libraries sequenced to identify the fuel-borne bacterial communities. The most common sequence, found in algal- and camelina-based biofuels as well as in ultra-low sulfur diesel (ULSD) and F76 diesel, was similar to that of a Tumebacillus. The next most common sequence was similar to Methylobacterium and was found in the biofuels and ULSD. Higher level phylogenetic groups included representatives of the Firmicutes (Bacillus, Lactobacillus and Streptococcus), several Actinobacteria, Deinococcus-Thermus, Chloroflexi, Cyanobacteria, Bacteroidetes, Alphaproteobacteria (Methylobacterium and Sphingomonadales), Betaproteobacteria (Oxalobacteraceae and Burkholderiales) and Deltaproteobacteria. All of the fuel-associated bacterial sequences, except those obtained from a few facultative microorganisms, were from aerobes and only remotely affiliated with sequences that resulted from anaerobic successional events evident when ULSD was incubated with a coastal seawater and sediment inoculum. Thus, both traditional and alternate fuel formulations harbor a characteristic microflora, but these microorganisms contributed little to the successional patterns that ultimately resulted in fuel decomposition, sulfide formation and metal biocorrosion. The findings illustrate the value of molecular approaches to track the fate of bacteria that might come in contact with fuels and potentially contribute to corrosion problems throughout the energy value chain.
NASA Technical Reports Server (NTRS)
Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.
2003-01-01
The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at -9 degrees C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 x 10(7) cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at -2 degrees C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years.
Microbial Community Biofabrics in a Geothermal Mine Adit▿ †
Spear, John R.; Barton, Hazel A.; Robertson, Charles E.; Francis, Christopher A.; Pace, Norman R.
2007-01-01
Speleothems such as stalactites and stalagmites are usually considered to be mineralogical in composition and origin; however, microorganisms have been implicated in the development of some speleothems. We have identified and characterized the biological and mineralogical composition of mat-like biofabrics in two novel kinds of speleothems from a 50°C geothermal mine adit near Glenwood Springs, CO. One type of structure consists of 2- to 3-cm-long, 3- to 4-mm-wide, leather-like, hollow, soda straw stalactites. Light and electron microscopy indicated that the stalactites are composed of a mineralized biofabric with several cell morphotypes in a laminated form, with gypsum and sulfur as the dominant mineral components. A small-subunit rRNA gene phylogenetic community analysis along the stalactite length yielded a diverse gradient of organisms, with a relatively simple suite of main constituents: Thermus spp., crenarchaeotes, Chloroflexi, and Gammaproteobacteria. PCR analysis also detected putative crenarchaeal ammonia monooxygenase subunit A (amoA) genes in this community, the majority related to sequences from other geothermal systems. The second type of speleothem, dumpling-like rafts floating on a 50°C pool on the floor of the adit, showed a mat-like fabric of evidently living organisms on the outside of the dumpling, with a multimineral, amorphous, gypsum-based internal composition. These two novel types of biofabrics are examples of the complex roles that microbes can play in mineralization, weathering, and deposition processes in karst environments. PMID:17693567
Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.
2003-01-01
The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at −9°C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 × 107 cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at −2°C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years. PMID:12676695
Bacterial community in ancient permafrost alluvium at the Mammoth Mountain (Eastern Siberia).
Brouchkov, Anatoli; Kabilov, Marsel; Filippova, Svetlana; Baturina, Olga; Rogov, Victor; Galchenko, Valery; Mulyukin, Andrey; Fursova, Oksana; Pogorelko, Gennady
2017-12-15
Permanently frozen (approx. 3.5Ma) alluvial Neogene sediments exposed in the Aldan river valley at the Mammoth Mountain (Eastern Siberia) are unique, ancient, and poorly studied permafrost environments. So far, the structure of the indigenous bacterial community has remained unknown. Use of 16S metagenomic analysis with total DNA isolation using DNA Spin Kit for Soil (MO-Bio) and QIAamp DNA Stool Mini Kit (Qiagen) has revealed the major and minor bacterial lineages in the permafrost alluvium sediments. In sum, 61 Operational Taxonomic Units (OTUs) with 31,239 reads (Qiagen kit) and 15,404 reads (Mo-Bio kit) could be assigned to the known taxa. Only three phyla, Bacteroidetes, Proteobacteria and Firmicutes, comprised >5% of the OTUs abundance and accounted for 99% of the total reads. OTUs pertaining to the top families (Chitinophagaceae, Caulobacteraceae, Sphingomonadaceae, Bradyrhizobiaceae, Halomonadaceae) held >90% of reads. The abundance of Actinobacteria was less (0.7%), whereas members of other phyla (Deinococcus-Thermus, Cyanobacteria/Chloroplast, Fusobacteria, and Acidobacteria) constituted a minor fraction of reads. The bacterial community in the studied ancient alluvium differs from other permafrost sediments, mainly by predominance of Bacteroidetes (>52%). The diversity of this preserved bacterial community has the potential to cause effects unknown if prompted to thaw and spread with changing climate. Therefore, this study elicits further reason to study how reintroduction of these ancient bacteria could affect the surrounding ecosystem, including current bacterial species. Copyright © 2017 Elsevier B.V. All rights reserved.
Structural insights into translational recoding by frameshift suppressor tRNASufJ
Fagan, Crystal E.; Maehigashi, Tatsuya; Dunkle, Jack A.; Miles, Stacey J.
2014-01-01
The three-nucleotide mRNA reading frame is tightly regulated during translation to ensure accurate protein expression. Translation errors that lead to aberrant protein production can result from the uncoupled movement of the tRNA in either the 5′ or 3′ direction on mRNA. Here, we report the biochemical and structural characterization of +1 frameshift suppressor tRNASufJ, a tRNA known to decode four, instead of three, nucleotides. Frameshift suppressor tRNASufJ contains an insertion 5′ to its anticodon, expanding the anticodon loop from seven to eight nucleotides. Our results indicate that the expansion of the anticodon loop of either ASLSufJ or tRNASufJ does not affect its affinity for the A site of the ribosome. Structural analyses of both ASLSufJ and ASLThr bound to the Thermus thermophilus 70S ribosome demonstrate both ASLs decode in the zero frame. Although the anticodon loop residues 34–37 are superimposable with canonical seven-nucleotide ASLs, the single C31.5 insertion between nucleotides 31 and 32 in ASLSufJ imposes a conformational change of the anticodon stem, that repositions and tilts the ASL toward the back of the A site. Further modeling analyses reveal that this tilting would cause a distortion in full-length A-site tRNASufJ during tRNA selection and possibly impede gripping of the anticodon stem by 16S rRNA nucleotides in the P site. Together, these data implicate tRNA distortion as a major driver of noncanonical translation events such as frameshifting. PMID:25352689
Bacterial population dynamics in recycled mushroom compost leachate.
Safianowicz, Katarzyna; Bell, Tina L; Kertesz, Michael A
2018-06-01
Mushrooms are an important food crop throughout the world. The most important edible mushroom is the button mushroom (Agaricus bisporus), which comprises about 30% of the global mushroom market. This species is cultivated commercially on a selective compost that is produced predominantly from wheat straw/stable bedding and chicken manure, at a moisture content of around 70% (w/w) and temperatures of up to 80 °C. Large volumes of water are required to achieve this moisture content, and many producers therefore collect leachate from the composting windrows and bunkers (known in the industry as "goody water") and reuse it to wet the raw ingredients. This has the benefit of recycling and saving water and has the potential to enrich beneficial microorganisms that stimulate composting, but also the risk of enhancing pathogen populations that could reduce productivity. Here, we show by 16S rRNA gene sequencing that mushroom compost leachate contains a high diversity of unknown microbes, with most of the species found affiliated with the phyla Firmicutes and Proteobacteria. However, by far the most abundant species was the thermophile Thermus thermophilus, which made up approximately 50% of the bacterial population present. Although the leachate was routinely collected and stored in an aerated central storage tank, many of the bacterial species found in leachate were facultative anaerobes. However, there was no evidence for sulfide production, and no sulfate-reducing bacterial species were detected. Because T. thermophilus is important in the high temperature phase of composting, the use of recycled leachate as an inoculum for the raw materials is likely to be beneficial for the composting process.
Revisiting the structures of several antibiotics bound to the bacterial ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulkley, David; Innis, C. Axel; Blaha, Gregor
2010-10-08
The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less
Revisiting the Structures of Several Antibiotics Bound to the Bacterial Ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
D Bulkley; C Innis; G Blaha
2011-12-31
The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
Effect of postharvest practices including degreening on citrus carpoplane microbial biomes.
Gomba, A; Chidamba, L; Korsten, L
2017-04-01
To investigate the effect of commercial citrus packhouse processing steps on the fruit surface microbiome of Clementines and Palmer navel oranges. Viable bacteria, yeast and fungi counts, and the pyrosequencing analysis of the 16S rRNA and ITS were used to evaluate the community structure and population dynamics of phylloepiphytic bacteria and fungi associated with commercial postharvest processing. Drenching significantly reduced microbial counts in all cases except for yeasts on navels, while the extent of degreening effects varied between the citrus varieties. Pyrosequencing analysis showed a total of 4409 bacteria and 5792 fungi nonchimeric unique sequences with an average of 1102 bacteria and 1448 fungi reads per sample. Dominant phyla on the citrus carpoplane were Proteobacteria (53·5%), Actinobacteria (19·9%), Bacteroidetes (5·6%) and Deinococcus-Thermus (5·4%) for bacteria and Ascomycota (80·5%) and Basidiomycota (9·8%) for fungi. Beginning with freshly harvested fruit fungal diversity declined significantly after drenching, but had little effect on bacteria and populations recovered during degreening treatments, including those for Penicillium sp. Packhouse processing greatly influences microbial communities on the citrus carpoplane. A broad orange biome was described with pyrosequencing and gave insight into the likely survival and persistence of pathogens, especially as they may affect the quality and safety of the packed product. A close examination of the microbiota of fruit and the impact of intervention strategies on the ecological balance may provide a more durable approach to reduce losses and spoilage. © 2017 The Society for Applied Microbiology.
Jiménez, Diego Javier; Dini-Andreote, Francisco; Ottoni, Júlia Ronzella; de Oliveira, Valéria Maia; van Elsas, Jan Dirk; Andreote, Fernando Dini
2015-01-01
The occurrence of genes encoding biotechnologically relevant α/β-hydrolases in mangrove soil microbial communities was assessed using data obtained by whole-metagenome sequencing of four mangroves areas, denoted BrMgv01 to BrMgv04, in São Paulo, Brazil. The sequences (215 Mb in total) were filtered based on local amino acid alignments against the Lipase Engineering Database. In total, 5923 unassembled sequences were affiliated with 30 different α/β-hydrolase fold superfamilies. The most abundant predicted proteins encompassed cytosolic hydrolases (abH08; ∼ 23%), microsomal hydrolases (abH09; ∼ 12%) and Moraxella lipase-like proteins (abH04 and abH01; < 5%). Detailed analysis of the genes predicted to encode proteins of the abH08 superfamily revealed a high proportion related to epoxide hydrolases and haloalkane dehalogenases in polluted mangroves BrMgv01-02-03. This suggested selection and putative involvement in local degradation/detoxification of the pollutants. Seven sequences that were annotated as genes for putative epoxide hydrolases and five for putative haloalkane dehalogenases were found in a fosmid library generated from BrMgv02 DNA. The latter enzymes were predicted to belong to Actinobacteria, Deinococcus-Thermus, Planctomycetes and Proteobacteria. Our integrated approach thus identified 12 genes (complete and/or partial) that may encode hitherto undescribed enzymes. The low amino acid identity (< 60%) with already-described genes opens perspectives for both production in an expression host and genetic screening of metagenomes. PMID:25171437
Functionalized active-nucleus complex sensor
Pines, Alexander; Wemmer, David E.; Spence, Megan; Rubin, Seth
2003-11-25
A functionalized active-nucleus complex sensor that selectively associates with one or more target species, and a method for assaying and screening for one or a plurality of target species utilizing one or a plurality of functionalized active-nucleus complexes with at least two of the functionalized active-nucleus complexes having an attraction affinity to different corresponding target species. The functionalized active-nucleus complex has an active-nucleus and a targeting carrier. The method involves functionalizing an active-nucleus, for each functionalized active-nucleus complex, by incorporating the active-nucleus into a macromolucular or molecular complex that is capable of binding one of the target species and then bringing the macromolecular or molecular complexes into contact with the target species and detecting the occurrence of or change in a nuclear magnetic resonance signal from each of the active-nuclei in each of the functionalized active-nucleus complexes.
A bidirectional relationship between physical activity and executive function in older adults
Daly, Michael; McMinn, David; Allan, Julia L.
2015-01-01
Physically active lifestyles contribute to better executive function. However, it is unclear whether high levels of executive function lead people to be more active. This study uses a large sample and multi-wave data to identify whether a reciprocal association exists between physical activity and executive function. Participants were 4555 older adults tracked across four waves of the English Longitudinal Study of Aging. In each wave executive function was assessed using a verbal fluency test and a letter cancelation task and participants reported their physical activity levels. Fixed effects regressions showed that changes in executive function corresponded with changes in physical activity. In longitudinal multilevel models low levels of physical activity led to subsequent declines in executive function. Importantly, poor executive function predicted reductions in physical activity over time. This association was found to be over 50% larger in magnitude than the contribution of physical activity to changes in executive function. This is the first study to identify evidence for a robust bidirectional link between executive function and physical activity in a large sample of older adults tracked over time. PMID:25628552
Physical Activity and Function in Older, Long-term Colorectal Cancer Survivors
Johnson, Brent L.; Trentham-Dietz, Amy; Koltyn, Kelli F.; Colbert, Lisa H.
2009-01-01
Objective Increasing age and cancer history are related to impaired physical function. Since physical activity has been shown to ameliorate age-related functional declines, we evaluated the association between physical activity and function in older, long-term colorectal cancer survivors. Methods In 2006–2007, mailed surveys were sent to colorectal cancer survivors, aged ≥65 years when diagnosed during 1995 – 2000, and identified through a state cancer registry. Information on physical activity, physical function and relevant covariates was obtained and matched to registry data. Analysis of covariance and linear regression were used to compare means and trends in physical function across levels of activity in the final analytic sample of 843 cases. Results A direct, dose-dependent association between physical activity and function was observed (ptrend <.001), with higher SF-36 physical function subscores in those reporting high vs. low activity levels (65.0 ± 1.7 vs. 42.7 ± 1.7 (mean ± standard error)). Walking, gardening, housework, and exercise activities were all independently related to better physical function. Moderate-vigorous intensity activity (ptrend <.001) was associated with function, but light activity (ptrend =0.39) was not. Conclusion Results from this cross-sectional study indicate significant associations between physical activity and physical function in older, long-term colorectal cancer survivors. PMID:19123055
Association Between Perceived Physical Activity and Cognitive Function in Older Adults.
Loprinzi, Paul D; Frith, Emily
2018-01-01
There is irrefutable evidence that regular participation in physical activity is favorably associated with numerous positive health outcomes, including cognitive function. Emerging work suggests that perceived physical activity, independent of actual physical activity behavior, is inversely associated with mortality risk. In this study, we evaluate whether perceived physical activity, independent of actual physical activity, is associated with cognitive function, a robust indicator of mortality risk. Data from the cross-sectional 1999-2002 National Health and Nutrition Examination Survey were employed ( N = 2352; 60+ years of age). Actual physical activity was assessed via a validated survey. Perceived physical activity was assessed using the following question: "Compared with others of the same age, would you say that you are: more active, less active, or about the same?" Cognitive function was assessed from the Digit Symbol Substitution Test. When examined in separate models, both actual and perceived physical activity were positively and statistically significantly associated with cognitive function. However, when considered in the same model, actual physical activity was no longer statistically significantly associated with cognitive function, but perceived physical activity was. Perceived physical activity, independent of actual physical activity, is independently associated with cognitive function. If these findings are replicated, future work should consider evaluating perceived physical activity when examining the effects of actual physical activity behavior on cognitive function.
Steensberg, Alvilda T; Eriksen, Mette M; Andersen, Lars B; Hendriksen, Ole M; Larsen, Heinrich D; Laier, Gunnar H; Thougaard, Thomas
2017-06-01
The European Resuscitation Council Guidelines 2015 recommend bystanders to activate their mobile phone speaker function, if possible, in case of suspected cardiac arrest. This is to facilitate continuous dialogue with the dispatcher including (if required) cardiopulmonary resuscitation instructions. The aim of this study was to measure the bystander capability to activate speaker function in case of suspected cardiac arrest. In 87days, a systematic prospective registration of bystander capability to activate the speaker function, when cardiac arrest was suspected, was performed. For those asked, "can you activate your mobile phone's speaker function", audio recordings were examined and categorized into groups according to the bystanders capability to activate speaker function on their own initiative, without instructions, or with instructions from the emergency medical dispatcher. Time delay was measured, in seconds, for the bystanders without pre-activated speaker function. 42.0% (58) was able to activate the speaker function without instructions, 2.9% (4) with instructions, 18.1% (25) on own initiative and 37.0% (51) were unable to activate the speaker function. The median time to activate speaker function was 19s and 8s, with and without instructions, respectively. Dispatcher assisted cardiopulmonary resuscitation with activated speaker function, in cases of suspected cardiac arrest, allows for continuous dialogue between the emergency medical dispatcher and the bystander. In this study, we found a 63.0% success rate of activating the speaker function in such situations. Copyright © 2017 Elsevier B.V. All rights reserved.
Jerome, Gerald J; Glass, Thomas A; Mielke, Michelle; Xue, Qian-Li; Andersen, Ross E; Fried, Linda P
2006-11-01
Physical activity is important for maintaining functional independence of older persons, especially for those with existing functional deficits. Since such deficits may pose barriers to activity, it would be instructive to examine activity patterns in relation to specific types of deficits to determine the amount and type of physical activity older women pursue. This study sought to identify categories of functional deficits associated with activity levels and evaluated the potential for older women to increase their physical activity levels. Community-dwelling women, aged 70-79 years, from the Women's Health and Aging Studies I and II (N = 710), were assessed for self-reported physical activity, functional deficits and chronic conditions, along with objective measures of muscle strength. Both type (household chores, exercise, and recreational activity) and amount of physical activity (min/wk) were examined. Meeting physical activity recommendations was defined as > or =150 minutes per week of moderate intensity physical activity, and inactivity was defined as no weekly moderate intensity physical activity. Hierarchical categories of functional deficits were based on self-reported difficulty in four functional domains (i.e., mobility/exercise tolerance, upper extremity, higher functioning, and self-care), and self-reports ranged from no difficulty to difficulty in all four domains. The prevalence of inactivity and meeting activity recommendations were 14.4% and 12.7%, respectively. Severity of functional deficits was associated with increased risk of inactivity (adjusted odds ratios [ORs(adj)] = 3.14-17.61) and reduced likelihood of meeting activity recommendations (ORs(adj) =.11-.40). Even among those with higher functioning or self-care difficulties, 30% reported walking for exercise. There was evidence that older women with functional deficits can remain physically active. However, for some of these women, meeting the recommended levels of activity may be unrealistic. Efforts to increase physical activity levels among older adults should include treatment or management of functional deficits, chronic conditions, and poor strength.
Jung, Hee-Kyoung; Chung, EunJung; Lee, Byoung-Hee
2017-08-01
[Purpose] To compare function, activity, participation, and quality of life of Down syndrome children and typically developing children according to age. [Subjects and Methods] A total of 16 Down syndrome children and 20 children with typical development were included as subjects for this study. International Classification of Functioning, Disability, and Health (ICF) Child and Youth version (CY) developed by the World Health Organization (WHO) and a questionnaire were used to measure children's functioning, activity, and participation. To measure quality of life, KIDSCREEN 52-HRQOL questionnaire was used in this study. [Results] ICF-CY function, activity, participation, and quality of life showed statistically significant differences between Down syndrome children and typically developing children. Down syndrome children with higher functions showed higher activities and participation. Higher function, activity and participation features were correlated with better quality of life. Higher function resulted in better quality of life. [Conclusion] Function, activity, participation, quality of life, and several common factors of Down syndrome children depend on the ability of children. Function of Down syndrome children affects their activity, participation, and quality of life. Activities and participations also affect quality of life. Therefore, children's functional aspect is the foundation for quality of life.
Assessing physical function and physical activity in patients with CKD.
Painter, Patricia; Marcus, Robin L
2013-05-01
Patients with CKD are characterized by low levels of physical functioning, which, along with low physical activity, predict poor outcomes in those treated with dialysis. The hallmark of clinical care in geriatric practice and geriatric research is the orientation to and assessment of physical function and functional limitations. Although there is increasing interest in physical function and physical activity in patients with CKD, the nephrology field has not focused on this aspect of care. This paper provides an in-depth review of the measurement of physical function and physical activity. It focuses on physiologic impairments and physical performance limitations (impaired mobility and functional limitations). The review is based on established frameworks of physical impairment and functional limitations that have guided research in physical function in the aging population. Definitions and measures for physiologic impairments, physical performance limitations, self-reported function, and physical activity are presented. On the basis of the information presented, recommendations for incorporating routine assessment of physical function and encouragement for physical activity in clinical care are provided.
Siletsky, Sergey A; Belevich, Ilya; Belevich, Nikolai P; Soulimane, Tewfik; Wikström, Mårten
2017-11-01
Two electrogenic phases with characteristic times of ~14μs and ~290μs are resolved in the kinetics of membrane potential generation coupled to single-electron reduction of the oxidized "relaxed" O state of ba 3 oxidase from T. thermophilus (O→E transition). The rapid phase reflects electron redistribution between Cu A and heme b. The slow phase includes electron redistribution from both Cu A and heme b to heme a 3 , and electrogenic proton transfer coupled to reduction of heme a 3 . The distance of proton translocation corresponds to uptake of a proton from the inner water phase into the binuclear center where heme a 3 is reduced, but there is no proton pumping and no reduction of Cu B . Single-electron reduction of the oxidized "unrelaxed" state (O H →E H transition) is accompanied by electrogenic reduction of the heme b/heme a 3 pair by Cu A in a "fast" phase (~22μs) and transfer of protons in "middle" and "slow" electrogenic phases (~0.185ms and ~0.78ms) coupled to electron redistribution from the heme b/heme a 3 pair to the Cu B site. The "middle" and "slow" electrogenic phases seem to be associated with transfer of protons to the proton-loading site (PLS) of the proton pump, but when all injected electrons reach Cu B the electronic charge appears to be compensated by back-leakage of the protons from the PLS into the binuclear site. Thus proton pumping occurs only to the extent of ~0.1 H + /e - , probably due to the formed membrane potential in the experiment. Copyright © 2017 Elsevier B.V. All rights reserved.
Anoxic biodegradation of BTEX in a biotrickling filter.
Akmirza, Ilker; Pascual, Celia; Carvajal, Andrea; Pérez, Rebeca; Muñoz, Raúl; Lebrero, Raquel
2017-06-01
Emissions of BTEX (benzene, toluene, ethylbenzene and xylene) from the petrochemical industry are characterized by a low pollutants concentration and the absence of oxygen. Biodegradation of these pollutants using nitrate as the electron acceptor is of key interest to reuse the residual gas for inertization purposes. However, the biological mineralization of BTEX is often limited by their recalcitrant nature and the toxicity of the secondary metabolites produced. The potential of an anoxic biotrickling filter for the treatment of a model O 2 -free BTEX-laden emission at inlet individual concentrations of ~700mgm -3 was here evaluated. A UV oxidation step was also tested both in the recycling liquid and in the inlet gas emission prior to biofiltration. Removal efficiencies >90% were achieved for both toluene and ethylbenzene, corresponding to elimination capacities (ECs) of 1.4±0.2gm -3 h -1 and 1.5±0.3gm -3 h -1 , respectively, while ~45% of xylene (EC=0.6±0.1g m -3 h -1 ) was removed at a liquid recycling rate of 2mh -1 . Benzene biodegradation was however limited by the accumulation of toxic metabolites in the liquid phase. The oxidation of these intermediates in the recycling liquid by UV photolysis boosted benzene abatement, achieving an average EC of 0.5±0.2gm -3 h -1 and removals of ~40%. However, the implementation of UV oxidation as a pretreatment step in the inlet gas emission resulted in the deterioration of the BTEX biodegradation capacity of the biotrickling filter. Finally, a high bacterial diversity was observed throughout the entire experiment, the predominant phyla being Proteobacteria and Deinococcus-thermus. Copyright © 2017 Elsevier B.V. All rights reserved.
Weese, Scott J; Nichols, Jamieson; Jalali, Mohammad; Litster, Annette
2015-03-03
The oral and conjunctival microbiotas likely play important roles in protection from opportunistic infections, while also being the source of potential pathogens. Yet, there has been limited investigation in cats, and the impact of comorbidities such as feline immunodeficiency virus (FIV) infection has not been reported. Oral and conjunctival swabs were collected from cats with FIV infection and FIV-uninfected controls, and subjected to 16S rRNA gene (V4) PCR and next generation sequencing. 9,249 OTUs were identified from conjunctival swabs, yet the most common 20 (0.22%) OTUs accounted for 76% of sequences. The two most abundant OTUs both belonged to Staphylococcus, and accounted for 37% of sequences. Cats with FIV infection had significantly lower relative abundances of Verrucomicrobia, Fibrobacteres, Spirochaetes, Bacteroidetes and Tenericutes, and a higher relative abundance of Deinococcus-Thermus. There were significant differences in both community membership (P = 0.006) and community structure (P = 0.02) between FIV-infected and FIV-uninfected cats. FIV-infected cats had significantly higher relative abundances of Fusobacteria and Actinobacteria in the oral cavity, and significantly higher relative abundances of several bacterial classes including Fusobacteria (0.022 vs 0.007, P = 0.006), Actinobacteria (0.017 vs 0.003, P = 0.003), Sphingobacteria (0.00015 vs 0.00003, P = 0.0013) and Flavobacteria (0.0073 vs 0.0034, P = 0.030). The feline conjunctival and oral microbiotas are complex polymicrobial communities but dominated by a limited number of genera. There is an apparent impact of FIV infection on various components of the microbiota, and assessment of the clinical relevance of these alterations in required.
NASA Technical Reports Server (NTRS)
Ward, D. M.; Santegoeds, C. M.; Nold, S. C.; Ramsing, N. B.; Ferris, M. J.; Bateson, M. M.
1997-01-01
We have begun to examine the basis for incongruence between hot spring microbial mat populations detected by cultivation or by 16S rRNA methods. We used denaturing gradient gel electrophoresis (DGGE) to monitor enrichments and isolates plated therefrom. At near extincting inoculum dilutions we observed Chloroflexus-like and cyanobacterial populations whose 16S rRNA sequences have been detected in the 'New Pit' Spring Chloroflexus mat and the Octopus Spring cyanobacterial mat. Cyanobacterial populations enriched from 44 to 54 degrees C and 56 to 63 degrees C samples at near habitat temperatures were similar to those previously detected in mat samples of comparable temperatures. However, a lower temperature enrichment from the higher temperature sample selected for the populations found in the lower temperature sample. Three Thermus populations detected by both DGGE and isolation exemplify even more how enrichment may bias our view of community structure. The most abundant population was adapted to the habitat temperature (50 degrees C), while populations adapted to 65 degrees C and 70 degrees C were 10(2)- and 10(4)-fold less abundant, respectively. However, enrichment at 70 degrees C favored the least abundant strain. Inoculum dilution and incubation at the habitat temperature favored the more numerically relevant populations. We enriched many other aerobic chemoorganotrophic populations at various inoculum dilutions and substrate concentrations, most of whose 16S rRNA sequences have not been detected in mats. A common feature of numerically relevant cyanobacterial, Chloroflexus-like and aerobic chemorganotrophic populations, is that they grow poorly and resist cultivation on solidified medium, suggesting plating bias, and that the medium composition and incubation conditions may not reflect the natural microenvironments these populations inhabit.
Phylogenetic Diversity Analysis of Subterranean Hot Springs in Iceland
Marteinsson, Viggó Thór; Hauksdóttir, Sigurbjörg; Hobel, Cédric F. V.; Kristmannsdóttir, Hrefna; Hreggvidsson, Gudmundur Oli; Kristjánsson, Jakob K.
2001-01-01
Geothermal energy has been harnessed and used for domestic heating in Iceland. In wells that are typically drilled to a depth of 1,500 to 2,000 m, the temperature of the source water is 50 to 130°C. The bottoms of the boreholes can therefore be regarded as subterranean hot springs and provide a unique opportunity to study the subterranean biosphere. Large volumes of geothermal fluid from five wells and a mixture of geothermal water from 50 geothermal wells (hot tap water) were sampled and concentrated through a 0.2-μm-pore-size filter. Cells were observed in wells RG-39 (91.4°C) and MG-18 (71.8°C) and in hot tap water (76°C), but no cells were detected in wells SN-4, SN-5 (95 to 117°C), and RV-5 (130°C). Archaea and Bacteria were detected by whole-cell fluorescent in situ hybridization. DNAs were extracted from the biomass, and small-subunit rRNA genes (16S rDNAs) were amplified by PCR using primers specific for the Archaea and Bacteria domains. The PCR products were cloned and sequenced. The sequence analysis showed 11 new operational taxonomic units (OTUs) out of 14, 3 of which were affiliated with known surface OTUs. Samples from RG-39 and hot tap water were inoculated into enrichment media and incubated at 65 and 85°C. Growth was observed only in media based on geothermal water. 16S rDNA analysis showed enrichments dominated with Desulfurococcales relatives. Two strains belonging to Desulfurococcus mobilis and to the Thermus/Deinococcus group were isolated from borehole RG-39. The results indicate that subsurface volcanic zones are an environment that provides a rich subsurface for novel thermophiles. PMID:11526029
Diets Alter the Gut Microbiome of Crocodile Lizards
Jiang, Hai-Ying; Ma, Jing-E; Li, Juan; Zhang, Xiu-Juan; Li, Lin-Miao; He, Nan; Liu, Hai-Yang; Luo, Shu-Yi; Wu, Zheng-Jun; Han, Ri-Chou; Chen, Jin-Ping
2017-01-01
The crocodile lizard is a critically endangered reptile, and serious diseases have been found in this species in recent years, especially in captive lizards. Whether these diseases are caused by changes in the gut microbiota and the effect of captivity on disease remains to be determined. Here, we examined the relationship between the gut microbiota and diet and disease by comparing the fecal microbiota of wild lizards with those of sick and healthy lizards in captivity. The gut microbiota in wild crocodile lizards was consistently dominated by Proteobacteria (∼56.4%) and Bacteroidetes (∼19.1%). However, the abundance of Firmicutes (∼2.6%) in the intestine of the wild crocodile lizards was distinctly lower than that in other vertebrates. In addition, the wild samples from Guangdong Luokeng Shinisaurus crocodilurus National Nature Reserve also had a high abundance of Deinococcus–Thermus while the wild samples from Guangxi Daguishan Crocodile Lizard National Nature Reserve had a high abundance of Tenericutes. The gut microbial community in loach-fed crocodile lizards was significantly different from the gut microbial community in the earthworm-fed and wild lizards. In addition, significant differences in specific bacteria were detected among groups. Notably, in the gut microbiota, the captive lizards fed earthworms resulted in enrichment of Fusobacterium, and the captive lizards fed loaches had higher abundances of Elizabethkingia, Halomonas, Morganella, and Salmonella, all of which are pathogens or opportunistic pathogens in human or other animals. However, there is no sufficient evidence that the gut microbiota contributes to either disease A or disease B. These results provide a reference for the conservation of endangered crocodile lizards and the first insight into the relationship between disease and the gut microbiota in lizards. PMID:29118742
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Rose, M. Franklin (Technical Monitor)
2000-01-01
Three different types of ribosome crystals were grown by the vapor diffusion technique in hanging drops as described in (1,2). The ribosome is a large asymmetric RNA-protein complex (2.3 million Da), which is protein syntheses machinery of the cell. In this poster we would like to discuss the features of ribosome crystallization. Ribosomes were purified from the thermophilic bacteria Thermus thermophilus by centrifugation (3). Three types of crystals (needle, flat tetragonal and tetragonal-like pyramid) can be grown from the same solution; furthermore, in the same drop using 10-15% 2-methyl-2,4- pentanediol as a precipitant. The crystals appeared in 5-48 hours. The crystals were stable and can co-exist in solution over long period of time. The kinetics of appearance of different crystal forms was different: first the needle crystals were grown, then the tetragonal, and finally the tetragonal pyramids. Later studies of the process of ribosome crystal growth depending on supersaturation showed that low supersaturation results in the appearance of tetragonal plates or tetragonal-like pyramids. An electron microscopy study, together with computer modeling, has shown that crystals of different forms have a high probability of having the same unit cell parameters. According to these experiments the following conclusion can be dranvn: the level of supersaturation of the macromolecule in a crystallizing solution is one of the major factors for forming three-dimensional crystals convenient for X-rays diffraction analysis. From the same macromolecule solution, crystals of different forms can be grown at approximately the same conditions by varying the concentration of macromolecule in the solution. Ion-macromolecule and water-macromolecule interactions, apparently, play the main role in the formation of the unit cell of the crystals.
Huang, M M; Arnheim, N; Goodman, M F
1992-01-01
Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758
Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.
Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane
2018-05-14
The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the predominant pathogens for early predisposition. Copyright © 2018 Elsevier Ltd. All rights reserved.
Phylogenetic diversity analysis of subterranean hot springs in Iceland.
Marteinsson, V T; Hauksdóttir, S; Hobel, C F; Kristmannsdóttir, H; Hreggvidsson, G O; Kristjánsson, J K
2001-09-01
Geothermal energy has been harnessed and used for domestic heating in Iceland. In wells that are typically drilled to a depth of 1,500 to 2,000 m, the temperature of the source water is 50 to 130 degrees C. The bottoms of the boreholes can therefore be regarded as subterranean hot springs and provide a unique opportunity to study the subterranean biosphere. Large volumes of geothermal fluid from five wells and a mixture of geothermal water from 50 geothermal wells (hot tap water) were sampled and concentrated through a 0.2-microm-pore-size filter. Cells were observed in wells RG-39 (91.4 degrees C) and MG-18 (71.8 degrees C) and in hot tap water (76 degrees C), but no cells were detected in wells SN-4, SN-5 (95 to 117 degrees C), and RV-5 (130 degrees C). Archaea and Bacteria were detected by whole-cell fluorescent in situ hybridization. DNAs were extracted from the biomass, and small-subunit rRNA genes (16S rDNAs) were amplified by PCR using primers specific for the Archaea and Bacteria domains. The PCR products were cloned and sequenced. The sequence analysis showed 11 new operational taxonomic units (OTUs) out of 14, 3 of which were affiliated with known surface OTUs. Samples from RG-39 and hot tap water were inoculated into enrichment media and incubated at 65 and 85 degrees C. Growth was observed only in media based on geothermal water. 16S rDNA analysis showed enrichments dominated with Desulfurococcales relatives. Two strains belonging to Desulfurococcus mobilis and to the Thermus/Deinococcus group were isolated from borehole RG-39. The results indicate that subsurface volcanic zones are an environment that provides a rich subsurface for novel thermophiles.
Leight, Andrew K.; Crump, Byron C.; Hood, Raleigh R.
2018-01-01
Routine monitoring of shellfish growing waters for bacteria indicative of human sewage pollution reveals little about the bacterial communities that co-occur with these indicators. This study investigated the bacterial community, potential pathogens, and fecal indicator bacteria in 40 water samples from a shellfish growing area in the Chesapeake Bay, USA. Bacterial community composition was quantified with deep sequencing of 16S rRNA gene amplicons, and absolute gene abundances were estimated with an internal standard (Thermus thermophilus genomes). Fecal coliforms were quantified by culture, and Vibrio vulnificus and V. parahaemolyticus with quantitative PCR. Fecal coliforms and V. vulnificus were detected in most samples, and a diverse assemblage of potential human pathogens were detected in all samples. These taxa followed two general patterns of abundance. Fecal coliforms and 16S rRNA genes for Enterobacteriaceae, Aeromonas, Arcobacter, Staphylococcus, and Bacteroides increased in abundance after a 1.3-inch rain event in May, and, for some taxa, after smaller rain events later in the season, suggesting that these are allochthonous organisms washed in from land. Clostridiaceae and Mycobacterium 16S rRNA gene abundances increased with day of the year and were not positively related to rainfall, suggesting that these are autochthonous organisms. Other groups followed both patterns, such as Legionella. Fecal coliform abundance did not correlate with most other taxa, but were extremely high following the large rainstorm in May when they co-occurred with a broad range of potential pathogen groups. V. vulnificus were absent during the large rainstorm, and did not correlate with 16S rRNA abundances of Vibrio spp. or most other taxa. These results highlight the complex nature of bacterial communities and the limited utility of using specific bacterial groups as indicators of pathogen presence. PMID:29593669
Exploring bacterial diversity in hospital environments by GS-FLX Titanium pyrosequencing.
Poza, Margarita; Gayoso, Carmen; Gómez, Manuel J; Rumbo-Feal, Soraya; Tomás, María; Aranda, Jesús; Fernández, Ana; Bou, Germán
2012-01-01
Understanding microbial populations in hospital environments is crucial for improving human health. Hospital-acquired infections are an increasing problem in intensive care units (ICU). In this work we present an exploration of bacterial diversity at inanimate surfaces of the ICU wards of the University Hospital A Coruña (Spain), as an example of confined hospital environment subjected to selective pressure, taking the entrance hall of the hospital, an open and crowded environment, as reference. Surface swab samples were collected from both locations and recovered DNA used as template to amplify a hypervariable region of the bacterial 16S rRNA gene. Sequencing of the amplicons was performed at the Roche 454 Sequencing Center using GS-FLX Titanium procedures. Reads were pre-processed and clustered into OTUs (operational taxonomic units), which were further classified. A total of 16 canonical bacterial phyla were detected in both locations. Members of the phyla Firmicutes (mainly Staphylococcus and Streptococcus) and Actinobacteria (mainly Micrococcaceae, Corynebacteriaceae and Brevibacteriaceae) were over-represented in the ICU with respect to the Hall. The phyllum Proteobacteria was also well represented in the ICU, mainly by members of the families Enterobacteriaceae, Methylobacteriaceae and Sphingomonadaceae. In the Hall sample, the phyla Proteobacteria, Bacteroidetes, Deinococcus-Thermus and Cyanobacteria were over-represented with respect to the ICU. Over-representation of Proteobacteria was mainly due to the high abundance of Enterobacteriaceae members. The presented results demonstrate that bacterial diversity differs at the ICU and entrance hall locations. Reduced diversity detected at ICU, relative to the entrance hall, can be explained by its confined character and by the existence of antimicrobial selective pressure. This is the first study using deep sequencing techniques made in hospital wards showing substantial hospital microbial diversity.
Bacterial diversity at different stages of the composting process
2010-01-01
Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants. PMID:20350306
Baker, Perrin; Hillis, Colleen; Carere, Jason; Seah, Stephen Y K
2012-03-06
Bacterial aldolase-dehydrogenase complexes catalyze the last steps in the meta cleavage pathway of aromatic hydrocarbon degradation. The aldolase (TTHB246) and dehydrogenase (TTHB247) from Thermus thermophilus were separately expressed and purified from recombinant Escherichia coli. The aldolase forms a dimer, while the dehydrogenase is a monomer; these enzymes can form a stable tetrameric complex in vitro, consisting of two aldolase and two dehydrogenase subunits. Upon complex formation, the K(m) value of 4-hydroxy-2-oxopentanoate, the substrate of TTHB246, is decreased 4-fold while the K(m) of acetaldehyde, the substrate of TTHB247, is increased 3-fold. The k(cat) values of each enzyme were reduced by ~2-fold when they were in a complex. The half-life of TTHB247 at 50 °C increased by ~4-fold when it was in a complex with TTHB246. The acetaldehyde product from TTHB246 could be efficiently channelled directly to TTHB247, but the channeling efficiency for the larger propionaldehyde was ~40% lower. A single A324G substitution in TTHB246 increased the channeling efficiency of propionaldehyde to a value comparable to that of acetaldehyde. Stable and catalytically competent chimeric complexes could be formed between the T. thermophilus enzymes and the orthologous aldolase (BphI) and dehydrogenase (BphJ) from the biphenyl degradation pathway of Burkholderia xenovorans LB400. However, channeling efficiencies for acetaldehyde in these chimeric complexes were ~10%. Structural and sequence analysis suggests that interacting residues in the interface of the aldolase-dehydrogenase complex are highly conserved among homologues, but coevolution of partner enzymes is required to fine-tune this interaction to allow for efficient substrate channeling.
Bacterial communities in soil samples from the Mingyong Glacier of southwestern China.
Li, Haoyu; Taj, Muhammad Kamran; Ji, Xiuling; Zhang, Qi; Lin, Liangbing; Zhou, Zhimei; Wei, Yunlin
2017-05-01
The present study was an effort to determine the bacterial diversity of soils in Mingyong Glacier located at the Meili Snow Mountains of southwestern China. Mingyong Glacier has different climatic zones within a very narrow area, and bacterial community diversity in this low temperature area remains largely unknown. In this study, soil samples were collected from four different climatic zones: M11A (dry warm valley), M14 (forest), M15 (grass land), and M16 (glacier zones). Phylogenetic analysis based on 16S rRNA gene V6 hypervariable region showed high bacterial abundance in the glacier. The number of Operational Taxonomic Units ranged from 2.24×10 3 to 5.56×10 3 in soil samples. Statistical analysis of 16S rRNA gene clone libraries results showed that bacterial diversity in zones M11A,M14 and M16 are higher than in zone M15. The bacterial community structures are clearly distinguishable, and phylogenetic analysis showed that the predominant phyla were Proteobacteria, Deinococcus-Thermus, Firmicutes, Actinobacteria, and Nitrospirae in Mingyong Glacier. Seventy-nine different orders from four zones have been isolated. Bacterial diversity and distribution of bacterial communities related to the anthropogenic perturbations in zone (M15) were confirmed by diversity index analysis, and the diversity index of other three zones was satisfactory through this analysis software. The results suggest that bacterial diversity and distribution analyses using bacterial 16S rRNA gene V6 hypervariable region were successful, and bacterial communities in this area not only had the same bacterial phyla compared to other glaciers but also had their own rare species.
NASA Technical Reports Server (NTRS)
Olendzenski, L.; Liu, L.; Zhaxybayeva, O.; Murphey, R.; Shin, D. G.; Gogarten, J. P.
2000-01-01
Members of the Deinococcaceae (e.g., Thermus, Meiothermus, Deinococcus) contain A/V-ATPases typically found in Archaea or Eukaryotes which were probably acquired by horizontal gene transfer. Two methods were used to quantify the extent to which archaeal or eukaryotic genes have been acquired by this lineage. Screening of a Meiothermus ruber library with probes made against Thermoplasma acidophilum DNA yielded a number of clones which hybridized more strongly than background. One of these contained the prolyl tRNA synthetase (RS) gene. Phylogenetic analysis shows the M. ruber and D. radiodurans prolyl RS to be more closely related to archaeal and eukaryal forms of this gene than to the typical bacterial type. Using a bioinformatics approach, putative open reading frames (ORFs) from the prerelease version of the D. radiodurans genome were screened for genes more closely related to archaeal or eukaryotic genes. Putative ORFs were searched against representative genomes from each of the three domains using automated BLAST. ORFs showing the highest matches against archaeal and eukaryotic genes were collected and ranked. Among the top-ranked hits were the A/V-ATPase catalytic and noncatalytic subunits and the prolyl RS genes. Using phylogenetic methods, ORFs were analyzed and trees assessed for evidence of horizontal gene transfer. Of the 45 genes examined, 20 showed topologies in which D. radiodurans homologues clearly group with eukaryotic or archaeal homologues, and 17 additional trees were found to show probable evidence of horizontal gene transfer. Compared to the total number of ORFs in the genome, those that can be identified as having been acquired from Archaea or Eukaryotes are relatively few (approximately 1%), suggesting that interdomain transfer is rare.
Non-complexed four cascade enzyme mixture: simple purification and synergetic co-stabilization.
Myung, Suwan; Zhang, Y-H Percival
2013-01-01
Cell-free biosystems comprised of synthetic enzymatic pathways would be a promising biomanufacturing platform due to several advantages, such as high product yield, fast reaction rate, easy control and access, and so on. However, it was essential to produce (purified) enzymes at low costs and stabilize them for a long time so to decrease biocatalyst costs. We studied the stability of the four recombinant enzyme mixtures, all of which originated from thermophilic microorganisms: triosephosphate isomerase (TIM) from Thermus thermophiles, fructose bisphosphate aldolase (ALD) from Thermotoga maritima, fructose bisphosphatase (FBP) from T. maritima, and phosphoglucose isomerase (PGI) from Clostridium thermocellum. It was found that TIM and ALD were very stable at evaluated temperature so that they were purified by heat precipitation followed by gradient ammonia sulfate precipitation. In contrast, PGI was not stable enough for heat treatment. In addition, the stability of a low concentration PGI was enhanced by more than 25 times in the presence of 20 mg/L bovine serum albumin or the other three enzymes. At a practical enzyme loading of 1000 U/L for each enzyme, the half-life time of free PGI was prolong to 433 h in the presence of the other three enzymes, resulting in a great increase in the total turn-over number of PGI to 6.2×10(9) mole of product per mole of enzyme. This study clearly suggested that the presence of other proteins had a strong synergetic effect on the stabilization of the thermolabile enzyme PGI due to in vitro macromolecular crowding effect. Also, this result could be used to explain why not all enzymes isolated from thermophilic microorganisms are stable in vitro because of a lack of the macromolecular crowding environment.
Jiménez, Diego Javier; Dini-Andreote, Francisco; Ottoni, Júlia Ronzella; de Oliveira, Valéria Maia; van Elsas, Jan Dirk; Andreote, Fernando Dini
2015-05-01
The occurrence of genes encoding biotechnologically relevant α/β-hydrolases in mangrove soil microbial communities was assessed using data obtained by whole-metagenome sequencing of four mangroves areas, denoted BrMgv01 to BrMgv04, in São Paulo, Brazil. The sequences (215 Mb in total) were filtered based on local amino acid alignments against the Lipase Engineering Database. In total, 5923 unassembled sequences were affiliated with 30 different α/β-hydrolase fold superfamilies. The most abundant predicted proteins encompassed cytosolic hydrolases (abH08; ∼ 23%), microsomal hydrolases (abH09; ∼ 12%) and Moraxella lipase-like proteins (abH04 and abH01; < 5%). Detailed analysis of the genes predicted to encode proteins of the abH08 superfamily revealed a high proportion related to epoxide hydrolases and haloalkane dehalogenases in polluted mangroves BrMgv01-02-03. This suggested selection and putative involvement in local degradation/detoxification of the pollutants. Seven sequences that were annotated as genes for putative epoxide hydrolases and five for putative haloalkane dehalogenases were found in a fosmid library generated from BrMgv02 DNA. The latter enzymes were predicted to belong to Actinobacteria, Deinococcus-Thermus, Planctomycetes and Proteobacteria. Our integrated approach thus identified 12 genes (complete and/or partial) that may encode hitherto undescribed enzymes. The low amino acid identity (< 60%) with already-described genes opens perspectives for both production in an expression host and genetic screening of metagenomes. © 2014 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Structural insights into translational recoding by frameshift suppressor tRNA SufJ
Fagan, Crystal E.; Maehigashi, Tatsuya; Dunkle, Jack A.; ...
2014-10-28
The three-nucleotide mRNA reading frame is tightly regulated during translation to ensure accurate protein expression. Translation errors that lead to aberrant protein production can result from the uncoupled movement of the tRNA in either the 5' or 3' direction on mRNA. Here, we report the biochemical and structural characterization of +1 frameshift suppressor tRNA SufJ, a tRNA known to decode four, instead of three, nucleotides. Frameshift suppressor tRNA SufJ contains an insertion 5' to its anticodon, expanding the anticodon loop from seven to eight nucleotides. Our results indicate that the expansion of the anticodon loop of either ASL SufJ ormore » tRNA SufJ does not affect its affinity for the A site of the ribosome. Structural analyses of both ASL SufJ and ASL Thr bound to the Thermus thermophilus 70S ribosome demonstrate both ASLs decode in the zero frame. Although the anticodon loop residues 34–37 are superimposable with canonical seven-nucleotide ASLs, the single C31.5 insertion between nucleotides 31 and 32 in ASL SufJ imposes a conformational change of the anticodon stem, that repositions and tilts the ASL toward the back of the A site. Further modeling analyses reveal that this tilting would cause a distortion in full-length A-site tRNA SufJ during tRNA selection and possibly impede gripping of the anticodon stem by 16S rRNA nucleotides in the P site. Together, these data implicate tRNA distortion as a major driver of noncanonical translation events such as frameshifting.« less
Papadopoulos, Anthony
2009-01-01
The first-degree power-law polynomial function is frequently used to describe activity metabolism for steady swimming animals. This function has been used in hydrodynamics-based metabolic studies to evaluate important parameters of energetic costs, such as the standard metabolic rate and the drag power indices. In theory, however, the power-law polynomial function of any degree greater than one can be used to describe activity metabolism for steady swimming animals. In fact, activity metabolism has been described by the conventional exponential function and the cubic polynomial function, although only the power-law polynomial function models drag power since it conforms to hydrodynamic laws. Consequently, the first-degree power-law polynomial function yields incorrect parameter values of energetic costs if activity metabolism is governed by the power-law polynomial function of any degree greater than one. This issue is important in bioenergetics because correct comparisons of energetic costs among different steady swimming animals cannot be made unless the degree of the power-law polynomial function derives from activity metabolism. In other words, a hydrodynamics-based functional form of activity metabolism is a power-law polynomial function of any degree greater than or equal to one. Therefore, the degree of the power-law polynomial function should be treated as a parameter, not as a constant. This new treatment not only conforms to hydrodynamic laws, but also ensures correct comparisons of energetic costs among different steady swimming animals. Furthermore, the exponential power-law function, which is a new hydrodynamics-based functional form of activity metabolism, is a special case of the power-law polynomial function. Hence, the link between the hydrodynamics of steady swimming and the exponential-based metabolic model is defined.
Ultrasound Assessment of the Transverse Abdominis During Functional Movement.
Mangum, L Colby; Henderson, Kaitlin; Murray, Kyle P; Saliba, Susan A
2018-05-01
The traditional activation ratio divides contracted muscle thickness by resting muscle thickness while an abdominal draw-in maneuver is performed during hook lying. Ultrasound imaging during function, such as standing or gait, or peak knee flexion in a single-leg squat allows for further visualization of muscle activity. The goal of this study was to examine activation ratio calculations for transverse abdominis function in supine versus loaded conditions to determine the most informative normalization strategy for muscle activity based on thickness values. Transverse abdominis thickness was measured via ultrasound in 35 healthy participants under 4 different conditions. Comparisons were made between the traditional activation ratio tabletop, standing activation ratio (standing abdominal draw-in maneuver thickness/quiet standing thickness), and functional activation ratio (single-leg squat thickness/quiet standing thickness). Additionally, a cued activation ratio (single-leg squat with cued abdominal draw-in maneuver thickness/single-leg squat thickness) during the single-leg squat was obtained. Activation ratios of greater than 1.0 indicated that participants could activate the muscle during activity, and values were compared by analysis of variance. The participants included 23 women and 12 men with a mean age ± SD of 21.3 ± 2.7 years, mass of 66.1 ± 14.4 kg, and height of 168.5 ± 10.1 cm. Activation ratios exceeded 1.0 in 94.3% for the traditional activation ratio, 85.7% for the standing activation ratio, 82.9% for the cued activation ratio, and 82.9% for the functional activation ratio. With groups defined as tabletop activated or not, the standing, cued, and functional activation ratios were all significantly different (all P < .05). Normalizing muscle thickness to the corresponding functional position quiet value provides a useful functional activation ratio and may help clinicians better understand the transverse abdominis role during complex functional tasks. Assessment techniques using various formulas for activation ratios reveal that the muscle functions differently during weight bearing compared to traditional measures. © 2017 by the American Institute of Ultrasound in Medicine.
McAuley, Edward; Morris, Katherine S; Doerksen, Shawna E; Motl, Robert W; Liang, Hu; White, Siobhan M; Wójcicki, Thomas R; Rosengren, Karl
2007-12-01
To examine the hypothesis that changes in self-efficacy and functional performance mediate, in part, the beneficial effect of physical activity on functional limitations over time. Prospective, observational study. Community-based. Two hundred forty-nine community-dwelling older women. Participants completed measures of self-reported physical activity, functional limitations, and self-efficacy. Four measures of physical function performance were also assessed. Measures were completed at baseline and 24 months. Data were analyzed using a panel model within a covariance modeling framework. Results indicated that increases in physical activity over time were associated with greater improvements in self-efficacy, which was associated in turn with improved physical function performance, both of which mediated the association between physical activity and functional limitations. Fewer functional limitations at baseline were also associated with higher levels of self-efficacy at 24 months. Age, race, and health status covariates did not significantly change these relationships. The findings support the mediating roles of self-efficacy and physical function performance in the relationship between longitudinal changes in physical activity and functional limitations in older women.
Widowhood, leisure activity engagement, and cognitive function among older adults.
Lee, Yura; Chi, Iris; A Palinkas, Lawrence
2018-04-10
Maintaining cognitive function is an essential aspect of successful aging. Widowhood is a salient life transition that can affect older adults' cognitive function. Leisure engagement has received increasing attention because it is still modifiable in later life to help prevent cognitive decline. Nonetheless, limited longitudinal studies have examined how widowhood influences cognitive function, and even fewer studies have tested the role of leisure activities in this relationship. This study delineated the mechanism of widowhood, leisure activity engagement, and cognitive function among older adults using a national longitudinal dataset, the Health and Retirement Study, and its supplementary dataset, the Consumption and Activities Mail Survey, which repeatedly measured individuals' leisure activity engagement. Findings showed no significant association between widowhood and cognitive function during a 4-year period. However, engagement in mental activities moderated the impact of widowhood on cognitive function. Specifically, the benefit of mental activity engagement on cognition was more pronounced among individuals who were recently widowed compared to those who were married. This implies a protective role of mental activities in the relationship between widowhood and cognitive function. Interventions with mentally stimulating activities at the community level to retain cognition among individuals in early phase widowhoodare suggested. Future studies are necessary to explore whether other factors such as changes in physical and mental health and intergenerational support from adult children during widowhood may further influence this mechanism among widowhood, leisure activities, and cognitive function.
Matsuda, Kensuke; Ikeda, Shou; Mitsutake, Tsubasa; Nakahara, Masami; Nagai, Yoshiharu; Ikeda, Takuro; Horikawa, Etsuo
2017-03-01
[Purpose] Prevention of dementia requires early intervention against it. To ensure that early interventions are effective it is crucial to study the cognitive functions related to dementia in young adulthood. Moreover, it is needed not only to verify the cognitive function test but also to elucidate the actual brain activity and the influence of related factors on the brain activity. To investigate the factors influencing cognitive function among young adults and examine the differences in executive function by physical activity level. [Subjects and Methods] Forty healthy university students (mean age, 20.4 years) were classified into two groups by cognitive function score (HIGH and LOW), determined according to Trail Making Test performance and Stroop task processing time. We then assessed what factors were related to cognitive function by logistic regression analysis. Executive function was determined by brain blood flow using near-infrared spectroscopy during the Stroop task, and was then compared by physical activity levels (determined according to number of steps per hour). [Results] Full-scale Intelligence Quotient according to the 3rd Wechsler Adult Intelligent Scale and number of steps per hour influenced cognitive function score, with odds ratios of 1.104 and 1.012, respectively. Oxy-hemoglobin concentrations in areas related to executive function during the Stroop task were significantly higher among those in the high physical activity group than among those in the low physical activity group. [Conclusion] The study revealed that Full-scale Intelligence Quotient and a number of steps per hour are factors associated with the cognitive functions in young adulthood. In addition, activity in execution function related area was found to be significantly higher in the high physical activity group than in the low physical activity group, suggesting the importance of physical activity for enhancing young adulthood cognitive functions.
Lahti, Jouni; Sabia, Séverine; Singh-Manoux, Archana; Kivimäki, Mika; Tatsuse, Takashi; Yamada, Masaaki; Sekine, Michikazu; Lallukka, Tea
2016-01-06
The aim of this study was to examine whether leisure time physical activity contributes to subsequent physical and mental health functioning among midlife employees. The associations were tested in three occupational cohorts from Finland, Britain and Japan. Cohort study. Finland, Britain and Japan. Prospective employee cohorts from the Finnish Helsinki Health Study (2000-2002 and 2007, n=5958), British Whitehall II study (1997-1999 and 2003-2004, n=4142) and Japanese Civil Servants Study (1998-1999 and 2003, n=1768) were used. Leisure time physical activity was classified into three groups: inactive, moderately active and vigorously active. Mean scores of physical and mental health functioning (SF-36) at follow-up were examined. Physical activity was associated with better subsequent physical health functioning in all three cohorts, however, with varying magnitude and some gender differences. Differences were the clearest among Finnish women (inactive: 46.0, vigorously active: 49.5) and men (inactive: 47.8, active vigorous: 51.1) and British women (inactive: 47.3, active vigorous: 50.4). In mental health functioning, the differences were generally smaller and not that clearly related to the intensity of physical activity. Emerging differences in health functioning were relatively small. Vigorous physical activity was associated with better subsequent physical health functioning in all three cohorts with varying magnitude. For mental health functioning, the intensity of physical activity was less important. Promoting leisure time physical activity may prove useful for the maintenance of health functioning among midlife employees. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Functional performance testing for power and return to sports.
Manske, Robert; Reiman, Michael
2013-05-01
Functional performance testing of athletes can determine physical limitations that may affect sporting activities. Optimal functional performance testing simulates the athlete's activity. A Medline search from 1960 to 2012 was implemented with the keywords functional testing, functional impairment testing, and functional performance testing in the English language. Each author also undertook independent searches of article references. Functional performance tests can bridge the gap between general physical tests and full, unrestricted athletic activity.
Kurokawa, Hirofumi; Sugiyama, Seigo; Nozaki, Toshimitsu; Sugamura, Koichi; Toyama, Kensuke; Matsubara, Junichi; Fujisue, Koichiro; Ohba, Keisuke; Maeda, Hirofumi; Konishi, Masaaki; Akiyama, Eiichi; Sumida, Hitoshi; Izumiya, Yasuhiro; Yasuda, Osamu; Kim-Mitsuyama, Shokei; Ogawa, Hisao
2015-04-01
Mitochondrial dysfunction plays an important role in cellular senescence and impaired function of vascular endothelium, resulted in cardiovascular diseases. Telmisartan is a unique angiotensin II type I receptor blocker that has been shown to prevent cardiovascular events in high risk patients. AMP-activated protein kinase (AMPK) plays a critical role in mitochondrial biogenesis and endothelial function. This study assessed whether telmisartan enhances mitochondrial function and alters cellular functions via AMPK in human coronary artery endothelial cells (HCAECs). In cultured HCAECs, telmisartan significantly enhanced mitochondrial activity assessed by mitochondrial reductase activity and intracellular ATP production and increased the expression of mitochondria related genes. Telmisartan prevented cellular senescence and exhibited the anti-apoptotic and pro-angiogenic properties. The expression of genes related anti-oxidant and pro-angiogenic properties were increased by telmisartan. Telmisartan increased endothelial NO synthase and AMPK phosphorylation. Peroxisome proliferator-activated receptor gamma signaling was not involved in telmisartan-induced improvement of mitochondrial function. All of these effects were abolished by inhibition of AMPK. Telmisartan enhanced mitochondrial activity and exhibited anti-senescence effects and improving endothelial function through AMPK in HCAECs. Telmisartan could provide beneficial effects on vascular diseases via enhancement of mitochondrial activity and modulating endothelial function through AMPK activation. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Kalénine, Solène; Mirman, Daniel; Middleton, Erica L.; Buxbaum, Laurel J.
2012-01-01
The current research aimed at specifying the activation time course of different types of semantic information during object conceptual processing and the effect of context on this time course. We distinguished between thematic and functional knowledge and the specificity of functional similarity. Two experiments were conducted with healthy older adults using eye tracking in a word-to-picture matching task. The time course of gaze fixations was used to assess activation of distractor objects during the identification of manipulable artifact targets (e.g., broom). Distractors were (a) thematically related (e.g., dustpan), (b) related by a specific function (e.g., vacuum cleaner), or (c) related by a general function (e.g., sponge). Growth curve analyses were used to assess competition effects when target words were presented in isolation (Experiment 1) and embedded in contextual sentences of different generality levels (Experiment 2). In the absence of context, there was earlier and shorter lasting activation of thematically related as compared to functionally related objects. The time course difference was more pronounced for general functions than specific functions. When contexts were provided, functional similarities that were congruent with context generality level increased in salience with earlier activation of those objects. Context had little impact on thematic activation time course. These data demonstrate that processing a single manipulable artifact concept implicitly activates thematic and functional knowledge with different time courses and that context speeds activation of context-congruent functional similarity. PMID:22449134
Herbolsheimer, Florian; Riepe, Matthias W; Peter, Richard
2018-02-21
Numerous studies have reported weak or moderate correlations between self-reported and accelerometer-assessed physical activity. One explanation is that self-reported physical activity might be biased by demographic, cognitive or other factors. Cognitive function is one factor that could be associated with either overreporting or underreporting of daily physical activity. Difficulties in remembering past physical activities might result in recall bias. Thus, the current study examines whether the cognitive function is associated with differences between self-reported and accelerometer-assessed physical activity. Cross-sectional data from the population-based Activity and Function in the Elderly in Ulm study (ActiFE) were used. A total of 1172 community-dwelling older adults (aged 65-90 years) wore a uniaxial accelerometer (activPAL unit) for a week. Additionally, self-reported physical activity was assessed using the LASA Physical Activity Questionnaire (LAPAQ). Cognitive function was measured with four items (immediate memory, delayed memory, recognition memory, and semantic fluency) from the Consortium to Establish a Registry for Alzheimer's Disease Total Score (CERAD-TS). Mean differences of self-reported and accelerometer-assessed physical activity (MPA) were associated with cognitive function in men (r s = -.12, p = .002) but not in women. Sex-stratified multiple linear regression analyses showed that MPA declined with high cognitive function in men (β = -.13; p = .015). Results suggest that self-reported physical activity should be interpreted with caution in older populations, as cognitive function was one factor that explained the differences between objective and subjective physical activity measurements.
Correspondence of the brain's functional architecture during activation and rest.
Smith, Stephen M; Fox, Peter T; Miller, Karla L; Glahn, David C; Fox, P Mickle; Mackay, Clare E; Filippini, Nicola; Watkins, Kate E; Toro, Roberto; Laird, Angela R; Beckmann, Christian F
2009-08-04
Neural connections, providing the substrate for functional networks, exist whether or not they are functionally active at any given moment. However, it is not known to what extent brain regions are continuously interacting when the brain is "at rest." In this work, we identify the major explicit activation networks by carrying out an image-based activation network analysis of thousands of separate activation maps derived from the BrainMap database of functional imaging studies, involving nearly 30,000 human subjects. Independently, we extract the major covarying networks in the resting brain, as imaged with functional magnetic resonance imaging in 36 subjects at rest. The sets of major brain networks, and their decompositions into subnetworks, show close correspondence between the independent analyses of resting and activation brain dynamics. We conclude that the full repertoire of functional networks utilized by the brain in action is continuously and dynamically "active" even when at "rest."
Expectations Regarding Aging, Physical Activity, and Physical Function in Older Adults
Breda, Aili I.; Watts, Amber S.
2017-01-01
Objective: The present study examined how expectations regarding aging (ERA) influence physical activity participation and physical function. Method: We surveyed 148 older adults about their ERA (ERA-38), health-promoting lifestyles (HPLP-II), and self-rated health (RAND-36). We tested the mediating effect of physical activity on the relationships between ERA and physical function. Results: Positive expectations were associated with more engagement in physical activity (B = 0.016, p < .05) and better physical function (B = 0.521, p < .01). Physical activity mediated the relationship between ERA and physical function (B = 5.890, p < .01, indirect effect 0.092, CI = [0.015, 0.239]). Discussion: ERA play an important role in adoption of physically active lifestyles in older adults and may influence health outcomes, such as physical function. Future research should evaluate whether attempts to increase physical activity are more successful when modifications to ERA are also targeted. PMID:28491915
Van Holle, Veerle; Van Cauwenberg, Jelle; Gheysen, Freja; Van Dyck, Delfien; Deforche, Benedicte; Van de Weghe, Nico; De Bourdeaudhuij, Ilse
2016-01-01
Better physical functioning in the elderly may be associated with higher physical activity levels. Since older adults spend a substantial part of the day in their residential neighborhood, the neighborhood physical environment may moderate associations between functioning and older adults' physical activity. The present study investigated the moderating role of the objective and perceived physical environment on associations between Belgian older adults' physical functioning and transport walking, recreational walking, and moderate-to-vigorous physical activity. Data from 438 older adults were included. Objective physical functioning was assessed using the Short Physical Performance Battery. Potential moderators included objective neighborhood walkability and perceptions of land use mix diversity, access to recreational facilities, access to services, street connectivity, physical barriers for walking, aesthetics, crime-related safety, traffic speeding-related safety, and walking infrastructure. Transport and recreational walking were self-reported, moderate-to-vigorous physical activity was assessed through accelerometers. Multi-level regression analyses were conducted using MLwiN to examine two-way interactions between functioning and the environment on both walking outcomes. Based on a previous study where environment x neighborhood income associations were found for Belgian older adults' moderate-to-vigorous physical activity, three-way functioning x environment x income interactions were examined for moderate-to-vigorous physical activity. Objectively-measured walkability moderated the association between functioning and transport walking; this positive association was only present in high-walkable neighborhoods. Moreover, a three-way interaction was observed for moderate-to-vigorous physical activity. Only in high-income, high-walkable neighborhoods, there was a positive association between functioning and moderate-to-vigorous physical activity. No functioning x walkability interactions were observed for recreational walking, and none of the perceived environmental variables moderated the positive association between physical functioning and the physical activity outcomes. For older adults with better physical functioning, living in a high-walkable neighborhood could be beneficial to engage in more transport walking. Living in high-income, high-walkable neighborhoods and having better functioning might also be beneficial for more engagement in moderate-to-vigorous physical activity. This might suggest a protective role of neighborhood walkability for preventing declining physical functioning and consequently decreasing physical activity levels in older adults. However, given the cross-sectional design of the present study, this suggestion needs to be confirmed through longitudinal assessment investigating over-time changes in the observed associations.
[Functional deterioration of basic daily living activities after an emergency service consultation].
Gutiérrez Rodríguez, J; Varela Suárez, C; Alonso Alvarez, M; Solano Jaurrieta, J J
2000-05-01
To determine the incidence of functional decline of elderly patients discharged from an emergency department and to analized functional impairment as a risk of readmission. A prospective cohort aged 75 or older were followed up after discharge from an emergency department between 01-02-95 and 01-04-95. The study protocol included sociodemografics, clinicals, functionals and mentalsoutcomes. We studied the incidence of functional decline in basic activities of daily living, with Barthel Index, and association with the risk of readmission. The sample was composed by 125 elders (mean aged 81.9 +/- 4.6 years and 60.8% were women). The incidence of functional decline in basic activities of daily living at the visit to emergency department was 20.8% and one moth after discharge was 18.4%. Both activities with more functional impairment were bathing, dressing and movility activities. Functional decline was associated with the risk of readmission at emergency department (Odds Ratio = 4.1 [1.4-11.8]) 20% of patients who are discharged of emergency department present a new functional impairment in basics activities of daily living. Functional decline is associated with the risk of readmission one moth after discharged.
Functional Performance Testing for Power and Return to Sports
Manske, Robert; Reiman, Michael
2013-01-01
Context: Functional performance testing of athletes can determine physical limitations that may affect sporting activities. Optimal functional performance testing simulates the athlete’s activity. Evidence Acquisition: A Medline search from 1960 to 2012 was implemented with the keywords functional testing, functional impairment testing, and functional performance testing in the English language. Each author also undertook independent searches of article references. Conclusion: Functional performance tests can bridge the gap between general physical tests and full, unrestricted athletic activity. PMID:24427396
Baruth, Meghan; Wilcox, Sara; Wegley, Stacy; Buchner, David M; Ory, Marcia G; Phillips, Alisa; Schwamberger, Karen; Bazzarre, Terry L
2011-09-01
Physical activity can prevent or delay the onset of physical functional limitations in older adults. There are limited data that evidence-based physical activity interventions can be successfully translated into community programs and result in similar benefits for physical functioning. The purpose of this study is to measure the effects of the Active Living Every Day program on physical functioning and physical functional limitations in a diverse sample of older adults. As a part of the Active for Life initiative, the Council on Aging of Southwestern Ohio implemented Active Living Every Day (ALED), a group-based lifestyle behavior change program designed to increase physical activity. Performance-based physical functioning tests (30-s Chair Stand Test, eight Foot Up-and-Go Test, Chair Sit-and-Reach Test, 30-Foot Walk Test) were administered to participants at baseline and posttest. Baseline to post-program changes in physical functioning and impairment status were examined with repeated measures analysis of covariance. Interactions tested whether change over time differed according to race/ethnicity, body mass index (BMI), and baseline impairment status. Participants significantly increased their performance in all four physical functioning tests. The percentage of participants classified as "impaired" according to normative data significantly decreased over time. Physical functioning improved regardless of BMI, race/ethnicity, or baseline impairment status. ALED is an example of an evidenced-based physical activity program that can be successfully translated into community programs and result in significant and clinically meaningful improvements in performance-based measures of physical functioning.
Kamo, Tomohiko; Nishida, Yuusuke
2014-10-01
To identify the direct and indirect effects of nutritional status, physical function, and cognitive function on activities of daily living in Japanese older adults requiring long-term care. In total, 179 participants aged ≥ 65 years who were eligible for long-term care insurance (mean age 85.5 ± 7.8 years) were recruited for this study. Nutritional status (Mini Nutritional Assessment, Short Form) and physical function (Short Physical Performance Battery) were examined. Activities of daily living, cognitive function and frailty were assessed using the Barthel Index, Mini-Mental State Examination and Clinical Frailty Scale, respectively. Path analysis was used to determine relationships between these factors and the activities of daily living. For Japanese older adults requiring long-term care, pathways were modeled for nutritional status, physical function and the activities of daily living. The total effect of nutritional status was 0.516 (P<0.001). The indirect effect of nutritional status through physical function on the activities of daily living was 0.458 (P<0.001). Finally, no significant direct effect of nutritional status on activities of daily living was observed (b=0.058, P=0.258). The present study identified the complex pathway from nutritional status to the activities of daily living through physical function in aged Japanese people requiring long-term care. These findings suggest that maintaining good nutritional status and nutritional support might delay physical function decline, and prolong the activities of daily living. © 2013 Japan Geriatrics Society.
Engeroff, Tobias; Ingmann, Tobias; Banzer, Winfried
2018-06-01
A growing body of literature suggests that physical activity might alleviate the age-related neurodegeneration and decline of cognitive function. However, most of this evidence is based on data investigating the association of exercise interventions or current physical activity behavior with cognitive function in elderly subjects. We performed a systematic review and hypothesize that physical activity during the adult life span is connected with maintained domain-specific cognitive functions during late adulthood defined as age 60+ years. We performed a systematic literature search up to November 2017 in PubMed, Web of Science, and Google Scholar without language limitations for studies analyzing the association of leisure physical activity during the adult life span (age 18+ years) and domain-specific cognitive functions in older adults (age 60+ years). The literature review yielded 14,294 articles and after applying inclusion and exclusion criteria, nine cross-sectional and 14 longitudinal studies were included. Moderate- and vigorous-intensity leisure physical activity was associated with global cognitive function and specific cognitive domains including executive functions and memory but not attention or working memory. Most studies assessed mid- to late-adulthood physical activity, thus information concerning the influence of young adult life-span physical activity is currently lacking. Observational evidence that moderate- and vigorous-intensity leisure physical activity is beneficially associated with maintained cognitive functions during old age is accumulating. Further studies are necessary to confirm a causal link by assessing objective physical activity data and the decline of cognitive functions at multiple time points during old age.
Frisard, Madlyn I; Fabre, Jennifer M; Russell, Ryan D; King, Christina M; DeLany, James P; Wood, Robert H; Ravussin, Eric
2007-07-01
Functional dependence and the risks of disability increase with age. The loss of independence is thought to be partially due to a decrease in physical activity. However, in populations, accurate measurement of physical activity is challenging and may not provide information on functional impairment. This study therefore assessed physical functionality and physical activity level in a group of nonagenarians (11 men/11 women; 93+/-1 years, 66.6+/-2.4 kg, body mass index [BMI]=24+/-1 kg/m2) and a group of participants aged 60-74 years (17 men/15 women; 70+/-1 years, 83.3+/-3.0 kg, BMI=29+/-1 kg/m2) from the Louisiana Healthy Aging Study. Physical activity level was calculated from total energy expenditure (TEE) and resting metabolic rate (RMR). Physical functionality was assessed using the Reduced Continuous Scale Physical Functional Performance Test (CS-PFP10). Nonagenarians had lower absolute (p<.001) and adjusted (p<.007) TEE compared to participants aged 60-74 years which was attributed to a reduction in both RMR and physical activity level. Nonagenarians also had reduced functional performance (p<.001) which was correlated with activity level (r=0.68, p<.001). When compared to individuals aged 60-74 years, 73% of the reduction in TEE in nonagenarians can be attributed to a reduction in physical activity level, the remaining being accounted for by a reduction in RMR. The reduced physical activity in nonagenarians is associated with less physical functionality. This study provides the first objective comparison of physical functionality and actual levels of physical activity in older individuals.
Physical activity, motor function, and white matter hyperintensity burden in healthy older adults.
Fleischman, Debra A; Yang, Jingyun; Arfanakis, Konstantinos; Arvanitakis, Zoe; Leurgans, Sue E; Turner, Arlener D; Barnes, Lisa L; Bennett, David A; Buchman, Aron S
2015-03-31
To test the hypothesis that physical activity modifies the association between white matter hyperintensity (WMH) burden and motor function in healthy older persons without dementia. Total daily activity (exercise and nonexercise physical activity) was measured for up to 11 days with actigraphy (Actical; Philips Respironics, Bend, OR) in 167 older adults without dementia participating in the Rush Memory and Aging Project. Eleven motor performances were summarized into a previously described global motor score. WMH volume was expressed as percent of intracranial volume. Linear regression models, adjusted for age, education, and sex, were performed with total WMH volume as the predictor and global motor score as the outcome. Terms for total daily physical activity and its interaction with WMH volume were then added to the model. Higher WMH burden was associated with lower motor function (p = 0.006), and total daily activity was positively associated with motor function (p = 0.002). Total daily activity modified the association between WMH and motor function (p = 0.007). WMH burden was not associated with motor function in persons with high activity (90th percentile). By contrast, higher WMH burden remained associated with lower motor function in persons with average (50th percentile; estimate = -0.304, slope = -0.133) and low (10th percentile; estimate = -1.793, slope = -0.241) activity. Higher levels of physical activity may reduce the effect of WMH burden on motor function in healthy older adults. © 2015 American Academy of Neurology.
Physical activity, motor function, and white matter hyperintensity burden in healthy older adults
Yang, Jingyun; Arfanakis, Konstantinos; Arvanitakis, Zoe; Leurgans, Sue E.; Turner, Arlener D.; Barnes, Lisa L.; Bennett, David A.; Buchman, Aron S.
2015-01-01
Objective: To test the hypothesis that physical activity modifies the association between white matter hyperintensity (WMH) burden and motor function in healthy older persons without dementia. Methods: Total daily activity (exercise and nonexercise physical activity) was measured for up to 11 days with actigraphy (Actical; Philips Respironics, Bend, OR) in 167 older adults without dementia participating in the Rush Memory and Aging Project. Eleven motor performances were summarized into a previously described global motor score. WMH volume was expressed as percent of intracranial volume. Linear regression models, adjusted for age, education, and sex, were performed with total WMH volume as the predictor and global motor score as the outcome. Terms for total daily physical activity and its interaction with WMH volume were then added to the model. Results: Higher WMH burden was associated with lower motor function (p = 0.006), and total daily activity was positively associated with motor function (p = 0.002). Total daily activity modified the association between WMH and motor function (p = 0.007). WMH burden was not associated with motor function in persons with high activity (90th percentile). By contrast, higher WMH burden remained associated with lower motor function in persons with average (50th percentile; estimate = −0.304, slope = −0.133) and low (10th percentile; estimate = −1.793, slope = −0.241) activity. Conclusions: Higher levels of physical activity may reduce the effect of WMH burden on motor function in healthy older adults. PMID:25762710
Nijholt, W; Jager-Wittenaar, H; Visser, M; van der Schans, C P; Hobbelen, J S M
2016-01-01
Previous research has demonstrated that being both physically active and adhering a healthy diet is associated with improved cognitive functioning; however, it remains unclear whether these factors act synergistically. We investigated the synergistic association of a healthy diet and being physically active with cognitive functioning. Cross-sectional study. Data from the Longitudinal Aging Study Amsterdam (LASA) were used. We analyzed data from 2,165 community dwelling adults who were aged 55-85 years, 56% of whom were female. Cognitive functioning was assessed by the Mini-Mental State Examination (MMSE), an MMSE score of >26 indicates good cognitive functioning. Physical activity was assessed by the LASA Physical Activity Questionnaire and was considered sufficient if the person engaged in moderately intense physical activity ≥ 20 min/day. A healthy diet score was based on the intake of fruit, vegetables and fish. Each of the food groups was assigned a score that ranged from 1 (well below the Dutch guideline for a healthy diet) to 4 (well above the Dutch guideline for a healthy diet), and the scores were aggregated to determine a healthy diet (healthy ≥ 9 points). Multiple logistic and linear regression analyses were used to examine the (synergistic) association among physical activity, a healthy diet and cognitive functioning. All analyses were adjusted for potential chronic diseases and lifestyle confounders. Of all of the participants, 25% were diagnosed with a cognitive impairment (MMSE ≤26), 80% were physically active and 41% had a healthy diet. Sixty three percent of the participants both adhered to a healthy diet and were physically active. Sufficient daily physical activity (OR=2.545 p<.001) and adherence to a healthy diet (OR=1.766 p=.002) were associated with good cognitive functioning. After adjusting for confounding factors, sufficient physical activity was not significantly related to cognitive functioning (p=.163); however adherence to a healthy diet remained significantly associated with good cognitive functioning (p=.017). No interaction among sufficient physical activity, healthy diet adherence and good cognitive functioning was observed (crude: p=.401, adjusted: p=.216). The results of this cross-sectional study indicate that adherence to a healthy diet is inde-pendently related to cognitive functioning. Being physically active does not modify this association. Furthermore, these two lifestyle factors do not synergistically relate to cognitive functioning.
Exergaming immediately enhances children's executive function.
Best, John R
2012-09-01
The current study examined an important aspect of experience--physical activity--that may contribute to children's executive function. The design attempted to tease apart 2 important aspects of children's exercise by examining the separate and combined effects of acute physical activity and cognitive engagement on an aspect of children's executive functioning. In a 2 × 2 within-subject experimental design, children (N = 33, 6 to 10 years old) completed activities that varied systematically in both physical activity (physically active video games versus sedentary video activities) and cognitive engagement (challenging and interactive video games versus repetitive video activities). Cognitive functioning, including executive function, was assessed after each activity by a modified flanker task (Rueda et al., 2004). Whereas cognitive engagement had no effect on any aspect of task performance, physical activity (i.e., exergaming) enhanced children's speed to resolve interference from conflicting visuospatial stimuli. Age comparisons indicated improvements with age in the accuracy of resolving interference and in overall response time. The results extend past research by showing more precisely how physical activity influences executive function and how this effect differs from the improvements that occur with development. PsycINFO Database Record (c) 2012 APA, all rights reserved.
What is the relation between fear of falling and physical activity in older adults?
Hornyak, Victoria; Brach, Jennifer S; Wert, David M; Hile, Elizabeth; Studenski, Stephanie; Vanswearingen, Jessie M
2013-12-01
To describe the association between fear of falling (FOF) and total daily activity in older adults. Cross-sectional observational study. Ambulatory clinical research training center. Community-dwelling older adults aged ≥64 years (N=78), who were independent in ambulation with or without an assistive device. Not applicable. FOF was defined by self-reported fear ratings using the Survey of Activities and Fear of Falling in the Elderly and self-reported fear status determined by response to the following question: Are you afraid of falling? Physical function was assessed using the Late Life Function and Disability Instrument. Physical activity was recorded using an accelerometer worn on the waist for 7 consecutive days, and mean daily counts of activity per minute were averaged over the 7-day period. Fear ratings were related to total daily activity (r=-.26, P=.02). The relation was not as strong as the relation of function and physical activity (r=.45, P<.001). When stratified by exercise status or functional status, fear was no longer related to total daily activity. Physical function explained 19% of the variance in physical activity, whereas the addition of fear status did not add to the explained variance in physical activity. FOF is related to total daily physical activity; however, FOF was not independently associated with physical activity when accounting for physical function. Some FOF may be reported as a limitation in function. Copyright © 2013 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Consistency of a lumbar movement pattern across functional activities in people with low back pain.
Marich, Andrej V; Hwang, Ching-Ting; Salsich, Gretchen B; Lang, Catherine E; Van Dillen, Linda R
2017-05-01
Limitation in function is a primary reason people with low back pain seek medical treatment. Specific lumbar movement patterns, repeated throughout the day, have been proposed to contribute to the development and course of low back pain. Varying the demands of a functional activity test may provide some insight into whether people display consistent lumbar movement patterns during functional activities. Our purpose was to examine the consistency of the lumbar movement pattern during variations of a functional activity test in people with low back pain and back-healthy people. 16 back-healthy adults and 32 people with low back pain participated. Low back pain participants were classified based on the level of self-reported functional limitations. Participants performed 5 different conditions of a functional activity test. Lumbar excursion in the early phase of movement was examined. The association between functional limitations and early phase lumbar excursion for each test condition was examined. People with low back pain and high levels of functional limitation demonstrated a consistent pattern of greater early phase lumbar excursion across test conditions (p<0.05). For each test condition, the amount of early phase lumbar excursion was associated with functional limitation (r=0.28-0.62). Our research provides preliminary evidence that people with low back pain adopt consistent movement patterns during the performance of functional activities. Our findings indicate that the lumbar spine consistently moves more readily into its available range in people with low back pain and high levels of functional limitation. How the lumbar spine moves during a functional activity may contribute to functional limitations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Functional Evolution of PLP-dependent Enzymes based on Active-Site Structural Similarities
Catazaro, Jonathan; Caprez, Adam; Guru, Ashu; Swanson, David; Powers, Robert
2014-01-01
Families of distantly related proteins typically have very low sequence identity, which hinders evolutionary analysis and functional annotation. Slowly evolving features of proteins, such as an active site, are therefore valuable for annotating putative and distantly related proteins. To date, a complete evolutionary analysis of the functional relationship of an entire enzyme family based on active-site structural similarities has not yet been undertaken. Pyridoxal-5’-phosphate (PLP) dependent enzymes are primordial enzymes that diversified in the last universal ancestor. Using the Comparison of Protein Active Site Structures (CPASS) software and database, we show that the active site structures of PLP-dependent enzymes can be used to infer evolutionary relationships based on functional similarity. The enzymes successfully clustered together based on substrate specificity, function, and three-dimensional fold. This study demonstrates the value of using active site structures for functional evolutionary analysis and the effectiveness of CPASS. PMID:24920327
Functional evolution of PLP-dependent enzymes based on active-site structural similarities.
Catazaro, Jonathan; Caprez, Adam; Guru, Ashu; Swanson, David; Powers, Robert
2014-10-01
Families of distantly related proteins typically have very low sequence identity, which hinders evolutionary analysis and functional annotation. Slowly evolving features of proteins, such as an active site, are therefore valuable for annotating putative and distantly related proteins. To date, a complete evolutionary analysis of the functional relationship of an entire enzyme family based on active-site structural similarities has not yet been undertaken. Pyridoxal-5'-phosphate (PLP) dependent enzymes are primordial enzymes that diversified in the last universal ancestor. Using the comparison of protein active site structures (CPASS) software and database, we show that the active site structures of PLP-dependent enzymes can be used to infer evolutionary relationships based on functional similarity. The enzymes successfully clustered together based on substrate specificity, function, and three-dimensional-fold. This study demonstrates the value of using active site structures for functional evolutionary analysis and the effectiveness of CPASS. © 2014 Wiley Periodicals, Inc.
Post optimization paradigm in maximum 3-satisfiability logic programming
NASA Astrophysics Data System (ADS)
Mansor, Mohd. Asyraf; Sathasivam, Saratha; Kasihmuddin, Mohd Shareduwan Mohd
2017-08-01
Maximum 3-Satisfiability (MAX-3SAT) is a counterpart of the Boolean satisfiability problem that can be treated as a constraint optimization problem. It deals with a conundrum of searching the maximum number of satisfied clauses in a particular 3-SAT formula. This paper presents the implementation of enhanced Hopfield network in hastening the Maximum 3-Satisfiability (MAX-3SAT) logic programming. Four post optimization techniques are investigated, including the Elliot symmetric activation function, Gaussian activation function, Wavelet activation function and Hyperbolic tangent activation function. The performances of these post optimization techniques in accelerating MAX-3SAT logic programming will be discussed in terms of the ratio of maximum satisfied clauses, Hamming distance and the computation time. Dev-C++ was used as the platform for training, testing and validating our proposed techniques. The results depict the Hyperbolic tangent activation function and Elliot symmetric activation function can be used in doing MAX-3SAT logic programming.
Fastenau, Annemieke; van Schayck, Onno C P; Gosselink, Rik; Aretz, Karin C P M; Muris, Jean W M
2013-12-01
In patients with moderate to severe chronic obstructive pulmonary disease (COPD) the six-minute walk distance reflects the functional exercise level for daily physical activity. It is unknown if this also applies to patients with mild to moderate COPD in primary care. To assess the relationship between functional exercise capacity and physical activity in patients with mild to moderate COPD. A cross-sectional study was performed in 51 patients with mild to moderate COPD in primary care. Functional exercise capacity was assessed by the six-minute walk test and physical activity was measured with an accelerometer-based activity monitor. Functional exercise capacity was close to normal values. However, the daily physical activity of the patients could be classified as 'sedentary' and 'low active'. No significant correlations were observed between six-minute walk distance (% predicted) and any of the physical activity variables (steps per day, movement intensity during walking, total active time, total walking time, physical activity level, and time spent in moderate physical activity). A discrepancy was found between functional exercise capacity and daily physical activity in patients with mild to moderate COPD recruited and assessed in primary care. We conclude that these variables represent two different concepts. Our results reinforce the importance of measuring daily physical activity in order to fine-tune treatment (i.e. focusing on enhancement of exercise capacity or behavioural change, or both).
Abraha, Abraham B.; Whalen, Margaret M.
2008-01-01
Destruction of tumor cells is a key function of NK cells. Previous studies have shown that tributyltin (TBT) can significantly reduce the lytic function of the human NK cells with accompanying increases in the phosphorylation (activation) states of the mitogen activated protein kinases (MAPKs), p44/42. The current studies examine the role of p44/42 activation in the TBT-induced reduction of NK-lytic function, by using MAPK kinase (MEK) inhibitors, PD98059 and U0126. A 1 h treatment with PD98059 or U0126 or both decreased the ability of NK cells to lyse K562 tumor cells. PD98059, U0126 or a combination of both inhibitors were able to completely block TBT-induced activation of p44/42. However, when p44/42 activation was blocked by the presence of PD98059, U0126, or the combination, subsequent exposure to TBT was still able to decrease the lytic function of NK cells. These results indicate that TBT-induced activation of p44/42 occurs via the activation of its upstream activator, MEK, and not by a TBT-induced inhibition of p44/42 phosphatase activity. Additionally, as lytic function was never completely blocked by MEK inhibitors, the results indicate that activation of p44/42 pathway is not solely responsible for the activation of lytic function of freshly isolated human NK cells. Finally, the results showed that TBT-induced activation of p44/42 is not solely responsible for the loss of lytic function. PMID:18989867
Aadland, Katrine N; Ommundsen, Yngvar; Aadland, Eivind; Brønnick, Kolbjørn S; Lervåg, Arne; Resaland, Geir K; Moe, Vegard F
2017-01-01
Changes in cognitive function induced by physical activity have been proposed as a mechanism for the link between physical activity and academic performance. The aim of this study was to investigate if executive function mediated the prospective relations between indices of physical activity and academic performance in a sample of 10-year-old Norwegian children. The study included 1,129 children participating in the Active Smarter Kids (ASK) trial, followed over 7 months. Structural equation modeling (SEM) with a latent variable of executive function (measuring inhibition, working memory, and cognitive flexibility) was used in the analyses. Predictors were objectively measured physical activity, time spent sedentary, aerobic fitness, and motor skills. Outcomes were performance on national tests of numeracy, reading, and English (as a second language). Generally, indices of physical activity did not predict executive function and academic performance. A modest mediation effect of executive function was observed for the relation between motor skills and academic performance. Trial registration: Clinicaltrials.gov registry, trial registration number: NCT02132494.
Aadland, Katrine N.; Ommundsen, Yngvar; Aadland, Eivind; Brønnick, Kolbjørn S.; Lervåg, Arne; Resaland, Geir K.; Moe, Vegard F.
2017-01-01
Changes in cognitive function induced by physical activity have been proposed as a mechanism for the link between physical activity and academic performance. The aim of this study was to investigate if executive function mediated the prospective relations between indices of physical activity and academic performance in a sample of 10-year-old Norwegian children. The study included 1,129 children participating in the Active Smarter Kids (ASK) trial, followed over 7 months. Structural equation modeling (SEM) with a latent variable of executive function (measuring inhibition, working memory, and cognitive flexibility) was used in the analyses. Predictors were objectively measured physical activity, time spent sedentary, aerobic fitness, and motor skills. Outcomes were performance on national tests of numeracy, reading, and English (as a second language). Generally, indices of physical activity did not predict executive function and academic performance. A modest mediation effect of executive function was observed for the relation between motor skills and academic performance. Trial registration: Clinicaltrials.gov registry, trial registration number: NCT02132494. PMID:28706500
Multifunctional and biologically active matrices from multicomponent polymeric solutions
NASA Technical Reports Server (NTRS)
Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor)
2010-01-01
The present invention relates to a biologically active functionalized electrospun matrix to permit immobilization and long-term delivery of biologically active agents. In particular the invention relates to a functionalized polymer matrix comprising a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin. Examples of active molecules that may be used with the multicomponent polymer of the invention include, for example, a drug, a biopolymer, for example a growth factor, a protein, a peptide, a nucleotide, a polysaccharide, a biological macromolecule or the like. The invention is further directed to the formation of functionalized crosslinked matrices, such as hydrogels, that include at least one functionalized compatibilizing polymer capable of assembly.
Nawrocka, Agnieszka; Mynarski, Władysław; Cholewa, Jarosław
2017-12-23
Physical activity is an important factor in maintaining the health and functional fitness of elderly people. The aim of the study was to determine the number of senior women meeting the physical activity guidelines, and their level of functional fitness in comparison to women who are not sufficiently physically active. The study involved 61 women, aged 60-75. Physical activity was monitored on seven consecutive days of the week, using a triaxial accelerometer ActiGraph GT3X. Results of the assessment of physical activity were verified against the Global Recommendations of Physical Activity for Health. The Senior Fitness Test (Fullerton Test) was used to evaluate functional fitness. In the studied group, 36.1% achieved the recommended level of physical activity. All those examined mainly undertook physical activity of low intensity. Vigorous physical activity during the week was noted in only 6 seniors. Women who met the recommendations of physical activity achieved significantly better results in test trials, e.g. Chair Stands, Up and Go, Six Minute Step Test. Adherence to physical activity guidelines was associated with better functional fitness of older women. However, less than half of the examined seniors met the Global Recommendations on Physical Activity for Health.
Busk, Peter Kamp; Lange, Lene
2013-06-01
Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.
Funahashi, Shintaro
2014-01-01
Prefrontal neurons exhibit saccade-related activity and pre-saccadic memory-related activity often encodes the directions of forthcoming eye movements, in line with demonstrated prefrontal contribution to flexible control of voluntary eye movements. However, many prefrontal neurons exhibit post-saccadic activity that is initiated well after the initiation of eye movement. Although post-saccadic activity has been observed in the frontal eye field, this activity is thought to be a corollary discharge from oculomotor centers, because this activity shows no directional tuning and is observed whenever the monkeys perform eye movements regardless of goal-directed or not. However, prefrontal post-saccadic activities exhibit directional tunings similar as pre-saccadic activities and show context dependency, such that post-saccadic activity is observed only when monkeys perform goal-directed saccades. Context-dependency of prefrontal post-saccadic activity suggests that this activity is not a result of corollary signals from oculomotor centers, but contributes to other functions of the prefrontal cortex. One function might be the termination of memory-related activity after a behavioral response is done. This is supported by the observation that the termination of memory-related activity coincides with the initiation of post-saccadic activity in population analyses of prefrontal activities. The termination of memory-related activity at the end of the trial ensures that the subjects can prepare to receive new and updated information. Another function might be the monitoring of behavioral performance, since the termination of memory-related activity by post-saccadic activity could be associated with informing the correctness of the response and the termination of the trial. However, further studies are needed to examine the characteristics of saccade-related activities in the prefrontal cortex and their functions in eye movement control and a variety of cognitive functions. PMID:25071482
Multifunctional and biologically active matrices from multicomponent polymeric solutions
NASA Technical Reports Server (NTRS)
Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor); Rabolt, John (Inventor); Casper, Cheryl (Inventor)
2012-01-01
A functionalized electrospun matrix for the controlled-release of biologically active agents, such as growth factors, is presented. The functionalized matrix comprises a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin.
Ru, Xiaojuan; Dai, Hong; Jiang, Bin; Li, Ninghua; Zhao, Xingquan; Hong, Zhen; He, Li; Wang, Wenzhi
2017-07-01
The aim of this study was to evaluate the effectiveness of a community-based rehabilitation appropriate technique (CRAT) intervention program in increasing rehabilitation participation and improving functional recovery of stroke survivors. This study followed a quasi-experimental design. In each of 5 centers servicing approximately 50,000 individuals, 2 communities were designated as either the intervention or control community. A CRAT intervention program, including 2-year rehabilitation education and 3-month CRAT treatment, was regularly implemented in the intervention communities, whereas there was no special intervention in the control community. Two sampling surveys, at baseline and after intervention, were administered to evaluate the rehabilitation activity undertaken. In intervention communities, stroke survivor's motor function, daily activity, and social activity were evaluated pretreatment and posttreatment, using the Fugl-Meyer Motor Function Assessment, Barthel index, and Social Functional Activities Questionnaire. The proportion of individuals participating in rehabilitation-related activity was increased significantly (P < 0.05) in intervention communities, as compared with control communities. In intervention communities, the patients' Fugl-Meyer Motor Function Assessment, Barthel index, and Social Functional Activities Questionnaire scores were significantly improved after rehabilitation (P < 0.05) across all ages and disease courses, except for the FAQ scores in patients younger than 50 years (P > 0.05). Community-based rehabilitation appropriate technique increases rehabilitation participation rates and enhances motor function, daily activity, and social activity of stroke survivors.
Code of Federal Regulations, 2010 CFR
2010-04-01
... cash management functions; (ii) Procurement and purchasing functions; (iii) Property management functions; (iv) Personnel management functions; (v) Payroll functions; (vi) Coordinating the resolution of... for official business in carrying out administrative activities or the overall management of the WIA...
Kuk, Nienke O; den Ouden, Mirre; Zijlstra, G A Rixt; Hamers, Jan P H; Kempen, Gertrudis I J M; Bours, Gerrie J J W
2017-01-14
Nursing home residents are mainly inactive. Nursing staff can encourage residents to perform functional activities during daily care activities. This study examines 1) the extent to which nursing staff perceive that they encourage functional activity in nursing home residents and 2) the associations between these nursing behaviors and professional characteristics, contextual factors, and information-seeking behaviors. In this cross-sectional study, 368 registered nurses and certified nurse assistants, working in somatic and psychogeriatric wards of forty-one nursing homes throughout the Netherlands participated. Self-reported data were collected with a questionnaire, comprising the MAINtAIN-behaviors, which assesses the extent to which nursing staff encourage functional activities, including different activities of daily living (ADL), household activities, and miscellaneous encouraging activities (e.g., discouraging informal caregivers from taking over activities residents can do themselves). Additional data collected included professional characteristics (e.g., age), contextual factors (e.g., ward type), and information-seeking behaviors (e.g., reading professional journals). Descriptive statistics were used to determine the extent to which functional activities were encouraged. Hierarchical linear regression analyses were performed to determine the associations between the encouragement of functional activities and other factors. Nursing staff perceived that household activities (mean 4.1 (scale range 1-9), SD 1.9) were less often encouraged than ADL (mean 6.9, SD 1.2) or miscellaneous activities (mean 6.7, SD 1.5). The percentage of nursing staff stating that different household activities, ADL, or miscellaneous activities were almost always encouraged ranged from 11 to 45%, 41 to 86%, and 50 to 83% per activity, respectively. The extent to which these activities were encouraged differed for some of the professional characteristics, contextual factors, or information-seeking behaviors, but no consistent pattern in associations emerged. According to nursing staff, household activities are not as often encouraged as ADL or miscellaneous activities. Professional characteristics, contextual factors, and information-seeking behaviors are not consistently associated with the encouragement of functional activity. Nursing staff should also focus on improving the encouragement of household activities. Future research could examine the role of other factors in encouraging functional activity, such as experienced barriers, and assess to what extent the perception of nursing staff corresponds with their actual behavior.
48 CFR 1852.237-73 - Release of sensitive information.
Code of Federal Regulations, 2012 CFR
2012-10-01
... that support management activities and administrative functions. To gain access to this sensitive... sensitive or privileged. (b) In accomplishing management activities and administrative functions, NASA relies heavily on the support of various service providers. To support NASA activities and functions...
48 CFR 1852.237-73 - Release of sensitive information.
Code of Federal Regulations, 2014 CFR
2014-10-01
... that support management activities and administrative functions. To gain access to this sensitive... sensitive or privileged. (b) In accomplishing management activities and administrative functions, NASA relies heavily on the support of various service providers. To support NASA activities and functions...
48 CFR 1852.237-73 - Release of sensitive information.
Code of Federal Regulations, 2011 CFR
2011-10-01
... that support management activities and administrative functions. To gain access to this sensitive... sensitive or privileged. (b) In accomplishing management activities and administrative functions, NASA relies heavily on the support of various service providers. To support NASA activities and functions...
48 CFR 1852.237-73 - Release of sensitive information.
Code of Federal Regulations, 2013 CFR
2013-10-01
... that support management activities and administrative functions. To gain access to this sensitive... sensitive or privileged. (b) In accomplishing management activities and administrative functions, NASA relies heavily on the support of various service providers. To support NASA activities and functions...
48 CFR 1852.237-73 - Release of sensitive information.
Code of Federal Regulations, 2010 CFR
2010-10-01
... that support management activities and administrative functions. To gain access to this sensitive... sensitive or privileged. (b) In accomplishing management activities and administrative functions, NASA relies heavily on the support of various service providers. To support NASA activities and functions...
Velykopols'ka, O Iu; Man'ko, B O; Man'ko, V V
2012-01-01
Using Clark oxygen electrode, dependence of mitochondrial functions on Ca(2+)-release channels activity of Chironomus plumosus L. larvae salivary glands suspension was investigated. Cells were ATP-permeabilized in order to enable penetration of exogenous oxidative substrates. Activation of plasmalemmal P2X-receptors (as well as P2Y-receptors) per se does not modify the endogenous respiration of salivary gland suspension. That is, Ca(2+)-influx from extracellular medium does not influence functional activity of mitochondria, although they are located along the basal part of the plasma membrane. Activation of RyRs intensifies endogenous respiration and pyruvate-malate-stimulated respiration, but not succinate-stimulated respiration. Neither activation of IP3Rs (via P2Y-receptors activation), nor their inhibition alters endogenous respiration. Nevertheless, IP3Rs inhibition by 2-APB intensifies succinate-stimulated respiration. All abovementioned facts testify that Ca2+, released from stores via channels, alters functional activity of mitochondria, and undoubtedly confirm the existence of endoplasmic-mitochondrial Ca(2+)-functional unit in Ch. plumosus larvae salivary glands secretory cells. In steady state of endoplasmic-mitochondrial Ca(2+)-functional unit the spontaneous activity of IP3Rs is observed; released through IP3Rs, Ca2+ is accumulated in mitochondria via uniporter and modulates oxidative processes. Activation of RyRs induces the transition of endoplasmic-mitochondrial Ca(2+)-functional unit to the active state, which is required to intensify cell respiration and oxidative phosphorylation. As expected, the transition of endoplasmic-mitochondrial Ca(2+)-functional unit to inactivated state (i. e. inhibition of Ca(2+)-release channels at excessive [Ca2+]i) limits the duration of signal transduction, has protective nature and prevents apoptosis.
Mace Firebaugh, Casey; Moyes, Simon; Jatrana, Santosh; Rolleston, Anna; Kerse, Ngaire
2018-01-18
The relationship between physical activity, function, and mortality is not established in advanced age. Physical activity, function, and mortality were followed in a cohort of Māori and non-Māori adults living in advanced age for a period of six years. Generalised Linear regression models were used to analyse the association between physical activity and NEADL while Kaplan-Meier survival analysis, and Cox-proportional hazard models were used to assess the association between the physical activity and mortality. The Hazard Ratio for mortality for those in the least active physical activity quartile was 4.1 for Māori and 1.8 for non- Māori compared to the most active physical activity quartile. There was an inverse relationship between physical activity and mortality, with lower hazard ratios for mortality at all levels of physical activity. Higher levels of physical activity were associated with lower mortality and higher functional status in advanced aged adults.
A Novel Higher Order Artificial Neural Networks
NASA Astrophysics Data System (ADS)
Xu, Shuxiang
2010-05-01
In this paper a new Higher Order Neural Network (HONN) model is introduced and applied in several data mining tasks. Data Mining extracts hidden patterns and valuable information from large databases. A hyperbolic tangent function is used as the neuron activation function for the new HONN model. Experiments are conducted to demonstrate the advantages and disadvantages of the new HONN model, when compared with several conventional Artificial Neural Network (ANN) models: Feedforward ANN with the sigmoid activation function; Feedforward ANN with the hyperbolic tangent activation function; and Radial Basis Function (RBF) ANN with the Gaussian activation function. The experimental results seem to suggest that the new HONN holds higher generalization capability as well as abilities in handling missing data.
Fu, Chang; Li, Zhen; Mao, Zongfu
2018-01-30
Participation in social activities is one of important factors for older adults' health. The present study aims to examine the cross-sectional association between social activities and cognitive function among Chinese elderly. A total of 8966 individuals aged 60 and older from the 2015 China Health and Retirement Longitudinal Study were obtained for this study. Telephone interviews of cognitive status, episodic memory, and visuospatial abilities were assessed by questionnaire. We used the sum of all three of the above measures to represent the respondent's cognitive status as a whole. Types and frequencies of participation in social groups were used to measure social activities. Multiple linear regression analysis was used to explore the relationship between social activities and cognitive function. After adjustment for demographics, smoking, drinking, depression, hypertension, diabetes, basic activities of daily living, instrumental activities of daily living, and self-rated health, multiple linear regression analysis revealed that interaction with friends, participating in hobby groups, and sports groups were associated with better cognitive function among both men and women ( p < 0.05); doing volunteer work was associated with better cognitive function among women but not among men ( p < 0.05). These findings suggest that there is a cross-sectional association between participation in social activities and cognitive function among Chinese elderly. Longitudinal studies are needed to examine the effects of social activities on cognitive function.
Fu, Chang; Li, Zhen; Mao, Zongfu
2018-01-01
Participation in social activities is one of important factors for older adults’ health. The present study aims to examine the cross-sectional association between social activities and cognitive function among Chinese elderly. A total of 8966 individuals aged 60 and older from the 2015 China Health and Retirement Longitudinal Study were obtained for this study. Telephone interviews of cognitive status, episodic memory, and visuospatial abilities were assessed by questionnaire. We used the sum of all three of the above measures to represent the respondent’s cognitive status as a whole. Types and frequencies of participation in social groups were used to measure social activities. Multiple linear regression analysis was used to explore the relationship between social activities and cognitive function. After adjustment for demographics, smoking, drinking, depression, hypertension, diabetes, basic activities of daily living, instrumental activities of daily living, and self-rated health, multiple linear regression analysis revealed that interaction with friends, participating in hobby groups, and sports groups were associated with better cognitive function among both men and women (p < 0.05); doing volunteer work was associated with better cognitive function among women but not among men (p < 0.05). These findings suggest that there is a cross-sectional association between participation in social activities and cognitive function among Chinese elderly. Longitudinal studies are needed to examine the effects of social activities on cognitive function. PMID:29385773
Hagenbeek, R E; Rombouts, S A R B; Veltman, D J; Van Strien, J W; Witter, M P; Scheltens, P; Barkhof, F
2007-10-01
Changes in brain activation as a function of continuous multiparametric word recognition have not been studied before by using functional MR imaging (fMRI), to our knowledge. Our aim was to identify linear changes in brain activation and, what is more interesting, nonlinear changes in brain activation as a function of extended word repetition. Fifteen healthy young right-handed individuals participated in this study. An event-related extended continuous word-recognition task with 30 target words was used to study the parametric effect of word recognition on brain activation. Word-recognition-related brain activation was studied as a function of 9 word repetitions. fMRI data were analyzed with a general linear model with regressors for linearly changing signal intensity and nonlinearly changing signal intensity, according to group average reaction time (RT) and individual RTs. A network generally associated with episodic memory recognition showed either constant or linearly decreasing brain activation as a function of word repetition. Furthermore, both anterior and posterior cingulate cortices and the left middle frontal gyrus followed the nonlinear curve of the group RT, whereas the anterior cingulate cortex was also associated with individual RT. Linear alteration in brain activation as a function of word repetition explained most changes in blood oxygen level-dependent signal intensity. Using a hierarchically orthogonalized model, we found evidence for nonlinear activation associated with both group and individual RTs.
2017-01-01
Sufficient and regular physical activity is considered a protective factor, reducing the onset of secondary disability conditions in adolescents with chronic diseases and functional limitations. The aim of this study was to explore whether participation in organized sport may be associated to higher levels of physical activity in adolescents with functional limitations, based on a national representative sample. Data from the Health Behaviour in School-aged Children (HBSC) study collected in Finland from two data collection rounds (2002 and 2010) were conducted and pooled from adolescents aged between 13 and 15 years old with functional limitations (n = 1041). Differences in self-reported physical activity over the past week and participation in organized sport activity were analysed for each function. Overall, four in ten (n = 413) participated in organized sport and were significantly (p < 0.001) more physically active (mean = 4.92 days, SD = 1.81) than their non-participating (mean = 3.29, SD = 1.86) peers with functional limitations. Despite low population prevalence, adolescents with epilepsy or visual impairments were the least active if they were not participating in organized sport, yet were the most active if they were involved in organized sport. Participating in organized sport appears to be an important factor promoting resources for maintaining recommended levels of physical activity in Finnish adolescents with functional limitations. PMID:29910441
Panneton, Vincent; Nath, Apurba; Sader, Fadi; Delaunay, Nathalie; Pelletier, Ariane; Maier, Dominic; Oh, Karen; Hipfner, David R
2015-08-21
Protein kinases carry out important functions in cells both by phosphorylating substrates and by means of regulated non-catalytic activities. Such non-catalytic functions have been ascribed to many kinases, including some members of the Ste20 family. The Drosophila Ste20 kinase Slik phosphorylates and activates Moesin in developing epithelial tissues to promote epithelial tissue integrity. It also functions non-catalytically to promote epithelial cell proliferation and tissue growth. We carried out a structure-function analysis to determine how these two distinct activities of Slik are controlled. We find that the conserved C-terminal coiled-coil domain of Slik, which is necessary and sufficient for apical localization of the kinase in epithelial cells, is not required for Moesin phosphorylation but is critical for the growth-promoting function of Slik. Slik is auto- and trans-phosphorylated in vivo. Phosphorylation of at least two of three conserved sites in the activation segment is required for both efficient catalytic activity and non-catalytic signaling. Slik function is thus dependent upon proper localization of the kinase via the C-terminal coiled-coil domain and activation via activation segment phosphorylation, which enhances both phosphorylation of substrates like Moesin and engagement of effectors of its non-catalytic growth-promoting activity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Pituitary adenylate cyclase-activating polypeptide: a novel peptide with protean implications.
Pisegna, Joseph R; Oh, David S
2007-02-01
The purpose of this review is to highlight the importance of pituitary adenylate cyclase-activating polypeptide in physiological processes and to describe how this peptide is becoming increasingly recognized as having a major role in the body. Since its discovery in 1989, investigators have sought to determine the site of biological activity and the function of pituitary adenylate cyclase-activating polypeptide in maintaining homeostasis. Since its discovery, pituitary adenylate cyclase-activating polypeptide appears to play an important role in the regulation of processes within the central nervous system and gastrointestinal tract, as well in reproductive biology. Pituitary adenylate cyclase-activating polypeptide has been shown to regulate tumor cell growth and to regulate immune function through its effects on T lympocytes. These discoveries suggest the importance of pituitary adenylate cyclase-activating polypeptide in neuronal development, neuronal function, gastrointestinal tract function and reproduction. Future studies will examine more closely the role of pituitary adenylate cyclase-activating polypeptide in regulation of malignantly transformed cells, as well as in regulation of immune function.
van der Niet, Anneke G; Smith, Joanne; Scherder, Erik J A; Oosterlaan, Jaap; Hartman, Esther; Visscher, Chris
2015-11-01
While there is some evidence that aerobic fitness is positively associated with executive functioning in children, evidence for a relation between children's daily physical activity and their executive functioning is limited. The objective was to examine associations between objectively measured daily physical activity (total volume, sedentary behavior, moderate to vigorous physical activity) and executive functioning in children. Cross-sectional. Eighty primary school children (36 boys, 44 girls) aged 8-12 years old participated in the study. Physical activity was measured using accelerometers. Executive functions measured included inhibition (Stroop test), working memory (Visual Memory Span test), cognitive flexibility (Trailmaking test), and planning (Tower of London). Total volume of physical activity, time spent in sedentary behavior and moderate to vigorous physical activity were calculated and related to performance on executive functioning. More time spent in sedentary behavior was related to worse inhibition (r = -0.24). A higher total volume of physical activity was associated with better planning ability, as reflected by both a higher score on the Tower of London (r = 0.24) and a shorter total execution time (r = -0.29). Also, a significant moderate correlation was found between time spent in moderate to vigorous physical activity and the total execution time of the Tower of London (r = -0.29). Children should limit time spent in sedentary behavior, and increasing their total physical activity. Total volume of physical activity, which consisted mostly of light intensity physical activity, is related to executive functioning. This opens up new possibilities to explore both the quantity and quality of physical activity in relation to cognition in children. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Furlanetto, Karina C.; Pinto, Isabela F. S.; Sant’Anna, Thais; Hernandes, Nidia A.; Pitta, Fabio
2016-01-01
ABSTRACT Objective To compare the profiles of patients with chronic obstructive pulmonary disease (COPD) considered physically active or inactive according to different classifications of the level of physical activity in daily life (PADL). Method Pulmonary function, dyspnea, functional status, body composition, exercise capacity, respiratory and peripheral muscle strength, and presence of comorbidities were assessed in 104 patients with COPD. The level of PADL was quantified with a SenseWear Armband activity monitor. Three classifications were used to classify the patients as physically active or inactive: 30 minutes of activity/day with intensity >3.2 METs, if age ≥65 years, and >4 METs, if age <65 years; 30 minutes of activity/day with intensity >3.0 METs, regardless of patient age; and 80 minutes of activity/day with intensity >3.0 METs, regardless of patient age. Results In all classifications, when compared with the inactive group, the physically active group had better values of anthropometric variables (higher fat-free mass, lower body weight, body mass index and fat percentage), exercise capacity (6-minute walking distance), lung function (forced vital capacity) and functional status (personal care domain of the London Chest Activity of Daily Living). Furthermore, patients classified as physically active in two classifications also had better peripheral and expiratory muscle strength, airflow obstruction, functional status, and quality of life, as well as lower prevalence of heart disease and mortality risk. Conclusion In all classification methods, physically active patients with COPD have better exercise capacity, lung function, body composition, and functional status compared to physically inactive patients. PMID:27683835
Methodology for the systems engineering process. Volume 1: System functional activities
NASA Technical Reports Server (NTRS)
Nelson, J. H.
1972-01-01
Systems engineering is examined in terms of functional activities that are performed in the conduct of a system definition/design, and system development is described in a parametric analysis that combines functions, performance, and design variables. Emphasis is placed on identification of activities performed by design organizations, design specialty groups, as well as a central systems engineering organizational element. Identification of specific roles and responsibilities for doing functions, and monitoring and controlling activities within the system development operation are also emphasized.
Holstila, A; Mänty, M; Rahkonen, O; Lahelma, E; Lahti, J
2017-12-01
Functioning will be an increasingly important issue in Finland over the coming decades as the proportion of the population aged 65 and older is growing significantly. However, the associations between changes in physical activity and subsequent health functioning are poorly understood. The aim of this study was to examine how changes in physical activity relate to concurrent and prospective levels of health functioning. Cohort data from the Helsinki Health Study were used. Phase 1 (n = 8960, response rate 67%, 80% women) was conducted among 40- to 60-year-old employees of the City of Helsinki in 2000-2002, phase 2 in 2007 (n = 7332, response rate 83%), and phase 3 in 2012 (n = 6814, response rate 79%). Linear mixed models were used as the main statistical method. Increasing physical activity was associated with higher concurrent and prospective levels of physical health functioning, whereas decreasing activity was associated with lower levels of physical health functioning. The associations were stronger with physical than with mental health functioning. Promoting physical activity among aging people may help to maintain their level of health functioning. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Spiritual activity is associated with better cognitive function in old age.
Fung, A W T; Lam, L C W
2013-09-01
This cross-sectional study aimed to explore the association between late-life spiritual activity participation and cognitive function in older Chinese adults in Hong Kong. Participants aged 60 years or older without clinical dementia or major psychiatric disorders were recruited. Dementia severity and global cognitive function were assessed using the Clinical Dementia Rating and Cantonese version of the Mini-Mental State Examination, respectively. Cognitive performance was measured using 10-minute delayed recall, the Category Verbal Fluency Test, Visual Aural Digit Span Test, and Modified Card Sorting Test. Psychological status was assessed using the Chinese version of the Purpose in Life scale. Activities participated in were categorised into 6 domains of physical, cognitive, social, prosocial, spiritual, and recreational activities. A total of 380 participants were enrolled. Bivariate correlation showed that the composite score of cognitive function was positively correlated with aerobic exercise (r = 0.14; p = 0.01), cognitive activity (r = 0.30; p < 0.001), and spiritual activity (r = 0.16; p = 0.002). Multiple linear regression suggested that frequent participation in cognitive activity (B = 0.87, beta = 0.22; 95% confidence interval [CI] = 0.52-1.25 and p < 0.001) and spiritual activity (B = 0.45, beta = 0.11; 95% CI = 0.13-0.76 and p = 0.01) were associated with better cognitive function after controlling for age and years of education. Engagement in spiritual activity may benefit cognitive function in old age. Longitudinal studies are recommended to further examine the causal relationship of spiritual activity and cognitive function.
Functional assessment in mental health: lessons from occupational therapy
Rogers, Joan C.; Holm, Margo B.
2016-01-01
Occupational therapists have been conducting functional assessments since World War I, and this accumulated experience has taught us several critical lessons. First, a comprehensive profile of a patient's functioning requires multiple assessment methods. Second, assessment content and measurement constructs must change with the times. Third, technology can enhance and extend functional assessment. Fourth, performance-based assessments of everyday activities can also be used to measure body functions/impairments. However, while deconstructing activities into body functions/impairments is possible, the results do not reflect patients' abilities to integrate the cognitive, motor, sensory and affective functions necessary to complete a complex activity. Finally, the differential complexity of everyday activities that a patient can master or successfully complete can also provide a ruler with which to measure progress. PMID:27489454
Quantitative Biology of Exercise-Induced Signal Transduction Pathways.
Liu, Timon Cheng-Yi; Liu, Gang; Hu, Shao-Juan; Zhu, Ling; Yang, Xiang-Bo; Zhang, Quan-Guang
2017-01-01
Exercise is essential in regulating energy metabolism. Exercise activates cellular, molecular, and biochemical pathways with regulatory roles in training response adaptation. Among them, endurance/strength training of an individual has been shown to activate its respective signal transduction pathways in skeletal muscle. This was further studied from the viewpoint of quantitative difference (QD). For the mean values, [Formula: see text], of two sets of data, their QD is defined as [Formula: see text] ([Formula: see text]). The function-specific homeostasis (FSH) of a function of a biosystem is a negative-feedback response of the biosystem to maintain the function-specific conditions inside the biosystem so that the function is perfectly performed. A function in/far from its FSH is called a normal/dysfunctional function. A cellular normal function can resist the activation of other signal transduction pathways so that there are normal function-specific signal transduction pathways which full activation maintains the normal function. An acute endurance/strength training may be dysfunctional, but its regular training may be normal. The normal endurance/strength training of an individual may resist the activation of other signal transduction pathways in skeletal muscle so that there may be normal endurance/strength training-specific signal transduction pathways (NEPs/NSPs) in skeletal muscle. The endurance/strength training may activate NSPs/NEPs, but the QD from the control is smaller than 0.80. The simultaneous activation of both NSPs and NEPs may enhance their respective activation, and the QD from the control is larger than 0.80. The low level laser irradiation pretreatment of rats may promote the activation of NSPs in endurance training skeletal muscle. There may be NEPs/NSPs in skeletal muscle trained by normal endurance/strength training.
Building an Understanding of Functions: A Series of Activities for Pre-Calculus
ERIC Educational Resources Information Center
Carducci, Olivia M.
2008-01-01
Building block toys can be used to illustrate various concepts connected with functions including graphs and rates of change of linear and exponential functions, piecewise functions, and composition of functions. Five brief activities suitable for a pre-calculus course are described.
Physical activity interventions and children's mental function: An introduction and overview
Tomporowski, Phillip D.; Lambourne, Kate; Okumura, Michelle S.
2011-01-01
Background This review provides a historical overview of physical activity interventions designed by American educators and an evaluation of research that has assessed the effects of exercise on children's mental function. Method Historical descriptions of the emergence of American physical education doctrine throughout the 20th century were evaluated. Prior reviews of studies that assessed the effects of single acute bouts of exercise and the effects of chronic exercise training on children's mental function were examined and the results of recent studies were summarized. Results Physical activity interventions designed for American children have reflected two competing views: activities should promote physical fitness and activities should promote social, emotional, and intellectual development. Research results indicate that exercise fosters the emergence of children's mental function; particularly executive functioning. The route by which physical activity impacts mental functioning is complex and is likely moderated by several variables, including physical fitness level, health status, and numerous psycho-social factors. Conclusion Physical activity interventions for children should be designed to meet multiple objectives; e.g., optimize physical fitness, promote health-related behaviors that offset obesity, and facilitate mental development. PMID:21420981
Hall, Peter A; Zehr, Christopher; Paulitzki, Jeffrey; Rhodes, Ryan
2014-08-01
Implementation intentions are effective for enhancing physical activity, but it is unknown how well these effects extend to older adults and/or are modified by cognitive variables. Our objective is to examine (1) the efficacy of an implementation intentions intervention for physical activity in older adult women and (2) to examine the moderating effects of executive function. Participants (N = 75, M age = 73.72) completed measures of executive function and were randomly assigned to weekly implementation intentions for physical activity (experimental condition), implementation intentions for an unrelated behavior (control condition), or no treatment. Baseline activity was measured by accelerometer and self-report; follow-up activity was measured by weekly self-report. Findings indicated a significant treatment effect for the experimental condition and a treatment by executive function interaction. Specifically, participants with relatively stronger executive function benefited most from the experimental intervention. Implementation intentions are effective for enhancing physical activity among older adult women, and the effects may be especially pronounced for those with relatively stronger executive function.
Integrating research, clinical care, and education in academic health science centers.
King, Gillian; Thomson, Nicole; Rothstein, Mitchell; Kingsnorth, Shauna; Parker, Kathryn
2016-10-10
Purpose One of the major issues faced by academic health science centers (AHSCs) is the need for mechanisms to foster the integration of research, clinical, and educational activities to achieve the vision of evidence-informed decision making (EIDM) and optimal client care. The paper aims to discuss this issue. Design/methodology/approach This paper synthesizes literature on organizational learning and collaboration, evidence-informed organizational decision making, and learning-based organizations to derive insights concerning the nature of effective workplace learning in AHSCs. Findings An evidence-informed model of collaborative workplace learning is proposed to aid the alignment of research, clinical, and educational functions in AHSCs. The model articulates relationships among AHSC academic functions and sub-functions, cross-functional activities, and collaborative learning processes, emphasizing the importance of cross-functional activities in enhancing collaborative learning processes and optimizing EIDM and client care. Cross-functional activities involving clinicians, researchers, and educators are hypothesized to be a primary vehicle for integration, supported by a learning-oriented workplace culture. These activities are distinct from interprofessional teams, which are clinical in nature. Four collaborative learning processes are specified that are enhanced in cross-functional activities or teamwork: co-constructing meaning, co-learning, co-producing knowledge, and co-using knowledge. Practical implications The model provides an aspirational vision and insight into the importance of cross-functional activities in enhancing workplace learning. The paper discusses the conceptual and empirical basis to the model, its contributions and limitations, and implications for AHSCs. Originality/value The model's potential utility for health care is discussed, with implications for organizational culture and the promotion of cross-functional activities.
A method for measuring quality of life through subjective weighting of functional status.
Stineman, Margaret G; Wechsler, Barbara; Ross, Richard; Maislin, Greg
2003-04-01
To apply a new tool to understand the quality of life (QOL) implications of patients' functional status. Results from the Features-Resource Trade-Off Game were used to form utility weights by ranking functional activities by the relative value of achieving independence in each activity compared with all other component activities. The utility weights were combined with patients' actual levels of performance across the same activities to produce QOL-weighted functional status scores and to form "value rulers" to order activities by perceived importance. Persons with severe disabilities living in the community and clinicians practicing in various rehabilitation disciplines. Two panels of 5 consumers with disabilities and 2 panels of 5 rehabilitation clinicians. The 4 panels played the Features Resource Trade-Off Game by using the FIMT(TM) instrument definitions. Utility weights for each of the 18 FIM items, QOL-weighted FIM scores, and value rulers. All 4 panels valued the achievement of independence in cognitive and communication activities more than independence in physical activities. Consequently, the unweighted FIM scores of patients who have severe physical disabilities but relatively intact cognitive skills will underestimate QOL, while inflating QOL in those with low levels of independence in cognition and communication but higher physical function. Independence in some activities is more valued than in others; thus, 2 people with the same numeric functional status score could experience very different QOL. QOL-weighted functional status scores translate objectively measured functional status into its subjective meaning. This new technology for measuring subjective function-related QOL has a variety of applications to clinical, educational, and research practices.
Correspondence of the brain's functional architecture during activation and rest
Smith, Stephen M.; Fox, Peter T.; Miller, Karla L.; Glahn, David C.; Fox, P. Mickle; Mackay, Clare E.; Filippini, Nicola; Watkins, Kate E.; Toro, Roberto; Laird, Angela R.; Beckmann, Christian F.
2009-01-01
Neural connections, providing the substrate for functional networks, exist whether or not they are functionally active at any given moment. However, it is not known to what extent brain regions are continuously interacting when the brain is “at rest.” In this work, we identify the major explicit activation networks by carrying out an image-based activation network analysis of thousands of separate activation maps derived from the BrainMap database of functional imaging studies, involving nearly 30,000 human subjects. Independently, we extract the major covarying networks in the resting brain, as imaged with functional magnetic resonance imaging in 36 subjects at rest. The sets of major brain networks, and their decompositions into subnetworks, show close correspondence between the independent analyses of resting and activation brain dynamics. We conclude that the full repertoire of functional networks utilized by the brain in action is continuously and dynamically “active” even when at “rest.” PMID:19620724
Loprinzi, Paul D
2016-06-01
Limited research has examined the association of muscle-strengthening activities and executive cognitive function among older adults, which was this study's purpose. Data from the 1999-2002 NHANES were employed (N = 2157; 60-85 years). Muscle-strengthening activities were assessed via self-report, with cognitive function assessed using the digit symbol substitution test. After adjusting for age, age-squared, gender, race-ethnicity, poverty level, body mass index, C-reactive protein, smoking, comorbid illness and physical activity, muscle-strengthening activities were significantly associated with cognitive function (βadjusted = 3.4; 95% CI: 1.7-5.1; P < 0.001). Compared to those not engaging in aerobic exercise and not meeting muscle-strengthening activity guidelines, those doing 1 (βadjusted = 3.7; 95% CI: 1.9-5.4; P < 0.001) and both (βadjusted = 6.6; 95% CI: 4.8-8.3; P < 0.001) of these behaviors had a significantly higher executive cognitive function score. In conclusion, muscle-strengthening activities are associated with executive cognitive function among older U.S. adults, underscoring the importance of promoting both aerobic exercise and muscle-strengthening activities to older adults. © The Author(s) 2016.
Park, Sung-Jun; Ahmad, Faiyaz; Um, Jee-Hyun; Brown, Alexandra L; Xu, Xihui; Kang, Hyeog; Ke, Hengming; Feng, Xuesong; Ryall, James; Philp, Andrew; Schenk, Simon; Kim, Myung K; Sartorelli, Vittorio; Chung, Jay H
2017-04-01
The specific Sirt1 activator SRT1720 increases mitochondrial function in skeletal muscle, presumably by activating Sirt1. However, Sirt1 gain of function does not increase mitochondrial function, which raises a question about the central role of Sirt1 in SRT1720 action. Moreover, it is believed that the metabolic effects of SRT1720 occur independently of AMP-activated protein kinase (AMPK), an important metabolic regulator that increases mitochondrial function. Here, we show that SRT1720 activates AMPK in a Sirt1-independent manner and SRT1720 activates AMPK by inhibiting a cAMP degrading phosphodiesterase (PDE) in a competitive manner. Inhibiting the cAMP effector protein Epac prevents SRT1720 from activating AMPK or Sirt1 in myotubes. Moreover, SRT1720 does not increase mitochondrial function or improve glucose tolerance in AMPKα2 knockout mice. Interestingly, weight loss induced by SRT1720 is not sufficient to improve glucose tolerance. Therefore, contrary to current belief, the metabolic effects produced by SRT1720 require AMPK, which can be activated independently of Sirt1. Published by Elsevier B.V.
de Hooge, Manouk; Ramonda, Roberta; Lorenzin, Mariagrazia; Frallonardo, Paola; Punzi, Leonardo; Ortolan, Augusta; Doria, Andrea
2016-11-16
Spondyloarthritis often affects young people, typically in their working years. The aim of our study was to investigate work productivity and its relationship with disease activity and physical functioning in Italian patients with axial spondyloarthritis (axSpA) with chronic back pain (CBP) for ≥3 months and ≤2 years, and onset < 45 years of age. Baseline absenteeism, presenteeism, work productivity loss (assessed by the Work Productivity and Activity Impairment questionnaire (WPAI)), and disease activity (assessed by the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI)/Ankylosing Spondylitis Disease Activity Score (ASDAS)) and functional ability (assessed by the Bath Ankylosing Spondylitis Disease Functional Index (BASFI)) of patients with axSpA (rheumatologist's diagnosis) included in the Italian section of the Spondyloarthritis Caught Early (SPACE) cohort were collected. Multivariate linear regression analysis was used to evaluate the associations between work productivity and disease activity/physical functioning. Absenteeism in 51 patients with axSpA was low (8.3 %). A decrease in work productivity was related to an increase in disease activity. Disease activity was strongly correlated with absenteeism (p < 0.01), presenteeism (p < 0.01) and work productivity loss (p < 0.001). In addition, decreased work productivity was related to a decrease in functional ability. Physical functioning was correlated with absenteeism (p < 0.001), presenteeism (p < 0.05) and work productivity loss (p < 0.001). Impairment of work productivity was correlated with disease activity and physical functioning in Italian patients with axSpA with CBP for ≥3 months and ≤2 years, with onset <45 years of age.
Preschool physical activity and functional constipation: the Generation R study.
Driessen, Lisa M; Kiefte-de Jong, Jessica C; Wijtzes, Anne; de Vries, Sanne I; Jaddoe, Vincent W V; Hofman, Albert; Raat, Hein; Moll, Henriette A
2013-12-01
Decreased physical activity levels in children may partly explain the rising prevalence of functional constipation in childhood. The aim of the present study, therefore, was to examine the association between physical activity and functional constipation during the preschool period. This study was embedded in the Generation R study, a large prospective birth-cohort study in Rotterdam, The Netherlands. Physical activity was measured by an Actigraph accelerometer in 347 children (182 boys, 165 girls; mean age 25.1 months) and data were expressed as counts per minute. Data were categorized into light activity (302-614 counts/15 seconds), moderate activity (615-1230 counts/15 seconds), and vigorous activity (≥1231 counts/15 seconds). Functional constipation in the third and fourth year of life was defined according to the Rome II criteria. Children spending time in the highest tertile of light (adjusted odds ratio [OR] 0.34; 95% confidence interval [CI] 0.13-0.87), moderate (adjusted OR 0.37; 95% CI 0.14-0.97), and total activity (adjusted OR 0.37; 95% CI 0.15-0.92) at the age of 2 years had significantly less functional constipation in the fourth year of life. For functional constipation in the third year of life, the results were in similar direction but not statistically significant. Additionally, children with physical activity of more than the WHO recommendation of 60 min/day had significantly less functional constipation in the fourth year of life (adjusted OR 0.48; 95% CI 0.24-0.97). Physical activity is associated with a decreased risk of functional constipation in the preschool period, but this may be time dependent.
Palmer, Raymond F; Espino, David V; Dergance, Jeannae M; Becho, Johanna; Markides, Kyriakos
2012-11-01
we investigate the temporal association between the rate of change in physical function and the rate of change in disability across four comparison groups: Those with and without diabetes who report >30 min of physical activity per day, and those who report <30 min of physical activity per day. six waves of longitudinal data from the Hispanic Established Population for Epidemiologic Studies of the Elderly were utilised. At baseline, there were a total of 3,050 elder participants aged 65 years old or greater. The longitudinal rates of change in disability and physical function were compared by the diabetes status (ever versus none) and the physical activity status (less than or greater than or equal to 30 min per day). disability and physical function data were analysed using a latent growth curve modelling approach adjusted for relevant demographic/health-related covariates. There were statistically significant longitudinal declines in physical function and disability (P < 0.001) in all groups. Most notable, the physical activity status was an important moderator. Those with >30 min of activity demonstrated better baseline function and less disability as well as better temporal trajectories than those reporting <30 min of physical activity per day. Comparisons between diabetes statuses within the same physical activity groups showed worse disability trajectories among those with diabetes. a longitudinal decline in physical function and disability is moderated most notably by physical activity. The diabetes status further moderates decline in function and disability over time. Increased physical activity appears to be protective of disability in general and may lessen the influence of diabetes-related disability in older Mexican Americans, particularly at the end of life.
Gruber-Baldini, Ann L.; Hicks, Gregory; Ostir, Glen; Klinedinst, N. Jennifer; Orwig, Denise; Magaziner, Jay
2015-01-01
Background Measurement of physical function post hip fracture has been conceptualized using multiple different measures. Purpose This study tested a comprehensive measurement model of physical function. Design This was a descriptive secondary data analysis including 168 men and 171 women post hip fracture. Methods Using structural equation modeling, a measurement model of physical function which included grip strength, activities of daily living, instrumental activities of daily living and performance was tested for fit at 2 and 12 months post hip fracture and among male and female participants and validity of the measurement model of physical function was evaluated based on how well the model explained physical activity, exercise and social activities post hip fracture. Findings The measurement model of physical function fit the data. The amount of variance the model or individual factors of the model explained varied depending on the activity. Conclusion Decisions about the ideal way in which to measure physical function should be based on outcomes considered and participant Clinical Implications The measurement model of physical function is a reliable and valid method to comprehensively measure physical function across the hip fracture recovery trajectory. Practical but useful assessment of function should be considered and monitored over the recovery trajectory post hip fracture. PMID:26492866
Large memory capacity in chaotic artificial neural networks: a view of the anti-integrable limit.
Lin, Wei; Chen, Guanrong
2009-08-01
In the literature, it was reported that the chaotic artificial neural network model with sinusoidal activation functions possesses a large memory capacity as well as a remarkable ability of retrieving the stored patterns, better than the conventional chaotic model with only monotonic activation functions such as sigmoidal functions. This paper, from the viewpoint of the anti-integrable limit, elucidates the mechanism inducing the superiority of the model with periodic activation functions that includes sinusoidal functions. Particularly, by virtue of the anti-integrable limit technique, this paper shows that any finite-dimensional neural network model with periodic activation functions and properly selected parameters has much more abundant chaotic dynamics that truly determine the model's memory capacity and pattern-retrieval ability. To some extent, this paper mathematically and numerically demonstrates that an appropriate choice of the activation functions and control scheme can lead to a large memory capacity and better pattern-retrieval ability of the artificial neural network models.
Park, Jin-Young; Chang, Moonyoung; Kim, Kyeong-Mi; Kim, Hee-Jung
2015-06-01
The purpose of this study was to examine the effects of mirror therapy on upper-extremity function and activities of daily living in chronic stroke patients. [Subjects and Methods] Fifteen subjects were each assigned to a mirror therapy group and a sham therapy group. The Fugl-Meyer Motor Function Assessment and the Box and Block Test were performed to compare paretic upper-extremity function and hand coordination abilities. The functional independence measurement was conducted to compare abilities to perform activities of daily living. [Results] Paretic upper-extremity function and hand coordination abilities were significantly different between the mirror therapy and sham therapy groups. Intervention in the mirror therapy group was more effective than in the sham therapy group for improving the ability to perform activities of daily living. Self-care showed statistically significant differences between the two groups. [Conclusion] Mirror therapy is effective in improving paretic upper-extremity function and activities of daily living in chronic stroke patients.
Park, Jin-Young; Chang, Moonyoung; Kim, Kyeong-Mi; Kim, Hee-Jung
2015-01-01
The purpose of this study was to examine the effects of mirror therapy on upper-extremity function and activities of daily living in chronic stroke patients. [Subjects and Methods] Fifteen subjects were each assigned to a mirror therapy group and a sham therapy group. The Fugl-Meyer Motor Function Assessment and the Box and Block Test were performed to compare paretic upper-extremity function and hand coordination abilities. The functional independence measurement was conducted to compare abilities to perform activities of daily living. [Results] Paretic upper-extremity function and hand coordination abilities were significantly different between the mirror therapy and sham therapy groups. Intervention in the mirror therapy group was more effective than in the sham therapy group for improving the ability to perform activities of daily living. Self-care showed statistically significant differences between the two groups. [Conclusion] Mirror therapy is effective in improving paretic upper-extremity function and activities of daily living in chronic stroke patients. PMID:26180297
L(p) approximation capabilities of sum-of-product and sigma-pi-sigma neural networks.
Long, Jinling; Wu, Wei; Nan, Dong
2007-10-01
This paper studies the L(p) approximation capabilities of sum-of-product (SOPNN) and sigma-pi-sigma (SPSNN) neural networks. It is proved that the set of functions that are generated by the SOPNN with its activation function in $L_{loc};p(\\mathcal{R})$ is dense in $L;p(\\mathcal{K})$ for any compact set $\\mathcal{K}\\subset \\mathcal{R};N$, if and only if the activation function is not a polynomial almost everywhere. It is also shown that if the activation function of the SPSNN is in ${L_{loc};\\infty(\\mathcal{R})}$, then the functions generated by the SPSNN are dense in $L;p(\\mathcal{K})$ if and only if the activation function is not a constant (a.e.).
NASA Astrophysics Data System (ADS)
Ménez, Bénédicte; Gérard, Emmanuelle; Rommevaux-Jestin, Céline; Dupraz, Sébastien; Guyot, François; Arnar Alfreősson, Helgi; Reynir Gíslason, Sigurőur; Sigurőardóttir, Hólmfríiur
2010-05-01
Due to their reactivity and high potential of carbonation, mafic and ultramafic rocks constitute targets of great interest to safely and permanently sequestrate anthropogenic CO2 and thus, limit the potential major environmental consequences of its increasing atmospheric level. In addition, subsurface (ultra)mafic environments are recognized to harbor diverse and active microbial populations that may be stimulated or decimated following CO2 injection (± impurities) and subsequent acidification. However, the nature and amplitude of the involved biogeochemical pathways are still unknown. To avoid unforeseen consequences at all time scales (e.g. reservoir souring and clogging, bioproduction of H2S and CH4), the impact of CO2 injection on deep biota with unknown ecology, and their retroactive effects on the capacity and long-term stability of CO2 storage sites, have to be determined. We present here combined field and experimental investigations focused on the Icelandic pilot site, implemented in the Hengill area (SW Iceland) at the Hellisheidi geothermal power plant (thanks to the CarbFix program, a consortium between the University of Iceland, Reykjavik Energy, the French CNRS of Toulouse and Columbia University in N.Y., U.S.A. and to the companion French ANR-CO2FIX project). This field scale injection of CO2 charged water is here designed to study the feasibility of storing permanently CO2 in basaltic rocks and to optimize industrial methods. Prior to the injection, the microbiological initial state was characterized through regular sampling at various seasons (i.e., October '08, July '09, February '10). DNA was extracted and amplified from the deep and shallow observatory wells, after filtration of 20 to 30 liters of groundwater collected in the depth interval 400-980 m using a specifically developed sampling protocol aiming at reducing contamination risks. An inventory of living indigenous bacteria and archaea was then done using molecular methods based on the amplification of small subunit ribosomal RNA genes (SSU rDNAs). The stratigraphic levels targeted to store the injected CO2 as aqueous phase harbor numerous new species close to cultivable species belonging to the genus Thermus or Proteobacteria species known to be linked in particular with the hydrogen and iron cycles. After injection, the evolution of these microbial communities will be monitored using the Denaturing Gradient Gel Electrophoresis technique. Beyond the ecological impact of storing high levels of CO2 in deep environments, particularly important is the ability of intraterrestrial microbes to potentially interact with the injected fluids. For example, carbonation has been shown to be strongly influenced by microbiological activities that can locally modify pH and induce nucleation of solid carbonates. To improve the understanding of these processes and to better constrain the influence of deep biota on the evolving chemical and petrophysical properties of the reservoir, an experimental and numerical modeling is carried out in parallel, using model strains representative of the subsurface (including acetogens, sulphate and iron reducing bacteria), as single-species or consortia. A set of batch experiments in presence of crushed olivine or basalts was especially designed to evaluate how microbial activity could overcome the slow kinetics of mineral-fluid reactions and reduce the energy needed to hasten the carbonation process.
Choi, Eunhee; Tang, Fengyan; Kim, Sung-Geun; Turk, Phillip
2016-10-01
This study examined the longitudinal relationships between functional health in later years and three types of productive activities: volunteering, full-time, and part-time work. Using the data from five waves (2000-2008) of the Health and Retirement Study, we applied multivariate latent growth curve modeling to examine the longitudinal relationships among individuals 50 or over. Functional health was measured by limitations in activities of daily living. Individuals who volunteered, worked either full time or part time exhibited a slower decline in functional health than nonparticipants. Significant associations were also found between initial functional health and longitudinal changes in productive activity participation. This study provides additional support for the benefits of productive activities later in life; engagement in volunteering and employment are indeed associated with better functional health in middle and old age. © The Author(s) 2016.
Correlates of Physical Functioning and Performance Across the Spectrum of Kidney Function.
Segura-Ortí, E; Gordon, P L; Doyle, J W; Johansen, K L
2018-06-01
The aim of this study was to determine the extent to which poor physical functioning, low participation in physical activity, and muscle atrophy observed among patients on hemodialysis are evident in the earlier stages of chronic kidney disease (CKD). We enrolled adults in three groups: no CKD, Stages 3 to 4 CKD, and hemodialysis. Outcomes measured were physical activity, muscle size, thigh muscle strength, physical performance, and self-reported physical function. Patients with CKD had muscle area intermediate between the no CKD and hemodialysis groups, but they had low levels of physical activity that were similar to the hemodialysis group. Physical activity and muscle size were significantly associated with all outcomes. Kidney function was not significantly associated with muscle strength or physical performance after adjustment for physical activity and muscle size. In conclusion, interventions aimed to increase muscle mass and energy expenditure might have an impact on improving physical function of CKD patients.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-09-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-01-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648
Loke, Seng Cheong; Lim, Wee Shiong; Someya, Yoshiko; Hamid, Tengku A.; Nudin, Siti S. H.
2015-01-01
Objective: This study examines the International Classification of Functioning, Disability, and Health model (ICF) using a data set of 2,563 community-dwelling elderly with disease-independent measures of mobility, physical activity, and social networking, to represent ICF constructs. Method: The relationship between chronic disease and disability (independent and dependent variables) was examined using logistic regression. To demonstrate variability in activity performance with functional impairment, graphing was used. The relationship between functional impairment, activity performance, and social participation was examined graphically and using ANOVA. The impact of cognitive deficits was quantified through stratifying by dementia. Results: Disability is strongly related to chronic disease (Wald 25.5, p < .001), functional impairment with activity performance (F = 34.2, p < .001), and social participation (F= 43.6, p < .001). With good function, there is considerable variability in activity performance (inter-quartile range [IQR] = 2.00), but diminishes with high impairment (IQR = 0.00) especially with cognitive deficits. Discussion: Environment modification benefits those with moderate functional impairment, but not with higher grades of functional loss. PMID:26472747
Neuroimaging explanations of age-related differences in task performance.
Steffener, Jason; Barulli, Daniel; Habeck, Christian; Stern, Yaakov
2014-01-01
Advancing age affects both cognitive performance and functional brain activity and interpretation of these effects has led to a variety of conceptual research models without always explicitly linking the two effects. However, to best understand the multifaceted effects of advancing age, age differences in functional brain activity need to be explicitly tied to the cognitive task performance. This work hypothesized that age-related differences in task performance are partially explained by age-related differences in functional brain activity and formally tested these causal relationships. Functional MRI data was from groups of young and old adults engaged in an executive task-switching experiment. Analyses were voxel-wise testing of moderated-mediation and simple mediation statistical path models to determine whether age group, brain activity and their interaction explained task performance in regions demonstrating an effect of age group. Results identified brain regions whose age-related differences in functional brain activity significantly explained age-related differences in task performance. In all identified locations, significant moderated-mediation relationships resulted from increasing brain activity predicting worse (slower) task performance in older but not younger adults. Findings suggest that advancing age links task performance to the level of brain activity. The overall message of this work is that in order to understand the role of functional brain activity on cognitive performance, analysis methods should respect theoretical relationships. Namely, that age affects brain activity and brain activity is related to task performance.
Lifshitz-Vahav, Hefziba; Shrira, Amit; Bodner, Ehud
2017-05-01
Participation in leisure activities is beneficial for cognitive functioning of older adults, but it is less known whether it is also beneficial for those with low basic cognitive level. This study examined the reciprocal relationship between participating in leisure activities and cognitive functioning among low and higher literacy level older adults. Respondents aged 60 years and older who participated in both first waves (2005-2006 and 2009-2010) of the Israeli component of the Survey of Health, Ageing and Retirement in Europe (SHARE-Israel) were divided into low (n = 139) and higher literacy level respondents (n = 714). They reported participation in leisure activities and completed measures of cognitive functioning at both waves. Cross-lagged models showed that participation in leisure activities predicted higher cognitive functioning four years later only among older adults with low literacy level. On the other hand, cognitive functioning predicted more participation in leisure activities four years later only among higher literacy level older adults. Participating in leisure activities may be especially beneficial to cognitive functioning among older adults with low literacy level, as their initial low cognitive level allows more room for cognitive improvement than among higher literacy level older adults. Public efforts aimed at increasing participation in leisure activities may therefore target particularly older adults with low basic cognitive level.
Roche, John P.; Alsharif, Peter; Graf, Ethan R.
2015-01-01
At synapses, the release of neurotransmitter is regulated by molecular machinery that aggregates at specialized presynaptic release sites termed active zones. The complement of active zone proteins at each site is a determinant of release efficacy and can be remodeled to alter synapse function. The small GTPase Rab3 was previously identified as playing a novel role that controls the distribution of active zone proteins to individual release sites at the Drosophila neuromuscular junction. Rab3 has been extensively studied for its role in the synaptic vesicle cycle; however, the mechanism by which Rab3 controls active zone development remains unknown. To explore this mechanism, we conducted a mutational analysis to determine the molecular and structural requirements of Rab3 function at Drosophila synapses. We find that GTP-binding is required for Rab3 to traffick to synapses and distribute active zone components across release sites. Conversely, the hydrolytic activity of Rab3 is unnecessary for this function. Through a structure-function analysis we identify specific residues within the effector-binding switch regions that are required for Rab3 function and determine that membrane attachment is essential. Our findings suggest that Rab3 controls the distribution of active zone components via a vesicle docking mechanism that is consistent with standard Rab protein function. PMID:26317909
Physical Activity and Cognitive Functioning of Children: A Systematic Review.
Bidzan-Bluma, Ilona; Lipowska, Małgorzata
2018-04-19
Childhood is an important and sensitive period for cognitive development. There is limited published research regarding the relationship between sports and cognitive functions in children. We present studies that demonstrate the influence of physical activity on health, especially a positive correlation between sports and cognitive functions. The keywords “children, cognition, cognitive function, physical activity, and brain” were searched for using PsycInfo, Medline, and Google Scholar, with publication dates ranging from January 2000 to November 2017. Of the 617 results, 58 articles strictly connected to the main topics of physical activity and cognitive functioning were then reviewed. The areas of attention, thinking, language, learning, and memory were analyzed relative to sports and childhood. Results suggest that engaging in sports in late childhood positively influences cognitive and emotional functions. There is a paucity of publications that investigate the impact of sports on pre-adolescents’ cognitive functions, or explore which cognitive functions are developed by which sporting disciplines. Such knowledge would be useful in developing training programs for pre-adolescents, aimed at improving cognitive functions that may guide both researchers and practitioners relative to the wide range of benefits that result from physical activity.
Jonsson, Marcus; Urell, Charlotte; Emtner, Margareta; Westerdahl, Elisabeth
2014-03-28
Physical activity has well-established positive health-related effects. Sedentary behaviour has been associated with postoperative complications and mortality after cardiac surgery. Patients undergoing cardiac surgery often suffer from impaired lung function postoperatively. The association between physical activity and lung function in cardiac surgery patients has not previously been reported. Patients undergoing cardiac surgery were followed up two months postoperatively. Physical activity was assessed on a four-category scale (sedentary, moderate activity, moderate regular exercise, and regular activity and exercise), modified from the Swedish National Institute of Public Health's national survey. Formal lung function testing was performed preoperatively and two months postoperatively. The sample included 283 patients (82% male). Two months after surgery, the level of physical activity had increased (p < 0.001) in the whole sample. Patients who remained active or increased their level of physical activity had significantly better recovery of lung function than patients who remained sedentary or had decreased their level of activity postoperatively in terms of vital capacity (94 ± 11% of preoperative value vs. 91 ± 9%; p = 0.03), inspiratory capacity (94 ± 14% vs. 88 ± 19%; p = 0.008), and total lung capacity (96 ± 11% vs. 90 ± 11%; p = 0.01). An increased level of physical activity, compared to preoperative level, was reported as early as two months after surgery. Our data shows that there could be a significant association between physical activity and recovery of lung function after cardiac surgery. The relationship between objectively measured physical activity and postoperative pulmonary recovery needs to be further examined to verify these results.
New approaches to enhance active steering system functionalities: preliminary results
NASA Astrophysics Data System (ADS)
Serarslan, Benan
2014-09-01
An important development of the steering systems in general is active steering systems like active front steering and steer-by-wire systems. In this paper the current functional possibilities in application of active steering systems are explored. A new approach and additional functionalities are presented that can be implemented to the active steering systems without additional hardware such as new sensors and electronic control units. Commercial active steering systems are controlling the steering angle depending on the driving situation only. This paper introduce methods for enhancing active steering system functionalities depending not only on the driving situation but also vehicle parameters like vehicle mass, tyre and road condition. In this regard, adaptation of the steering ratio as a function of above mentioned vehicle parameters is presented with examples. With some selected vehicle parameter changes, the reduction of the undesired influences on vehicle dynamics of these parameter changes has been demonstrated theoretically with simulations and with real-time driving measurements.
NASA Astrophysics Data System (ADS)
Levchuk, Georgiy; Bobick, Aaron; Jones, Eric
2010-04-01
In this paper, we describe results from experimental analysis of a model designed to recognize activities and functions of moving and static objects from low-resolution wide-area video inputs. Our model is based on representing the activities and functions using three variables: (i) time; (ii) space; and (iii) structures. The activity and function recognition is achieved by imposing lexical, syntactic, and semantic constraints on the lower-level event sequences. In the reported research, we have evaluated the utility and sensitivity of several algorithms derived from natural language processing and pattern recognition domains. We achieved high recognition accuracy for a wide range of activity and function types in the experiments using Electro-Optical (EO) imagery collected by Wide Area Airborne Surveillance (WAAS) platform.
Tic Related Activity Restriction as a Predictor of Emotional Functioning and Quality of Life
Conelea, Christine A.; Busch, Andrew M.; Catanzaro, Mark A.; Budman, Cathy L.
2013-01-01
Objectives Tourette Syndrome (TS) is a chronic neuropsychiatric condition that frequently persists into adulthood. Existing research has identified demographic and symptom-level variables associated with psychopathology and poor quality of life in TS. However, behavior patterns associated with enhanced or adaptive psychological and global functioning among adults with TS have yet to be empirically identified. The current study examined whether tic-specific activity restriction is related to emotional functioning and quality of life in adults with TS. Methods Participants were 509 adults from the Tourette Syndrome Impact Survey who completed self-report measures of demographics, tic severity, emotional functioning, quality of life, and tic related general and social activity restriction. Results Partial correlations controlling for tic severity indicated that tic related general and social activity restriction were significantly correlated with lower quality of life and poorer emotional functioning. Hierarchical linear regression models indicated that activity restriction significantly predicted lower quality of life and poorer emotional functioning when controlling for tic severity and demographic variables. Conclusions Adults who restrict fewer activities due to tics, regardless of tic severity, experience greater quality of life and better emotional functioning. Clinically, adults with chronic tics may benefit from interventions focused on enhancing engagement in valued life activities. PMID:24156871
McAuley, Edward; Szabo, Amanda; Gothe, Neha; Olson, Erin A
2011-07-01
Attenuating the physical decline and increases in disability associated with the aging process is an important public health priority. Evidence suggests that regular physical activity participation improves functional performance, such as walking, standing balance, flexibility, and getting up out of a chair, and also plays an important role in the disablement process by providing a protective effect against functional limitations. Whether these effects are direct or indirect has yet to be reliably established. In this review, the authors take the perspective that such relationships are indirect and operate through self-efficacy expectations. They first provide an introduction to social cognitive theory followed by an overview of self-efficacy's reciprocal relationship with physical activity. They then consider the literature that documents the effects of physical activity on functional performance and functional limitations in older adults and the extent to which self-efficacy might mediate these relationships. Furthermore, they also present evidence that suggests that self-efficacy plays a pivotal role in a model in which the protective effects conferred by physical activity on functional limitations operate through functional performance. The article concludes with a brief section making recommendations for the development of strategies within physical activity and rehabilitative programs for maximizing the major sources of efficacy information.
McAuley, Edward; Szabo, Amanda; Gothe, Neha; Olson, Erin A.
2013-01-01
Attenuating the physical decline and increases in disability associated with the aging process is an important public health priority. Evidence suggests that regular physical activity participation improves functional performance, such as walking, standing balance, flexibility, and getting up out of a chair, and also plays an important role in the disablement process by providing a protective effect against functional limitations. Whether these effects are direct or indirect has yet to be reliably established. In this review, the authors take the perspective that such relationships are indirect and operate through self-efficacy expectations. They first provide an introduction to social cognitive theory followed by an overview of self-efficacy's reciprocal relationship with physical activity. They then consider the literature that documents the effects of physical activity on functional performance and functional limitations in older adults and the extent to which self-efficacy might mediate these relationships. Furthermore, they also present evidence that suggests that self-efficacy plays a pivotal role in a model in which the protective effects conferred by physical activity on functional limitations operate through functional performance. The article concludes with a brief section making recommendations for the development of strategies within physical activity and rehabilitative programs for maximizing the major sources of efficacy information. PMID:24353482
Jeon, Dong-Wook; Ju, Hyun-Bin; Jung, Do-Un; Kim, Sung-Jin; Shim, Joo-Cheol; Moon, Jung-Joon; Kim, You-Na
2017-10-25
To assess the usefulness of the University of California San Diego Performance-Based Skills Assessment (UPSA) as a new diagnostic method and tool for the assessment of cognitive function and activities of daily living function in patients with cognitive impairment. In total, 35 patients with cognitive impairment and 35 healthy controls were recruited for this study. The Mini-Mental State Examination (MMSE), Clinical Dementia Rating (CDR), and Global Deterioration Scale (GDS) were used for the evaluation of cognitive function, while the Barthel Activities of Daily Living Index (BADL), Instrumental Activities of Daily Living Index (IADL), and UPSA were used for the evaluation of activities of daily living function. UPSA scores were significantly lower in patients with cognitive impairment than in controls. The UPSA total score was significantly correlated with MMSE, CDR, GDS, and IADL scores. With regard to the detection of cognitive impairment, UPSA exhibited a greater determination power (R 2 = 0.593) compared with BADL (R 2 = 0.149) and IADL (R 2 = 0.423) and higher sensitivity and specificity compared with IADL. Our results suggest that UPSA is a useful tool for the evaluation of cognitive function and activities of daily living function in patients with cognitive impairment.
Eckert, Katharina G; Lange, Martin A
2015-03-14
Physical activity questionnaires (PAQ) have been extensively used to determine physical activity (PA) levels. Most PAQ are derived from an energy expenditure-based perspective and assess activities with a certain intensity level. Activities with a moderate or vigorous intensity level are predominantly used to determine a person's PA level in terms of quantity. Studies show that the time spent engaging in moderate and vigorous intensity PA does not appropriately reflect the actual PA behavior of older people because they perform more functional, everyday activities. Those functional activities are more likely to be considered low-intense and represent an important qualitative health-promoting activity. For the elderly, functional, light intensity activities are of special interest but are assessed differently in terms of quantity and quality. The aim was to analyze the content of PAQ for the elderly. N = 18 sufficiently validated PAQ applicable to adults (60+) were included. Each item (N = 414) was linked to the corresponding code of the International Classification of Functioning, Disability and Health (ICF) using established linking rules. Kappa statistics were calculated to determine rater agreement. Items were linked to 598 ICF codes and 62 different ICF categories. A total of 43.72% of the codes were for sports-related activities and 14.25% for walking-related activities. Only 9.18% of all codes were related to household tasks. Light intensity, functional activities are emphasized differently and are underrepresented in most cases. Additionally, sedentary activities are underrepresented (5.55%). κ coefficients were acceptable for n = 16 questionnaires (0.48-1.00). There is a large inconsistency in the understandings of PA in elderly. Further research should focus (1) on a conceptual understanding of PA in terms of the behavior of the elderly and (2) on developing questionnaires that inquire functional, light intensity PA, as well as sedentary activities more explicitly.
Physical activity and trajectories in cognitive function: English Longitudinal Study of Ageing.
Hamer, Mark; Muniz Terrera, Graciela; Demakakos, Panayotes
2018-06-01
There are limited data on physical activity in relation to trajectories in cognitive function. The aim was to examine the association of physical activity with trajectories in cognitive function, measured from repeated assessments over 10 years. We conducted a 10-year follow-up of 10 652 (aged 65±10.1 years) men and women from the English Longitudinal Study of Ageing, a cohort of community dwelling older adults. Self-reported physical activity was assessed at baseline and neuropsychological tests of memory and executive function were administered at regular 2-year intervals. Data from six repeated measurements of memory over 10 years and five repeated measurements of executive function over 8 years were used. The multivariable models revealed relatively small baseline differences in cognitive function by physical activity status in both men and women. Over the 10-year follow-up, physically inactive women experienced a greater decline in their memory (-0.20 recalled words, 95% CI -0.29 to -0.11, per study wave) and in executive function ability (-0.33 named animals; -0.54 to -0.13, per study wave) in comparison with the vigorously active reference group. In men, there were no differences in memory (-0.08 recalled words, 95% CI -0.18 to 0.01, per study wave), but small differences in executive function (-0.23 named animals; -0.46 to -0.01, per study wave) between inactive and vigorously active. Physical activity was associated with preservation of memory and executive function over 10 years follow-up. The results were, however, more pronounced in women. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Botha-Scheepers, S; Riyazi, N; Kroon, H M; Scharloo, M; Houwing-Duistermaat, J J; Slagboom, E; Rosendaal, F R; Breedveld, F C; Kloppenburg, M
2006-11-01
Using the International Classification of Functioning, Disability and Health as framework, we evaluated modifying effects of illness perceptions and mental health on the association between impairments in body structures and functions due to osteoarthritis (OA) and limitation in activities in the lower extremities. Self-reported limitation in activities was assessed by the Western Ontario and McMaster Universities OA index (WOMAC) function subscale in 316 patients with knee or hip pain or evidence of OA on knee or hip radiographs. Body structures and functions were evaluated during clinical and radiological assessments. Illness perceptions and mental health were assessed with the revised Illness Perception Questionnaire (IPQ-R) and the mental component summary score of the RAND 36-item Health Survey, respectively. For each patient an expected WOMAC function score was calculated, using an equation based on a multivariate model of the association of body structures and functions with limitation in activities. The median (interquartile) self-reported WOMAC function score was 22.2 (9.6-43.5). Ninety-one patients reported more and 120 patients reported less limitation in activities than expected. Patients with lumbar spine degeneration, physical or exercise therapy and high IPQ-R identity, consequences and chronic timeline scores had an increased risk to report more limitation in activities than the expected range. Low IPQ-R identity, consequences and emotional representation scores and better mental health were associated with reporting less limitation in activities than the expected range. Illness perceptions and mental health modify the association between self-reported limitation in activities and calculated limitation in activities based on impairments in body structures and functions due to OA.
Bel, Linda G J; Vollebregt, Anna M; Van der Meulen-de Jong, Andrea E; Fidder, Herma H; Ten Hove, Willem R; Vliet-Vlieland, Cornelia W; Ter Kuile, Moniek M; de Groot, Helena E; Both, Stephanie
2015-07-01
Inflammatory bowel disease (IBD) is likely to have an impact on sexual function because of its symptoms, like diarrhea, fatigue, and abdominal pain. Depression is commonly reported in IBD and is also related to impaired sexual function. This study aimed to evaluate sexual function and its association with depression among patients with IBD compared with controls. IBD patients registered at two hospitals participated. The control group consisted of a general practitioner practice population. The web-based questionnaire included the Female Sexual Function Index (FSFI) for women and the International Index of Erectile Function (IIEF) for men. Other variables evaluated were depression, disease activity, IBD-related quality of life, body image, and fatigue. In total, 168 female and 119 male patients were available for analysis (response rate 24%). Overall, patients with IBD did not significantly differ in prevalence of sexual dysfunctions from controls: female patients 52%, female controls 44%, male patients and male controls both 25%. However, men and women with an active disease scored significantly lower than patients in remission and controls, indicating impaired sexual functioning during disease activity. Significant associations were found between active disease, fatigue, depressive mood, quality of life, and sexual function for both male and female patients. The association between disease activity and sexual function was totally mediated by depression. Male and female IBD patients with an active disease show impaired sexual function relative to patients in remission and controls. Depression is the most important determinant for impaired sexual function in IBD. © 2015 International Society for Sexual Medicine.
Executive Functions and Motor Ability Contribute to Children's Participation in Daily Activities
ERIC Educational Resources Information Center
Rosenberg, Limor; Jacobi, Shani; Bart, Orit
2017-01-01
Executive functions are crucial for efficient daily functioning. However, the contribution of executive functions to the participation in daily life activities of children, have been inadequately studied. The study aimed to examine the unique contribution of executive functions, beyond motor ability, to the diversity and independence of children's…
Association Between Brain Activation and Functional Connectivity.
Tomasi, Dardo; Volkow, Nora D
2018-04-13
The origin of the "resting-state" brain activity recorded with functional magnetic resonance imaging (fMRI) is still uncertain. Here we provide evidence for the neurovascular origins of the amplitude of the low-frequency fluctuations (ALFF) and the local functional connectivity density (lFCD) by comparing them with task-induced blood-oxygen level dependent (BOLD) responses, which are considered a proxy for neuronal activation. Using fMRI data for 2 different tasks (Relational and Social) collected by the Human Connectome Project in 426 healthy adults, we show that ALFF and lFCD have linear associations with the BOLD response. This association was significantly attenuated by a novel task signal regression (TSR) procedure, indicating that task performance enhances lFCD and ALFF in activated regions. We also show that lFCD predicts BOLD activation patterns, as was recently shown for other functional connectivity metrics, which corroborates that resting functional connectivity architecture impacts brain activation responses. Thus, our findings indicate a common source for BOLD responses, ALFF and lFCD, which is consistent with the neurovascular origin of local hemodynamic synchrony presumably reflecting coordinated fluctuations in neuronal activity. This study also supports the development of task-evoked functional connectivity density mapping.
Zhou, Jing; Tan, Shi-Hao; Nicolas, Valérie; Bauvy, Chantal; Yang, Nai-Di; Zhang, Jianbin; Xue, Yuan; Codogno, Patrice; Shen, Han-Ming
2013-01-01
Lysosome is a key subcellular organelle in the execution of the autophagic process and at present little is known whether lysosomal function is controlled in the process of autophagy. In this study, we first found that suppression of mammalian target of rapamycin (mTOR) activity by starvation or two mTOR catalytic inhibitors (PP242 and Torin1), but not by an allosteric inhibitor (rapamycin), leads to activation of lysosomal function. Second, we provided evidence that activation of lysosomal function is associated with the suppression of mTOR complex 1 (mTORC1), but not mTORC2, and the mTORC1 localization to lysosomes is not directly correlated to its regulatory role in lysosomal function. Third, we examined the involvement of transcription factor EB (TFEB) and demonstrated that TFEB activation following mTORC1 suppression is necessary but not sufficient for lysosomal activation. Finally, Atg5 or Atg7 deletion or blockage of the autophagosome-lysosome fusion process effectively diminished lysosomal activation, suggesting that lysosomal activation occurring in the course of autophagy is dependent on autophagosome-lysosome fusion. Taken together, this study demonstrates that in the course of autophagy, lysosomal function is upregulated via a dual mechanism involving mTORC1 suppression and autophagosome-lysosome fusion. PMID:23337583
Zhou, Jing; Tan, Shi-Hao; Nicolas, Valérie; Bauvy, Chantal; Yang, Nai-Di; Zhang, Jianbin; Xue, Yuan; Codogno, Patrice; Shen, Han-Ming
2013-04-01
Lysosome is a key subcellular organelle in the execution of the autophagic process and at present little is known whether lysosomal function is controlled in the process of autophagy. In this study, we first found that suppression of mammalian target of rapamycin (mTOR) activity by starvation or two mTOR catalytic inhibitors (PP242 and Torin1), but not by an allosteric inhibitor (rapamycin), leads to activation of lysosomal function. Second, we provided evidence that activation of lysosomal function is associated with the suppression of mTOR complex 1 (mTORC1), but not mTORC2, and the mTORC1 localization to lysosomes is not directly correlated to its regulatory role in lysosomal function. Third, we examined the involvement of transcription factor EB (TFEB) and demonstrated that TFEB activation following mTORC1 suppression is necessary but not sufficient for lysosomal activation. Finally, Atg5 or Atg7 deletion or blockage of the autophagosome-lysosome fusion process effectively diminished lysosomal activation, suggesting that lysosomal activation occurring in the course of autophagy is dependent on autophagosome-lysosome fusion. Taken together, this study demonstrates that in the course of autophagy, lysosomal function is upregulated via a dual mechanism involving mTORC1 suppression and autophagosome-lysosome fusion.
The importance of physical function to people with osteoporosis.
Kerr, C; Bottomley, C; Shingler, S; Giangregorio, L; de Freitas, H M; Patel, C; Randall, S; Gold, D T
2017-05-01
There is increasing need to understand patient outcomes in osteoporosis. This article discusses that fracture in osteoporosis can lead to a cycle of impairment, driven by complex psychosocial factors, having a profound impact on physical function/activity which accumulates over time. More information is required on how treatments impact physical function. There is increasing need to understand patient-centred outcomes in osteoporosis (OP) clinical research and management. This multi-method paper provides insight on the effect of OP on patients' physical function and everyday activity. Data were collected from three sources: (1) targeted literature review on OP and physical function, conducted in MEDLINE, Embase and PsycINFO; (2) secondary thematic analysis of transcripts from patient interviews, conducted to develop a patient-reported outcome instrument. Transcripts were re-coded to focus on OP impact on daily activities and physical function for those with and without fracture history; and (3) discussions of the literature review and secondary qualitative analysis results with three clinical experts to review and interpret the importance and implications of the findings. Results suggest that OP, particularly with fracture, can have profound impacts on physical function/activity. These impacts accumulate over time through a cycle of impairment, as fracture leads to longer term detriments in physical function, including loss of muscle, activity avoidance and reduced physical capacity, which in turn leads to greater risk of fracture and potential for further physical restrictions. The cycle of impairment is complex, as other physical, psychosocial and treatment-related factors, such as comorbidities, fears and beliefs about physical activity and fracture risk influence physical function and everyday activity. More information on how treatments impact physical function would benefit healthcare professionals and persons with OP in making treatment decisions and improving treatment compliance/persistence, as these impacts may be more salient to patients than fracture incidence.
Proteins with neomorphic moonlighting functions in disease.
Jeffery, Constance J
2011-07-01
One gene can encode multiple protein functions because of RNA splice variants, gene fusions during evolution, promiscuous enzyme activities, and moonlighting protein functions. In addition to these types of multifunctional proteins, in which both functions are considered "normal" functions of a protein, some proteins have been described in which a mutation or conformational change imparts a second function on a protein that is not a "normal" function of the protein. We propose to call these new functions "neomorphic moonlighting functions". The most common examples of neomorphic moonlighting functions are due to conformational changes that impart novel protein-protein interactions resulting in the formation of protein aggregates in Alzheimers, Parkinsons disease, and the systemic amyloidoses. Other changes that can result in a neomorphic moonlighting function include a mutation in SMAD4 that causes the protein to bind to new promoters and thereby alter gene transcription patterns, mutations in two isocitrate dehydrogenase isoforms that impart a new catalytic activity, and mutations in dihydrolipoamide dehydrogenase that activate a hidden protease activity. These neomorphic moonlighting functions were identified because of their connection to disease. In the cases described herein, the new functions cause cancers or severe neurological impairment, although in most cases the mechanism by which the new function leads to disease is unknown. Copyright © 2011 Wiley Periodicals, Inc.
Activity inhibition on municipal activated sludge by single-walled carbon nanotubes
NASA Astrophysics Data System (ADS)
Parise, Alex; Thakor, Harshrajsinh; Zhang, Xiaoqi
2014-01-01
The objective of this study was to evaluate the respiratory activity inhibition of activated sludge used in a typical wastewater treatment plant by single-walled carbon nanotubes (SWCNTs) with different length and functionality. Four types of SWCNTs were evaluated: short, functionalized short, long, and functionalized long. Based on the effective concentration (EC50) values obtained, we determined that functionalized SWCNTs resulted in a higher microbial respiratory inhibition than non-functionalized nanotubes, and long SWCNTs gave a higher microbial respiratory inhibition than their short counterparts. Among the four types of SWCNTs studied, functionalized long exhibited the highest respiration inhibition. Scanning electron microscopy imaging indicates that the long SWCNTs dispersed more favorably after sonication than the short variety. The findings demonstrated that the toxicity of CNTs (exhibited by respiratory inhibition) is related to their physical properties; the length and functionality of SWCNTs affected the toxicity of SWCNTs in a mixed-cultured biologic system.
BRAIN NETWORKS. Correlated gene expression supports synchronous activity in brain networks.
Richiardi, Jonas; Altmann, Andre; Milazzo, Anna-Clare; Chang, Catie; Chakravarty, M Mallar; Banaschewski, Tobias; Barker, Gareth J; Bokde, Arun L W; Bromberg, Uli; Büchel, Christian; Conrod, Patricia; Fauth-Bühler, Mira; Flor, Herta; Frouin, Vincent; Gallinat, Jürgen; Garavan, Hugh; Gowland, Penny; Heinz, Andreas; Lemaître, Hervé; Mann, Karl F; Martinot, Jean-Luc; Nees, Frauke; Paus, Tomáš; Pausova, Zdenka; Rietschel, Marcella; Robbins, Trevor W; Smolka, Michael N; Spanagel, Rainer; Ströhle, Andreas; Schumann, Gunter; Hawrylycz, Mike; Poline, Jean-Baptiste; Greicius, Michael D
2015-06-12
During rest, brain activity is synchronized between different regions widely distributed throughout the brain, forming functional networks. However, the molecular mechanisms supporting functional connectivity remain undefined. We show that functional brain networks defined with resting-state functional magnetic resonance imaging can be recapitulated by using measures of correlated gene expression in a post mortem brain tissue data set. The set of 136 genes we identify is significantly enriched for ion channels. Polymorphisms in this set of genes significantly affect resting-state functional connectivity in a large sample of healthy adolescents. Expression levels of these genes are also significantly associated with axonal connectivity in the mouse. The results provide convergent, multimodal evidence that resting-state functional networks correlate with the orchestrated activity of dozens of genes linked to ion channel activity and synaptic function. Copyright © 2015, American Association for the Advancement of Science.
Small Increase of Actual Physical Activity 6 Months After Total Hip or Knee Arthroplasty
Bussmann, Hans J.; Stam, Henk J.; Verhaar, Jan A.
2008-01-01
Limitation in daily physical activity is one of the reasons for total hip arthroplasty (THA) or total knee arthroplasty (TKA). However, studies of the effects of THA or TKA generally do not determine actual daily activity as part of physical functioning. We determined the effect of THA or TKA on patients’ actual physical activity and body function (pain, stiffness), capacity to perform tasks, and self-reported physical functioning. We also assessed whether there are differences in the effect of the surgery between patients undergoing THA or TKA and whether the improvements vary between these different outcome measures. We recruited patients with long-standing end-stage osteoarthritis of the hip or knee awaiting THA or TKA. Measurements were performed before surgery and 3 and 6 months after surgery. Actual physical activity improved by 0.7%. Patients’ body function, capacity, and self-reported physical functioning also improved. The effects of the surgery on these aspects of physical functioning were similar for THA and TKA. The effect on actual physical activity (8%) was smaller than on body function (80%–167%), capacity (19%–36%), and self-reported physical functioning (87%–112%). Therefore, in contrast to the large effect on pain and stiffness, patients’ capacity, and their self-reported physical functioning, the improvement in actual physical activity of our patients was less than expected 6 months after surgery. Level of Evidence: Level I, prospective study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18506555
ERIC Educational Resources Information Center
Ross, Samantha Mae; Case, Layne; Leung, Willie
2016-01-01
The introduction of the International Classification of Functioning, Disability and Health has placed emphasis on framing health behavior as a multidimensional construct. In relation to childhood physical activity, this encompasses dimensions of functional performance, activity attendance, and subjective perceptions of involvement and enjoyment…
ERIC Educational Resources Information Center
Wright, F. Virginia; Rosenbaum, Peter L.; Goldsmith, Charles H.; Law, Mary; Fehlings, Darcy L.
2008-01-01
Rehabilitation increasingly addresses the International Classification of Functioning, Disability and Health's (ICF) concepts of activity and participation, but little is known about associations between changes in body functions and structures, activity, and participation. We conducted a before-and-after study of 35 ambulatory children with…
Wilson, J T; Spelsberg, T C
1976-01-01
Adult male rats were subjected either to sham operation or to hypophysectomy and adrenalectomy and maintained for a total of 10 days before treatment with growth hormone. Results of the early effects of growth hormone on the activities of the mixed-function oxidases in rat liver over a 96h period after growth-hormone treatment are presented. 2. Hypophysectomy and adrenalectomy result in decreased body and liver weight and decreased drug metabolism (mixed-function oxidases). Concentrations of electron-transport-system components are also decreased. 3. In the hypophysectomized/adrenalectomized rats, growth hormone decreases the activities of the liver mixed-function oxidases and the cytochrome P-450 and cytochrome c reductases, as well as decreasing the concentration of cytochrome P-450 compared with that of control rats. Similar but less dramatic results are obtained with sham-operated rats. 4. It is concluded that whereas growth hormone enhances liver growth, including induction of many enzyme activities, it results in a decrease in mixed-function oxidase activity. Apparently, mixed-function oxidase activity decreases in liver when growth (mitogenesis) increases. PMID:938458
Physical Activity, Functional Ability, and Obesity in Older Adults: A Gender Difference.
Gretebeck, Kimberlee A; Sabatini, LeAnn M; Black, David R; Gretebeck, Randall J
2017-09-01
Disability, institutionalization, and loss of independence may be directly caused or exacerbated by physical inactivity and obesity. The purpose of the current cross-sectional survey was to explore the impact of gender and obesity on functional ability tasks, physical activity, and psychosocial factors in older adults. Participants comprised 964 University retirees (55% female, mean age = 75.3 years, SD = 6.7 years) with a mean body mass index (BMI) of 26.1 kg/m 2 (SD = 4.7 kg/m 2 ). Results revealed significant gender and BMI interaction effects. Women were less active than men and obese women were most functionally impaired, particularly in activities that target lower extremity function, regardless of weight status. These findings suggest that physical activity interventions for older adults should focus on exercises that improve functional ability and are tailored to meet individual needs while considering weight and gender. Type, intensity, frequency, and duration of exercises should be individualized to limit injuries and improve functional ability and physical activity adherence. [Journal of Gerontological Nursing, 43(9), 38-46.]. Copyright 2017, SLACK Incorporated.
Orthogonal use of a human tRNA synthetase active site to achieve multi-functionality
Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B.; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A.; Schimmel, Paul; Yang, Xiang-Lei
2011-01-01
Protein multi-functionality is an emerging explanation for the complexity of higher organisms. In this regard, while aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, some also act in pathways for inflammation, angiogenesis, and apoptosis. How multiple functions evolved and their relationship to the active site is not clear. Here structural modeling analysis, mutagenesis, and cell-based functional studies show that the potent angiostatic, natural fragment of human TrpRS associates via Trp side chains that protrude from the cognate cellular receptor VE-cadherin. Modeling indicates that (I prefer the way it was because the conclusion was reached not only by modeling, but more so by experimental studies.)VE-cadherin Trp side chains fit into the Trp-specific active site of the synthetase. Thus, specific side chains of the receptor mimic (?) amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multi-functionality of human tRNA synthetases and other proteins. PMID:20010843
Ishii, Tomohiro; Narita, Noriyuki; Endo, Hiroshi
2016-06-01
This study aims to quantitatively clarify the physiological features in rhythmically coordinated jaw and neck muscle EMG activities while chewing gum using EMG-EMG transfer function and EMG-EMG coherence function analyses in 20 healthy subjects. The chewing side masseter muscle EMG signal was used as the reference signal, while the other jaw (non-chewing side masseter muscle, bilateral anterior temporal muscles, and bilateral anterior digastric muscles) and neck muscle (bilateral sternocleidomastoid muscles) EMG signals were used as the examined signals in EMG-EMG transfer function and EMG-EMG coherence function analyses. Chewing-related jaw and neck muscle activities were aggregated in the first peak of the power spectrum in rhythmic chewing. The gain in the peak frequency represented the power relationships between jaw and neck muscle activities during rhythmic chewing. The phase in the peak frequency represented the temporal relationships between the jaw and neck muscle activities, while the non-chewing side neck muscle presented a broad range of distributions across jaw closing and opening phases. Coherence in the peak frequency represented the synergistic features in bilateral jaw closing muscles and chewing side neck muscle activities. The coherence and phase in non-chewing side neck muscle activities exhibited a significant negative correlation. From above, the bilateral coordination between the jaw and neck muscle activities is estimated while chewing when the non-chewing side neck muscle is synchronously activated with the jaw closing muscles, while the unilateral coordination is estimated when the non-chewing side neck muscle is irregularly activated in the jaw opening phase. Thus, the occurrence of bilateral or unilateral coordinated features in the jaw and neck muscle activities may correspond to the phase characteristics in the non-chewing side neck muscle activities during rhythmical chewing. Considering these novel findings in healthy subjects, EMG-EMG transfer function and EMG-EMG coherence function analyses may also be useful to diagnose the pathologically in-coordinated features in jaw and neck muscle activities in temporomandibular disorders and whiplash-associated disorders during critical chewing performance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Zult, Tjerk; Gokeler, Alli; van Raay, Jos J A M; Brouwer, Reinoud W; Zijdewind, Inge; Hortobágyi, Tibor
2017-01-01
The function of the anterior cruciate ligament (ACL) patients' non-injured leg is relevant in light of the high incidence of secondary ACL injuries on the contralateral side. However, the non-injured leg's function has only been examined for a selected number of neuromuscular outcomes and often without appropriate control groups. We measured a broad array of neuromuscular functions between legs of ACL patients and compared outcomes to age, sex, and physical activity matched controls. Thirty-two ACL-deficient patients (208 ± 145 days post-injury) and active and less-active controls (N = 20 each) participated in the study. We measured single- and multi-joint neuromuscular function in both legs in each group and expressed the overall neuromuscular function in each leg by calculating a mean z-score across all neuromuscular measures. A group by leg MANOVA and ANOVA were performed to examine group and leg differences for the selected outcomes. After an ACL injury, duration (-4.3 h/week) and level (Tegner activity score of -3.9) of sports activity decreased and was comparable to less-active controls. ACL patients showed bilateral impairments in the star excursion balance test compared to both control groups (P ≤ 0.004) and for central activation ratio compared to active controls (P ≤ 0.002). There were between-leg differences within each group for maximal quadriceps and hamstring strength, voluntary quadriceps activation, star excursion balance test performance, and single-leg hop distance (all P < 0.05), but there were no significant differences in quadriceps force accuracy and variability, knee joint proprioception, and static balance. Overall neuromuscular function (mean z-score) did not differ between groups, but ACL patients' non-injured leg displayed better neuromuscular function than the injured leg (P < 0.05). Except for poorer dynamic balance and reduced quadriceps activation, ACL patients had no bilateral neuromuscular deficits despite reductions in physical activity after injury. Therapists can use the non-injured leg as a reference to assess the injured leg's function for tasks measured in the present study, excluding dynamic balance and quadriceps activation. Rehabilitation after an ACL injury should be mainly focused on the injured leg. III.
Second-Order Perturbation Theory for Generalized Active Space Self-Consistent-Field Wave Functions.
Ma, Dongxia; Li Manni, Giovanni; Olsen, Jeppe; Gagliardi, Laura
2016-07-12
A multireference second-order perturbation theory approach based on the generalized active space self-consistent-field (GASSCF) wave function is presented. Compared with the complete active space (CAS) and restricted active space (RAS) wave functions, GAS wave functions are more flexible and can employ larger active spaces and/or different truncations of the configuration interaction expansion. With GASSCF, one can explore chemical systems that are not affordable with either CASSCF or RASSCF. Perturbation theory to second order on top of GAS wave functions (GASPT2) has been implemented to recover the remaining electron correlation. The method has been benchmarked by computing the chromium dimer ground-state potential energy curve. These calculations show that GASPT2 gives results similar to CASPT2 even with a configuration interaction expansion much smaller than the corresponding CAS expansion.
Voss, Michelle W; Weng, Timothy B; Burzynska, Agnieszka Z; Wong, Chelsea N; Cooke, Gillian E; Clark, Rachel; Fanning, Jason; Awick, Elizabeth; Gothe, Neha P; Olson, Erin A; McAuley, Edward; Kramer, Arthur F
2016-05-01
Greater physical activity and cardiorespiratory fitness are associated with reduced age-related cognitive decline and lower risk for dementia. However, significant gaps remain in the understanding of how physical activity and fitness protect the brain from adverse effects of brain aging. The primary goal of the current study was to empirically evaluate the independent relationships between physical activity and fitness with functional brain health among healthy older adults, as measured by the functional connectivity of cognitively and clinically relevant resting state networks. To build context for fitness and physical activity associations in older adults, we first demonstrate that young adults have greater within-network functional connectivity across a broad range of cortical association networks. Based on these results and previous research, we predicted that individual differences in fitness and physical activity would be most strongly associated with functional integrity of the networks most sensitive to aging. Consistent with this prediction, and extending on previous research, we showed that cardiorespiratory fitness has a positive relationship with functional connectivity of several cortical networks associated with age-related decline, and effects were strongest in the default mode network (DMN). Furthermore, our results suggest that the positive association of fitness with brain function can occur independent of habitual physical activity. Overall, our findings provide further support that cardiorespiratory fitness is an important factor in moderating the adverse effects of aging on cognitively and clinically relevant functional brain networks. Copyright © 2015 Elsevier Inc. All rights reserved.
Frith, Emily; Loprinzi, Paul D
2017-11-01
We evaluated the association between physical activity and cognitive function among a national sample of the broader U.S. adult population, with consideration by social risk. Data from the 1999-2002 National Health and Nutrition Examination Survey (NHANES) were used to identify 2031 older adults, ages 60-85. Social risk was classified by measuring four NHANES variables, namely poverty level, education, minority status, and social living status, which were graded on a scale of 0-4, with higher scores corresponding with higher social risk. The Digit Symbol Substitution Test (DSST) was used to assess cognitive function. Physical activity was assessed via a validated self-report questionnaire. After adjustments, meeting physical activity guidelines (vs not) was associated with greater cognitive function (β = 3.0, 95% CI [1.5, 4.4], p < 0.001). In this same model, social risk status was also independently associated with cognitive function. Meeting physical activity guidelines (vs. not) was not associated with higher cognitive function among those with a social risk score of of 3 (β = -0.01; 95% CI [-6.3, 6.4], p = 0.99) or a social risk score of 4 (β = -6.8, 95% CI [-15.7, 2.0], p = 0.12). In this national sample of older adults, meeting physical activity guidelines, and degree of social risk were independently associated with cognitive function. However, physical activity was not associated with cognitive function among older adults with the highest degree of social risk.
Voss, Michelle W.; Weng, Timothy B.; Burzynska, Agnieszka Z.; Wong, Chelsea N.; Cooke, Gillian E.; Clark, Rachel; Fanning, Jason; Awick, Elizabeth; Gothe, Neha P.; Olson, Erin A.; McAuley, Edward; Kramer, Arthur F.
2015-01-01
Greater physical activity and cardiorespiratory fitness are associated with reduced age-related cognitive decline and lower risk for dementia. However, significant gaps remain in the understanding of how physical activity and fitness protect the brain from adverse effects of brain aging. The primary goal of the current study was to empirically evaluate the independent relationships between physical activity and fitness with functional brain health among healthy older adults, as measured by the functional connectivity of cognitively and clinically relevant resting state networks. To build context for fitness and physical activity associations in older adults, we first demonstrate that young adults have greater within-network functional connectivity across a broad range of cortical association networks. Based on these results and previous research, we predicted that individual differences in fitness and physical activity would be most strongly associated with functional integrity of the networks most sensitive to aging. Consistent with this prediction, and extending on previous research, we showed that cardiorespiratory fitness has a positive relationship with functional connectivity of several cortical networks associated with age-related decline, and effects were strongest in the Default Mode Network (DMN). Furthermore, our results suggest that the positive association of fitness with brain function can occur independent of habitual physical activity. Overall, our findings provide further support that cardiorespiratory fitness is an important factor in moderating the adverse effects of aging on cognitively and clinically relevant functional brain networks. PMID:26493108
26 CFR 1.892-4T - Commercial activities (temporary regulations).
Code of Federal Regulations, 2010 CFR
2010-04-01
... current or future production of income or gain are commercial activities. An activity may be considered a... railroad is not a non-profit activity. (4) Governmental functions. Governmental functions are not commercial activities. The term “governmental functions” shall be determined under U.S. standards. In general...
26 CFR 1.892-4T - Commercial activities (temporary regulations).
Code of Federal Regulations, 2011 CFR
2011-04-01
... current or future production of income or gain are commercial activities. An activity may be considered a... railroad is not a non-profit activity. (4) Governmental functions. Governmental functions are not commercial activities. The term “governmental functions” shall be determined under U.S. standards. In general...
26 CFR 1.892-4T - Commercial activities (temporary regulations).
Code of Federal Regulations, 2014 CFR
2014-04-01
... current or future production of income or gain are commercial activities. An activity may be considered a... railroad is not a non-profit activity. (4) Governmental functions. Governmental functions are not commercial activities. The term “governmental functions” shall be determined under U.S. standards. In general...
26 CFR 1.892-4T - Commercial activities (temporary regulations).
Code of Federal Regulations, 2013 CFR
2013-04-01
... current or future production of income or gain are commercial activities. An activity may be considered a... railroad is not a non-profit activity. (4) Governmental functions. Governmental functions are not commercial activities. The term “governmental functions” shall be determined under U.S. standards. In general...
26 CFR 1.892-4T - Commercial activities (temporary regulations).
Code of Federal Regulations, 2012 CFR
2012-04-01
... current or future production of income or gain are commercial activities. An activity may be considered a... railroad is not a non-profit activity. (4) Governmental functions. Governmental functions are not commercial activities. The term “governmental functions” shall be determined under U.S. standards. In general...
Alkan, Yelda; Biswal, Bharat B.; Alvarez, Tara L.
2011-01-01
Purpose Eye movement research has traditionally studied solely saccade and/or vergence eye movements by isolating these systems within a laboratory setting. While the neural correlates of saccadic eye movements are established, few studies have quantified the functional activity of vergence eye movements using fMRI. This study mapped the neural substrates of vergence eye movements and compared them to saccades to elucidate the spatial commonality and differentiation between these systems. Methodology The stimulus was presented in a block design where the ‘off’ stimulus was a sustained fixation and the ‘on’ stimulus was random vergence or saccadic eye movements. Data were collected with a 3T scanner. A general linear model (GLM) was used in conjunction with cluster size to determine significantly active regions. A paired t-test of the GLM beta weight coefficients was computed between the saccade and vergence functional activities to test the hypothesis that vergence and saccadic stimulation would have spatial differentiation in addition to shared neural substrates. Results Segregated functional activation was observed within the frontal eye fields where a portion of the functional activity from the vergence task was located anterior to the saccadic functional activity (z>2.3; p<0.03). An area within the midbrain was significantly correlated with the experimental design for the vergence but not the saccade data set. Similar functional activation was observed within the following regions of interest: the supplementary eye field, dorsolateral prefrontal cortex, ventral lateral prefrontal cortex, lateral intraparietal area, cuneus, precuneus, anterior and posterior cingulates, and cerebellar vermis. The functional activity from these regions was not different between the vergence and saccade data sets assessed by analyzing the beta weights of the paired t-test (p>0.2). Conclusion Functional MRI can elucidate the differences between the vergence and saccade neural substrates within the frontal eye fields and midbrain. PMID:22073141
Liao, Wan-Wen; Wu, Ching-Yi; Hsieh, Yu-Wei; Lin, Keh-Chung; Chang, Wan-Ying
2012-02-01
To compare the outcome of robot-assisted therapy with dose-matched active control therapy by using accelerometers to study functional recovery in chronic stroke patients. Prospective, randomized, controlled trial. Stroke units in three medical centres. Twenty patients post stroke for a mean of 22 months. Robot-assisted therapy (n = 10) or dose-matched active control therapy (n = 10). All patients received either of these two therapies for 90-105 minutes each day, 5 days per week, for four weeks. Outcome measures included arm activity ratio (the ratio of mean activity between the impaired and unimpaired arm) and scores on the Fugl-Meyer Assessment Scale, Functional Independence Measure, Motor Activity Log and ABILHAND questionnaire. The robot-assisted therapy group significantly increased motor function, hemiplegic arm activity and bilateral arm coordination (Fugl-Meyer Assessment Scale: 51.20 ± 8.82, P = 0.002; mean arm activity ratio: 0.76 ± 0.10, P = 0.026; ABILHAND questionnaire: 1.24 ± 0.28, P = 0.043) compared with the dose-matched active control group (Fugl-Meyer Assessment Scale: 40.90 ± 13.14; mean arm movement ratio: 0.69 ± 0.11; ABILHAND questionnaire: 0.95 ± 0.43). Symmetrical and bilateral robotic practice, combined with functional task training, can significantly improve motor function, arm activity, and self-perceived bilateral arm ability in patients late after stroke.
Function of the parotid gland in juvenile recurrent parotitis: a case series.
Xie, Li-song; Pu, Yi-ping; Zheng, Ling-yan; Yu, Chuang-qi; Wang, Zhi-jun; Shi, Huan
2016-04-01
Our aim was to find out how the parotid gland functions in 44 patients with juvenile recurrent parotitis, and to assess the value of measuring the serum amylase activity. Clinical and personal details were recorded, and all patients had their serum amylase activity measured together with sialography during the chronic phase. The function of the gland was classified by sialographic images. The chi square test and Spearman's rank correlation coefficient were used in the statistical analyses. There was a significant association between the degree of glandular function and serum amylase activity (p=0.014). The patients with unilateral and bilateral disease differed significantly in their degree of glandular function (p=0.020), those with bilateral disease having poorer function. There were no significant correlations between other clinical variables and glandular function. Serum amylase activity is an important diagnostic variable in juvenile recurrent parotitis, and poor parotid function reflects the severity of the disease. Copyright © 2016 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Saliva Microbiota Carry Caries-Specific Functional Gene Signatures
Chang, Xingzhi; Yuan, Xiao; Tu, Qichao; Yuan, Tong; Deng, Ye; Hemme, Christopher L.; Van Nostrand, Joy; Cui, Xinping; He, Zhili; Chen, Zhenggang; Guo, Dawei; Yu, Jiangbo; Zhang, Yue; Zhou, Jizhong; Xu, Jian
2014-01-01
Human saliva microbiota is phylogenetically divergent among host individuals yet their roles in health and disease are poorly appreciated. We employed a microbial functional gene microarray, HuMiChip 1.0, to reconstruct the global functional profiles of human saliva microbiota from ten healthy and ten caries-active adults. Saliva microbiota in the pilot population featured a vast diversity of functional genes. No significant distinction in gene number or diversity indices was observed between healthy and caries-active microbiota. However, co-presence network analysis of functional genes revealed that caries-active microbiota was more divergent in non-core genes than healthy microbiota, despite both groups exhibited a similar degree of conservation at their respective core genes. Furthermore, functional gene structure of saliva microbiota could potentially distinguish caries-active patients from healthy hosts. Microbial functions such as Diaminopimelate epimerase, Prephenate dehydrogenase, Pyruvate-formate lyase and N-acetylmuramoyl-L-alanine amidase were significantly linked to caries. Therefore, saliva microbiota carried disease-associated functional signatures, which could be potentially exploited for caries diagnosis. PMID:24533043
Saliva microbiota carry caries-specific functional gene signatures.
Yang, Fang; Ning, Kang; Chang, Xingzhi; Yuan, Xiao; Tu, Qichao; Yuan, Tong; Deng, Ye; Hemme, Christopher L; Van Nostrand, Joy; Cui, Xinping; He, Zhili; Chen, Zhenggang; Guo, Dawei; Yu, Jiangbo; Zhang, Yue; Zhou, Jizhong; Xu, Jian
2014-01-01
Human saliva microbiota is phylogenetically divergent among host individuals yet their roles in health and disease are poorly appreciated. We employed a microbial functional gene microarray, HuMiChip 1.0, to reconstruct the global functional profiles of human saliva microbiota from ten healthy and ten caries-active adults. Saliva microbiota in the pilot population featured a vast diversity of functional genes. No significant distinction in gene number or diversity indices was observed between healthy and caries-active microbiota. However, co-presence network analysis of functional genes revealed that caries-active microbiota was more divergent in non-core genes than healthy microbiota, despite both groups exhibited a similar degree of conservation at their respective core genes. Furthermore, functional gene structure of saliva microbiota could potentially distinguish caries-active patients from healthy hosts. Microbial functions such as Diaminopimelate epimerase, Prephenate dehydrogenase, Pyruvate-formate lyase and N-acetylmuramoyl-L-alanine amidase were significantly linked to caries. Therefore, saliva microbiota carried disease-associated functional signatures, which could be potentially exploited for caries diagnosis.
Modelling the maximum voluntary joint torque/angular velocity relationship in human movement.
Yeadon, Maurice R; King, Mark A; Wilson, Cassie
2006-01-01
The force exerted by a muscle is a function of the activation level and the maximum (tetanic) muscle force. In "maximum" voluntary knee extensions muscle activation is lower for eccentric muscle velocities than for concentric velocities. The aim of this study was to model this "differential activation" in order to calculate the maximum voluntary knee extensor torque as a function of knee angular velocity. Torque data were collected on two subjects during maximal eccentric-concentric knee extensions using an isovelocity dynamometer with crank angular velocities ranging from 50 to 450 degrees s(-1). The theoretical tetanic torque/angular velocity relationship was modelled using a four parameter function comprising two rectangular hyperbolas while the activation/angular velocity relationship was modelled using a three parameter function that rose from submaximal activation for eccentric velocities to full activation for high concentric velocities. The product of these two functions gave a seven parameter function which was fitted to the joint torque/angular velocity data, giving unbiased root mean square differences of 1.9% and 3.3% of the maximum torques achieved. Differential activation accounts for the non-hyperbolic behaviour of the torque/angular velocity data for low concentric velocities. The maximum voluntary knee extensor torque that can be exerted may be modelled accurately as the product of functions defining the maximum torque and the maximum voluntary activation level. Failure to include differential activation considerations when modelling maximal movements will lead to errors in the estimation of joint torque in the eccentric phase and low velocity concentric phase.
Papma, Janne M; Smits, Marion; de Groot, Marius; Mattace Raso, Francesco U; van der Lugt, Aad; Vrooman, Henri A; Niessen, Wiro J; Koudstaal, Peter J; van Swieten, John C; van der Veen, Frederik M; Prins, Niels D
2017-09-01
Diminished function of the posterior cingulate cortex (PCC) is a typical finding in early Alzheimer's disease (AD). It is hypothesized that in early stage AD, PCC functioning relates to or reflects hippocampal dysfunction or atrophy. The aim of this study was to examine the relationship between hippocampus function, volume and structural connectivity, and PCC activation during an episodic memory task-related fMRI study in mild cognitive impairment (MCI). MCI patients (n = 27) underwent episodic memory task-related fMRI, 3D-T1w MRI, 2D T2-FLAIR MRI and diffusion tensor imaging. Stepwise linear regression analysis was performed to examine the relationship between PCC activation and hippocampal activation, hippocampal volume and diffusion measures within the cingulum along the hippocampus. We found a significant relationship between PCC and hippocampus activation during successful episodic memory encoding and correct recognition in MCI patients. We found no relationship between the PCC and structural hippocampal predictors. Our results indicate a relationship between PCC and hippocampus activation during episodic memory engagement in MCI. This may suggest that during episodic memory, functional network deterioration is the most important predictor of PCC functioning in MCI. • PCC functioning during episodic memory relates to hippocampal functioning in MCI. • PCC functioning during episodic memory does not relate to hippocampal structure in MCI. • Functional network changes are an important predictor of PCC functioning in MCI.
Gabriel, Kelley Pettee; Sternfeld, Barbara; Colvin, Alicia; Stewart, Andrea; Strotmeyer, Elsa S.; Cauley, Jane A.; Dugan, Sheila; Karvonen-Gutierrez, Carrie
2018-01-01
The purpose of this study was to examine the importance of midlife physical activity on physical functioning in later life. Data are from 1771 Study of Women’s Health Across the Nation (SWAN) participants, aged 42–52 (46.4 ± 2.7) years at baseline (1996–97). Latent class growth analysis was used to identify physical activity trajectory groups using reported sports and exercise index data collected at seven time-points from baseline to Visit 13 (2011–13); objective measures of physical functioning performance were collected at Visit 13. The sports and exercise index (henceforth: physical activity) is a measure of moderate to vigorous intensity physical activity during discretionary periods of the day. Multivariable linear regression analyses were used to model each continuous physical performance measure as a function of the physical activity trajectory class. Across midlife, five physical activity trajectory classes emerged, including: lowest (26.2% of participants), increasing (13.4%), decreasing (22.4%), middle (23.9%), and highest (14.1%) physical activity. After full adjustment, women included in the middle and highest physical activity groups demonstrated ≥5% better physical functioning performance than those who maintained low physical activity levels (all comparisons; p < 0.05). Statistically significant differences were also noted when physical activity trajectory groups were compared to the increasing physical activity group. Results from the current study support health promotion efforts targeting increased (or maintenance of) habitual physical activity in women during midlife to reduce future risk of functional limitations and disability. These findings have important public health and clinical relevance as future generations continue to transition into older adulthood. PMID:28987336