Cloning and expression of a small heat and salt tolerant protein (Hsp22) from Chaetomium globosum.

PubMed

Aggarwal, Rashmi; Gupta, Sangeeta; Sharma, Sapna; Banerjee, Sagar; Singh, Priyanka

2012-11-01

The present study reports molecular characterization of small heat shock protein gene in Indian isolates of Chaetomium globosum, C. perlucidum, C. reflexum, C. cochlioides and C. cupreum. Six isolates of C. globosum and other species showed a band of 630bp using specific primers. Amplified cDNA product of C. globosum (Cg 1) cloned and sequenced showed 603bp open reading frame encoding 200 amino-acids. The protein sequence had a molecular mass of 22 kDa and was therefore, named Hsp22. BlastX analysis revealed that the gene codes for a protein homologous to previously characterized Hsp22.4 gene from C. globosum (AAR36902.1, XP 001229241.1) and shared 95% identity in amino acid sequence. It also showed varying degree of similarities with small Hsp protein from Neurospora spp. (60%), Myceliophthora sp. (59%), Glomerella sp. (50%), Hypocrea sp. (52%), and Fusarium spp. (51%). This gene was further cloned into pET28a (+) and transformed E. coli BL21 cells were induced by IPTG, and the expressed protein of 30 kDa was analyzed by SDS-PAGE. The IPTG induced transformants displayed significantly greater resistance to NaCl and Na2CO3 stresses.

Endophytic fungus strain 28 isolated from Houttuynia cordata possesses wide-spectrum antifungal activity.

PubMed

Pan, Feng; Liu, Zheng-Qiong; Chen, Que; Xu, Ying-Wen; Hou, Kai; Wu, Wei

2016-01-01

The aim of this paper is to identify and investigate an endophytic fungus (strain 28) that was isolated from Houttuynia cordata Thunb, a famous and widely-used Traditional Chinese Medicine. Based on morphological methods and a phylogenetic analysis of ITS sequences, this strain was identified as Chaetomium globosum. An antifungal activity bioassay demonstrated that the crude ethyl acetate (EtOAc) extracts of strain 28 had a wide antifungal spectrum and strong antimicrobial activity, particularly against Exserohilum turcicum (Pass.) Leonard et Suggs, Botrytis cinerea persoon and Botrytis cinerea Pers. ex Fr. Furthermore, the fermentation conditions, extraction method and the heat stability of antifungal substances from strain 28 were also studied. The results showed that optimal antifungal activity can be obtained with the following parameters: using potato dextrose broth (PDB) as the base culture medium, fermentation for 4-8d (initial pH: 7.5), followed by extraction with EtOAc. The extract was stable at temperatures up to 80°C. This is the first report on the isolation of endophytic C. globosum from H. cordata to identify potential alternative biocontrol agents that could provide new opportunities for practical applications involving H. cordata. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Expression and Characterization of a Novel Antifungal Exo-β-1,3-glucanase from Chaetomium cupreum.

PubMed

Jiang, Cheng; Song, Jinzhu; Cong, Hua; Zhang, Junzheng; Yang, Qian

2017-05-01

A novel β-1,3-glucanase gene, designated Ccglu17A, was cloned from the biological control fungus Chaetomium cupreum Ame. Its 1626-bp open reading frame encoded 541 amino acids. The corresponding amino acid sequence showed highest identity (67 %) with a glycoside hydrolase family 17 β-1,3-glucanase from Chaetomium globosum. The recombinant protein Ccglu17A was successfully expressed in Pichia pastoris, and the enzyme was purified to homogeneity with 10.1-fold purification and 47.8 % recovery yield. The protein's molecular mass was approximately 65 kDa, and its maximum activity appeared at pH 5.0 and temperature 45 °C. Heavy metal ions Fe 2+ , Mn 2+ , Cu 2+ , Co 2+ , Ag + , and Hg 2+ had inhibitory effects on Ccglu17A, but Ba 2+ promoted the enzyme's activity. Ccglu17A exhibited high substrate specificity, almost exclusively catalyzing β-1,3-glycosidic bond cleavage in various polysaccharoses to liberate glucose. The enzyme had a Km of 2.84 mg/mL and Vmax of 10.7 μmol glucose/min/mg protein for laminarin degradation under optimal conditions. Ccglu17A was an exoglucanase with transglycosylation activity based on its hydrolytic properties. It showed potential antifungal activity with a degradative effect on cell walls and inhibitory action against the germination of pathogenic fungus. In conclusion, Ccglu17A is the first functional exo-1,3-β-glucanase to be identified from C. cupreum and has potential applicability in industry and agriculture.

Nonsteroidal Anti-inflammatory Drugs (NSAIDS) Inhibit the Growth and Reproduction of Chaetomium globosum and Other Fungi Associated with Water-Damaged Buildings.

PubMed

Dalmont, Kelsey; Biles, Charles L; Konsure, Heather; Dahal, Sujita; Rowsey, Tyler; Broge, Matthew; Poudyal, Shubhra; Gurung, Tara; Shrestha, Sabina; Biles, Caleb L; Cluck, Terry; Howard, Alisha

2017-12-01

Indoor mold due to water damage causes serious human respiratory disorders, and the remediation to homes, schools, and businesses is a major expense. Prevention of mold infestation of building materials would reduce health problems and building remediation costs. Nonsteroidal anti-inflammatory drugs (NSAIDs) inhibit yeasts and a limited number of filamentous fungi. The purpose of this research was to determine the possible inhibitory activity of nonsteroidal anti-inflammatory drugs (NSAIDs) on germination, fungal growth, and reproduction of Chaetomium globosum and other important filamentous fungi that occur in water-damaged buildings. Several NSAIDs were found to inhibit C. globosum germination, growth, and reproduction. The most effective NSAIDs inhibiting C. globosum were ibuprofen, diflunisal, and diclofenac. Fusarium oxysporum, Fusarium solani, Aspergillus niger, and Stachybotrys atra were also tested on the various media with similar results obtained. However, F. oxysporum and A. niger exhibited a higher level of resistance to aspirin and NaSAL when compared to the C. globosum isolates. The inhibition exhibited by NSAIDs was variable depending on growth media and stage of fungal development. These compounds have a great potential of inhibiting fungal growth on building materials such as gypsum board. Formulations of sprays or building materials with NSAID-like chemical treatments may hold promise in reducing mold in homes and buildings.

Identification and characterization of the major antifungal substance against Fusarium Sporotrichioides from Chaetomium globosum.

PubMed

Jiang, Cheng; Song, Jinzhu; Zhang, Junzheng; Yang, Qian

2017-06-01

Fusarium sporotrichioides, is a common soil-borne plant pathogen causing dry rot of potato in Northeast China. The objective of this study was to identify the main antifungal substances from Chaetomium globosum W7 against F. sporotrichioides. Strain W7 can significantly inhibit F. sporotrichioides without direct contact, suggesting that its antifungal substance was extracellular, and the solubility of this antifungal substance in ethyl acetate was superior to that in water. Acetone was selected as the optimum solvent for the extraction of the metabolites of C. globosum. Metabolites were then separated with thin-layer chromatography. Following antifungal tests on bands, a dark brown band with Rf value of 0.20 was determined as the antifungal substance, and identified as chaetoglobosin A. The antifungal activity test showed that the minimum inhibitory concentration of chaetoglobosin A to F. sporotrichioides was 9.45-10.50 μg/mL, IC50 being 4.344 μg/mL. Chaetoglobosin A also proved to have an excellent preventive effect on potato dry rot caused by F. sporotrichioides. To summarize, chaetoglobosin A was identified as the main active substance of C. globosum to inhibit F. sporotrichioides for the first time, and demonstrated a potential application value in agriculture.

Biodegradation of PCL and PVC: Chaetomium globosum (ATCC 16021) activity.

PubMed

Vivi, Viviane Karolina; Martins-Franchetti, Sandra Mara; Attili-Angelis, Derlene

2018-06-07

The increasing use of plastics in human activities has resulted in an enormous amount of residues which became a matter of great environmental concern. Scientific studies on the microbial degradation of natural and synthetic molecules show the potential of fungal application on cleaning technologies. The biodegradation of PCL (polycaprolactone) and PVC (polyvinyl chloride) films by Aspergillus brasiliensis (ATCC 9642), Penicillium funiculosum (ATCC 11797), Chaetomium globosum (ATCC 16021), Trichoderma virens (ATCC 9645), and Paecilomyces variotii (ATCC 16023) was studied. According to ISO 846-1978-"Testing of Plastics - Influence of fungi and bacteria", samples of the studied polymers were inoculated with a mix suspension of 10 6 fungal inoculum and maintained in moisture glass chambers in a bacteriological incubator at 28 °C for 28 days. The samples were analyzed by means of morphological and color changes, mass loss, optical microscopy (OM), and scanning electron microscopy (SEM) after 28 days of culturing. After the incubation period, visual observations of the PCL films showed many micropores and cracks, pigmentation, surface erosion and hyphal adhesion on the sample surfaces, and a mass loss of up to 75%. On the contrary, there was no evidence of PVC biodegradation, such as changes in color and significant mass loss. Chaetomium globosum ATCC 16021 was a pioneer in the colonization and attack of PCL, resulting in significant mass losses. Although PVC was less attacked by the ascomycete, the polymer supported the adhesion and growth of its fertile structures (perithecia), suggesting the fungal potential to degrade both plastics.

In vitro antagonism of cotton seedlings fungi and characterization of chitinase isozyme activities in Trichoderma harzianum.

PubMed

Asran-Amal, A; Moustafa-Mahmoud, S M; Sabet, K K; El Banna, O H

2010-04-01

The antagonistic fungus Trichoderma harzianum is widely recognized as a potential biocontrol agent against several soil-borne plant pathogens. T. harzinum is rich source of chitinoltic enzymes. In vitro screening of 5 isolates of T. harzinum, one isolate of Chaetomium globosum and one isolate of Conetherium mentance, revealed that all of them had reduced growth area of Macrophomina phaseolina, Fusarium solani and Rhizoctonia solani on PDA medium, significantly. The inhibition percentage ranged from 77.9 % to 55.9% for M. phaseolina and 59.2% to 40.4% for R. solani by T. harzinum and C. mentance, respectively. Inhibition for F. solani ranged from 76.5% to 55.7% by T. harzinum and C. globosum, respectively. Isozyme gel electrophoresis was used to assess chitinase activity secreted by selected isolates of T. harzinum under different pH degrees and temperatures. Obtained results indicated that activity of chitinase isozyme produced at 30 °C was higher than 15-20 °C for all tested isolates and activity of chitinase produced by isolates No. 4 and 5 of T. harzinum at pH (7-7.5) was higher than at pH 6, respectively.

Indole Alkaloids from Chaetomium globosum.

PubMed

Xu, Guo-Bo; He, Gu; Bai, Huan-Huan; Yang, Tao; Zhang, Guo-Lin; Wu, Lin-Wei; Li, Guo-You

2015-07-24

Two new indole alkaloids chaetocochin J (1) and chaetoglobinol A (8), along with chetomin (2), chetoseminudin A (3), cochliodinol (9), and semicochliodinol (10), were isolated from the rice culture of the fungus Chaetomium globosum. Their structures were elucidated by spectral analysis. Three new epipolythiodioxopiperazines, chaetocochins G-I (5-7), were identified by the combination of UPLC and mass spectrometric analysis. Chaetocochin I contained two sulfur bridges, one formed by three sulfur atoms between C-3 and C-11a, and the other formed by four sulfur atoms between C-3' and C-6'. Chaetocochin I was readily transformed into chetomin (2), chetoseminudin A (3), chaetocochin D (4), chaetocochin G (5), and chaetocochin H (6) by losing sulfur atoms. Compounds 1-3, and 8 exhibited antibacterial activities against Bacillus subtilis with MICs of 25, 0.78, 0.78, and 50 μg/mL, respectively, but not against Gram-negative bacterium (Escherichia coli). Compounds 2 and 8 were inactive against Candida albicans, Fusarium graminearum, Fusarium vasinfectum, Saccharomyces cerevisiae, and Aspergillus niger even at the high concentrations of 200 and 100 μg/mL, respectively. Compound 8 showed free radical scavenging capacity against the 1,1-diphenyl-2-picryl-hydrazyl (DPPH) and 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid radical (ABTS(+•)), with IC50 values of 143.6 and 45.2 μM, respectively. The free radical scavenging capacity rates of compounds 1-3 on the DPPH and ABTS(+•) were less than 20% at the test concentrations (89.9-108.3 μM). The superoxide anion radical scavenging assay indicated that compounds 1-3, and 8 showed 14.8% (90.9 μM), 18.1% (90.9 μM), 51.5% (88.3 μM), and 30.4% (61.3 μM) superoxide anion radical scavenging capacity, respectively.

[Chemical constituents from endophyte Chaetomium globosum in Imperata cylindrical].

PubMed

Shen, Li; Zhu, Li; Wei, Zhong-qi; Li, Xiao-wen; Li, Ming; Song, Yong-chun

2015-12-01

Isolation and purification of chemical constituents from solid culture of endophyte Chaetomium globosum in Imperata cylindrical was performed through silica gel column chromatography, gel filtration over Sephadex LH-20 and preparative HPLC. Nine compounds were obtained and their structures were determined as chaetoglobosin F(1), chaetoglobosin Fex(2), chaetoglobosin E(3) cytoglobosin A(4), penochalasin C(S), isochaetoglobosin D (6), N-benzoylphenylalaninyl-N-benzoyphenylalaninate(7), uracil(8) and 5-methyluracil(9), respectively, based on HR-MS and NMR data and comparison with literatures. Compound 7 was isolated from Chaeeomium sp. for the first time. In vitro cytotoxicity of compounds was evaluated using MTT mothed and 1,3,4 and 5 showed inhibition activity to the human cervical carcinoma cell HeLa with IC50 values of 99.43, 23.77, 97.92, 86.25 micromol x L(-1), while positive cotolocisnin Ad apno1ch alse IC50 24.33 micromol x L(-1).

The sirodesmin biosynthetic gene cluster of the plant pathogenic fungus Leptosphaeria maculans.

PubMed

Gardiner, Donald M; Cozijnsen, Anton J; Wilson, Leanne M; Pedras, M Soledade C; Howlett, Barbara J

2004-09-01

Sirodesmin PL is a phytotoxin produced by the fungus Leptosphaeria maculans, which causes blackleg disease of canola (Brassica napus). This phytotoxin belongs to the epipolythiodioxopiperazine (ETP) class of toxins produced by fungi including mammalian and plant pathogens. We report the cloning of a cluster of genes with predicted roles in the biosynthesis of sirodesmin PL and show via gene disruption that one of these genes (encoding a two-module non-ribosomal peptide synthetase) is essential for sirodesmin PL biosynthesis. Of the nine genes in the cluster tested, all are co-regulated with the production of sirodesmin PL in culture. A similar cluster is present in the genome of the opportunistic human pathogen Aspergillus fumigatus and is most likely responsible for the production of gliotoxin, which is also an ETP. Homologues of the genes in the cluster were also identified in expressed sequence tags of the ETP producing fungus Chaetomium globosum. Two other fungi with publicly available genome sequences, Magnaporthe grisea and Fusarium graminearum, had similar gene clusters. A comparative analysis of all four clusters is presented. This is the first report of the genes responsible for the biosynthesis of an ETP. Copyright 2004 Blackwell Publishing Ltd

Military Requirements for JP-8 Reformers and Solid Oxide Fuel Cell Power Systems

DTIC Science & Technology

2005-12-01

U.S. And European groups of fun- gus commonly used for testing Aspergillus niger , Aspergillus terreus, Paecilomyces varioti, Penicillium...funiculosum, Penicillium ochro-chloron, Scopulariopsis brevicaulis, Aspergillus flavus, Aspergillus versicolor, Penicillium funiculosum, Chaetomium globosum

Pre-contamination of new gypsum wallboard with potentially harmful fungal species.

PubMed

Andersen, B; Dosen, I; Lewinska, A M; Nielsen, K F

2017-01-01

Gypsum wallboard is a popular building material, but is also very frequently overgrown by Stachybotrys chartarum after severe and/or undetected water damage. The purpose of this study was to determine whether Stachybotrys and other fungi frequently isolated from wet gypsum wallboard are already present in the panels directly from the factory. Surface-disinfected gypsum disks were wetted with sterile water, sealed, and incubated for 70 days. The results showed that Neosartorya hiratsukae (≡ Aspergillus hiratsukae) was the most dominant fungus on the gypsum wallboard followed by Chaetomium globosum and Stachybotrys chartarum. Our results suggest that these three fungal species are already embedded in the materials, presumably in the paper/carton layer surrounding the gypsum core, before the panels reach the retailers/building site. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Potential allelopathic azaphilones produced by the endophytic Chaetomium globosum TY1 inhabited in Ginkgo biloba using the one strain-many compounds method.

PubMed

Wang, Dacheng; Zhang, Yamei; Li, Xiang; Pan, Hongyu; Chang, Mengyuan; Zheng, Tianyu; Sun, Jinzhu; Qiu, Daren; Zhang, Mingzhe; Wei, Dongsheng; Qin, Jianchun

2017-03-01

On the basis of the one strain-many compounds strategy, seven azaphilones, including Chaetomugilin A (1), D (2), S (3), I (4), J (5), Q (6) and O (7), were isolated from the endophytic Chaetomium globosum TY1. Their structures were identified by NMR and HRESIMS spectrometry data. All azaphilones were evaluated for plant growth regulation using eight species of herbaceous plant seeds seedling growth bioassay, which showed the plant growth influence of the seedling. Among these compounds tested, Chaetomugilin O (7) with tetrahydrofuran exhibited higher response index and lower IC 50 values than positive control glyphosate, a broad-spectrum systemic herbicide. 1-3 also showed better or similar inhibit activity to glyphosate. The structure-allelopathic activity relationship analysis of these isolated azaphilones indicates that both tetrahydrofuran and tetrahydrofuran combine with lactones ring groups give potent inhibition of seedling growth. Chaetomugilin O and Chaetomugilin A, D, S could be used to develop natural eco-friendly herbicides.

Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

EPA Science Inventory

The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

Anti-rheumatoid Activity of Secondary Metabolites Produced by Endophytic Chaetomium globosum

PubMed Central

Abdel-Azeem, Ahmed M.; Zaki, Sherif M.; Khalil, Waleed F.; Makhlouf, Noha A.; Farghaly, Lamiaa M.

2016-01-01

The aim of the present study was to investigate the anti-rheumatoid activity of secondary metabolites produced by endophytic mycobiota in Egypt. A total of 27 endophytic fungi were isolated from 10 dominant medicinal plant host species in Wadi Tala, Saint Katherine Protectorate, arid Sinai, Egypt. Of those taxa, seven isolates of Chaetomium globosum (CG1–CG7), being the most frequent taxon, were recovered from seven different host plants and screened for production of active anti-inflammatory metabolites. Isolates were cultivated on half – strength potato dextrose broth for 21 days at 28°C on a rotatory shaker at 180 rpm, and extracted in ethyl acetate and methanol, respectively. The probable inhibitory effects of both extracts against an adjuvant induced arthritis (AIA) rat model were examined and compared with the effects of methotrexate (MTX) as a standard disease-modifying anti-rheumatoid drug. Disease activity and mobility scoring of AIA, histopathology and transmission electron microscopy (TEM) were used to evaluate probable inhibitory roles. A significant reduction (P < 0.05) in the severity of arthritis was observed in both the methanolic extract of CG6 (MCG6) and MTX treatment groups 6 days after treatment commenced. The average arthritis score of the MCG6 treatment group was (10.7 ± 0.82) compared to (13.8 ± 0.98) in the positive control group. The mobility score of the MCG6 treatment group (1.50 ± 0.55) was significantly lower than that of the positive control group (3.33 ± 0.82). In contrast, the ethyl acetate extract of CG6 (EACG6) treatment group showed no improvements in arthritis and mobility scores in AIA model rats. Histopathology and TEM findings confirmed the observation. Isolate CG6 was subjected to sequencing for confirmation of phenotypic identification. The internal transcribed spacer (ITS) 1–5.8 s – ITS2 rDNA sequences obtained were compared with those deposited in the GenBank Database and registered with accession number KC811080 in the NCBI Database. The present study revealed that the methanol extract of endophytic fungus C. globosum (KC811080) recovered from maidenhair fern has an inhibitory effect on inflammation, histopathology and morphological features of rheumatoid arthritis in an AIA rat model. PMID:27703452

Efficacy of Chaetomium Species as Biological Control Agents against Phytophthora nicotianae Root Rot in Citrus

PubMed Central

Wattanachai, Pongnak; Kasem, Soytong; Poeaim, Supattra

2015-01-01

Thailand is one of the largest citrus producers in Southeast Asia. Pathogenic infection by Phytophthora, however, has become one of major impediments to production. This study identified a pathogenic oomycete isolated from rotted roots of pomelo (Citrus maxima) in Thailand as Phytophthora nicotianae by the internal transcribed spacer ribosomal DNA sequence analysis. Then, we examined the in vitro and in vivo effects of Chaetomium globosum, Chaetomium lucknowense, Chaetomium cupreum and their crude extracts as biological control agents in controlling this P. nicotianae strain. Represent as antagonists in biculture test, the tested Chaetomium species inhibited mycelial growth by 50~56% and parasitized the hyphae, resulting in degradation of P. nicotianae mycelia after 30 days. The crude extracts of these Chaetomium species exhibited antifungal activities against mycelial growth of P. nicotianae, with effective doses of 2.6~101.4 µg/mL. Under greenhouse conditions, application of spores and methanol extracts of these Chaetomium species to pomelo seedlings inoculated with P. nicotianae reduced root rot by 66~71% and increased plant weight by 72~85% compared to that in the control. The method of application of antagonistic spores to control the disease was simple and economical, and it may thus be applicable for large-scale, highly effective biological control of this pathogen. PMID:26539045

Corneal ulcer due to a rare coelomycetes fungus Chaetomium strumarium: Case report and global review of Chaetomium keratomycosis.

PubMed

Reddy, Mamatha; Venugopal, Ramya; Prakash, Peralam Yegneswaran; Kamath, Yogish Subraya

2017-09-01

We present a rare case of corneal ulcer caused by a species of a coelomycetes fungus, Chaetomium strumarium. This fungal genus is a rare causative agent of keratomycosis, with only a handful of cases reported. The clinical presentation, investigative techniques, and preliminary management of our patient are reported. The cases reported in global literature are also summarized in a tabular form in the discussion.

Corneal ulcer due to a rare coelomycetes fungus Chaetomium strumarium: Case report and global review of Chaetomium keratomycosis

PubMed Central

Reddy, Mamatha; Venugopal, Ramya; Prakash, Peralam Yegneswaran; Kamath, Yogish Subraya

2017-01-01

We present a rare case of corneal ulcer caused by a species of a coelomycetes fungus, Chaetomium strumarium. This fungal genus is a rare causative agent of keratomycosis, with only a handful of cases reported. The clinical presentation, investigative techniques, and preliminary management of our patient are reported. The cases reported in global literature are also summarized in a tabular form in the discussion. PMID:28905835

Biochemical characterization and synergism of cellulolytic enzyme system from Chaetomium globosum on rice straw saccharification.

PubMed

Wanmolee, Wanwitoo; Sornlake, Warasirin; Rattanaphan, Nakul; Suwannarangsee, Surisa; Laosiripojana, Navadol; Champreda, Verawat

2016-11-21

Efficient hydrolysis of lignocellulosic materials to sugars for conversion to biofuels and chemicals is a key step in biorefinery. Designing an active saccharifying enzyme system with synergy among their components is considered a promising approach. In this study, a lignocellulose-degrading enzyme system of Chaetomium globosum BCC5776 (CG-Cel) was characterized for its activity and proteomic profiles, and synergism with accessory enzymes. The highest cellulase productivity of 0.40 FPU/mL was found for CG-Cel under the optimized submerged fermentation conditions on 1% (w/v) EPFB (empty palm fruit bunch), 2% microcrystalline cellulose (Avicel®) and 1% soybean meal (SBM) at 30 °C, pH 5.8 for 6 d. CG-Cel worked optimally at 50-60 °C in an acidic pH range. Proteomics analysis by LC/MS/MS revealed a complex enzyme system composed of core cellulases and accessory hydrolytic/non-hydrolytic enzymes attacking plant biopolymers. A synergistic enzyme system comprising the CG-Cel, a β-glucosidase (Novozyme® 188) and a hemicellulase Accellerase® XY was optimized on saccharification of alkaline-pretreated rice straw by a mixture design approach. Applying a full cubic model, the optimal ratio of ternary enzyme mixture containing CG-Cel: Novozyme® 188: Accellerase® XY of 44.4:20.6:35.0 showed synergistic enhancement on reducing sugar yield with a glucose releasing efficiency of 256.4 mg/FPU, equivalent to a 2.9 times compared with that from CG-Cel alone. The work showed an approach for developing an active synergistic enzyme system based on the newly characterized C. globosum for lignocellulose saccharification and modification in bio-industries.

Development Test II of Time Division Digital Multiplexer TD-1069( )/G

DTIC Science & Technology

1976-11-01

fungi: (1) Aspergillus flavus (2) Aspergillus niger (3) Aspergillus versicolor (4) Penicillium funicolosum (5) Chaetomium globosum c The fungi... Aspergillus flavus and a negligible amount of Aspergillus niger were observed on the exterior surface of the test item. 2-80 ■ ■■--’ — (2) Top...interior. The wire ties maintained a moderate amount of Aspergillus veraicolor and spotted colonies of Penicillium funiculosum. The voltage select

Endophytic Fungal Flora from Roots and Fruits of an Indian Neem Plant Azadirachta indica A. Juss., and Impact of Culture Media on their Isolation.

PubMed

Verma, Vijay C; Gond, Surendra K; Kumar, Anuj; Kharwar, Ravindra N; Boulanger, Lori-Ann; Strobel, Gary A

2011-10-01

Azadirachta indica A. Juss. (neem), native to India, is well known worldwide for its insecticidal and ethanopharmacological properties. Although endophytic microbes are known from this plant as only leaves and stems were the subjects of past reports. Now, a variety of procedures and a number of different media were used to isolate the maximum number of endophytic fungi from unripe fruits and roots. A total of 272 isolates of 29 filamentous fungal taxa were isolated at rate of 68.0% from 400 samples of three different individual trees (at locations-Az1, Az2, Az3). Mycological agar (MCA) medium yielded the highest number of isolates (95, with a 14.50% isolation rate) with the greatest species richness. Mycelia Sterilia (1, 2, 3) accounted for 11.06%, Coelomycetes 7.25%, while Hyphomycetes showed the maximum number of representative isolates (81.69%). Mycelia-Sterilia (1, 2, 3), based on their 5.8S ITS 1, ITS2 and partial 18S and 28S rDNA sequences were identified as Fusarium solani (99%), Chaetomium globosum (93%) and Chaetomium globosum (93%) respectively. Humicola, Drechslera, Colletotrichum, and Scytalidium sp. were some of the peculiar fungal endophytes recovered from this plant.

Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

PubMed

Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

2016-10-01

Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. Copyright © 2016 Elsevier B.V. All rights reserved.

Study on the diversity of endophytic communities from rice (Oryza sativa L.) and their antagonistic activities in vitro.

PubMed

Naik, B Shankar; Shashikala, J; Krishnamurthy, Y L

2009-01-01

Endophytic populations were isolated from 2400 segments of Oryza sativa collected from Bhadra River Project Area, Southern India during December 2005 (Winter) and April 2006 (Summer). Overall colonization rates from surface sterilized tissues were 40.3% in roots and 25.83% in leaves during winter season, 20.15% in roots and 8.66% in leaves during summer season. Nineteen different fungal taxa, a Streptomyces sp. and bacterial species were isolated. Streptomyces sp., Chaetomium globosum, Penicillium chrysogenum, Fusarium oxysporum and Cladosporium cladosporioides were dominant endophytes in this study. Frequency of colonization between the sites, seasons and rice varieties were found to differ significantly. Dual culture studies revealed that C. globosum, P. chrysogenum and Streptomyces sp. are suitable candidates for extraction of biologically active compounds. Rice harbors many endophytic organisms and some of them have antagonistic properties against fungal pathogens.

Prospecting fungal parasites of the potato cyst nematode Globodera pallida using a rapid screening technique.

PubMed

Kooliyottil, Rinu; Dandurand, Louise-Marie; Knudsen, Guy R

2017-05-01

Seven filamentous fungal species were isolated from individual eggs of Globodera pallida cysts collected from infested fields in Shelley Idaho, USA and identified as Chaetomium globosum, Fusarium oxysporum, Fusarium solani, Fusarium tricinctum, Microdochium bolleyi, Purpureocillium lilacinum, and Plectosphaerella cucumerina. Their ability to reduce infection by G. pallida in planta were assessed in simple, reproducible micro-rhizosphere chambers (micro-ROCs). All fungi reduced G. pallida infection in potato, but greatest reduction was observed with C. globosum at an average reduction of 76%. Further non-destructive methods were developed to rapidly assess biological control potential of putative fungal strains by staining the infectious second stage juveniles of G. pallida with the live fluorescent stain PKH26. In comparisons between the standard, invasive acid fuchsin method and use of the live stain PKH26, no significant difference in infection level of G. pallida was observed whether roots were stained with PKH26 or acid fuchsin. For both methods, a similar reduction (77% for acid fuchsin, and 78% for PKH26 stain) in invasion of infectious stage of G. pallida was observed when potato plants were inoculated with C. globosum compared to non-inoculated potato. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The rust fungus Gymnosporangium in Korea including two new species, G. monticola and G. unicorne

USDA-ARS?s Scientific Manuscript database

A survey was conducted of species of the rust fungus Gymnosporangium in Korea. The previously known species were recollected, namely Gymnosporangium asiaticum, G. clavariiforme, G. globosum, G. japonicum, and G. yamadae. Although G. cornutum was reported from Korea, collections similar to that speci...

Ecological and physiological studies on soil fungi at Western region, libya.

PubMed

El-Said, A H M; Saleem, A

2008-03-01

Sixty three species and 5 varieties belonging to 30 fungal genera were collected from 75 soil samples. Cultivated (29 genera and 58 species + 5 var.), desert (22 and 35 + 2 var.) and saline soil (21 and 41 + 1 var.) fungi were recovered on glucose-, cellulose- and 50% sucrose-Czapek's agar at 28℃. The most common genera were Alternaria, Aspergillus, Emericella, Fusarium, Mycosphaerella, Nectria and Penicillium. The most prevalent species from the three types of soils on the three types of media were Alternaria alternata, Aspergillus flavus, A. fumigatus, A. niger, A. terreus, Emericella nidulans, Fusarium oxysporum, Mycosphaerella tassiana, Nectria haematococca and Penicillium chrysogenum. Chaetomium globosum was in the top of fungi in producing endo-β-1,4-glucanases among the 42 tested isolates obtained from soils on cellulose-Czapek's agar. Maximum production of this enzyme by C. globosum obtained after 6 days of incubation at 30℃ with culture medium containing maltose as a carbon source and ammonium nitrate as a nitrogen source and pH initially adjusted to 6.

New on-line separation workflow of microbial metabolites via hyphenation of analytical and preparative comprehensive two-dimensional liquid chromatography.

PubMed

Yan, Xia; Wang, Li-Juan; Wu, Zhen; Wu, Yun-Long; Liu, Xiu-Xiu; Chang, Fang-Rong; Fang, Mei-Juan; Qiu, Ying-Kun

2016-10-15

Microbial metabolites represent an important source of bioactive natural products, but always exhibit diverse of chemical structures or complicated chemical composition with low active ingredients content. Traditional separation methods rely mainly on off-line combination of open-column chromatography and preparative high performance liquid chromatography (HPLC). However, the multi-step and prolonged separation procedure might lead to exposure to oxygen and structural transformation of metabolites. In the present work, a new two-dimensional separation workflow for fast isolation and analysis of microbial metabolites from Chaetomium globosum SNSHI-5, a cytotoxic fungus derived from extreme environment. The advantage of this analytical comprehensive two-dimensional liquid chromatography (2D-LC) lies on its ability to analyze the composition of the metabolites, and to optimize the separation conditions for the preparative 2D-LC. Furthermore, gram scale preparative 2D-LC separation of the crude fungus extract could be performed on a medium-pressure liquid chromatograph×preparative high-performance liquid chromatography system, under the optimized condition. Interestingly, 12 cytochalasan derivatives, including two new compounds named cytoglobosin Ab (3) and isochaetoglobosin Db (8), were successfully obtained with high purity in a short period of time. The structures of the isolated metabolites were comprehensively characterized by HR ESI-MS and NMR. To be highlighted, this is the first report on the combination of analytical and preparative 2D-LC for the separation of microbial metabolites. The new workflow exhibited apparent advantages in separation efficiency and sample treatment capacity compared with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

Effect of Fungal Deterioration on Physical and Mechanical Properties of Hemp and Flax Natural Fiber Composites

PubMed Central

Crawford, Bryn; Pakpour, Sepideh; Kazemian, Negin; Klironomos, John; Stoeffler, Karen; Rho, Denis; Denault, Johanne; Milani, Abbas S.

2017-01-01

The development and application of bio-sourced composites have been gaining wide attention, yet their deterioration due to the growth of ubiquitous microorganisms during storage/manufacturing/in-service phases is still not fully understood for optimum material selection and design purposes. In this study, samples of non-woven flax fibers, hemp fibers, and mats made of co-mingled randomly-oriented flax or hemp fiber (50%) and polypropylene fiber (50%) were subjected to 28 days of exposure to (i) no water-no fungi, (ii) water only and (iii) water along with the Chaetomium globosum fungus. Biocomposite samples were measured for weight loss over time, to observe the rate of fungal growth and the respiration of cellulose components in the fibers. Tensile testing was conducted to measure mechanical properties of the composite samples under different configurations. Scanning electron microscopy was employed to visualize fungal hyphal growth on the natural fibers, as well as to observe the fracture planes and failure modes of the biocomposite samples. Results showed that fungal growth significantly affects the dry mass as well as the tensile elastic modulus of the tested natural fiber mats and composites, and the effect depends on both the type and the length scale of fibers, as well as the exposure condition and time. PMID:29088118

Endoglucanase production by paper-degrading mycoflora.

PubMed

Das, M K; Prasad, J S; Ahmad, S K

1997-11-01

Fourteen fungal species, namely Aspergillus flavus, A. fumigatus, A. niger, A. ustus, Penicillium islandicum, P. wortmannii, Memnoniella echinata, Cladosporium herbarum, Stachybotrys atra, Chaetomium globosum, Fusarium oxysporum, Torula herbarum, Alternaria alternata and Curvularia uncinata were isolated from different grades of paper. They differ in their distribution on various kinds of paper and also in relative occurrence. While seasonal influence on mycoflora was observed, most of the moulds were capable of growing in all three seasons examined (summer, winter, rainy season). The moulds were cellulolytic in nature and endoglucanase activity was greatest in Aspergillus flavus, A. niger, A. fumigatus, P. wortmannii and P. islandicum.

Four new steroids from the endophytic fungus Chaetomium sp. M453 derived of Chinese herbal medicine Huperzia serrata.

PubMed

Yu, Fei-Xue; Li, Zhe; Chen, Yao; Yang, Yin-He; Li, Guo-Hong; Zhao, Pei-Ji

2017-03-01

An endophytic fungus, Chaetomium sp. M453, was isolated from Huperzia serrata (Thunb. ex Murray) Trev. and subjected to phytochemical investigation. Three unusual C25 steroids, neocyclocitrinols E-G (1-3), and 3β-hydroxy-5,9-epoxy-(22E,24R)-ergosta-7,22-dien-6-one (4) together with three known steroids were isolated from solid fermentation products of the fungus, which were elucidated by extensive spectroscopic analyses, including 1D-, 2D-NMR, and HR-ESI-MS experiments. The absolute configuration of 1 was determined by X-ray crystallographic analysis and CD analyses. The acetylcholinesterase inhibitory activities of compounds 1-4 were tested in vitro. Compound 4 showed weak acetylcholinesterase inhibitory activity. Copyright © 2016 Elsevier B.V. All rights reserved.

Magnesium and iron nanoparticles production using microorganisms and various salts

NASA Astrophysics Data System (ADS)

Kaul, R. K.; Kumar, P.; Burman, U.; Joshi, P.; Agrawal, A.; Raliya, R.; Tarafdar, J. C.

2012-09-01

Response of five fungi and two bacteria to different salts of magnesium and iron for production of nanoparticles was studied. Pochonia chlamydosporium, and Aspergillus fumigatus were exposed to three salts of magnesium while Curvularia lunata, Chaetomium globosum, A. fumigatus, A. wentii and the bacteria Alcaligenes faecalis and Bacillus coagulans were exposed to two salts of iron for nanoparticle production. The results revealed that P. chlamydosporium induces development of extracellular nanoparticles in MgCl2 solution while A. fumigatus produces also intracellular nanoparticles when exposed to MgSO4 solution. C. globosum was found as the most effective in producing nanoparticles when exposed to Fe2O3 solution. The FTIR analysis of the nanoparticles obtained from Fe2O3 solution showed the peaks similar to iron (Fe). In general, the species of the tested microbes were selective to different chemicals in their response for synthesis of nanoparticles. Further studies on their characterization and improving the efficiency of promising species of fungi need to be undertaken before tapping their potential as nanonutrients for plants.

Mycological studies housed in the Apollo 16 microbial ecology evaluation device

NASA Technical Reports Server (NTRS)

Volz, P. A.

1973-01-01

Survival, death, and phenotype count have yielded variation in the number of fungi recovered from the controls and the flight exposed cuvettes during preliminary analysis of postflight first phase data. Also the preliminary analysis was indicative that fungi exposed to specific space flight conditions demonstrated variable survival rates and phenotype counts. Specific space flight conditions included full light space exposure for Chaetomium globosum, exposure at 300- and 254-nanometer wavelengths for Rhodotorula rubra, full light and 280-nanometer wavelength exposure for Trichophyton terrestre, and 254-nanometer wavelength exposure for Saccharomyces cerevisiae. In general, phenotype counts for flight cuvettes and survival rates for control cuvettes were higher compared with the remaining cuvettes.

Organic neem compounds inhibit soft-rot fungal growth and improve the strength of anthracite bricks bound with collagen and lignin for use in iron foundry cupolas.

PubMed

Kelsey, D J; Nieto-Delgado, C; Cannon, F S; Brennan, R A

2015-07-01

To examine organic neem compounds for their effective growth inhibition of saprotrophic soft-rot fungi on anthracite bricks bound with collagen and lignin for use in iron foundry cupolas as an alternative fuel source. Azadirachtin, crude neem oil (NO), and clarified neem oil extract (CNO) were combined with copper to inhibit the growth of the soft-rot fungus, Chaetomium globosum. A synergistic interaction was observed between CNO and a low dose of copper on nutrient media (two-factor anova with triplicate replication: P < 0·05). Interaction was confirmed on lab-scale collagen-lignin-anthracite briquettes by measuring their unconfined compressive (UC) strength. The effective collagen strength of the briquettes was enhanced by applying CNO to their surface prior to inoculation: the room temperature UC strength of the briquettes was 28 ± 4·6% greater when CNO (0·4 mg cm(-2) ) was surface-applied, and was 43 ± 3·0% greater when CNO plus copper (0·14 μg cm(-2) ) were surface-applied. Surface application of CNO and copper synergistically prevents fungal growth on bindered anthracite briquettes and increases their room temperature strength. This novel organic fungicidal treatment may increase the storage and performance of anthracite bricks in iron foundries, thereby saving 15-20% of the energy used in conventional coke production. © 2015 The Society for Applied Microbiology.

Mycotoxins from mould infested building materials.

PubMed

Nielsen, K F

2000-03-01

Only limited documentation of non-allergenic, especially toxic reactions after inhalation of microfungal spores in water damaged buildings exists. Recently attention has been drawn to the mycotoxins as causal compounds, as some the dominating genera found in buildings are well known mycotoxin producers.Penicillium chrysogenum and A. ustus do not seem to produce any known mycotoxins when growing on building materials, whereasP. brevicompactum produces mycophenolic acid, someP. polonicum produces verrucosidin and verrucofortine,A. versicolor produces sterigmatocystins,A. niger produces nigragillin, orlandin, naphtho-γ-pyrones and tetracyclic compounds, someA. ochraceus produces ochratoxin A,Alternaria spp. produce alternariol and alternariol monomethyl ether,Chaetomium globosum produce chaetoglobosins, and finally 30-40% ofStachybotrys chartarum isolates from buildings produce macrocyclic trichothecenes and a number of other biologically active compounds.

Chaetochromones A and B, two new polyketides from the fungus Chaetomium indicum (CBS.860.68).

PubMed

Lu, Keyang; Zhang, Yisheng; Li, Li; Wang, Xuewei; Ding, Gang

2013-09-05

Chaetochromones A (1) and B (2), two novel polyketides, were isolated from the crude extract of fungus Chaetomium indicum (CBS.860.68) together with three known analogues PI-3(3), PI-4 (4) and SB236050 (5). The structures of these compounds were determined by HRESI-MS and NMR experiments. Chaetochromones A (1) and B (2) are a member of the polyketides family, which might originate from a similar biogenetic pathway as the known compounds PI-3 (3), PI-4 (4) and SB236050 (5). The biological activities of these secondary metabolites were evaluated against eight plant pathogens, including Alternaria alternata, Ilyonectria radicicola, Trichoderma viride pers, Aspergillus niger, Fusarium verticillioide, Irpex lacteus (Fr.), Poria placenta (Fr.) Cooke and Coriolus versicolor (L.) Quél. Compound 1 displayed moderate inhibitory rate (>60%) against the brown rot fungus Poria placenta (Fr.) Cooke, which causes significant wood decay. In addition, the cytotoxic activities against three cancer cell lines A549, MDA-MB-231, PANC-1 were also tested, without any inhibitory activities being detected.

The antifungal efficiency of carbide lime slurry compared with the commercial lime efficiency

NASA Astrophysics Data System (ADS)

Strigac, J.; Mikusinec, J.; Strigacova, J.; Stevulova, N.

2017-10-01

The article deals with studying the antifungal efficiency of carbide lime slurry compared to industrially manufactured commercial lime. Antifungal efficiency expressed as mould proofness properties was tested on the fungi using the procedure given in standard CSN 72 4310. A mixture of fungi Aspergillus niger, Chaetomium globosum, Penicillium funiculosum, Paecilomyces variotii and Gliocladium virens was utilized for testing. The scale for evaluating mould proofness properties according to CSN 72 4310 is from 0 to 5 in degree of fungi growth, where 0 means that no fungi growth occurs and the building products and materials possess fungistatic properties. The study confirms the fungistatic propeties of carbide lime slurry as well as industrially manufactured commercial lime. However, carbide lime slurry and industrially manufactured commercial lime possess no fungicidal effect.

Fungal communities in herbaceous medicinal plants from the malnad region, southern India.

PubMed

Krishnamurthy, Yelugere L; Naik, Shankar B; Jayaram, Shashikala

2008-01-01

Fungal communities were isolated from surface sterilized leaf segments of nine ethnopharmaceutically important medicinal herbs collected from the Bhadra River Project Area, the Malnad region, Southern India. A total of 2159 isolates belonging to 55 different fungal species were isolated from 3600 leaf segments collected during the wet and dry seasons. Chaetomium globosum (7.3%), Aureobasidium pullulans (6.1%), Cladosporium cladosporioides (3.9%), Curvularia lunata (1.9%), Nigrospora oryzae (1.7%), Alternaria alternata (1.3%), Botryosphaeria subglobosa (1.1%), Phoma multirostrata (0.9%), Aspergillus niger (0.8%), Fusarium oxysporum (0.7%), Rhizoctonia solani (0.4%), and Sphaeropsis sapenea (0.3%) were the most frequently isolated fungal species. Colonization rates of fungal species varied significantly between the two seasons. Host specificity was observed in some host plants.

Fungal endophytes isolated from Protium heptaphyllum and Trattinnickia rhoifolia as antagonists of Fusarium oxysporum.

PubMed

Fierro-Cruz, Juan E; Jiménez, Pedro; Coy-Barrera, Ericsson

Control of fungal pathogens is mainly addressed by the use of chemically synthesized fungicides which result in environmental pollution, developing resistance after prolonged use. In this context, endophytes have been recognized as potential biocontrollers, and also as a promising source of antifungal metabolites. Therefore, as part of our research on phytopathogen controllers, 355 fungal endophytes were isolated from Protium heptaphyllum and Trattinnickia rhoifolia (Burseraceae), both ethnobotanically important tree species that produce secondary metabolites of agronomic and industrial interest. Endophytes were tested by in vitro dual culture against Fusarium oxysporum, a phytopathogen of agronomic importance. Five endophytes exerted at least 40% inhibition on F. oxysporum growth. Ethyl acetate (EtOAc) extracts were obtained from the most active antagonistic fungi, after growing them in three different liquid media. The extracts were tested against a conidial suspension of F. oxysporum by direct bioautography. Two extracts derived from fungi identified as Chaetomium globosum, F211_UMNG and Meyerozima sp. F281_UMNG showed inhibition of pathogen growth. Isolate C. globosum, F211_UMNG was selected for a chemical analysis by RP-HPLC-DAD-ESI-MS and antifungal molecules such as cladosporin, chaetoatrosin A and chaetoviridin A were annotated and identified based on their MS data. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Morphological evolution of various fungal species in the presence and absence of aluminum oxide microparticles: Comparative and quantitative insights into microparticle-enhanced cultivation (MPEC).

PubMed

Kowalska, Anna; Boruta, Tomasz; Bizukojć, Marcin

2018-03-05

The application of microparticle-enhanced cultivation (MPEC) is an attractive method to control mycelial morphology, and thus enhance the production of metabolites and enzymes in the submerged cultivations of filamentous fungi. Unfortunately, most literature data deals with the spore-agglomerating species like aspergilli. Therefore, the detailed quantitative study of the morphological evolution of four different fungal species (Aspergillus terreus, Penicillium rubens, Chaetomium globosum, and Mucor racemosus) based on the digital analysis of microscopic images was presented in this paper. In accordance with the current knowledge, these species exhibit different mechanisms of agglomerates formation. The standard submerged shake flask cultivations (as a reference) and MPEC involving 10 μm aluminum oxide microparticles (6 g·L -1 ) were performed. The morphological parameters, including mean projected area, elongation, roughness, and morphology number were determined for the mycelial objects within the first 24 hr of growth. It occurred that heretofore observed and widely discussed effect of microparticles on fungi, namely the decrease in pellet size, was not observed for the species whose pellet formation mechanism is different from spore agglomeration. In the MPEC, C. globosum developed core-shell pellets, and M. racemosus, a nonagglomerative species, formed the relatively larger, compared to standard cultures, pellets with distinct cores. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Biological Evaluation of Endophytic Fungus Chaetomium sp. NF15 of Justicia adhatoda L.: A Potential Candidate for Drug Discovery

PubMed Central

Fatima, Nighat; Mukhtar, Usman; Ihsan-Ul-Haq; Ahmed Qazi, Muneer; Jadoon, Muniba; Ahmed, Safia

2016-01-01

Background The endophytes of medicinal plants, such as Justicia adhatoda L., represent a promising and largely underexplored domain that is considered as a repository of biologically active compounds. Objectives The aim of present study was isolation, identification, and biological evaluation of endophytic fungi associated with the J. adhatoda L. plant for the production of antimicrobial, antioxidant, and cytotoxic compounds Materials and Methods Endophytic fungi associated with the J. adhatoda L. plant were isolated from healthy plant parts and taxonomically characterized through morphological, microscopic, and 18S rDNA sequencing methods. The screening for bioactive metabolite production was achieved using ethyl acetate extracts, followed by the optimization of different parameters for maximum production of bioactive metabolites. Crude and partially purified extracts were used to determine the antimicrobial, antioxidant, and cytotoxic potential Results Out of six endophytic fungal isolates, Chaetomium sp. NF15 showed the most promising biological activity and was selected for detailed study. The crude ethyl acetate extract of NF15 isolate after cultivation under optimized culture conditions showed promising antimicrobial activity, with significant inhibition of the clinical isolates of Staphylococcus aureus (87%, n=42), Pseudomonas aeruginosa (> 85%, n = 41), and Candida albicans (62%, n = 24). Conclusions The present study confirms the notion of selecting endophytic fungi of medicinal plant Justicia for the bioassay-guided isolation of its bioactive compounds, and demonstrates that endophytic fungus Chaetomium sp. NF15 could be a potential source of bioactive metabolites PMID:27635208

Rare case of subcutaneous mycosis with intrathoracic extension due to Chaetomium strumarium.

PubMed

Verma, R; Vasudevan, B; Badwal, S; Sriram, R; Neema, S; Kharayat, V

2015-08-01

A 47-year-old man presented with a 10-year history of multiple lumps over his left upper arm and shoulder and the adjoining left side of his chest and upper back. His medical history included diabetes mellitus type 2. The patient was a farmer and used to lift sacks of grains and fertilizers onto his shoulders as part of his work, although he did not recollect any history of specific trauma. Skin biopsy revealed granulomatous reaction with Splendore-Hoeppli phenomenon, while periodic-acid-Schiff and Grocott-Gomori stains confirmed fungal elements. Sabouraud agar grew Chaetomium species, and lactophenol blue mount confirmed the fungus as Chaetomium strumarium. Radiography and computed tomography of the chest revealed intrathoracic extension of the mycetoma. The patient responded well to treatment with oral Itraconazole. Subcutaneous mycosis due to C. strumarium is rarely reported in the literature, and the intrathoracic extension makes it an even rarer entity. © 2015 British Association of Dermatologists.

Heat stability of chaetoglobosins A and C.

PubMed

Fogle, M R; Douglas, D R; Jumper, C A; Straus, D C

2008-05-01

Chaetomium globosum is commonly found in water-damaged buildings and produces the mycotoxins chaetoglobosin A and chaetoglobosin C (Ch-A and Ch-C, respectively). While attempting to purify Ch-A and Ch-C, we observed that these mycotoxins were broken down after heating. The objective of this study was to determine the temperature and the amount of time necessary to break down Ch-A and Ch-C. We demonstrated that the amounts of Ch-A were significantly reduced when exposed to 75 degrees C for 24 h and 100 degrees C for 90, 120, or 150 min. Under the same conditions, the levels of Ch-C were also lower (although not significantly). At 175 degrees C, no Ch-A was detected after 15 min and Ch-C was significantly reduced after 30 min. Our findings will aid other researchers who work with these mycotoxins in the future.

Chemical composition and antimicrobial activities of essential oil from Wedelia urticifolia growing wild in Hunan Province, China.

PubMed

Hu, Junpeng; Jia, Mengmeng; Zhu, Liang

2018-04-18

The essential oil obtained from Wedelia urticifolia growing in Hunan Province, China, was analyzed for the first time by capillary GC and GC-MS. A total of 67 constituents, representing 98.68% in essential oil were identified. The major constituents of the oil were: α-pinene (8.85%), limonene (6.38%), carvacrol (6.15%), caryophyllene (6.08%), spathulenol (5.49%), sabinene (5.36%), camphor (4.34%). Antimicrobial potential of oil against bacterial strains (Pseudomonas aeruginosa, Escherichia coli and Bacillus subtilis, and Staphylococcus aureus), yeast strains (Hansenula anomala and Saccharomy cescerevisiae) and molds (Aspergillus niger, Chaetomium globosum, Mucor racemosus, and Monascus anka) was determined by disc diffusion method and broth micro dilution method, respectively. The oil exhibited promising antimicrobial effect as a diameter of zones of inhibition (16.8-24.9 mm). Minimum inhibitory concentration values of oil were ranged 62.5-1000 μg/mL.

Chaetomium elatum (Kunze: Chaetomiaceae) as a root-colonizing fungus in avocado: is it a mutualist, cheater, commensalistic associate, or pathogen?

PubMed

Violi, Helen A; Menge, John A; Beaver, Robert J

2007-04-01

Plants support numerous root colonists that may share morphological characteristics with mycorrhizal fungi but may play different roles in the rhizosphere. To determine the function of one such root-colonizing fungus, Chaetomium elatum, the infectivity and composition of inoculum containing C. elatum were varied independently of and in association with the known mutualist Glomus intraradices under two light intensities. Maximum plant benefit occurred with mixtures of both G. intraradices and C. elatum and under high light intensity. Under low light intensity and in monoculture, C. elatum functioned as a weak pathogen that was able to kill host plants. Here, maximum plant mortality was associated with the highest levels of C. elatum infectivity. When G. intraradices was present, no negative impact of C. elatum was detected. Intraspecific interactions were important in predicting sporulation rates for both fungi, whereas no interspecific fungal interactions were detected. In the presence of G. intraradices, C. elatum appears to function as a "commensalistic associate," neither impacting plant growth nor sporulation by G. intraradices. Overall, C. elatum appears to be multifunctional, serving as both a rhizoplane and rhizophere fungus, opportunistically colonizing plant roots and only becoming pathogenic when resources are severely limited and intraspecific competition is high. This multifunctional strategy may be shared with other fungi that form similar structures in roots.

Antifungal properties of silver nanoparticles against indoor mould growth.

PubMed

Ogar, Anna; Tylko, Grzegorz; Turnau, Katarzyna

2015-07-15

The presence of moulds in indoor environments causes serious diseases and acute or chronic toxicological syndromes. In order to inhibit or prevent the growth of microorganisms on building materials, the disruption of their vital processes or the reduction of reproduction is required. The development of novel techniques that impair the growth of microorganisms on building materials is usually based on silver nanoparticles (AgNPs). It makes them an alternative to other biocides. AgNPs have proven antibacterial activity and became promising in relation to fungi. The aim of the study was to assess growth and morphology of mycelia of typical indoor fungal species: Penicillium brevicompactum, Aspergillus fumigatus, Cladosporium cladosporoides, Chaetomium globosum and Stachybotrys chartarum as well as Mortierella alpina, cultured on agar media. The antifungal activity of AgNPs was also tested in relation to C. globosum and S. chartarum grown on the surface of gypsum drywall. It was found that the presence of AgNPs in concentrations of 30-200mg/l significantly decreased the growth of fungi. However, in the case of M. alpina, AgNPs stimulated its growth. Moreover, strong changes in moulds morphology and colour were observed after administration of AgNPs. Parameters of conidiophores/sporangiophores varied depending on mould region and changed significantly after treatment with AgNPs. The experiments have shown antifungal properties of AgNPs against common indoor mould species. Their application to building materials could effectively protect indoor environments from mould development. However, consideration must be given to the fact that the growth of some fungal strains might be stimulated by AgNPs. Copyright © 2015 Elsevier B.V. All rights reserved.

Biosynthesized silver nanoparticles to control fungal infections in indoor environments

NASA Astrophysics Data System (ADS)

Deyá, Cecilia; Bellotti, Natalia

2017-06-01

Fungi grow especially in dark and moist areas, deteriorating the indoor environment and causing infections that particularly affect immunosuppressed individuals. Antimicrobial coatings have as principal objective to prevent biofilm formation and infections by incorporation of bioactive additives. In this sense, metallic nanoparticles, such as silver, have proven to be active against different microorganisms specially bacteria. Biosynthesized method is a promising environmentally friendly option to obtain nanoparticles. The aim of this research was assess the employment of plants extracts of Aloysia triphylla (cedrón), Laurelia sempervirens (laurel) and Ruta chalepensis (ruda) to obtain silver nanoparticles to be used as an antimicrobial additive to a waterborne coating formulation. The products obtained were assessed against fungal isolates from biodeteriorated indoor coatings. The fungi were identified by conventional and molecular techniques as Chaetomium globosum and Alternaria alternate. The results revealed that the coating with silver nanoparticles obtained with L. sempervirens extract at 60 °C with a size of 9.8 nm was the most efficient against fungal biofilm development.

Mycoflora and mycotoxin-producing fungi of air-dust particles from Egypt.

PubMed

Abdel-Hafez, S I; Shoreit, A A; Abdel-Hafez, A I; el Maghraby, O M

1986-01-01

Using the dilution-plate method, 27 genera and 64 species were collected from 20 air-dust samples on glucose - (24 genera and 57 species) and cellulose - (21 genera and 45 species) Czapek's agar at 28 degrees C. There are basic similarities between the mycoflora of air-dust on the two media and the most prevalent species were Aspergillus niger, A. flavus, A. ochraceus, A. terreus, A. versicolor, Penicillium chrysogenum, P. funiculosum, Alternaria alternata, Cladosporium herbarum, Fusarium oxysporum, Rhizopus stolonifer and Trichoderma viride. Chaetomium globosum, Stachybotrys chartarum, Humicola grisea and Arthrobotrys oligospora were common only on cellulose agar plates. Extracts of mycelium from 25 isolates were tested with brine schrimp (Artemia salina); of these 23 displayed varying degrees of toxicity. Thin layer chromatographic analysis of 12 isolates of Aspergillus flavus revealed that 4 strains were producing detectable aflatoxin. Zearalenone production was noted for 3 out of 5 strains of Fusarium oxysporum and 2 out of 5 strains of F. solani.

Proposals to conserve the names Chaetomium piluliferum (Botryotrichum piluliferum) against ……and Gnomonia intermedia (Ophiognomonia intermedia) against Gloeosporium betulae (Discula betulae) (Ascomycota: Sordariomycetes)

USDA-ARS?s Scientific Manuscript database

In the course of updating the scientific names of plant-associated fungi in the USDA-ARS U.S. National Fungus Collections Fungal Databases to conform with one scientific name for fungi as required by the International Code of Nomenclature for algae, fungi and plants (ICN, McNeill & al. in Regnum Veg...

Growth of chitinolytic dune soil beta-subclass Proteobacteria in response to invading fungal hyphae.

PubMed

De Boer, W; Klein Gunnewiek, P J; Kowalchuk, G A; Van Veen, J A

2001-08-01

It has frequently been reported that chitinolytic soil bacteria, in particular biocontrol strains, can lyse living fungal hyphae, thereby releasing potential growth substrate. However, the conditions used in such assays (high bacterial density, rich media, fragmented hyphae) make it difficult to determine whether mycolytic activity is actually of importance for the growth and survival of chitinolytic bacteria in soils. An unidentified group of beta-subclass Proteobacteria (CbetaPs) was most dominant among the culturable nonfilamentous chitinolytic bacteria isolated from Dutch sand dune soils. Here we demonstrate that the CbetaPs grew at the expense of extending fungal mycelium of three dune soil fungi (Chaetomium globosum, Fusarium culmorum, and Mucor hiemalis) under nutrient-limiting, soil-like conditions. Aggregates of CbetaPs were also often found attached to fungal hyphae. The growth of a control group of dominant nonchitinolytic dune soil bacteria (beta- and gamma-subclass Proteobacteria) was not stimulated in the mycelial zone, indicating that growth-supporting materials were not independently released in appreciable amounts by the extending hyphae. Therefore, mycolytic activities of CbetaPs have apparently been involved in allowing them to grow after exposure to living hyphae. The chitinase inhibitor allosamidin did not, in the case of Mucor, or only partially, in the cases of Chaetomium and Fusarium, repress mycolytic growth of the CbetaPs, indicating that chitinase activity alone could not explain the extent of bacterial proliferation. Chitinolytic Stenotrophomonas-like and Cytophaga-like bacteria, isolated from the same dune soils, were only slightly stimulated by exposure to fungal hyphae.

Microbial community composition affects soil fungistasis.

PubMed

de Boer, Wietse; Verheggen, Patrick; Klein Gunnewiek, Paulien J A; Kowalchuk, George A; van Veen, Johannes A

2003-02-01

Most soils inhibit fungal germination and growth to a certain extent, a phenomenon known as soil fungistasis. Previous observations have implicated microorganisms as the causal agents of fungistasis, with their action mediated either by available carbon limitation (nutrient deprivation hypothesis) or production of antifungal compounds (antibiosis hypothesis). To obtain evidence for either of these hypotheses, we measured soil respiration and microbial numbers (as indicators of nutrient stress) and bacterial community composition (as an indicator of potential differences in the composition of antifungal components) during the development of fungistasis. This was done for two fungistatic dune soils in which fungistasis was initially fully or partly relieved by partial sterilization treatment or nutrient addition. Fungistasis development was measured as restriction of the ability of the fungi Chaetomium globosum, Fusarium culmorum, Fusarium oxysporum, and Trichoderma harzianum to colonize soils. Fungistasis did not always reappear after soil treatments despite intense competition for carbon, suggesting that microbial community composition is important in the development of fungistasis. Both microbial community analysis and in vitro antagonism tests indicated that the presence of pseudomonads might be essential for the development of fungistasis. Overall, the results lend support to the antibiosis hypothesis.

In-vessel composting of household wastes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iyengar, Srinath R.; Bhave, Prashant P.

The process of composting has been studied using five different types of reactors, each simulating a different condition for the formation of compost; one of which was designed as a dynamic complete-mix type household compost reactor. A lab-scale study was conducted first using the compost accelerators culture (Trichoderma viridae, Trichoderma harzianum, Trichorus spirallis, Aspergillus sp., Paecilomyces fusisporus, Chaetomium globosum) grown on jowar (Sorghum vulgare) grains as the inoculum mixed with cow-dung slurry, and then by using the mulch/compost formed in the respective reactors as the inoculum. The reactors were loaded with raw as well as cooked vegetable waste for amore » period of 4 weeks and then the mulch formed was allowed to maturate. The mulch was analysed at various stages for the compost and other environmental parameters. The compost from the designed aerobic reactor provides good humus to build up a poor physical soil and some basic plant nutrients. This proves to be an efficient, eco-friendly, cost-effective, and nuisance-free solution for the management of household solid wastes.« less

The application of bioactive compounds from the food industry to control mold growth in indoor waterborne coatings.

PubMed

Bellotti, N; Salvatore, L; Deyá, C; Del Panno, M T; del Amo, B; Romagnoli, R

2013-04-01

Microbial growth in indoor environments creates health problems, especially in people with asthma; approximately 80% of these patients are allergic to mold. Antimicrobial coatings are formulated to generate surfaces that are easy to clean and may also incorporate active agents, commonly called biocides, which inhibit microbial colonization, subsequent growth and bio-deterioration of the substrates. Some research lines seek to replace traditional organometallic and organochlorines biocides with environmentally acceptable ones. The aim of this research was, primarily, to explore the possible application of different compounds used in food industry like preservatives to be used as antimicrobial additives for antimicrobial coatings. Four biocides were tested against two different ambient molds isolated from an interior painted wall (Chaetomium globosum and Alternaria alternate). The selected biocides were zinc salicylate, zinc benzoate, calcium benzoate and potassium sorbate. The resulting paints were subjected to biological and physical tests (viscosity, hiding power, humidity absorption and biocides leaching rate). Bioassays revealed that zinc benzoate and zinc salicylate resulted active against both fungi. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning, expression, purification, and characterisation of the HEAT-repeat domain of TOR from the thermophilic eukaryote Chaetomium thermophilum.

PubMed

Robinson, Graham C; Vegunta, Yogesh; Gabus, Caroline; Gaubitz, Christl; Thore, Stéphane

2017-05-01

The Target of Rapamycin Complex is a central controller of cell growth and differentiation in eukaryotes. Its global architecture has been described by cryoelectron microscopy, and regions of its central TOR protein have been described by X-ray crystallography. However, the N-terminal region of this protein, which consists of a series of HEAT repeats, remains uncharacterised at high resolution, most likely due to the absence of a suitable purification procedure. Here, we present a robust method for the preparation of the HEAT-repeat domain, utilizing the thermophilic fungus Chaetomium thermophilum as a source organism. We describe construct design and stable expression in insect cells. An efficient two-step purification procedure is presented, and the purified product is characterised by SEC and MALDI-TOF MS. The methods described pave the way for a complete high-resolution characterisation of this elusive region of the TOR protein. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a Parchment Document, the 13th Century Incorporation Charter for the City of Krakow, Poland, for Microbial Hazards

PubMed Central

2016-01-01

The literature of environmental microbiology broadly discusses issues associated with microbial hazards in archives, but these publications are mainly devoted to paper documents. There are few articles on historical parchment documents, which used to be very important for the development of literature and the art of writing. These studies present a broad spectrum of methods for the assessment of biodeterioration hazards of the parchment document in question. They are based on both conventional microbiological methods and advanced techniques of molecular biology. Here, a qualitative analysis was conducted, based on genetic identification of bacteria and fungi present on the document as well as denaturing gradient gel electrophoresis profiling and examining the destructive potential of isolated microbes. Moreover, the study involved a quantitative and qualitative microbiological assessment of the indoor air in the room where the parchment was kept. The microbes with the highest destructive potential that were isolated from the investigated item were Bacillus cereus and Acinetobacter lwoffii bacteria and Penicillium chrysogenum, Chaetomium globosum, and Trichoderma longibrachiatum fungi. The presence of the B. cereus strain was particularly interesting since, under appropriate conditions, it leads to complete parchment degradation within several days. PMID:26896133

Microbial Community Composition Affects Soil Fungistasis†

PubMed Central

de Boer, Wietse; Verheggen, Patrick; Klein Gunnewiek, Paulien J. A.; Kowalchuk, George A.; van Veen, Johannes A.

2003-01-01

Most soils inhibit fungal germination and growth to a certain extent, a phenomenon known as soil fungistasis. Previous observations have implicated microorganisms as the causal agents of fungistasis, with their action mediated either by available carbon limitation (nutrient deprivation hypothesis) or production of antifungal compounds (antibiosis hypothesis). To obtain evidence for either of these hypotheses, we measured soil respiration and microbial numbers (as indicators of nutrient stress) and bacterial community composition (as an indicator of potential differences in the composition of antifungal components) during the development of fungistasis. This was done for two fungistatic dune soils in which fungistasis was initially fully or partly relieved by partial sterilization treatment or nutrient addition. Fungistasis development was measured as restriction of the ability of the fungi Chaetomium globosum, Fusarium culmorum, Fusarium oxysporum, and Trichoderma harzianum to colonize soils. Fungistasis did not always reappear after soil treatments despite intense competition for carbon, suggesting that microbial community composition is important in the development of fungistasis. Both microbial community analysis and in vitro antagonism tests indicated that the presence of pseudomonads might be essential for the development of fungistasis. Overall, the results lend support to the antibiosis hypothesis. PMID:12571002

Association between sensitization to Aureobasidium pullulans (Pullularia sp) and severity of asthma.

PubMed

Niedoszytko, Marek; Chełmińska, Marta; Jassem, Ewa; Czestochowska, Eugenia

2007-02-01

Recent data indicate that fungi may contribute to increased severity of asthma. To determine the prevalence of allergy to 15 mold allergens among patients hospitalized because of exacerbation of asthma and to evaluate the relationship between the severity of the disease and allergy to particular molds. Skin prick tests with standard aeroallergens of airborne allergens, including grass, tree, Dermatophagoides pteronyssinus, Dermatophagoides farinae, feather, and cat and dog fur, and a panel of mold allergens, including Alternaria, Cladosporium, Aspergillus, Penicillium, Trichothecium, Chaetomium globosum, Epicoccum, Epidermophyton, Helminthosporium, Aureobasidium pullulans, Rhizopus nigricans, Fusarium, Mucor, Merulius lacrymans, and yeast mix, were performed in 105 asthmatic patients and 30 controls. Positive skin prick test results were found in 98% of asthmatic patients and 66% of controls. Sensitivity to A pullulans was significantly associated with more severe asthma (odds ratio, 1.4; 95% confidence interval, 1.09-1.75; P = .006). Sensitization to Helminthosporium was associated with an increased number of asthma exacerbations that required hospitalization (17% vs 38%; chi2 test P = .03). Sensitization to A pullulans is a risk factor for severe asthma. Sensitization to Helminthosporium may be related to asthma exacerbation that requires hospitalization.

Benomyl Tolerance of Ten Fungi Antagonistic to Plant-parasitic Nematodes.

PubMed

Meyer, S L; Sayre, R M; Huettel, R N

1991-10-01

Ten strains of fungi were tested for tolerance to the fungicide benomyl. Verticillium chlamydosporium strain 2 did not grow in the presence of benomyl; Drechraeria coniospora strains 1 and 2 and Chaetomium sp. tolerated only 0.1 mug benomyl/ml medium; Acremonium bacillisporum, an unidentified fungus, and Phoma chrysanthemicola uniformly grew at 1 mug/ml, but some hyphae grew at higher benomyl concentrations; Fusarium sp. tolerated 475 mug/ml, but some hyphae grew on medium amended with 1,000 mug/ml; Verticillium lecanii and V. chlamydosporium strain 1 routinely tolerated 1,000 mug/ml. Fungi generally grew more slowly at higher than at lower benomyl concentrations. Strains with elevated tolerance to benomyl were selected from Acremonium bacillisporum, Drechmeria coniospora, Fusarium sp., and an unidentified fungus. These strains retained the increased tolerance after repeated transfers on unamended medium.

Fermentation of cellulosic materials to mycoprotein foods.

PubMed

Moo-Young, M; Chisti, Y; Vlach, D

1993-01-01

A new bioprocess is described in which a cellulolytic, food-grade fungus Neurospora sitophila converts cellulosic materials to protein-rich products for food and fodder. The optimal conditions for the conversion are identified: 35-37 degrees C temperature, pH 5.5, 2.35 ms(-1) agitator tip speed. Scale-up of the production process to 1,300 L is reported. The mycoprotein production data on several types of cellulosic materials (sugarcane bagasse, corn stover, wood cellulose) are presented. The performance of N. sitophila is found to compare favourably with that of Chaetomium cellulolyticum, another cellulolytic organism previously reported on by us.

Evaluation of a Parchment Document, the 13th Century Incorporation Charter for the City of Krakow, Poland, for Microbial Hazards.

PubMed

Lech, Tomasz

2016-05-01

The literature of environmental microbiology broadly discusses issues associated with microbial hazards in archives, but these publications are mainly devoted to paper documents. There are few articles on historical parchment documents, which used to be very important for the development of literature and the art of writing. These studies present a broad spectrum of methods for the assessment of biodeterioration hazards of the parchment document in question. They are based on both conventional microbiological methods and advanced techniques of molecular biology. Here, a qualitative analysis was conducted, based on genetic identification of bacteria and fungi present on the document as well as denaturing gradient gel electrophoresis profiling and examining the destructive potential of isolated microbes. Moreover, the study involved a quantitative and qualitative microbiological assessment of the indoor air in the room where the parchment was kept. The microbes with the highest destructive potential that were isolated from the investigated item were Bacillus cereus and Acinetobacter lwoffii bacteria and Penicillium chrysogenum,Chaetomium globosum, and Trichoderma longibrachiatum fungi. The presence of the B. cereuss train was particularly interesting since, under appropriate conditions, it leads to complete parchment degradation within several days. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Keratinophilic fungi and other moulds associated with air-dust particles from Egypt.

PubMed

Abdel-Hafez, S I; Moubasher, A H; Barakat, A

1990-01-01

One-hundred and eleven species and three species varieties belonging to 39 genera were collected from 50 dust samples on the five media used at 28 degrees C. Using the hair-baiting technique with horse hair, 10 species of Chrysosporium were isolated: C. asperatum, C. state of Arthroderma tuberculatum, C. indicum, C. inops, C. keratinophilum, C. merdarium, C. pannorum, C. queenslandicum, C. tropicum and C. xerophilum. True dermatophytes were isolated: Trichophyton verrucosum and Trichophyton sp. Also, numerous fungi tolerating high levels of cycloheximide were encountered, such as members of Acremonium, Aspergillus and Penicillium. On plates of glucose or cellulose Czapek-Dox agar (free from sucrose) the most frequent fungi were: Alternaria alternata, Aspergillus flavus, A. flavus var. columnaris, A. fumigatus, A. niger, A. ochraceus, A. sydowii, A. terreus, Chaetomium globosum, Cladosporium herbarum, Emericella nidulans, Fusarium oxysporum, Mucor hiemalis, Penicillium chrysogenum, P. oxalicum, Scopulariopsis brevicaulis and Ulocladium atrum. On plates of 50% sucrose or 10 and 20% NaCl-Czapek's agar, some interesting species were frequently encountered: Eurotium amstelodami, E. chevalieri, E. halophilicum, E. montevidensis, E. repens, E. rubrum and Scopulariopsis halophilica. The isolated fungi have been tested for osmophilicity and halophilicity, they showed different rates of growth on sucrose and sodium chloride-Czapek's medium of various osmotic potential.

Season and tissue type affect fungal endophyte communities of the Indian medicinal plant Tinospora cordifolia more strongly than geographic location.

PubMed

Mishra, Ashish; Gond, Surendra K; Kumar, Anuj; Sharma, Vijay K; Verma, Satish K; Kharwar, Ravindra N; Sieber, Thomas N

2012-08-01

A total of 1,151 endophytic fungal isolates representing 29 taxa were isolated from symptom-less, surface-sterilized segments of stem, leaf, petiole, and root of Tinospora cordifolia which had been collected at three locations differing in air pollution in India (Ramnagar, Banaras Hindu University, Maruadih) during three seasons (summer, monsoon, winter). Endophytes were most abundant in leaf tissues (29.38% of all isolates), followed by stem (18.16%), petiole (10.11%), and root segments (6.27%). The frequency of colonization (CF) varied more strongly among tissue type and season than location. CF was maximal during monsoon followed by winter and minimal during summer. A species each of Guignardia and Acremonium could only be isolated from leaves, whereas all other species occurred in at least two tissue types. Penicillium spp. were dominant (12.62% of all isolates), followed by Colletotrichum spp. (11.8%), Cladosporium spp. (8.9%), Chaetomium globosum (8.1%), Curvularia spp. (7.6%), and Alternaria alternata (6.8%). Species richness, evenness, and the Shannon-Wiener diversity index followed the same pattern as the CF with the tissue type and the season having the greatest effect on these indices, suggesting that tissue type and season are more influential than geography. Dissimilarity of endophyte communities in regards to species composition was highest among seasons. Colletotrichum linicola occurred almost exclusively in winter, Fusarium oxysporum only in winter and summer but never during monsoon and Curvularia lunata only in winter and during monsoon but never in summer. Emissions of NO(2), SO(2), and suspended particulate matter were negatively correlated with the CF. Ozone did not have any effect. The frequency of most species declined with increasing pollution, but some showed an opposite trend (e.g., Aspergillus flavus). Five unnamed taxa (sterile mycelia) were identified as Aspergillus tubingensis, Colletotrichum crassipes, Botryosphaeria rhodina, Aspergillus sydowii, and Pseudofusicoccum violaceum, using molecular tools. Fifteen of the 29 endophyte taxa exhibited antibacterial activity. B. rhodina (JQ031157) and C. globosum showed activity against all bacterial human pathogens tested, with the former showing higher activity than the latter.

Production and Characterization of a Monoclonal Antibody Raised Against Surface Antigens from Mycelium of Gaeumannomyces graminis var. tritici: Evidence for an Extracellular Polyphenol Oxidase.

PubMed

Thornton, C R; Dewey, F M; Gilligan, C A

1997-01-01

ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L-DOPA, and secretion by C. globosum in response to the phenolic amino acid was significantly less compared to G. graminis var. tritici.

Purification of an Inducible DNase from a Thermophilic Fungus

PubMed Central

Landry, Kyle S.; Vu, Andrea; Levin, Robert E.

2014-01-01

The ability to induce an extracellular DNase from a novel thermophilic fungus was studied and the DNAse purified using both traditional and innovative purification techniques. The isolate produced sterile hyphae under all attempted growing conditions, with an average diameter of 2 μm and was found to have an optimal temperature of 45 °C and a maximum of 65 °C. Sequencing of the internal transcribed region resulted in a 91% match with Chaetomium sp., suggesting a new species, but further clarification on this point is needed. The optimal temperature for DNase production was found to be 55 °C and was induced by the presence of DNA and/or deoxyribose. Static growth of the organism resulted in significantly higher DNase production than agitated growth. The DNase was purified 145-fold using a novel affinity membrane purification system with 25% of the initial enzyme activity remaining. Electrophoresis of the purified enzyme resulted in a single protein band, indicating DNase homogeneity. PMID:24447923

Mycoflora and mycotoxins in Brazilian black pepper, white pepper and Brazil nuts.

PubMed

Freire, F C; Kozakiewicz, Z; Paterson, R R

2000-01-01

A wide range of field and storage fungi were isolated from black pepper, white pepper and Brazil nut kernels from Amazonia. A total of 42 species were isolated from both peppers. Aspergillus flavus and A. niger were isolated more frequently from black than from white pepper. Other potential mycotoxigenic species isolated included: A. ochraceus, A. tamarii, A. versicolor, Emericella nidulans and Chaetomium globosum, Penicillium brevicompactum, P. citrinum, P. islandicum and P. glabrum. Species isolated from pepper for the first time were Acrogenospora sphaerocephala, Cylindrocarpon lichenicola, Lacellinopsis sacchari, Microascus cinereus, Petriella setifera and Sporormiella minima. Seventeen species were isolated from Brazil nut kernels. A. flavus was the dominant species followed by A. niger. P. citrinum and P. glabrum were the only penicillia isolated. Species isolated for the first time included Acremonium curvulum, Cunninghamella elegans, Exophiala sp., Fusarium oxysporum, Pseudoallescheria boydii, Rhizopus oryzae, Scopulariopsis sp., Thielavia terricola and Trichoderma citrinoviride. Considerably more metabolites were detected from black than white pepper in qualitative analyses. Chaetocin, penitrem A, and xanthocillin were identified only from black pepper, and tenuazonic acid was identified from both black and white pepper. Aflatoxin G2, chaetoglobosin C, and spinulosin were identified from poor quality brazil nuts. Aflatoxin B1 and B2 were also only detected in poor quality brazil nuts at concentrations of 27.1 micrograms kg-1 and 2.1 micrograms kg-1 respectively (total 29.2 micrograms kg-1).

Antifungal screening of endophytic fungi from Ginkgo biloba for discovery of potent anti-phytopathogenic fungicides.

PubMed

Xiao, Yu; Li, Hong-Xia; Li, Cong; Wang, Jian-Xin; Li, Jun; Wang, Ming-Hua; Ye, Yong-Hao

2013-02-01

Many endophytic fungi have been found to synthesize bioactive compounds to defend host plants against pathogenic organisms. Here we performed anti-fungal bioassay of 80 endophytic fungi isolated from Ginkgo biloba. Fifteen endophytes were active against at least one of the selected fungi, Fusarium graminearum, Sclerotinia sclerotiorum and Phytophthora capsici, using the agar diffusion method. The most bioactive strain CDW7 was identified as Chaetomium globosum by microscopic examination and ITS rRNA gene sequence data. Culture broth of CDW7 diluted 3-fold completely inhibited the mycelial growth and conidia germination of F. graminearum in vitro. Therefore, Fusarium head blight, a common disease in wheat and barley associated with Fusarium spp., was used to test the anti-phytopathogenic activity in vivo. The fermentation broth of CDW7 resulted in a protective efficacy of 54.9% and curative efficacy of 48.8%. Followed by a bioassay-guided approach, 1,2-benzenedicarboxaldehyde-3,4,5-trihydroxy-6-methyl (flavipin) was isolated and demonstrated to significantly inhibit the growth of several plant-pathogenic fungi, especially F. graminearum with an EC(50) value of 0.73 μg mL(-1) comparable to the commonly used fungicide carbendazim, indicating that it could be used as a fungicide or as a lead compound of new fungicides. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Population genomics and geographical parthenogenesis in Japanese harvestmen (Opiliones, Sclerosomatidae, Leiobunum).

PubMed

Burns, Mercedes; Hedin, Marshal; Tsurusaki, Nobuo

2018-01-01

Naturally occurring population variation in reproductive mode presents an opportunity for researchers to test hypotheses regarding the evolution of sex. Asexual reproduction frequently assumes a geographical pattern, in which parthenogenesis-dominated populations are more broadly dispersed than their sexual conspecifics. We evaluate the geographical distribution of genomic signatures associated with parthenogenesis using nuclear and mitochondrial DNA sequence data from two Japanese harvestman sister taxa, Leiobunum manubriatum and Leiobunum globosum . Asexual reproduction is putatively facultative in these species, and female-biased localities are common in habitat margins. Past karyotypic and current cytometric work indicates L. globosum is entirely tetraploid, while L. manubriatum may be either diploid or tetraploid. We estimated species phylogeny, genetic differentiation, diversity, and mitonuclear discordance in females collected across the species range in order to identify range expansion toward marginal habitat, potential for hybrid origin, and persistence of asexual lineages. Our results point to northward expansion of a tetraploid ancestor of L. manubriatum and L. globosum , coupled with support for greater male gene flow in southern L. manubriatum localities. Specimens from localities in the Tohoku and Hokkaido regions were indistinct, particularly those of L. globosum , potentially due to little mitochondrial differentiation or haplotypic variation. Although L. manubriatum overlaps with L. globosum across its entire range, L. globosum was reconstructed as monophyletic with strong support using mtDNA, and marginal support with nuclear loci. Ultimately, we find evidence for continued sexual reproduction in both species and describe opportunities to clarify the rate and mechanism of parthenogenesis.

Fungal Parasitism of Heterodera glycines Eggs as Influenced by Egg Age and Pre-colonization of Cysts by Other Fungi.

PubMed

Chen, S Y; Chen, F J

2003-09-01

The objective of this study was to determine the effect of egg age and pre-colonization of cysts by a saprophytic or parasitic fungus on parasitism of Heterodera glycines eggs by other parasitic fungi. In agar and in soil tests, fungi generally parasitized more eggs in early developmental stages than eggs containing a juvenile. The effect of pre-colonization of cysts by a fungus on parasitism of eggs by other fungi depended on the fungi involved. In most cases, pre-colonization of cysts by an unidentified, saprophytic fungal isolate (A-1-24) did not affect parasitism of eggs in the cysts subsequently treated with other fungi. However, pre-colonization of cysts by A-1-24 reduced fungal parasitism of eggs in cysts subsequently treated with Cylindrocarpon destructans isolate 3. In agar tests, pre-colonization of cysts by Chaetomium cochliodes, a saprophytic or weakly parasitic fungus, reduced parasitism of eggs in cysts subsequently treated with Verticillium chlamydosporium Florida isolate, Fusarium oxysporum, Fusarium solani, ARF18, and another sterile fungus. However, in soil tests, pre-colonization of cysts by C. cochliodes had no effect on parasitism of eggs by subsequent fungal parasites. In another test, parasitism of eggs by V. chlamydosporium in cysts was not affected by pre-colonizing fungi C. destructans, F. oxysporum, and F. solani but was reduced by Mortierella sp., Pyrenochaeta terrestris, and C. cochliodes. Parasitism of eggs in cysts by ARF18 was reduced by pre-colonizing fungi C. destructans, F. oxysporum, F. solani, P. terrestris, and C. cochliodes but not Mortierella sp.

Inositol-phosphate signaling as mediator for growth and sexual reproduction in Podospora anserina.

PubMed

Xie, Ning; Ruprich-Robert, Gwenaël; Chapeland-Leclerc, Florence; Coppin, Evelyne; Lalucque, Hervé; Brun, Sylvain; Debuchy, Robert; Silar, Philippe

2017-09-01

The molecular pathways involved in the development of multicellular fruiting bodies in fungi are still not well known. Especially, the interplay between the mycelium, the female tissues and the zygotic tissues of the fruiting bodies is poorly documented. Here, we describe PM154, a new strain of the model ascomycetes Podospora anserina able to mate with itself and that enabled the easy recovery of new mutants affected in fruiting body development. By complete genome sequencing of spod1, one of the new mutants, we identified an inositol phosphate polykinase gene as essential, especially for fruiting body development. A factor present in the wild type and diffusible in mutant hyphae was able to induce the development of the maternal tissues of the fruiting body in spod1, but failed to promote complete development of the zygotic ones. Addition of myo-inositol in the growth medium was able to increase the number of developing fruiting bodies in the wild type, but not in spod1. Overall, the data indicated that inositol and inositol polyphosphates were involved in promoting fruiting body maturation, but also in regulating the number of fruiting bodies that developed after fertilization. The same effect of inositol was seen in two other fungi, Sordaria macrospora and Chaetomium globosum. Key role of the inositol polyphosphate pathway during fruiting body maturation appears thus conserved during the evolution of Sordariales fungi. Copyright © 2017 Elsevier Inc. All rights reserved.

Onychomycosis due to nondermatophytic molds.

PubMed

Hwang, Sung Min; Suh, Moo Kyu; Ha, Gyoung Yim

2012-05-01

Although there have been many studies about onychomycosis due to nondermatophytic molds (NDM), few studies about etiologic agents including NDM in onychomycosis have been reported in Korea. This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. In the 10-year period from 1999~2009, we reviewed 59 patients with onychomycosis due to NDM. The etiologic agents were identified by cultures on Sabouraud's Dextrose agar with and without cycloheximide. In some cases, internal transcribed spacer sequence analysis was done. NDM isolated considered pathogens when the presence of fungal elements was identified by direct microscopy observation and in follow-up cultures yielding the same fungi. Onychomycosis due to NDM comprised 2.3% of all onychomycosis. Of the 59 patients with onychomycosis due to NDM, 84.7% were toenail onychomycosis and 15.3% were fingernail onychomycosis. The incidence rate was highest in the fifth decade (27.1%). The ratio of male to female patients was 1:1.6. The frequency of associated diseases, in descending order, was hypertension, diabetes mellitus, and cerebral hematoma. Distal and lateral subungual onychomycosis (86.4%) was the most common clinical type of onychomycosis. Aspergillus spp. was the most frequently isolated etiologic agent of onychomycosis due to NDM (83.0%). Other causative agents were Scopulariopsis brevicaulis (10.2%), Acremonium spp. (3.4%), Fusarium solani (1.7%), and Chaetomium globosum (1.7%). Because of the increase in onychomycosis due to NDM, we suggest the need of a careful mycological examination in patients with onychomycosis.

GEN1 from a thermophilic fungus is functionally closely similar to non-eukaryotic junction-resolving enzymes.

PubMed

Freeman, Alasdair D J; Liu, Yijin; Déclais, Anne-Cécile; Gartner, Anton; Lilley, David M J

2014-12-12

Processing of Holliday junctions is essential in recombination. We have identified the gene for the junction-resolving enzyme GEN1 from the thermophilic fungus Chaetomium thermophilum and expressed the N-terminal 487-amino-acid section. The protein is a nuclease that is highly selective for four-way DNA junctions, cleaving 1nt 3' to the point of strand exchange on two strands symmetrically disposed about a diagonal axis. CtGEN1 binds to DNA junctions as a discrete homodimer with nanomolar affinity. Analysis of the kinetics of cruciform cleavage shows that cleavage of the second strand occurs an order of magnitude faster than the first cleavage so as to generate a productive resolution event. All these properties are closely similar to those described for bacterial, phage and mitochondrial junction-resolving enzymes. CtGEN1 is also similar in properties to the human enzyme but lacks the problems with aggregation that currently prevent detailed analysis of the latter protein. CtGEN1 is thus an excellent enzyme with which to engage in biophysical and structural analysis of eukaryotic GEN1. Copyright © 2014. Published by Elsevier Ltd.

Magnetic resonance imaging findings in fatal primary cerebral infection due to Chaetomium strumarium.

PubMed

Aribandi, M; Bazan Iii, C; Rinaldi, M G

2005-04-01

This report describes MRI findings of a rare case of biopsy-proven fatal cerebral infection with Chaetomium strumarium in a 28-year-old man with a history of i.v. drug abuse. Magnetic resonance imaging revealed rapidly progressing lesions with irregular peripheral enhancement, possible central haemorrhage and significant mass effect. Only six cases of cerebral infection with Chaetomium have been reported in the English literature. This is the first report in the radiology literature describing the imaging findings. The previously reported cases of cerebral infection by the Chaetomium species are also reviewed.

Distribution of sterigmatocystin in filamentous fungi.

PubMed

Rank, Christian; Nielsen, Kristian F; Larsen, Thomas O; Varga, Janos; Samson, Rob A; Frisvad, Jens C

2011-01-01

During the last 50y, the carcinogenic mycotoxin sterigmatocystin (ST) has been reported in several phylogenetically and phenotypically different genera: Aschersonia, Aspergillus, Bipolaris, Botryotrichum, Chaetomium, Emericella, Eurotium, Farrowia, Fusarium, Humicola, Moelleriella, Monocillium and Podospora. We have reexamined all available strains of the original producers, in addition to ex type and further strains of each species reported to produce ST and the biosynthetically derived aflatoxins. We also screened strains of all available species in Penicillium and Aspergillus for ST and aflatoxin. Six new ST producing fungi were discovered: Aspergillus asperescens, Aspergillus aureolatus, Aspergillus eburneocremeus, Aspergillus protuberus, Aspergillus tardus, and Penicillium inflatum and one new aflatoxin producer: Aspergillus togoensis (=Stilbothamnium togoense). ST was confirmed in 23 Emericella, four Aspergillus, five Chaetomium, one Botryotrichum and one Humicola species grown on a selection of secondary metabolite inducing media, and using multiple detection methods: HPLC-UV/Vis DAD, - HRMS and - MS/MS. The immediate precursor for aflatoxin, O-methylsterigmatocystin was found in Chaetomium cellulolyticum, Chaetomium longicolleum, Chaetomium malaysiense and Chaetomium virescens, but aflatoxin was not detected from any Chaetomium species. In all 55 species, representing more than 11 clades throughout the Pezizomycotina, can be reliably claimed to be ST producers and 13 of these can also produce aflatoxins. It is not known yet whether the ST/aflatoxin pathway has been developed independently 11 times, or is the result of partial horizontal gene transfer. Copyright © 2011 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Free tropospheric transport of microorganisms from Asia to North America.

PubMed

Smith, David J; Jaffe, Daniel A; Birmele, Michele N; Griffin, Dale W; Schuerger, Andrew C; Hee, Jonathan; Roberts, Michael S

2012-11-01

Microorganisms are abundant in the troposphere and can be transported vast distances on prevailing winds. This study measures the abundance and diversity of airborne bacteria and fungi sampled at the Mt. Bachelor Observatory (located 2.7 km above sea level in North America) where incoming free tropospheric air routinely arrives from distant sources across the Pacific Ocean, including Asia. Overall deoxyribonucleic acid (DNA) concentrations for microorganisms in the free troposphere, derived from quantitative polymerase chain reaction assays, averaged 4.94 × 10(-5) ng DNA m(-3) for bacteria and 4.77 × 10(-3) ng DNA m(-3) for fungi. Aerosols occasionally corresponded with microbial abundance, most often in the springtime. Viable cells were recovered from 27.4 % of bacterial and 47.6 % of fungal samples (N = 124), with 49 different species identified by ribosomal DNA gene sequencing. The number of microbial isolates rose significantly above baseline values on 22-23 April 2011 and 13-15 May 2011. Both events were analyzed in detail, revealing distinct free tropospheric chemistries (e.g., low water vapor, high aerosols, carbon monoxide, and ozone) useful for ruling out boundary layer contamination. Kinematic back trajectory modeling suggested air from these events probably originated near China or Japan. Even after traveling for 10 days across the Pacific Ocean in the free troposphere, diverse and viable microbial populations, including presumptive plant pathogens Alternaria infectoria and Chaetomium globosum, were detected in Asian air samples. Establishing a connection between the intercontinental transport of microorganisms and specific diseases in North America will require follow-up investigations on both sides of the Pacific Ocean.

Free tropospheric transport of microorganisms from Asia to North America

USGS Publications Warehouse

D. Smith,; Dan Jaffe,; Michele Birmele,; Griffin, Dale W.; Andrew Schuerger,; Hee, J.; Michael Roberts,

2012-01-01

Microorganisms are abundant in the troposphere and can be transported vast distances on prevailing winds. This study measures the abundance and diversity of airborne bacteria and fungi sampled at the Mt. Bachelor Observatory (located 2.7 km above sea level in North America) where incoming free tropospheric air routinely arrives from distant sources across the Pacific Ocean, including Asia. Overall deoxyribonucleic acid (DNA) concentrations for microorganisms in the free troposphere, derived from quantitative polymerase chain reaction assays, averaged 4.94 × 10(-5) ng DNA m(-3) for bacteria and 4.77 × 10(-3) ng DNA m(-3) for fungi. Aerosols occasionally corresponded with microbial abundance, most often in the springtime. Viable cells were recovered from 27.4 % of bacterial and 47.6 % of fungal samples (N = 124), with 49 different species identified by ribosomal DNA gene sequencing. The number of microbial isolates rose significantly above baseline values on 22-23 April 2011 and 13-15 May 2011. Both events were analyzed in detail, revealing distinct free tropospheric chemistries (e.g., low water vapor, high aerosols, carbon monoxide, and ozone) useful for ruling out boundary layer contamination. Kinematic back trajectory modeling suggested air from these events probably originated near China or Japan. Even after traveling for 10 days across the Pacific Ocean in the free troposphere, diverse and viable microbial populations, including presumptive plant pathogens Alternaria infectoria and Chaetomium globosum, were detected in Asian air samples. Establishing a connection between the intercontinental transport of microorganisms and specific diseases in North America will require follow-up investigations on both sides of the Pacific Ocean.

Monitoring the effects of different conservation treatments on paper-infecting fungi

PubMed Central

Michaelsen, Astrid; Pinzari, Flavia; Barbabietola, Nicoletta; Piñar, Guadalupe

2013-01-01

Fungi are among the most degradative organisms inducing biodeterioration of paper-based items of cultural heritage. Appropriate conservation measures and restoration treatments to deal with fungal infections include mechanical, chemical, and biological methods, which entail effects on the paper itself and health hazards for humans. Three different conservation treatments, namely freeze-drying, gamma rays, and ethylene oxide fumigation, were compared and monitored to assess their short- (one month, T1) and long-term (one year, T2) effectiveness to inhibit fungal growth. After the inoculation with fungi possessing cellulose hydrolysis ability — Chaetomium globosum, Trichoderma viride, and Cladosporium cladosporioides — as single strains or as a mixture, different quality paper samples were treated and screened for fungal viability by culture-dependent and -independent techniques. Results derived from both strategies were contradictory. Both gamma irradiation and EtO fumigation showed full efficacy as disinfecting agents when evaluated with cultivation techniques. However, when using molecular analyses, the application of gamma rays showed a short-term reduction in DNA recovery and DNA fragmentation; the latter phenomenon was also observed in a minor degree in samples treated with freeze-drying. When RNA was used as an indicator of long-term fungal viability, differences in the RNA recovery from samples treated with freeze-drying or gamma rays could be observed in samples inoculated with the mixed culture. Only the treatment with ethylene oxide proved negative for both DNA and RNA recovery. Therefore, DNA fragmentation after an ethylene oxide treatment can hamper future paleogenetic and archaeological molecular studies on the objects. PMID:24092956

Culturability and toxicity of sick building syndrome-related fungi over time.

PubMed

Wilson, Stephen C; Carriker, Curtis G; Brasel, Trevor L; Karunasena, Enusha; Douglas, David R; Wu, Chunfa; Andriychuk, Larysa A; Fogle, Matthew R; Martin, Jared M; Straus, David C

2004-08-01

Two experiments were conducted regarding the culturability and toxicity of fungi located on building materials over time and the efficacy of seven laboratory techniques in recovering culturable fungi from sample swabs. In the first experiment, eight sections of drywall were inoculated with Stachybotrys chartarum and stored at 25 +/- 5 degrees Celsius and 20-60% relative humidity (RH) for up to two years. Another eight sections of ceiling tile were stored at 100% RH for 1 year. Six sections of ceiling tile and 15 swabs were also inoculated with Penicillium chrysogenum and S. chartarum respectively and stored under the same conditions for 8 months and 3.3 years. All materials were tested for culturability at the end of the storage period. S. chartarum-inoculated samples were also tested for toxicity. In the second experiment (replicated twice), S. chartarum and Chaetomium globosum were inoculated onto 84 swabs each. Storage was up to 266 days at 25 +/- 5 degrees Celsius and 20-60% RH. Seven techniques were compared regarding the recovery of culturable fungi from the swabs over different time points. Results for Experiment 1 showed that all samples were culturable after the storage period and that the S. chartarum-inoculated drywall samples were toxic. In Experiment 2, all techniques showed high rates of recovery. These data show that despite being without a water source, these organisms can be culturable and toxic after long periods of time under conditions similar to human-occupied dwellings and that a number of preparation techniques are suitable for the recovery of these fungi from inoculated swabs.

Monitoring the effects of different conservation treatments on paper-infecting fungi.

PubMed

Michaelsen, Astrid; Pinzari, Flavia; Barbabietola, Nicoletta; Piñar, Guadalupe

2013-10-01

Fungi are among the most degradative organisms inducing biodeterioration of paper-based items of cultural heritage. Appropriate conservation measures and restoration treatments to deal with fungal infections include mechanical, chemical, and biological methods, which entail effects on the paper itself and health hazards for humans. Three different conservation treatments, namely freeze-drying, gamma rays, and ethylene oxide fumigation, were compared and monitored to assess their short- (one month, T1) and long-term (one year, T2) effectiveness to inhibit fungal growth. After the inoculation with fungi possessing cellulose hydrolysis ability - Chaetomium globosum , Trichoderma viride, and Cladosporium cladosporioides - as single strains or as a mixture, different quality paper samples were treated and screened for fungal viability by culture-dependent and -independent techniques. Results derived from both strategies were contradictory. Both gamma irradiation and EtO fumigation showed full efficacy as disinfecting agents when evaluated with cultivation techniques. However, when using molecular analyses, the application of gamma rays showed a short-term reduction in DNA recovery and DNA fragmentation; the latter phenomenon was also observed in a minor degree in samples treated with freeze-drying. When RNA was used as an indicator of long-term fungal viability, differences in the RNA recovery from samples treated with freeze-drying or gamma rays could be observed in samples inoculated with the mixed culture. Only the treatment with ethylene oxide proved negative for both DNA and RNA recovery. Therefore, DNA fragmentation after an ethylene oxide treatment can hamper future paleogenetic and archaeological molecular studies on the objects.

Optimization of headspace solid phase microextraction for the analysis of microbial volatile organic compounds emitted by fungi: Application to historical objects.

PubMed

Sawoszczuk, Tomasz; Syguła-Cholewińska, Justyna; del Hoyo-Meléndez, Julio M

2015-08-28

The main goal of this work was to optimize the SPME sampling method for measuring microbial volatile organic compounds (MVOCs) emitted by active molds that may deteriorate historical objects. A series of artificially aged model materials that resemble those found in historical objects was prepared and evaluated after exposure to four different types of fungi. The investigated pairs consisted of: Alternaria alternata on silk, Aspergillus niger on parchment, Chaetomium globosum on paper and wool, and Cladosporium herbarum on paper. First of all, a selection of the most efficient SPME fibers was carried out as there are six different types of fibers commercially available. It was important to find a fiber that absorbs the biggest number and the highest amount of MVOCs. The results allowed establishing and selecting the DVB/CAR/PDMS fiber as the most effective SPME fiber for this kind of an analysis. Another task was to optimize the time of MVOCs extraction on the fiber. It was recognized that a time between 12 and 24h is adequate for absorbing a high enough amount of MVOCs. In the last step the temperature of MVOCs desorption in the GC injection port was optimized. It was found that desorption at a temperature of 250°C allowed obtaining chromatograms with the highest abundances of compounds. To the best of our knowledge this work constitutes the first attempt of the SPME method optimization for sampling MVOCs emitted by molds growing on historical objects. Copyright © 2015 Elsevier B.V. All rights reserved.

The normal mycoflora of commodities from Thailand. 1. Nuts and oilseeds.

PubMed

Pitt, J I; Hocking, A D; Bhudhasamai, K; Miscamble, B F; Wheeler, K A; Tanboon-Ek, P

1993-12-01

A comprehensive study was carried out of the fungi occurring in commodities normally traded in Thailand. Samples of major commodities were obtained from farmers' stocks and middlemen in major producing areas throughout the country. Retail samples were obtained from outlets in and around Bankok. Samples were divided into two portions, one being examined in Bangkok, and the second in Sydney. After surface disinfection, fungi were enumerated by direct plating on dichloran rose bengal chloramphenicol agar, dichloran 18% glycerol agar, Aspergillus flavus and parasiticus agar and dichloran chloramphenicol peptone agar. Figures for percentage infection were calculated, and fungi were isolated and identified to species level. In all 602 samples were examined, and at North Ryde about 18,000 fungal isolates identified. Data obtained from 329 samples are reported here, comprising maize (154), peanuts (109), cashews (45) and copra (21). Major fungi in maize included Fusarium moniliforme (present in 97% of samples), Aspergillus flavus (85%), Penicillium citrinum (67%), Aspergillus niger (64%), Lasiodiplodia theobromae (58%) and Fusarium semitectum (45%). In peanuts, the major fungi were Aspergillus flavus (95% of samples), Aspergillus niger (86%), Rhizopus oryzae (60%), Eurotium rubrum (51%), Macromina phaseolina (49%), Penicillium citrinum (46%) and Eurotium chevalieri (46%). Invasion in cashews was lower, major fungi being Aspergillus flavus (60%), Nigrospora oryzae (58%), Aspergillus niger (53%), Chaetomium globosum (47%) and Eurotium chevalieri (40%). Aspergillus flavus (86% of samples) was again dominant in copra, with Rhizopus oryzae (52%), Aspergillus niger (43%), Eurotium chevalieri (43%) the only other species exceeding 40% infection. Aspergillus parasiticus was rarely seen, and Aspergillus nomius was reported from foods for the first time.

[Fungal population structure and its biological effect in rhizosphere soil of continuously cropped potato].

PubMed

Meng, Pin-Pin; Liu, Xing; Qiu, Hui-Zhen; Zhang, Wen-Ming; Zhang, Chun-Hong; Wang, Di; Zhang, Jun-Lian; Shen, Qi-Rong

2012-11-01

Continuous cropping obstacle is one of the main restriction factors in potato industry. In order to explore the mechanisms of potato's continuous cropping obstacle and to reduce the impact on potato's tuber yield, a field experiment combined with PCR-DGGE molecular fingerprinting was conducted to investigate the fungal population structure and its biological effect in rhizosphere soil of continuously cropped potato. With the increasing year of potato' s continuous cropping, the numbers of visible bands in rhizosphere fungal DGGE profiles increased obviously. As compared with that of CK (rotation cropping), the operational taxonomic unit (OTU) in treatments of one to five years continuous cropping was increased by 38.5%, 38.5%, 30.8%, 46.2%, and 76.9% respectively, indicating that potato's continuous cropping caused an obvious increase in the individual numbers of dominant fungal populations in rhizosphere soil. Also with the increasing year of potato's continuous cropping, the similarity of the fungal population structure among the treatments had a gradual decrease. The sequencing of the fungal DGGE bands showed that with the increasing year of continuous cropping, the numbers of the potato's rhizosphere soil-borne pathogens Fusarium oxysporum and F. solani increased obviously, while the number of Chaetomium globosum, as a biocontrol species, had a marked decrease in the fifth year of continuous cropping. It was suggested that potato' s continuous cropping caused the pathogen fungal populations become the dominant microbial populations in rhizosphere soil, and the rhizosphere micro-ecological environment deteriorated, which in turn affected the root system, making the root vigor and its absorption area reduced, and ultimately, the tuber yield decreased markedly.

Structural Insight into the Core of CAD, the Multifunctional Protein Leading De Novo Pyrimidine Biosynthesis.

PubMed

Moreno-Morcillo, María; Grande-García, Araceli; Ruiz-Ramos, Alba; Del Caño-Ochoa, Francisco; Boskovic, Jasminka; Ramón-Maiques, Santiago

2017-06-06

CAD, the multifunctional protein initiating and controlling de novo biosynthesis of pyrimidines in animals, self-assembles into ∼1.5 MDa hexamers. The structures of the dihydroorotase (DHO) and aspartate transcarbamoylase (ATC) domains of human CAD have been previously determined, but we lack information on how these domains associate and interact with the rest of CAD forming a multienzymatic unit. Here, we prove that a construct covering human DHO and ATC oligomerizes as a dimer of trimers and that this arrangement is conserved in CAD-like from fungi, which holds an inactive DHO-like domain. The crystal structures of the ATC trimer and DHO-like dimer from the fungus Chaetomium thermophilum confirm the similarity with the human CAD homologs. These results demonstrate that, despite being inactive, the fungal DHO-like domain has a conserved structural function. We propose a model that sets the DHO and ATC complex as the central element in the architecture of CAD. Copyright © 2017 Elsevier Ltd. All rights reserved.

Antagonistic activity of fungi of Olea europaea L. against Colletotrichum acutatum.

PubMed

Landum, Miguel C; Félix, Maria do Rosário; Alho, Joana; Garcia, Raquel; Cabrita, Maria João; Rei, Fernando; Varanda, Carla M R

2016-02-01

Fungi naturally present in olive trees were identified and tested for their antagonistic potential against Colletotrichum acutatum. A total of 14 isolates were identified, 12 belonged to genera Alternaria, Epicoccum, Fusarium, Aspergillus, Anthrinium, Chaetomium, Diaporthe, Nigrospora, one to family Xylariaceae and one was unclassified. All fungal isolates showed some inhibitory action over the growth of C. acutatum during dual culture growth, however, when agar-diffusible tests were performed only five fungal isolates caused C. acutatum growth inhibition: Alternaria sp. isolate 2 (26.8%), the fungus from Xylariaceae family (14.3%), Alternaria sp. isolate 1 (10.7%); Diaporthe sp. (10.7%), Nigrospora oryzae (3.5%). Volatile substances produced by these isolates were identified through gas-chromatography techniques, as phenylethyl alcohol, 4-methylquinazoline, benzothiazole, benzyl alcohol, lilial, galaxolide, among others. These inhibitory volatiles could play a significant role in reduction of C. acutatum expansion in olive and their study as potential biocontrol agents should be further explored. Copyright © 2015 Elsevier GmbH. All rights reserved.

Microbial diversity and dynamics during the production of May bryndza cheese.

PubMed

Pangallo, Domenico; Saková, Nikoleta; Koreňová, Janka; Puškárová, Andrea; Kraková, Lucia; Valík, Lubomír; Kuchta, Tomáš

2014-01-17

Diversity and dynamics of microbial cultures were studied during the production of May bryndza cheese, a traditional Slovak cheese produced from unpasteurized ewes' milk. Quantitative culture-based data were obtained for lactobacilli, lactococci, total mesophilic aerobic counts, coliforms, E. coli, staphylococci, coagulase-positive staphylococci, yeasts, fungi and Geotrichum spp. in ewes' milk, curd produced from it and ripened for 0 - 10 days, and in bryndza cheese produced from the curd, in three consecutive batches. Diversity of prokaryotes and eukaryotes in selected stages of the production was studied by non-culture approach based on amplification of 16S rDNA and internal transcribed spacer region, coupled to denaturing gradient gel electrophoresis and sequencing. The culture-based data demonstrated an overall trend of growth of the microbial population contributing to lactic acid production and to ripening of the cheese, lactobacilli, lactococci and Geotrichum spp. growing up to densities of 10(8) CFU/g, 10(9) CFU/g and 10(5) CFU/g, respectively, in all three consecutive batches of bryndza cheese. The diversity of bacteria encompassed Acinetobacter calcoaceticus, Acinetobacter guillouiae, Acinetobacter sp., Acinetobacter johnsonii, Citrobacter braakii, Clostridium bartlettii, Corynebacterium callunae, Corynebacterium maris, Enterobacter aerogenes, Enterobacter asburiae, Enterobacter hormaechei, Enterococcus faecium, Enterococcus pallens, Escherichia coli, Haemophilus haemolyticus, Hafnia alvei, Kluyvera cryocrescens, Lactobacillus helveticus, Lactococcus garvieae, Lc. lactis subsp. cremoris, Lc. lactis subsp. lactis, "Leuconostoc garlicum", Mannheimia glucosida, Mannheimia haemolytica, Pseudomonas sp., Ps. fluorescens, "Ps. reactans", Raoultella ornithinolytica, R. terrigena, "Rothia arfidiae", Staphylococcus aureus, Staph. epidermidis, Staph. felis, Staph. pasteuri, Staph. sciuri, Staph. xylosus, Streptococcus parauberis, Str. thermophilus and Variovorax paradoxus. The diversity of yeasts and fungi encompassed Alternaria alternata, "Ascomycete sp.", Aspergillus fumigatus, Beauveria brongniartii, Candida xylopsoci, C. inconspicua, Cladosporium cladosporioides, Debaromyces hansenii, Fomes fomentarius, Galactomyces candidus, Gymnoascus reesii, Chaetomium globosum, Kluyveromyces marxianus, Metarhizium anisopliae, Penicillium aurantiogriseum, P. camemberti, P. freii, P. polonicum, P. viridicatum, Pichia kudriavzevii, Sordaria alcina, Trichosporon lactis and Yarrowia lipolytica. © 2013.

Development of an environmental relative moldiness index for US homes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vesper, Sephen J.; McKinstry, Craig A.; Haugland, Richard A.

2007-08-01

As part of the HUD American Healthy Survey, dust samples were collected by vacuuming 2 m2 in the bedroom plus 2 m2 in the living room of a nationally representative 1096 homes in the USA using the Mitest™ sampler. Five mg of sieved (300 µ pore, nylon mesh) dust was analyzed by mold specific quantitative PCR for the 36 EPA Mold Panel Species. On this basis, an “environmental relative moldiness index” (ERMI) was created with values ranging from about -10 to 20 (lowest to highest). In order to try to reduce the cost of this analysis, the number of testmore » species was reduced by selecting only those species with a national average concentration of 30 cell equivalents (CE) per mg dust or greater. Only 19 of 36 species met this criterion. (In 40% of the homes, an additional 46 species were quantified from the same dust sample. All of these species had average concentrations less than 30 CE per mg dust.) These 19 species were then categorized into two groups based on their coefficient of variation (CV). If the CV was > 9, the mold was placed in Category 1 (10/19) and the other molds were placed in Category 2 (9/19). Using these Categories, the sum of the log-transformed concentrations of three Category 2 molds (C. herbarum, A. alternata and C. cladosporioides Type 1) was subtracted from the sum of the log-transformed concentrations of the ten Category 1 molds (Aspergillus niger, A. ochraceus, A. penicillioides, A. restrictus, A. sydowii, Chaetomium globosum, Eurotium amsteldoami, Paecilomyces variotii, Penicillium chrysogenum and Wallemia sebi). Assembling these values for the 1096 AHHS homes from lowest to highest produced the “American relative moldiness index” (ARMI). The correlation between the ERMI and ARMI values was 0.88. The ERMI or ARMI scales may be useful as a standard for mold exposure estimates in epidemiological studies.« less

An Endophytic Fungus, Talaromyces radicus, Isolated from Catharanthus roseus, Produces Vincristine and Vinblastine, Which Induce Apoptotic Cell Death.

PubMed

Palem, Padmini P C; Kuriakose, Gini C; Jayabaskaran, Chelliah

2015-01-01

Endophytic fungi isolated from Catharanthus roseus were screened for the production of vincristine and vinblastine. Twenty-two endophytic fungi isolated from various tissues of C. roseus were characterized taxonomically by sequence analysis of the internal transcribed spacer (ITS) region of rDNA and grouped into 10 genera: Alternaria, Aspergillus, Chaetomium, Colletotrichum, Dothideomycetes, Eutypella, Eutypa, Flavodon, Fusarium and Talaromyces. The antiproliferative activity of these fungi was assayed in HeLa cells using the MTT assay. The fungal isolates Eutypella sp--CrP14, obtained from stem tissues, and Talaromyces radicus--CrP20, obtained from leaf tissues, showed the strongest antiproliferative activity, with IC50 values of 13.5 μg/ml and 20 μg/ml, respectively. All 22 endophytic fungi were screened for the presence of the gene encoding tryptophan decarboxylase (TDC), the key enzyme in the terpenoid indole alkaloid biosynthetic pathway, though this gene could only be amplified from T. radicus--CrP20 (NCBI GenBank accession number KC920846). The production of vincristine and vinblastine by T. radicus--CrP20 was confirmed and optimized in nine different liquid media. Good yields of vincristine (670 μg/l) in modified M2 medium and of vinblastine (70 μg/l) in potato dextrose broth medium were obtained. The cytotoxic activity of partially purified fungal vincristine was evaluated in different human cancer cell lines, with HeLa cells showing maximum susceptibility. The apoptosis-inducing activity of vincristine derived from this fungus was established through cell cycle analysis, loss of mitochondrial membrane potential and DNA fragmentation patterns.

Potential use of cucumber (Cucumis sativus L.) endophytic fungi as seed treatment agents against root-knot nematode Meloidogyne incognita.

PubMed

Yan, Xiao-ning; Sikora, Richard A; Zheng, Jing-wu

2011-03-01

Seed treatment with endophytic fungi has been regarded as an effective method for plant parasitic nematode control. Endophytic fungi from cucumber seedlings were isolated and screened for their potential to be used as seed treatment agents against Meloidogyne incognita. Among the 294 isolates screened, 23 significantly reduced galls formed by M. incognita in greenhouse test. The 10 most effective isolates were Fusarium (5), Trichoderma (1), Chaetomium (1), Acremonium (1), Paecilomyces (1), and Phyllosticta (1). Their control efficacies were repeatedly tested and their colonizations as well as in vitro activity against M. incognita were studied. They reduced the number of galls by 24.0%-58.4% in the first screening and 15.6%-44.3% in the repeated test, respectively. Phyllosticta Ph511 and Chaetomium Ch1001 had high colonizations on both the roots and the aboveground parts of cucumber seedlings. Fusarium isolates had colonization preference on the roots, their root colonizations ranging from 20.1% to 47.3% of the total root area. Trichoderma Tr882, Paecilomyces Pa972, and Acremonium Ac985 had low colonizations on both the roots and the aboveground parts. Acremonium Ac985, Chaetomium Ch1001, Paecilomyces Pa972, and Phyllosticta Ph511 produced compounds affecting motility of the second stage juveniles of M. incognita. Based on these results, Chaetomium Ch1001 was considered to have the highest potential as a seed treatment agent for M. incognita biocontrol.

Potential use of cucumber (Cucumis sativus L.) endophytic fungi as seed treatment agents against root-knot nematode Meloidogyne incognita *

PubMed Central

Yan, Xiao-ning; Sikora, Richard A.; Zheng, Jing-wu

2011-01-01

Seed treatment with endophytic fungi has been regarded as an effective method for plant parasitic nematode control. Endophytic fungi from cucumber seedlings were isolated and screened for their potential to be used as seed treatment agents against Meloidogyne incognita. Among the 294 isolates screened, 23 significantly reduced galls formed by M. incognita in greenhouse test. The 10 most effective isolates were Fusarium (5), Trichoderma (1), Chaetomium (1), Acremonium (1), Paecilomyces (1), and Phyllosticta (1). Their control efficacies were repeatedly tested and their colonizations as well as in vitro activity against M. incognita were studied. They reduced the number of galls by 24.0%–58.4% in the first screening and 15.6%–44.3% in the repeated test, respectively. Phyllosticta Ph511 and Chaetomium Ch1001 had high colonizations on both the roots and the aboveground parts of cucumber seedlings. Fusarium isolates had colonization preference on the roots, their root colonizations ranging from 20.1% to 47.3% of the total root area. Trichoderma Tr882, Paecilomyces Pa972, and Acremonium Ac985 had low colonizations on both the roots and the aboveground parts. Acremonium Ac985, Chaetomium Ch1001, Paecilomyces Pa972, and Phyllosticta Ph511 produced compounds affecting motility of the second stage juveniles of M. incognita. Based on these results, Chaetomium Ch1001 was considered to have the highest potential as a seed treatment agent for M. incognita biocontrol. PMID:21370507

Isolation of Fungi from Heterodera glycines and in vitro Bioassays for Their Antagonism to Eggs.

PubMed

Meyer, S L; Huettel, R N; Sayre, R M

1990-10-01

Twenty fungi were assayed in vitro for antagonism to eggs of Heterodera glycines. Eight of the fungi were isolated from cysts or eggs of H. glycines during the current study, one was isolated from Panagrellus redivivus, and eleven were obtained from other researchers or collections. The bioassays were conducted on eggs from nematodes that had been grown monoxenically on excised root tips. Phoma chrysanthemicola, one strain of Verticillium chlamydosporium, and one strain of V. lecanii caused a decrease (P < 0.01, P < 0.05, P < 0.05, respectively) in the number of viable eggs, although no hyphae were observed colonizing live eggs. Trichoderma polysporum infected live eggs but enhanced (P < 0.05) egg survival. Acremonium bacillisporum, Chaetomium sp., Drechmeria coniospora (two strains), Epicoccum sp., Exophiala jeanselmei, Fusarium sp., Neocosmospora vasinfecta, Scytalidium fulvum, Trichoderma harzianum (two strains), V. chlamydosporium (one strain), V. lecanii (three strains), and an unidentified fungus did not measurably affect egg viability, even though hyphae of five of these fungi were seen in live eggs. The bioassay provides a useful step in the selection of a biological control agent for this major nematode pest.

Interactions between nematophagous fungi and consequences for their potential as biological agents for the control of potato cyst nematodes.

PubMed

Jacobs, Helen; Gray, Simon N; Crump, David H

2003-01-01

The efficacies of three nematophagous fungi, Paecilomyces lilacinus, Plectosphaerella cucumerina and Pochonia chlamydosporia, for controlling potato cyst nematodes (PCN) as part of an Integrated Pest Management (IPM) regime were studied. The compatibility of the nematophagous fungi with commonly used chemical pesticides and their ability to compete with the soil fungi Rhizoctonia solani, Chaetomium globosum, Fusarium oxysporum, Penicillium bilaii and Trichoderma harzianum were tested in vitro. Paecilomyces lilacinus was the most successful competitor when the ability to grow and inhibit growth of an opposing colony at both 10 and 20 degrees C was considered. P. lilacinus also showed potential for control of the soil-borne fungal pathogen R. solani, releasing a diffusable substance in vitro which inhibited its growth and caused morphological abnormalities in its hyphae. Pochonia chlamydosporia was least susceptible to growth inhibition by other fungi at 20 degrees in vitro, but the isolate tested did not grow at 10 degrees. Plectosphaerella cucumerina was a poor saprophytic competitor. Radial growth of Paecilomyces lilacinus and Plectosphaerella cucumerina was slowed, but not prevented, when grown on potato dextrose agar incorporating the fungicides fenpiclonil and tolclofos-methyl, and was not inhibited by the addition of pencycuron or the nematicide oxamyl. Radial growth of Pochonia chlamydosporia was partially inhibited by all the chemical pesticides tested. The efficacy of Paecilomyces lilacinus as a control agent for R. solani was further investigated in situ. Treatment with P. lilacinus significantly reduced the symptoms of Rhizoctonia disease on potato stems in a pot trial. The effectiveness of P. lilacinus and P. cucumerina against PCN was also tested in situ. Three application methods were compared; incorporating the fungi into alginate pellets, Terra-Green inoculated with the fungi and applying conidia directly to the tubers. Both formulations containing P. lilacinus and formulation mixtures alone, particularly alginate pellets, significantly reduced multiplication of PCN in soil. We conclude that P. lilacinus showed the greatest potential for use in combination with selected fungicides and nematicides as part of an IPM programme for the control of PCN, but further work is required to confirm whether it is effective against PCN in soil.

Comparative degradation of oomycete, ascomycete, and basidiomycete cell walls by mycoparasitic and biocontrol fungi.

PubMed

Inglis, G D; Kawchuk, L M

2002-01-01

Fourteen fungi (primarily representing mycoparasitic and biocontrol fungi) were tested for their ability to grow on and degrade cell walls (CWs) of an oomycete (Pythium ultimum), ascomycete (Fusarium equisetii), and basidiomycete (Rhizoctonia solani), and their hydrolytic enzymes were characterized. Protein was detected in the cultural medium of eleven of the test isolates, and these fungi significantly degraded CWs over the 14-day duration of the experiment. In general, a greater level of CW degradation occurred for F. equisetii and P. ultimum than for R. solani. Fungi that degraded F. equisetii CWs were Coniothyrium minitans, Gliocladium roseum, Myrothecium verrucaria, Talaromyces flavus, and Trichoderma harzianum. Taxa degrading P ultimum CWs included Chaetomium globosum, Coniothyrium minitans, M. verrucaria, Seimatosporium sp., Talaromyces flavus, Trichoderma hamatum, Trichoderma harzianum, and Trichoderma viride. Production of extracellular protein was highly correlated with CW degradation. Considerable variation in the molecular weights of CW-degrading enzymes were detected among the test fungi and the CW substrates in zymogram electrophoresis. Multivariate analysis between CW degradation and hydrolysis of barley beta-glucan (beta1,3- and beta1,4-glucanases), laminarin (beta1,3- and beta1,6-glucanases), carboxymethyl cellulose (endo-beta1,4-glucanases), colloidal chitin (chitinases), and chitosan (chitosanases) was conducted. For F. equisetii CWs, the regression model accounted for 80% of the variability, and carboxymethyl cellulases acting together with beta-glucanases contributed an R2 of 0.52, whereas chitinases and beta-glucanases alone contributed an R2 of 0.11 and 0.12, respectively. Only 61% of the variability observed in the degradation of P. ultimum CWs was explained by the enzyme classes tested, and primarily beta-glucanases (R2 of 0.53) and carboxymethyl cellulases (R2 of 0.08) alone contributed to CW break down. Too few of the test fungi degraded R. solani CWs to perform multivariate analysis effectively. This study identified several fungi that degraded ascomyceteous and oomyceteous, and to a lesser extent, basidiomycetous CWs. An array of enzymes were implicated in CW degradation.

Chemical and bioactive diversities of the genus Chaetomium secondary metabolites.

PubMed

Zhang, Q; Li, H-Q; Zong, S-C; Gao, J-M; Zhang, A-L

2012-02-01

The genus Chaetomium fungi are considered to be a rich source of novel and bioactive secondary metabolites of great importance. Up till now, a variety of more than 200 secondary metabolites belonging to diverse structural types of chaetoglobosins, epipolythiodioxopiperazines, azaphilones, xanthones, anthraquinones, chromones, depsidones, terpenoids, and steroids have been discovered. Most of these fungal metabolites exhibited antitumor, cytotoxic, antimalarial, enzyme inhibitory, antibiotic, and other activities. This review covers the extraction, structure elucidation, structural diversity, and biological activities of natural products isolated from about 30 fungi associated with marine- and terrestrial- origins, and highlights some bioactive compounds as well as their mechanisms of action and structure-activity relationships.

Application of α- and β-naphthoflavones as monooxygenase inhibitors of Absidia coerulea KCh 93, Syncephalastrum racemosum KCh 105 and Chaetomium sp. KCh 6651 in transformation of 17α-methyltestosterone.

PubMed

Janeczko, Tomasz; Popłoński, Jarosław; Kozłowska, Ewa; Dymarska, Monika; Huszcza, Ewa; Kostrzewa-Susłow, Edyta

2018-08-01

In this work, 17α-methyltestosterone was effectively hydroxylated by Absidia coerulea KCh 93, Syncephalastrum racemosum KCh 105 and Chaetomium sp. KCh 6651. A. coerulea KCh 93 afforded 6β-, 12β-, 7α-, 11α-, 15α-hydroxy derivatives with 44%, 29%, 6%, 5% and 9% yields, respectively. S. racemosum KCh 105 afforded 7α-, 15α- and 11α-hydroxy derivatives with yields of 45%, 19% and 17%, respectively. Chaetomium sp. KCh 6651 afforded 15α-, 11α-, 7α-, 6β-, 9α-, 14α-hydroxy and 6β,14α-dihydroxy derivatives with yields of 31%, 20%, 16%, 7%, 5%, 7% and 4%, respectively. 14α-Hydroxy and 6β,14α-dihydroxy derivatives were determined as new compounds. Effect of various sources of nitrogen and carbon in the media on biotransformations were tested, however did not affect the degree of substrate conversion or the composition of the products formed. The addition of α- or β-naphthoflavones inhibited 17α-methyltestosterone hydroxylation but did not change the percentage composition of the resulting products. Copyright © 2018 Elsevier Inc. All rights reserved.

[Effect of a preparation from Chaetomium fungi on the growth of phytopathogenic fungi].

PubMed

Tomilova, O G; Shternshis, M V

2006-01-01

We studied the fungicidal activity of a biological preparation from the fungi of the genus Chaetomium against soil phytopathogenic fungi Rhizoctonia solani and Fusarium oxysporum. The inhibitory effect of the preparation under study depended on its concentration, duration of storage, and growth characteristics of pure cultures of the phytopathogens. The highest (98.8%) inhibitory activity was observed on day 3 of the interaction with Rhizoctonia solani. After a 2-year storage, this preparation was capable of inhibiting the growth of the phytopathogens only at high doses. The preparation precluded the development of bare patch and increased the productivity of potato plants. The preparation may serve as an alternative to chemical fungicides for plant protection.

Purification and properties of a beta-1,3-glucanase from Chaetomium sp. that is involved in mycoparasitism.

PubMed

Sun, Hui; Yang, Jinkui; Lin, Chao; Huang, Xiaowei; Xing, Ruihuan; Zhang, Ke-Qin

2006-01-01

A beta-1,3-glucanase was detected, using laminarin as substrate, in the culture broth of Chaetomium sp. Major activity was associated with a 70 kDa protein band visualized on a polyacrylamide gel. beta-1,3-Glucanase was purified by a one-step, native gel purification procedure. Optimal activity was observed at pH 6.0 and 30 degrees C (over 30 min). It could degrade cell walls of plant pathogens including Rhizoctonia solani, Gibberella zeae, Fusarium sp., Colletotrichum gloeosporioides and Phoma sp. The N-terminal amino acid residues of the purified beta-1,3-glucanase are PYQLQTP, which do not exhibit homology to other fungal beta-1,3-glucanases suggesting it may be a novel enzyme.

Bioconversion of straw into improved fodder: fungal flora decomposing rice straw.

PubMed

Helal, G A

2005-09-01

The fungal flora decomposing rice straw were investigated all over the soil of Sharkia Province, east of Nile Delta, Egypt, using the nylon net bag technique. Sixty-four straw-decomposing species belonging to 30 genera were isolated by the dilution plate method in ground rice straw-Czapek's agar medium at pH 6. The plates were incubated separately at 5℃, 25℃ and 45℃, respectively. Twenty nine species belonging to 14 genera were isolated at 5℃. The most frequent genus was Penicillium (seven species), and the next frequent genera were Acremonium (three species), Fusarium (three species), Alternaria, Chaetomium, Cladosporium, Mucor, Stachybotrys (two species) and Rhizopus stolonifer. At 25℃, 47 species belonging to 24 genera were isolated. The most frequent genus was Aspergillus (nine species), and the next frequent genera were ranked by Penicillium (five species), Chaetomium (three species), Fusarium (three species). Each of Alternaria, Cladosporium, Mucor, Myrothecium and Trichoderma was represented by two species. At 45℃, 15 species belonging to seven genera were isolated. These were seven species of Aspergillus, two species of Chaetomium and two species of Emericella, while Humicola, Malbranchea, Rhizomucor and Talaromyces were represented by one species respectively. The total counts of fungi the genera, and species per gram of dry straw were significantly affected by incubation temperature and soil analysis (P < 0.05).

Phylogenetic findings suggest possible new habitat and routes of infection of human eumyctoma.

PubMed

de Hoog, G Sybren; Ahmed, Sarah A; Najafzadeh, Mohammad J; Sutton, Deanna A; Keisari, Maryam Saradeghi; Fahal, Ahmed H; Eberhardt, Ursala; Verkleij, Gerard J; Xin, Lian; Stielow, Benjamin; van de Sande, Wendy W J

2013-01-01

Eumycetoma is a traumatic fungal infection in tropical and subtropical areas that may lead to severe disability. Madurella mycetomatis is one of the prevalent etiologic agents in arid Northeastern Africa. The source of infection has not been clarified. Subcutaneous inoculation from plant thorns has been hypothesized, but attempts to detect the fungus in relevant material have remained unsuccessful. The present study aims to find clues to reveal the natural habitat of Madurella species using a phylogenetic approach, i.e. by comparison of neighboring taxa with known ecology. Four species of Madurella were included in a large data set of species of Chaetomium, Chaetomidium, Thielavia, and Papulaspora (n = 128) using sequences of the universal fungal barcode gene rDNA ITS and the partial LSU gene sequence. Our study demonstrates that Madurella species are nested within the Chaetomiaceae, a family of fungi that mainly inhabit animal dung, enriched soil, and indoor environments. We hypothesize that cattle dung, ubiquitously present in rural East Africa, plays a significant role in the ecology of Madurella. If cow dung is an essential factor in inoculation by Madurella, preventative measures may involve the use of appropriate footwear in addition to restructuring of villages to reduce the frequency of contact with etiologic agents of mycetoma. On the other hand, the Chaetomiaceae possess a hidden clinical potential which needs to be explored.

Post-Flight Microbial Analysis of Samples from the International Space Station Water Recovery System and Oxygen Generation System

NASA Technical Reports Server (NTRS)

Birmele, Michele N.

2011-01-01

The Regenerative, Environmental Control and Life Support System (ECLSS) on the International Space Station (ISS) includes the the Water Recovery System (WRS) and the Oxygen Generation System (OGS). The WRS consists of a Urine Processor Assembly (UPA) and Water Processor Assembly (WPA). This report describes microbial characterization of wastewater and surface samples collected from the WRS and OGS subsystems, returned to KSC, JSC, and MSFC on consecutive shuttle flights (STS-129 and STS-130) in 2009-10. STS-129 returned two filters that contained fluid samples from the WPA Waste Tank Orbital Recovery Unit (ORU), one from the waste tank and the other from the ISS humidity condensate. Direct count by microscopic enumeration revealed 8.38 x 104 cells per mL in the humidity condensate sample, but none of those cells were recoverable on solid agar media. In contrast, 3.32 x lOs cells per mL were measured from a surface swab of the WRS waste tank, including viable bacteria and fungi recovered after S12 days of incubation on solid agar media. Based on rDNA sequencing and phenotypic characterization, a fungus recovered from the filter was determined to be Lecythophora mutabilis. The bacterial isolate was identified by rDNA sequence data to be Methylobacterium radiotolerans. Additional UPA subsystem samples were returned on STS-130 for analysis. Both liquid and solid samples were collected from the Russian urine container (EDV), Distillation Assembly (DA) and Recycle Filter Tank Assembly (RFTA) for post-flight analysis. The bacterium Pseudomonas aeruginosa and fungus Chaetomium brasiliense were isolated from the EDV samples. No viable bacteria or fungi were recovered from RFTA brine samples (N= 6), but multiple samples (N = 11) from the DA and RFTA were found to contain fungal and bacterial cells. Many recovered cells have been identified to genus by rDNA sequencing and carbon source utilization profiling (BiOLOG Gen III). The presence of viable bacteria and fungi from WRS and OGS subsystems demonstrates the need for continued monitoring of ECLSS during future ISS operations and investigation of advanced antimicrobial controls.

[Atmospheric concentration of fungus spores in Ankara and the effect of meteorological factors in 2003 period].

PubMed

Ceter, Talip; Pinar, Nur Münevver

2009-10-01

The atmospheric concentrations of airborne fungus spores change continuously according to the meteorological factors, and their intensity have important allergic effects on atopic subjects and opportunistic pathogenic effects on immunocompromised patients. The aim of this study was to identify the fungal spores found in Ankara atmosphere during 2003 period and to investigate the changes in spore concentrations in relation to meteorological factors. Fungal spores were sampled by using 7-day Burkard volumetric trap between January to December 2003, and probable identification was performed microscopically based on their morphological structures. A total of 433.079 spores/m3 belonging to 35 taxa were observed during the study. The rates of these taxa were as follows; 75.5% Cladosporium, 6.1% Alternaria, 2.2% Leptosphaeria, 2.2% Ustilago, 2.1% 1-septate ascospores, 2% Exosporium, 1.6% Pleospora, and 1.3% Drechslera. The other taxa with concentrations < 1% have consisted a total of 7.1% of all atmospheric spores (Puccinia, Curvularia, Coprinus, Nigrospora, Periconia, Melanomma, Torula, Ascobolus, Agrocybe, Pithomyces, Stemphyllium, Ganoderma, Boletus, Peronospora, Venturia, Paraphaeosphaeria, Epicoccum, Didymella, Chaetomium and Fusarium rates between 0.7-0.1%; Oidium, Xylaria, Botrytis, Melanospora, Dictyosporium, Sporormiella and Tetracoccosporium rates between 0.09-0.01%). Although fungal spores were detected in all months in Ankara atmosphere, the evaluation of the seasonal distribution of spore concentrations revealed that the highest value was detected in July (100.697 spores/m3), while the lowest value was in January (4268 spores/m3). When the effects of meteorological factors on spore concentrations were investigated, it was found that, monthly mean temperature (> 20 degrees C) has a strong positive correlation (p < 0.01), and monthly mean relative humidity (< %50) and precipitation (0-20 mm) have strong negative correlations (p < 0.01) on the spore concentrations, while wind velocity (3 m/s) has a slightly positive effect. An annual spore calendar which indicated weekly concentrations and allergenicity levels of those identified fungal spores, was also prepared in this study. In conclusion, it is expected that these data would be helpful for the researchers in the area of aeropalinology and for the clinicians to evaluate allergic diseases.

A Preliminary Toxicological Evaluation of Eight Chemicals Used as Wood Preservatives.

DTIC Science & Technology

1984-05-01

Fungicides , 1959. NAS/NRC. 2. Abstract journal searched: Chemical Abstracts to December 1980. 3. Computer searches: The following data bases were...changed the qualitative composition of the microflora by replacing Fusarium, Penicillium, Aspergillus, Trichoderma and Chaetomium species with Streptomyces

Polyketides from two Chaetomium species and their biological functions.

PubMed

Li, He; Liao, Zhong-Bin; Tang, Dan; Han, Wen-Bo; Zhang, Qiang; Gao, Jin-Ming

2018-04-16

Four new secondary metabolites, chaetosemins G-J (1-4), along with 11 known ones (5-15) were isolated from the culture of C. seminudum C208 and Chaetomium sp. C521. Their structures were determined by extensive NMR spectroscopic analyses. These metabolites were evaluated in vitro for antifungal, antioxidant, toxicity, and α-glucosidase inhibitory activities. Chaetosemin J (4) and monaschromone (5) significantly inhibited the growth of four plant pathogenic fungi Botrytis cinerea, Alternaria solani, Magnaporthe oryzae, and Gibberella saubinettii with the minimum inhibitory concentrations (MIC) values ranging from 6.25 to 25.0 μM. Moreover, both epicoccone B (11) and flavipin (14) exhibited the DPPH free radical scavenging ability with IC 50 values of 10.8 and 7.2 μM, respectively, and had more potent α-glucosidase inhibition than the drug acarbose with IC 50 values of 27.3 and 33.8 μM, respectively. Monaschromone (5) might act as the lead compound of pesticide.

Banana peel culture as an indigenous medium for easy identification of late-sporulation human fungal pathogens.

PubMed

Kindo, A J; Tupaki-Sreepurna, A; Yuvaraj, M

2016-01-01

Fungi are increasing in incidence as human pathogens and newer and rarer species are continuously being encountered. Identifying these species from growth on regular culture media may be challenging due to the absence of typical features. An indigenous and cheap medium, similar to the natural substrate of these fungi, was standardised in our laboratory as an aid to species identification in a conventional laboratory setting. Ripe banana peel pieces, sterilised in an autoclave at 121°C temperature and 15 lbs pressure for 15 min promoted good growth of hyphae and pycnidia or acervuli in coelomycetes, flabelliform and medusoid fruiting bodies of basidiomycetes and fruit bodies such as cleistothecium in ascomycetes. The growth from the primary isolation medium was taken and inoculated onto the pieces of double-autoclaved ripe banana peel pieces in a sterile glass Petri dish with some moisture (sprinkles of sterile distilled water). A few sterile coverslips were placed randomly inside the Petri dish for the growing fungus to stick on to it. The plates were kept at room temperature and left undisturbed for 15-20 days. At a time, one coverslip was taken out and placed on a slide with lactophenol cotton blue and focused under the microscope to look for fruit bodies. Lasiodiplodia theobromae, Macrophomina phaseolina, Nigrospora sphaerica, Chaetomium murorum, Nattrassia mangiferae and Schizophyllum commune were identified by characteristic features from growth on banana peel culture. Banana peel culture is a cheap and effective medium resembling the natural substrate of fungi and is useful for promoting characteristic reproductive structures that aid identification.

Optimization of Process Conditions for Enzymatic Modification of Alternan using Dextranase from Chaetomium erraticum

USDA-ARS?s Scientific Manuscript database

Alternan is a unique branched glucan with alternating a-(1 ' 6) and a-(1 ' 3) backbone linkages. We previously described the modification of alternan to a reduced molecular weight form using dextranase from Penicillium sp. The solution viscosity properties of this modified alternan resemble those ...

Endocarpic Microorganisms of Two Types of Windrow-Dried Peanut Fruit (Arachis hypogaea L.) 1

PubMed Central

Porter, D. Morris; Garren, Kenneth H.

1970-01-01

The endocarpic microorganisms of peanut fruit dried in either a random windrow (plants left as they fell from the digger) or an inverted windrow (plants inverted to expose fruit to sunlight) were different from that of freshly dug fruit. Chaetomium, Penicillium, Trichoderma, Rhizoctonia, and Fusarium were the dominant fungi found associated with shells (pericarp) of freshly dug fruit. The dominant fungi of shells of windrowed fruit included Chaetomium, Rhizoctonia, Fusarium, Sclerotium, and Alternaria. Seeds of freshly dug fruit were dominated by Penicillium and Aspergillus. The only dominant species in seed of windrowed fruit was Penicillium. Microorganisms were isolated from shells and seed of freshly dug fruit at a frequency of 79% and 52%, respectively. The percentage of infestation was reduced by drying in the field. This was particularly true of the inverted windrow. The proportion of shells and seed infested with a microorganism was reduced 13% and 36%, respectively, after field drying for 5 to 7 days in random and inverted windrows. Microorganisms were isolated much more frequently from shell pieces (73%) than from seed (36%). Images PMID:5466133

Endocarpic microorganisms of two types of windrow-dried peanut fruit (Arachis hypogaea L.).

PubMed

Porter, D M; Garren, K H

1970-07-01

The endocarpic microorganisms of peanut fruit dried in either a random windrow (plants left as they fell from the digger) or an inverted windrow (plants inverted to expose fruit to sunlight) were different from that of freshly dug fruit. Chaetomium, Penicillium, Trichoderma, Rhizoctonia, and Fusarium were the dominant fungi found associated with shells (pericarp) of freshly dug fruit. The dominant fungi of shells of windrowed fruit included Chaetomium, Rhizoctonia, Fusarium, Sclerotium, and Alternaria. Seeds of freshly dug fruit were dominated by Penicillium and Aspergillus. The only dominant species in seed of windrowed fruit was Penicillium. Microorganisms were isolated from shells and seed of freshly dug fruit at a frequency of 79% and 52%, respectively. The percentage of infestation was reduced by drying in the field. This was particularly true of the inverted windrow. The proportion of shells and seed infested with a microorganism was reduced 13% and 36%, respectively, after field drying for 5 to 7 days in random and inverted windrows. Microorganisms were isolated much more frequently from shell pieces (73%) than from seed (36%).

Asymmetry in the function and dynamics of the cytosolic group II chaperonin CCT/TRiC

PubMed Central

Yamamoto, Yohei Y.; Uno, Yuko; Sha, Eiryo; Ikegami, Kentaro; Ishii, Noriyuki; Dohmae, Naoshi; Sekiguchi, Hiroshi; Sasaki, Yuji C.

2017-01-01

The eukaryotic group II chaperonin, the chaperonin-containing t-complex polypeptide 1 (CCT), plays an important role in cytosolic proteostasis. It has been estimated that as much as 10% of cytosolic proteins interact with CCT during their folding process. CCT is composed of 8 different paralogous subunits. Due to its complicated structure, molecular and biochemical investigations of CCT have been difficult. In this study, we constructed an expression system for CCT from a thermophilic fungus, Chaetomium thermophilum (CtCCT), by using E. coli as a host. As expected, we obtained recombinant CtCCT with a relatively high yield, and it exhibited fairly high thermal stability. We showed the advantages of the overproduction system by characterizing CtCCT variants containing ATPase-deficient subunits. For diffracted X-ray tracking experiment, we removed all surface exposed cysteine residues, and added cysteine residues at the tip of helical protrusions of selected two subunits. Gold nanocrystals were attached onto CtCCTs via gold-thiol bonds and applied for the analysis by diffracted X-ray tracking. Irrespective of the locations of cysteines, it was shown that ATP binding induces tilting motion followed by rotational motion in the CtCCT molecule, like the archaeal group II chaperonins. When gold nanocrystals were attached onto two subunits in the high ATPase activity hemisphere, the CtCCT complex exhibited a fairly rapid response to the motion. In contrast, the response of CtCCT, which had gold nanocrystals attached to the low-activity hemisphere, was slow. These results clearly support the possibility that ATP-dependent conformational change starts with the high-affinity hemisphere and progresses to the low-affinity hemisphere. PMID:28463997

Asymmetry in the function and dynamics of the cytosolic group II chaperonin CCT/TRiC.

PubMed

Yamamoto, Yohei Y; Uno, Yuko; Sha, Eiryo; Ikegami, Kentaro; Ishii, Noriyuki; Dohmae, Naoshi; Sekiguchi, Hiroshi; Sasaki, Yuji C; Yohda, Masafumi

2017-01-01

The eukaryotic group II chaperonin, the chaperonin-containing t-complex polypeptide 1 (CCT), plays an important role in cytosolic proteostasis. It has been estimated that as much as 10% of cytosolic proteins interact with CCT during their folding process. CCT is composed of 8 different paralogous subunits. Due to its complicated structure, molecular and biochemical investigations of CCT have been difficult. In this study, we constructed an expression system for CCT from a thermophilic fungus, Chaetomium thermophilum (CtCCT), by using E. coli as a host. As expected, we obtained recombinant CtCCT with a relatively high yield, and it exhibited fairly high thermal stability. We showed the advantages of the overproduction system by characterizing CtCCT variants containing ATPase-deficient subunits. For diffracted X-ray tracking experiment, we removed all surface exposed cysteine residues, and added cysteine residues at the tip of helical protrusions of selected two subunits. Gold nanocrystals were attached onto CtCCTs via gold-thiol bonds and applied for the analysis by diffracted X-ray tracking. Irrespective of the locations of cysteines, it was shown that ATP binding induces tilting motion followed by rotational motion in the CtCCT molecule, like the archaeal group II chaperonins. When gold nanocrystals were attached onto two subunits in the high ATPase activity hemisphere, the CtCCT complex exhibited a fairly rapid response to the motion. In contrast, the response of CtCCT, which had gold nanocrystals attached to the low-activity hemisphere, was slow. These results clearly support the possibility that ATP-dependent conformational change starts with the high-affinity hemisphere and progresses to the low-affinity hemisphere.

Cellobiose dehydrogenase of Chaetomium sp. INBI 2-26(-): structural basis of enhanced activity toward glucose at neutral pH.

PubMed

Vasilchenko, Liliya G; Karapetyan, Karen N; Yershevich, Olga P; Ludwig, Roland; Zamocky, Marcel; Peterbauer, Clemens K; Haltrich, Dietmar; Rabinovich, Mikhail L

2011-05-01

Cellobiose dehydrogenase (CDH) is an extracellular fungal flavocytochrome specifically oxidizing cellooligosaccharides and lactose to corresponding (-lactones by a variety of electron acceptors. In contrast to basidiomycetous CDHs, CDHs of ascomycetes also display certain activity toward glucose. The objective of this study was to establish the structural reasons of such an activity of CDH from mesophilic ascomycete Chaetomium sp. INBI 2-26 (ChCDH). The complete amino acid sequence of ChCDH displayed high levels of similarity with the amino acid sequences of CDHs from the thermophilic fungi Thielavia heterotallica and Myriococcum thermophilum. Peptide mass fingerprinting of purified ChCDH provided evidence for the oxidation of methionine residues in the FAD-domain. Comparative homology modeling of the structure of the ChCDH FAD-domain in complex with the transition state analog based on the structure of the same complex of basidiomycetous CDH (1NAA) as template indicated possible structural reasons for the enhanced activity of ascomycetous CDHs toward glucose at neutral pH, which is a prerequisite for application of CDH in a variety of biocompatible biosensors and biofuel cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Immobilization of dextranase from Chaetomium erraticum.

PubMed

Erhardt, Frank Alwin; Jördening, Hans-Joachim

2007-09-30

In order to facilitate the Co-Immobilization of dextransucrase and dextranase, various techniques for the immobilization of industrial endo-dextranase from Chaetomium erraticum (Novozymes A/S) were researched. Adsorption isotherms at various pH-values have been determined for bentonite (Montmorillonite), hydroxyapatite and Streamline DEAE. Using bentonite and hydroxyapatite, highest activity loads (12,000 Ug(-1); 2900 Ug(-1), respectively) can be achieved without a significant change of the apparent Michaelis-Menten constant K(M). For successful adsorption, enzyme to bentonite ratios greater than 0.4 (w/w) have to be used as lower ratios lead to 90% enzyme inactivation due to bentonite contact. In addition, covalent linkage using the activated oxiran carriers Eupergit C and Eupergit C250L as well as linkage with aminopropyl silica via metaperiodate activation of glycosyl moiety of dextranase are discussed. This is also the first report probing the structure of a matrix containing dextranase by use of substrate species with different molecular weights. From this we can observe a relationship between the porosity of Eupergit and dextran dependent activity. For the reactor concept using Co-Immobilisates, hydroxyapatite will be preferred to Eupergit because of its higher specific activity and dispersity.

Fungal flora associated with combine harvester wheat and sorghum dusts from Egypt.

PubMed

Abdel-Hafez, S I; Moubasher, A H; Shoreit, A A; Ismail, M A

1990-01-01

107 species and 8 species varieties belonging to 44 genera were collected from combine harvester wheat and sorghum dusts (35 genera and 91 species + 4 varieties) and from the atmosphere of their hay sites (26 genera and 69 species + 4 varieties) on glucose- and cellulose-Czapek's Dox agar at 28 degrees C and 45 degrees C. The mycoflora of wheat and sorghum dusts were basically similar on the two types of media and the most common fungi were: Alternaria alternata, Aspergillus flavus, A. fumigatus, A. niger, A. ochraceus, A. sydowii, A. terreus, Cochliobolus spicifer, Emericella nidulans, Fusarium moniliforme, Penicillium chrysogenum, P. duclauxii, P. funiculosum and P. oxalicum. Truly thermophilic species were frequently encountered from the two substrates: Chaetomium thermophilum, Humicola grisea var. thermoidae, H. insolens, Malbranchea pulchella var., sulphurea, Rhizomucor pusillus, Sporotrichum thermophilum, Talaromyces thermophilus, Thermoascus thermophilus and Thermomyces lanuginosus. The airborne fungi in the two atmospheres were basically similar and the most prevalent species were members of Alternaria (1 species), Aspergillus (18 species + 2 varieties), Chaetomium (2 species), Cochliobolus(3 species), Emericella (3 species + 2 varieties), Fusarium (3 species), Mucor (1 species), Penicillium (14 species) and Stachybotrys (1 species).

Enhancement of catalytic activity and thermostability of a thermostable cellobiohydrolase from Chaetomium thermophilum by site-directed mutagenesis.

PubMed

Han, Chao; Li, Weiguang; Hua, Chengyao; Sun, Fengqing; Bi, Pengsheng; Wang, Qunqing

2018-05-20

Enzymatic saccharification of lignocellulosic biomass is increasingly applied in agricultural and industrial applications. Nevertheless, low performance in the extreme environment severely prevents the utilization of commercial enzyme preparations. To obtain cellobiohydrolases with improved catalytic activity and thermostability, structure-based rational design was performed based on a thermostable cellobiohydrolase CtCel6 from Chaetomium thermophilum. In the present study, four conserved and noncatalytic residue substitutions were generated via site-directed mutagenesis. Mutations were heterologously expressed in yeast Pichia pastoris, purified, and ultimately assayed for enzymatic characteristics. The mutant Y119F increased the catalytic activity 1.82-, 1.65- and 1.43-fold against β-d-glucan, phosphoric acid swollen cellulose (PASC) and carboxymethylcellulose sodium (CMC-Na), respectively. In addition, S131 W effectively enhanced the enzyme's heat resistance to elevated temperatures. The half-life (t 1/2 ) of this mutant enzyme was increased 1.42- and 2.40-fold at 80 °C and 90 °C, respectively, compared to the wild-type. This study offers initial insight into the biological function of the conserved and noncatalytic residues of thermostable cellobiohydrolases and provides a valid approach to the improvement of enzyme redesign proposal. Copyright © 2018 Elsevier B.V. All rights reserved.

The chloroplast and mitochondrial genome sequences of the charophyte Chaetosphaeridium globosum: Insights into the timing of the events that restructured organelle DNAs within the green algal lineage that led to land plants

PubMed Central

Turmel, Monique; Otis, Christian; Lemieux, Claude

2002-01-01

The land plants and their immediate green algal ancestors, the charophytes, form the Streptophyta. There is evidence that both the chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) underwent substantial changes in their architecture (intron insertions, gene losses, scrambling in gene order, and genome expansion in the case of mtDNA) during the evolution of streptophytes; however, because no charophyte organelle DNAs have been sequenced completely thus far, the suite of events that shaped streptophyte organelle genomes remains largely unknown. Here, we have determined the complete cpDNA (131,183 bp) and mtDNA (56,574 bp) sequences of the charophyte Chaetosphaeridium globosum (Coleochaetales). At the levels of gene content (124 genes), intron composition (18 introns), and gene order, Chaetosphaeridium cpDNA is remarkably similar to land-plant cpDNAs, implying that most of the features characteristic of land-plant lineages were gained during the evolution of charophytes. Although the gene content of Chaetosphaeridium mtDNA (67 genes) closely resembles that of the bryophyte Marchantia polymorpha (69 genes), this charophyte mtDNA differs substantially from its land-plant relatives at the levels of size, intron composition (11 introns), and gene order. Our finding that it shares only one intron with its land-plant counterparts supports the idea that the vast majority of mitochondrial introns in land plants appeared after the emergence of these organisms. Our results also suggest that the events accounting for the spacious intergenic spacers found in land-plant mtDNAs took place late during the evolution of charophytes or coincided with the transition from charophytes to land plants. PMID:12161560

Growth of Chaetomium cellulolyticum on Alkali-Pretreated Hardwood Sawdust Solids and Pretreatment Liquor

PubMed Central

Pamment, N.; Moo-Young, M.; Hsieh, F.-H.; Robinson, C. W.

1978-01-01

The treatment of a hardwood sawdust with 1% NaOH solution at 121°C dissolved 19.7% of the dry matter, mainly hemicellulose and lignin. Fermentation of the treated solids by Chaetomium cellulolyticum for 48 h gave a product containing 12.5% crude protein (total N × 6.25) on a dry weight basis. The in vitro rumen digestibility of the 48-h fermentation product was 30%, compared to 24% for the alkali-treated but unfermented sawdust. Growth was independent of sawdust particle size in the range 40 to 100 mesh. Fermentation of the pretreatment liquor gave a product containing up to 50% crude protein (dry weight basis) with an in vitro rumen digestibility of 65 to 76%. Approximately 6.7 g of crude protein was obtained from the treated solids and 2.2 g from the pretreatment liquor per 100 g of sawdust treated. The product from the pretreatment liquor fermentation has potential as a high-protein animal feed supplement but could not be produced economically without an outlet for the relatively indigestible product from the solids fermentation. Growth on the pretreatment liquor was strongly pH dependent; there was a considerable increase in the lag phase when the pH was lowered from 7.5 to 5.2. This effect appears to be due to an inhibitor whose toxicity is reduced at high pH. PMID:16345308

Prevalence of Fusarium species of the Liseola section on Zimbabwean corn and their ability to produce the mycotoxins zearalenone, moniliformin and fumonisin B1.

PubMed

Mubatanhema, W; Moss, M O; Frank, M J; Wilson, D M

1999-12-01

Maize samples were collected from nine Grain Marketing Board (G.M.B) centers in Zimbabwe during the 1991 harvest season. A further 47 samples collected directly from farmers and from the G.M.B., centers in Chinhoyi and Kwekwe during the 1992 harvest season. These samples were analyzed mycologically and the predominant flora was Fusarium although Penicillium, Nigrospora, Aspergillus and Chaetomium could be isolated from some samples. From the first nine samples studied, F. verticillioides and F. subglutinans were isolated in almost equal proportions on samples from the central and the south of the country whereas only F. verticillioides was isolated on the samples from the north. The subsequent study demonstrated that there was a greater fungal diversity in samples from North (Mashonaland West) than samples from the South (Midlands area) with species of Nigrospora, Chaetomium, Acremonium and Diplodia occurring in significant numbers. From a total of 2821 fungal isolates obtained from all the maize samples analyzed, 1485 (53%) were found to belong to the liseola section of Fusarium. The ability of these isolates to produce the mycotoxins zearalenone, moniliformin and fumonisin B1 was tested using a simplified TLC Agar plate method. Out of the 886 isolates tested, only one produced all the three mycotoxins simultaneously whilst most produced fumonisin B1 and/or moniliformin. Only nine isolates produced zearalenone.

Chaetomium thermophilum formate dehydrogenase has high activity in the reduction of hydrogen carbonate (HCO3 -) to formate.

PubMed

Aslan, Aşkın Sevinç; Valjakka, Jarkko; Ruupunen, Jouni; Yildirim, Deniz; Turner, Nicholas J; Turunen, Ossi; Binay, Barış

2017-01-01

While formate dehydrogenases (FDHs) have been used for cofactor recycling in chemoenzymatic synthesis, the ability of FDH to reduce CO 2 could also be utilized in the conversion of CO 2 to useful products via formate (HCOO - ). In this study, we investigated the reduction of CO 2 in the form of hydrogen carbonate (HCO 3 - ) to formate by FDHs from Candida methylica (CmFDH) and Chaetomium thermophilum (CtFDH) in a NADH-dependent reaction. The catalytic performance with HCO 3 - as a substrate was evaluated by measuring the kinetic rates and conducting productivity assays. CtFDH showed a higher efficiency in converting HCO 3 - to formate than CmFDH, whereas CmFDH was better in the oxidation of formate. The pH optimum of the reduction was at pH 7-8. However, the high concentrations of HCO 3 - reduced the reaction rate. CtFDH was modeled in the presence of HCO 3 - showing that it fits to the active site. The active site setting for hydride transfer in CO 2 reduction was modeled. The hydride donated by NADH would form a favorable contact to the carbon atom of HCO 3 - , resulting in a surplus of electrons within the molecule. This would cause the complex formed by hydrogen carbonate and the hydride to break into formate and hydroxide ions. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The first fossil fungus gardens of Isoptera: oldest evidence of symbiotic termite fungiculture (Miocene, Chad basin)

NASA Astrophysics Data System (ADS)

Duringer, Philippe; Schuster, Mathieu; Genise, Jorge F.; Likius, Andossa; Mackaye, Hassan Taisso; Vignaud, Patrick; Brunet, Michel

2006-12-01

Higher termites of the subfamily Macrotermitinae (fungus-growing termites) are known to build fungus gardens where a symbiotic fungus ( Termitomyces sp.) is cultivated. The fungus grows on a substrate called fungus comb, a structure built with the termites’ own faeces. Here we present the first fossil fungus combs ever found in the world. They were extracted from 7-million-year-old continental sandstone (Chad basin). Fossilized fungus combs have an ovoid morphology with a more or less flattened concave base and a characteristic general alveolar aspect. Under lens, they display a typical millimetre-scale pelletal structure. The latter, as well as the general shape and alveolar aspect, are similar to the morphology of fungus combs from extant fungus-growing termites.

Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lasure, Linda L; Dai, Ziyu

2008-10-21

The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.

[Effects of fungus on the growth of Dendrobium candidum and D. nobile in vitro culture].

PubMed

Song, J Y; Guo, S X

2001-12-01

To examine effects of fungus AR-18 (Epulorhiza sp.) on the growth of Dendrobium candidum and D. nobile in vitro culture. Effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when agar was used as rest, and effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when vermiculite was used as rest. In agar medium, effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were not significant (P > 0.05). However, in vermiculite medium, the effect of fungus AR-18 on fresh weight of D. nobile was significant (P < 0.05). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 16% compared with the non-inoculated ones (control). The effect of fungus AR-18 on dry weight of D. nobile was very significant (P < 0.01). Dry weight of D. nobile inoculated with fungus AR-18 was increased by 21% compared with the control. In vermiculite medium, the effect of combination treatment (Fungus AR-18 + Distilled H2O) on fresh weight of D. nobile was very significant (P < 0.01). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 47% compared with the control, while the effect of combination treatment (Fungus AR-18 + Nutrients) on fresh weight of D. nobile was not significant (P > 0.05). In addition, the effect of combinations treatment (Fungus AR-18 + Nutrients) and (Fungus AR-18 + Distilled H2O) on dry weight of D. nobile was not significant (P > 0.05). So the combination treatment (Fungus AR-18 + Distilled H2O) was the best for the growth of D. nobile. In vermiculite medium, effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum were not significant (P > 0.05). It is important in vitro culture to select a proper rest for the control of the growth of fungus to establish a beneficial symbiotic relationship between plants and fungi. If the fungus AR-18 is utilized as biological manure in got-up planting of D. nobile, a good result may be obtained.

Associations between fungal species and water-damaged building materials.

PubMed

Andersen, Birgitte; Frisvad, Jens C; Søndergaard, Ib; Rasmussen, Ib S; Larsen, Lisbeth S

2011-06-01

Fungal growth in damp or water-damaged buildings worldwide is an increasing problem, which has adverse effects on both the occupants and the buildings. Air sampling alone in moldy buildings does not reveal the full diversity of fungal species growing on building materials. One aim of this study was to estimate the qualitative and quantitative diversity of fungi growing on damp or water-damaged building materials. Another was to determine if associations exist between the most commonly found fungal species and different types of materials. More than 5,300 surface samples were taken by means of V8 contact plates from materials with visible fungal growth. Fungal identifications and information on building material components were analyzed using multivariate statistic methods to determine associations between fungi and material components. The results confirmed that Penicillium chrysogenum and Aspergillus versicolor are the most common fungal species in water-damaged buildings. The results also showed Chaetomium spp., Acremonium spp., and Ulocladium spp. to be very common on damp building materials. Analyses show that associated mycobiotas exist on different building materials. Associations were found between (i) Acremonium spp., Penicillium chrysogenum, Stachybotrys spp., Ulocladium spp., and gypsum and wallpaper, (ii) Arthrinium phaeospermum, Aureobasidium pullulans, Cladosporium herbarum, Trichoderma spp., yeasts, and different types of wood and plywood, and (iii) Aspergillus fumigatus, Aspergillus melleus, Aspergillus niger, Aspergillus ochraceus, Chaetomium spp., Mucor racemosus, Mucor spinosus, and concrete and other floor-related materials. These results can be used to develop new and resistant building materials and relevant allergen extracts and to help focus research on relevant mycotoxins, microbial volatile organic compounds (MVOCs), and microparticles released into the indoor environment.

Pulmonary aspergilloma

MedlinePlus

Aspergillosis is an infection caused by the fungus aspergillus. Aspergillomas are formed when the fungus grows in ... of fungus that causes disease in humans is Aspergillus fumigatus . Aspergillus is a common fungus. It grows ...

Attraction, Oviposition and Larval Survival of the Fungus Gnat, Lycoriella ingenua, on Fungal Species Isolated from Adults, Larvae, and Mushroom Compost.

PubMed

Cloonan, Kevin R; Andreadis, Stefanos S; Chen, Haibin; Jenkins, Nina E; Baker, Thomas C

2016-01-01

We previously showed that the females of the mushroom sciarid, Lycoriella ingenua (Dufour, 1839) (Diptera: Sciaridae), one of the most severe pests of the cultivated white button mushroom, Agaricus bisporus (J.E. Lange) Emil J. Imbach (Agaricales: Agaricaceae), are attracted to the mushroom compost that mushrooms are grown on and not to the mushrooms themselves. We also showed that females are attracted to the parasitic green mold, Trichoderma aggressivum. In an attempt to identify what is in the mushroom compost that attracts female L. ingenua, we isolated several species of fungi from adult males and females, third instar larvae, and mushroom compost itself. We then analyzed the attraction of females to these substrates using a static-flow two choice olfactometer, as well as their oviposition tendencies in another type of assay under choice and no-choice conditions. We also assessed the survival of larvae to adulthood when first instar larvae were placed on each of the isolated fungal species. We found that female flies were attracted most to the mycoparasitic green mold, T. aggressivum, to Penicilium citrinum isolated from adult female bodies, and to Scatylidium thermophilium isolated from the mushroom compost. Gravid female flies laid the most eggs on T. aggressivum, Aspergillus flavus isolated from third instar larval frass, Aspergillus fumigatus isolated from adult male bodies, and on P. citrinum. This egg-laying trend remained consistent under no-choice conditions as females aged. First instar larvae developed to adulthood only on S. thermophilium and Chaetomium sp. isolated from mushroom compost, and on P. citrinum. Our results indicate that the volatiles from a suite of different fungal species act in tandem in the natural setting of mushroom compost, with some first attracting gravid female flies and then others causing them to oviposit. The ecological context of these findings is important for creating an optimal strategy for using possible semiochemicals isolated from these fungal species to better monitor and control this pestiferous mushroom fly species.

Attraction, Oviposition and Larval Survival of the Fungus Gnat, Lycoriella ingenua, on Fungal Species Isolated from Adults, Larvae, and Mushroom Compost

PubMed Central

Cloonan, Kevin R.; Andreadis, Stefanos S.; Chen, Haibin; Jenkins, Nina E.; Baker, Thomas C.

2016-01-01

We previously showed that the females of the mushroom sciarid, Lycoriella ingenua (Dufour, 1839) (Diptera: Sciaridae), one of the most severe pests of the cultivated white button mushroom, Agaricus bisporus (J.E. Lange) Emil J. Imbach (Agaricales: Agaricaceae), are attracted to the mushroom compost that mushrooms are grown on and not to the mushrooms themselves. We also showed that females are attracted to the parasitic green mold, Trichoderma aggressivum. In an attempt to identify what is in the mushroom compost that attracts female L. ingenua, we isolated several species of fungi from adult males and females, third instar larvae, and mushroom compost itself. We then analyzed the attraction of females to these substrates using a static-flow two choice olfactometer, as well as their oviposition tendencies in another type of assay under choice and no-choice conditions. We also assessed the survival of larvae to adulthood when first instar larvae were placed on each of the isolated fungal species. We found that female flies were attracted most to the mycoparasitic green mold, T. aggressivum, to Penicilium citrinum isolated from adult female bodies, and to Scatylidium thermophilium isolated from the mushroom compost. Gravid female flies laid the most eggs on T. aggressivum, Aspergillus flavus isolated from third instar larval frass, Aspergillus fumigatus isolated from adult male bodies, and on P. citrinum. This egg-laying trend remained consistent under no-choice conditions as females aged. First instar larvae developed to adulthood only on S. thermophilium and Chaetomium sp. isolated from mushroom compost, and on P. citrinum. Our results indicate that the volatiles from a suite of different fungal species act in tandem in the natural setting of mushroom compost, with some first attracting gravid female flies and then others causing them to oviposit. The ecological context of these findings is important for creating an optimal strategy for using possible semiochemicals isolated from these fungal species to better monitor and control this pestiferous mushroom fly species. PMID:27936070

Differanisole A, an inducer of the differentiation of Friend leukemic cells, induces stalk cell differentiation in Dictyostelium discoideum.

PubMed

Kubohara, Y; Okamoto, K; Tanaka, Y; Asahi, K; Sakurai, A; Takahashi, N

1993-05-03

Differanisole A isolated from the conditioned medium of a soil microorganism, Chaetomium strain RB-001, is an inducer of the differentiation of the Friend leukemic cells (mouse leukemia cells). The chemical structure of this substance is very similar to that of stalk cell differentiation-inducing factor (DIF) isolated from the cellular slime mould, Dictyostelium discoideum. We examined the effects of differanisole A on Dictyostelium HM44 cells, a mutant strain which is defective in DIF production, and found this substance to be an inducer of stalk cell differentiation in D. discoideum.

Biosynthesis of human diazepam and clonazepam metabolites.

PubMed

de Paula, Núbia C; Araujo Cordeiro, Kelly C F; de Melo Souza, Paula L; Nogueira, Diogo F; da Silva e Sousa, Diego B; Costa, Maísa B; Noël, François; de Oliveira, Valéria

2015-03-01

A screening of fungal and microbial strains allowed to select the best microorganisms to produce in high yields some of the human metabolites of two benzodiazepine drugs, diazepam and clonazepam, in order to study new pharmacological activities and for chemical standard proposes. Among the microorganisms tested, Cunninghamella echinulata ATCC 9244 and Rhizopus arrhizus ATCC 11145 strains, were the most active producers of the mains metabolites of diazepam which included demethylated, hydroxylated derivatives. Beauveria bassiana ATCC 7159 and Chaetomium indicum LCP 984200 produced the 7 amino-clonazepam metabolite and a product of acid hydrolysis of this benzodiazepine. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fungi of virgin and cultivated soil of Salhiah Desert, Egypt.

PubMed

el-Gindy, A A; Saad, R R

1990-01-01

27 species and 13 genera of fungi were identified from virgin and cultivated soil of Salhiah. The most abundant species of phosphate solubilizing fungi were Aspergillus nidulans, A. niger, A flavus, Penicillium lilacinum, P. frequentans and Fusarium moniliforme. On cellulose agar the most prevalent species were Chaetomium bostrychodes, C. olivaceum, Humicola fuscoatra, Aspergillus flavus, A. nidulans, A. niger, A. ochraceus, Fusarium solani and F. oxysporum. On xylan agar Aspergillus fumigatus, A. ochraceus, A. niger, A. versicolor and Penicillium frequentans were the most frequent species. On lignin agar only two species were isolated. These are Aspergillus niger and Humicola fuscoatra.

Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

2008-11-11

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

2008-11-11

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

2014-05-27

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Dentigerumycin: a bacterial mediator of an ant-fungus symbiosis

PubMed Central

Oh, Dong-Chan; Poulsen, Michael; Currie, Cameron R.; Clardy, Jon

2009-01-01

Fungus-growing ants engage in mutualistic associations with both the fungus they cultivate for food and actinobacteria (Pseudonocardia spp.) that produce selective antibiotics to defend that fungus from specialized fungal parasites. In the first system to be analyzed at the molecular level, the bacterium associated with the ant Apterostigma dentigerum produces dentigerumycin, a cyclic depsipeptide with highly modified amino acids, to selectively inhibit the parasitic fungus (Escovopsis sp.). PMID:19330011

Associations between Fungal Species and Water-Damaged Building Materials ▿

PubMed Central

Andersen, Birgitte; Frisvad, Jens C.; Søndergaard, Ib; Rasmussen, Ib S.; Larsen, Lisbeth S.

2011-01-01

Fungal growth in damp or water-damaged buildings worldwide is an increasing problem, which has adverse effects on both the occupants and the buildings. Air sampling alone in moldy buildings does not reveal the full diversity of fungal species growing on building materials. One aim of this study was to estimate the qualitative and quantitative diversity of fungi growing on damp or water-damaged building materials. Another was to determine if associations exist between the most commonly found fungal species and different types of materials. More than 5,300 surface samples were taken by means of V8 contact plates from materials with visible fungal growth. Fungal identifications and information on building material components were analyzed using multivariate statistic methods to determine associations between fungi and material components. The results confirmed that Penicillium chrysogenum and Aspergillus versicolor are the most common fungal species in water-damaged buildings. The results also showed Chaetomium spp., Acremonium spp., and Ulocladium spp. to be very common on damp building materials. Analyses show that associated mycobiotas exist on different building materials. Associations were found between (i) Acremonium spp., Penicillium chrysogenum, Stachybotrys spp., Ulocladium spp., and gypsum and wallpaper, (ii) Arthrinium phaeospermum, Aureobasidium pullulans, Cladosporium herbarum, Trichoderma spp., yeasts, and different types of wood and plywood, and (iii) Aspergillus fumigatus, Aspergillus melleus, Aspergillus niger, Aspergillus ochraceus, Chaetomium spp., Mucor racemosus, Mucor spinosus, and concrete and other floor-related materials. These results can be used to develop new and resistant building materials and relevant allergen extracts and to help focus research on relevant mycotoxins, microbial volatile organic compounds (MVOCs), and microparticles released into the indoor environment. PMID:21531835

A mycological investigation of phane, an edible caterpillar of an emperor moth, Imbrasia belina.

PubMed

Simpanya, M F; Allotey, J; Mpuchane, S F

2000-01-01

Phane worm (an edible larval stage of the emperor moth Imbrasia belina Westwood) is an important food source, and its harvesting is an economic activity in rural Botswana. When the larva is feeding on leaves and later during processing, phane gets contaminated with fungi from the leaves and soil. We examined 73 jars, each containing approximately 608 g (+/-0.25 g) of processed phane stored under laboratory conditions (temperature range 20 to 24 degrees C and 50 to 80% relative humidity) and combined intestinal contents of five phane squeezed into each of 74 Duran bottles for fungi. Ninety seven percent of 74 samples of intestinal contents and 57.5% of 73 laboratory-stored phane were positive for either molds and/or yeasts. Yeast population in intestinal contents ranged from 2 x 10(1) CFU/g to 5 x 10(3) CFU/g, whereas molds ranged from 1 x 10(1) CFU/g to 2 x 10(2) CFU/g. Laboratory-stored phane had a mold population of 1 x 10(2) CFU/g to 6 x 10(5) CFU/g. Species of Chaetomium 13.8%, Aspergillus 12.4%, Fusarium 5.5%, and Mucor racemosus 4.1% were the most prevalent in intestinal contents of phane, whereas Aspergillus 42.1%, Penicillium 33.9%, and Mucorales 5.7% were predominant in laboratory-stored phane. The important mycotoxigenic fungi A. flavus, A. parasiticus, A. ochraceus, P. aurantiogriseum, P. citrinum, and P. verrucosum were isolated mainly from the laboratory-stored phane. The genera isolated from both intestinal phane contents and laboratory-stored phane were Alternaria, Aspergillus, Chaetomium, Drechslera, Fusarium, Mucor, Phoma, and Penicillium, suggesting recontamination of phane during drying and storage.

Resistance to Black Dot in Potato

USDA-ARS?s Scientific Manuscript database

Black dot fungus can colonize tubers on the surface, in the stolon end, or in a combination of both.On the surface the fungus is prevalent as sclerotia, and in the stolon end the fungus colonizes the vascular tissuesas hyphae. The fungus is introduced to non-infested soils mostly by infected potato ...

THE IMPORTANCE OF ANIMAL INFECTIONS FOR THE HUMAN

DTIC Science & Technology

tuberculosis, leptospiroses. VIRUS-CAUSED ZOOANTHROPONOSES: Rickettsioses, ornithosis, lyssa, arboviroses. FUNGUS-CAUSED ANIMAL-HUMAN INFECTIONS: filamentous fungus, yeast fungus. PROTOZOA DISEASES: Toxoplasmoses .

Contamination of Pine Seeds by the Pitch Canker Fungus

Treesearch

L. David Dwinell; S.W. Fraedrich

1999-01-01

The pitch canker fungus, Fusarium subglutinans f. sp. pini, has been identified as a significant problem in man pine seed orchards and nursuries in the South. THe fungus causes strobilus mortality, seed deterioation, and cankers on the main stem, branches, and shoots of pines Dwinell and others 1985). The pitche canker fungus...

Native arbuscular mycorrhizal symbiosis alters foliar bacterial community composition.

PubMed

Poosakkannu, Anbu; Nissinen, Riitta; Kytöviita, Minna-Maarit

2017-11-01

The effects of arbuscular mycorrhizal (AM) fungi on plant-associated microbes are poorly known. We tested the hypothesis that colonization by an AM fungus affects microbial species richness and microbial community composition of host plant tissues. We grew the grass, Deschampsia flexuosa in a greenhouse with or without the native AM fungus, Claroideoglomus etunicatum. We divided clonally produced tillers into two parts: one inoculated with AM fungus spores and one without AM fungus inoculation (non-mycorrhizal, NM). We characterized bacterial (16S rRNA gene) and fungal communities (internal transcribed spacer region) in surface-sterilized leaf and root plant compartments. AM fungus inoculation did not affect microbial species richness or diversity indices in leaves or roots, but the AM fungus inoculation significantly affected bacterial community composition in leaves. A total of three OTUs in leaves belonging to the phylum Firmicutes positively responded to the presence of the AM fungus in roots. Another six OTUs belonging to the Proteobacteria (Alpha, Beta, and Gamma) and Bacteroidetes were significantly more abundant in NM plants when compared to AM fungus-inoculated plants. Further, there was a significant correlation between plant dry weight and leaf microbial community compositional shift. Also, there was a significant correlation between leaf bacterial community compositional shift and foliar nitrogen content changes due to AM fungus inoculation. The results suggest that AM fungus colonization in roots has a profound effect on plant physiology that is reflected in leaf bacterial community composition.

Final Environmental Assessment and Finding of No Significant Impact: Deployment of Up to Four F-16C Aircraft to the 133rd Airlift Wing for Air Sovereignty Alert Operations

DTIC Science & Technology

2007-11-01

species of moss FUNGI Endangered Fuscoboletinus weaverae . . . . . . . . . . . . . . a species of fungus Psathyrella cystidiosa...a species of fungus Psathyrella rhodospora . . . . . . . . . . . . . . . a species of fungus Special concern Laccaria trullisata...SC . . . . . . . . . caddisfly Psathyrella cystidiosa . . . . . . . . . . . . . . . . a species of fungus

Host deception: Predaceous fungus, esteya vermicola, entices pine wood nematode by mimicking the scent of its host pine for nutrient

USDA-ARS?s Scientific Manuscript database

A nematophagous fungus, Esteya vermicola, is recorded as the first endoparasitic fungus of pine wood nematode (PWN), Burasphelenchus xylophilus, in the last century. E. vermicola exhibited high infectivity toward PWN in the laboratory conditions and conidia spraying of this fungus on Japanese red pi...

Fungi inhabiting household environments in Riyadh, Saudi Arabia.

PubMed

Bokhary, H A; Parvez, S

1995-05-01

Fungi inhabiting household environments in the West, East and Central localities of Riyadh city were screened. The screened area included bedrooms, drawing rooms, living rooms, kitchens and bathrooms. The common genera of fungi isolated were Alternaria, Aspergillus, Cercospora, Chaetomium, Cladosporium, Curvularia, Drechslera, Embellisia, Fusarium, Mucor, Penicillium, Rhizopus, Scytalidium, Trichoderma, Torula and Ulocladium. Two uncommon genera Nodulosporium and Oidiodendron for Saudi Arabian mycoflora were also isolated. In all the localities, the highest number of fungal colonies per plate or per gram were found in the living rooms, followed by bedrooms. The number of colonies per plate or per gram was in general higher in densely populated than in less populated areas.

[Onychocola canadensis Sigler in onychomycosis : A new dermatophyte-like mould in Germany].

PubMed

Nenoff, P; Schorlemmer, B; Uhrlaß, S; Baunacke, A; Baunacke, A; Friedrichs, C; Iffländer, J; Syhre, E; Schneider, A; Krüger, C; Maier, T

2016-09-01

Moulds or non-dermatophyte moulds (NDM) are being increasingly isolated as causative agent of onychomycoses. Known causes of a NDM-OM are Scopulariopsis brevicaulis, Fusarium, Aspergillus, Acremonium, Neoscytalidium dimidiatum, Arthrographis kalrae, and Chaetomium. In this article, 5 patients with suspected nail infection due to Onychocola canadensis are reported for the first time in Germany. Systemic antifungal agents are not considered to be effective in NDM onychomycosis. In individual cases, however, terbinafine seems to be effective in Onychocola canadensis infection of the nails. Treatment of choice represents, however, nontraumatic nail avulsion using 40 % urea ointment followed by antifungal nail lacquer with ciclopirox olamine or amorolfine.

Isolation and characterization of an ether-type polyurethane-degrading micro-organism and analysis of degradation mechanism by Alternaria sp.

PubMed

Matsumiya, Y; Murata, N; Tanabe, E; Kubota, K; Kubo, M

2010-06-01

To degrade ether-type polyurethane (ether-PUR), ether-PUR-degrading micro-organism was isolated. Moreover, ether-PUR-degrading mechanisms were analysed using model compounds of ether-PUR. A fungus designated as strain PURDK2, capable of changing the configuration of ether-PUR, has been isolated. This isolated fungus was identified as Alternaria sp. Using a scanning electron microscope, the grid structure of ether-PUR was shown to be melted and disrupted by the fungus. The degradation of ether-PUR by the fungus was analysed, and the ether-PUR was degraded by the fungus by about 27.5%. To analyse the urethane-bond degradation by the fungus, a degraded product of ethylphenylcarbamate was analysed using GC/MS. Aniline and ethanol were detected by degradation with the supernatant, indicating that the fungus secreted urethane-bond-degrading enzyme(s). PURDK2 also degraded urea bonds when diphenylmethane-4,4'-dibutylurea was used as a substrate. The enzyme(s) from PURDK2 degraded urethane and urea bonds to convert the high molecular weight structure of ether-PUR to small molecules; and then the fungus seems to use the small molecules as an energy source. Ether-PUR-degrading fungus, strain PURDK2, was isolated, and the urethane- and urea-bonds-degrading enzymes from strain PURDK2 could contribute to the material recycling of ether-PUR.

Histoplasmosis

MedlinePlus

... by the fungus Histoplasma. The fungus lives in soil. You get the infection by breathing in spores ... construction, gardening, or any activity that disturbs the soil can release fungus spores into the air. If ...

Blastomycosis

MedlinePlus

... dermatitidis fungus. The fungus is found in decaying wood and soil. Causes You can get blastomycosis by ... moist soil, most commonly where there is rotting wood and leaves. The fungus enters the body through ...

Scanning electron microscopy of Ancylostoma spp. dog infective larvae captured and destroyed by the nematophagous fungus Duddingtonia flagrans.

PubMed

Maciel, A S; Araújo, J V; Campos, A K; Benjamin, L A; Freitas, L G

2009-06-01

The interaction between the nematode-trapping fungus Duddingtonia flagrans (isolate CG768) against Ancylostoma spp. dog infective larvae (L(3)) was evaluated by means of scanning electron microscopy. Adhesive network trap formation was observed 6h after the beginning of the interaction, and the capture of Ancylostoma spp. L(3) was observed 8h after the inoculation these larvae on the cellulose membranes colonized by the fungus. Scanning electron micrographs were taken at 0, 12, 24, 36 and 48 h, where 0 is the time when Ancylostoma spp. L(3) was first captured by the fungus. Details of the capture structure formed by the fungus were described. Nematophagous Fungus Helper Bacteria (NHB) were found at interactions points between the D. flagrans and Ancylostoma spp. L(3). The cuticle penetration by the differentiated fungal hyphae with the exit of nematode internal contents was observed 36 h after the capture. Ancylostoma spp. L(3) were completely destroyed after 48 h of interaction with the fungus. The scanning electron microscopy technique was efficient on the study of this interaction, showing that the nematode-trapping fungus D. flagrans (isolate CG768) is a potential exterminator of Ancylostoma spp. L(3).

Growth inhibition of an Araucaria angustifolia (Coniferopsida) fungal seed pathogen, Neofusicoccum parvum, by soil streptomycetes

PubMed Central

2013-01-01

Background Araucariaceae are important forest trees of the southern hemisphere. Life expectancy of their seedlings can largely be reduced by fungal infections. In this study we have isolated and characterized such a fungus and investigated the potential of Streptomyces Actinobacteria from the respective rhizosphere to act as antagonists. Results The pathogenic fungus from Araucaria angustifolia seeds was identified by morphological markers (pore-associated Woronin-bodies) as belonging to the Pezizomycotina. Molecular data identified the fungus as Neofusicoccum parvum (Botryosphaeriaceae). Co-cultures on agar of this fungus with certain streptomycete isolates from the rhizosphere, and from the surface of Araucaria roots significantly reduced the growth of the fungus. HPLC analysis of the agar yielded streptomycete-specific exudate compounds which were partly identified. There were differences in compounds between single (bacteria, fungus) and dual cultures (bacteria + fungus). Conclusion Streptomycetes from the rhizosphere of Araucariaceae produce exudates which can suppress the development of pathogenic fungi in their seeds. PMID:23866024

Caecomyces sympodialis sp. nov., a new rumen fungus isolated from Bos indicus.

PubMed

Chen, Yo-Chia; Tsai, Sheng-Da; Cheng, Hsueh-Ling; Chien, Chiu-Yuan; Hu, Chun-Yi; Cheng, Tai-Yi

2007-01-01

A new anaerobic rumen fungus was isolated from the rumen fluid of a yellow cow (Bos indicus). This fungus appears to be a previously undescribed species of the genus Caecomyces, it possessing uniflagellate zoospores, a spherical holdfast, tubular sporangiophores and bulbous rhizoids. This new fungus also features distinctive multisporangiate thallus sympodially distributed on sporangiophores. The fungus resembles Caecomyces communis and C. equi in that it characterizes bulbous rhizoids and uniflagellate zoospores but differs from C. communis and C. equi in that it possesses multisporangiate and sympodial sporangia. This new fungus and Cyllamyces aberensis both reveal similar morphology during early thallus development in having a spherical holdfast, but they vary from unbranched sporangiophores and additional bulbous rhizoids. In addition, the molecular phylogenetic analyses ITS1 (internal transcribed spacer 1) also conform to the results of the morphological examinations of Caecomyces. For the mentioned reasons, this new species of fungus is described as Caecomyces sympodialis sp. nov. The genera of Neocallimasticaceae and species of Caecomyces are also keyed out.

Carbon dioxide sensing in an obligate insect-fungus symbiosis: CO2 preferences of leaf-cutting ants to rear their mutualistic fungus.

PubMed

Römer, Daniela; Bollazzi, Martin; Roces, Flavio

2017-01-01

Defense against biotic or abiotic stresses is one of the benefits of living in symbiosis. Leaf-cutting ants, which live in an obligate mutualism with a fungus, attenuate thermal and desiccation stress of their partner through behavioral responses, by choosing suitable places for fungus-rearing across the soil profile. The underground environment also presents hypoxic (low oxygen) and hypercapnic (high carbon dioxide) conditions, which can negatively influence the symbiont. Here, we investigated whether workers of the leaf-cutting ant Acromyrmex lundii use the CO2 concentration as an orientation cue when selecting a place to locate their fungus garden, and whether they show preferences for specific CO2 concentrations. We also evaluated whether levels preferred by workers for fungus-rearing differ from those selected for themselves. In the laboratory, CO2 preferences were assessed in binary choices between chambers with different CO2 concentrations, by quantifying number of workers in each chamber and amount of relocated fungus. Leaf-cutting ants used the CO2 concentration as a spatial cue when selecting places for fungus-rearing. A. lundii preferred intermediate CO2 levels, between 1 and 3%, as they would encounter at soil depths where their nest chambers are located. In addition, workers avoided both atmospheric and high CO2 levels as they would occur outside the nest and at deeper soil layers, respectively. In order to prevent fungus desiccation, however, workers relocated fungus to high CO2 levels, which were otherwise avoided. Workers' CO2 preferences for themselves showed no clear-cut pattern. We suggest that workers avoid both atmospheric and high CO2 concentrations not because they are detrimental for themselves, but because of their consequences for the symbiotic partner. Whether the preferred CO2 concentrations are beneficial for symbiont growth remains to be investigated, as well as whether the observed preferences for fungus-rearing influences the ants' decisions where to excavate new chambers across the soil profile.

Biological control of horse cyathostomin (Nematoda: Cyathostominae) using the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

PubMed

Braga, Fabio Ribeiro; Araújo, Jackson Victor; Silva, André Ricardo; Araujo, Juliana Milani; Carvalho, Rogério Oliva; Tavela, Alexandre Oliveira; Campos, Artur Kanadani; Carvalho, Giovanni Ribeiro

2009-08-26

The viability of a fungal formulation using the nematode-trapping fungus Duddingtonia flagrans was assessed for the biological control of horse cyathostomin. Two groups (fungus-treated and control without fungus treatment), consisting of eight crossbred mares (3-18 years of age) were fed on Cynodon sp. pasture naturally infected with equine cyathostome larvae. Each animal of the treated group received oral doses of sodium alginate mycelial pellets (1g/(10 kg live weight week)), during 6 months. Significant reduction (p<0.01) in the number of eggs per gram of feces and coprocultures was found for animals of the fungus-treated group compared with the control group. There was difference (p<0.01) of 78.5% reduction in herbage samples collected up to (0-20 cm) between the fungus-treated group and the control group, during the experimental period (May-October). Difference of 82.5% (p<0.01) was found between the fungus-treated group and the control group in the sampling distance (20-40 cm) from fecal pats. During the last 3 months of the experimental period (August, September and October), fungus-treated mares had significant weight gain (p<0.01) compared with the control group, an increment of 38 kg. The treatment with sodium alginate pellets containing the nematode-trapping fungus D. flagrans reduced cyathostomin in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in horses.

The status of the fungi-grower ants (Hymenoptera: Formicidae) in Puerto Rico and adjacent islands

Treesearch

J.A. Torres

1989-01-01

Ants of the tribe Attini (fungus grower) collect different organic materials that are used to grow a fungus. It was thought that the fungus mycelium was the only source of nutrition for these ants, but Quinlan and Cherrett found that Atta cephalotes (L.) squeezes oils from fresh leaves and uses them as food.  These oils supplement the fungus material eaten by this...

Rust-red stringy white rot: The Indian paint fungus, Echinodontium tinctorium

Treesearch

A. D. Wilson

1997-01-01

Older trees are more susceptible to damage by this fungus, although even very young trees are susceptible to infection. Infections occur most frequently in dense stands where selfpruning creates infection courts for the fungus.

Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies.

PubMed

Cloyd, Raymond A

2015-04-09

Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems.

Sequential batch culture studies for the decolorisation of reactive dye by Coriolus versicolor.

PubMed

Sanghi, Rashmi; Dixit, Awantika; Guha, Sauymen

2006-02-01

The white rot fungus Coriolus versicolor could decolorise reactive dye Remazol Brilliant Violet to almost 90%. The fungal mycelia removed color as well as COD up to 95% and 75%, respectively, in a batch reactor. Decolorising activity was observed during the repeated reuse of the fungus. It was possible to substantially increase the dye decolorising activity of the fungus by carefully selecting the operational conditions such as media composition, age of fungus and nitrogen source. The fungal pellets could be used for eight cycles during the long term operation, where medium and dye was replenished at the end of each cycle and the fungus was recycled. Presence of a nitrogen source and nutrient content of media played an important role in sustaining the decolorisation activity of the fungus. The form of nitrogen source (e.g. peptone vs. urea) was also important to maintain the decolorising activity with peptone showing better decolorisation.

Oligocene Termite Nests with In Situ Fungus Gardens from the Rukwa Rift Basin, Tanzania, Support a Paleogene African Origin for Insect Agriculture

PubMed Central

Roberts, Eric M.; Todd, Christopher N.; Aanen, Duur K.; Nobre, Tânia; Hilbert-Wolf, Hannah L.; O’Connor, Patrick M.; Tapanila, Leif; Mtelela, Cassy; Stevens, Nancy J.

2016-01-01

Based on molecular dating, the origin of insect agriculture is hypothesized to have taken place independently in three clades of fungus-farming insects: the termites, ants or ambrosia beetles during the Paleogene (66–24 Ma). Yet, definitive fossil evidence of fungus-growing behavior has been elusive, with no unequivocal records prior to the late Miocene (7–10 Ma). Here we report fossil evidence of insect agriculture in the form of fossil fungus gardens, preserved within 25 Ma termite nests from southwestern Tanzania. Using these well-dated fossil fungus gardens, we have recalibrated molecular divergence estimates for the origins of termite agriculture to around 31 Ma, lending support to hypotheses suggesting an African Paleogene origin for termite-fungus symbiosis; perhaps coinciding with rift initiation and changes in the African landscape. PMID:27333288

Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies

PubMed Central

Cloyd, Raymond A.

2015-01-01

Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems. PMID:26463188

Microbiology and foodborne pathogens in honey.

PubMed

Grabowski, N T; Klein, G

2017-06-13

Honey has been considered a relatively safe foodstuff due to its compositional properties, with infant botulism caused by Clostridium botulinum being the most prominent health risk associated with it. Our review is focused on the honey microflora along the food chain and evaluates the pathogenic potential of those microorganisms found in honey. This product may contain a great variety of bacteria and, particularly, fungi that eventually entered the food chain at an early stage (e.g., via pollen). For many of these microorganisms, opportunistic infections in humans have been recorded (e.g., infections by Staphylococcus spp., Citrobacter spp., Escherichia coli, Hafnia alvei, Aspergillus spp., Fusarium spp., Trichoderma spp., Chaetomium spp.), although direct infections via honey were not registered.

Noninvasive medical management of fungus ball uropathy in a premature infant.

PubMed

Alkalay, A L; Srugo, I; Blifeld, C; Komaiko, M S; Pomerance, J J

1991-09-01

Unilateral renal obstruction secondary to fungus balls is described in a premature infant. Noninvasive medical management, which included amphotericin B and 5-flucytosine therapy and forced diuresis, resulted in disappearance of fungus balls and resolution of the obstruction.

THE ROLE OF PREDISPOSING FACTORS IN EXPERIMENTAL FUNGUS INFECTIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheldon, W.H.; Bauer, H.

Among other factors, the influence of ionizing radiations on susceptibility to fungus diseases is reviewed. X irradiation singly or in combination with cortisone administration has been employed in the study of experimental fungus diseases, and it has been shown that total-body radiation enhaaced infection with Candida albicans, Blastomyces dermatididis, and Cryptococcus neoformans in mice. Enhanced susceptibility to fungus infections following radiation therapy has also been reported, the mechanism resulting in lowered host resistance being presumably the same as in other infections. (BBB)

Exploring the potential for actinobacteria as defensive symbionts in fungus-growing termites.

PubMed

Visser, Anna A; Nobre, Tânia; Currie, Cameron R; Aanen, Duur K; Poulsen, Michael

2012-05-01

In fungus-growing termites, fungi of the subgenus Pseudoxylaria threaten colony health through substrate competition with the termite fungus (Termitomyces). The potential mechanisms with which termites suppress Pseudoxylaria have remained unknown. Here we explore if Actinobacteria potentially play a role as defensive symbionts against Pseudoxylaria in fungus-growing termites. We sampled for Actinobacteria from 30 fungus-growing termite colonies, spanning the three main termite genera and two geographically distant sites. Our isolations yielded 360 Actinobacteria, from which we selected subsets for morphological (288 isolates, grouped in 44 morphotypes) and for 16S rRNA (35 isolates, spanning the majority of morphotypes) characterisation. Actinobacteria were found throughout all sampled nests and colony parts and, phylogenetically, they are interspersed with Actinobacteria from origins other than fungus-growing termites, indicating lack of specificity. Antibiotic-activity screening of 288 isolates against the fungal cultivar and competitor revealed that most of the Actinobacteria-produced molecules with antifungal activity. A more detailed bioassay on 53 isolates, to test the specificity of antibiotics, showed that many Actinobacteria inhibit both Pseudoxylaria and Termitomyces, and that the cultivar fungus generally is more susceptible to inhibition than the competitor. This suggests that either defensive symbionts are not present in the system or that they, if present, represent a subset of the community isolated. If so, the antibiotics must be used in a targeted fashion, being applied to specific areas by the termites. We describe the first discovery of an assembly of antibiotic-producing Actinobacteria occurring in fungus-growing termite nests. However, due to the diversity found, and the lack of both phylogenetic and bioactivity specificity, further work is necessary for a better understanding of the putative role of antibiotic-producing bacteria in the fungus-growing termite mutualistic system.

Biological activities of ophiobolin K and 6-epi-ophiobolin K produced by the endophytic fungus Aspergillus calidoustus

USDA-ARS?s Scientific Manuscript database

The endophytic fungus, Aspergillus calidoustus, was isolated from the plant species Acanthospermum australe (Asteraceae). A dichloromethane extract of the fungus displayed antifungal, antiprotozoal, and cytotoxic activities. Aspergillus calidoustus was identified using molecular, physiological and m...

Effects of Some Pesticides on the Growth of ARF18 and Its Pathogenicity to Heterodera glycines

PubMed Central

Kim, D. G.; Riggs, R. D.

1998-01-01

The effects of 22 pesticides on the mycelial growth and pathogenicity of the biocontrol fungus ARFI8 to Heterodera glycines were tested in vitro. The chemicals were added to agar at 10, 100, and 1,000 ppm a.i.; a block of agar containing the fungus was added to each test concentration; and fungal growth was measured. Subsequently, a block of the fungus on the pesticide-containing agar was used to determine the ability of the fungus to parasitize eggs of H. glycines. Aldicarb, bentazone, and chlorothalonil had little or no effect on fungal growth, whereas benomyl and thiophanate methyl completely inhibited growth of the fungus at 10 ppm. The relative insensitivity of ARF18 to certain pesticides would permit selected use of those pesticides with ARF18 in an integrated control program if the effects on the fungus in the field are similar to results from petri dish studies. PMID:19274211

Performance of Metarhizium anisopliae-treated foam in combination with Phytoseiulus longipes Evans on Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae).

PubMed

Azandémè Hounmalon, Ginette Y; Maniania, Nguya K; Niassy, Saliou; Fellous, Simon; Kreiter, Serge; Delétré, Emilie; Fiaboe, Komi K; Martin, Thibaud

2018-05-13

Tetranychus evansi (Te) is an exotic pest of solanaceous crops in Africa. The predatory mite Phytoseiulus longipes (Pl) and the fungus Metarhizium anisopliae (Ma), are potential biocontrol agents of Te. The present study investigated efficacy of fungus-treated foam placed above or below the third Te-infested tomato leaf. The persistence of fungus-treated foam and the performance of Pl with or without fungus-treated foam were evaluated. The fungus-treated foam was effective when Te infestation was below the third tomato leaf as no damage was recorded on all upper tomato leaves up to 30 days post-treatment. However, in the control treatments, the infestation increased considerably from 9±0.3% to 100±0% at 15 days post-treatment. The reuse of the fungus-treated foam at 15, 30 and 45 days post-treatment resulted in 19±1.4%, 25±1.2% and 54±2.1% respective infestation by Te. The fungus-treated foam and Pl alone are efficient, but there is no benefit to combinting both against Te. The fungus-treated foam is an effective method to optimize the use of Ma in screenhouse conditions. These two control agents could be integrated in an IPM strategy for crops protection. However, these results need to be confirmed in large field trials. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Microsatellite variability in the entomopathogenic fungus Paeciolomyces fumosoroseus: genetic diversity and population structure

USDA-ARS?s Scientific Manuscript database

The hyphomycete Paecilomyces fumosoroseus (Pfr) is a geographically widespread fungus capable of infecting various insect hosts. The fungus has been used for the biological control of several important insect pests of agriculture. However knowledge of the fungus’ genetic diversity and population str...

Metacridamides A and B from the biocontrol fungus metarhizium acridum

USDA-ARS?s Scientific Manuscript database

Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

Structural basis for ATP-dependent chromatin remodelling by the INO80 complex.

PubMed

Eustermann, Sebastian; Schall, Kevin; Kostrewa, Dirk; Lakomek, Kristina; Strauss, Mike; Moldt, Manuela; Hopfner, Karl-Peter

2018-04-01

In the eukaryotic nucleus, DNA is packaged in the form of nucleosomes, each of which comprises about 147 base pairs of DNA wrapped around a histone protein octamer. The position and histone composition of nucleosomes is governed by ATP-dependent chromatin remodellers 1-3 such as the 15-subunit INO80 complex 4 . INO80 regulates gene expression, DNA repair and replication by sliding nucleosomes, the exchange of histone H2A.Z with H2A, and the positioning of + 1 and -1 nucleosomes at promoter DNA 5-8 . The structures and mechanisms of these remodelling reactions are currently unknown. Here we report the cryo-electron microscopy structure of the evolutionarily conserved core of the INO80 complex from the fungus Chaetomium thermophilum bound to a nucleosome, at a global resolution of 4.3 Å and with major parts at 3.7 Å. The INO80 core cradles one entire gyre of the nucleosome through multivalent DNA and histone contacts. An Rvb1/Rvb2 AAA + ATPase heterohexamer is an assembly scaffold for the complex and acts as a 'stator' for the motor and nucleosome-gripping subunits. The Swi2/Snf2 ATPase motor binds to nucleosomal DNA at superhelical location -6, unwraps approximately 15 base pairs, disrupts the H2A-DNA contacts and is poised to pump entry DNA into the nucleosome. Arp5 and Ies6 bind superhelical locations -2 and -3 to act as a counter grip for the motor, on the other side of the H2A-H2B dimer. The Arp5 insertion domain forms a grappler element that binds the nucleosome dyad, connects the Arp5 actin-fold and entry DNA over a distance of about 90 Å and packs against histone H2A-H2B near the 'acidic patch'. Our structure together with biochemical data 8 suggests a unified mechanism for nucleosome sliding and histone editing by INO80. The motor is part of a macromolecular ratchet, persistently pumping entry DNA across the H2A-H2B dimer against the Arp5 grip until a large nucleosome translocation step occurs. The transient exposure of H2A-H2B by motor activity as well as differential recognition of H2A.Z and H2A may regulate histone exchange.

Airway toxicity of house dust and its fungal composition.

PubMed

Piecková, Elena; Wilkins, Ken

2004-01-01

House dust is an important source of different toxic metabolites as well as allergens, including those of fungal origin, in the indoor environment. A bio-assay employing 1-day-old chick tracheas was used to characterize airway effects of 2-butanone and dimethylsulphoxide (Me2SO) extracts of 23 dust samples collected from water damaged (13) and control (10) Danish schools. Direct microscopical analysis of samples, followed by cultivation on dichloran 18 % glycerol agar at 25 degrees C for 10 days to establish their mycoflora, was performed. The in vitro ciliostatic potential of the chloroform-extractable endo- and exometabolites of 41 representative fungal isolates was determined. Nine dust extracts in 2-butanone (2 from damp rooms) or 10 (6) in Me(2)SO showed some ciliostatic activity in the 3-days' experiment. Fungal composition of dust from buildings with leakage was almost identical with that from undamaged houses, as well as the fungal colony counts from the damp schools and the control samples. Aspergillus spp. were prevalent in the samples - 31 or 40 % of all fungi, followed by Penicillium spp. and Cladosporium cladosporioides. Alternaria spp., Chaetomium spp., Mucor spp., Mycelia sterilia, Paecilomyces variotii, Rhizopus sp., Ulocladium sp. and yeasts were each isolated in less than 8 % of the fungal content. No Aspergillus flavus isolate (8 in total) was aflatoxigenic,em>in vitro. Alternaria spp., Aspergillus spp., Botrytis cinerea, Penicillium spp., C. cladosporioides, Chaetomium spp. and Ulocladium sp.; in total, 88 % of all fungi tested, produced ciliostatically active metabolites. These toxigenic strains were also present in 4 dust samples from controls and 5 dust samples from water damaged buildings. Extracts of these dust samples were also toxic in bioassay. There were bio-detectable concentrations (10-20 microg of extracts/ml of the organ culture medium) of toxic compounds in house dust. Contribution of fungal metabolites to its toxic effect should be studied further.

RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola

USDA-ARS?s Scientific Manuscript database

The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers’ symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop ...

Speciation despite globally overlapping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming’s lucky fungus

USDA-ARS?s Scientific Manuscript database

Eighty years ago, Alexander Fleming described the antibiotic effects of a fungus that had contaminated his bacterial culture, kick starting the antimicrobial revolution. The fungus was later ascribed to a globally distributed asexual species, Penicillium chrysogenum. Recently, the species has been...

Mating and Progeny Isolation in The Corn Smut Fungus Ustilago maydis

USDA-ARS?s Scientific Manuscript database

The corn smut pathogen, Ustilago maydis (U. maydis) (DC.) Corda, is a semi-obligate plant pathogenic fungus in the phylum Basidiomycota (Alexopoulos, Mims and Blackwell, 1996). The fungus can be easily cultured in its haploid yeast phase on common laboratory media. However, to complete its sexual cy...

Chronicles of Fibroporia radiculosa (= Antrodia radiculosa) TFFH 294

Treesearch

Carol A. Clausen; Katie M. Jenkins

2011-01-01

The brown-rot fungus, Fibroporia radiculosa, has been included in numerous research studies because many isolates of this fungus demonstrate an unusually high tolerance to copper. This fungus has undergone several recognized changes in taxonomic nomenclature, and through DNA technology, scientists have correctly identified isolates that had been misidentified...

Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus

Treesearch

Bryn H. Daisy; Gary A. Strobel; Uvidelio Castillo; David Ezra; Joe Sears; David K. Weaver; Justin B. Runyon

2002-01-01

Muscodor vitigenus is a recently described endophytic fungus of Paullinia paullinioides, a liana growing in the understorey of the rainforests of the Peruvian Amazon. This fungus produces naphthalene under certain cultural conditions. Naphthalene produced by M. vitigenus was identified by gas chromatography/mass...

Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci.

PubMed

Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm

2015-09-01

A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.

Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants.

PubMed

Ruiz-González, Mario X; Malé, Pierre-Jean G; Leroy, Céline; Dejean, Alain; Gryta, Hervé; Jargeat, Patricia; Quilichini, Angélique; Orivel, Jérôme

2011-06-23

Ant-fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant-fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries.

Pathogenic nature of Syncephalastrum in Atta sexdens rubropilosa fungus gardens.

PubMed

Barcoto, Mariana O; Pedrosa, Felipe; Bueno, Odair C; Rodrigues, Andre

2017-05-01

Leaf-cutter ants are considered to be a major herbivore and agricultural pest in the Neotropics. They are often controlled by environmentally persistent insecticides. Biological control using pathogenic fungi is regarded as an alternative for the management of these insects. Here, we assess whether the filamentous fungus Syncephalastrum sp. is a pathogenic microorganism responsible for a characteristic disease in fungus gardens. We also characterise the damage caused by this fungus by evaluating physiological and behavioural responses of Atta sexdens rubropilosa subcolonies infected with Syncephalastrum sp. Syncephalastrum sp. fulfils Koch's postulates characterising it as a pathogenic microorganism. Ant workers recognise the infection and remove contaminated fragments from the fungus garden. Syncephalastrum sp. infection causes an interruption of foraging activity, an increase in ant mortality, subcolony deterioration and an increase in the amount of waste generated, all resulting in subcolony death. Syncephalastrum sp. also inhibits the ant fungal cultivar in vitro. The pathogenic effect of Syncephalastrum sp. does not depend on host morbidity or stress (e.g. worker mortality caused by an entomopathogenic fungus). Syncephalastrum sp. treatment resulted in progressive damage in subcolonies. The interactions among Syncephalastrum sp., fungus garden and ants offer new opportunities in integrated pest management of leaf-cutter ants. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Biological control of cyathostomin (Nematoda: Cyathostominae) with nematophagous fungus Monacrosporium thaumasium in tropical southeastern Brazil.

PubMed

Tavela, Alexandre de Oliveira; Araújo, Jackson Victor; Braga, Fábio Ribeiro; Silva, André Ricardo; Carvalho, Rogério Oliva; Araujo, Juliana Milani; Ferreira, Sebastião Rodrigo; Carvalho, Giovanni Ribeiro

2011-01-10

Horses are hosts to a wide variety of helminthes; the most important are the cyathostomin, or small strongyles. The viability of a fungal formulation (pellets) using the nematode-trapping fungus Monacrosporium thaumasium was assessed in biological control of horse cyathostomin. Two groups (fungus-treated and control) consisted of six mares in each group, crossbred (ages of 2.5 and 3.5 years), were placed in pastures of Cynodon sp. naturally infected with horse cyathostomin larvae. In the treated group, each animal received 1g/10 kg body weight (0.2g/10 kg live weight of fungus) of pellets of sodium alginate matrix containing the fungus M. thaumasium orally, twice a week for 6 months. In the control group, animals received (1g/10 kg body weight) of pellets without fungus. The egg count per gram of feces showed difference (p<0.01) in the animals treated with the fungus in relation to the control animals during all months of the experiment. The EPG percentage decrease were 87.5%, 89.7%, 68.3%, 58.7%, 52.5% and 35.2% during June, July, August, September, October and November, respectively. In faecal cultures, there was difference (p<0.05) among animals treated with fungus was found in relation to the control animals during all the experiment month, with percentage reduction of 67.5%, 61.4% and 31.8% in September, October and November, respectively. Difference (p<0.01) was observed in the recovery of infective larvae from pastures that were collected up to 20 cm from the dung pats in pastures in the group treated with the fungus in relation to the control group with a reduction of 60.9% and between 0-20 and 0-40 cm from the faecal pat reduction (p<0.01) was about 56% in the group treated with the fungus M. thaumasium in relation to the control group pasture. There was no difference (p>0.05) between the average weight gains in both animal groups. The treatment of horses with pellets containing the nematophagous fungus M. thaumasium can be effective in controlling cyathostomin in the tropical region of southeastern Brazil. Copyright © 2010 Elsevier B.V. All rights reserved.

Biochemical Characterization of Fungus Isolated during In vitro Propagation of Bambusa balcooa.

PubMed

Tyagi, Bhawna; Tewari, Salil; Dubey, Ashutosh

2018-01-01

Bambusa balcooa ( Poaceae: Bambusoideae ) is a multipurpose bamboo species, which is native of the Indian subcontinent. B. balcooa is regarded as one of the best species for scaffolding and building purposes because of its strong culm. Other uses include paper pulp, handicrafts, and products of the wood chip industry. Due to these various uses in industries, this species has been identified as one of the priority bamboos by the National Bamboo Mission. This study is designed to analyze the identification of fungus and develop the strategy to eliminate the contamination during in vitro establishment of B. balcooa through nodal part. Fungus contamination is a problem which is encountered during in vitro establishment of B. balcooa cultures. In the present study, fungus contamination from in vitro cultured plant has been isolated and subjected to partial sequence analysis of the 18S rRNA gene to identify the fungus strain. Experiments were designed to develop a strategy for removal of the fungus contamination with the help of antifungal compounds and commercial antimicrobial supplement supplied by HiMedia. Fusarium equiseti was identified as endophytic fungus. It was observed that antimicrobial supplement at concentration of 500 μl/l was more effective concentration to remove fungus contamination and not showed any detrimental effect on growth parameters of shoot. This experiment would help in identification and to get rid of fungal contamination and improve the in vitro establishment of B. balcooa cultures for large-scale propagation. Endogenous fungus was isolated from contaminated culture of B. balcooa , and it was identified as Fusarium equiseti and submitted to NCBI under accession no. KP274872. The endophytic fungus had shown substantial production of amylase, cellulase, and protease media. Gibberellic acid (GA 3 ) production by F. equiseti was maximum on the 7 th day on inoculation. Abbreviations used: B. balcooa : Bambusa balcooa , F. equiseti : Fusarium equiseti , PDA: Potato dextrose agar, PCR: Polymerase chain reaction, MS: Murashige and Skoog's, BAP: 6-Benzylaminopurine, ITS1/4: Internal transcribed spacer region 1/4, GA 3 : Gibberellic acid.

Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae)

PubMed Central

2014-01-01

Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month. PMID:24766705

Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae).

PubMed

Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I

2014-04-25

Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month.

Leaf-Cutter Ant Fungus Gardens Are Biphasic Mixed Microbial Bioreactors That Convert Plant Biomass to Polyols with Biotechnological Applications

PubMed Central

Somera, Alexandre F.; Lima, Adriel M.; dos Santos-Neto, Álvaro J.; Lanças, Fernando M.

2015-01-01

Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. PMID:25911490

Leaf-cutter ant fungus gardens are biphasic mixed microbial bioreactors that convert plant biomass to polyols with biotechnological applications.

PubMed

Somera, Alexandre F; Lima, Adriel M; Dos Santos-Neto, Álvaro J; Lanças, Fernando M; Bacci, Maurício

2015-07-01

Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Phomalactone from a phytopathogenic fungus infecting Zinnia elegans (Asteraceae) leaves

USDA-ARS?s Scientific Manuscript database

Zinnia elegans plants are infected by a fungus that causes necrosis with dark red spots particularly in late spring to the middle of summer in the Mid-South part of the United States. This fungal disease when untreated causes the leaves to wilt and eventually kills the plant. The fungus was isolated...

White-Nose Syndrome Fungus in a 1918 Bat Specimen from France.

PubMed

Campana, Michael G; Kurata, Naoko P; Foster, Jeffrey T; Helgen, Lauren E; Reeder, DeeAnn M; Fleischer, Robert C; Helgen, Kristofer M

2017-09-01

White-nose syndrome, first diagnosed in North America in 2006, causes mass deaths among bats in North America. We found the causative fungus, Pseudogymnoascus destructans, in a 1918 sample collected in Europe, where bats have now adapted to the fungus. These results are consistent with a Eurasian origin of the pathogen.

Contents and Structure Atta texana Nest in Summer

Treesearch

John C. Moser

1963-01-01

A large nest of Atta texana (Buckley) in central Louisiana was partially excavated in August 1960. Twelve dormancy, 5 detritus, and 93 fungus-garden cavities were found. Fungus-garden cavities near the surface outnumbered those at lower depths and contained most of the fungus material and brood. Inquilines were most numerous in detritus cavities....

Complete Genome of Enterobacteriaceae Bacterium Strain FGI 57, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

PubMed Central

Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

2013-01-01

The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353

Complete Genome of Serratia sp. Strain FGI 94, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

PubMed Central

Aylward, Frank O.; Tremmel, Daniel M.; Starrett, Gabriel J.; Bruce, David C.; Chain, Patrick; Chen, Amy; Davenport, Karen W.; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Teshima, Hazuki; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

2013-01-01

Serratia sp. strain FGI 94 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its 4.86-Mbp chromosome will help advance our knowledge of symbiotic interactions and plant biomass degradation in this ancient ant-fungus mutualism. PMID:23516234

Comparison of radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa forel in two culture media

PubMed Central

Miyashira, C.H.; Tanigushi, D.G.; Gugliotta, A.M.; Santos, D.Y.A.C.

2010-01-01

In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier. PMID:24031524

Does co-inoculation of Lactuca serriola with endophytic and arbuscular mycorrhizal fungi improve plant growth in a polluted environment?

PubMed

Ważny, Rafał; Rozpądek, Piotr; Jędrzejczyk, Roman J; Śliwa, Marta; Stojakowska, Anna; Anielska, Teresa; Turnau, Katarzyna

2018-04-01

Phytoremediation of polluted sites can be improved by co-inoculation with mycorrhizal and endophytic fungi. In this study, the effects of single- and co-inoculation of Lactuca serriola with an arbuscular mycorrhizal (AM) fungus, Rhizoglomus intraradices, and endophytic fungi, Mucor sp. or Trichoderma asperellum, on plant growth, vitality, toxic metal accumulation, sesquiterpene lactone production and flavonoid concentration in the presence of toxic metals were evaluated. Inoculation with the AM fungus increased biomass yield of the plants grown on non-polluted and polluted substrate. Co-inoculation with the AM fungus and Mucor sp. resulted in increased biomass yield of plants cultivated on the polluted substrate, whereas co-inoculation with T. asperellum and the AM fungus increased plant biomass on the non-polluted substrate. In the presence of Mucor sp., mycorrhizal colonization and arbuscule richness were increased in the non-polluted substrate. Co-inoculation with the AM fungus and Mucor sp. increased Zn concentration in leaves and roots. The concentration of sesquiterpene lactones in plant leaves was decreased by AM fungus inoculation in both substrates. Despite enhanced host plant costs caused by maintaining symbiosis with numerous microorganisms, interaction of wild lettuce with both mycorrhizal and endophytic fungi was more beneficial than that with a single fungus. The study shows the potential of double inoculation in unfavourable environments, including agricultural areas and toxic metal-polluted areas.

The Dynamics of Plant Cell-Wall Polysaccharide Decomposition in Leaf-Cutting Ant Fungus Gardens

PubMed Central

Harholt, Jesper; Willats, William G. T.; Boomsma, Jacobus J.

2011-01-01

The degradation of live plant biomass in fungus gardens of leaf-cutting ants is poorly characterised but fundamental for understanding the mutual advantages and efficiency of this obligate nutritional symbiosis. Controversies about the extent to which the garden-symbiont Leucocoprinus gongylophorus degrades cellulose have hampered our understanding of the selection forces that induced large scale herbivory and of the ensuing ecological footprint of these ants. Here we use a recently established technique, based on polysaccharide microarrays probed with antibodies and carbohydrate binding modules, to map the occurrence of cell wall polymers in consecutive sections of the fungus garden of the leaf-cutting ant Acromyrmex echinatior. We show that pectin, xyloglucan and some xylan epitopes are degraded, whereas more highly substituted xylan and cellulose epitopes remain as residuals in the waste material that the ants remove from their fungus garden. These results demonstrate that biomass entering leaf-cutting ant fungus gardens is only partially utilized and explain why disproportionally large amounts of plant material are needed to sustain colony growth. They also explain why substantial communities of microbial and invertebrate symbionts have evolved associations with the dump material from leaf-cutting ant nests, to exploit decomposition niches that the ant garden-fungus does not utilize. Our approach thus provides detailed insight into the nutritional benefits and shortcomings associated with fungus-farming in ants. PMID:21423735

Fungus-Specific Sirtuin HstD Coordinates Secondary Metabolism and Development through Control of LaeA

PubMed Central

Kawauchi, Moriyuki; Nishiura, Mika

2013-01-01

The sirtuins are members of the NAD+-dependent histone deacetylase family that contribute to various cellular functions that affect aging, disease, and cancer development in metazoans. However, the physiological roles of the fungus-specific sirtuin family are still poorly understood. Here, we determined a novel function of the fungus-specific sirtuin HstD/Aspergillus oryzae Hst4 (AoHst4), which is a homolog of Hst4 in A. oryzae yeast. The deletion of all histone deacetylases in A. oryzae demonstrated that the fungus-specific sirtuin HstD/AoHst4 is required for the coordination of fungal development and secondary metabolite production. We also show that the expression of the laeA gene, which is the most studied fungus-specific coordinator for the regulation of secondary metabolism and fungal development, was induced in a ΔhstD strain. Genetic interaction analysis of hstD/Aohst4 and laeA clearly indicated that HstD/AoHst4 works upstream of LaeA to coordinate secondary metabolism and fungal development. The hstD/Aohst4 and laeA genes are fungus specific but conserved in the vast family of filamentous fungi. Thus, we conclude that the fungus-specific sirtuin HstD/AoHst4 coordinates fungal development and secondary metabolism via the regulation of LaeA in filamentous fungi. PMID:23729383

Biological control of Ascaris suum eggs by Pochonia chlamydosporia fungus.

PubMed

Ferreira, Sebastião Rodrigo; de Araújo, Jackson Victor; Braga, Fábio Ribeiro; Araujo, Juliana Milani; Frassy, Luiza Neme; Ferreira, Aloízio Soares

2011-12-01

Ascaris suum is a gastrointestinal nematode parasite of swines. The aim of this study was to observe Pochonia chlamydosporia fungus on biological control of A. suum eggs after fungus passage through swines gastrointestinal tract. Eighteen pigs, previously dewormed, were randomly divided into three groups: group 1, treated with the fungus isolate VC4; group 2, treated with the fungus isolate VC1 and group 3 did not receive fungus (control). In the treated groups, each animal received a 9 g single dose of mycelium mass containing P. chlamydosporia (VC1 or VC4). Thereafter, animal fecal samples were collected at the following intervals: 8, 12, 24, 36, 48, 72 and 96 h after treatment beginning and these were poured in Petri dishes containing 2% water-agar culture medium. Then, 1,000 A. suum eggs were poured into each dish and kept in an incubator at 26 °C and in the dark for 30 days. After this period, approximately 100 eggs were removed from each Petri dish and morphologically analyzed under light microscopy following the ovicidal activity parameters. The higher percentage observed for isolated VC4 eggs destruction was 57.5% (36 h) after fungus administration and for isolate VC1 this percentage was 45.8% (24 h and 72 h) (p > 0.01). P. chlamydosporia remained viable after passing through the gastrointestinal tract of swines, maintaining its ability of destroying A. suum eggs.

The fungus gardens of leaf-cutter ants undergo a distinct physiological transition during biomass degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Eric L.; Aylward, Frank O.; Kim, Young-Mo

Leaf-cutter ants are dominant herbivores in ecosystems throughout the Neotropics. Rather than directly consuming the fresh foliar biomass they harvest, these ants use it to cultivate specialized fungus gardens. Although recent investigations have shed light on how plant biomass is degraded in fungus gardens, the cycling of nutrients that takes place in these specialized microbial ecosystems is still not well understood. Here, using metametabolomics and metaproteomics techniques, we examine the dynamics of nutrient turnover and biosynthesis in these gardens. Our results reveal that numerous free amino acids and sugars are depleted throughout the process of biomass degradation, indicating that easilymore » accessible nutrients from plant material are readily consumed by microbes in these ecosystems. Accumulation of cellobiose and lignin derivatives near the end of the degradation process is consistent with previous findings of cellulases and laccases produced by Leucoagaricus gongylophorus, the fungus cultivated by leaf-cutter ants. Our results also suggest that ureides may be an important source of nitrogen in fungus gardens, especially during nitrogen-limiting conditions. No free arginine was detected in our metametabolomics experiments despite evidence that the host ants cannot produce this amino acid, suggesting that biosynthesis of this metabolite may be tightly regulated in the fungus garden. These results provide new insights into the dynamics of nutrient cycling that underlie this important ant-fungus symbiosis.« less

Do novel genotypes drive the success of an invasive bark beetle–fungus complex? Implications for potential reinvasion

Treesearch

Min Lu; Michael J. Wingfield; Nancy Gillette; Jiang-Hua Sun

2011-01-01

Novel genotypes often arise during biological invasions, but their role in invasion success has rarely been elucidated. Here we examined the population genetics and behavior of the fungus, Leptographium procerum, vectored by a highly invasive bark beetle, Dendroctonus valens, to determine whether genetic changes in the fungus...

Association of the Pitch Canker Fungus with Cones and Seeds of Pines

Treesearch

L. David Dwinell

1998-01-01

The pitch canker fungus, Fusarium subglutinans f. sp.pini, causes the mortality of female flowers and mature cones, and can infect and destroy gametophyte tissues of seeds of several pine species in the southeastern U.S. The fungus can also be associated with the seed coats of apparently healthy, viable pine seeds. The pitch canker...

Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.

ERIC Educational Resources Information Center

Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.

1997-01-01

Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…

Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

Treesearch

Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

2018-01-01

Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

Mosquitocidal activity of a naturally occurring isochroman and synthetic analogs from the plant pathogenic fungus, Diaporthe eres against Aedes aegypti ( Diptera: Culicidae)

USDA-ARS?s Scientific Manuscript database

The culture filtrate of a plant pathogenic fungus that infects English ivy (Hegera helix) was investigated for mosquitocidal constituents by bioassay guided isolation. The fungus responsible for pathogenic effects on the plant Hegera helix has been identified as Diaporthe eres by molecular technique...

Reproduction of a woodwasp, Urocerus japonicus (Hymenoptera: Siricidae) using no maternal symbiotic fungus

Treesearch

Hideshi Fukuda

2003-01-01

Most woodwasps (Siricidae) are symbiotically associated with the specific fungus, Amylostereum spp. Female adults inoculate the fungus during their oviposition in sapwood of the host trees (Morgan 1968). Woodwasp larvae can digest sapwood with low nutritional quality with the aid of symbiosis (Kukor and Martin 1983). In the earlier study, we...

Using copper sulfate to control egg fungus at Keo Fish Farm

USDA-ARS?s Scientific Manuscript database

Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab has been working on gaining FDA-approval to use copper sulfate to control fungus on catfish eggs, so we were con...

Mucormycosis (Mucor fungus ball) of the maxillary sinus.

PubMed

Cho, Hang Sun; Yang, Hoon Shik; Kim, Kyung Soo

2014-01-01

A fungus ball is an extramucosal fungal proliferation that completely fills one or more paranasal sinuses and usually occurs as a unilateral infection. It is mainly caused by Aspergillus spp in an immunocompetent host, but some cases of paranasal fungal balls reportedly have been caused by Mucor spp. A Mucor fungus ball is usually found in the maxillary sinus and/or the sphenoid sinus and may be black in color. Patients with mucormycosis, or a Mucor fungal ball infection, usually present with facial pain or headache. On computed tomography, there are no pathognomonic findings that are conclusive for a diagnosis of mucormycosis. In this article we report a case of mucormycosis in a 56-year-old woman and provide a comprehensive review of the literature on the "Mucor fungus ball." To the best of our knowledge, 5 case reports (8 patients) have been published in which the fungus ball was thought to be caused by Mucor spp.

Biosynthesis of size-controlled gold nanoparticles using fungus, Penicillium sp.

PubMed

Zhang, Xiaorong; He, Xiaoxiao; Wang, Kemin; Wang, Yonghong; Li, Huimin; Tan, Weihong

2009-10-01

The unique optoelectronic and physicochemical properties of gold nanoparticles are significantly dependent on the particle size, shape and structure. In this paper, biosynthesis of size-controlled gold nanoparticles using fungus Penicillium sp. is reported. Fungus Penicillium sp. could successfully bioreduce and nucleate AuCl4(-) ions, and lead to the assembly and formation of intracellular Au nanoparticles with spherical morphology and good monodispersity after exposure to HAuCl4 solution. Reaction temperature, as an important physiological parameter for fungus Penicillium sp. growth, could significantly control the size of the biosynthesized Au nanoparticles. The biological compositions and FTIR spectra analysis of fungus Penicillium sp. exposed to HAuCl4 solution indicated the intracellular reducing sugar played an important role in the occurrence of intracellular reduction of AuCl4(-) ions and the growth of gold nanoparticles. Furthermore, the intracellular gold nanoparticles could be easily separated from the fungal cell lysate by ultrasonication and centrifugation.

Chytrid fungus parasitizing the wild amphibian Leptodactylus ocellatus (Anura: Leptodactylidae) in Argentina.

PubMed

Herrera, Raúl A; Steciow, Mónica M; Natale, Guillermo S

2005-05-20

The present contribution is the first report of parasitosis by a chytrid fungus in wild anuran amphibians in Argentina, as well as the first case of amphibian mortality documented to date in Argentina. We report the presence of the chytrid fungus in dead adult Leptodactylus ocellatus. It has been suggested that chytridiomycosis is the main cause of death in several amphibian populations worldwide. Our study demonstrates that chytridiomycosis afflicts L. ocellatus, a common widespread amphibian species, and is the first report of chytridiomycosis in the Argentinian lowlands. The occurrence at this latitude would indicate an extended distribution of this fungus in wildlife populations. It is also the first report of amphibian mortality due to chytrid fungus in our country. It is noteworthy that the site of collection is situated very close to sea level in a temperate climate zone and that this represents the southern most record for South American wild amphibians.

Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luey, J.; Brouns, T.M.; Elliott, M.L.

1990-11-01

The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable formore » the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs.« less

The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica.

PubMed

Torii, Masato; Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-Ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

2014-06-01

In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven.

The Evolutionary Innovation of Nutritional Symbioses in Leaf-Cutter Ants

PubMed Central

Aylward, Frank O.; Currie, Cameron R.; Suen, Garret

2012-01-01

Fungus-growing ants gain access to nutrients stored in plant biomass through their association with a mutualistic fungus they grow for food. This 50 million-year-old obligate mutualism likely facilitated some of these species becoming dominant Neotropical herbivores that can achieve immense colony sizes. Recent culture-independent investigations have shed light on the conversion of plant biomass into nutrients within ant fungus gardens, revealing that this process involves both the fungal cultivar and a symbiotic community of bacteria including Enterobacter, Klebsiella, and Pantoea species. Moreover, the genome sequences of the leaf-cutter ants Atta cephalotes and Acromyrmex echinatior have provided key insights into how this symbiosis has shaped the evolution of these ants at a genetic level. Here we summarize the findings of recent research on the microbial community dynamics within fungus-growing ant fungus gardens and discuss their implications for this ancient symbiosis. PMID:26467948

Deciphering the molecular mechanisms behind cellulase production in Trichoderma reesei, the hyper-cellulolytic filamentous fungus.

PubMed

Shida, Yosuke; Furukawa, Takanori; Ogasawara, Wataru

2016-09-01

The filamentous fungus Trichoderma reesei is a potent cellulase producer and the best-studied cellulolytic fungus. A lot of investigations not only on glycoside hydrolases produced by T. reesei, but also on the machinery controlling gene expression of these enzyme have made this fungus a model organism for cellulolytic fungi. We have investigated the T. reesei strain including mutants developed in Japan in detail to understand the molecular mechanisms that control the cellulase gene expression, the biochemical and morphological aspects that could favor this phenotype, and have attempted to generate novel strains that may be appropriate for industrial use. Subsequently, we developed recombinant strains by combination of these insights and the heterologous-efficient saccharifing enzymes. Resulting enzyme preparations were highly effective for saccharification of various biomass. In this review, we present some of the salient findings from the recent biochemical, morphological, and molecular analyses of this remarkable cellulase hyper-producing fungus.

Fungal decay resistance of wood reacted with phosphorus pentoxide-amine system

Treesearch

Hong-Lin Lee; George C. Chen; Roger M. Rowell

2004-01-01

Resistance of wood reacted in situ with phosphorus pentoxide-amine to the brown-rot fungus Gloeophyllum trabeum and white-rot fungus Trametes versicolor was examined. Wood reacted with either octyl, tribromo, or nitro derivatives were more resistant to both fungi. Threshold retention values of phosphoramide-reacted wood to white-rot fungus T. versicolor ranged from 2.9...

Serpula lacrymans, the dry rot fungus and tolerance towards copper-based wood preservatives

Treesearch

Anne Christine Steenkjaer Hastrup; Frederick Green; Carol Clausen; Bo Jensen

2005-01-01

Serpula lacrymans (Wulfen : Fries) Schröter, the dry rot fungus, is considered the most economically important wood decay fungus in temperate regions of the world i.e. northern Europe, Japan and Australia. Previously copper based wood preservatives were the most commonly used preservatives for pressure treatment of wood for building constructions. Because of a...

Arbuscular mycorrhizal fungus inoculation reduces the drought-resistance advantage of endophyte-infected versus endophyte-free Leymus chinensis.

PubMed

Liu, Hui; Chen, Wei; Wu, Man; Wu, Rihan; Zhou, Yong; Gao, Yubao; Ren, Anzhi

2017-11-01

Grasses can be infected simultaneously by endophytic fungi and arbuscular mycorrhizal (AM) fungi. In this study, we tested the hypothesis that endophyte-associated drought resistance of a native grass was affected by an AM fungus. In a greenhouse experiment, we compared the performance of endophyte-infected (EI) and endophyte-free (EF) Leymus chinensis, a dominant species native to the Inner Mongolia steppe, under altered water and AM fungus availability. The results showed that endophyte infection significantly increased drought resistance of the host grass, but the beneficial effects were reduced by AM fungus inoculation. In the mycorrhizal-non-inoculated (MF) treatment, EI plants accumulated significantly more biomass, had greater proline and total phenolic concentration, and lower malondialdehyde concentration than EF plants. In the mycorrhizal-inoculation (MI) treatment, however, no significant difference occurred in either growth or physiological characters measured between EI and EF plants. AM fungus inoculation enhanced drought resistance of EF plants but had no significant effect on drought resistance of EI plants, thus AM fungus inoculation reduced the difference between EI and EF plants. Our findings highlight the importance of interactions among multiple microorganisms for plant performance under drought stress.

Improving Efficacy of Beauveria bassiana against Stored Grain Beetles with a Synergistic Co-Formulant

PubMed Central

Storm, Clare; Scoates, Freya; Nunn, Adam; Potin, Olivier; Dillon, Aoife

2016-01-01

The potential of a dry powder co-formulant, kaolin, to improve the control of storage beetles by the entomopathogenic fungus Beauveria bassiana, isolate IMI389521, was investigated. The response of Oryzaephilus surinamensis adults to the fungus when applied to wheat at 1 × 1010 conidia per kg with and without kaolin at 1.74 g per kg wheat was assessed. Addition of kaolin increased control from 46% to 88% at day 7 and from 81% to 99% at day 14 post-treatment. Following this the dose response of O. surinamensis and Tribolium confusum to both kaolin and the fungus was investigated. Synergistic effects were evident against O. surinamensis at ≥0.96 g of kaolin per kg of wheat when combined with the fungus at all concentrations tested. For T. confusum, adult mortality did not exceed 55%, however, the larvae were extremely susceptible with almost complete suppression of adult emergence at the lowest fungal rate tested even without the addition of kaolin. Finally, the dose response of Sitophilus granarius to the fungus at 15 and 25 °C, with and without kaolin at 1 g per kg of wheat, was examined. Improvements in efficacy were achieved by including kaolin at every fungal rate tested and by increasing the temperature. Kaolin by itself was not effective, only when combined with the fungus was an effect observed, indicating that kaolin was having a synergistic effect on the fungus. PMID:27571107

Nature of the interactions between hypocrealean fungi and the mutualistic fungus of leaf-cutter ants.

PubMed

Varanda-Haifig, Sadala Schmidt; Albarici, Tatiane Regina; Nunes, Pablo Henrique; Haifig, Ives; Vieira, Paulo Cezar; Rodrigues, Andre

2017-04-01

Leaf-cutter ants cultivate and feed on the mutualistic fungus, Leucoagaricus gongylophorus, which is threatened by parasitic fungi of the genus Escovopsis. The mechanism of Escovopsis parasitism is poorly understood. Here, we assessed the nature of the antagonism of different Escovopsis species against its host. We also evaluated the potential antagonism of Escovopsioides, a recently described fungal genus from the attine ant environment whose role in the colonies of these insects is unknown. We performed dual-culture assays to assess the interactions between L. gongylophorus and both fungi. We also evaluated the antifungal activity of compounds secreted by the latter on L. gongylophorus growth using crude extracts of Escovopsis spp. and Escovopsioides nivea obtained either in (1) absence or (2) presence of the mutualistic fungus. The physical interaction between these fungi and the mutualistic fungus was examined under scanning electron microscopy (SEM). Escovopsis spp. and E. nivea negatively affected the growth of L. gongylophorus, which was also significantly inhibited by both types of crude extract. These results indicate that Escovopsis spp. and E. nivea produce antifungal metabolites against the mutualistic fungus. SEM showed that Escovopsis spp. and E. nivea maintained physical contact with the mutualistic fungus, though no specialised structures related to mycoparasitism were observed. These results showed that Escovopsis is a destructive mycoparasite that needs physical contact for the death of the mutualistic fungus to occur. Also, our findings suggest that E. nivea is an antagonist of the ant fungal cultivar.

Efficacy of the nematode-trapping fungus Duddingtonia flagrans against three species of gastro-intestinal nematodes in laboratory faecal cultures from sheep and goats.

PubMed

Waghorn, T S; Leathwick, D M; Chen, L-Y; Skipp, R A

2003-12-30

The ability of the nematode-killing fungus Duddingtonia flagrans to reduce number of infective larvae of three species of gastro-intestinal parasitic nematodes developing in dung was investigated in both goats and sheep. Groups of lambs and kids (12-20 weeks old) were given mono-specific infections of Haemonchus contortus, Ostertagia (Teladorsagia) circumcincta or Trichostrongylus colubriformis. Following patency of the infections (t1) faecal samples were collected for determination of faecal nematode egg count (FEC) and culture of parasite larvae. Groups of animals were then dosed on 2 consecutive days with one of the two dose rates of the fungus (250,000 or 500,000 spores/kg liveweight). One (t2) and 5 (t3) days after the second dose of fungus samples were again collected for FEC and culture. The number of larvae recovered from the faecal cultures at t1 and t3 were used as controls to assess the efficacy of the experimental treatment at t2. Average efficacy was 78% with group means ranging from 40 to 93%. Dose rate of fungus appeared to influence efficacy against O. circumcincta but not against H. contortus or T. colubriformis. Overall, there were no differences in the efficacy of the fungus against any of the parasite species or in either host animal. The results of this trial indicate the potential use of this fungus as a broad spectrum anti-parasite agent for use in both goats and sheep.

Draft genome sequence of the fungus associated with oak-wilt mortality in South Korea, Raffaelea quercus-mongolicae KACC44405

Treesearch

Jongbum Jeon; Ki-Tae Kim; Hyeunjeong Song; Gir-Won Lee; Kyeongchae Cheong; Hyunbin Kim; Gobong Choi; Yong-Hwan Lee; Jane E. Stewart; Ned B. Klopfenstein; Mee-Sook Kim

2017-01-01

The fungus Raffaelea quercus-mongolicae is the causal agent of Korean oak wilt, a disease associated with mass mortality of oak trees (e.g., Quercus spp.). The fungus is vectored and dispersed by the ambrosia beetle, Platypus koryoensis. Here, we present the 27.0-Mb draft genome sequence of R. quercus-mongolicae strain KACC44405.

Characteristics of a newly isolated fungus Geotrichum candidum Dec 1 with broad degradation spectrum of xenobiotic compounds.

PubMed

Shoda, M

2003-01-01

A newly isolated fungus, Geotrichum candidum Dec 1 (abbreviated as Dec 1), was found to have the ability to degrade many xenobiotic compounds such as synthetic dyes, food coloring agents, molasses, organic halogens, lignin and kraft pulp effluents. The broad spectrum of the degradation of these compounds are associated mainly with peroxidases produced by the fungus.

Cutinase in Cryphonectria parasitica, the chestnut blight fungus: suppression of cutinase gene expression in isogenic hypovirulent strains containing double-stranded RNAs

Treesearch

D.A. ​Varley; G.K. Podila; S.T. Hiremath

1992-01-01

Plant-pathogenic fungi produce cutinase, an enzyme required to degrade plant cuticles and facilitate penetration into the host. The absence of cutinase or a decrease in its production has been associated with a decrease in pathogenicity of the fungus. A set of isogenic strains of Cryphonectria parasitica, the chestnut blight fungus, was tested for...

First unusual case of keratitis in Europe due to the rare fungus Metarhizium anisopliae.

PubMed

Dorin, Josephine; Debourgogne, Anne; Zaïdi, Mohamed; Bazard, Marie-Christine; Machouart, Marie

2015-05-01

Metarhizium anisopliae is a fungus utilized worldwide for insect-pest biocontrol. Few M. anisopliae infections have been reported previously. Here, M. anisopliae was isolated from a corneal ulcer in a healthy man. It is the first ocular case in France and Europe of this extremely rare fungus in humans. Copyright © 2015 Elsevier GmbH. All rights reserved.

Symbiosis-regulated expression of an acetyl-CoA acetyltransferase gene in the ectomycorrhizal fungus Laccaria bicolor

Treesearch

Shiv T. Hiremath; Sujata Balasubramanian; Jun Zheng; Gopi K. Podila

2006-01-01

The ectomycorrhiza is a symbiotic organ generated from the intricate association of fungal hyphae and plant root. The establishment of the ectomycorrhiza is a coordinated process of cross-talk between plant and fungus, followed by metabolic, developmental, and structural changes in the fungus, resulting in its growth toward the root. The initial stages of the symbiotic...

Genetic diversity and population structure of Raffaelea quercus-mongolicae, a fungus associated with oak mortality in South Korea

Treesearch

M. -S. Kim; P. A. Hohenlohe; K. -H. Kim; S. -T. Seo; Ned Klopfenstein

2016-01-01

Raffaelea quercus-mongolicae is a fungus associated with oak wilt and deemed to cause extensive oak mortality in South Korea. Since the discovery of this fungus on a dead Mongolian oak (Quercus mongolica) in 2004, the mortality continued to spread southwards in South Korea. Despite continued expansion of the disease and associated significant impacts on forest...

[Scytalidium dimidiatum an opportunistic fungus for both man and Mangifera indica trees in Venezuela].

PubMed

Padin, Carmiña; Fernández-Zeppenfeldt, Guillermo; Yegres, Francisco; Richard-Yegres, Nicole

2005-09-01

The purpose of this study was to confirm the presence of Scytalidium dimidiatum on Mangifera indica (mango) trees, in a plantation managed by a diabetic patient with a white grain mycetoma of the foot caused by the same fungus. Samples from necrotic apices, roots, burned leaves and rotten stems from eight trees were processed by the Smith and Furcolow's mineral oil technique (modified). Several isolates from the apex material and clinical samples from the diabetic patient isolated in pure culture a fungus with the macroscopic and microscopic characteristics of that in S. dimidiatum. This fungus should be considered as an opportunistic microorganism for both humans and M. indica.

Isocoumarin Derivatives from the Sea Squirt-derived Fungus Penicillium stoloniferum QY2-10 and the Halotolerant Fungus Penicillium notatum B-52.

PubMed

Xin, Zhi-Hong; Tian, Li; Zhu, Tian-Jiao; Wang, Wen-Liang; Du, Lin; Fang, Yu-Chun; Gu, Qian-Qun; Zhu, Wei-Ming

2007-07-01

Two isocoumarin derivatives, stoloniferol A (1) and B (2), a known 5alpha, 8alpha-epidioxy-23-methyl-(22E, 24R)-ergosta-6, 22-dien-3beta-ol (3), and a known dihydrocitrinone (4) were isolated from the ethyl acetate extract of the sea squirt-derived fungus, Penicillium stoloniferum QY2-10, and a halophilic fungus, Penicillium notatum B-52, respectively. Their structures were elucidated by spectroscopic methods and optical rotation. The stereochemistry of 2 was determined on the basis of different NOE experiments and chemical transformation. Compound 3 showed cytotoxicity against P388 cells, with an IC50 value of 4.07 microM.

The chestnut blight fungus for studies on virus/host and virus/virus interactions: from a natural to a model host.

PubMed

Eusebio-Cope, Ana; Sun, Liying; Tanaka, Toru; Chiba, Sotaro; Kasahara, Shin; Suzuki, Nobuhiro

2015-03-01

The chestnut blight fungus, Cryphonectria parasitica, is an important plant pathogenic ascomycete. The fungus hosts a wide range of viruses and now has been established as a model filamentous fungus for studying virus/host and virus/virus interactions. This is based on the development of methods for artificial virus introduction and elimination, host genome manipulability, available host genome sequence with annotations, host mutant strains, and molecular tools. Molecular tools include sub-cellular distribution markers, gene expression reporters, and vectors with regulatable promoters that have been long available for unicellular organisms, cultured cells, individuals of animals and plants, and certain filamentous fungi. A comparison with other filamentous fungi such as Neurospora crassa has been made to establish clear advantages and disadvantages of C. parasitica as a virus host. In addition, a few recent studies on RNA silencing vs. viruses in this fungus are introduced. Copyright © 2014 Elsevier Inc. All rights reserved.

Greater taxol yield of fungus Pestalotiopsis hainanensis from dermatitic scurf of the giant panda (Ailuropoda melanoleuca).

PubMed

Gu, Yu; Wang, Yanlin; Ma, Xiaoping; Wang, Chengdong; Yue, Guizhou; Zhang, Yuetian; Zhang, Yunyan; Li, Shanshan; Ling, Shanshan; Liu, Xiaomin; Wen, Xintian; Cao, Sanjie; Huang, Xiaobo; Deng, Junliang; Zuo, Zhicai; Yu, Shumin; Shen, Liuhong; Wu, Rui

2015-01-01

While taxol yields of fungi from non-animal sources are still low, whether Pestalotiopsis hainanensis isolated from the scurf of a dermatitic giant panda, Ailuropoda melanoleuca, provides a greater taxol yield remains unknown. The objective of the study was to determine the corresponding taxol yield. The structure of the taxol produced by the fungus was evaluated by thin layer chromatography (TLC), ultraviolet (UV) spectroscopy, high-performance liquid chromatography (HPLC), (1)H and (13)C nuclear magnetic resonance spectroscopy ((1)H-NMR and (13)C-NMR), and time-of-flight mass spectrometry (TOF-MS), with standard taxol as a control. The results demonstrated that the P. hainanensis fungus produced taxol, which had the same structure as the standard taxol and yield of 1,466.87 μg/L. This fungal taxol yield from the dermatitic giant panda was significantly greater than those of fungus from non-animal sources. The taxol-producing fungus may be a potential candidate for the production of taxol on an industrial scale.

The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica

PubMed Central

Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

2014-01-01

In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven. PMID:25071395

Genome Sequence of the Mucoromycotina Fungus Umbelopsis isabellina, an Effective Producer of Lipids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takeda, Itaru; Tamano, Koichi; Yamane, Noriko

2014-02-27

Umbelopsis isabellina is a fungus in the subdivision Mucoromycotina, many members of which have been shown to be oleaginous and have become important organisms for producing oil because of their high level of intracellular lipid accumulation from various feedstocks. The genome sequence of U. isabellina NBRC 7884 was determined and annotated, and this information might provide insights into the oleaginous properties of this fungus.

Phylogenetic placement of an unusual coral mushroom challenges the classic hypothesis of strict coevolution in the Apterostigma pilosum group ant-fungus mutualism

Treesearch

Bryn T.M. Dentinger; D.Jean Lodge; Andrew B. Munkacsi; Dennis E. Desjardin; David J. McLaughlin

2009-01-01

The ~50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus ...

Fingerprints of a forest fungus: Swiss needle cast, carbon isotopes, carbohydrates, and growth in Douglas-fir

Treesearch

Andrea Watts; Frederick Meinzer; Brandy J. Saffell

2014-01-01

Swiss needle cast is caused by a fungus native to the Pacific Northwest. Its host is Douglas-fir, an iconic evergreen tree in the region. The fungus does not kill its host, but it adversely affects the tree's growth. The fungal fruiting bodies block the stomata, small openings on the underside of the needle where carbon dioxide, water vapor, and other gases are...

The genome of an industrial workhorse : sequencing of the filamentous fungus Aspergillus niger offers new opportunities for the production of specialty chemicals and enzymes

Treesearch

Dan Cullen

2007-01-01

Few microbes compare with the filamentous fungus Aspergillus niger in its ability to produce prodigious amounts of useful chemicals and enzymes. This fungus is the principal source of citric acid for food, beverages and pharmaceuticals and of several important commercial enzymes, including glucoamylase, which is widely used for the conversion of starch to food syrups...

Histopathology of cutaneous sporotrichosis in Rio de Janeiro: a series of 119 consecutive cases.

PubMed

Quintella, Leonardo Pereira; Passos, Sonia Regina Lambert; do Vale, Antônio Carlos Francesconi; Galhardo, Maria Clara Gutierrez; Barros, Monica Bastos De Lima; Cuzzi, Tullia; Reis, Rosani Dos Santos; de Carvalho, Maria Helena Galdino Figueiredo; Zappa, Mônica Barbato; Schubach, Armando De Oliveira

2011-01-01

Sporotrichosis is the most common subcutaneous mycosis in Rio de Janeiro. Histopathological examination reveals diffuse granulomatous and suppurative dermatitis, and the fungus is rarely identifiable in tissue. We describe the histopathological features of cutaneous sporotrichosis, and investigate the association between them and the lack of visualization of the fungus. A total of 119 samples of confirmed sporotrichosis cases were studied. The characteristics of the inflammatory infiltrate, the presence of epidermal changes, necrosis and fibrosis, and the parasite burden were analyzed. The association between histopathological changes and the lack of visualization of the fungus was evaluated using prevalence ratios. Granulomas were observed in all samples, suppurative granulomas in 100 (84%) and diffuse dermatitis in 114 (95.8%). Liquefaction and caseous necrosis were present in 78 (65.5%) and 52 (43.7%) samples, respectively. The fungus was not seen in 77 (64.7%) samples. Epithelioid, tuberculoid or foreign-body-type granulomas, caseous, fibrinoid or absent necrosis, predominance of lymphocytes among nonphagocytic cells and fibrosis were associated with the lack of visualization of the fungus. The histopathological characteristics of sporotrichosis were variable when the causative fungus was not seen. In a proper context, the diagnosis of sporotrichosis remains a potential consideration even in the absence of demonstrable yeast. Copyright © 2010 John Wiley & Sons A/S.

Comparative effects of native filamentous and arbuscular mycorrhizal fungi in the establishment of an autochthonous, leguminous shrub growing in a metal-contaminated soil.

PubMed

Carrasco, L; Azcón, R; Kohler, J; Roldán, A; Caravaca, F

2011-02-15

The aim of this study was to assess the effectiveness of inoculation with a native arbuscular mycorrhizal (AM) fungus, Glomus mosseae (Nicol. and Gerd.) Gerd. and Trappe, or a filamentous fungus, Penicillium aurantiogriseum Dierckx 1901, on the establishment of Coronilla juncea L. seedlings grown in a polluted, semiarid soil. For that, root and shoot biomass, nutrient uptake, mycorrhizal colonisation and nitrate reductase (NR) and phosphatase activities were analysed. Six months after planting, the shoot biomass of C. juncea was increased only by the inoculation with G. mosseae (by about 62% compared with non-mycorrhizal plants). The shoot NR and root acid phosphatase activities were increased more by inoculation with G. mosseae than with P. aurantiogriseum inoculation. The root NR activity and foliar nutrient contents were increased only by the inoculation with the AM fungus. The root Zn and Cu decreased with the AM fungus. In conclusion, the autochthonous AM fungus was an effective inoculant with regard to stimulating growth and alleviating heavy metal toxicity for plants growing on a soil contaminated by multiple heavy metals. Inoculation with an autochthonous, filamentous fungus does not seem to be a good strategy for phytoremediation of such problematic sites. Copyright © 2011 Elsevier B.V. All rights reserved.

Synergistic interaction between the fungus Beauveria bassiana and desiccant dusts applied against poultry red mites (Dermanyssus gallinae).

PubMed

Steenberg, Tove; Kilpinen, Ole

2014-04-01

The poultry red mite, Dermanyssus gallinae, is a major pest in egg production, feeding on laying hens. Widely used non-chemical control methods include desiccant dusts, although their persistence under field conditions is often short. Entomopathogenic fungi may also hold potential for mite control, but these fungi often take several days to kill mites. Laboratory experiments were carried out to study the efficacy of 3 types of desiccant dusts, the fungus Beauveria bassiana and combinations of the two control agents against D. gallinae. There was significant synergistic interaction between each of the desiccant dusts and the fungus, with observed levels of mite mortality significantly higher than those expected for an additive effect (up to 38 % higher). Synergistic interaction between desiccant dust and fungus was found also when different application methods were used for the fungus and at different levels of relative humidity. Although increased levels of mortality were reached due to the synergistic interaction, the speed of lethal action was not influenced by combining the two components. The persistence of the control agents applied separately or in combination did not change over a period of 4 weeks. Overall, combinations of desiccant dusts and fungus conidia seem to hold considerable promise for future non-chemical control of poultry red mites.

Phomalactone from a Phytopathogenic Fungus Infecting ZINNIA elegans (ASTERACEAE) Leaves.

PubMed

Meepagala, Kumudini M; Johnson, Robert D; Techen, Natascha; Wedge, David E; Duke, Stephen O

2015-07-01

Zinnia elegans Jacq. plants are infected by a fungus that causes dark red spots with necrosis on leaves, particularly in late spring to the middle of summer in the Mid-South of the United States. This fungal disease causes the leaves to wilt and eventually kills the plant. The fungus was isolated, cultured in potato dextrose broth, and identified as Nigrospora sphaerica by molecular techniques. Two major lactone metabolites (phomalactone and catenioblin A) were isolated from liquid culture of N. sphaerica isolated from Z. elegans. When injected into leaves of Z. elegans, phomalactone caused lesions similar to those of the fungus. The lesion sizes were proportional to the concentration of the phomalactone. Phomalactone, but not catenioblin A, was phytotoxic to Z. elegans and other plant species by inhibition of seedling growth and by causing electrolyte leakage from photosynthetic tissues of both Z. elegans leaves and cucumber cotyledons. This latter effect may be related to the wilting caused by the fungus in mature Z. elegans plants. Phomalactone was moderately fungicidal to Coletotrichum fragariae and two Phomopsis species, indicating that the compound may keep certain other fungi from encroaching into plant tissue that N. sphaerica has infected. Production of large amounts of phomalactone by N. sphaerica contributes to the pathogenic behavior of this fungus, and may have other ecological functions in the interaction of N. sphaerica with other fungi. This is the first report of isolation of catenioblin A from a plant pathogenic fungus. The function of catenioblin A is unclear, as it was neither significantly phyto- nor fungitoxic.

Fungus symbionts colonizing the galleries of the ambrosia beetle Platypus quercivorus.

PubMed

Endoh, Rikiya; Suzuki, Motofumi; Okada, Gen; Takeuchi, Yuko; Futai, Kazuyoshi

2011-07-01

Isolations were made to determine the fungal symbionts colonizing Platypus quercivorus beetle galleries of dead or dying Quercus laurifolia, Castanopsis cuspidata, Quercus serrata, Quercus crispula, and Quercus robur. For these studies, logs from oak wilt-killed trees were collected from Kyoto Prefecture, Japan. Fungi were isolated from the: (1) entrances of beetle galleries, (2) vertical galleries, (3) lateral galleries, and (4) the larval cradle of P. quercivorus in each host tree. Among the fungus colonies which appeared on YM agar plates, 1,219 were isolated as the representative isolates for fungus species inhabiting in the galleries based on their cultural characteristics. The validity of the visual classification of the fungus colonies was checked and if necessary properly corrected using microsatellite-primed PCR fingerprints. The nucleotide sequence of the D1/D2 region of the large subunit nuclear rRNA gene detected 38 fungus species (104 strains) of which three species, i.e., Candida sp. 3, Candida kashinagacola (both yeasts), and the filamentous fungus Raffaelea quercivora were isolated from all the tree species. The two yeasts were most prevalent in the interior of galleries, regardless of host tree species, suggesting their close association with the beetle. A culture-independent method, terminal restriction fragment length polymorphism (T-RFLP) analysis was also used to characterize the fungus flora of beetle galleries. T-RFLP patterns showed that yeast species belonging to the genus Ambrosiozyma frequently occurred on the gallery walls along with the two Candida species. Ours is the first report showing the specific fungi inhabiting the galleries of a platypodid ambrosia beetle.

Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aylward, Frank O.; Burnum-Johnson, Kristin E.; Tringe, Susannah G.

Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass ismore » degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.« less

Species-specific ant brain manipulation by a specialized fungal parasite.

PubMed

de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P

2014-08-29

A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation by this specialized fungus and therefore represent a major advancement towards an understanding of the molecular mechanisms underlying this phenomenon.

Potential of endophytic fungi as biocontrol agents of Duponchelia fovealis (Zeller) (Lepidoptera:Crambidae).

PubMed

Amatuzzi, R F; Cardoso, N; Poltronieri, A S; Poitevin, C G; Dalzoto, P; Zawadeneak, M A; Pimentel, I C

2017-11-09

This study reports the first assessment of endophytic fungi isolated from strawberry leaves and selection of isolates for the control of Duponchelia fovealis, a new pest of strawberries. A total of 400 strawberry leaves of the cultivar 'Albion' were collected in four commercial farms. Leaves were disinfected, cut in fragments, and placed on Petri dishes containing potato dextrose agar media with tetracycline and incubated for 30 days. Following this time, 517 fungal colonies were isolated, and thirteen genera were identified: Cladosporium, Aspergillus, Nigrospora, Fusarium, Trichoderma, Chaetomium, Alternaria, Paecilomyces, Penicillium, Ulocladium, Bipolaris, Diaporthe, and Phoma. Eight isolates belonging to the genera Aspergillus, Diaporthe, Paecilomyces, and Cladosporium were selected for pathogenicity bioassays against third instar larvae of D. fovealis. Isolates of Paecilomyces induced the highest mortality rates.

Pneumocystis jiroveci pneumonia

MedlinePlus

Pneumocystis pneumonia; Pneumocystosis; PCP; Pneumocystis carinii ... This type of pneumonia is caused by the fungus Pneumocystis jiroveci . This fungus is common in the environment and rarely causes illness in ...

A specialized fungal parasite (Massospora cicadina) hijacks the sexual signals of periodical cicadas (Hemiptera: Cicadidae: Magicicada).

PubMed

Cooley, John R; Marshall, David C; Hill, Kathy B R

2018-01-23

Male periodical cicadas (Magicicada spp.) infected with conidiospore-producing ("Stage I") infections of the entomopathogenic fungus Massospora cicadina exhibit precisely timed wing-flick signaling behavior normally seen only in sexually receptive female cicadas. Male wing-flicks attract copulation attempts from conspecific males in the chorus; close contact apparently spreads the infective conidiospores. In contrast, males with "Stage II" infections that produce resting spores that wait for the next cicada generation do not produce female-specific signals. We propose that these complex fungus-induced behavioral changes, which resemble apparently independently derived changes in other cicada-Massospora systems, represent a fungus "extended phenotype" that hijacks cicadas, turning them into vehicles for fungus transmission at the expense of the cicadas' own interests.

Patterns of functional enzyme activity in fungus farming ambrosia beetles.

PubMed

De Fine Licht, Henrik H; Biedermann, Peter H W

2012-06-06

In wood-dwelling fungus-farming weevils, the so-called ambrosia beetles (Curculionidae: Scolytinae and Platypodinae), wood in the excavated tunnels is used as a medium for cultivating fungi by the combined action of digging larvae (which create more space for the fungi to grow) and of adults sowing and pruning the fungus. The beetles are obligately dependent on the fungus that provides essential vitamins, amino acids and sterols. However, to what extent microbial enzymes support fungus farming in ambrosia beetles is unknown. Here we measure (i) 13 plant cell-wall degrading enzymes in the fungus garden microbial consortium of the ambrosia beetle Xyleborinus saxesenii, including its primary fungal symbionts, in three compartments of laboratory maintained nests, at different time points after gallery foundation and (ii) four specific enzymes that may be either insect or microbially derived in X. saxesenii adult and larval individuals. We discovered that the activity of cellulases in ambrosia fungus gardens is relatively small compared to the activities of other cellulolytic enzymes. Enzyme activity in all compartments of the garden was mainly directed towards hemicellulose carbohydrates such as xylan, glucomannan and callose. Hemicellulolytic enzyme activity within the brood chamber increased with gallery age, whereas irrespective of the age of the gallery, the highest overall enzyme activity were detected in the gallery dump material expelled by the beetles. Interestingly endo-β-1,3(4)-glucanase activity capable of callose degradation was identified in whole-body extracts of both larvae and adult X. saxesenii, whereas endo-β-1,4-xylanase activity was exclusively detected in larvae. Similar to closely related fungi associated with bark beetles in phloem, the microbial symbionts of ambrosia beetles hardly degrade cellulose. Instead, their enzyme activity is directed mainly towards comparatively more easily accessible hemicellulose components of the ray-parenchyma cells in the wood xylem. Furthermore, the detection of xylanolytic enzymes exclusively in larvae (which feed on fungus colonized wood) and not in adults (which feed only on fungi) indicates that only larvae (pre-) digest plant cell wall structures. This implies that in X. saxesenii and likely also in many other ambrosia beetles, adults and larvae do not compete for the same food within their nests - in contrast, larvae increase colony fitness by facilitating enzymatic wood degradation and fungus cultivation.

Fungal arthritis

MedlinePlus

... examine you. Tests that may be ordered include: Culture of joint fluid that grows fungus Joint x-ray showing joint changes Positive antibody test (serology) for fungal disease Synovial biopsy showing fungus

Colonization by the arbuscular mycorrhizal fungus Glomus versiforme induces a defense response against the root-knot nematode Meloidogyne incognita in the grapevine (Vitis amurensis Rupr.), which includes transcriptional activation of the class III chitinase gene VCH3.

PubMed

Li, Hai-Yan; Yang, Guo-Dong; Shu, Huai-Rui; Yang, Yu-Tao; Ye, Bao-Xing; Nishida, Ikuo; Zheng, Cheng-Chao

2006-01-01

Inoculation of the grapevine (Vitis amurensis Rupr.) with the arbuscular mycorrhizal (AM) fungus Glomus versiforme significantly increased resistance against the root-knot nematode (RKN) Meloidogyne incognita. Studies using relative quantitative reverse transcription-PCR (RQRT-PCR) analysis of grapevine root inoculation with the AM fungus revealed an up-regulation of VCH3 transcripts. This increase was greater than that observed following infection with RKN. However, inoculation of the mycorrhizal grapevine roots with RKN was able to enhance VCH3 transcript expression further. Moreover, the increase in VCH3 transcripts appeared to result in a higher level of resistance against subsequent RKN infection. Constitutive expression of VCH3 cDNA in transgenic tobacco under the control of the cauliflower mosaic virus 35S promoter also conferred resistance against RKN, but had no significant effect on the growth of the AM fungus. We analyzed beta-glucuronidase (GUS) activity directed by a 1,216 bp VCH3 promoter in transgenic tobacco following inoculation with both the AM fungus and RKN. GUS activity was negligible in the root tissues before inoculation, and was more effectively induced after inoculation with the AM fungus than with RKN. Moreover, GUS staining in the mycorrhizal transgenic tobacco roots was enhanced by subsequent RKN infection, and was found ubiquitously throughout the whole root tissue. Together, these results suggest that AM fungus induced a defense response against RKN in the mycorrhizal grapevine roots, which appeared to involve transcriptional control of VCH3 expression throughout the whole root tissue.

A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

PubMed

Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

2013-06-01

The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Mucor indicus: biology and industrial application perspectives: a review.

PubMed

Karimi, Keikhosro; Zamani, Akram

2013-01-01

Mucor indicus, one of the most important strains of zygomycetes fungi, has been the subject of several studies since a couple of hundred years ago. This fungus, regarded as a non-pathogenic dimorphic microorganism, is used for production of several beers and foods. Morphology of the fungus can be manipulated and well controlled by changing a number of parameters. Furthermore, M. indicus can grow on a variety of substrates including lignocellulosic hydrolysates which are mixtures of hexoses, pentoses, and different severe fermentation inhibitors. Indeed, high yield ethanol production is among the most important features of this strain. Presence of considerable amounts of chitosan in the cell wall is another important aspect of the fungus. Besides production of ethanol and chitosan, the biomass of this fungus has shown a great potential to be used as a rich nutritional source, e.g. fish feed. The fungus is also among the oleaginous fungi and produces high amounts of polyunsaturated fatty acids particularly γ-linolenic acid. Furthermore, the biomass autolysate has a high potential for yeast extract replacement in fermentation by the fungus. Additionally, the strain has shown promising results in heavy metal removal from wastewaters. This review discusses different aspects of biology and industrial application perspectives of M. indicus. Furthermore, open areas for the future basic and applied levels of research are also presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Biological control of trichostrongyles in beef cattle by the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

PubMed

Assis, R C L; Luns, F D; Araújo, J V; Braga, F R

2012-11-01

The efficacy of a fungal formulation based on the nematophagous fungus Duddingtonia flagrans was assessed in the control of cattle trichostrongyles. Twenty male Nellore calves, six-month-old, divided in two groups (fungus-treated and control without fungus) were fed on a pasture of Brachiaria decumbens naturally infected with larvae of bovine trichostrongyles. Animals of the treated group received doses of sodium alginate mycelial pellets orally (1 g/10 kg live weight, twice a week), for 12 months. Feces samples were collected for egg count (eggs per gram of feces-EPG) and coprocultures during 12 months. There was a significant reduction in EPG (56.7%) and infective larvae (L3) in coprocultures (60.5%) for animals of the treated group in relation to the control group at the end of the study. There was a significant reduction of L3 (64.5%) in herbage samples collected up to 0-20 cm from fecal pats and 73.2% in distant samples (20-40 cm) between the fungus-treated group and the control group. The treatment with sodium alginate pellets containing the nematode trapping fungus D. flagrans reduced trichostrongylid in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in beef cattle. Copyright © 2012 Elsevier Inc. All rights reserved.

The nematophagous fungus Monacrosporium thaumasium and its nematicidal activity on Angiostrongylus vasorum.

PubMed

Soares, Filippe Elias de Freitas; Braga, Fabio Ribeiro; de Araújo, Jackson Victor; Lima, Walter dos Santos; de Queiroz, José Humberto

2015-01-01

The dog acts as a reservoir and environmental disseminator of potentially zoonotic parasites. The objective of this work was to study the fungus Monacrosporium thaumasium regarding its nematicidal potential in laboratory trials and its proteolytic profile. The in vitro test was carried out through two assays (A and B). In assay A, conidia of the fungus N34a were added in positive coprocultures for Angiostrongylus vasorum. In assay B, crude extract (treated group) and distilled water (control group) were added to coprocultures. Next, the proteolytic profile of crude extract of the nematophagous fungus M. thaumasium (NF34a) was revealed by performing a zymogram. There was a reduction (p<0.01) in the averages of larvae recovered from the treated groups (conidia and crude extract) in relation to control groups. The zymogram suggested that the nematophagous fungus M. thaumasium produces a protease of approximately 40 kDa. The results of this work confirm that the conidia as well as the crude extract of the fungus M. thaumasium may be used to control A. vasorum L1. The proteolytic profile suggested the presence of one protease (Mt1) of approximately 40 kDa that in the future may be used in biological control of L1 of this nematode. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Paracoccidioidomycosis

MedlinePlus

... brasiliensis . Spores of the fungus, which grow in soil, may be inhaled. Most people have no symptoms, ... inhaling spores of the fungus, which grow in soil. Paracoccidioidomycosis usually involves the lungs, skin, mouth, throat, ...

Histoplasmosis

MedlinePlus

... by the fungus. Soil that contains bird or bat droppings may have larger amounts of this fungus. ... by reducing exposure to dust in chicken coops, bat caves, and other high-risk locations. Wear masks ...

Histoplasmosis

MedlinePlus

... is a disease caused by a fungus (or mold) called Histoplasma. The fungus is common in the eastern and central United States. It grows in soil and material contaminated with bat or bird droppings. ...

Approaches for monitoring the release of Pochonia chlamydosporia var. catenulata, a biocontrol agent of root-knot nematodes.

PubMed

Atkins, Simon D; Hidalgo-Diaz, Leopoldo; Clark, Ian M; Morton, C Oliver; de Oca, Nivian Montes; Gray, Paul A; Kerry, Brian R

2003-02-01

Pochonia chlamydosporia var. catenulata is a potential biocontrol agent against root-knot nematodes. Diagnosis of isolates has relied on morphological identification, and is both time-consuming and difficult. beta-tubulin primers have been developed for the identification of this fungus that were specific enough to distinguish between varieties of the fungus within the same species. Separate primers have been developed for the specific detection of P. chlamydosporia var. catenulata based on ITS sequences, which were able to detect the fungus in soil from various sites in Cuba where the biocontrol agent had been added. When the PCR diagnosis was combined with serial dilution of soil samples on selective medium, colonies were rapidly identified. The fungus was still present, albeit at low densities, in soils inoculated five years previously. The development of a baiting method allowed quick in situ screening of the isolates' ability to infect nematode eggs, and when combined with PCR diagnosis both varieties of the fungus could be detected in infected eggs. RFLP analysis of ITS sequences from P. chlamydosporia provided an extra level of discrimination between isolates.

50 CFR Appendix A to Part 622 - Species Tables

Code of Federal Regulations, 2013 CFR

2013-10-01

... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

50 CFR Appendix A to Part 622 - Species Tables

Code of Federal Regulations, 2014 CFR

2014-10-01

... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

First report of Albizia lebbeck dieback caused by Scytalidium dimidiatum in Oman.

PubMed

Elshafie, Abdulkadir E; Ba-Omar, Taher

2002-01-01

Over 200 Albizia lebbeck trees at Sultan Qaboos University campus wilted and died. The symptoms were dieback of large branches due to infection by Scytalidium dimidiatum. The fungus has also infected Ficus benghalensis, F. carica, F. retusa, Thespesia populnea, Delonix regia and Peltophorum petrocarpum. This is the first report of the fungus in Oman and on A. lebbeck, T. populnea, D. regia and P. petrocarpum. The strain of this fungus has not been found to cause human disease in Oman.

Antimicrobials from the marine algal endophyte Penicillium sp.

PubMed

Flewelling, Andrew J; Johnson, John A; Gray, Christopher A

2013-03-01

An endophytic fungus identified as Penicillium sp. was isolated from the brown alga Fucus spiralis collected from the Shetland Islands, United Kingdom. Bioassay-guided fractionation of an extract of the fungus led to the isolation of cladosporin, epiepoformin, phyllostine, and patulin, all of which showed antimicrobial activity against either Staphylococcus aureus or Pseudomonas aeruginosa. Cladosporin has not previously been identified from a fungus of the genus Penicillium, and, despite being biosynthetically related, epiepoformin, phyllostine and patulin have not been previously reported from one source.

Quantitative evaluation of protocorm growth and fungal colonization in Bletilla striata (Orchidaceae) reveals less-productive symbiosis with a non-native symbiotic fungus.

PubMed

Yamamoto, Tatsuki; Miura, Chihiro; Fuji, Masako; Nagata, Shotaro; Otani, Yuria; Yagame, Takahiro; Yamato, Masahide; Kaminaka, Hironori

2017-02-21

In nature, orchid plants depend completely on symbiotic fungi for their nutrition at the germination and the subsequent seedling (protocorm) stages. However, only limited quantitative methods for evaluating the orchid-fungus interactions at the protocorm stage are currently available, which greatly constrains our understanding of the symbiosis. Here, we aimed to improve and integrate quantitative evaluations of the growth and fungal colonization in the protocorms of a terrestrial orchid, Blettila striata, growing on a plate medium. We achieved both symbiotic and asymbiotic germinations for the terrestrial orchid B. striata. The protocorms produced by the two germination methods grew almost synchronously for the first three weeks. At week four, however, the length was significantly lower in the symbiotic protocorms. Interestingly, the dry weight of symbiotic protocorms did not significantly change during the growth period, which implies that there was only limited transfer of carbon compounds from the fungus to the protocorms in this relationship. Next, to evaluate the orchid-fungus interactions, we developed an ink-staining method to observe the hyphal coils in protocorms without preparing thin sections. Crushing the protocorm under the coverglass enables us to observe all hyphal coils in the protocorms with high resolution. For this observation, we established a criterion to categorize the stages of hyphal coils, depending on development and degradation. By counting the symbiotic cells within each stage, it was possible to quantitatively evaluate the orchid-fungus symbiosis. We describe a method for quantitative evaluation of orchid-fungus symbiosis by integrating the measurements of plant growth and fungal colonization. The current study revealed that although fungal colonization was observed in the symbiotic protocorms, the weight of the protocorm did not significantly increase, which is probably due to the incompatibility of the fungus in this symbiosis. These results suggest that fungal colonization and nutrition transfer can be differentially regulated in the symbiosis. The evaluation methods developed in this study can be used to study various quantitative aspects of the orchid-fungus symbiosis.

FLUORESCENT-SERIOLOGICAL INVESTIGATIONS OF A PATHOGENIC FUNGUS (SPOROTRICHUM SCHENCKII),

DTIC Science & Technology

coloration of numerous other species of fungus no cross reactions with Sporotrichum schenkii were found. The use of this fluorescent coloring method for the diagnosis of Sporotrichosis is suggested. (Author)

Athlete's Foot

MedlinePlus

... this page. Please enable Javascript in your browser. Athlete's Foot Athlete's foot is a skin infection caused by fungus. A ... the body; on the foot, it is called athlete’s foot, or tinea pedis. Fungus commonly attacks the feet ...

The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

PubMed

Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

2010-03-01

The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

The Hidden Habit of the Entomopathogenic Fungus Beauveria bassiana: First Demonstration of Vertical Plant Transmission

PubMed Central

Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

2014-01-01

Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120–140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum. PMID:24551242

Distribution and environmental persistence of the causative agent of white-nose syndrome, Geomyces destructans, in bat hibernacula of the eastern United States

USGS Publications Warehouse

Lorch, Jeffrey M.; Muller, Laura K.; Russell, Robin E.; O'Connor, Michael; Lindner, Daniel L.; Blehert, David S.

2013-01-01

White-nose syndrome (WNS) is an emerging disease of hibernating bats caused by the recently described fungus Geomyces destructans. First isolated in 2008, the origins of this fungus in North America and its ability to persist in the environment remain undefined. To investigate the correlation between manifestation of WNS and distribution of G. destructans in the U.S., we analyzed sediment samples collected from 55 bat hibernacula (caves and mines) both within and outside the known range of WNS using a newly developed real-time PCR assay. Geomyces destructans was detected in 17 of 21 sites within the known range of WNS at the time the samples were collected; the fungus was not found in 28 sites beyond the known range of the disease at the time that environmental samples were collected. These data indicate that distribution of G. destructans is correlated with disease in hibernating bats and support the hypothesis that the fungus is likely an exotic species in North America. Additionally, we examined whether G. destructans persists in infested bat hibernacula when bats are absent. Sediment samples were collected from 14 WNS-positive hibernacula, and the samples were screened for viable fungus using a culture technique. Viable G. destructans was cultivated from 7 of the 14 sites sampled during late summer when bats were no longer in hibernation, suggesting the fungus can persist in the environment in the absence of bat hosts for long periods of time.

The hidden habit of the entomopathogenic fungus Beauveria bassiana: first demonstration of vertical plant transmission.

PubMed

Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

2014-01-01

Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120-140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum.

Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.

2012-09-01

Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence andmore » three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.« less

Trichoderma virens as a biocontrol of Toxocara canis: In vivo evaluation.

PubMed

de Souza Maia Filho, Fernando; da Silva Fonseca, Anelise Oliveira; Persici, Beatriz Maroneze; de Souza Silveira, Julia; Braga, Caroline Quintana; Pötter, Luciana; de Avila Botton, Sônia; Brayer Pereira, Daniela Isabel

Microorganisms have been widely studied as biological control agents of parasites of medical and veterinary importance. Coprophagous arthropods, bacteria and fungi are among the different organisms evaluated as potential biological control agents. Nematophagous fungi capture and digest the free forms of nematodes in the soil. Due to its zoonotic potential, Toxocara canis have been brought to the attention of researchers. The aim of the present study was to determine whether the administration of embryonated T. canis eggs exposed to the nematophagous fungus Trichoderma virens reduces parasite infection in experimental animals. Embryonated T. canis eggs were exposed to T. virens mycelium for 15 days at 25°C. Subsequently, 100 fungus-exposed eggs were orally administered to 20 Swiss mice. As a positive control, another 20 mice received 100 embryonated eggs that were not exposed to the fungus. After 48h, the animals were killed, and heart, lungs and liver were harvested for the recovery of larvae. The organs of the animals that received embryonated T. canis eggs exposed to the fungus showed a lower mean larval recovery when compared with the animals that received embryonated eggs without fungus exposure (p<0.05). The exposure of T. canis eggs to T. virens reduces the experimental infection, demonstrating the potential of this nematophagous fungus as a biocontrol agent. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Fungus-insect gall of Phlebopus portentosus.

PubMed

Zhang, Chun-Xia; He, Ming-Xia; Cao, Yang; Liu, Jing; Gao, Feng; Wang, Wen-Bing; Ji, Kai-Ping; Shao, Shi-Cheng; Wang, Yun

2015-01-01

Phlebopus portentosus is a popular edible wild mushroom found in the tropical Yunnan, China, and northern Thailand. In its natural habitats, a gall often has been found on some plant roots, around which fungal fruiting bodies are produced. The galls are different from common insect galls in that their cavity walls are not made from plant tissue but rather from the hyphae of P. portentosus. Therefore we have termed this phenomenon "fungus-insect gall". Thus far six root mealy bug species in the family Pseudococcidae that form fungus-insect galls with P. portentosus have been identified: Formicococcus polysperes, Geococcus satellitum, Planococcus minor, Pseudococcus cryptus, Paraputo banzigeri and Rastrococcus invadens. Fungus-insect galls were found on the roots of more than 21 plant species, including Delonix regia, Citrus maxima, Coffea arabica and Artocarpus heterophyllus. Greenhouse inoculation trials showed that fungus-insect galls were found on the roots of A. heterophyllus 1 mo after inoculation. The galls were subglobose to globose, fulvous when young and became dark brown at maturation. Each gall harbored one or more mealy bugs and had a chimney-like vent for ventilation and access to the gall. The cavity wall had three layers. Various shaped mealy bug wax deposits were found inside the wall. Fungal hyphae invaded the epidermis of plant roots and sometimes even the cortical cells during the late stage of gall development. The identity of the fungus inside the cavity was confirmed by molecular methods. © 2015 by The Mycological Society of America.

Viral repression of fungal pheromone precursor gene expression.

PubMed

Zhang, L; Baasiri, R A; Van Alfen, N K

1998-02-01

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G alpha(i) subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete.

Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens.

PubMed

Aylward, Frank O; Burnum, Kristin E; Scott, Jarrod J; Suen, Garret; Tringe, Susannah G; Adams, Sandra M; Barry, Kerrie W; Nicora, Carrie D; Piehowski, Paul D; Purvine, Samuel O; Starrett, Gabriel J; Goodwin, Lynne A; Smith, Richard D; Lipton, Mary S; Currie, Cameron R

2012-09-01

Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant neotropical herbivores cultivate symbiotic fungus gardens on large quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers. Using metagenomic and metaproteomic techniques, we characterize the bacterial diversity and physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter and Escherichia. We show that these bacterial communities possess genes associated with lignocellulose degradation and diverse biosynthetic pathways, suggesting that they play a role in nutrient cycling by converting the nitrogen-poor forage of the ants into B-vitamins, amino acids and other cellular components. Our metaproteomic analysis confirms that bacterial glycosyl hydrolases and proteins with putative biosynthetic functions are produced in both field-collected and laboratory-reared colonies. These results are consistent with the hypothesis that fungus gardens are specialized fungus-bacteria communities that convert plant material into energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities in the ecology and evolution of herbivorous metazoans.

Occurrence of itraconazole-tolerant micromycetes in the soil and food products.

PubMed

Piecková, E; Jesenská, Z

1999-01-01

Unexpected pathogens from the environment represent considerable risk for humans with impaired health. We examined the occurrence of itraconazole tolerant micromycetes in soil and in maize products. Five concentrations of itraconazole (2.5-12.5 micrograms/mL) selected according to known treatment schedules for human patients were incorporated into Sabouraud agar with chloramphenicol and Rose Bengal and diluted samples were inoculated onto the agar surface. After 7-d growth at 22 degrees C colonies of Alternaria sp., Aspergillus clavatus, A. glaucus group, A. flavus, A. fumigatus, A. niger group, A. ochraceus group, A. ochraceus, Chaetomium sp., Cladosporium cladosporioides, Cylindrocarpon sp., Doratomyces sp., Fusarium sp., F. moniliforme, F. oxysporum, F. solani, F. subglutinans, Marianaea elegans, Mortierella sp., Mucor sp., Myrothecium sp., Penicillium sp., Rhizopus sp., Scopulariopsis brevicaulis, Sepedonium sp., Stachybotrys chartarum, Stemphylium sp., Torula humicola and Trichoderma viride were isolated.

[Effect of Trichoderma species fungi on soil micromycetes, causing infectious conifer seedling lodging in Siberian tree nurseries].

PubMed

Iakimenko, E E; Grodinitskaia, I D

2000-01-01

Soils in the tree nurseries studied were characterized by a lower species diversity of fungi than adjacent virgin soils. In particular, the relative abundances of representatives of the genera Mucor, Chaetomium, and Trichoderma in the nursery soil were two times lower than in adjacent virgin soils. On the other hand, the nursery soil exhibited greater abundances of fungi of the genus Fusarium, which are causative agents of many diseases of conifer seedlings. To appreciate the efficiency of biocontrol of the infectious diseases of conifer seedlings, we introduced several indigenous Trichoderma strains into the nursery soil and found that this affected the species composition of soil microflora considerably. Changes in the species composition of mycobiota beneficially influenced the phytosanitary state of soils and reduced the infectious lodging of conifer seedlings.

An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat

PubMed Central

Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L.; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F.; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A.; Schweizer, Patrick

2016-01-01

Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici. Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei. Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus. PMID:28018377

An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat.

PubMed

Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A; Schweizer, Patrick

2016-01-01

Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8 ) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici . Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei . Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus.

Unintentional ingestion of Cordyceps fungus-infected cicada nymphs causing ibotenic acid poisoning in Southern Vietnam.

PubMed

Doan, Uyen Vy; Mendez Rojas, Bomar; Kirby, Ralph

2017-09-01

Cordyceps fungus found in infected cicada nymphs ("cicada flowers") is utilized in traditional Chinese medicine. Cordyceps fungus toxicity in humans has not been previously reported. We report 60 cases of apparent Cordyceps poisoning in Southern Vietnam. We retrospectively collected demographic and clinical data from the medical records (21 cases) and by telephone interview (39 cases) of patients admitted to seven hospitals in Southern Vietnam following ingestion of cicada flowers between 2008 and 2015. We also determined the species of Cordyceps present in the cicada flowers and performed a partial chemical analysis of the fungus. Sixty cases of toxic effects following ingestion of cicada flowers were documented. Symptom onset occurred within 60 minutes following ingestion. Symptoms included dizziness, vomiting, salivation, mydriasis, jaw stiffness, urinary retention, seizures, agitated delirium, hallucinations, somnolence and coma. None of the patients suffered liver or kidney injury. There was one fatality. The Cordyceps fungus involved in these poisoning was identified as Ophiocordyceps heteropoda. The presence of ibotenic acid was confirmed, but musimol and muscarine were absent. Cicada infected with Ophiocordyceps heteropoda in Vietnam contain ibotenic acid and are associated with a clinical syndrome consistent with its effects.

Fabrication of a superhydrophobic surface with fungus-cleaning properties on brazed aluminum for industrial application in heat exchangers

NASA Astrophysics Data System (ADS)

Lee, Jeong-Won; Hwang, Woonbong

2018-06-01

Extensive research has been carried out concerning the application of superhydrophobic coating in heat exchangers, but little is known about the application of this technique to brazed aluminum heat exchangers (BAHEs). In this work, we describe a new superhydrophobic coating method, which is suitable for BAHE use on an industrial scale. We first render the BAHE superhydrophobic by fabricating micro/nanostructures using solution dipping followed by fluorination. After the complete removal of the silicon residue, we verify using surface analysis that the BAHE surface is perfectly superhydrophobic. We also studied the fungus-cleaning properties of the superhydrophobic surface by growing fungus for 4 weeks in a moist environment on BAHE fins with and without superhydrophobic coating. We observed that, whereas the fungus grown on the untreated fins is extremely difficult to remove, the fungus on the fins with the superhydrophobic coating can be removed easily with only a modest amount of water. We also found that the coated BAHE fins exhibit excellent resistance to moisture. The superhydrophobic coating method that we propose is therefore expected to have a major impact in the heating, ventilating and air conditioning industry market.

Vertical transmission as the key to the colonization of Madagascar by fungus-growing termites?

PubMed Central

Nobre, T.; Eggleton, P.; Aanen, D. K.

2010-01-01

The mutualism between fungus-growing termites (Macrotermitinae) and their mutualistic fungi (Termitomyces) began in Africa. The fungus-growing termites have secondarily colonized Madagascar and only a subset of the genera found in Africa is found on this isolated island. Successful long-distance colonization may have been severely constrained by the obligate interaction of the termites with fungal symbionts and the need to acquire these symbionts secondarily from the environment for most species (horizontal symbiont transmission). Consistent with this hypothesis, we show that all extant species of fungus-growing termites of Madagascar are the result of a single colonization event of termites belonging to one of the only two groups with vertical symbiont transmission, and we date this event at approximately 13 Mya (Middle/Upper Miocene). Vertical symbiont transmission may therefore have facilitated long-distance dispersal since both partners disperse together. In contrast to their termite hosts, the fungal symbionts have colonized Madagascar multiple times, suggesting that the presence of fungus-growing termites may have facilitated secondary colonizations of the symbiont. Our findings indicate that the absence of the right symbionts in a new environment can prevent long-distance dispersal of symbioses relying on horizontal symbiont acquisition. PMID:19828546

Serine proteases activity is important for the interaction of nematophagous fungus Duddingtonia flagrans with infective larvae of trichostrongylides and free-living nematodes Panagrellus spp.

PubMed

Cruz, Daniela G; Costa, Luana M; Rocha, Letícia O; Retamal, Claudio A; Vieira, Ricardo A M; Seabra, Sergio H; Silva, Carlos P; DaMatta, Renato A; Santos, Clóvis P

2015-08-01

The nematode-trapping fungus Duddingtonia flagrans has been studied as a possible control method for gastrointestinal nematodes of livestock animals. These fungi capture and infect the nematode by cuticle penetration, immobilization, and digestion of the internal contents. It has been suggested that this sequence of events occurs by a combination of physical and enzymatical activities. The aim of this study was to investigate the participation of proteolytic enzymatic activity during the interaction of the nematophagous fungus D. flagrans with infective larvae of trichostrongylides and the free-living nematode Panagrellus spp. Protease inhibitors used interfered in the predatory activity of D. flagrans. However, only PMSF significantly reduced the mean number of Panagrellus spp. captured by D. flagrans in comparison with the control. The experiment with fluorogenic substrate showed that maximum urokinase activity during the interaction of the fungus with the infective larvae of trichostrongylides or Panagrellus spp. occurred within 7 or 1 h of incubation, respectively. The protease activity, especially of the serine class, may be important during the interaction between the fungus and nematodes. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

[Biochemical basis of tolerance to osmotic stress in phytopathogenic fungus: The case of Macrophomina phaseolina (Tassi) Goid.

PubMed

Martínez-Villarreal, Rodolfo; Garza-Romero, Tamar S; Moreno-Medina, Víctor R; Hernández-Delgado, Sanjuana; Mayek-Pérez, Netzahualcoyotl

Fungus Macrophomina phaseolina (Tassi) Goid. is the causative agent of charcoal rot disease which causes significant yield losses in major crops such as maize, sorghum, soybean and common beans in Mexico. This fungus is a facultative parasite which shows broad ability to adapt itself to stressed environments where water deficits and/or high temperature stresses commonly occur. These environmental conditions are common for most cultivable lands throughout Mexico. Here we describe some basic facts related to the etiology and epidemiology of the fungus as well as to the importance of responses to stressed environments, particularly to water deficits, based on morphology and growth traits, as well as on physiology, biochemistry and pathogenicity of fungus M. phaseolina. To conclude, we show some perspectives related to future research into the genus, which emphasize the increasing need to improve the knowledge based on the application of both traditional and biotechnological tools in order to elucidate the mechanisms of resistance to environmental stress which can be extrapolated to other useful organisms to man. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus.

PubMed

Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk; Lee, Tae Soo

2016-03-01

Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously.

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2012 CFR

2012-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2013 CFR

2013-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2011 CFR

2011-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

Genetic Recombination

ERIC Educational Resources Information Center

Whitehouse, H. L. K.

1973-01-01

Discusses the mechanisms of genetic recombination with particular emphasis on the study of the fungus Sordaria brevicollis. The study of recombination is facilitated by the use of mutants of this fungus in which the color of the ascospores is affected. (JR)

Chemical constituents of the mangrove-associated fungus Capnodium sp. SZ-F22. A new eremophilane sesquiterpene.

PubMed

He, Haibing; Ma, Zhongjun; Wang, Qianqian; Liu, Yu; Xu, Hualin

2016-07-01

A new eremophilane sesquiterpene, capnodiumone (1), along with five known eremophilane sesquiterpenes (2-6) and eight other compounds (7-14), have been isolated from a mangrove-associated fungus Capnodium sp. SZ-F22. The chemical structures were elucidated on the basis of extensive spectroscopic analysis. The broth extract of the fungus exhibited a good inhibitory effect on the mycelium growth against Fusarium graminearum at 100 μg/mL, however, all the 14 compounds showed no expected antifungal activity. The probable reasons were discussed.

The research of using Co-60 γ ray to sterilize different mediums for edible fungus

NASA Astrophysics Data System (ADS)

Guozhu, Li; Zhenqian, Guan; Hengshou, Zhao

1993-10-01

The present experiment has been carried out by using different dosage of Co—60 γ ray for radiation sterilization of five kinds of cultural materials of edible fungus, The results indicated that sterilization dosage of sawdust is 22 kGy. that of cotton—seed shell and the rest are 26 kGy. We conclude that using Co-60 γ ray to sterilize the cultura 1 materials of edible fungus is a secure and saving labor and energy new method which could sterilize thoroughly.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Colonization of soil by Histoplasma capsulatum: II. Effect of bat guano added to an area of reduced colonization.

PubMed

Hasenclever, H F; Piggott, W R

1976-07-01

Application of bat guano to an area with reduced but detectable colonization by Histoplasma capsulatum had no quantitative effect on the fungus. After seeding the guano treated area and an untreated area with a soil culture of the fungus, a quantitative effect was noted in the treated area but the period of survival did not appear to be extended. Twenty-four months after seeding, the fungus was no longer detectable in the study areas and they have remained negative for more than a year.

Process for producing ethanol from plant biomass using the fungus paecilomyces sp.

DOEpatents

Wu, Jung Fu

1989-01-01

A process for producing ethanol from plant biomass is disclosed. The process in cludes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces, which has the ability to ferment both cellobiose and xylose to ethanol, is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate.

Process for producing ethanol from plant biomass using the fungus Paecilomyces sp

DOEpatents

Wu, J.F.

1985-08-08

A process for producing ethanol from plant biomass is disclosed. The process includes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces which has the ability to ferment both cellobiose and xylose to ethanol is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate. 5 figs., 3 tabs.

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia.

PubMed

Gabriel, Frédéric; D'Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2013-02-09

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries.

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia

PubMed Central

Gabriel, Frédéric; D’Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2013-01-01

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries. PMID:24432214

Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites

PubMed Central

Pedersen, Kristine S. K.; Aanen, Duur K.

2017-01-01

ABSTRACT Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ. Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. PMID:29269491

Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites.

PubMed

da Costa, Rafael R; Hu, Haofu; Pilgaard, Bo; Vreeburg, Sabine M E; Schückel, Julia; Pedersen, Kristine S K; Kračun, Stjepan K; Busk, Peter K; Harholt, Jesper; Sapountzis, Panagiotis; Lange, Lene; Aanen, Duur K; Poulsen, Michael

2018-03-01

Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. Copyright © 2018 da Costa et al.

76 FR 7095 - Avocados Grown in South Florida; Increased Assessment Rate

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-09

... Red Bay Ambrosia beetle. The beetle carries the Laurel Wilt fungus which can infect and kill avocado trees. Research into the beetle and fungus had been funded by the University of Florida. However, the...

Focus on Fungi

ERIC Educational Resources Information Center

Flannery, Maura C.

2004-01-01

A mention of "The Fungus Fighters: Two Women Scientists and Their Discovery" by Richard Baldwin and discovery of a huge fungus of the species Armillaria bulbosa and A. ostoyae are presented. Other aspects like fungal infections and shifting relationships are discussed.

Multifarious plant growth promotion by an entomopathogenic fungus Lecanicillium psalliotae.

PubMed

Senthil Kumar, C M; Jacob, T K; Devasahayam, S; Thomas, Stephy; Geethu, C

2018-03-01

An entomopathogenic fungus, Lecanicillium psalliotae strain IISR-EPF-02 previously found infectious to cardamom thrips, Sciothrips cardamomi promoted plant growth in cardamom, Elettaria cardamomum. The isolate exhibited direct plant growth promoting traits by production of indole-3-acetic acid and ammonia and by solubilizing inorganic phosphate and zinc. It also showed indirect plant growth promoting traits by producing siderophores and cell wall-degrading enzymes like, α-amylases, cellulases and proteases. In pot culture experiments, application of the fungus at the root zone of cardamom seedlings significantly increased shoot and root length, shoot and root biomass, number of secondary roots and leaves and leaf chlorophyll content compared to untreated plants. This is the first report on the plant growth promoting traits of this fungus. The entomopathogenic and multifarious growth promoting traits of L. psalliotae strain IISR-EPF-02 suggest that it has great potential for exploitation in sustainable agriculture. Copyright © 2017 Elsevier GmbH. All rights reserved.

Myco-fluidics: The fluid dynamics of fungal chimerism

NASA Astrophysics Data System (ADS)

Roper, Marcus; Hickey, Patrick; Dressaire, Emilie; Roch, Sebastien

2012-11-01

Chimeras-fantastical creatures formed as amalgams of many animals-have captured the human imagination since Ancient times. But they are also surprisingly common in Nature. The syncytial cells of filamentous fungi harbor large numbers of nuclei bathed in a single cytoplasm. As a fungus grows these nuclei become genetically diverse, either from mutation or from exchange of nuclei between different fungal individuals, a process that is known to increase the virulence of the fungus and its adaptability. By directly measuring nuclear movement in the model ascomycete fungus Neurospora crassa, we show that the fungus' tolerance for internal genetic diversity is enabled by hydrodynamic mixing of nuclei acting at all length scales within the fungal mycelium. Mathematical modeling and experiments in a mutant with altered mycelial morphology reveal some of the exquisite hydraulic engineering necessary to create these mixing flows from spatially coarse pressure gradients.

Investigating the effects of laser beams (532 and 660 nm) in annihilation of pistachio mould fungus using spectrophotometry analysis

NASA Astrophysics Data System (ADS)

Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.

2010-09-01

When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.

Genome characteristics reveal the impact of lichenization on lichen-forming fungus Endocarpon pusillum Hedwig (Verrucariales, Ascomycota)

PubMed Central

2014-01-01

Background Lichen is a classic mutualistic organism and the lichenization is one of the fungal symbioses. The lichen-forming fungus Endocarpon pusillum is living in symbiosis with the green alga Diplosphaera chodatii Bialsuknia as a lichen in the arid regions. Results 454 and Illumina technologies were used to sequence the genome of E. pusillum. A total of 9,285 genes were annotated in the 37.5 Mb genome of E. pusillum. Analyses of the genes provided direct molecular evidence for certain natural characteristics, such as homothallic reproduction and drought-tolerance. Comparative genomics analysis indicated that the expansion and contraction of some protein families in the E. pusillum genome reflect the specific relationship with its photosynthetic partner (D. chodatii). Co-culture experiments using the lichen-forming fungus E. pusillum and its algal partner allowed the functional identification of genes involved in the nitrogen and carbon transfer between both symbionts, and three lectins without signal peptide domains were found to be essential for the symbiotic recognition in the lichen; interestingly, the ratio of the biomass of both lichen-forming fungus and its photosynthetic partner and their contact time were found to be important for the interaction between these two symbionts. Conclusions The present study lays a genomic analysis of the lichen-forming fungus E. pusillum for demonstrating its general biological features and the traits of the interaction between this fungus and its photosynthetic partner D. chodatii, and will provide research basis for investigating the nature of its drought resistance and symbiosis. PMID:24438332

Impact of Climate Change on Potential Distribution of Chinese Caterpillar Fungus (Ophiocordyceps sinensis) in Nepal Himalaya

PubMed Central

Shrestha, Uttam Babu; Bawa, Kamaljit S.

2014-01-01

Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11–4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species. PMID:25180515

Impact of climate change on potential distribution of Chinese caterpillar fungus (Ophiocordyceps sinensis) in Nepal Himalaya.

PubMed

Shrestha, Uttam Babu; Bawa, Kamaljit S

2014-01-01

Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11-4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species.

Pycnoscelus surinamensis cockroach gut microbiota respond consistently to a fungal diet without mirroring those of fungus-farming termites.

PubMed

Richards, Callum; Otani, Saria; Mikaelyan, Aram; Poulsen, Michael

2017-01-01

The gut microbiotas of cockroaches and termites play important roles in the symbiotic digestion of dietary components, such as lignocellulose. Diet has been proposed as a primary determinant of community structure within the gut, acting as a selection force to shape the diversity observed within this "bioreactor", and as a key factor for the divergence of the termite gut microbiota from the omnivorous cockroach ancestor. The gut microbiota in most termites supports primarily the breakdown of lignocellulose, but the fungus-farming sub-family of higher termites has become similar in gut microbiota to the ancestral omnivorous cockroaches. To assess the importance of a fungus diet as a driver of community structure, we compare community compositions in the guts of experimentally manipulated Pycnoscelus surinamensis cockroaches fed on fungus cultivated by fungus-farming termites. MiSeq amplicon analysis of gut microbiotas from 49 gut samples showed a step-wise gradient pattern in community similarity that correlated with an increase in the proportion of fungal material provided to the cockroaches. Comparison of the taxonomic composition of manipulated communities to that of gut communities of a fungus-feeding termite species showed that although some bacteria OTUs shared by P. surinamensis and the farming termites increased in the guts of cockroaches on a fungal diet, cockroach communities remained distinct from those of termites. These results demonstrate that a fungal diet can play a role in structuring gut community composition, but at the same time exemplifies how original community compositions constrain the magnitude of such change.

Viral Repression of Fungal Pheromone Precursor Gene Expression

PubMed Central

Zhang, Lei; Baasiri, Rudeina A.; Van Alfen, Neal K.

1998-01-01

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a Gαi subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete. PMID:9447992

Aerial application of the insect-killing fungus Lecanicillium muscarium in a microfactory formulation for hemlock woolly adelgid suppression

Treesearch

Scott Costa; Karen Felton; Bradley Onken; Richard Reardon; Rusty. Rhea

2011-01-01

Forest populations of hemlock woolly adelgid (HWA) were reduced using an operational formulation of the insect-killing fungus Lecanicillium muscarium when it was supported by microfactory formulation technology.

Evolutionary patterns of proteinase activity in attine ant fungus gardens

PubMed Central

2011-01-01

Background Attine ants live in symbiosis with a basidiomycetous fungus that they rear on a substrate of plant material. This indirect herbivory implies that the symbiosis is likely to be nitrogen deprived, so that specific mechanisms may have evolved to enhance protein availability. We therefore hypothesized that fungal proteinase activity may have been under selection for efficiency and that different classes of proteinases might be involved. Results We determined proteinase activity profiles across a wide pH range for fungus gardens of 14 Panamanian species of fungus-growing ants, representing eight genera. We mapped these activity profiles on an independently obtained molecular phylogeny of the symbionts and show that total proteinase activity in lower attine symbionts peaks at ca. pH 6. The higher attine symbionts that have no known free-living relatives had much higher proteinase activities than the lower attine symbionts. Their total in vitro proteinase activity peaked at pH values around 5, which is close to the pH that the ants maintain in their fungus gardens, suggesting that the pH optimum of fungal proteinases may have changed after the irreversible domestication of evolutionary more derived fungal symbionts. This notion is also supported by buffering capacities of fungus gardens at pH 5.2 being remarkably high, and suggests that the fungal symbiont actively helps to maintain garden acidity at this specific level. Metalloproteinases dominated the activity profiles of lower attine gardens and may thus represent the ancestral type of proteinase production, whereas serine proteinase activity dominated the activity profiles of the higher attine gardens reared by Trachymyrmex and Sericomyrmex, suggesting that there may be trade-offs in the production of these enzyme classes. Remarkably, the single symbiont that is shared by species of the crown group of Atta and Acromyrmex leaf-cutting ants mostly showed metalloproteinase activity, suggesting that recurrent changes in enzyme production may have occurred throughout the domestication history of fungus-garden symbionts. Conclusions Proteinase pH optima and buffering capacities of fungal symbionts appear to have evolved remarkable adaptations to living in obligate symbiosis with farming ants. Although the functional roles of serine and metalloproteinases in fungus gardens are unknown, the differential production of these classes of proteolytic enzymes suggest that substrate specificity may be important and that trade-offs may prevent the simultaneous upregulation of both classes of enzymes. PMID:21247468

Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium (1988)

EPA Science Inventory

Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [14C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble met...

CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
Da as determ...

CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

Parasitic Aspects of a Fairy Ring Fungus, Marasmius oreades

Treesearch

T. H. Filer

1965-01-01

Marasmius oreades parasitizes Poa pratensis, Festuca rubra, and Agrostis tenuis. The fungus penetrates the root directly in all three species and does not require natural openings or wounds. The mycelium ramifies in the cortical cells and destroys the cell contents.

Cyclodepsipeptides, sesquiterpenoids, and other cytotoxic metabolites from the filamentous fungus Trichothecium sp. (MSX 51320).

PubMed

Sy-Cordero, Arlene A; Graf, Tyler N; Adcock, Audrey F; Kroll, David J; Shen, Qi; Swanson, Steven M; Wani, Mansukh C; Pearce, Cedric J; Oberlies, Nicholas H

2011-10-28

Two new cyclodepsipeptides (1 and 2), two new sesquiterpenoids (3 and 4), and the known compounds guangomide A (5), roseotoxin S, and three simple trichothecenes were isolated from the cytotoxic organic extract of a terrestrial filamentous fungus, Trichothecium sp. The structures were determined using NMR spectroscopy and mass spectrometry. Absolute configurations of the cyclodepsipeptides were established by employing chiral HPLC, while the relative configurations of 3 and 4 were determined via NOESY data. The isolation of guangomide A was of particular interest, since it was reported previously from a marine-derived fungus.

A virus in a fungus in a plant: Three-way symbiosis required for thermal tolerance

USGS Publications Warehouse

Marquez, L.M.; Redman, R.S.; Rodriguez, R.J.; Roossinck, M.J.

2007-01-01

A mutualistic association between a fungal endophyte and a tropical panic grass allows both organisms to grow at high soil temperatures. We characterized a virus from this fungus that is involved in the mutualistic interaction. Fungal isolates cured of the virus are unable to confer heat tolerance, but heat tolerance is restored after the virus is reintroduced. The virus-infected fungus confers heat tolerance not only to its native monocot host but also to a eudicot host, which suggests that the underlying mechanism involves pathways conserved between these two groups of plants.

Effects Sprayed Solution of Salicylic Acid to Prevent of Wilt Disease Caused by Fussarium oxysporium

NASA Astrophysics Data System (ADS)

Yousif, Dina. Y. M.

2018-05-01

The current search aimed to detective the effect of sprayed solution of salicylic acid on plant and leaves of sweet green pepper (Capsicum annuum) for control the pathogen Fussarium oxysporium compering with control plant and leaves. Results indicated that, the spray of salicylic acid at concentration 0.5 g/L is effecting the fungal infection through prevent transport fungus F. oxysporum to the neighboring green pepper plant. The number of dead green pepper plant after sprayed with solution of salicylic acid and only water they were (4, 6, and 3) (8, 9, and 10) respectively. While the experimental infection of green pepper leaves after inoculated the fungus as local spot by scorching small spots of these leaves with the aid of hot nail. These spots were then exposed to the 0.5 g/L aqueous solution salicylic acid before and after the inoculation of the fungus. The spray of salicylic acid before 24 and 48 hour prevent the development of disease and make a good protection of the mention leaves from infection with this fungus, the diameter of leaves lesion (1,1.5 cm) respectively. while the ability of fungus to grow after 24 and 48 hour from salicylic acid treatment was markedly reduce as compared with control, such treatment show slow growth of pathogen infect.

Changes in selected enzyme activities during growth of pure and mixed cultures of the white-rot decay fungus Trametes versicolor and the potential biocontrol fungus Trichoderma harzianum.

PubMed

Freitag, M; Morrell, J J

1992-04-01

Two filamentous fungi, the white-rot fungus Trametes versicolor and the soil fungus and potential biocontrol organism Trichoderma harzianum, have been grown in pure and mixed cultures on low-N (0.4 mM) and high-N (4 mM) defined synthetic media to determine the activities of selected wood-degrading enzymes such as cellobiase, cellulase, laccase, and peroxidases. Growth characteristics and enzyme activities were examined for potential correlations. Such correlations would allow the use of simple enzyme assays for measuring biomass development and would facilitate predictions about competitiveness of species in mixed fungal cultures. Our results show that while laccase and Poly Red-478 peroxidase activities indicate survival of the decay fungus, none of the monitored extracellular enzymes can serve as a quantitative indicator for biomass accumulation. As expected, the level of available nitrogen affected the production of the enzymes monitored: in low-N media, specific cellobiase, specific cellulase, and peroxidase activities were enhanced, while laccase activities were reduced. Most importantly, laccase activities of Trametes versicolor, and to a smaller extent, cellobiase activities of both fungi, were significantly induced in mixed cultures of Trametes versicolor and Trichoderma harzianum.

An arbuscular mycorrhizal fungus and Epichloë festucae var. lolii reduce Bipolaris sorokiniana disease incidence and improve perennial ryegrass growth.

PubMed

Li, Fang; Guo, Yan'e; Christensen, Michael J; Gao, Ping; Li, Yanzhong; Duan, Tingyu

2018-02-01

Leaf spot of perennial ryegrass (Lolium perenne) caused by Bipolaris sorokiniana is an important disease in temperate regions of the world. We designed this experiment to test for the combined effects of the arbuscular mycorrhizal (AM) fungus Claroideoglomus etunicatum and the grass endophyte fungus Epichloë festucae var. lolii on growth and disease occurrence in perennial ryegrass. The results show that C. etunicatum increased plant P uptake and total dry weight and that this beneficial effect was slightly enhanced when in association with the grass endophyte. The presence in plants of both the endophyte and B. sorokiniana decreased AM fungal colonization. Plants inoculated with B. sorokiniana showed the typical leaf spot symptoms 2 weeks after inoculation and the lowest disease incidence was with plants that were host to both C. etunicatum and E. festucae var. lolii. Plants with these two fungi had much higher activity of peroxidases (POD), superoxide dismutase (SOD) and catalase (CAT) and lower values of malondialdehyde (MDA) and hydrogen peroxide (H 2 O 2 ). The AM fungus C. etunicatum and the grass endophyte fungus E. festucae var. lolii have the potential to promote perennial ryegrass growth and resistance to B. sorokiniana leaf spot.

Cuticle hydrolysis in four medically important fly species by enzymes of the entomopathogenic fungus Conidiobolus coronatus.

PubMed

Boguś, M I; Włóka, E; Wrońska, A; Kaczmarek, A; Kazek, M; Zalewska, K; Ligęza-Żuber, M; Gołębiowski, M

2017-03-01

Entomopathogenic fungi infect insects via penetration through the cuticle, which varies remarkably in chemical composition across species and life stages. Fungal infection involves the production of enzymes that hydrolyse cuticular proteins, chitin and lipids. Host specificity is associated with fungus-cuticle interactions related to substrate utilization and resistance to host-specific inhibitors. The soil fungus Conidiobolus coronatus (Constantin) (Entomophthorales: Ancylistaceae) shows virulence against susceptible species. The larvae and pupae of Calliphora vicina (Robineau-Desvoidy) (Diptera: Calliphoridae), Calliphora vomitoria (Linnaeus), Lucilia sericata (Meigen) (Diptera: Calliphoridae) and Musca domestica (Linnaeus) (Diptera: Muscidae) are resistant, but adults exposed to C. coronatus quickly perish. Fungus was cultivated for 3 weeks in a minimal medium. Cell-free filtrate, for which activity of elastase, N-acetylglucosaminidase, chitobiosidase and lipase was determined, was used for in vitro hydrolysis of the cuticle from larvae, puparia and adults. Amounts of amino acids, N-glucosamine and fatty acids released were measured after 8 h of incubation. The effectiveness of fungal enzymes was correlated with concentrations of compounds detected in the cuticles of tested insects. Positive correlations suggest compounds used by the fungus as nutrients, whereas negative correlations may indicate compounds responsible for insect resistance. Adult deaths result from the ingestion of conidia or fungal excretions. © 2016 The Royal Entomological Society.

Acromyrmex Leaf-Cutting Ants Have Simple Gut Microbiota with Nitrogen-Fixing Potential

PubMed Central

Zhukova, Mariya; Hansen, Lars H.; Sørensen, Søren J.; Schiøtt, Morten

2015-01-01

Ants and termites have independently evolved obligate fungus-farming mutualisms, but their gardening procedures are fundamentally different, as the termites predigest their plant substrate whereas the ants deposit it directly on the fungus garden. Fungus-growing termites retained diverse gut microbiota, but bacterial gut communities in fungus-growing leaf-cutting ants have not been investigated, so it is unknown whether and how they are specialized on an exclusively fungal diet. Here we characterized the gut bacterial community of Panamanian Acromyrmex species, which are dominated by only four bacterial taxa: Wolbachia, Rhizobiales, and two Entomoplasmatales taxa. We show that the Entomoplasmatales can be both intracellular and extracellular across different gut tissues, Wolbachia is mainly but not exclusively intracellular, and the Rhizobiales species is strictly extracellular and confined to the gut lumen, where it forms biofilms along the hindgut cuticle supported by an adhesive matrix of polysaccharides. Tetracycline diets eliminated the Entomoplasmatales symbionts but hardly affected Wolbachia and only moderately reduced the Rhizobiales, suggesting that the latter are protected by the biofilm matrix. We show that the Rhizobiales symbiont produces bacterial NifH proteins that have been associated with the fixation of nitrogen, suggesting that these compartmentalized hindgut symbionts alleviate nutritional constraints emanating from an exclusive fungus garden diet reared on a substrate of leaves. PMID:26048932

Dissection of niche competition between introduced and indigenous arbuscular mycorrhizal fungi with respect to soybean yield responses.

PubMed

Niwa, Rieko; Koyama, Takuya; Sato, Takumi; Adachi, Katsuki; Tawaraya, Keitaro; Sato, Shusei; Hirakawa, Hideki; Yoshida, Shigenobu; Ezawa, Tatsuhiro

2018-05-09

Arbuscular mycorrhizal (AM) fungi associate with most land plants and deliver phosphorus to the host. Identification of biotic/abiotic factors that determine crop responses to AM fungal inoculation is an essential step for successful application of the fungi in sustainable agriculture. We conducted three field trials on soybean with a commercial inoculum and developed a new molecular tool to dissect interactions between the inoculum and indigenous fungi on the MiSeq sequencing platform. Regression analysis indicated that sequence read abundance of the inoculum fungus was the most significant factor that determined soybean yield responses to the inoculation, suggesting that dominance of the inoculum fungus is a necessary condition for positive yield responses. Agricultural practices (fallow/cropping in the previous year) greatly affected the colonization levels (i.e. read abundances) of the inoculum fungus via altering the propagule density of indigenous AM fungi. Analysis of niche competition revealed that the inoculum fungus competed mainly with the indigenous fungi that are commonly distributed in the trial sites, probably because their life-history strategy is the same as that of the inoculum fungus. In conclusion, we provide a new framework for evaluating the significance of environmental factors towards successful application of AM fungi in agriculture.

Characteristics of uranium biosorption from aqueous solutions on fungus Pleurotus ostreatus.

PubMed

Zhao, Changsong; Liu, Jun; Tu, Hong; Li, Feize; Li, Xiyang; Yang, Jijun; Liao, Jiali; Yang, Yuanyou; Liu, Ning; Sun, Qun

2016-12-01

Uranium(VI) biosorption from aqueous solutions was investigated in batch studies by using fungus Pleurotus ostreatus biomass. The optimal biosorption conditions were examined by investigating the reaction time, biomass dosage, pH, temperature, and uranium initial concentration. The interaction between fungus biomass and uranium was confirmed using Fourier transformed infrared (FT-IR), scanning electronic microscopy energy dispersive X-ray (SEM-EDX), and X-ray photoelectron spectroscopy (XPS) analysis. Results exhibited that the maximum biosorption capacity of uranium on P. ostreatus was 19.95 ± 1.17 mg/g at pH 4.0. Carboxylic, amine, as well as hydroxyl groups were involved in uranium biosorption according to FT-IR analysis. The pseudo-second-order model properly evaluated the U(VI) biosorption on fungus P. ostreatus biomass. The Langmuir equation provided better fitting in comparison with Freundlich isotherm models. The obtained thermodynamic parameters suggested that biosorption is feasible, endothermic, and spontaneous. SEM-EDX and XPS were additionally conducted to comprehend the biosorption process that could be described as a complex process involving several mechanisms of physical adsorption, chemisorptions, and ion exchange. Results obtained from this work indicated that fungus P. ostreatus biomass can be used as potential biosorbent to eliminate uranium or other radionuclides from aqueous solutions.

Influence of Cadmium and Mercury on Activities of Ligninolytic Enzymes and Degradation of Polycyclic Aromatic Hydrocarbons by Pleurotus ostreatus in Soil

PubMed Central

Baldrian, Petr; in der Wiesche, Carsten; Gabriel, Jiří; Nerud, František; Zadražil, František

2000-01-01

The white-rot fungus Pleurotus ostreatus was able to degrade the polycyclic aromatic hydrocarbons (PAHs) benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a]pyrene, dibenzo[a,h]anthracene, and benzo[ghi]perylene in nonsterile soil both in the presence and in the absence of cadmium and mercury. During 15 weeks of incubation, recovery of individual compounds was 16 to 69% in soil without additional metal. While soil microflora contributed mostly to degradation of pyrene (82%) and benzo[a]anthracene (41%), the fungus enhanced the disappearance of less-soluble polycyclic aromatic compounds containing five or six aromatic rings. Although the heavy metals in the soil affected the activity of ligninolytic enzymes produced by the fungus (laccase and Mn-dependent peroxidase), no decrease in PAH degradation was found in soil containing Cd or Hg at 10 to 100 ppm. In the presence of cadmium at 500 ppm in soil, degradation of PAHs by soil microflora was not affected whereas the contribution of fungus was negligible, probably due to the absence of Mn-dependent peroxidase activity. In the presence of Hg at 50 to 100 ppm or Cd at 100 to 500 ppm, the extent of soil colonization by the fungus was limited. PMID:10831426

Termites promote resistance of decomposition to spatiotemporal variability in rainfall.

PubMed

Veldhuis, Michiel P; Laso, Francisco J; Olff, Han; Berg, Matty P

2017-02-01

The ecological impact of rapid environmental change will depend on the resistance of key ecosystems processes, which may be promoted by species that exert strong control over local environmental conditions. Recent theoretical work suggests that macrodetritivores increase the resistance of African savanna ecosystems to changing climatic conditions, but experimental evidence is lacking. We examined the effect of large fungus-growing termites and other non-fungus-growing macrodetritivores on decomposition rates empirically with strong spatiotemporal variability in rainfall and temperature. Non-fungus-growing larger macrodetritivores (earthworms, woodlice, millipedes) promoted decomposition rates relative to microbes and small soil fauna (+34%) but both groups reduced their activities with decreasing rainfall. However, fungus-growing termites increased decomposition rates strongest (+123%) under the most water-limited conditions, making overall decomposition rates mostly independent from rainfall. We conclude that fungus-growing termites are of special importance in decoupling decomposition rates from spatiotemporal variability in rainfall due to the buffered environment they create within their extended phenotype (mounds), that allows decomposition to continue when abiotic conditions outside are less favorable. This points at a wider class of possibly important ecological processes, where soil-plant-animal interactions decouple ecosystem processes from large-scale climatic gradients. This may strongly alter predictions from current climate change models. © 2016 by the Ecological Society of America.

Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus

PubMed Central

Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk

2016-01-01

Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously. PMID:27103854

The development of a spatially-explicit, individual-based, disease model for frogs and the chytrid fungus

EPA Science Inventory

Background / Question / Methods The fungal pathogen, Batrachochytrium dendrobatidis (BD), has been associated with amphibian population declines and even extinctions worldwide. Transmission of the fungus between amphibian hosts occurs via motile zoospores, which are produced on...

BIODEGRADATION OF CRYSTAL VIOLET BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM

EPA Science Inventory

Biodegradation of crystal violet (N,N,N',N',N",N"-hexamethylpararosaniline) in ligninolytic (nitrogen-limited) cultures of the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance of crystal violet and by the identification of three metabolites (N,N,...

7 CFR 810.302 - Definitions of other terms.

Code of Federal Regulations, 2010 CFR

2010-01-01

... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...

7 CFR 810.302 - Definitions of other terms.

Code of Federal Regulations, 2011 CFR

2011-01-01

... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...

Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents

USDA-ARS?s Scientific Manuscript database

The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...

The widely used ATB FUNGUS 3 automated readings in China and its misleading high MICs of Candida spp. to azoles: challenges for developing countries' clinical microbiology labs.

PubMed

Zhang, Li; Wang, He; Xiao, Meng; Kudinha, Timothy; Mao, Lei-Li; Zhao, Hao-Ran; Kong, Fanrong; Xu, Ying-Chun

2014-01-01

The rapid development in the clinical microbiology diagnostic assays presents more challenges for developing countries than for the developed world, especially in the area of test validation before the introduction of new tests. Here we report on the misleading high MICs of Candida spp. to azoles using the ATB FUNGUS 3 (bioMérieux, La Balme-les Grottes, France) with automated readings in China to highlight the dangers of introducing a diagnostic assay without validation. ATB FUNGUS 3 is the most commonly used commercial antifungal susceptibility testing method in China. An in-depth analysis of data showed higher levels of resistance to azoles when ATB FUNGUS 3 strips were read automatically than when read visually. Based on this finding, the performance of ATB FUNGUS 3, read both visually and automatically, was evaluated by testing 218 isolates of five clinically important Candida species, using broth microdilution (BMD) following CLSI M27-A3 as the gold-standard. The overall essential agreement (EA) between ATB visual readings and BMD was 99.1%. In contrast, the ATB automated readings showed higher discrepancies with BMD, with overall EA of 86.2%, and specifically lower EA was observed for fluconazole (80.7%), voriconazole (77.5%), and itraconazole (73.4%), which was most likely due to the trailing effect of azoles. The major errors in azole drug susceptibilities by ATB automated readings is a concern in China that can result in misleading clinical antifungal drug selection and pseudo high rates of antifungal resistance. Therefore, the ATB visual reading is generally recommended. In the meantime, we propose a practical algorithm to be followed for ATB FUNGUS 3 antifungal susceptibility for Candida spp. before the improvement in the automated reading system.

Magnaporthe oryzae Glycine-Rich Secretion Protein, Rbf1 Critically Participates in Pathogenicity through the Focal Formation of the Biotrophic Interfacial Complex

PubMed Central

Ishii-Minami, Naoko; Kawahara, Yoshihiro; Yoshida, Yuri; Okada, Kazunori; Ando, Sugihiro; Matsumura, Hideo; Terauchi, Ryohei; Minami, Eiichi; Nishizawa, Yoko

2016-01-01

Magnaporthe oryzae, the fungus causing rice blast disease, should contend with host innate immunity to develop invasive hyphae (IH) within living host cells. However, molecular strategies to establish the biotrophic interactions are largely unknown. Here, we report the biological function of a M. oryzae-specific gene, R equired-for-Focal- B IC- F ormation 1 (RBF1). RBF1 expression was induced in appressoria and IH only when the fungus was inoculated to living plant tissues. Long-term successive imaging of live cell fluorescence revealed that the expression of RBF1 was upregulated each time the fungus crossed a host cell wall. Like other symplastic effector proteins of the rice blast fungus, Rbf1 accumulated in the biotrophic interfacial complex (BIC) and was translocated into the rice cytoplasm. RBF1-knockout mutants (Δrbf1) were severely deficient in their virulence to rice leaves, but were capable of proliferating in abscisic acid-treated or salicylic acid-deficient rice plants. In rice leaves, Δrbf1 inoculation caused necrosis and induced defense-related gene expression, which led to a higher level of diterpenoid phytoalexin accumulation than the wild-type fungus did. Δrbf1 showed unusual differentiation of IH and dispersal of the normally BIC-focused effectors around the short primary hypha and the first bulbous cell. In the Δrbf1-invaded cells, symplastic effectors were still translocated into rice cells but with a lower efficiency. These data indicate that RBF1 is a virulence gene essential for the focal BIC formation, which is critical for the rice blast fungus to suppress host immune responses. PMID:27711180

Colony Size Affects the Efficacy of Bait Containing Chlorfluazuron Against the Fungus-Growing Termite Macrotermes gilvus (Blattodea: Termitidae).

PubMed

Lee, Ching-Chen; Neoh, Kok-Boon; Lee, Chow-Yang

2014-12-01

The efficacy of chitin synthesis inhibitors (CSIs) against fungus-growing termites is known to vary. In this study, 0.1% chlorfluazuron (CFZ) cellulose bait was tested against medium and large field colonies of Macrotermes gilvus (Hagen). The termite mounds were dissected to determine the health of the colony. Individual termites (i.e., workers and larvae) and fungus combs were subjected to gas chromatography-mass spectrometry (GC-MS) analysis to detect the presence of CFZ. In this study, 540.0 ± 25.8 g (or equivalent to 540.0 ± 25.8 mg active ingredient) and 680.0 ± 49.0 g (680.0 ± 49.0 mg active ingredient) of bait matrix were removed by the medium- and large-sized colonies, respectively, after baiting. All treated medium-sized colonies were moribund. The dead termites were scattered in the mound, larvae were absent, population size had decreased by 90%, and the queens appeared unhealthy. In contrast, no or limited effects were found in large-sized colonies. Only trace amounts of CFZ were detected in workers, larvae, and fungus combs, and the population of large-sized colonies had declined by only up to 40%. This might be owing to the presence of large amount of basidiomycete fungus and a drastic decrease of CFZ content per unit fungus comb (a main food source of larvae) in the large-sized colonies, and hence reduced the toxic effect and longer time is required to accumulate the lethal dose in larvae. Nevertheless, we do not deny the possibility of CSI bait eliminating or suppressing the higher termite if the test colonies could pick up adequate lethal dose by installing more bait stations and prolonging the baiting period. © 2014 Entomological Society of America.

Utilizing fungus myceliated grain for molt induction and performance in commercial laying hens.

PubMed

Willis, W L; Isikhuemhen, O S; Allen, J W; Byers, A; King, K; Thomas, C

2009-10-01

Molting in poultry is used to rejuvenate hens for a second or third laying cycle. Feed withdrawal was once the most effective method used for molt induction; however, it has being phased out due to food safety and animal welfare concerns. This study evaluated the utilization of fungus myceliated grain as a safe and effective alternative for inducing molt, enhancing immunity, reducing Salmonella growth, and returning to egg production. Laying hens were subjected to 1 of 5 treatments: 1) nonfed (NF), 2) full-fed (FF), 3) fungus myceliated meal (FM), 4) 90% fungus myceliated meal+10% standard layer ration (FM-90), and 5) 90% alfalfa meal+10% fungus myceliated meal (AF-90). Each treatment condition was replicated 9 times during a 9-d molt period. The results revealed that egg production for treatments 1 and 3 ceased completely by d 5, whereas hens in treatments 4 and 5 ceased egg production by d 6. The percentage of BW loss decreased significantly (P<0.05) in treatments 1 (57%), 2 (8%), 3 (35%), 4 (37%), and 5 (44%). Ovary weights of hens fed all molting diets decreased significantly from the full-fed control but did not differ significantly (P<0.05) from each other. Salmonella population in the crop, ovary, and ceca from hens differed significantly (P<0.05) among treatments. Return to egg production differed between treatments with higher production beginning in treatment 3 and ending in treatment 5. Antibody titers did differ (P<0.05) among treatments. From these results, fungus myceliated meal appears to be a viable alternative to conventional feed withdrawal and other methods for the successful induction of molt and retention of postmolt performance.

Identifying the core microbial community in the gut of fungus-growing termites.

PubMed

Otani, Saria; Mikaelyan, Aram; Nobre, Tânia; Hansen, Lars H; Koné, N'Golo A; Sørensen, Søren J; Aanen, Duur K; Boomsma, Jacobus J; Brune, Andreas; Poulsen, Michael

2014-09-01

Gut microbes play a crucial role in decomposing lignocellulose to fuel termite societies, with protists in the lower termites and prokaryotes in the higher termites providing these services. However, a single basal subfamily of the higher termites, the Macrotermitinae, also domesticated a plant biomass-degrading fungus (Termitomyces), and how this symbiont acquisition has affected the fungus-growing termite gut microbiota has remained unclear. The objective of our study was to compare the intestinal bacterial communities of five genera (nine species) of fungus-growing termites to establish whether or not an ancestral core microbiota has been maintained and characterizes extant lineages. Using 454-pyrosequencing of the 16S rRNA gene, we show that gut communities have representatives of 26 bacterial phyla and are dominated by Firmicutes, Bacteroidetes, Spirochaetes, Proteobacteria and Synergistetes. A set of 42 genus-level taxa was present in all termite species and accounted for 56-68% of the species-specific reads. Gut communities of termites from the same genus were more similar than distantly related species, suggesting that phylogenetic ancestry matters, possibly in connection with specific termite genus-level ecological niches. Finally, we show that gut communities of fungus-growing termites are similar to cockroaches, both at the bacterial phylum level and in a comparison of the core Macrotermitinae taxa abundances with representative cockroach, lower termite and higher nonfungus-growing termites. These results suggest that the obligate association with Termitomyces has forced the bacterial gut communities of the fungus-growing termites towards a relatively uniform composition with higher similarity to their omnivorous relatives than to more closely related termites. © 2014 John Wiley & Sons Ltd.

Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump.

PubMed

Arenas, Andrés; Roces, Flavio

2017-01-01

Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden.

Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump

PubMed Central

Roces, Flavio

2017-01-01

Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden. PMID:28273083

Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

PubMed

Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

2003-08-01

Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

Fungal endophyte assemblages from ethnopharmaceutically important medicinal trees.

PubMed

Tejesvi, Mysore V; Mahesh, Basavanna; Nalini, Monnanda S; Prakash, Harishchandra S; Kini, Kukkundoor R; Subbiah, Ven; Shetty, Hunthrike S

2006-05-01

Endophytic fungi represent an interesting group of microorganisms associated with the healthy tissues of terrestrial plants. They represent a large reservoir of genetic diversity. Fungal endophytes were isolated from the inner bark segments of ethnopharmaceutically important medicinal tree species, namely Terminalia arjuna, Crataeva magna, Azadirachta indica, Holarrhena antidysenterica, Terminalia chebula, and Butea monosperma (11 individual trees), growing in different regions of southern India. Forty-eight fungal species were recovered from 2200 bark segments. Mitosporic fungi represented a major group (61%), with ascomycetes (21%) and sterile mycelia (18%) the next major groups. Species of Fusarium, Pestalotiopsis, Myrothecium, Trichoderma, Verticillium, and Chaetomium were frequently isolated. Exclusive fungal taxa were recovered from five of the six plant species considered for the study of endophytic fungi. Rarefaction indices for species richness indicated the highest expected number of species for bark segments were isolated from T. arjuna and A. indica (20 species each) and from C. magna (18 species).

Mycotoxin-producing potential of fungi associated with qat (Catha edulis) leaves in Yemen.

PubMed

Mahmoud, A L

2000-01-01

Forty-four fungal species belonging to 20 genera were isolated from 30 samples of qat leaves. The most frequent genera were Aspergillus, Alternaria, Penicillium, and Cladosporium followed by Fusarium, Drechslera, Chaetomium, and Mucor. The most prevalent species in above genera were Aspergillus niger, A. flavus, A fumigatus, Alternaria alternata, Penicillium chrysogenum, P. citrinum, Cladosporium cladosporioides, and Fusarium verticillioides. From these fungi, 17 species (39%) related to 7 genera (35%) proved to be true endophytes. Eleven out of 75 isolates were mycotoxigenic. A. alternata produced alternariol and alternariol monomethyl ether whereas A. flavus produced aflatoxins B1 and B2. Ochratoxin A, sterigmatocystin, citrinin and T-2 toxin were produced by A. ochraceus, A. versicolor, P. citrinum and F. oxysporum, respectively. The presence of such toxigenic fungi associated with qat leaves is considered to be a threat to public health.

Microbial transformation of (+)-nootkatone and the antiproliferative activity of its metabolites.

PubMed

Gliszczyńska, Anna; Łysek, Agnieszka; Janeczko, Tomasz; Świtalska, Marta; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

2011-04-01

Six metabolites were obtained as a result of microbial transformation of (+)-nootkatone (1) by the fungal strains: Botrytis, Didymosphaeria, Aspergillus, Chaetomium and Fusarium. Their structure were established as (+)-(4R,5S,7R,9R)-9α-hydroxynootkatone (2), (+)-(4R,5S,7R)-13-hydroxynootkatone (3) and (+)-(4R,5S,7R,9R,11S)-11,12-epoxy-9α-hydroxynootkatone (4), (+)-(4R,5S,7R,11S)-11,12-epoksynootkatone (5), (+)-(4R,5S,7R)-11,12-dihydroxynootkatone (6) and (+)-(4R,5S,7R)-7,11,12-trihydroxynootkatone (7) on the basis of their spectral data. Two products: (4) and (7) were not previously reported in the literature. The antiproliferative activity of (+)-nootkatone (1) and isolated metabolites (2-7) of its biotransformation has been evaluated. Copyright © 2011 Elsevier Ltd. All rights reserved.

Relating coccidioidomycosis (Valley Fever) incidence via to soil moisture conditions

USDA-ARS?s Scientific Manuscript database

Coccidioidomycosis (also called Valley fever) is caused by a soil-borne fungus, Coccidioides spp., in arid regions of the southwestern United States. Though some who develop infections from this fungus remain asymptomatic, others develop respiratory disease as a consequence. Less commonly, severe ...

Development of 11 polymorphic microsatellite markers for the blackberry rust fungus Phragmidium violaceum

USDA-ARS?s Scientific Manuscript database

Eleven polymorphic microsatellite markers were developed for the Uredinales fungus Phragmidium violaceum, which causes leaf rust on European blackberry (Rubus fruticosus L. aggregate). Allele frequency ranged between two and seventeen alleles per locus with no evidence of linkage disequilibrium amon...

Brown spot needle disease--biology and control in Scotch pine plantations.

Treesearch

Darroll D. Skilling; Thomas H. Nicholls

1975-01-01

An application section briefly describes and illustrates the symptoms, hosts, life history of the brown spot needlecast fungus (Scirrhia acicola), and recommends chemical and cultural control methods. A documentation section details the research on the biology and control of the fungus.

Inferring outcrossing in the homothallic fungus Sclerotinia sclerotiorum using linkage disequilibrium decay

USDA-ARS?s Scientific Manuscript database

The occurrence and frequency of outcrossing in homothallic fungal species in nature is an unresolved question. Here we report detection of frequent outcrossing in the homothallic fungus Sclerotinia sclerotiorum. In using multilocus linkage disequilibrium (LD) to infer recombination among microsatell...

Entomology: A Bee Farming a Fungus.

PubMed

Oldroyd, Benjamin P; Aanen, Duur K

2015-11-16

Farming is done not only by humans, but also by some ant, beetle and termite species. With the discovery of a stingless bee farming a fungus that provides benefits to its larvae, bees can be added to this list. Copyright © 2015 Elsevier Ltd. All rights reserved.

Commandra Blister Rust

Treesearch

David W. Johnson

1986-01-01

Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

Analysis of Volatile Organic Compounds Emitted by Plant Growth-Promoting Fungus Phoma sp. GS8-3 for Growth Promotion Effects on Tobacco

PubMed Central

Naznin, Hushna Ara; Kimura, Minako; Miyazawa, Mitsuo; Hyakumachi, Mitsuro

2013-01-01

We extracted volatile organic compounds (VOCs) emitted by a plant growth-promoting fungus (PGPF) Phoma sp. GS8-3 by gas chromatography and identified them by mass spectrometry. All of the identified compounds belonged to C4-C8 hydrocarbons. Volatiles varied in number and quantity by the culture period of the fungus (in days). 2-Methyl-propanol and 3-methyl-butanol formed the main components of the volatile blends for all the culture periods of fungus. Growth-promoting effects of the identified synthetic compounds were analyzed individually and in blends using tobacco plants. We found that the mixture of volatiles extracted from 3-day-old culture showed significant growth promotion in tobacco in vitro. The volatile blend showed better growth promotion at lower than higher concentrations. Our results confirm the potential role of volatile organic compounds in the mechanism of growth enhancement by GS8-3. PMID:23080408

Continuous xylanase production with Aspergillus nidulans under pyridoxine limitation using a trickle bed reactor.

PubMed

Müller, Michael; Prade, Rolf A; Segato, Fernando; Atiyeh, Hasan K; Wilkins, Mark R

2015-01-01

A trickle bed reactor (TBR) with recycle was designed and tested using Aspergillus nidulans with a pyridoxine marker and over-expressing/secreting recombinant client xylanase B (XynB). The pyridoxine marker prevented the fungus from synthesizing its own pyridoxine and fungus was unable to grow when no pyridoxine was present in the medium; however, enzyme production was unaffected. Uncontrolled mycelia growth that led to clogging of the TBR was observed when fungus without a pyridoxine marker was used for XynB production. Using the fungus with pyridoxine marker, the TBR was operated continuously for 18 days and achieved a XynB output of 41 U/ml with an influent and effluent flow rate of 0.5 ml/min and a recycle flow rate of 56 ml/min. Production yields in the TBR were 1.4 times greater than a static tray culture and between 1.1 and 67 times greater than yields for SSF enzyme production stated in the literature. Copyright © 2015 Elsevier Ltd. All rights reserved.

The toxicosis of Embellisia fungi from locoweed (Oxytropis lambertii) is similar to locoweed toxicosis in rats.

PubMed

McLain-Romero, J; Creamer, R; Zepeda, H; Strickland, J; Bell, G

2004-07-01

Locoweeds cause significant livestock poisoning and economic loss in the western United States. The toxicity of Embellisia sp. fungi isolated from locoweed was compared with locoweed toxicity using the rat as a model. Rats were fed diets containing locoweed, fungus and alfalfa, or alfalfa. Locoweed- and fungus-fed rats consumed swainsonine-containing food at approximately 1.3 mg x kg(-1) x d(-1), gained less weight (P = 0.001) and ate less than controls. Swainsonine is the principal agent responsible for inducing locoism in animals. The concentrations of alkaline phosphatase and aspartate aminotransferase enzymes were greater (P < 0.05) in serum of locoweed- and fungus-fed rats compared with control rats. Similar intracellular vacuolation was observed in renal, pancreatic, and hepatic tissues of rats that consumed either locoweed or fungus. Rats that ate locoweed or Embellisia fungi displayed indistinguishable toxicity symptoms. The Embellisia fungi from locoweed can induce toxicity without the plants. Locoism management strategies need to involve management of the Embellisia fungi.

Lignocellulose degradation patterns, structural changes, and enzyme secretion by Inonotus obliquus on straw biomass under submerged fermentation.

PubMed

Xu, Xiangqun; Xu, Zhiqi; Shi, Song; Lin, Mengmeng

2017-10-01

This study examined the white rot fungus I. obliquus on the degradation of three types of straw biomass and the production of extracellular lignocellulolytic enzymes under submerged fermentation. The fungus process resulted in a highest lignin loss of 72%, 39%, and 47% in wheat straw, rice straw, and corn stover within 12days, respectively. In merely two days, the fungus selectively degraded wheat straw lignin by 37%, with only limited cellulose degradation (13%). Fourier transform infrared spectroscopy revealed that the fungus most effectively degraded the wheat straw lignin and rice straw crystalline cellulose. Scanning electronic microscopy showed the most pronounced structural changes in wheat straw. High activities of manganese peroxidase (159.0U/mL) and lignin peroxidase (123.4U/mL) were observed in wheat straw culture on Day 2 and 4, respectively. Rice straw was the best substrate to induce the production of cellulase and xylanase. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lignocellulose pretreatment in a fungus-cultivating termite

DOE PAGES

Li, Hongjie; Yelle, Daniel J.; Li, Chang; ...

2017-04-19

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less

Mathematical modeling on obligate mutualism: Interactions between leaf-cutter ants and their fungus garden.

PubMed

Kang, Yun; Clark, Rebecca; Makiyama, Michael; Fewell, Jennifer

2011-11-21

We propose a simple mathematical model by applying Michaelis-Menton equations of enzyme kinetics to study the mutualistic interaction between the leaf cutter ant and its fungus garden at the early stage of colony expansion. We derive sufficient conditions on the extinction and coexistence of these two species. In addition, we give a region of initial condition that leads to the extinction of two species when the model has an interior attractor. Our global analysis indicates that the division of labor by worker ants and initial conditions are two important factors that determine whether leaf cutter ants' colonies and their fungus garden can survive and grow or not. We validate the model by comparing model simulations and data on fungal and ant colony growth rates under laboratory conditions. We perform sensitive analysis of the model based on the experimental data to gain more biological insights on ecological interactions between leaf-cutter ants and their fungus garden. Finally, we give conclusions and discuss potential future work. Published by Elsevier Ltd.

Biotransformation of ginsenoside Rb1 to ginsenoside C-K by endophytic fungus Arthrinium sp. GE 17-18 isolated from Panax ginseng.

PubMed

Fu, Y; Yin, Z-H; Wu, L-P; Yin, C-R

2016-09-01

This research aimed to isolate β-glycosidase-producing endophytic fungus in Panax ginseng to achieve biotransformation of ginsenoside Rb1 to ginsenoside C-K. Of these 15 β-glucosidase-producing endophytic fungus isolated from ginseng roots, a β-glucosidase-producing endophytic fungi GE 17-18 could hydrolyse major ginsenosides Rb1 to minor ginsenoside C-K with metabolic pathways: ginsenoside Rb1→ginsenoside Rd→ginsenoside F2→ginsenoside C-K. Phylogenetic analysis of ITS gene sequences indicated that the strain GE 17-18 belongs to the genus Arthrinium and is most closely related to Arthrinium sp. HQ832803.1. This is the first study to provide information of cultivable β-glycosidase-producing Endophytic fungus in Panax ginseng. The strain GE 17-18 has potential to be applied on the preparation for minor ginsenoside C-K in pharmaceutical industry. © 2016 The Society for Applied Microbiology.

Lignocellulose pretreatment in a fungus-cultivating termite

PubMed Central

Li, Hongjie; Yelle, Daniel J.; Li, Chang; Yang, Mengyi; Ke, Jing; Zhang, Ruijuan; Liu, Yu; Zhu, Na; Liang, Shiyou; Mo, Xiaochang; Currie, Cameron R.; Mo, Jianchu

2017-01-01

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid of various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation. PMID:28424249

Lignocellulose pretreatment in a fungus-cultivating termite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Hongjie; Yelle, Daniel J.; Li, Chang

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less

Fate of Residual Lignin during Delignification of Kraft Pulp by Trametes versicolor

PubMed Central

Reid, Ian D.

1998-01-01

The fungus Trametes versicolor can delignify and brighten kraft pulps. To better understand the mechanism of this biological bleaching and the by-products formed, I traced the transformation of pulp lignin during treatment with the fungus. Hardwood and softwood kraft pulps containing 14C-labelled residual lignin were prepared by laboratory pulping of lignin-labelled aspen and spruce wood and then incubated with T. versicolor. After initially polymerizing the lignin, the fungus depolymerized it to alkali-extractable forms and then to soluble forms. Most of the labelled carbon accumulated in the water-soluble pool. The extractable and soluble products were oligomeric; single-ring aromatic products were not detected. The mineralization of the lignin carbon to CO2 varied between experiments, up to 22% in the most vigorous cultures. The activities of the known enzymes laccase and manganese peroxidase did not account for all of the lignin degradation that took place in the T. versicolor cultures. This fungus may produce additional enzymes that could be useful in enzyme bleaching systems. PMID:9603823

Epiphytic lichen mycota of the virgin forest reserve Rajhenavski Rog (Slovenia)

PubMed Central

Bilovitz, Peter O.; Batič, Franc; Mayrhofer, Helmut

2012-01-01

A list of 128 taxa (127 species) of lichens, 6 species of lichenicolous fungi and 2 non-lichenized fungi traditionally included in lichenological literature from the virgin forest Rajhenavski Rog and its surroundings in the southeastern part of Slovenia is presented. The lichen Gyalecta derivata, the lichenicolous fungus Homostegia piggotii, and the non-lichenized fungus Mycomicrothelia pachnea are new to Slovenia. The lichenized fungi Chaenotheca trichialis, C. xyloxena, Lecanactis abietina, Lecanora thysanophora, Pertusaria ophthalmiza, the lichenicolous fungi Monodictys epilepraria, Tremella hypogymniae, Taeniolella friesii, and the non-lichenized fungus Chaenothecopsis pusilla are new to the Dinaric phytogeographical region of Slovenia. PMID:22942459

Intersporal Genetic Variation of Gigaspora margarita, a Vesicular Arbuscular Mycorrhizal Fungus, Revealed by M13 Minisatellite-Primed PCR.

PubMed

Zeze, A; Sulistyowati, E; Ophel-Keller, K; Barker, S; Smith, S

1997-02-01

Spores of vesicular arbuscular mycorrhizal (VAM) fungi contain thousands of nuclei. In order to understand the karyotic structure of a VAM fungus spore, the genetic variation of the first generation of spores from a VAM fungus (Gigaspora margarita) was examined. Spores originating from both single- and multispore inoculations of the species G. margarita were analyzed by M13 minisatellite-primed PCR. In both cases, different fingerprints were obtained from individual spores with few spores exhibiting similar fingerprints. These results can be explained only by a heterokaryotic status of the nuclear population within a spore.

Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

NASA Astrophysics Data System (ADS)

Matsuura, Shu; Miyazima, Sasuke

Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

PubMed

Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

2008-06-01

The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

Pestalotiopamide E, a new amide from the endophytic fungus Pestalotiopsis sp.

PubMed

Xu, Jing; Lin, Qiang; Wang, Bin; Wray, Victor; Lin, Wen-Han; Proksch, Peter

2011-04-01

Chemical examination of the endophytic fungus Pestalotiopsis sp., isolated from the leaves of the Chinese mangrove Rhizophora mucronata, yielded a new amide called pestalotiopamide E (1). The structure of the new compound was unambiguously elucidated on the basis of extensive spectroscopic data analysis.

Development of a greenhouse-based inoculation protocol for the fungus Colletotrichum cereale pathogenic to annual bluegrass (Poa annua)

USDA-ARS?s Scientific Manuscript database

The fungus Colletotrichum cereale incites anthracnose disease on Poa annua (annual bluegrass) turfgrass. Anthracnose disease is geographically widespread highly destructive, with infections by C. cereale resulting in extensive turfgrass loss. Comprehensive research aimed at controlling turfgrass a...

An in vivo transcriptome for entomopathogenic fungus Metarhizium robertsii ARSEF 2575

USDA-ARS?s Scientific Manuscript database

Molecular mechanisms underlying the pathogenic process of the insect pathogen Metarhizium robertsii ARSEF 2575 in its host are only partially understood. To probe the transcriptional responses of the fungus during the interaction with insects, we have developed a method to specifically recover patho...

Strategies for durable resistance to the grapevine powdery mildew fungus, Erysiphe necator

USDA-ARS?s Scientific Manuscript database

Nearly all cultivars of Vitis vinifera are highly susceptible to the grapevine powdery mildew fungus, Erysiphe necator. Grape breeders around the world are working to introgress resistance from wild Vitis. Of the widely-used introgressions, most involve dominant, race-specific resistance phenotype...

Protection against common bean rust conferred by a gene silencing method

USDA-ARS?s Scientific Manuscript database

Rust disease of the dry bean plant, Phaseolus vulgaris, is caused by the fungus Uromyces appendiculatus. The fungus acquires its nutrients and energy from bean leaves using a specialized cell structure, the haustorium, through which it secretes effector proteins that contribute to pathogenicity by ...

Draft genome sequence of a monokaryotic model brown-rot fungus Postia (Rhodonia) placenta SB12

Treesearch

Jill Gaskell; Phil Kersten; Luis F. Larrondo; Paulo Canessa; Diego Martinez; David Hibbett; Monika Schmoll; Christian P. Kubicek; Angel T. Martinez; Jagjit Yadav; Emma Master; Jon Karl Magnuson; Debbie Yaver; Randy Berka; Kathleen Lail; Cindy Chen; Kurt LaButti; Matt Nolan; Anna Lipzen; Andrea Aerts; Robert Riley; Kerrie Barry; Bernard Henrissat; Robert Blanchette; Igor V. Grigoriev; Dan Cullen

2017-01-01

We report the genome of Postia (Rhodonia) placenta MAD-SB12, a homokaryotic wood decay fungus (Basidiomycota, Polyporales). Intensively studied as a representative brown rot decayer, the gene complement is consistent with the rapid depolymerization of cellulose but not lignin.

Biological pretreatment of corn stover with white-rot fungus for improved enzymatic hydrolysis

USDA-ARS?s Scientific Manuscript database

Biological pretreatment of lignocellulosic biomass by white-rot fungus can represent a low-cost and eco-friendly alternative to harsh physical, chemical or physico-chemical pretreatment methods to facilitate enzymatic hydrolysis. However, fungal pretreatment can cause carbohydrate loss and it is, th...

Sirococcus Shoot Blight

Treesearch

Thomas H. Nicholls; Kathryn Robbins

1984-01-01

Sirococcus shoot blight, caused by the fungus Sirococcus strobilinus Preuss, affects conifers in the Northern United States and southern Canada. The fungus infects the new shoots; diseased seedlings and saplings are especially affected. In the United States, sirococcus shoot blight has become increasingly widespread since the early 1970's. When favorable...

Compatibility of the insect pathogenic fungus Beauveria bassiana with neem against sweetpotato whitefly, Bemisia tabaci, on eggplant

USDA-ARS?s Scientific Manuscript database

A study on the compatibility of the entomopathogenic fungus Beauveria bassiana (Balsamo) Vuillemin (Ascomycota: Hypocreales) with neem was conducted against sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), on eggplant. Initially, three concentrations of B. bassiana (106, 1...

Suppression of aflatoxin production in Aspergillus species by selected peanut (Arachis hypogaea) stilbenoids

USDA-ARS?s Scientific Manuscript database

Aspergillus (A.) flavus is a soil fungus that commonly invades peanut seeds and often produces the carcinogenic aflatoxins. Under favorable conditions, the fungus-challenged peanut plant produces and accumulates resveratrol and its prenylated derivatives in response to such invasion. These prenylate...

Advances in molecular and genomic research to safeguard food and feed supply from aflatoxin contamination

USDA-ARS?s Scientific Manuscript database

Worldwide recognition that aflatoxin contamination of agricultural commodities by the fungus Aspergillus flavus is a global problem which has significantly benefitted from global collaboration for understanding the contaminating fungus as well as for developing and implementing solutions against the...

Wood decay fungus Flavodon ambrosius (Basidiomycota: Polyporales) is widely farmed by two genera of ambrosia beetles

Treesearch

You Li; Craig Christopher Bateman; James Skelton; Michelle Alice Jusino; Zachary John Nolen; David Rabern Simmons; Jiri Hulcr

2017-01-01

The ambrosia fungus Flavodon ambrosius is the primary nutritional mutualist of ambrosia beetles Ambrosiodmus and Ambrosiophilus in North America. F. ambrosius is the only known ambrosial basidiomycete, unique in its efficient lignocellulose degradation. F. ambrosius is associated with...

Intercontinental divergence in the Populus-associated ectomycorrhizal fungus, Tricholoma populinum

Treesearch

L.C. Grubisha; N. Levsen; M.S. Olson; D.L. Taylor

2012-01-01

The ectomycorrhizal fungus Tricholoma populinum is host-specific with Populus species. T. populinum has wind-dispersed progagules and may be capable of long-distance dispersal. In this study, we tested the hypothesis of a panmictic population between Scandinavia and North America. DNA sequences from five...

Neem oil increases the efficiency of the entomopathogenic fungus Metarhizium anisopliae for the control of Aedes aegypti (Diptera: Culicidae) larvae.

PubMed

Gomes, Simone A; Paula, Adriano R; Ribeiro, Anderson; Moraes, Catia O P; Santos, Jonathan W A B; Silva, Carlos P; Samuels, Richard I

2015-12-30

Entomopathogenic fungi are potential candidates for use in integrated vector management and many isolates are compatible with synthetic and natural insecticides. Neem oil was tested separately and in combination with the entomopathogenic fungus Metarhizium anisopliae against larvae of the dengue vector Aedes aegypti. Our aim was to increase the effectiveness of the fungus for the control of larval mosquito populations. Commercially available neem oil was used at concentrations ranging from 0.0001 to 1%. Larval survival rates were monitored over a 7 day period following exposure to neem. The virulence of the fungus M. anisopliae was confirmed using five conidial concentrations (1 × 10(5) to 1 × 10(9) conidia mL(-1)) and survival monitored over 7 days. Two concentrations of fungal conidia were then tested together with neem (0.001%). Survival curve comparisons were carried out using the Log-rank test and end-point survival rates were compared using one-way ANOVA. 1% neem was toxic to A. aegypti larvae reducing survival to 18% with S50 of 2 days. Neem had no effect on conidial germination or fungal vegetative growth in vitro. Larval survival rates were reduced to 24% (S50 = 3 days) when using 1 × 10(9) conidia mL(-1). Using 1 × 10(8) conidia mL(-1), 30% survival (S50 = 3 days) was observed. We tested a "sub-lethal" neem concentration (0.001%) together with these concentrations of conidia. For combinations of neem + fungus, the survival rates were significantly lower than the survival rates seen for fungus alone or for neem alone. Using a combination of 1 × 10(7) conidia mL(-1) + neem (0.001%), the survival rates were 36%, whereas exposure to the fungus alone resulted in 74% survival and exposure to neem alone resulted in 78% survival. When using 1 × 10(8) conidia mL(-1), the survival curves were modified, with a combination of the fungus + neem resulting in 12% survival, whilst the fungus alone at this concentration also significantly reduced survival rates (28%). The use of adjuvants is an important strategy for maintaining/increasing fungal virulence and/or shelf-life. The addition of neem to conidial suspensions improved virulence, significantly reducing larval survival times and percentages.

Fungal Production and Manipulation of Plant Hormones.

PubMed

Fonseca, Sandra; Radhakrishnan, Dhanya; Prasad, Kalika; Chini, Andrea

2018-01-01

Living organisms are part of a highly interconnected web of interactions, characterised by species nurturing, competing, parasitizing and preying on one another. Plants have evolved cooperative as well as defensive strategies to interact with neighbour organisms. Among these, the plant-fungus associations are very diverse, ranging from pathogenic to mutualistic. Our current knowledge of plant-fungus interactions suggests a sophisticated coevolution to ensure dynamic plant responses to evolving fungal mutualistic/pathogenic strategies. The plant-fungus communication relies on a rich chemical language. To manipulate the plant defence mechanisms, fungi produce and secrete several classes of biomolecules, whose modeof- action is largely unknown. Upon perception of the fungi, plants produce phytohormones and a battery of secondary metabolites that serve as defence mechanism against invaders or to promote mutualistic associations. These mutualistic chemical signals can be co-opted by pathogenic fungi for their own benefit. Among the plant molecules regulating plant-fungus interaction, phytohormones play a critical role since they modulate various aspects of plant development, defences and stress responses. Intriguingly, fungi can also produce phytohormones, although the actual role of fungalproduced phytohormones in plant-fungus interactions is poorly understood. Here, we discuss the recent advances in fungal production of phytohormone, their putative role as endogenous fungal signals and how fungi manipulate plant hormone balance to their benefits. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

De novo genome assembly of the soil-borne fungus and tomato pathogen Pyrenochaeta lycopersici

PubMed Central

2014-01-01

Background Pyrenochaeta lycopersici is a soil-dwelling ascomycete pathogen that causes corky root rot disease in tomato (Solanum lycopersicum) and other Solanaceous crops, reducing fruit yields by up to 75%. Fungal pathogens that infect roots receive less attention than those infecting the aerial parts of crops despite their significant impact on plant growth and fruit production. Results We assembled a 54.9Mb P. lycopersici draft genome sequence based on Illumina short reads, and annotated approximately 17,000 genes. The P. lycopersici genome is closely related to hemibiotrophs and necrotrophs, in agreement with the phenotypic characteristics of the fungus and its lifestyle. Several gene families related to host–pathogen interactions are strongly represented, including those responsible for nutrient absorption, the detoxification of fungicides and plant cell wall degradation, the latter confirming that much of the genome is devoted to the pathogenic activity of the fungus. We did not find a MAT gene, which is consistent with the classification of P. lycopersici as an imperfect fungus, but we observed a significant expansion of the gene families associated with heterokaryon incompatibility (HI). Conclusions The P. lycopersici draft genome sequence provided insight into the molecular and genetic basis of the fungal lifestyle, characterizing previously unknown pathogenic behaviors and defining strategies that allow this asexual fungus to increase genetic diversity and to acquire new pathogenic traits. PMID:24767544

Fungus-Farming Termites Selectively Bury Weedy Fungi that Smell Different from Crop Fungi.

PubMed

Katariya, Lakshya; Ramesh, Priya B; Gopalappa, Thejashwini; Desireddy, Sathish; Bessière, Jean-Marie; Borges, Renee M

2017-10-01

Mutualistic associations such as the fungal farms of insects are prone to parasitism and are consequently vulnerable to attack by weeds and pests. Therefore, efficient farm management requires quick detection of weeds for their elimination. Furthermore, if the available weedicides are non-specific, then the ability of insects to discriminate between crop and weeds becomes essential for targeted application of such compounds. Here, we demonstrate for the first time in fungus-farming insects, that worker castes of the fungus-growing termite Odontotermes obesus discriminate between their crop (Termitomyces) and the weedy (Pseudoxylaria) fungi, even if exposed to only fungal scents. Termites respond to the presence of fungal mycelium or scent alone, by burying the weed with the offered material such as soil or agar, possibly anointing the weed with chemicals in the process. The scent profiles of crop and weedy fungi are distinct and the differences are likely exploited by termites to selectively mount their defences. Sesquiterpene compounds such as aristolene and viridiflorol, which are absent from crop odours, may constitute the "weedy scent". Our results provide a general mechanism of how other fungus-farming insects could avoid indiscriminate application of non-specific fungicides which could lead to poisoning their crops, and have bearing on the stability of the mutualism between termites and their crop fungus in the face of parasitism by weedy fungi.

Molecular Genetics of Beauveria bassiana Infection of Insects.

PubMed

Ortiz-Urquiza, A; Keyhani, N O

2016-01-01

Research on the insect pathogenic filamentous fungus, Beauveria bassiana has witnessed significant growth in recent years from mainly physiological studies related to its insect biological control potential, to addressing fundamental questions regarding the underlying molecular mechanisms of fungal development and virulence. This has been in part due to a confluence of robust genetic tools and genomic resources for the fungus, and recognition of expanded ecological interactions with which the fungus engages. Beauveria bassiana is a broad host range insect pathogen that has the ability to form intimate symbiotic relationships with plants. Indeed, there is an increasing realization that the latter may be the predominant environmental interaction in which the fungus participates, and that insect parasitism may be an opportunist lifestyle evolved due to the carbon- and nitrogen-rich resources present in insect bodies. Here, we will review progress on the molecular genetics of B. bassiana, which has largely been directed toward identifying genetic pathways involved in stress response and virulence assumed to have practical applications in improving the insect control potential of the fungus. Important strides have also been made in understanding aspects of B. bassiana development. Finally, although increasingly apparent in a number of studies, there is a need for progressing beyond phenotypic mutant characterization to sufficiently investigate the molecular mechanisms underlying B. bassiana's unique and diverse lifestyles as saprophyte, insect pathogen, and plant mutualist. Copyright © 2016 Elsevier Inc. All rights reserved.

Preliminary data on growth and enzymatic abilities of soil fungus Humicolopsis cephalosporioides at different incubation temperatures.

PubMed

Elíades, Lorena Alejandra; Cabello, Marta N; Pancotto, Verónica; Moretto, Alicia; Rago, María Melisa; Saparrat, Mario C N

2015-01-01

Nothofagus pumilio (Poepp & Endl.) Krasser, known as "lenga" is the most important timber wood species in southernmost Patagonia (Argentina). Humicolopsis cephalosporioides Cabral & Marchand is a soil fungus associated with Nothofagus pumilio forests, which has outstanding cellulolytic activity. However, there is no information about the ability of this fungus to use organic substrates other than cellulose, and its ability to produce different enzyme systems, as well as its response to temperature. The aim of this study was to examine the role of H. cephalosporioides in degradation processes in N. pumilio forests in detail by evaluating the in vitro ability of four isolates of this fungus to grow and produce different lytic enzyme systems, and their response to incubation temperature. The ability of the fungi to grow and produce enzyme systems was estimated by inoculating them on agar media with specific substrates, and the cultures were incubated at three temperatures. A differential behavior of each strain in levels of growth and enzyme activity was found according to the medium type and/or incubation temperature. A intra-specific variability was found in H. cephalosporioides. Likewise a possible link between the saprotrophic role of this fungus in N. pumilio forests and the degradation of organic matter under stress conditions, such as those from frosty environments, was also discussed. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

A nonpathogenic Fusarium oxysporum strain enhances phytoextraction of heavy metals by the hyperaccumulator Sedum alfredii Hance.

PubMed

Zhang, Xincheng; Lin, Li; Chen, Mingyue; Zhu, Zhiqiang; Yang, Weidong; Chen, Bao; Yang, Xiaoe; An, Qianli

2012-08-30

Low biomass and shallow root systems limit the application of heavy metal phytoextraction by hyperaccumulators. Plant growth-promoting microbes may enhance hyperaccumulators'phytoextraction. A heavy metal-resistant fungus belonged to the Fusarium oxysporum complex was isolated from the Zn/Cd co-hyperaccumulator Sedum alfredii Hance grown in a Pb/Zn mined area. This Fusarium fungus was not pathogenic to plants but promoted host growth. Hydroponic experiments showed that 500 μM Zn(2+) or 50 μM Cd(2+) combined with the fungus increased root length, branches, and surface areas, enhanced nutrient uptake and chlorophyll synthesis, leading to more vigorous hyperaccumulators with greater root systems. Soil experiments showed that the fungus increased root and shoot biomass and S. alfredii-mediated heavy metal availabilities, uptake, translocation or concentrations, and thus increased phytoextraction of Zn (144% and 44%), Cd (139% and 55%), Pb (84% and 85%) and Cu (63% and 77%) from the original Pb/Zn mined soil and a multi-metal contaminated paddy soil. Together, the nonpathogenic Fusarium fungus was able to increase S. alfredii root systems and function, metal availability and accumulation, plant biomass, and thus phytoextraction efficiency. This study showed a great application potential for culturable indigenous fungi other than symbiotic mycorrhizas to enhance the phytoextraction by hyperaccumulators. Copyright © 2012 Elsevier B.V. All rights reserved.

Penicillium sp. as an organism that degrades endosulfan and reduces its genotoxic effects.

PubMed

Romero-Aguilar, Mariana; Tovar-Sánchez, Efrain; Sánchez-Salinas, Enrique; Mussali-Galante, Patricia; Sánchez-Meza, Juan Carlos; Castrejón-Godínez, María Luisa; Dantán-González, Edgar; Trujillo-Vera, Miguel Ángel; Ortiz-Hernández, Ma Laura

2014-01-01

Endosulfan is an organochloride and persistent pesticide that has caused concern because of its impact in the environment and its toxicity to and bioaccumulation in living organisms. In this study, we isolated an endosulfan-degrading fungus from the activated sludge from an industrial wastewater treatment plant. Through repetitive enrichment and successive subculture in media containing endosulfan as the sole carbon source, a fungus designated CHE 23 was isolated. Based on a phylogenetic analysis, strain CHE 23 was assigned to the genus Penicillium sp. In a mineral salt medium with 50 mg/l endosulfan as the sole source carbon, CHE 23 removed the added endosulfan in a period of six days. To verify the decrease in endosulfan toxicity due to the activity of the fungus, we performed genotoxicity tests trough the single cell gel electrophoresis assay or comet assay, with Eisenia fetida as the bioindicator species. This organism was exposed to the supernatants of the culture of the fungus and endosulfan. Our results indicated that the genotoxicity of endosulfan was completely reduced due the activity of this fungus. These results suggest that the Penicillium sp. CHE 23 strain can be used to degrade endosulfan residues and/or for water and soil bioremediation processes without causing toxicity problems, which are probably due to the generation of no-toxic metabolites during biodegradation.

Benzyl Derivatives with in Vitro Binding Affinity for Human Opioid Receptors and Cannabinoid Receptors from the Fungus Eurotium repens

USDA-ARS?s Scientific Manuscript database

Bioassay-guided fractionation of the fungus Eurotium repens resulted in the isolation of two benzyl derivatives, repenol A (1) and repenol B (2). Seven known secondary metabolites were also isolated including five benzaldehyde compounds, flavoglaucin (3), tetrahydroauroglaucin (4), dihydroauroglauci...

Influence of Procerum Root Disease on the Water Relations of Eastern White Pine (Pinus strobus L.)

Treesearch

J.R. Butnor; J.R. Seiler; J.A. Gray

2000-01-01

Procerum root disease (PRD) is caused by the deuteromycete fungus Leptogruphium procerum (Kendr.) Wingf, formerly Verticic ladiella procera (Kendr.) and is most commonly isolated from Pinus sp. L., though the fungus has been isolated from other conifer species including Fraser fir (Abies fraseri...

Curvularin and dehydrocurvularin as phytotoxic constituents from curvularia intermedia infecting pandanus amaryllifolius

USDA-ARS?s Scientific Manuscript database

Microbes are good sources of biologically active compounds that can be used as pharmaceuticals and agrochemicals. As part of our continuous efforts in search for biopesticides from natural sources, a fungus was isolated from leaves of Pandanus amaryllifolius that showed severe necrosis. This fungus ...

TREATMENT OF A PENTACHLOROPHENOL AND CREOSOTE-CONTAMINATED SOIL USING THE LIGNIN-DEGRADING FUNGUS PHANERO- CHAETE SORDIDA: A FIELD DEMONSTRATION

EPA Science Inventory

The feasibility of large-scale fungal bioaugmentation was evaluated by assessing the ability of the lignin-degrading fungus Phanerochaete sordida to decrease the soil concentrations of pentachlorophenol (PCP) and 13 priority pollutant polynuclear aromatic (PNA) creosote component...

Fungus Amongus

ERIC Educational Resources Information Center

Wakeley, Deidra

2005-01-01

This role-playing simulation is designed to help teach middle level students about the typical lifecycle of a fungus. In this interactive simulation, students assume the roles of fungi, spores, living and dead organisms, bacteria, and rain. As they move around a playing field collecting food and water chips, they discover how the organisms…

Using enzymes and microorganisms to modify the mycotoxin deoxynivalenol

USDA-ARS?s Scientific Manuscript database

Deoxynivalenol (DON) is a trichothecene mycotoxin produced by the fungus Fusarium graminearum that contaminates staple crops such as wheat, barley, and maize when they are infected with this fungus. New strategies are needed to mitigate DON. We screened for microbes that could grow in the presence o...

Comparative genomic analysis in the fungus Fusarium for production of toxins of concern to food safety

USDA-ARS?s Scientific Manuscript database

SUMMARY Comparative analysis of 207 genomes representing 159 species of the fungus Fusarium detected 9403 known and putative secondary metabolite (SM) biosynthetic gene clusters. The clusters included those responsible for synthesis of mycotoxins, plant hormones and pigments, and varied in distribut...

The Impact of Culture Age, Aeration, and Agitation on the Production of Microsclerotia of the Entomopathogenic Fungus Metarhizium anisopliae Using 100-Liter Fermentors

USDA-ARS?s Scientific Manuscript database

Microsclerotia are desiccation-tolerant, compact hyphal aggregates produced by numerous fungi as overwintering structures. We recently discovered that the entomopathogenic fungus Metarhizium anisopliae produced microsclerotia during liquid culture fermentation. When air-dried microsclerotial granu...

Wood-decay abilities of grapevine trunk pathogens Diaporthe ampelina, Diplodia seriata, Eutypa lata, and Neofusicoccum parvum

USDA-ARS?s Scientific Manuscript database

Trunk pathogens are fungi that infect grapevine wood through pruning wounds and destroy fruiting positions, thereby impacting grape production. Neofusicoccum parvum (causal fungus of Botryosphaeria dieback) and Eutypa lata (causal fungus of Eutypa dieback) cause chronic infections (cankers) of the t...

A small cysteine-rich protein from the Asian soybean rust fungus, Phakopsora pachyrhizi, suppresses plant immunity

USDA-ARS?s Scientific Manuscript database

The Asian soybean rust fungus, Phakopsora pachyrhizi, is an obligate pathogen capable of causing explosive disease epidemics that drastically reduce the yield of soybean (Glycine max). Currently, the molecular mechanisms by which P. pachyrhizi and other rust fungi cause disease are poorly understood...

Copper sulfate controls fungus on mat-spawned largemouth bass eggs

USDA-ARS?s Scientific Manuscript database

Copper sulfate (CuSO4) is widely used by the catfish and hybrid striped bass industries as an economical treatment to control fungus (Saprolegnia spp.) on eggs; these industries use hatching troughs and McDonald jars, respectively, in moderate alkalinity waters. This study determined the effectivene...

Report membrane transport of lactic acid in the filamentous fungus Rhizopus

USDA-ARS?s Scientific Manuscript database

The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

Analysis of a Functional Lactate Permease in the Fungus Rhizopus

USDA-ARS?s Scientific Manuscript database

The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

Cold Tolerance of Pityophthorus juglandis (Coleoptera: Scolytidae) From Northern California

Treesearch

Andrea R. Hefty; Steven J. Seybold; Brian H. Aukema; Robert C. Venette

2017-01-01

Winter survivorship of insects is determined by a combination of physiological, behavioral, and microhabitat characteristics. We characterized the cold tolerance of the walnut twig beetle, Pityophthorus juglandis Blackman, a domestic alien invasive bark beetle that vectors a phytopathogenic fungus. The beetle and fungus cause thousand cankers...

Cellular development associated with induced secondary metabolism in the filamentous fungus Fusarium graminearum

USDA-ARS?s Scientific Manuscript database

Several species of the filamentous fungus Fusarium colonize plants and produce toxic small molecules that contaminate agricultural products, rendering them unsuitable for consumption. Among the most destructive of these species is F. graminearum, which causes disease in wheat and barley and often in...

Effect of biochar soil-amendments on Allium porrum growth, arbuscular mycorrhizal fungus colonization

USDA-ARS?s Scientific Manuscript database

Aims: Examine the interaction of biochar addition and arbuscular mycorrhizal [AM] fungus inoculation upon growth and Zn and Cu uptake by Allium porrum L. in heavy metal amended soil mix, and relate these responses to physicochemical properties of the biochars. Methods: The experiment was a complete ...

Black Stain Root Disease of Conifers (FIDL)

Treesearch

Paul F. Hessburg; Donald J. Goheen; Robert V. Bega

1995-01-01

The black stain fungus?Leptographium wageneri (Kendrick) Wingfield*?infects and kills several species of western conifers. The fungus colonizes water-conducting tissues of the host's roots, root collars, and lower stems, ultimately blocking the movement of water to foliage. Severely infected trees exhibit wilting symptoms characteristic of vascular wilt diseases...

Differential gene expression during conidiation in the grape powdery mildew fungus, Erysiphe necator

USDA-ARS?s Scientific Manuscript database

Asexual sporulation (conidiation) is coordinately regulated in the grape powdery mildew fungus Erysiphe necator, but nothing is known about its genetic regulation. We hypothesized that genes required for conidiation in other fungi would be up-regulated at conidiophore initiation and/or full conidia...

Isolation and identification of nematode-antagonistic compounds from the fungus Aspergillus candidus

USDA-ARS?s Scientific Manuscript database

An isolate of the fungus Aspergillus candidus was tested for production of nematicidal compounds. Adults of the nematode Ditylenchus destructor were completely inactive after 24 hr exposure to soy medium in which A. candidus was cultured. Column, thin layer and preparative chromatographies, and spec...

Development of molecular markers for breeding for disease resistant crops

USDA-ARS?s Scientific Manuscript database

Rice blast disease caused by the filamentous ascomycetes fungus Magnaporthe oryzae and sheath blight disease caused by the soil borne fungus Rhizocotonia solani are the two major rice diseases that threaten stable rice production in the USA and worldwide. These two diseases have been managed with a ...

Polymorphic sequence-characterized codominant loci in the chestnut blight fungus, Cryphonectria parasitica

Treesearch

J. E. Davis; Thomas L. Kubisiak; M. G. Milgroom

2005-01-01

Studies on the population biology of the chestnut blight fungus, Cryphonectria parasitica, have previously been carried out with dominant restriction fragment length polymorphism (RFLP) fingerprinting markers. In this study, we described the development of 11 condominant markers from randomly amplified polymorphic DNAs (RAPDs). RAPD fragments were...

Secondary metabolites produced by solid fermentation of the marine-derived fungus Penicillium commune QSD-17.

PubMed

Gao, Shu-Shan; Shang, Zhuo; Li, Xiao-Ming; Li, Chun-Shun; Cui, Chuan-Ming; Wang, Bin-Gui

2012-01-01

The marine sediment-derived fungus Penicillium commune QSD-17 was re-investigated and cultured on rice solid medium. Two new compounds, isophomenone (1) and 3-deacetylcitreohybridonol (2), together with seven known derivatives (3-9), were identified. Their structures were determined by spectroscopic analysis.

Metacridamides A and B, bioactive macrocycles from conidia of the entomopathogenic fungus Metarhizium acridum

USDA-ARS?s Scientific Manuscript database

Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. Its conidia produce two novel 17-membered macrocycles, metacridamides A (1) and B (2), which consist of a Phe unit condensed with a nonaketide....

Confirming QTL for aflatoxin resistance from Mp313E in different genetic backgrounds

USDA-ARS?s Scientific Manuscript database

The fungus Aspergillus flavus (Link:Fr) causes ear rot of maize (Zea mays L.) and produces the toxic metabolic product aflatoxin. One particularly effective method to control the fungus is via host plant resistance, but while several resistant breeding lines have been identified, transferring the r...

Meroterpenoids with antiproliferative activity from a Hawaiian-plant associated fungus Peyronellaea coffeae-arabicae FT238

USDA-ARS?s Scientific Manuscript database

Three unusual polyketide-sesquiterpene metabolites peyronellins A-C (1-3), along with the new epoxyphomalin analog 11-dehydroxy epoxyphomalin A (4), have been isolated from the endophytic fungus Peyronellaea cof feae-arabicae FT238, which was isolated from the native Hawaiian plant Pritchardia lowre...

OXIDATION OF PERSISTANT ENVIRONMENTAL POLLUTANTS BY A WHITE ROT FUNGUS

EPA Science Inventory

The white rot fungus Phanerochaete chrysosporium degraded DDT [1,1,-bis(4-chlorophenyl)-2,2,2-trichloroethane], 3,4,3',4'-tetrachlorobiphenyl, 2,4,5,2',-4',5'-hexachlorobiphenyl, 2,3,7,8-tetrachlorodibenzo-p-dioxin, lindane (1,2,3,4,5,6-hexachlorocylohexane), and benzo[a]pyrene t...

Integrated genomic and transcriptomic analysis reveals mycoparasitism as the ancestoral life style of Trichoderma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kubicek, Christian P.; Herrera-Estrella, Alfredo; Seidl, Verena

2011-04-29

Mycoparasitism, a lifestyle where one fungus is parasitic on another fungus has special relevance when the prey is a plant pathogen, providing a strategy for biological control of pests for plant protection. Probably, the most studied biocontrol agents are species of the genus Hypocrea/Trichoderma.

Diseases of pines caused by the pitch canker fungus

Treesearch

L. David Dwinell; Stephen W. Fraedrich; D. Adams

2001-01-01

Fusarium subglutinans f. sp. pini, the pitch canker fungus, causes a number of serious diseases of Pinus species. The pathogen infects a variety of vegetative and reproductive pine structures at different stages of maturity and produces a diversity of symptoms. When the pathogen infects the woody vegetative...

Temperature determines symbiont abundance in a multipartite bark beetle-fungus ectosymbiosis

Treesearch

D. L. Six; B. J. Bentz

2007-01-01

In this study, we report evidence that temperature plays a key role in determining the relative abundance of two mutualistic fungi associated with an economically and ecologically important bark beetle, Dendroctonus ponderosae. The symbiotic fungi possess different optimal temperature ranges. These differences determine which fungus is vectored by...

TESTING OF THE INSECT PEST CONTROL FUNGUS BEAUVERIA BASSIANA IN GRASS SHRIMP PALAEMONETES PUGIO

EPA Science Inventory

Embryos, larvae and adult grass shrimp Palaemonetes pugio were exposed to spores of the insect-control fungus Beauveria bassiana. onidiospores attached to embryos held by gravid females and remained with the egg mass for at least 6 d. In the first experiment where individual deve...

78 FR 69817 - Certain Preserved Mushrooms From the People's Republic of China: Preliminary Results and...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-21

... Enforcement and Compliance, ``Deadlines Affected by the Shutdown of the Federal Government'' (October 18, 2013...) Fujian Pinghe Baofeng Canned Foods; (6) Fujian Yuxing Fruits and Vegetables Foodstuffs Development Co...) Shandong Fengyu Edible Fungus Corporation Ltd.; (13) Shandong Jiufa Edible Fungus Corporation, Ltd.; (14...

First report of Pantoea ananatis (Syn. Erwinia uredovora) being associated with peanut rust in Georgia

USDA-ARS?s Scientific Manuscript database

Peanut rust is caused by the fungus Puccinia arachidis. This disease, if not treated can cause severe damage and defoliation. While sequencing DNA of urediniospores of the rust fungus, BLAST analysis detected many sequences corresponding to the bacterial species Pantoea ananatis. This bacterium, ...

Trouble in the aquatic world: how wildlife professionals are battling amphibian declines

Treesearch

Deanna H. Olson; Tara Chestnut

2014-01-01

Aparasitic fungus, similar to the one that caused the extinction of numerous tropical frog and toad species, is killing salamanders in Europe. Scientists first identified the fungus, Batrachochytrium salamandrivorans, in 2013 as the culprit behind the death of fire salamanders (Salamandra salamandra) in the Netherlands (Martel...

Scleroderris Canker of Northern Conifers

Treesearch

Darroll D. Skilling; James T. O' Brien; James A. Bell

1979-01-01

Scleroderris canker, caused by the fungus Gremmeniella abietina-Scleroderris lagerbergii (Lagerb.) Morelet, has caused extensive mortality in conifer plantations and forest nurseries in the northeast and north central United States and eastern Canada. Two strains of the fungus are known in North America. The Lake States strain, present throughout northeastern North...

The fungus Ustilago maydis, from the aztec cuisine to the research laboratory.

PubMed

Ruiz-Herrera, J; Martínez-Espinoza, A D

1998-06-01

Ustilago maydis is a plant pathogen fungus responsible for corn smut. It has a complex life cycle. In its saprophitic stage, it grows as haploid yeast cells, while in the invasive stage it grows as a mycelium formed by diploid cells. Thus, a correlation exists between genetic ploidy, pathogenicity and morphogenesis. Dimorphism can be modulated in vitro by changing environmental parameters such as pH. Studies with auxotrophic mutants have shown that polyamines play a central role in regulating dimorphism. Molecular biology approaches are being employed for the analysis of fundamental aspects of the biology of this fungus, such as mating type regulation, dimorphism or cell wall biogenesis.

Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

PubMed

Wang, J W; Wu, J H; Huang, W Y; Tan, R X

2006-03-01

The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

Sarcoid-like lesions in Paracoccidioidomycosis: immunological factors*

PubMed Central

de Medeiros, Vanessa Lucília Silveira; Arruda, Lúcia

2013-01-01

The clinical presentation of paracoccidioidomycosis is spectral. Spontaneous cure, state of latency or active disease with different levels of severity can occur after the hematogenous dissemination. The morphology and number of skin lesions will depend on the interaction of host immunity, which is specific and individual, and fungus virulence. Some individuals have natural good immunity, which added to the low virulence of the fungus maintain the presence of well-marked granulomas with no microorganism and negative serology for a long time, making the diagnosis a challenge. Factors inherent to the fungus, however, may modulate the immune response and modify the clinical picture over the time. We present a sarcoidosis-like clinical presentation and discuss the immunological factors involved. PMID:23539015

Meroterpenoids and isoberkedienolactone from endophytic fungus Penicillium sp. associated with Dysosma versipellis.

PubMed

Li, Jun-Wei; Duan, Rui-Gang; Zou, Jian-Hua; Chen, Ri-Dao; Chen, Xiao-Guang; Dai, Jun-Gui

2014-06-01

Seven meroterpenoids and five small-molecular precursors were isolated from Penicillium sp., an endophytic fungus from Dysosma versipellis. The structures of new compounds, 11beta-acetoxyisoaustinone (1) and isoberkedienolactone (2) were elucidated based on analysis of the spectral data, and the absolute configuration of 2 was established by TDDFT ECD calculation with satisfactory match to its experimental ECD data. Meroterpenoids originated tetraketide and pentaketide precursors, resepectively, were found to be simultaneously produced in specific fungus of Penicillium species. These compounds showed weak cytotoxicity in vitro against HCT-116, HepG2, BGC-823, NCI-H1650, and A2780 cell lines with IC 50 > 10 micromol x L(-1).

Trichopeptides A and B, trichocyclodipeptides A-C, new peptides from the ascomycete fungus Stagonospora trichophoricola.

PubMed

Chen, Zhengkun; Xu, Xiuli; Ren, Jinwei; Wang, Wenzhao; Liu, Xingzhong; Li, Erwei

2017-08-01

Trichopeptides A (1) and B (2), new linear tetrapeptide and tripeptide, respectively, and three new diketopiperazines trichocyclodipeptides A-C (3-5) were isolated from the fermentation of the ascomycete fungus Stagonospora trichophoricola, a fungus isolated from the soil sample surrounding the fruiting body of Ophiocordyceps sinensis in Maqin Country, Qinghai Province, People's Republic of China. Their structures were primarily elucidated by interpretation of NMR and MS experiments. The absolute configurations of 1-5 were assigned through Marfey's method on their acid hydrolyzates. Compound 3 showed antifungal activity against Candida albicans with the IC 50 and MIC values of 22 and 90 μg ml -1 , respectively.

Study of coatings for improved fire and decay resistance of mine timbers

NASA Technical Reports Server (NTRS)

Baum, B.

1977-01-01

The purpose of this program was to find a fire- and rot-retardant polymer/fungicide reaction product for coating mine timbers. Fire-retardant polymers were screened as films and coatings on fir wood. Curable polyimide appeared to be flame retardant and evolved a minimum of fumes when exposed to a flame. Several organic and metal, low toxicity, fungicides were reacted with the polyimide in-situ on the wood. These coated samples were screened for fungus resistance. All formulations rated well - even the polyimide film without additives was fungicidal. The fir wood control itself resisted internal damage during the ten weeks of fungus exposure. A more severe test for fungus resistance will be required.

The link between rapid enigmatic amphibian decline and the globally emerging chytrid fungus.

PubMed

Lötters, Stefan; Kielgast, Jos; Bielby, Jon; Schmidtlein, Sebastian; Bosch, Jaime; Veith, Michael; Walker, Susan F; Fisher, Matthew C; Rödder, Dennis

2009-09-01

Amphibians are globally declining and approximately one-third of all species are threatened with extinction. Some of the most severe declines have occurred suddenly and for unknown reasons in apparently pristine habitats. It has been hypothesized that these "rapid enigmatic declines" are the result of a panzootic of the disease chytridiomycosis caused by globally emerging amphibian chytrid fungus. In a Species Distribution Model, we identified the potential distribution of this pathogen. Areas and species from which rapid enigmatic decline are known significantly overlap with those of highest environmental suitability to the chytrid fungus. We confirm the plausibility of a link between rapid enigmatic decline in worldwide amphibian species and epizootic chytridiomycosis.

Ramularia collo-cygni--An Emerging Pathogen of Barley Crops.

PubMed

Havis, Neil D; Brown, James K M; Clemente, Gladys; Frei, Peter; Jedryczka, Malgorzata; Kaczmarek, Joanna; Kaczmarek, Maciej; Matusinsky, Pavel; McGrann, Graham R D; Pereyra, Sylvia; Piotrowska, Marta; Sghyer, Hind; Tellier, Aurelien; Hess, Michael

2015-07-01

Ramularia collo-cygni is the biotic factor responsible for the disease Ramularia leaf spot (RLS) of barley (Hordeum vulgare). Despite having been described over 100 years ago and being considered a minor disease in some countries, the fungus is attracting interest in the scientific community as a result of the increasing number of recorded economically damaging disease epidemics. New reports of disease spread and fungal identification using molecular diagnostics have helped redefine RLS as a global disease. This review describes recent developments in our understanding of the biology and epidemiology of the fungus, outlines advances made in the field of the genetics of both the fungus and host, and summarizes the control strategies currently available.

Mode of Infection of Metarhizium spp. Fungus and Their Potential as Biological Control Agents

PubMed Central

Aw, Kimberly Moon San; Hue, Seow Mun

2017-01-01

Chemical insecticides have been commonly used to control agricultural pests, termites, and biological vectors such as mosquitoes and ticks. However, the harmful impacts of toxic chemical insecticides on the environment, the development of resistance in pests and vectors towards chemical insecticides, and public concern have driven extensive research for alternatives, especially biological control agents such as fungus and bacteria. In this review, the mode of infection of Metarhizium fungus on both terrestrial and aquatic insect larvae and how these interactions have been widely employed will be outlined. The potential uses of Metarhizium anisopliae and Metarhizium acridum biological control agents and molecular approaches to increase their virulence will be discussed. PMID:29371548

Identification and sequence determination of a new chrysovirus infecting the entomopathogenic fungus Isaria javanica.

PubMed

Herrero, Noemi

2017-04-01

A new double-stranded RNA (dsRNA) mycovirus has been identified in the isolate NB IFR-19 of the entomopathogenic fungus Isaria javanica. Isaria javanica chrysovirus-1 (IjCV-1) constitutes a new member of the Chrysoviridae family, and its genome is made up of four dsRNA elements designated dsRNA1, 2, 3 and 4 from largest to smallest. dsRNA1 and dsRNA2 encode an RNA-dependent RNA polymerase (RdRp) and a coat protein (CP), respectively. dsRNA3 and 4 encode hypothetical proteins of unknown function. IjCV-1 constitutes the first report of a chrysovirus infecting the entomopathogenic fungus Isaria javanica.

An arabinobio-hydrolase (Arb93B) from Fusarium graminearum is associated with wheat head blight disease

USDA-ARS?s Scientific Manuscript database

Fusarium head blight (FHB), caused by the fungus Fusarium graminearum, is one of the most important diseases of wheat and barley worldwide. FHB not only reduces crop yield, but the fungus also contaminates grains with mycotoxins, which are harmful to humans and animals. A previous study demonstrated...

Low prevalence of chytrid fungus (Batrachochytrium dendrobatidis) in amphibians of U.S

Treesearch

Blake R. Hossack; Michael J. Adams; Evan H. Campbell Grant; Christopher A. Pearl; James B. Bettaso; William J. Barichivich; Winsor H. Lowe; Kimberly True; Joy L. Ware; Paul Stephen Corn

2010-01-01

Many declines of amphibian populations have been associated with chytridiomycosis, a disease caused by the aquatic fungus Batrachochytrium dendrobatidis (Bd). Despite the relatively high prevalence of chytridiomycosis in stream amphibians globally, most surveys in North America have focused primarily on wetland-associated species, which are frequently infected. To...

Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

USDA-ARS?s Scientific Manuscript database

ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

Effect of sterilizing treatments on survival and growth of hybrid poplar cuttings

Treesearch

Harold F. Ford

1954-01-01

Fungus diseases of poplars might be spread to new locations if hybrid poplar cuttings (now being test-planted in various parts of the northeast) were not sterilized before shipment. Among these diseases are the canker-producing fungi Septoria musiva and Dothichiza populea and the leafblotch fungus Septotinia populiperda.

Field evaluation of soybean lines from a new source of resistance to Cercospora kikuchii, 2013

USDA-ARS?s Scientific Manuscript database

Purple seed stain, which is caused by the fungus Cercospora kikuchii, is an important seed disease which causes soybean seed quality losses when environmental conditions favor its growth, and harvest is delayed due to wet field conditions. Frogeye leaf spot caused by the fungus Cercospora sojina is...

Allelochemical effects of volatile compounds and organic extracts from Muscodor yucatanensis, a tropical endophytic fungus from Bursera simaruba

USDA-ARS?s Scientific Manuscript database

Muscodor yucatanensis, a recently described endophytic fungus, was isolated from the leaves of Bursera simaruba (Burseraceae) growing in the dry, semideciduous tropical forest of the Ecological Reserve El Eden, Quintana Roo, Mexico. In the present study we tested in vitro the mixture of volatile org...

BIODEGRADATION OF DDT [1,1,1-TRICHLORO-2,2-BIS(4- CHLOROPHENYL) ETHANE] BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

EPA Science Inventory

Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the form...

Tracking the footsteps of an invasive plant pathogen: Intercontinental phylogeographic structure of the white-pine-blister-rust fungus, Cronartium ribicola

Treesearch

Bryce A. Richardson; Mee-Sook Kim; Ned B. Klopfenstein; Yuko Ota; Kwan Soo Woo; Richard C. Hamelin

2009-01-01

Presently, little is known about the worldwide genetic structure, diversity, or evolutionary relationships of the white-pineblister-rust fungus, Cronartium ribicola. A collaborative international effort is underway to determine the phylogeographic relationships among Asian, European, and North American sources of C. ribicola and...

Control of Liriomyza trifolii (Diptera: Agromyzidae) in cut flowers using Isaria fumosorosea (Hypocreales: Cordycipitaceae) alone and in combination with insecticides

USDA-ARS?s Scientific Manuscript database

The generalist entomopathogenic fungus, Isaria fumosorosea (Wize) Brown and Smith (Hypocreales: Cordycipitaceae) strain Apopka-97 has exhibited significant potential as a biological control agent of several important pests both in the field and greenhouse. Although this fungus has never been tested ...

Dynamic changes of rice blast fungus in the USA through six decades

USDA-ARS?s Scientific Manuscript database

Rice blast disease caused by the fungus Magnaporthe oryzae is a serious rice disease in the USA and worldwide. M. oryzae is highly adaptive and changeable due to the instability of its genome and resistance genes which are effective only when M. oryzae isolates contain the cognate avirulence (AVR) g...

Red Fox as Sentinel for Blastomyces dermatitidis, Ontario, Canada.

PubMed

Nemeth, Nicole M; Campbell, G Douglas; Oesterle, Paul T; Shirose, Lenny; McEwen, Beverly; Jardine, Claire M

2016-07-01

Blastomyces dermatitidis, a fungus that can cause fatal infection in humans and other mammals, is not readily recoverable from soil, its environmental reservoir. Because of the red fox's widespread distribution, susceptibility to B. dermatitidis, close association with soil, and well-defined home ranges, this animal has potential utility as a sentinel for this fungus.

Thielavins A, J and K: alpha-glucosidase inhibitors from MEXU 27095, an endophytic fungus from Hintonia latiflora

USDA-ARS?s Scientific Manuscript database

Bioassay-guided fractionation of the bio-active organic extract obtained from solid-media culture of MEXU 27095, an endophytic fungus isolated from the Mexican medicinal plant Hintonia latiflora (Rubiaceae), led to separation of three tridepsides which were identified as thielavins A, J and K. All ...

A simple culture method inducing sexual reproduction by Fusarium graminearum, the primary causal agent of Fusarium head blight

USDA-ARS?s Scientific Manuscript database

The homothallic ascomycete fungus Fusarium graminearum is the primary causal agent of Fusarium head blight (FHB), a devastating disease of wheat and barley worldwide. The fungus undergoes both asexual and sexual stages in its life cycle. The asexual stage produces conidiospores, whereas the sexual s...

Influence of Populus Genotype on Gene Expression by the Wood Decay Fungus Phanerochaete chrysosporium

Treesearch

Jill Gaskell; Amber Marty; Michael Mozuch; Philip J. Kersten; Sandra Splinter Bondurant; Grzegorz Sabat; Ali Azarpira; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Dan Cullen

2014-01-01

We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba tremula) and syringyl (S)-rich transgenic derivatives. Acombination ofmicroarrays and liquid chromatography- tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793...

Sudden Oak Death - Eastern (Pest Alert)

Treesearch

Joseph O' Brien; Manfred Mielke; Steve Oak; Bruce Moltzan

2002-01-01

A phenomenon known as Sudden Oak Death was first reported in 1995 in central coastal California. Since then, tens of thousands of tanoaks (Lithocarpus densiflorus), coast live oaks (Quercus agrifolia), and California black oaks (Quercus kelloggii) have been killed by a newly identified fungus, Phytophthora ramorum. On these hosts, the fungus causes a bleeding canker on...

Draft Genome Sequence of the Patulin-Producing Fungus Paecilomyces niveus Strain CO7.

PubMed

Biango-Daniels, Megan N; Wang, Tristan W; Hodge, Kathie T

2018-06-21

Paecilomyces niveus is an extremotolerant fungus with surprising powers to survive high temperatures and infect apples and aphids. These abilities make it a formidable enemy in food and agricultural environments. In addition, it produces patulin, the most significant mycotoxin in apples. Copyright © 2018 Biango-Daniels et al.

Thousand cankers disease: Geosmithia morbida spores isolated from a weevil

Treesearch

Michele Warmund; Jerry. Van Sambeek

2014-01-01

Recently, Geosmithia morbida, the canker-causing fungus associated with thousand cankers disease, was isolated from Stenomimus pallidus weevils found on two stressed black walnut trees in Yellowwood State Forest near Nashville, Indiana. This is the first report of Geosmithia fungus occurring on an insect other than the walnut twig beetle (Pityophthorus juglandis)....

Lignocellulose pretreatment in a fungus-cultivating termite

Treesearch

Hongjie Li; Daniel J. Yelle; Chang Li; Mengyi Yang; Jing Ke; Ruijuan Zhang; Yu Liu; Na Zhu; Shiyou Liang; Xiaochang Mo; John Ralph; Cameron R. Currie; Jianchu Mo

2017-01-01

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating...

Sudden oak death: disease trends in Marin county plots after one year

Treesearch

Brice A. McPherson; David L. Wood; Andrew J. Storer; Nina Maggi Kelly; Richard B. Standiford

2002-01-01

Sudden oak death has emerged as a major threat to the oak forests of California. In oaks and tanoak, this disease complex consists of a previously unreported fungus-like pathogen, Phytophthora ramorum, insects (bark and ambrosia beetles), and a secondary fungus, Hypoxylon thouarsianum. Species monitored in this study were coast...

First Report of Botrytis cinerea as a Postharvest Pathogen of Blueberry in Korea

PubMed Central

Cheon, Mi-Geon; Choi, Okhee; Kim, Jinwoo

2011-01-01

Gray mold of blueberry caused by Botrytis sp. is reported for the first time in Korea. A detailed description of the fungus is given, along with its rDNA internal transcribed spacer sequence. The fungus was identified as Botrytis cinerea based on mycological characteristics and molecular data. PMID:22783073

Gene action and linkage of avirulence genes to DNA makers in the rust fungus Puccinia graminis

Treesearch

P. J. Zambino; A. R. Kubelik; L. J. Szabo

2000-01-01

Two strains of the wheat stem rust fungus, Puccinia graminis f. sp. tritici, were crossed on barberry, and a single F1 progeny strain was seifed. The parents, F1 and 81 F2 progeny were examined for virulence phenotypes on wheat differential cultivars carrying stem...

Characterization of molecular identity and pathogenicity of rice blast fungus in Hunan province of China

USDA-ARS?s Scientific Manuscript database

Characterization of molecular identity and pathogenicity of the rice blast fungus benefits the deployment of effective blast resistance (R) genes. In order to identify blast resistance genes in rice producing areas where most of the hybrid rice is grown in Hunan province, 182 M. oryzae strains were ...

A novel fungal hyperparasite of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust

USDA-ARS?s Scientific Manuscript database

Puccinia striiformis f. sp. tritici (Pst), the causal fungus of wheat stripe rust, was previously reported to be infected by Lecanicillium lecanii, Microdochium nivale and Typhula idahoensis. Here, we report a novel hyperparasite on Pst. This hyperparasitic fungus was identified as Cladosporium clad...

Identification of major blast resistance genes in the southern US

USDA-ARS?s Scientific Manuscript database

Resistance (R) genes in rice play important roles in preventing infections of rice blast fungus, Magnaporthe oryzae. In order to identify more R genes for different rice growing areas in the Southern US, an extensive field survey of the blast fungus was performed from 2012 to 2013. A total of 500 is...

On-farm AM fungus inoculum production: a complete how-to on-farm am fungus inoculum production

USDA-ARS?s Scientific Manuscript database

Arbuscular mycorrhizal (AM) fungi are beneficial soil fungi that form a symbiosis with the majority of crop plants. The benefits to the plant include increased nutrient uptake and disease and drought resistance. This makes utilization of the symbiosis a potentially important part in ensuring the s...

Dothistroma Needle Blight of Pines

Treesearch

Glenn W. Peterson

1982-01-01

Dothistroma blight is a devastating foliar disease of a wide range of pine species. The causal fungus, Dothistroma pini Hulbary, infects and kills needles. Premature defoliation caused by this fungus has resulted in complete failure of most ponderosa pine plantings in States east of the Great Plains. In the central and southern Great Plains, D. pini damages Austrian...

Relationship between canopy structure, microclimate, and Swiss needle cast severity among different ages of Douglas-fir forests

EPA Science Inventory

Swiss needle cast (SNC) is an endemic disease of Douglas-fir caused by Phaeocryptopus gaeumannii. The fungus infects newly emerged needles between May and August. As the fungus develops, its fruiting bodies (pseudothecia) block the stomata and inhibit gas exchange, reducing the p...

Hickory Mortality

Treesearch

USDA Forest Service Northern Area State & Private Forestry and Region 8

1994-01-01

Mortality of bitternut and shagbark hickory has been observed in Wisconsin since the late 1980's. This is similar to occurrences in the 1960's. The recent tree mortality has been associated with attacks by the hickory bark beetle, Scolytus quadrispinosus Say, and a newly discovered fungus in the genus Ceratocystis (tentatively C. caryae). The fungus can be...

Oviposition behavior and survival of Tamarixia radiata (Hymenoptera: Eulophidae), an ectoparasitoid of the Asian citrus psyllid, Diaphorina citri (Hemiptera: Liviidae), on hosts exposed to an entomopathogenic fungus

USDA-ARS?s Scientific Manuscript database

Antagonistic interactions between the nymphal parasitoid, Tamarixia radiata Waterston (Hymenoptera: Eulophidae), and the ARSEF 3581 isolate of the entomopathogenic fungus, Isaria fumosorosea Wize (Hypocreales: Cordycipitaceae) could disrupt biological control of the Asian citrus psyllid, Diaphorina ...

The origin of Ceratocystis fagacearum, the oak wilt fungus

Treesearch

Jennifer Juzwik; Thomas C. Harrington; William L. MacDonald; David N. Appel

2008-01-01

The oak wilt pathogen, Ceratocystis fagacearum, may be another example of a damaging, exotic species in forest ecosystems in the United States. Though C. fagacearum has received much research attention, the origin of the fungus is unknown. The pathogen may have been endemic at a low incidence until increased disturbances, changes...

Dissolved oxygen levels affect dimorphic growth by the entomopathogenic fungus Isaria fumosorosea

USDA-ARS?s Scientific Manuscript database

The entomopathogenic fungus Isaria fumosorosea is capable of dimorphic growth (hyphal or yeast-like) in submerged culture. In shake flask studies, we evaluated the impact of aeration on the mode of growth of I. fumosorosea. Using 250 mL baffled Erlenmeyer flasks, culture volumes of 50, 100, 150, a...

Using copper sulfate on hybrid striped bass eggs to control fungus and increase survival

USDA-ARS?s Scientific Manuscript database

A major obstacle in fish hatcheries is the inevitable fungal growth on eggs. Copper sulfate (CuSO4) is commonly used for fungus control in channel catfish hatcheries that use troughs, but effectiveness on fish eggs hatched using different systems has only recently been investigated. Fish were spawn...

Microsatellite DNA suggests regional structure in the fusiform rust fungus Cronartium quercuum f. sp fusiforme

Treesearch

T.L Kubisiak; J.H. Roberds; P.C. Spaine; R.L. Doudrick

2004-01-01

This paper reports results obtained from microsatellite DNA analysis of genetic structure for populations of the native fungus Cronartium quercuum f. sp fusiforme infecting loblolly pine (Pinus taeda L.) over much of this host's natural range. Mostly all fusiform rust galls formed under field conditions are...

Global distribution of the pitch canker fungus

Treesearch

L. David Dwinell

1998-01-01

The pitch canker fungus, Fusarium subglutinans f. sp. pini, causes diseases of pines in the United States, Haiti, Japan, Mexico, Spain, and South Africa. Pitch canker was first reported in Virginia pine in North Carolina in 1946. Although the disease was reported in Haitian pine in 1953, pitch canker was generally considered a...

Rapid detection method for fusaric acid-producing species of Fusarium by PCR

USDA-ARS?s Scientific Manuscript database

Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...

Melanin and the ecology of southern pine beetle associated fungi

Treesearch

Kier D. Klepzig

2006-01-01

I report here a series of initial investigations into effects of melanins on the interactions of the three primary species of fungi associated with the southern pine beetle (SPB), and into possible means for mitigating the damaging activities of the melanistic fungus, Ophiostoma minus. Growth of the SPB mutualistic fungus Entomocorticium...

Using copper sulfate to control egg fungus at Keo Fish Farm

USDA-ARS?s Scientific Manuscript database

Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab had just successfully completed an effectiveness study that was needed in our pursuit of gaining FDA-approval to...

Aggregation and feeding behavior of the formosan subterranean termite (Isoptera: Rhinotermitidae) on wood decayed by three species of wood rot fungi

USDA-ARS?s Scientific Manuscript database

Aggregation and feeding behavior of the Formosan subterranean termite, Coptotermes formosanus Shiraki, was evaluated on wood decayed by three species of fungus that use different enzymatic pathways to degrade lignocellulose, the brown rot fungus, Gloeophyllum trabeum and two white rot fungi, Phanero...

Draft Genome Sequence of a Rare Smut Relative, Tilletiaria anomala UBC 951

DOE PAGES

Toome, Merje; Kuo, Alan; Henrissat, Bernard; ...

2014-06-12

We present the draft genome sequence of the smut fungus Tilletiaria anomala UBC 951 (Basidiomycota, Ustilaginomycotina). The sequenced genome size is 18.7 Mb, consisting of 289 scaffolds and a total of 6,810 predicted genes. This is the first genome sequence published for a fungus in the order Georgefisheriales (Exobasidiomycetes).

Translocation and incorporation of strontium carbonate derived strontium into calcium oxalate crystals by the wood decay fungus Resinicium bicolor

Treesearch

Jon H. Connolly; Walter C. Shortle; Jody Jellison

1999-01-01

The white-rot wood decay fungus Resinicium bicolor (Abertini & Schwein.: Fr.) Parmasto was studied for its ability to solubilize and translocate ions from the naturally occurring mineral strontianite. Resinicium bicolor colonized a soil mixture culture medium containing strontianite sand, solubilized strontium ions from this...

Lethality of the entomogenous fungus Beauveria bassiana strain NI8 on Lygus lineolaris (Hemiptera: Miridae) and its possible impact on beneficial arthropods

USDA-ARS?s Scientific Manuscript database

Bioassays were conducted to examine the pathogenicity of the fungus Beauveria bassiana (Balsamo) Vuillemin (Ascomycota: Hypocreales) strain NI8 against Lygus lineolaris (Palisot de Beauvois) and its impact on natural enemies including Apis mellifera L., Crysoperla rufrilabris Burmeister, Orius insid...

Fun Microbiology: How To Measure Growth of a Fungus.

ERIC Educational Resources Information Center

Mitchell, James K.; And Others

1997-01-01

Describes an experiment to demonstrate a simple method for measuring fungus growth by monitoring the effect of temperature on the growth of Trichoderma viride. Among the advantages that this experimental model provides is introducing students to the importance of using the computer as a scientific tool for analyzing and presenting data. (AIM)

Polyketide-Terpene Hybrid Metabolites from an Endolichenic Fungus Pestalotiopsis sp.

PubMed

Yuan, Chao; Ding, Gang; Wang, Hai-Ying; Guo, Yu-Hua; Shang, Hai; Ma, Xiao-Jun; Zou, Zhong-Mei

2017-01-01

Five new polyketide-terpene hybrid metabolites ( 1 - 5 ) with highly functionalized groups, together with six known derivatives ( 6 - 11 ), were isolated from the endolichenic fungus Pestalotiopsis sp. Their structures were elucidated by extensive NMR experiments including 1 H, 13 C, HMQC, COSY, and HMBC. The relative configurations of the new compounds were determined by analysis of coupling constants and ROESY correlations. The absolute configurations especially the secondary alcohol at C-15 in 1 and secondary alcohol at C-14 in 5 were established via the CD experiments of the in situ formed [Rh 2 (OCOCF 3 ) 4 ] complex with the acetonide derivatives. These compounds were tested for their inhibition activity against six plant pathogens. Compounds 1 and 5 exhibited pronounced efficiency against Fusarium oxysporum , and compounds 5 and 6 potently inhibited Fusarium gramineum with MIC value of 8  µ g/mL, which revealed the plausible ecological role of endolichenic fungus in providing chemical protection for its host lichen in the fungus-plant relationship. The biosynthetic pathway of compounds 1 - 11 was postulated for the first time, which paved the way for its further biosynthesis research.

Biomimetics of silver nanoparticles by white rot fungus, Phaenerochaete chrysosporium.

PubMed

Vigneshwaran, Nadanathangam; Kathe, Arati A; Varadarajan, P V; Nachane, Rajan P; Balasubramanya, R H

2006-11-01

Extracellular synthesis of silver nanoparticles by a white rot fungus, Phaenerochaete chrysosporium is reported in this paper. Incubation of P. chrysosporium mycelium with silver nitrate solution produced silver nanoparticles in 24h. These silver nanoparticles were characterized by means of UV-vis spectroscopy, X-ray diffraction analysis, scanning electron microscopy, transmission electron microscopy, and photoluminescence spectroscopy. The synthesized silver nanoparticles absorbed maximum at 470 nm in the visible region. XRD spectrum of the silver nanoparticles confirmed the formation of metallic silver. The SEM characterization of the fungus reacted on the Ag+ indicated that the protein might be responsible for the stabilization of silver nanoparticles. This result was further supported by the TEM examination. Though shape variation was noticed, majority of the nanoparticles were found to be of pyramidal shape as seen under TEM. Photoluminescence spectrum showed a broad emission peak of silver nanoparticles at 423 nm when excited at 350 nm. Apart from eco-friendliness, fungus as bio-manufacturing unit will give us an added advantage in ease of handling when compared to other classes of microorganisms.

Effects of 20 standard amino acids on the growth, total fatty acids production, and γ-linolenic acid yield in Mucor circinelloides.

PubMed

Tang, Xin; Zhang, Huaiyuan; Chen, Haiqin; Chen, Yong Q; Chen, Wei; Song, Yuanda

2014-12-01

Twenty standard amino acids were examined as single nitrogen source on the growth, total fatty acids production, and yield of γ-linolenic acid (GLA) in Mucor circinelloides. Of the amino acids, tyrosine gave the highest biomass and lipid accumulation and thus resulted in a high GLA yield with respective values of 17.8 g/L, 23 % (w/w, dry cell weight, DCW), and 0.81 g/L, which were 36, 25, and 72 % higher than when the fungus was grown with ammonium tartrate. To find out the potential mechanism underlying the increased lipid accumulation of M. circinelloides when grown on tyrosine, the activity of lipogenic enzymes of the fungus during lipid accumulation phase was measured. The enzyme activities of glucose 6-phosphate dehydrogenase, 6-phosphogluconate dehydrogenase, and ATP-citrate lyase were up-regulated, while NADP-isocitrate dehydrogenase was down-regulated by tyrosine during the lipid accumulation phase of the fungus which suggested that these enzymes may be involved in the increased lipid biosynthesis by tyrosine in this fungus.

Abscisic acid negatively regulates post-penetration resistance of Arabidopsis to the biotrophic powdery mildew fungus.

PubMed

Xiao, Xiang; Cheng, Xi; Yin, Kangquan; Li, Huali; Qiu, Jin-Long

2017-08-01

Pytohormone abscisic acid (ABA) plays important roles in defense responses. Nonetheless, how ABA regulates plant resistance to biotrophic fungi remains largely unknown. Arabidopsis ABA-deficient mutants, aba2-1 and aba3-1, displayed enhanced resistance to the biotrophic powdery mildew fungus Golovinomyces cichoracearum. Moreover, exogenously administered ABA increased the susceptibility of Arabidopsis to G. cichoracearum. Arabidopsis ABA perception components mutants, abi1-1 and abi2-1, also displayed similar phenotypes to ABA-deficient mutants in resistance to G. cichoracearum. However, the resistance to G. cichoracearum is not changed in downstream ABA signaling transduction mutants, abi3-1, abi4-1, and abi5-1. Microscopic examination revealed that hyphal growth and conidiophore production of G. cichoracearum were compromised in the ABA deficient mutants, even though pre-penetration and penetration growth of the fungus were not affected. In addition, salicylic acid (SA) and MPK3 are found to be involved in ABA-regulated resistance to G. cichoracearum. Our work demonstrates that ABA negatively regulates post-penetration resistance of Arabidopsis to powdery mildew fungus G. cichoracearum, probably through antagonizing the function of SA.

Carbohydrate-active enzymes from the zygomycete fungus Rhizopus oryzae: a highly specialized approach to carbohydrate degradation depicted at genome level

PubMed Central

2011-01-01

Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy) annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs) and a high number of glycosyl transferases (GTs) and carbohydrate esterases (CEs). A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars), chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota. PMID:21241472

Microbially Influenced Corrosion of 304 Stainless Steel and Titanium by P. variotii and A. niger in Humid Atmosphere

NASA Astrophysics Data System (ADS)

Zhang, Dawei; Zhou, Feichi; Xiao, Kui; Cui, Tianyu; Qian, Hongchong; Li, Xiaogang

2015-07-01

Microbially induced corrosion (MIC) poses significant threats to reliability and safety of engineering materials and structures. While most MIC studies focus on prokaryotic bacteria such as sulfate-reducing bacteria, the influence of fungi on corrosion behaviors of metals has not been adequately reported. In this study, 304 stainless steel and titanium were exposed to two very common fungi, Paecilomyces variotii, Aspergillus niger and their mixtures under highly humid atmosphere. The initial corrosion behaviors within 28 days were studied via scanning Kelvin probe, which showed marked surface ennoblement and increasingly heterogeneous potential distribution upon prolonged fungus exposure. Using stereomicroscopy, fungus growth as well as corrosion morphology of 304 stainless steel and titanium were also evaluated after a long-term exposure for 60 days. The presence of fungi decreased the corrosion resistance for both 304 stainless steel and titanium. Titanium showed higher resistance to fungus growth and the induced corrosion. Exposure to the mixed strains resulted in the highest fungus growth rate but the mildest corrosion, possibly due to the decreased oxygen level by increased fungal activities.

Effect of salinity medium on antioxidant and antidiabetic activity marine endophytic fungus of asperegillus elegans ptf 9

NASA Astrophysics Data System (ADS)

Mulyani, Hani; Artanti, Nina; Fitria, Irni; Filailla, Euis; Kandace, Yoice Sri; Udin, Linar Zalinar

2017-11-01

Our previous studies on screening of antioxidant activities from various endophytic fungi isolated from marine bioata showed that A. elegans PTF9 isolated from sea weed is one of the fungus that has good antioxidant activity. In current study we reported the effect of medium salinity (0, 3 and 10% salt in PDB medium) on antioxidant and antidiabetes activity of mycelium and filtrate ethyl acetate extracts of A. elegans Ptf 9. The antioxidant assay was conducted using DPPH free radical scavenging activity method. The antidiabetes assay was conducted using a-glucosidase inhibitory activity method. The results showed that the best antioxidant activity was obtained from filtrate extract of fungus cultures with 0% salt (IC50=1.56 ppm), whereas the best antidiabetes activity was obtained from filtrate extract of fungus culture with 10% salt (IC50= 3.64 ppm). Addition of salt reduced the antioxidant activity, but not the antidiabetes activity. The results suggest that A. elegans PTF9 showed potential for further studies on isolation of antioxidant and antidiabetes lead compounds that could be use for further development of new drugs.

Potential for spread of the white-nose fungus (Pseudogymnoascus destructans) in the Americas: use of Maxent and NicheA to assure strict model transference.

PubMed

Escobar, Luis E; Lira-Noriega, Andrés; Medina-Vogel, Gonzalo; Townsend Peterson, A

2014-11-01

Emerging infectious diseases can present serious threats to wildlife, even to the point of causing extinction. Whitenose fungus (Pseudogymnoascus destructans) is causing an epizootic in bats that is expanding rapidly, both geographically and taxonomically. Little is known of the ecology and distributional potential of this intercontinental pathogen. We address this gap via ecological niche models that characterise coarse resolution niche differences between fungus populations on different continents, identifying areas potentially vulnerable to infection in South America. Here we explore a novel approach to identifying areas of potential distribution across novel geographic regions that avoids perilious extrapolation into novel environments. European and North American fungus populations show differential use of environmental space, but rather than niche differentiation, we find that changes are best attributed to climatic differences between the two continents. Suitable areas for spread of the pathogen were identified across southern South America; however caution should be taken to avoid underestimating the potential for spread of this pathogen in South America.

A fibronectin receptor on Candida albicans mediates adherence of the fungus to extracellular matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klotz, S.A.; Smith, R.L.

1991-03-01

Binding of fibronectin, an extracellular matrix (ECM) protein, to Candida albicans was measured, and adherence of the fungus to immobilized ECM proteins, fibronectin, laminin, types I and IV collagen, and subendothelial ECM was studied. 125I-labeled fibronectin was inhibited from binding to the fungus by unlabeled human plasma fibronectin and by Arg-Gly-Asp (RGD), Gly-Arg-Gly-Glu-Ser-Pro (GRGESP), and Gly-Arg-Gly-Asp-Thr-Pro (GRGDTP), but binding was not inhibited by Gly-Arg-Gly-Asp-Ser-Pro. Soluble fibronectin, RGD, GRGESP, and GRGDTP also inhibited fungal adherence to the individual immobilized ECM proteins in a complex pattern, but only soluble fibronectin (10(-7) M) inhibited fungal adherence to subendothelial ECM. Thus, C. albicans possessesmore » at least one type of cell surface receptor for binding soluble fibronectin that can be inhibited with peptides. This receptor apparently is used to bind the fungus to immobilized ECM proteins and to subendothelial ECM and may play a role in the initiation of disseminated disease by bloodborne fungi by providing for adherence of the microorganisms to ECM proteins.« less

The fungus that came in from the cold: dry rot's pre-adapted ability to invade buildings.

PubMed

Balasundaram, S V; Hess, J; Durling, M B; Moody, S C; Thorbek, L; Progida, C; LaButti, K; Aerts, A; Barry, K; Grigoriev, I V; Boddy, L; Högberg, N; Kauserud, H; Eastwood, D C; Skrede, I

2018-03-01

Many organisms benefit from being pre-adapted to niches shaped by human activity, and have successfully invaded man-made habitats. One such species is the dry rot fungus Serpula lacrymans, which has a wide distribution in buildings in temperate and boreal regions, where it decomposes coniferous construction wood. Comparative genomic analyses and growth experiments using this species and its wild relatives revealed that S. lacrymans evolved a very effective brown rot decay compared to its wild relatives, enabling an extremely rapid decay in buildings under suitable conditions. Adaptations in intracellular transport machineries promoting hyphal growth, and nutrient and water transport may explain why it is has become a successful invader of timber in houses. Further, we demonstrate that S. lacrymans has poor combative ability in our experimental setup, compared to other brown rot fungi. In sheltered indoor conditions, the dry rot fungus may have limited encounters with other wood decay fungi compared to its wild relatives. Overall, our analyses indicate that the dry rot fungus is an ecological specialist with poor combative ability against other fungi.

Overexpression of the wasabi defensin gene confers enhanced resistance to blast fungus ( Magnaporthe grisea) in transgenic rice.

PubMed

Kanzaki, H.; Nirasawa, S.; Saitoh, H.; Ito, M.; Nishihara, M.; Terauchi, R.; Nakamura, I.

2002-11-01

Transgenic rice ( Oryza sativa cv. Sasanishiki) overexpressing the wasabi defensin gene, a plant defensin effective against the rice blast fungus, was generated by Agrobacterium tumefaciens-mediated transformation. Twenty-two T2 homozygous lines harboring the wasabi defensin gene were challenged by the blast fungus. Transformants exhibited resistance to rice blast at various levels. The inheritance of the resistance over generations was investigated. T3 plants derived from two highly blast-resistant T2 lines (WT14-5 and WT43-5) were challenged with the blast fungus using the press-injured spots method. The average size of disease lesions of the transgenic line WT43-5 was reduced to about half of that of non-transgenic plants. The 5-kDa peptide, corresponding to the processed form of the wasabi defensin, was detected in the total protein fraction extracted from the T3 progeny. Transgenic rice plants overproducing wasabi defensin are expected to possess a durable and wide-spectrum resistance (i.e. field resistance) against various rice blast races.

Muscodor kashayum sp. nov. – a new volatile anti-microbial producing endophytic fungus

PubMed Central

Meshram, Vineet; Kapoor, Neha; Saxena, Sanjai

2014-01-01

Muscodor kashayum (MycoBank no.: MB 803800; GenBank no.: KC481680) is a newly described endophytic fungus of a medicinal plant Aegle marmelos (Bael tree), growing in the tropical conserved rainforest in the Western Ghats of India. Muscodor kashayum possesses distinct morphological, molecular and physiological features from the earlier reported Muscodor species. The fungus forms characteristic rings of the ropy mycelium on potato dextrose agar medium. This sterile fungus is characterised by the presence of a pungent smell which is attributable to a blend of more than 23 volatile organic constituents, predominantly 3-cyclohexen-1-ol,1-(1,5-dimethyl-4-hexenyl)-4-methyl; 1,6-dioxacyclododecane-7,12-dione; 2,6-bis(1,1-dimethylethyl)-4-(1-oxopropyl) phenol; 2,4-di-tert-butylthiophenol and 4-octadecylmorpholine. In the in vitro anti-microbial assay using M. kashayum, growth of 75% of test fungi/yeasts and 72% of the test bacteria were completely inhibited. Therefore, M. Kashayum holds potential for future application to be used as a myco-fumigation agent. PMID:24587960

Identification and Characterization of Lipopeptides from Bacillus subtilis B1 Against Sapstain Fungus of Rubberwood Through MALDI-TOF-MS and RT-PCR.

PubMed

Sajitha, K L; Dev, Suma Arun; Maria Florence, E J

2016-07-01

Bacillus subtilis is a potent biocontrol agent producing a wide array of antifungal lipopeptides for the inhibition of fungal growth. B. subtilis B1 isolated from market-available compost provided an efficient control of rubberwood sapstain fungus, Lasiodiplodia theobromae. The current study is aimed to identify and characterize the lipopeptides responsible for the biocontrol of rubberwood sapstain fungus by Bacillus subtilis B1. The bacterial whole-cell surface extract from the dual culture of B. subtilis B1 and sapstain fungus (L. theobromae) was analysed using MALDI-TOF-MS. The protonated as well as sodium, potassium adducts of homologues of iturin C, surfactin, bacillomycin D and fengycin A and B were identified and expression of the lipopeptide biosynthetic genes could be confirmed through RT-PCR. This is the first report of mycobacillin and trimethylsilyl derivative of bacilysin during antagonism through MALDI-TOF-MS. MALDI-TOF-MS with RT-PCR offered easy platforms to characterize the antifungal lipopeptides. The identification of antifungal lipopeptides can lead to the formulation of prospective biocontrol by-products which have wide-scale utility.

Comparative vesicle proteomics reveals selective regulation of protein expression in chestnut blight fungus by a hypovirus.

PubMed

Wang, Jinzi; Wang, Fangzhen; Feng, Youjun; Mi, Ke; Chen, Qi; Shang, Jinjie; Chen, Baoshan

2013-01-14

The chestnut blight fungus (Cryphonectria parasitica) and hypovirus constitute a model system to study fungal pathogenesis and mycovirus-host interaction. Knowledge in this field has been gained largely from investigations at gene transcription level so far. Here we report a systematic analysis of the vesicle proteins of the host fungus with/without hypovirus infection. Thirty-three differentially expressed protein spots were identified in the purified vesicle protein samples by two-dimensional electrophoresis and mass spectrometry. Down-regulated proteins were mostly cargo proteins involved in primary metabolism and energy generation and up-regulated proteins were mostly vesicle associated proteins and ABC transporter. A virus-encoded protein p48 was found to have four forms with different molecular mass in vesicles from the virus-infected strain. While a few of the randomly selected differentially expressed proteins were in accordance with their transcription profiles, majority were not in agreement with their mRNA accumulation patterns, suggesting that an extensive post-transcriptional regulation may have occurred in the host fungus upon a hypovirus infection. Copyright © 2012 Elsevier B.V. All rights reserved.

Treatment of a Textile Effluent from Dyeing with Cochineal Extracts Using Trametes versicolor Fungus

PubMed Central

Arroyo-Figueroa, Gabriela; Ruiz-Aguilar, Graciela M. L.; López-Martínez, Leticia; González-Sánchez, Guillermo; Cuevas-Rodríguez, Germán; Rodríguez-Vázquez, Refugio

2011-01-01

Trametes versicolor (Tv) fungus can degrade synthetic dyes that contain azo groups, anthraquinone, triphenylmethane polymers, and heterocyclic groups. However, no references have been found related to the degradation of natural dyes, such as the carminic acid that is contained in the cochineal extract. Experiments to determine the decolorization of the effluent used in the cotton dyeing process with cochineal extract by means of Tv fungus were done. Treatments to determine decolorization in the presence or absence of Kirk's medium, glucose, and fungus, with an addition of 50% (v v-1) of nonsterilized effluent were performed. Physicochemical characterization was performed at the start and end of the treatment. Degradation kinetics were determined. A direct relationship was found between the dry weight of fungi, pH, and the decolorization system, with higher decolorization at lower pH levels (pH ~4.3). High decolorization (81% ± 0.09; 88% ± 0.17; and 99% ± 0.04) for three of the eight treatments (Kirk's medium without glucose, Kirk's medium with glucose, and without medium with glucose, respectively) was found. Toxicity tests determined an increase in the initial effluent toxicity (7.33 TU) compared with the final treatment (47.73 TU) in a period of 11 days. For this system, a degradation sequence of the carminic acid structure present in the effluent by the Tv fungus is suggested, in which it is seen that metabolites still containing aromatic structures are generated. PMID:21552764

Bryophytes and lichens: Small but indispensable forest dwellers

USGS Publications Warehouse

Hutten, Martin; Woodward, Andrea

2002-01-01

* What is a Bryophyte? * Bryophytes are the small green plants commonly known as mosses, liverworts and hornworts. Compared to plants, they have primitive tissues for conducting food and water, and they lack a protective outer surface to maintain water balance. Most bryophytes, because they lack tissues such as roots, obtain their water through direct surface contact with their environment. During dry weather they have the capacity to withstand complete dehydration. Bryophytes that are dry may appear dead but will regain normal function when moisture is available. Instead of producing seeds, bryophytes can either reproduce sexually by means of spores, or asexually when small pieces break off and grow into new individuals. * What is a Lichen? * Lichens are dual organisms consisting of a fungus and an alga or a cyanobacterium. The fungus provides the alga with structure, protection, nutrients, and water absorbed from the atmosphere and the substrate (e.g., soil, rotten logs, tree branches). In return, the alga provides carbohydrates from photosynthesis to the fungus. Algae from some lichens grow independently of the fungus, but in lichen form, the algae can inhabit more challenging environments than when growing alone. Most lichens can reproduce asexually. They either produce specialized propagules containing both partners, or parts of the lichen simply break, allowing both the fungus and the alga to disperse together. In some lichens, the fungal partner reproduces sexually by releasing spores, but the partner alga must be present in order for a lichen to reform.

Amphibians acquire resistance to live and dead fungus overcoming fungal immunosuppression.

PubMed

McMahon, Taegan A; Sears, Brittany F; Venesky, Matthew D; Bessler, Scott M; Brown, Jenise M; Deutsch, Kaitlin; Halstead, Neal T; Lentz, Garrett; Tenouri, Nadia; Young, Suzanne; Civitello, David J; Ortega, Nicole; Fites, J Scott; Reinert, Laura K; Rollins-Smith, Louise A; Raffel, Thomas R; Rohr, Jason R

2014-07-10

Emerging fungal pathogens pose a greater threat to biodiversity than any other parasitic group, causing declines of many taxa, including bats, corals, bees, snakes and amphibians. Currently, there is little evidence that wild animals can acquire resistance to these pathogens. Batrachochytrium dendrobatidis is a pathogenic fungus implicated in the recent global decline of amphibians. Here we demonstrate that three species of amphibians can acquire behavioural or immunological resistance to B. dendrobatidis. Frogs learned to avoid the fungus after just one B. dendrobatidis exposure and temperature-induced clearance. In subsequent experiments in which B. dendrobatidis avoidance was prevented, the number of previous exposures was a negative predictor of B. dendrobatidis burden on frogs and B. dendrobatidis-induced mortality, and was a positive predictor of lymphocyte abundance and proliferation. These results suggest that amphibians can acquire immunity to B. dendrobatidis that overcomes pathogen-induced immunosuppression and increases their survival. Importantly, exposure to dead fungus induced a similar magnitude of acquired resistance as exposure to live fungus. Exposure of frogs to B. dendrobatidis antigens might offer a practical way to protect pathogen-naive amphibians and facilitate the reintroduction of amphibians to locations in the wild where B. dendrobatidis persists. Moreover, given the conserved nature of vertebrate immune responses to fungi and the fact that many animals are capable of learning to avoid natural enemies, these results offer hope that other wild animal taxa threatened by invasive fungi might be rescued by management approaches based on herd immunity.

Treatment of a textile effluent from dyeing with cochineal extracts using Trametes versicolor fungus.

PubMed

Arroyo-Figueroa, Gabriela; Ruiz-Aguilar, Graciela M L; López-Martínez, Leticia; González-Sánchez, Guillermo; Cuevas-Rodríguez, Germán; Rodríguez-Vázquez, Refugio

2011-05-05

Trametes versicolor (Tv) fungus can degrade synthetic dyes that contain azo groups, anthraquinone, triphenylmethane polymers, and heterocyclic groups. However, no references have been found related to the degradation of natural dyes, such as the carminic acid that is contained in the cochineal extract. Experiments to determine the decolorization of the effluent used in the cotton dyeing process with cochineal extract by means of Tv fungus were done. Treatments to determine decolorization in the presence or absence of Kirk's medium, glucose, and fungus, with an addition of 50% (v v-1) of nonsterilized effluent were performed. Physicochemical characterization was performed at the start and end of the treatment. Degradation kinetics were determined. A direct relationship was found between the dry weight of fungi, pH, and the decolorization system, with higher decolorization at lower pH levels (pH ~4.3). High decolorization (81% ± 0.09; 88% ± 0.17; and 99% ± 0.04) for three of the eight treatments (Kirk's medium without glucose, Kirk's medium with glucose, and without medium with glucose, respectively) was found. Toxicity tests determined an increase in the initial effluent toxicity (7.33 TU) compared with the final treatment (47.73 TU) in a period of 11 days. For this system, a degradation sequence of the carminic acid structure present in the effluent by the Tv fungus is suggested, in which it is seen that metabolites still containing aromatic structures are generated.

Evidence for biological shaping of hair ice

NASA Astrophysics Data System (ADS)

Hofmann, D.; Preuss, G.; Mätzler, C.

2015-07-01

An unusual ice type, called hair ice, grows on the surface of dead wood of broad-leaf trees at temperatures slightly below 0 °C. We describe this phenomenon and present physical, chemical, and biological investigations to gain insight in the properties and processes related to hair ice. Tests revealed that the biological activity of a winter-active fungus is required in the wood for enabling the growth of hair ice. We confirmed the fungus hypothesis originally suggested by Wegener (1918) by reproducing hair ice on wood samples. Treatment by heat and fungicide suppresses the formation of hair ice. Fruiting bodies of Asco- and Basidiomycota are identified on hair-ice-carrying wood. One species, Exidiopsis effusa (Ee), was present on all investigated samples. Both hair-ice-producing wood samples and those with killed fungus show essentially the same temperature variation, indicating that the heat produced by fungal metabolism is very small, that the freezing rate is not influenced by the fungus activity, and that ice segregation is the common mechanism of ice growth on the wood surface. The fungus plays the role of shaping the ice hairs and preventing them from recrystallisation. Melted hair ice indicates the presence of organic matter. Chemical analyses show a complex mixture of several thousand CHO(N,S) compounds similar to fulvic acids in dissolved organic matter (DOM). The evaluation reveals decomposed lignin as being the main constituent. Further work is needed to clarify its role in hair-ice growth and to identify the recrystallisation inhibitor.

Evidence for biological shaping of hair ice

NASA Astrophysics Data System (ADS)

Hofmann, D.; Preuss, G.; Mätzler, C.

2015-04-01

An unusual ice type, called hair ice, grows on the surface of dead wood of broad-leaf trees at temperatures slightly below 0 °C. We describe this phenomenon and present physical, chemical, and biological investigations to gain insight in the properties and processes related to hair ice. Tests revealed that the biological activity of a winter-active fungus is required in the wood for enabling the growth of hair ice. We confirmed the fungus hypothesis originally suggested by Wegener (1918) by reproducing hair ice on wood samples. Treatment by heat and fungicide, respectively, suppresses the formation of hair ice. Fruiting bodies of Asco- and Basidiomycota are identified on hair-ice carrying wood. One species, Exidiopsis effusa (Ee), has been present on all investigated samples. Both hair-ice producing wood samples and those with killed fungus show essentially the same temperature variation, indicating that the heat produced by fungal metabolism is very small, that the freezing rate is not influenced by the fungus activity and that ice segregation is the common mechanism of ice growth at the wood surface. The fungus plays the role of shaping the ice hairs and to prevent them from recrystallisation. Melted hair ice indicates the presence of organic matter. Chemical analyses show a complex mixture of several thousand CHO(N,S)-compounds similar to fulvic acids in dissolved organic matter (DOM). The evaluation reveals decomposed lignin as the main constituent. Further work is needed to clarify its role in hair-ice growth and to identify the recrystallisation inhibitor.

A Brazilian social bee must cultivate fungus to survive.

PubMed

Menezes, Cristiano; Vollet-Neto, Ayrton; Marsaioli, Anita Jocelyne; Zampieri, Davila; Fontoura, Isabela Cardoso; Luchessi, Augusto Ducati; Imperatriz-Fonseca, Vera Lucia

2015-11-02

The nests of social insects provide suitable microenvironments for many microorganisms as they offer stable environmental conditions and a rich source of food [1-4]. Microorganisms in turn may provide several benefits to their hosts, such as nutrients and protection against pathogens [1, 4-6]. Several examples of symbiosis between social insects and microorganisms have been found in ants and termites. These symbioses have driven the evolution of complex behaviors and nest structures associated with the culturing of the symbiotic microorganisms [5, 7, 8]. However, while much is known about these relationships in many species of ants and termites, symbiotic relationships between microorganisms and social bees have been poorly explored [3, 4, 9, 10]. Here, we report the first case of an obligatory relationship between the Brazilian stingless bee Scaptotrigona depilis and a fungus of the genus Monascus (Ascomycotina). Fungal mycelia growing on the provisioned food inside the brood cell are eaten by the larva. Larvae reared in vitro on sterilized larval food supplemented with fungal mycelia had a much higher survival rate (76%) compared to larvae reared under identical conditions but without fungal mycelia (8% survival). The fungus was found to originate from the material from which the brood cells are made. Since the bees recycle and transport this material between nests, fungus would be transferred to newly built cells and also to newly founded nests. This is the first report of a fungus cultivation mutualism in a social bee. Copyright © 2015 Elsevier Ltd. All rights reserved.

Paracoccidioides brasiliensis interferes on dendritic cells maturation by inhibiting PGE2 production.

PubMed

Fernandes, Reginaldo K; Bachiega, Tatiana F; Rodrigues, Daniela R; Golim, Marjorie de A; Dias-Melicio, Luciane A; Balderramas, Helanderson de A; Kaneno, Ramon; Soares, Ângela M V C

2015-01-01

Paracoccidioidomycosis (PCM) is a systemic mycosis, endemic in most Latin American countries, especially in Brazil, whose etiologic agent is the thermodimorphic fungus of the genus Paracoccidioides, comprising cryptic species of Paracoccidioides brasiliensis, S1, PS2, PS3 and Paracoccidioides lutzii. The mechanisms involved in the initial interaction of the fungus with cells of the innate immune response, as dendritic cells (DCs), deserve to be studied. Prostaglandins (PGs) are eicosanoids that play an important role in modulating functions of immune cells including DCs. Here we found that human immature DCs derived from the differentiation of monocytes cultured with GM-CSF and IL-4 release substantial concentrations of PGE2, which, however, were significantly inhibited after challenge with P. brasiliensis. In vitro blocking of pattern recognition receptors (PRRs) by monoclonal antibodies showed the involvement of mannose receptor (MR) in PGE2 inhibition by the fungus. In addition, phenotyping assays showed that after challenge with the fungus, DCs do not change their phenotype of immature cells to mature ones, as well as do not produce IL-12 p70 or adequate concentrations of TNF-α. Assays using exogenous PGE2 confirmed an association between PGE2 inhibition and failure of cells to phenotypically mature in response to P. brasiliensis. We conclude that a P. brasiliensis evasion mechanism exists associated to a dysregulation on DC maturation. These findings may provide novel information for the understanding of the complex interplay between the host and this fungus.

Immune-physiological aspects of synergy between avermectins and the entomopathogenic fungus Metarhizium robertsii in Colorado potato beetle larvae.

PubMed

Tomilova, Oksana G; Kryukov, Vadim Yu; Duisembekov, Bahytzhan A; Yaroslavtseva, Olga N; Tyurin, Maksim V; Kryukova, Natalia A; Skorokhod, Valery; Dubovskiy, Ivan M; Glupov, Viktor V

2016-10-01

The interaction between the entomopathogenic fungus Metarhizium robertsii and natural avermectin metabolites of the actinomycete Streptomyces avermitilis were investigated on Colorado potato beetle larvae. A synergy in the mortality of larvae was detected after simultaneous treatment with half-lethal doses of avermectins (commercial name actarophit) 0.005% and fungus (5×10 5 conidia/ml). The treatment with avermectins led to rapid fungal colonization of the hemolymph. The defense strategies of insects infected by fungus and treated with avermectins and untreated insects were compared to investigate the mechanisms of this synergy. We have shown an increase in hemocytes, especially immunocompetent cells - plasmatocytes and granular cells in the initial stages of mycosis (third day post inoculation). In contrast, avermectins suppressed cellular immunity in hemolymph. Specifically, avermectins dramatically decreased the count of granular cells in larvae infected and uninfected with fungus. Apoptosis inducement and hemocyte necrosis under the influence of avermectins has been shown in vitro as one of the possible reasons for hemocyte mortality. In addition, avermectins enhanced the activity of phenoloxidases in integuments and hemolymph and increased the activity of glutathione-S-transferases activity in the fat body and hemolymph of infected and uninfected larvae, thereby intensifying the development of fungal infection by M. robertsii in Colorado potato beetle larvae. The combination of fungal infection and avermectins constitutes a new perspective for developing multicomponent bioinsecticides. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of Immunity-Related Genes in Dialeurodes citri against Entomopathogenic Fungus Lecanicillium attenuatum by RNA-Seq Analysis.

PubMed

Yu, Shijiang; Ding, Lili; Luo, Ren; Li, Xiaojiao; Yang, Juan; Liu, Haoqiang; Cong, Lin; Ran, Chun

2016-01-01

Dialeurodes citri is a major pest in citrus producing areas, and large-scale outbreaks have occurred increasingly often in recent years. Lecanicillium attenuatum is an important entomopathogenic fungus that can parasitize and kill D. citri. We separated the fungus from corpses of D. citri larvae. However, the sound immune defense system of pests makes infection by an entomopathogenic fungus difficult. Here we used RNA sequencing technology (RNA-Seq) to build a transcriptome database for D. citri and performed digital gene expression profiling to screen genes that act in the immune defense of D. citri larvae infected with a pathogenic fungus. De novo assembly generated 84,733 unigenes with mean length of 772 nt. All unigenes were searched against GO, Nr, Swiss-Prot, COG, and KEGG databases and a total of 28,190 (33.3%) unigenes were annotated. We identified 129 immunity-related unigenes in transcriptome database that were related to pattern recognition receptors, information transduction factors and response factors. From the digital gene expression profile, we identified 441 unigenes that were differentially expressed in D. citri infected with L. attenuatum. Through calculated Log2Ratio values, we identified genes for which fold changes in expression were obvious, including cuticle protein, vitellogenin, cathepsin, prophenoloxidase, clip-domain serine protease, lysozyme, and others. Subsequent quantitative real-time polymerase chain reaction analysis verified the results. The identified genes may serve as target genes for microbial control of D. citri.