Cordyceps collected from Bhutan, an appropriate alternative of Cordyceps sinensis.

PubMed

Wu, Ding-Tao; Lv, Guang-Ping; Zheng, Jian; Li, Qian; Ma, Shuang-Cheng; Li, Shao-Ping; Zhao, Jing

2016-11-22

Natural Cordyceps collected in Bhutan has been widely used as natural Cordyceps sinensis, an official species of Cordyceps used as Chinese medicines, around the world in recent years. However, whether Cordyceps from Bhutan could be really used as natural C. sinensis remains unknown. Therefore, DNA sequence, bioactive components including nucleosides and polysaccharides in twelve batches of Cordyceps from Bhutan were firstly investigated, and compared with natural C. sinensis. Results showed that the fungus of Cordyceps from Bhutan was C. sinensis and the host insect belonged to Hepialidae sp. In addition, nucleosides and their bases such as guanine, guanosine, hypoxanthine, uridine, inosine, thymidine, adenine, and adenosine, as well as compositional monosaccharides, partial acid or enzymatic hydrolysates, molecular weights and contents of polysaccharides in Cordyceps from Bhutan were all similar to those of natural C. sinensis. All data suggest that Cordyceps from Bhutan is a rational alternative of natural C. sinensis, which is beneficial for the improvement of their performance in health and medicinal food areas.

Identification of Chinese medicinal fungus Cordyceps sinensis by depth-profiling mid-infrared photoacoustic spectroscopy

NASA Astrophysics Data System (ADS)

Du, Changwen; Zhou, Jianmin; Liu, Jianfeng

2017-02-01

With increased demand for Cordyceps sinensis it needs rapid methods to meet the challenge of identification raised in quality control. In this study Cordyceps sinensis from four typical natural habitats in China was characterized by depth-profiling Fourier transform infrared photoacoustic spectroscopy. Results demonstrated that Cordyceps sinensis samples resulted in typical photoacoustic spectral appearance, but heterogeneity was sensed in the whole sample; due to the heterogeneity Cordyceps sinensis was represented by spectra of four groups including head, body, tail and leaf under a moving mirror velocity of 0.30 cm s- 1. The spectra of the four groups were used as input of a probabilistic neural network (PNN) to identify the source of Cordyceps sinensis, and all the samples were correctly identified by the PNN model. Therefore, depth-profiling Fourier transform infrared photoacoustic spectroscopy provides novel and unique technique to identify Cordyceps sinensis, which shows great potential in quality control of Cordyceps sinensis.

Identification of Chinese medicinal fungus Cordyceps sinensis by depth-profiling mid-infrared photoacoustic spectroscopy.

PubMed

Du, Changwen; Zhou, Jianmin; Liu, Jianfeng

2017-02-15

With increased demand for Cordyceps sinensis it needs rapid methods to meet the challenge of identification raised in quality control. In this study Cordyceps sinensis from four typical natural habitats in China was characterized by depth-profiling Fourier transform infrared photoacoustic spectroscopy. Results demonstrated that Cordyceps sinensis samples resulted in typical photoacoustic spectral appearance, but heterogeneity was sensed in the whole sample; due to the heterogeneity Cordyceps sinensis was represented by spectra of four groups including head, body, tail and leaf under a moving mirror velocity of 0.30cms -1 . The spectra of the four groups were used as input of a probabilistic neural network (PNN) to identify the source of Cordyceps sinensis, and all the samples were correctly identified by the PNN model. Therefore, depth-profiling Fourier transform infrared photoacoustic spectroscopy provides novel and unique technique to identify Cordyceps sinensis, which shows great potential in quality control of Cordyceps sinensis. Copyright © 2016 Elsevier B.V. All rights reserved.

Cordycepin: a bioactive metabolite with therapeutic potential.

PubMed

Tuli, Hardeep S; Sharma, Anil K; Sandhu, Sardul S; Kashyap, Dharambir

2013-11-26

Cytotoxic nucleoside analogues were the first chemotherapeutic agents for cancer treatment. Cordycepin, an active ingredient of the insect fungus Cordyceps militaris, is a category of compounds that exhibit significant therapeutic potential. Cordycepin has many intracellular targets, including nucleic acid (DNA/RNA), apoptosis and cell cycle, etc. Investigations of the mechanism of anti-cancer drugs have yielded important information for the design of novel drug targets in order to enhance anti-tumor activity with less toxicity to patients. This extensive review covers various molecular aspects of cordycepin interactions with its recognized cellular targets and proposes the development of novel therapeutic strategies for cancer treatment. © 2013 Elsevier Inc. All rights reserved.

Development of High Cordycepin-Producing Cordyceps militaris Strains.

PubMed

Kang, Naru; Lee, Hyun-Hee; Park, Inmyoung; Seo, Young-Su

2017-03-01

Cordyceps militaris , known as Dong-Chong-Xia-Cao, produces the most cordycepin among Cordyceps species and can be cultured artificially. For these reasons, C. militaris is widely used as herb or functional food in the East Asia. In this study, we developed a new strain of C. militaris that produces higher cordycepin content than parent strains through mating-based sexual reproduction. Twenty parent strains were collected and identified as C. militaris based on internal trasncrived spacer and rDNA sequences. Seven single spores of MAT 1-1 idiomorph and five single spores of MAT 1-2 idiomorph were isolated from 12 parent strains. When 35 combinations were mated on the brown rice medium with the isolated single spores, eight combinations formed a stroma with a normal perithecia and confirmed mated strains. High pressure liquid chromatography analysis showed that mated strain KSP8 produced the most cordycepin in all the media among all the tested strains. This result showed due to genetic recombination occurring during the sexual reproduction of C. militaris . The development of C. militaris strain with increased cordycepin content by this approach can help not only to generate new C. militaris strains, but also to contribute to the health food or medicine industry.

Development of High Cordycepin-Producing Cordyceps militaris Strains

PubMed Central

Kang, Naru; Lee, Hyun-Hee; Park, Inmyoung

2017-01-01

Cordyceps militaris, known as Dong-Chong-Xia-Cao, produces the most cordycepin among Cordyceps species and can be cultured artificially. For these reasons, C. militaris is widely used as herb or functional food in the East Asia. In this study, we developed a new strain of C. militaris that produces higher cordycepin content than parent strains through mating-based sexual reproduction. Twenty parent strains were collected and identified as C. militaris based on internal trasncrived spacer and rDNA sequences. Seven single spores of MAT 1-1 idiomorph and five single spores of MAT 1-2 idiomorph were isolated from 12 parent strains. When 35 combinations were mated on the brown rice medium with the isolated single spores, eight combinations formed a stroma with a normal perithecia and confirmed mated strains. High pressure liquid chromatography analysis showed that mated strain KSP8 produced the most cordycepin in all the media among all the tested strains. This result showed due to genetic recombination occurring during the sexual reproduction of C. militaris. The development of C. militaris strain with increased cordycepin content by this approach can help not only to generate new C. militaris strains, but also to contribute to the health food or medicine industry. PMID:28435352

Authentication of Cordyceps sinensis by DNA Analyses: Comparison of ITS Sequence Analysis and RAPD-Derived Molecular Markers.

PubMed

Lam, Kelly Y C; Chan, Gallant K L; Xin, Gui-Zhong; Xu, Hong; Ku, Chuen-Fai; Chen, Jian-Ping; Yao, Ping; Lin, Huang-Quan; Dong, Tina T X; Tsim, Karl W K

2015-12-15

Cordyceps sinensis is an endoparasitic fungus widely used as a tonic and medicinal food in the practice of traditional Chinese medicine (TCM). In historical usage, Cordyceps specifically is referring to the species of C. sinensis. However, a number of closely related species are named themselves as Cordyceps, and they are sold commonly as C. sinensis. The substitutes and adulterants of C. sinensis are often introduced either intentionally or accidentally in the herbal market, which seriously affects the therapeutic effects or even leads to life-threatening poisoning. Here, we aim to identify Cordyceps by DNA sequencing technology. Two different DNA-based approaches were compared. The internal transcribed spacer (ITS) sequences and the random amplified polymorphic DNA (RAPD)-sequence characterized amplified region (SCAR) were developed here to authenticate different species of Cordyceps. Both approaches generally enabled discrimination of C. sinensis from others. The application of the two methods, supporting each other, increases the security of identification. For better reproducibility and faster analysis, the SCAR markers derived from the RAPD results provide a new method for quick authentication of Cordyceps.

Enhancement of Neuromuscular Activity by Natural Specimens and Cultured Mycelia of Cordyceps sinensis in Mice

PubMed Central

Singh, K. P.; Meena, H. S.; Negi, P. S.

2014-01-01

The present study was aimed to evaluate the effect of natural specimen and laboratory cultured mycelia of Cordyceps sinensis on neuromuscular activity in mice. The powder of natural specimen and laboratory cultured Cordyceps sinensis was orally administered at the dose rate of 100, 300 and 500 mg/kg for 30 days. Natural specimen and in vitro propagated Cordyceps sinensis showed significant (P<0.05) enhancement in neuromuscular endurance and antidepressant activity at 300 and 500 mg/kg as compared to the control group. However, the fungus did not proved to be as effective as fluoxetine in exhibiting antidepressant action. Muscular endurance was determined on a Rota rod apparatus while antidepressant (mood elevating) activity was measured on a photoactometer in Swiss albino mice. The effects produced by both natural specimens and laboratory cultured Cordyceps sinensis were comparable and showed almost equal potency. PMID:25425763

Traditional uses and medicinal potential of Cordyceps sinensis of Sikkim

PubMed Central

Panda, Ashok Kumar; Swain, Kailash Chandra

2011-01-01

Cordyceps sinensis has been described as a medicine in old Chinese medical books and Tibetan medicine. It is a rare combination of a caterpillar and a fungus and found at altitudes above 4500m in Sikkim. Traditional healers and local people of North Sikkim recommend the mushroom, i.e., Yarsa gumba, Keera jhar (C. sinensis) for all diseases either as a single drug or combined with other herbs. The present study was undertaken to collect information regarding the traditional uses of cordyceps in Sikkim. It was found that most local folk healers/traditional healers use cordyceps for the treatment of 21 ailments. A modern literature search was carried out to assess whether the curative effects are valid or just blind faith of local people. Chemical constituents of cordyceps are given and pharmacological and biological studies reviewed. More mechanism-based and disease-oriented clinical studies are recommended. PMID:21731381

Enhancement of Neuromuscular Activity by Natural Specimens and Cultured Mycelia of Cordyceps sinensis in Mice.

PubMed

Singh, K P; Meena, H S; Negi, P S

2014-09-01

The present study was aimed to evaluate the effect of natural specimen and laboratory cultured mycelia of Cordyceps sinensis on neuromuscular activity in mice. The powder of natural specimen and laboratory cultured Cordyceps sinensis was orally administered at the dose rate of 100, 300 and 500 mg/kg for 30 days. Natural specimen and in vitro propagated Cordyceps sinensis showed significant (P<0.05) enhancement in neuromuscular endurance and antidepressant activity at 300 and 500 mg/kg as compared to the control group. However, the fungus did not proved to be as effective as fluoxetine in exhibiting antidepressant action. Muscular endurance was determined on a Rota rod apparatus while antidepressant (mood elevating) activity was measured on a photoactometer in Swiss albino mice. The effects produced by both natural specimens and laboratory cultured Cordyceps sinensis were comparable and showed almost equal potency.

Improvement of Learning and Memory Induced by Cordyceps Polypeptide Treatment and the Underlying Mechanism

PubMed Central

2018-01-01

Our previous research revealed that Cordyceps militaris can improve the learning and memory, and although the main active ingredient should be its polypeptide complexes, the underlying mechanism of its activity remains poorly understood. In this study, we explored the mechanisms by which Cordyceps militaris improves learning and memory in a mouse model. Mice were given scopolamine hydrobromide intraperitoneally to establish a mouse model of learning and memory impairment. The effects of Cordyceps polypeptide in this model were tested using the Morris water maze test; serum superoxide dismutase activity; serum malondialdehyde levels; activities of acetyl cholinesterase, Na+-k+-ATPase, and nitric oxide synthase; and gamma aminobutyric acid and glutamate contents in brain tissue. Moreover, differentially expressed genes and the related cellular signaling pathways were screened using an mRNA expression profile chip. The results showed that the genes Pik3r5, Il-1β, and Slc18a2 were involved in the effects of Cordyceps polypeptide on the nervous system of these mice. Our findings suggest that Cordyceps polypeptide may improve learning and memory in the scopolamine-induced mouse model of learning and memory impairment by scavenging oxygen free radicals, preventing oxidative damage, and protecting the nervous system. PMID:29736181

High-throughput sequencing-based analysis of endogenetic fungal communities inhabiting the Chinese Cordyceps reveals unexpectedly high fungal diversity

PubMed Central

Xia, Fei; Chen, Xin; Guo, Meng-Yuan; Bai, Xiao-Hui; Liu, Yan; Shen, Guang-Rong; Li, Yu-Ling; Lin, Juan; Zhou, Xuan-Wei

2016-01-01

Chinese Cordyceps, known in Chinese as “DongChong XiaCao”, is a parasitic complex of a fungus (Ophiocordyceps sinensis) and a caterpillar. The current study explored the endogenetic fungal communities inhabiting Chinese Cordyceps. Samples were collected from five different geographical regions of Qinghai and Tibet, and the nuclear ribosomal internal transcribed spacer-1 sequences from each sample were obtained using Illumina high-throughput sequencing. The results showed that Ascomycota was the dominant fungal phylum in Chinese Cordyceps and its soil microhabitat from different sampling regions. Among the Ascomycota, 65 genera were identified, and the abundant operational taxonomic units showed the strongest sequence similarity to Ophiocordyceps, Verticillium, Pseudallescheria, Candida and Ilyonectria Not surprisingly, the genus Ophiocordyceps was the largest among the fungal communities identified in the fruiting bodies and external mycelial cortices of Chinese Cordyceps. In addition, fungal communities in the soil microhabitats were clustered separately from the external mycelial cortices and fruiting bodies of Chinese Cordyceps from different sampling regions. There was no significant structural difference in the fungal communities between the fruiting bodies and external mycelial cortices of Chinese Cordyceps. This study revealed an unexpectedly high diversity of fungal communities inhabiting the Chinese Cordyceps and its microhabitats. PMID:27625176

Rapid authentication of Cordyceps by lateral flow dipstick.

PubMed

Wong, Yuk-Lau; Wong, Ka-Lok; Shaw, Pang-Chui

2015-01-01

Cordyceps (Dongchongxiacao), a valuable traditional Chinese medicine, is composed of the fruiting body of Ophiocordyceps sinensis (Family: Ophiocordycipitaceae) on a caterpillar of ghost-moth species (Family: Hepialidae). Owing to its multiple potential functions, Cordyceps are in great demand and represent significant economic value. Adulterants or substitutes named Cordyceps or Chongcao from related fungi have been reported. In this study, polymerase chain reaction (PCR) coupled with a lateral flow dipstick (LFD) system was developed to distinguish genuine herb O. sinensis from its common adulterant Cordyceps gunnii and Cordyceps militaris. Specific primers (EF-CS-F1-Biotin, EF-CG-F1-Biotin and EF-CM-F1- Biotin) were designed to differentiate the three Cordyceps species. Internal control (EF-F1-b-DIG and EF-R1-FITC) was included to minimize the false signal due to PCR inhibitors or DNA degradation. LFD was then successfully employed for speedy and accurate detection of the respective PCR products. Copyright © 2015 Elsevier B.V. All rights reserved.

Mycelia extracts of fungal strains isolated from Cordyceps sinensis differently enhance the function of RAW 264.7 macrophages.

PubMed

Meng, Lan-Zhen; Lin, Bao-Qin; Wang, Bo; Feng, Kun; Hu, De-Jun; Wang, Lan-Ying; Cheong, Kit-Leong; Zhao, Jing; Li, Shao-Ping

2013-07-30

Cordyceps sinensis, an entomogenous fungus used in traditional Chinese medicine with multiple pharmacological activities. However, its usage has been limited due to the high price and short supply. Isolate of fungi strains from natural Cordyceps sinensis to achieve a large-scale production by fermentation is an alternative choice. The aim of this study was to investigate and compare the effects of mycelia extracts of different fungal stains isolated from natural Cordyceps sinensis on macrophage functions in vitro. Macrophages' proliferation, phagocytosis, nitric oxide (NO) production, cytokines secretion, iNOS, NF-κB p65 activation and translocation were investigated by the MTT assay, flow cytometry assay, Griess reagent method, ELISA, western blot and immunostaining assay, respectively. The results showed that the effects of cultured Cordyceps mycelia of different fungal strains isolated from natural Cordyceps sinensis on macrophages greatly variant. Among 17 Cordyceps aqueous extracts, only five extracts (UM01, QH11, BNQM, GNCC and DCXC) could significantly increase cell proliferation and NO production of RAW 264.7 mouse macrophages. Moreover, the five extracts, especially UM01 and QH11, significantly enhanced phagocytosis and promoted cytokines release of macrophages. Polysaccharides in cultured UM01 mycelia were found to be the main immune stimulating compounds. The variation of biological effects of fermented mycelia of different fungal strains from natural Cordyceps sinensis may be derived from their chemical diversity, especially polysaccharides, which need further study in future. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Evaluation of an Epitypified Ophiocordyceps formosana (Cordyceps s.l.) for Its Pharmacological Potential

PubMed Central

Wang, Yen-Wen; Hong, Tzu-Wen; Tai, Yu-Ling; Wang, Ying-Jing; Tsai, Sheng-Hong; Lien, Pham Thi Kim; Chou, Tzu-Ho; Lai, Jui-Ya; Chu, Richard; Ding, Shih-Torng; Irie, Kenji; Li, Tsai-Kun; Tzean, Shean-Shong; Shen, Tang-Long

2015-01-01

The substantial merit of Cordyceps s.l. spp. in terms of medicinal benefits is largely appreciated. Nevertheless, only few studies have characterized and examined the clinical complications of the use of health tonics containing these species. Here, we epitypified C. formosana isolates that were collected and characterized as Ophiocordyceps formosana based on morphological characteristics, molecular phylogenetic analyses, and metabolite profiling. Thus, we renamed and transferred C. formosana to the new protologue Ophiocordyceps formosana (Kobayasi & Shimizu) Wang, Tsai, Tzean & Shen comb. nov. Additionally, the pharmacological potential of O. formosana was evaluated based on the hot-water extract from its mycelium. The relative amounts of the known bioactive ingredients that are unique to Cordyceps s.l. species in O. formosana were found to be similar to the amounts in O. sinensis and C. militaris, indicating the potential applicability of O. formosana for pharmacological uses. Additionally, we found that O. formosana exhibited antioxidation activities in vitro and in vivo that were similar to those of O. sinensis and C. militaris. Furthermore, O. formosana also displayed conspicuously effective antitumor activity compared with the tested Cordyceps s.l. species. Intrinsically, O. formosana exhibited less toxicity than the other Cordyceps species. Together, our data suggest that the metabolites of O. formosana may play active roles in complementary medicine. PMID:26451152

Protective effect of extract of Cordyceps sinensis in middle cerebral artery occlusion-induced focal cerebral ischemia in rats

PubMed Central

2010-01-01

Background Ischemic hypoxic brain injury often causes irreversible brain damage. The lack of effective and widely applicable pharmacological treatments for ischemic stroke patients may explain a growing interest in traditional medicines. From the point of view of "self-medication" or "preventive medicine," Cordyceps sinensis was used in the prevention of cerebral ischemia in this paper. Methods The right middle cerebral artery occlusion model was used in the study. The effects of Cordyceps sinensis (Caterpillar fungus) extract on mortality rate, neurobehavior, grip strength, lactate dehydrogenase, glutathione content, Lipid Peroxidation, glutathione peroxidase activity, glutathione reductase activity, catalase activity, Na+K+ATPase activity and glutathione S transferase activity in a rat model were studied respectively. Results Cordyceps sinensis extract significantly improved the outcome in rats after cerebral ischemia and reperfusion in terms of neurobehavioral function. At the same time, supplementation of Cordyceps sinensis extract significantly boosted the defense mechanism against cerebral ischemia by increasing antioxidants activity related to lesion pathogenesis. Restoration of the antioxidant homeostasis in the brain after reperfusion may have helped the brain recover from ischemic injury. Conclusions These experimental results suggest that complement Cordyceps sinensis extract is protective after cerebral ischemia in specific way. The administration of Cordyceps sinensis extract significantly reduced focal cerebral ischemic/reperfusion injury. The defense mechanism against cerebral ischemia was by increasing antioxidants activity related to lesion pathogenesis. PMID:20955613

Protective effect of extract of Cordyceps sinensis in middle cerebral artery occlusion-induced focal cerebral ischemia in rats.

PubMed

Liu, Zhenquan; Li, Pengtao; Zhao, Dan; Tang, Huiling; Guo, Jianyou

2010-10-19

Ischemic hypoxic brain injury often causes irreversible brain damage. The lack of effective and widely applicable pharmacological treatments for ischemic stroke patients may explain a growing interest in traditional medicines. From the point of view of "self-medication" or "preventive medicine," Cordyceps sinensis was used in the prevention of cerebral ischemia in this paper. The right middle cerebral artery occlusion model was used in the study. The effects of Cordyceps sinensis (Caterpillar fungus) extract on mortality rate, neurobehavior, grip strength, lactate dehydrogenase, glutathione content, Lipid Peroxidation, glutathione peroxidase activity, glutathione reductase activity, catalase activity, Na+K+ATPase activity and glutathione S transferase activity in a rat model were studied respectively. Cordyceps sinensis extract significantly improved the outcome in rats after cerebral ischemia and reperfusion in terms of neurobehavioral function. At the same time, supplementation of Cordyceps sinensis extract significantly boosted the defense mechanism against cerebral ischemia by increasing antioxidants activity related to lesion pathogenesis. Restoration of the antioxidant homeostasis in the brain after reperfusion may have helped the brain recover from ischemic injury. These experimental results suggest that complement Cordyceps sinensis extract is protective after cerebral ischemia in specific way. The administration of Cordyceps sinensis extract significantly reduced focal cerebral ischemic/reperfusion injury. The defense mechanism against cerebral ischemia was by increasing antioxidants activity related to lesion pathogenesis.

Pharmacological and therapeutic potential of Cordyceps with special reference to Cordycepin.

PubMed

Tuli, Hardeep S; Sandhu, Sardul S; Sharma, A K

2014-02-01

An entomopathogenic fungus, Cordyceps sp. has been known to have numerous pharmacological and therapeutic implications, especially, in terms of human health making it a suitable candidate for ethno-pharmacological use. Main constituent of the extract derived from this fungus comprises a novel bio-metabolite called as Cordycepin (3'deoxyadenosine) which has a very potent anti-cancer, anti-oxidant and anti-inflammatory activities. The current review discusses about the broad spectrum potential of Cordycepin including biological and pharmacological actions in immunological, hepatic, renal, cardiovascular systems as well as an anti-cancer agent. The article also reviews the current efforts to delineate the mechanism of action of Cordycepin in various bio-molecular processes. The study will certainly draw the attention of scientific community to improve the bioactivity and production of Cordycepin for its commercial use in pharmacological and medical fields.

Targeted Gene Deletion in Cordyceps militaris Using the Split-Marker Approach.

PubMed

Lou, HaiWei; Ye, ZhiWei; Yun, Fan; Lin, JunFang; Guo, LiQiong; Chen, BaiXiong; Mu, ZhiXian

2018-05-01

The macrofungus Cordyceps militaris contains many kinds of bioactive ingredients that are regulated by functional genes, but the functions of many genes in C. militaris are still unknown. In this study, to improve the frequency of homologous integration, a genetic transformation system based on a split-marker approach was developed for the first time in C. militaris to knock out a gene encoding a terpenoid synthase (Tns). The linear and split-marker deletion cassettes were constructed and introduced into C. militaris protoplasts by PEG-mediated transformation. The transformation of split-marker fragments resulted in a higher efficiency of targeted gene disruption than the transformation of linear deletion cassettes did. The color phenotype of the Tns gene deletion mutants was different from that of wild-type C. militaris. Moreover, a PEG-mediated protoplast transformation system was established, and stable genetic transformants were obtained. This method of targeted gene deletion represents an important tool for investigating the role of C. militaris genes.

Efficacy of Cordyceps sinensis as an adjunctive treatment in kidney transplant patients: A systematic-review and meta-analysis.

PubMed

Ong, Bee Yean; Aziz, Zoriah

2017-02-01

Cordyceps sinensis (cordyceps) is a fungus used in traditional Chinese medicine as adjuvant immunosuppressive agent in patients with kidney transplant. This review evaluates current evidence on the efficacy and safety of natural and fermented cordyceps preparations in patients with kidney transplant. English and Chinese electronic databases including The Cochrane Central Register of Controlled Trials, EMBASE, MEDLINE, and CNKI (China National Knowledge Infrastructure) were searched up to December 2015 for relevant randomized controlled trials. Journals and conference proceedings were also searched. Two review authors independently selected trials for inclusion, extracted data, and assessed methodological quality. The primary outcome measures were incidence of acute graft rejection in the first year post-transplantation, one-year graft survival rate (defined as the percentage of patients with functioning grafts) and patient survival rate (or all-cause mortality). Nine studies were eligible for inclusion. These studies were considered to be at moderate risk of bias due to poor reporting of methods. Four studies that compared cordyceps-based therapy with azathioprine-based therapy gave comparable acute rejection rates, and graft and patient survival. The cordyceps-treated group however showed better kidney function and lower incidences of hyperuricemia, hyperlipidemia, hyperglycemia and liver injury. Cordyceps used with different combinations of immunosuppressant therapy showed significant reduction in proteinuria after 6-12 months. Compared to the group receiving cyclosporine A monotherapy, treatment with a combination of cordyceps and cyclosporine A showed less treatment-induced nephrotoxicity. Adverse events were either not monitored or poorly documented in most trials. Current evidence shows that cordyceps as an adjuvant to routine immunosuppressant therapy may benefit kidney transplant patient, however, better quality evidence is still required. Copyright © 2016 Elsevier Ltd. All rights reserved.

Optimization of extraction of polysaccharides from fruiting body of Cordyceps militaris (L.) link using response surface methodology

NASA Astrophysics Data System (ADS)

Nguyen, Hoang Chinh; Thi, Dinh Huynh Mong; Pham, Dinh Chuong

2018-04-01

Polysaccharides from fruiting body of Cordyceps militaris (L.) Link possess various pharmaceutical activities. In this study, polysaccharides from the fruiting body of C. militaris were extracted with different solvents. Of those solvents tested, distilled water was identified as the most efficient solvent for the extraction, resulting in a significant increase in polysaccharides yield. Response surface methodology was then used to optimize the extraction conditions and establish a reliable mathematical model for prediction. A maximum polysaccharides yield of 11.07% was reached at a ratio of water to raw material of 23.2:1 mL/g, an extraction time of 76 min, and a temperature of 93.6°C. This study indicates that the obtained optimal extraction conditions are an efficient method for extraction of polysaccharides from the fruiting body of C. militaris.

Isolation and purification of a polysaccharide from the caterpillar medicinal mushroom Cordyceps militaris (Ascomycetes) fruit bodies and its immunomodulation of RAW 264.7 macrophages.

PubMed

Zhu, Lina; Tang, Qingjiu; Zhou, Shuai; Liu, Yanfang; Zhang, Zhong; Gao, Xinhua; Wang, Shiping; Wang, Zhaolong

2014-01-01

A novel polysaccharide (CP2-S) was purified from Cordyceps militaris fruit bodies by hot water extraction, ethanol precipitation, DEAE-Sepharose Fast Flow and Sephacryl S-400 high-resolution chromatography. The polysaccharide had a molecular weight of 5.938 × 10(6) g/mol and was mainly composed of glucose. CP2-S had carbohydrate content estimated to be 100% using the phenol-sulfuric acid method. Immunostimulating experiments in vitro indicated that CP2-S could stimulate nitric oxide production, phagocytosis, respiratory burst activity, and secretion of interleukin-1β and interleukin-2 of macrophages, suggesting that this water-soluble polysaccharide from the fruit body of C. militaris is a natural immunostimulating polysaccharide with potential for further application.

Cordyceps militaris extract attenuates D-galactose-induced memory impairment in mice.

PubMed

Li, Zaixin; Zhang, Zhi; Zhang, Jinshan; Jia, Jing; Ding, Jie; Luo, Rongzhen; Liu, Zhangqin

2012-12-01

Memory impairment is one of main clinical symptoms of brain senescence. To address the effects of Cordyceps militaris Link extract (CE) on memory impairment, a D-galactose (D-Gal)-induced aging mouse model was employed. Mice injected with D-Gal showed a significant learning and memory impairment that was rescued by CE treatment. The mechanism was further investigated by analyzing the protein level and activity of oxidant and antioxidant molecules, including malondialdehyde (MDA), monoamine oxidase (MAO), total super-oxide dismutase (T-SOD), total antioxidant capacity (T-AOC), glutathione (GSH), and glutathione peroxidase (GSH-px), which played critical roles in the development of brain senescence. The results showed that CE treatment resulted in a significant decrease in the oxidative activity of MAO and the level of MDA, and significantly increased the antioxidant activities of T-SOD and T-AOC in the cerebral cortices. Moreover, the level of GSH and the activity of antioxidant enzymes GSH-px in serum were significantly upregulated after CE treatment. Taken together, our results suggest that Cordyceps militaris extract could ameliorate experimental memory impairment in mice with D-Gal-induced aging through its potent antioxidant activities.

Entomopathogenicity and Biological Attributes of Himalayan Treasured Fungus Ophiocordyceps sinensis (Yarsagumba)

PubMed Central

Baral, Bikash

2017-01-01

Members of the entomophagous fungi are considered very crucial in the fungal domain relative to their natural phenomenon and economic perspectives; however, inadequate knowledge of their mechanisms of interaction keeps them lagging behind in parallel studies of fungi associated with agro-ecology, forest pathology and medical biology. Ophiocordyceps sinensis (syn. Cordyceps sinensis), an intricate fungus-caterpillar complex after it parasitizes the larva of the moth, is a highly prized medicinal fungus known widely for ages due to its peculiar biochemical assets. Recent technological innovations have significantly contributed a great deal to profiling the variable clinical importance of this fungus and other related fungi with similar medicinal potential. However, a detailed mechanism behind fungal pathogenicity and fungal-insect interactions seems rather ambiguous and is poorly justified, demanding special attention. The goal of the present review is to divulge an update on the published data and provides promising insights on different biological events that have remained underemphasized in previous reviews on fungal biology with relation to life-history trade-offs, host specialization and selection pressures. The infection of larvae by a fungus is not a unique event in Cordyceps; hence, other fungal species are also reviewed for effective comparison. Conceivably, the rationale and approaches behind the inheritance of pharmacological abilities acquired and stored within the insect framework at a time when they are completely hijacked and consumed by fungal parasites, and the molecular mechanisms involved therein, are clearly documented. PMID:29371523

Molecular Markers to Detect the Formation of Heterokaryon and Homokaryon from Asexual Spores of the Caterpillar Medicinal Mushroom, Cordyceps militaris (Ascomycetes).

PubMed

Wang, Hong; Cai, Tao; Wei, Jing; Feng, Aiping; Lin, Nan; Bao, Dapeng

2015-01-01

Cordyceps militaris is widely cultivated on artificial media in China; however, the cultures often are afflicted with the degeneration of nonfruiting strains. To understand the mechanism of degeneration of C. militaris, from the heterokaryotic strain into the homokaryotic strain, we examined the mating-type genes present in individual asexual spores. Further, we determined the distribution ratio of the different mating-type genes among a sample of asexual spores and the growth rate of heterokaryotic and homokaryotic strains of C. militaris. The distribution ratio of 3 groups of asexual spores from C. militaris heterokaryotic strains was determined as 1:1:1 by statistical analysis, whereas that of the two types of nuclei among asexual spores was 1:1. Nearly two-thirds of the asexual spore isolates were homokaryon, which showed a growth speed similar to the heterokaryon. However, the homokaryon (bearing mating-type MAT-HMG) grew significantly faster at times compared with the heterokaryon. Therefore, the purity of the spawn was difficult to establish. C. militaris heterokaryotic strains can transform into a homokaryotic strain following continued subculture.

Metabolomic comparison between wild Ophiocordyceps sinensis and artificial cultured Cordyceps militaris.

PubMed

Chen, Lin; Liu, Yuetao; Guo, Qingfeng; Zheng, Qingxia; Zhang, Wancun

2018-05-11

A systematic study on the metabolome differences between wild Ophiocordyceps sinensis and artificial cultured Cordyceps militaris was conducted using liquid chromatography-mass spectrometry. Principal component analysis and orthogonal projection on latent structure-discriminant analysis results showed that C. militaris grown on solid rice medium (R-CM) and C. militaris grown on tussah pupa (T-CM) evidently separated and individually separated from wild O. sinensis, indicating metabolome difference among wild O. sinensis, R-CM and T-CM. The metabolome differences between R-CM and T-CM indicated that C. militaris could accommodate to culture medium by differential metabolic regulation. Hierarchical clustering analysis was further performed to cluster the differential metabolites and samples based on their metabolic similarity. The higher content of amino acids (pyroglutamic acid, glutamic acid, histidine, phenylalanine and arginine), unsaturated fatty acid (linolenic acid and linoleic acid), peptides, mannitol, adenosine and succinoadenosine in O. sinensis make it as an excellent choice as a traditional Chinese medicine for invigoration or nutritional supplementation. Similar compositions with O. sinensis and easy cultivation make artificially cultured C. militaris a possible alternative to O. sinensis. Copyright © 2018 John Wiley & Sons, Ltd.

Heterothallic Type of Mating System for Cordyceps cardinalis

PubMed Central

Sung, Gi-Ho; Shrestha, Bhushan; Han, Sang-Kuk; Kim, Soo-Young

2010-01-01

Cordyceps cardinalis successfully produced its fruiting bodies from multi-ascospore isolates. However, subcultures of multi-ascospore isolates could not produce fruiting bodies after few generations. Fruiting body production also differed from sector to sector of the same isolate. Single ascospore isolates were then co-inoculated in combinations of two to observe the fruiting characteristics. Combinations of certain isolates produced perithecial stromata formation, whereas other combinations did not produce any fruiting bodies. These results show that C. cardinalis is a heterothallic fungus, requiring two isolates of opposite mating types for fruiting body production. It was also shown that single ascospore isolates are hermaphrodites. PMID:23956667

Genome-scale metabolic network of Cordyceps militaris useful for comparative analysis of entomopathogenic fungi.

PubMed

Vongsangnak, Wanwipa; Raethong, Nachon; Mujchariyakul, Warasinee; Nguyen, Nam Ninh; Leong, Hon Wai; Laoteng, Kobkul

2017-08-30

The first genome-scale metabolic network of Cordyceps militaris (iWV1170) was constructed representing its whole metabolisms, which consisted of 894 metabolites and 1,267 metabolic reactions across five compartments, including the plasma membrane, cytoplasm, mitochondria, peroxisome and extracellular space. The iWV1170 could be exploited to explain its phenotypes of growth ability, cordycepin and other metabolites production on various substrates. A high number of genes encoding extracellular enzymes for degradation of complex carbohydrates, lipids and proteins were existed in C. militaris genome. By comparative genome-scale analysis, the adenine metabolic pathway towards putative cordycepin biosynthesis was reconstructed, indicating their evolutionary relationships across eleven species of entomopathogenic fungi. The overall metabolic routes involved in the putative cordycepin biosynthesis were also identified in C. militaris, including central carbon metabolism, amino acid metabolism (glycine, l-glutamine and l-aspartate) and nucleotide metabolism (adenosine and adenine). Interestingly, a lack of the sequence coding for ribonucleotide reductase inhibitor was observed in C. militaris that might contribute to its over-production of cordycepin. Copyright © 2017. Published by Elsevier B.V.

A Systematic Review of the Mysterious Caterpillar Fungus Ophiocordyceps sinensis in Dong-ChongXiaCao (冬蟲夏草 Dōng Chóng Xià Cǎo) and Related Bioactive Ingredients

PubMed Central

Lo, Hui-Chen; Hsieh, Chienyan; Lin, Fang-Yi; Hsu, Tai-Hao

2013-01-01

The caterpillar fungus Ophiocordyceps sinensis (syn.† Cordyceps sinensis), which was originally used in traditional Tibetan and Chinese medicine, is called either “yartsa gunbu” or “DongChongXiaCao (冬蟲夏草 Dōng Chóng Xià Cǎo)” (“winter worm-summer grass”), respectively. The extremely high price of DongChongXiaCao, approximately USD $20,000 to 40,000 per kg, has led to it being regarded as “soft gold” in China. The multi-fungi hypothesis has been proposed for DongChongXiaCao; however, Hirsutella sinensis is the anamorph of O. sinensis. In Chinese, the meaning of “DongChongXiaCao” is different for O. sinensis, Cordyceps spp.,‡ and Cordyceps spƒ. Over 30 bioactivities, such as immunomodulatory, antitumor, anti-inflammatory, and antioxidant activities, have been reported for wild DongChongXiaCao and for the mycelia and culture supernatants of O. sinensis. These bioactivities derive from over 20 bioactive ingredients, mainly extracellular polysaccharides, intracellular polysaccharides, cordycepin, adenosine, mannitol, and sterols. Other bioactive components have been found as well, including two peptides (cordymin and myriocin), melanin, lovastatin, γ-aminobutyric acid, and cordysinins. Recently, the bioactivities of O. sinensis were described, and they include antiarteriosclerosis, antidepression, and antiosteoporosis activities, photoprotection, prevention and treatment of bowel injury, promotion of endurance capacity, and learning-memory improvement. H. sinensis has the ability to accelerate leukocyte recovery, stimulate lymphocyte proliferation, antidiabetes, and improve kidney injury. Starting January 1st, 2013, regulation will dictate that one fungus can only have one name, which will end the system of using separate names for anamorphs. The anamorph name “H. sinensis” has changed by the International Code of Nomenclature for algae, fungi, and plants to O. sinensis. PMID:24716152

Phylogenetic classification of Cordyceps and the clavicipitaceous fungi

PubMed Central

Sung, Gi-Ho; Hywel-Jones, Nigel L.; Sung, Jae-Mo; Luangsa-ard, J. Jennifer; Shrestha, Bhushan; Spatafora, Joseph W.

2007-01-01

Cordyceps, comprising over 400 species, was historically classified in the Clavicipitaceae, based on cylindrical asci, thickened ascus apices and filiform ascospores, which often disarticulate into part-spores. Cordyceps was characterized by the production of well-developed often stipitate stromata and an ecology as a pathogen of arthropods and Elaphomyces with infrageneric classifications emphasizing arrangement of perithecia, ascospore morphology and host affiliation. To refine the classification of Cordyceps and the Clavicipitaceae, the phylogenetic relationships of 162 taxa were estimated based on analyses consisting of five to seven loci, including the nuclear ribosomal small and large subunits (nrSSU and nrLSU), the elongation factor 1α (tef1), the largest and the second largest subunits of RNA polymerase II (rpb1 and rpb2), β-tubulin (tub), and mitochondrial ATP6 (atp6). Our results strongly support the existence of three clavicipitaceous clades and reject the monophyly of both Cordyceps and Clavicipitaceae. Most diagnostic characters used in current classifications of Cordyceps (e.g., arrangement of perithecia, ascospore fragmentation, etc.) were not supported as being phylogenetically informative; the characters that were most consistent with the phylogeny were texture, pigmentation and morphology of stromata. Therefore, we revise the taxonomy of Cordyceps and the Clavicipitaceae to be consistent with the multi-gene phylogeny. The family Cordycipitaceae is validated based on the type of Cordyceps, C. militaris, and includes most Cordyceps species that possess brightly coloured, fleshy stromata. The new family Ophiocordycipitaceae is proposed based on Ophiocordyceps Petch, which we emend. The majority of species in this family produce darkly pigmented, tough to pliant stromata that often possess aperithecial apices. The new genus Elaphocordyceps is proposed for a subclade of the Ophiocordycipitaceae, which includes all species of Cordyceps that parasitize the fungal genus Elaphomyces and some closely related species that parasitize arthropods. The family Clavicipitaceae s. s. is emended and includes the core clade of grass symbionts (e.g., Balansia, Claviceps, Epichloë, etc.), and the entomopathogenic genus Hypocrella and relatives. In addition, the new genus Metacordyceps is proposed for Cordyceps species that are closely related to the grass symbionts in the Clavicipitaceae s. s. Metacordyceps includes teleomorphs linked to Metarhizium and other closely related anamorphs. Two new species are described, and lists of accepted names for species in Cordyceps, Elaphocordyceps, Metacordyceps and Ophiocordyceps are provided. PMID:18490993

Evaluation of different agricultural wastes for the production of fruiting bodies and bioactive compounds by medicinal mushroom Cordyceps militaris.

PubMed

Lin, Qunying; Long, Liangkun; Wu, Liangliang; Zhang, Fenglun; Wu, Shuling; Zhang, Weiming; Sun, Xiaoming

2017-08-01

In commercial production of Cordyceps militaris (a famous Chinese medicine), cereal grains are usually utilized as cultivation substrates. This study aimed to evaluate the efficiency of agricultural wastes as substitute materials in the low-cost production of C. militaris. Cottonseed shells (CS), corn cob particles (CCP), Italian poplar sawdusts (IPS) and substrates spent by Flammulina velutipes (SS) were employed to cultivate C. militaris, using rice medium as control. CS and CCP were suitable for fruit body formation of C. militaris, with yields of 22 and 20 g per bottle respectively. Fruit bodies grown on CCP showed the highest levels of cordycepin and adenosine, up to 9.45 and 5.86 mg g -1 respectively. The content of d-mannitol in fruit bodies obtained on CS was 120 mg g -1 (80% of the control group), followed by that on CCP, 100 mg g -1 . Fruit bodies cultivated on CCP displayed a high crude polysaccharide level of 26.9 mg g -1 , which was the closest to that of the control group (34.5 mg g -1 ). CS and CCP are effective substrates for the production of fruit bodies and bioactive compounds by C. militaris. This study provides a new approach to decreasing the cost of C. militaris cultivation and dealing with these agricultural wastes. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Production and in vivo antioxidant activity of Zn, Ge, Se-enriched mycelia by Cordyceps sinensis SU-01.

PubMed

Zheng, Lan; Hao, Long; Ma, Hua; Tian, Chengye; Li, Tong; Sun, Xinyi; Jia, Mengshi; Jia, Le

2014-09-01

Cordyceps sinensis, a traditionally edible and medicinal fungus in China, cannot be artificially solid-cultured. Zinc (Zn), germanium (Ge), and selenium (Se) are the essential trace elements for human body. In this work, C. sinensis SU-01 was cultivated in liquid medium simultaneously containing Zn, Ge, and Se. The bioactive ingredients and in vivo antioxidant activities of Zn, Ge, Se-enriched mycelia (ZGSM) of C. sinensis SU-01 were investigated. Under the determined conditions, the Zn, Ge, and Se contents of ZGSM were 2543.16 ± 158.92, 1873.85 ± 81.82, and 1260.16 ± 107.12 μg/g, respectively. The optimal concentrations of Zn, Ge, and Se had a positive effect on biosynthesis of protein, polysaccharide, cordycepic acid, and amino acids. The activities of glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) of mice blood were 3.72 ± 0.15 and 28.74 ± 2.53 % higher than that of control, respectively, and the content of malondialdehyde (MDA) was 41.01 ± 3.66 % lower than that of control.

Proposals to conserve the names Balansia claviceps against Ephelis mexicana,……,and Tolypocladium inflatum against Cordyceps subsessilis (Ascomycota: Sordariomycetes: Hypocreales)

USDA-ARS?s Scientific Manuscript database

In the course of updating the scientific names of plant-associated fungi in the U.S. National Fungus Collections Databases to conform with the requirement of one scientific name for each fungal species, several scientific names currently in use were identified that should be changed to the oldest ep...

JPRS Report, China.

DTIC Science & Technology

1989-11-03

also diligently organize the gathering, processing and purchasing of Chinese medicinal herbs such as licorice root [Radix Geycyrrhizae], rhizome of...wind-weed [Rhizoma Ane- marrhenae], and Chinese caterpillar fungus [Cordyceps chinensis], as well as wild growing cash crops to increase the masses...unchanged for com- modities including grain and edible oil, sugar, coal, matches, soap, and washing powder supplies rationed to city and town residents

Isolation and Structure Characterization of an Antioxidative Glycopeptide from Mycelial Culture Broth of a Medicinal Fungus

PubMed Central

Wu, Jian-Yong; Chen, Xia; Siu, Ka-Chai

2014-01-01

A novel glycopeptide (Cs-GP1) with an average molecular weight (Mw) of 6.0 kDa was isolated and purified by column chromatography from the lower Mw fraction of exopolysaccharide (EPS) produced by a medicinal fungus Cordyceps sinensis Cs-HK1. Its carbohydrate moiety was mainly composed of glucose and mannose at 3.2:1.0 mole ratio, indicating an O-linked glycopeptide. The peptide chain contained relatively high mole ratios of aspartic acid, glutamic acid and glycine (3.3–3.5 relative to arginine) but relatively low ratios of tyrosine and histidine. The peptide chain sequence analyzed after trypsin digestion by LC-MS was KNGIFQFGEDCAAGSISHELGGFREFREFLKQAGLE. Cs-GP1 exhibited remarkable antioxidant capacity with a Trolox equivalent antioxidant capacity of 1183.8 μmol/g and a ferric reducing ability of 611.1 μmol Fe(II)/g, and significant protective effect against H2O2-induced PC12 cell injury at a minimum dose of 10 μg/mL. This is the first report on the structure and bioactivity of an extracellular glycopeptide from the Cordyceps species. PMID:25268609

A comb-like branched β-D-glucan produced by a Cordyceps sinensis fungus and its protective effect against cyclophosphamide-induced immunosuppression in mice.

PubMed

Hu, Ting; Jiang, Chenbo; Huang, Qilin; Sun, Fengyuan

2016-05-20

An exopolysaccharide (EPS) was fractionated from fermentation media of a Cordyceps sinensis fungus (Cs-HK1) by ethanol precipitation at 2/5 volume ratio of ethanol/media. Its structural characteristics were elucidated by FT-IR, GC, GC-MS, 1D and 2D NMR combined with periodate oxidation, Smith degradation, partial acid hydrolysis, and methylation analysis. Furthermore, the immunomodulatory activity of EPS was evaluated by the model of cyclophosphamide-induced immunosuppression. The results from monosaccharide composition and partial acid hydrolysis indicated that EPS almost consisted of glucose excluding a trace amount of mannose. GC-MS and NMR analysis further confirmed EPS had a linear backbone of (1→3)-β-D-glucopyranosyl residues with a single (1→6)-β-D-glucopyranosyl side-branching unit for every three β-D-glucopyranosyl residues, showing a comb-like β-D-glucan with short and intensive branches, which was responsible for high viscosity. Moreover, EPS could significantly enhance immune organs and stimulate the release of major cytokines TNF-α and INF-γ, suggesting that EPS exhibited protective effect in immunocompromised mice. Copyright © 2016 Elsevier Ltd. All rights reserved.

Rheological behaviors of an exopolysaccharide from fermentation medium of a Cordyceps sinensis fungus (Cs-HK1).

PubMed

Sun, Fengyuan; Huang, Qilin; Wu, Jianyong

2014-12-19

The rheological behaviors of an exopolysaccharide (EPS) from a Cordyceps sinensis fungus fermentation were investigated. The intrinsic viscosity of 1986 ± 55 mL/g indicated an extended and rigid chain for EPS. Shear-thinning behavior was observed and became apparent with increasing concentration. According to cross model, two critical transition concentrations (c(*) and c(**)) from dilute solution to semidilute and then to concentrated domain were 0.45 and 6.14 mg/mL. Flow activation energy was calculated by Arrhenius equation and decreased with increasing concentration, indicating a lower sensitivity to temperature. From dynamic frequency sweep, EPS system was classified to three regions including dilution solution (1.25mg/mL), entanglement network (3.75 and 5.00 mg/mL) and weak gel (≥ 7.50 mg/mL). Notably, the increase in η(*) at high frequencies was attributed to a large flow resistance depended on the rigid chain of EPS. Based on Winter-Chambon criterion, EPS formed gel at 2.6 mg/mL (cgel) and showed typical weak gel from temperature ramp and repetitive strain sweep. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effects of Illumination Pattern during Cultivation of Fruiting Body and Bioactive Compound Production by the Caterpillar Medicinal Mushroom, Cordyceps militaris (Ascomycetes).

PubMed

Wu, Chiu-Yeh; Liang, Zeng-Chin; Tseng, Chin-Yin; Hu, Shu-Hui

2016-01-01

We investigated the effects of light intensity in the 3 cultivation stages separately-the mycelium colonization stage, the primordial initiation stage, and the fruiting stage (in order)-on fruiting body and bioactive compound production by Cordyceps militaris. In the mycelium colonization stage, rice substrates were incubated in a spawn running room at 23°C. During the primordial initiation stage, C. militaris was grown at 18°C and illuminated 12 hours/day. In the fruiting stage the temperature was 23°C, with illumination provided 12 hours/day. The highest fruiting body yield and biological efficiency were 4.06 g dry weight/bottle and 86.83%, respectively, under 1750 ± 250 lux during the second and third stages. The cordycepin content was highest during the second and third stages under 1250 ± 250 lux. The mannitol and polysaccharide contents were highest under 1250 ± 250 and 1750 ± 250 lux during the primordial initiation stage and the fruiting stage, respectively. Thus, with controlled lighting, C. militaris can be cultivated in rice-water medium to increase fruiting body yield and bioactive compound production.

[Indiscriminate use of Latin name for natural Cordyceps sinensis insect-fungi complex and multiple Ophiocordyceps sinensis fungi].

PubMed

Yao, Yi-Sang; Zhu, Jia-Shi

2016-04-01

Natural Cordyceps sinensis(Dongchongxiacao) is an insect-fungi complex containing multiple Ophiocordyceps sinensis(≡Cordyceps sinensis) fungi and dead body of larva of the family of Hepialidae. But natural C. sinensis and O. sinensis fungi use the same Latin name, resulting in uncertainty of the specific meaning, even disturbing the formulation and implementation of governmental policies and regulations, and influencing consumer psychology onthe market. This paper reviews the history and current status of the indiscriminate use of the Latin name O. sinensis for both the natural insect-fungi complex C. sinensis and O. sinensis fungi and lists the rename suggetions. Some scholars suggested using the term O. sinensis for the fungi and renaming the natural C. sinensis "Chinese cordyceps". Others suggested renaming the natural C. sinensis "Ophiocordyceps & Hepialidae". Both suggestions have not reached general consensus due to various academic concerns. This paper also reviews the exacerbation of the academic uncertainties when forcing implementing the 2011 Amsterdam Declaration "One Fungus=One Name" under the academic debate. Joint efforts of mycological, zoological and botany-TCM taxonomists and properly initiating the dispute systems offered by International Mycology Association may solve the debate on the indiscriminate use of the Latin name O.sinensis for the natural insect-fungi complex,the teleomorph and anamorph(s) of O. sinensis fungi. Copyright© by the Chinese Pharmaceutical Association.

Fermentation optimization for the production of bioactive polysaccharides from Cordyceps sinensis fungus UM01.

PubMed

Wang, Lan-Ying; Cheong, Kit-Leong; Wu, Ding-Tao; Meng, Lan-Zhen; Zhao, Jing; Li, Shao-Ping

2015-08-01

The optimal fermentation conditions and medium for the production of bioactive polysaccharides from the mycelium of Cordyceps sinensis fungus UM01 were investigated by using orthogonal design and high performance size exclusion chromatography coupled with multi-angel laser light scattering and refractive index detector (HPSEC-MALLS-RID). Results showed that the optimal temperature, initial pH, rotation speed, medium capacity (ratio of medium volume to the volume of flask bottle) and inoculums volume for the mycelium growth were 15 °C, pH 6.0, 150 rpm, 2/5 (v/v), and 3% (v/v), respectively. Furthermore, bioactive polysaccharides from the mycelium of C. sinensis fungus UM01 were determined as polysaccharide fractions with the molecular weight above 10 kDa. The optimal fermentation medium was determined as a composition of glucose 30.0 g/L, sucrose 30.0 g/L, KH2PO4 1.0 g/L, CaCl2 0.5 g/L, yeast extract 3.0 g/L, and MgCl2 0.1g/L according to the maximum amount of the bioactive polysaccharides (486.16±19.60 mg/L) measured by HPSEC-MALLS/RID. Results are helpful to establish an efficient and controllable fermentation process for the industrial production of bioactive polysaccharides from C. sinensis UM01, and beneficial to develop a unique health and functional product in future. Copyright © 2015 Elsevier B.V. All rights reserved.

Cordyceps sinensis (a traditional Chinese medicine) for treating chronic kidney disease.

PubMed

Zhang, Hong Wei; Lin, Zhi Xiu; Tung, Yuk Stewart; Kwan, Tze Hoi; Mok, Chun Keung; Leung, Connie; Chan, Lai Sum

2014-12-18

Cordyceps sinensis (Cordyceps, Dong Chong Xia Cao), a herbal medicine also known as Chinese caterpillar fungus, is one of the most commonly used ingredients in traditional Chinese medicine for the treatment of people with chronic kidney disease (CKD). This review aimed to evaluate the therapeutic effects and potential adverse effects of Cordyceps sinensis for the treatment of people with CKD. We searched the Cochrane Renal Group's Specialised Register to 14 April 2014 through contact with the Trials' Search Co-ordinator using search terms relevant to this review. We also searched CINAHL, AMED, Current Controlled Trials, OpenSIGLE, and Chinese databases including CBM, CMCC, TCMLARS, Chinese Dissertation Database, CMAC and Index to Chinese Periodical Literature. Randomised and quasi-randomised trials comparing Cordyceps or its products with placebo, no treatment, or conventional treatment were considered for inclusion in the review. Two authors independently assessed data quality and extracted data. Statistical analyses were performed using the random-effects model and the results expressed as risk ratio (RR) for dichotomous outcomes or mean difference (MD) for continuous data with 95% confidence intervals (CI). We included 22 studies that involved 1746 participants. Among people with CKD who were not receiving dialysis, Cordyceps preparations were found to significantly decrease serum creatinine (14 studies, 987 participants): MD -60.76 μmol/L, 95% CI -85.82 to -35.71); increase creatinine clearance (6 studies, 362 participants): MD 9.22 mL/min, 95% CI 3.10 to 15.34) and reduce 24 hour proteinuria (4 studies, 211 participants: MD -0.15 g/24 h, 95% CI -0.24 to -0.05). However, suboptimal reporting and flawed methodological approaches meant that risk of bias was assessed as high in four studies and unclear in 18 studies, and hence, these results need to be interpreted with caution. We found that Cordyceps preparation, as an adjuvant therapy to conventional medicine, showed potential promise to decrease serum creatinine, increase creatine clearance, reduce proteinuria and alleviate CKD-associated complications, such as increased haemoglobin and serum albumin. However, definitive conclusions could not be made because of the low quality of evidence.

Effects of Cordyceps militaris on the growth of rumen microorganisms and in vitro rumen fermentation with respect to methane emissions.

PubMed

Kim, W Y; Hanigan, M D; Lee, S J; Lee, S M; Kim, D H; Hyun, J H; Yeo, J M; Lee, S S

2014-11-01

This experiment was designed to investigate the effects of different concentrations (0.00, 0.10, 0.15, 0.20, 0.25, and 0.30 g/L) of dried Cordyceps militaris mushroom on in vitro anaerobic ruminal microbe fermentation and methane production using soluble starch as a substrate. Ruminal fluids were collected from Korean native cattle, mixed with phosphate buffer (1:2), and incubated anaerobically at 38 °C for 3, 6, 9, 12, 24, 36, 48, and 72 h. The addition of C. militaris significantly increased total volatile fatty acid and total gas production. The molar proportion of acetate was decreased and that of propionate was increased, with a corresponding decrease in the acetate:propionate ratio. As the concentration of C. militaris increased from 0.10 to 0.30 g/L, methane and hydrogen production decreased. The decrease in methane accumulation relative to the control was 14.1, 22.0, 24.9, 39.7, and 40.9% for the 0.10, 0.15, 0.20, 0.25, and 0.30 g/L treatments, respectively. Ammonia-N concentration and numbers of live protozoa decreased linearly with increasing concentrations of C. militaris. The pH of the medium significantly decreased at the highest level of C. militaris compared with the control. In conclusion, C. militaris stimulated mixed ruminal microorganism fermentation and inhibited methane production in vitro. Therefore, C. militaris could be developed as a novel compound for antimethanogenesis. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The mechanism of Cordyceps sinensis and strontium in prevention of osteoporosis in rats.

PubMed

Qi, Wei; Wang, Pu-jie; Guo, Wen-jun; Yan, Ya-bo; Zhang, Yang; Lei, Wei

2011-10-01

The effects of Cordyceps sinensis (Caterpillar fungus) and strontium ranelate on ovariectomized osteopenic rats was studied in this paper. After the rats were treated orally with C. sinensis, strontium, and C. sinensis rich in strontium ranelate (CSS) respectively, serum alkaline phosphatase (ALP), tartarate-resistant acid phosphatase (TRAP), serum osteocalcin (OC), homocysteine, C-terminal crosslinked telopeptides of collagen type I (CTX), estradiol, and interferon-gamma (IFN-γ) level were examined. The beneficial effects of CSS on improvement of osteoporosis in rats were attributable mainly to decrease ALP activity, TRAP activity, CTX level, and IFN-γ level. At the same time, CSS also increase the OC and estradiol level in ovariectomized osteopenic rats. This study demonstrates the value of C. sinensis rich in strontium ranelate in the management of postmenopausal osteoporosis in humans.

Whole genome annotation and comparative genomic analyses of bio-control fungus Purpureocillium lilacinum.

PubMed

Prasad, Pushplata; Varshney, Deepti; Adholeya, Alok

2015-11-25

The fungus Purpureocillium lilacinum is widely known as a biological control agent against plant parasitic nematodes. This research article consists of genomic annotation of the first draft of whole genome sequence of P. lilacinum. The study aims to decipher the putative genetic components of the fungus involved in nematode pathogenesis by performing comparative genomic analysis with nine closely related fungal species in Hypocreales. de novo genomic assembly was done and a total of 301 scaffolds were constructed for P. lilacinum genomic DNA. By employing structural genome prediction models, 13, 266 genes coding for proteins were predicted in the genome. Approximately 73% of the predicted genes were functionally annotated using Blastp, InterProScan and Gene Ontology. A 14.7% fraction of the predicted genes shared significant homology with genes in the Pathogen Host Interactions (PHI) database. The phylogenomic analysis carried out using maximum likelihood RAxML algorithm provided insight into the evolutionary relationship of P. lilacinum. In congruence with other closely related species in the Hypocreales namely, Metarhizium spp., Pochonia chlamydosporia, Cordyceps militaris, Trichoderma reesei and Fusarium spp., P. lilacinum has large gene sets coding for G-protein coupled receptors (GPCRs), proteases, glycoside hydrolases and carbohydrate esterases that are required for degradation of nematode-egg shell components. Screening of the genome by Antibiotics & Secondary Metabolite Analysis Shell (AntiSMASH) pipeline indicated that the genome potentially codes for a variety of secondary metabolites, possibly required for adaptation to heterogeneous lifestyles reported for P. lilacinum. Significant up-regulation of subtilisin-like serine protease genes in presence of nematode eggs in quantitative real-time analyses suggested potential role of serine proteases in nematode pathogenesis. The data offer a better understanding of Purpureocillium lilacinum genome and will enhance our understanding on the molecular mechanism involved in nematophagy.

Effect of Polysaccharide from Cordyceps militaris (Ascomycetes) on Physical Fatigue Induced by Forced Swimming.

PubMed

Xu, Yan-Feng

2016-01-01

Cordyceps militaris is the one of the most important medicinal mushrooms, widely used in East Asian countries. Polysaccharide is considered to be the principal active component in C. militaris and has a wide range of biological and pharmacological properties. This study was undertaken to investigate the effect of polysaccharide from C. militaris (PCM) on physical fatigue induced in animals through a forced swimming test. The mice were divided into 4 groups receiving 28 days' treatment with drinking water (exercise control) or low-, medium-, and high-dose PCM (40, 80, and 160 mg/kg/day, respectively). After 28 days, the mice were subjected to the forced swimming test; the exhaustive swimming time was measured and fatigue-related biochemical parameters, including serum lactic acid, urea nitrogen, creatine kinase, alanine aminotransferase, aspartate aminotransferase, superoxide dismutase, glutathi- one peroxidase, catalase, malondialdehyde, liver glycogen, and muscle glycogen, were analyzed. The results showed that PCM could significantly prolong the exhaustive swimming time of mice; decrease concentrations of serum lactic acid, urea nitrogen, creatine kinase, aspartate aminotransferase, alanine aminotransferase, and malondialdehyde; and increase liver and muscle glycogen contents and the concentrations of serum superoxide dismutase, glutathione per- oxidase, and catalase. The data suggest that PCM has an antifatigue effect, and it might become a new functional food or medicine for fatigue resistance.

Characterization of Newly Bred Cordyceps militaris Strains for Higher Production of Cordycepin through HPLC and URP-PCR Analysis.

PubMed

Lee, Hyun-Hee; Kang, Naru; Park, Inmyoung; Park, Jungwook; Kim, Inyoung; Kim, Jieun; Kim, Namgyu; Lee, Jae-Yun; Seo, Young-Su

2017-07-28

Cordyceps militaris , a member of Ascomycota, a mushroom referred to as caterpillar Dongchung-ha-cho, is commercially valuable because of its high content of bioactive substances, including cordycepin, and its potential for artificial cultivation. Cordycepin (3'-deoxyadenosine) is highly associated with the pharmacological effects of C. militaris . C. militaris is heterothallic in that two mating-type loci, idiomorph MAT1-1 and MAT1-2 , exist discretely in two different spores. In this study, nine C. militaris strains were mated with each other to prepare newly bred strains that produced a larger amount of cordycepin than the parent strains. Nine strains of C. militaris were identified by comparing the internal transcribed spacer sequence, and a total of 12 single spores were isolated from the nine strains of C. militaris . After the MAT idiomorph was confirmed by PCR, 36 mating combinations were performed with six single spores with MAT1-1 and the others with MAT1-2 . Eight mating combinations were successfully mated, producing stroma with perithecia. Cordycepin content analysis of all strains by high-performance liquid chromatography revealed that the KASP4-bred strain produced the maximum cordycepin among all strains, regardless of the medium and stroma parts. Finally, universal rice primer-PCR was performed to demonstrate that the bred strains were genetically different from the parental strains and new C. militaris strains. These results may be related to the recombination of genes during mating. The newly produced strains can be used to meet the industrial demand for cordycepin. In addition, breeding through mating suggests the possibility of producing numerous cordycepin-producing C. militaris strains.

Uncovering the Molecular Mechanism of Anti-Allergic Activity of Silkworm Pupa-Grown Cordyceps militaris Fruit Body.

PubMed

Wu, Ting-Feng; Chan, Yu-Yi; Shi, Wan-Yin; Jhong, Meng-Ting

2017-01-01

Cordyceps militaris has been widely used as an herbal drug and tonic food in East Asia and has also been recently studied in the West because of its various pharmacological activities such as antitumoral, anti-inflammatory and immunomodulatory effects. In this study, we examined the molecular mechanism underlying the anti-allergic activity of ethanol extract prepared from silkworm pupa-cultivated Cordyceps militaris fruit bodies in activated mast cells. Our results showed that ethanol extract treatment significantly inhibited the release of [Formula: see text]-hexosaminidase (a degranulation marker) and mRNA levels of tumor necrosis factor-[Formula: see text] as well as interleukin-4 in RBL-2H3 cells. The cells were sensitized with 2,4-dinitrophenol specific IgE and then stimulated with human serum albumin conjugated with 2,4-dinitrophenol. Oral administration of 300[Formula: see text]mg/kg ethanol extract significantly ameliorated IgE-induced allergic reaction in mice with passive cutaneous anaphylaxis. Western immunoblotting results demonstrated that ethanol extract incubation significantly inhibited Syk/PI3K/MEKK4/JNK/c-jun biochemical cascade in activated RBL-2H3 cells, which activated the expression of various allergic cytokines. In addition, it suppressed Erk activation and PLC[Formula: see text] evocation, which would respectively evoke the synthesis of lipid mediators and Ca[Formula: see text] mobilization to induce degranulation in stimulated RBL-2H3 cells. A compound, identified as [Formula: see text]-sitostenone, was shown to inhibit [Formula: see text]-hexosaminidase secretion from activated mast cells. Our study demonstrated that ethanol extract contained the ingredients, which could inhibit immediate degranulation and de novo synthesis of allergic lipid mediators and cytokines in activated mast cells.

Evaluation of metal ions and surfactants effect on cell growth and exopolysaccharide production in two-stage submerged culture of Cordyceps militaris.

PubMed

Cui, Jian-Dong; Zhang, Ya-Nan

2012-11-01

During the two-stage submerged fermentation of medicinal mushroom Cordyceps militaris, it was found that K(+), Ca(2+), Mg(2+), and Mn(2+) were favorable to the mycelial growth. The EPS production reached the highest levels in the media containing Mg(2+) and Mn(2+). However, Ca(2+) and K(+) almost failed to increase significantly exopolysaccharides (EPS) production. Sodium dodecyl sulfate (SDS) significantly enhanced EPS production compared with that of without adding SDS when SDS was added on static culture stage of two-stage cultivation process. The presence of Tween 80 in the medium not only simulated mycelial growth but also increased EPS production. By response surface methods (RSM), EPS production reached its peak value of 3.28 g/L under optimal combination of 27.6 mM Mg(2+), 11.1 mM Mn(2+), and 0.05 mM SDS, which was 3.76-fold compared with that of without metal ion and surfactant. The results obtained were useful in better understanding the regulation for efficient production of EPS of C. militaris in the two-stage submerged culture.

The preparation of three selenium-containing Cordyceps militaris polysaccharides: Characterization and anti-tumor activities.

PubMed

Liu, Fei; Zhu, Zhen-Yuan; Sun, Xiaoli; Gao, Hui; Zhang, Yong-Min

2017-06-01

In the present work, three fractions of selenized Cordyceps militaris polysaccharides (SeCPS) named SeCPS- I, SeCPS- II and SeCPS- III were isolated and purified by ultra-filtration. Their selenium content were measured as 541.3, 863.7 and 623.3μg/g respectively by a graphite furnace atomic absorption spectroscopy. The monosaccharide comformation analysis showed that they were mainly consisted of D-Mannose, D-Glucose, and D-Galactose in mole ratios of 1:7.63:0.83, 1:1.34:0.31 and 1:3.77:0.41 respectively. Their structure characteristics were compared by IFR and NMR spectroscopy. Scanning electron microscopy (SEM) and Congo red (CR) spectrophotometric method were used to investigate their morphological characteristics and conformational transition. SeCPS-II showed the strongest anti-tumor effects judging from the result of in vitro anti-tumor assays against two tumor cell lines (hepatocellular carcinoma HepG-2 cells and lung adenocarcinom A549 cells). Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of carbohydrates in natural and cultured Cordyceps by pressurized liquid extraction and gas chromatography coupled with mass spectrometry.

PubMed

Guan, Jia; Yang, Feng-Qing; Li, Shao-Ping

2010-06-11

Free and polymeric carbohydrates in Cordyceps, a valued edible mushroom and well-known traditional Chinese medicine, were determined using stepwise pressurized liquid extraction (PLE) extraction and GC-MS. Based on the optimized PLE conditions, acid hydrolysis and derivatization, ten monosaccharides, namely rhamnose, ribose, arabinose, xylose, mannose, glucose, galactose, mannitol, fructose and sorbose in 13 samples of natural and cultured Cordyceps were qualitatively and quantitatively analyzed and compared with myo-inositol hexaacetate as internal standard. The results showed that natural C. sinensis contained more than 7.99% free mannitol and a small amount of glucose, while its polysaccharides were usually composed of mannose, glucose and galactose with a molar ratio of 1.00:16.61-3.82:1.60-1.28. However, mannitol in cultured C. sinensis and cultured C. militaris were less than 5.83%, and free glucose was only detected in a few samples, while their polysaccharides were mainly composed of mannose, glucose and galactose with molar ratios of 1.00:3.01-1.09:3.30-1.05 and 1.00:2.86-1.28:1.07-0.78, respectively. Natural and cultured Cordyceps could be discriminated by hierarchical clustering analysis based on its free carbohydrate contents.

Morphological Observations and Fatty Acid Composition of Indoor-Cultivated Cordyceps sinensis at a High-Altitude Laboratory on Sejila Mountain, Tibet

PubMed Central

Guo, Lian-Xian; Xu, Xiao-Ming; Liang, Fu-Rui; Yuan, Jian-Ping; Peng, Juan; Wu, Chou-Fei; Wang, Jiang-Hai

2015-01-01

Cordyceps sinensis, a caterpillar entomopathogenic fungus-host larva complex, is a rare medicinal herb found in the Qinghai-Tibetan Plateau and its surrounding high-altitude areas. The alternation of generations in the life cycle, whatever the fungus or its host insect, requires special growth conditions. However, it is difficult to simulate the growth conditions of C. sinensis, which hinders its artificial cultivation. In this work, the life cycle from the host larva to C. sinensis was observed in an indoor-cultivation laboratory at 4,200 m a.s.l. on Sejila Mountain, Tibet. Comparative examinations between indoor-cultivated and wild C. sinensis demonstrated that the indoor-cultivated C. sinensis preferred to germinate multiple long, slim stromata at diverse positions on dead larvae, including but not limited to their heads. Their fatty acid composition shows a significant difference in the levels of polyunsaturated fatty acids (PUFAs). In indoor-cultivated C. sinensis, PUFAs constituted 24.59% and 49.43%, respectively, of neutral and polar lipids; meanwhile, in wild C. sinensis, PUFAs represented 34.34% and 61.25% of neutral and polar lipids, respectively. These observations and fatty acid data suggest that environmental factors, particularly temperature, soil pressure and light intensity, strongly affect the growth of C. sinensis. Our new findings may provide important information for improving techniques for the large-scale artificial cultivation of C. sinensis. PMID:25938484

Morphological Observations and Fatty Acid Composition of Indoor-Cultivated Cordyceps sinensis at a High-Altitude Laboratory on Sejila Mountain, Tibet.

PubMed

Guo, Lian-Xian; Xu, Xiao-Ming; Liang, Fu-Rui; Yuan, Jian-Ping; Peng, Juan; Wu, Chou-Fei; Wang, Jiang-Hai

2015-01-01

Cordyceps sinensis, a caterpillar entomopathogenic fungus-host larva complex, is a rare medicinal herb found in the Qinghai-Tibetan Plateau and its surrounding high-altitude areas. The alternation of generations in the life cycle, whatever the fungus or its host insect, requires special growth conditions. However, it is difficult to simulate the growth conditions of C. sinensis, which hinders its artificial cultivation. In this work, the life cycle from the host larva to C. sinensis was observed in an indoor-cultivation laboratory at 4,200 m a.s.l. on Sejila Mountain, Tibet. Comparative examinations between indoor-cultivated and wild C. sinensis demonstrated that the indoor-cultivated C. sinensis preferred to germinate multiple long, slim stromata at diverse positions on dead larvae, including but not limited to their heads. Their fatty acid composition shows a significant difference in the levels of polyunsaturated fatty acids (PUFAs). In indoor-cultivated C. sinensis, PUFAs constituted 24.59% and 49.43%, respectively, of neutral and polar lipids; meanwhile, in wild C. sinensis, PUFAs represented 34.34% and 61.25% of neutral and polar lipids, respectively. These observations and fatty acid data suggest that environmental factors, particularly temperature, soil pressure and light intensity, strongly affect the growth of C. sinensis. Our new findings may provide important information for improving techniques for the large-scale artificial cultivation of C. sinensis.

Isolation of adenosine, iso-sinensetin and dimethylguanosine with antioxidant and HIV-1 protease inhibiting activities from fruiting bodies of Cordyceps militaris.

PubMed

Jiang, Y; Wong, J H; Fu, M; Ng, T B; Liu, Z K; Wang, C R; Li, N; Qiao, W T; Wen, T Y; Liu, F

2011-01-15

According to previous studies, a close relationship between oxidative stress and AIDS suggests that antioxidants might play an important role in the treatment of AIDS. Cordyceps militaris was selected from nine edible mushrooms by assay of inhibition of erythrocyte hemolysis. Macroporous adsorption resin and HPLC were used to purify three micromolecular compounds named L3a, L3b and L3c. L3a was identified to be adenosine with the molecular formula C(10)H(13)N(5)O(4); L3b was 6,7,2',4',5'-pentamethoxyflavone with the molecular formula C(20)H(20)O(7), and L3c was dimethylguanosine with the molecular formula C(12)H(17)N(5)O(5). The compound 6,7,2',4',5'-pentamethoxyflavone was first isolated from C. militaris. The assay of inhibition of HIV-1 protease (HIV-1 PR) was based on the fact that the expression of this enzyme can inhibit the growth of E. coli. This is a new screening system for HIV-1 PR inhibitors. Both L3a and L3b showed high inhibition to HIV-1 PR. These compounds could be new anti-HIV-1 PR drugs. 2010 Elsevier GmbH. All rights reserved.

Higher Anti-Liver Fibrosis Effect of Cordyceps militaris-Fermented Product Cultured with Deep Ocean Water via Inhibiting Proinflammatory Factors and Fibrosis-Related Factors Expressions.

PubMed

Hung, Yu-Ping; Lee, Chun-Lin

2017-06-08

Deep ocean water (DOW) has been shown to enhance the functional components of fungi, resulting in increased health benefits. Therefore, using DOW for culturing fungi can enhance the cordycepin and adenosine of Cordyceps militaris (CM) and its protective effects on the liver. In this study, the antiliver fibrosis effects and mechanisms of ultrapure water-cultured CM (UCM), DOW-cultured CM (DCM), synthetic water-cultured CM, DOW, cordycepin, and adenosine were compared in the liver fibrosis mice induced by intraperitoneal injections of thioacetamide (TAA). The results indicated that DCM exhibited superior performance in reducing liver collagen accumulation, mitigating liver injuries, inhibiting proinflammatory factors and fibrosis-related factor (TGF-β1, Smad2/3, α-SMA, COL1A1) expression compared with UCM. DOW, cordycepin, and adenosine also performed antiliver fibrosis effect. Therefore, because DCM is rich in DOW and functional components, it can achieve anti-liver fibrosis effects through multiple pathways. These ameliorative effects are considerably superior to those of UCM.

Isolation, characterization, and antitumor activity of a novel heteroglycan from cultured mycelia of Cordyceps sinensis.

PubMed

Mei, Yu-xia; Yang, Wei; Zhu, Pei-xin; Peng, Nan; Zhu, Hai; Liang, Yun-xiang

2014-08-01

A novel heteroglycan, Cordyceps sinensis polysaccharide 1 (molecular weight 1 17 × 10(5) Da), was isolated and purified from mycelia of the fungus C. sinensis obtained by solid-state culture. Structural characterization by chemical analysis, GC-MS, FTIR, and NMR spectroscopy showed that C. sinensis polysaccharide 1 was mainly composed of (1 → 6)-linked α-D-Glc and α-D-Gal, with minor β-(1 → 4)-D-Xyl and β-(1 → 4)-D-Man residues probably located in the side chains with a trace amount of α-(1 → 3)-L-Rha residue. In biological assays, C. sinensis polysaccharide 1 significantly inhibited proliferation of sarcoma 180 cells and induced apoptosis in a dose-dependent manner. Further studies will elucidate the antitumor mechanism of C. sinensis polysaccharide 1 and promote its utilization for the development of novel, effective anticancer drugs. Georg Thieme Verlag KG Stuttgart · New York.

Anticancer and antimetastatic effects of cordycepin, an active component of Cordyceps sinensis.

PubMed

Nakamura, Kazuki; Shinozuka, Kazumasa; Yoshikawa, Noriko

2015-01-01

Cordyceps sinensis, a fungus that parasitizes on the larva of Lepidoptera, has been used as a valued traditional Chinese medicine. We investigated the effects of water extracts of Cordyceps sinensis (WECS), and particularly focused on its anticancer and antimetastatic actions. Based on in vitro studies, we report that WECS showed an anticancer action, and this action was antagonized by an adenosine A3 receptor antagonist. Moreover, this anticancer action of WECS was promoted by an adenosine deaminase inhibitor. These results suggest that one of the components of WECS with an anticancer action might be an adenosine or its derivatives. Therefore, we focused on cordycepin (3'-deoxyadenosine) as one of the active ingredients of WECS. According to our experiments, cordycepin showed an anticancer effect through the stimulation of adenosine A3 receptor, followed by glycogen synthase kinase (GSK)-3β activation and cyclin D1 suppression. Cordycepin also showed an antimetastatic action through inhibiting platelet aggregation induced by cancer cells and suppressing the invasiveness of cancer cells via inhibiting the activity of matrix metalloproteinase (MMP)-2 and MMP-9, and accelerating the secretion of tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-2 from cancer cells. In conclusion, cordycepin, an active component of WECS, might be a candidate anticancer and antimetastatic agent. Copyright © 2014 Japanese Pharmacological Society. Production and hosting by Elsevier B.V. All rights reserved.

Optimal conditions for cordycepin production in surface liquid-cultured Cordyceps militaris treated with porcine liver extracts for suppression of oral cancer.

PubMed

Lin, Liang-Tzung; Lai, Ying-Jang; Wu, She-Ching; Hsu, Wei-Hsuan; Tai, Chen-Jei

2018-01-01

Cordycepin is one of the most crucial bioactive compounds produced by Cordyceps militaris and has exhibited antitumor activity in various cancers. However, industrial production of large amounts of cordycepin is difficult. The porcine liver is abundant in proteins, vitamins, and adenosine, and these ingredients may increase cordycepin production and bioconversion during C. militaris fermentation. We observed that porcine liver extracts increased cordycepin production. In addition, air supply (2 h/d) significantly increased the cordycepin level in surface liquid-cultured C. militaris after 14 days. Moreover, blue light light-emitting diode irradiation (16 h/d) increased cordycepin production. These findings indicated that these conditions are suitable for increasing cordycepin production. We used these conditions to obtain water extract from the mycelia of surface liquid-cultured C. militaris (WECM) and evaluated the anti-oral cancer activity of this extract in vitro and in vivo. The results revealed that WECM inhibited the cell viability of SCC-4 oral cancer cells and arrested the cell cycle in the G2/M phase. Oxidative stress and mitochondrial dysfunction (mitochondrial fission) were observed in SCC-4 cells treated with WECM for 12 hours. Furthermore, WECM reduced tumor formation in 7,12-dimethylbenz[a]anthracene-induced hamster buccal pouch carcinogenesis through the downregulation of proliferating cell nuclear antigen, vascular endothelial growth factor, and c-fos expression. The results indicated that porcine liver extracts irradiated with blue light light-emitting diode and supplied with air can be used as a suitable medium for the growth of mycelia and production of cordycepin, which can be used in the treatment of oral cancer. Copyright © 2017. Published by Elsevier B.V.

Sub-acute toxicity of cultured mycelia of himalayan entomogenous fungus Cordyceps sinensis (Berk.) Sacc. in rats.

PubMed

Meena, Harsahay; Singh, Kshetra Pal; Negi, Prem Sing; Ahmed, Zakwan

2013-05-01

Oral administration of laboratory cultured mycelia powder of C. sinensis did not show any sign of toxicity as no significant change was observed in organ weight and serological parameters in rats. However, there was a significant increase in food intake, body weight gain and hematological parameters like WBC, RBC, Hb and lymphocytes in treated groups. Histopathology of vital organs also supported the non toxic effect of C. sinensis. The results conclude that laboratory cultured mycelia powder of C. sinensis is safe and non toxic up to 2 g/kg body weight dose.

Soya-cerebroside, an extract of Cordyceps militaris, suppresses monocyte migration and prevents cartilage degradation in inflammatory animal models

PubMed Central

Liu, Shan-Chi; Chiu, Ching-Peng; Tsai, Chun-Hao; Hung, Chun-Yin; Li, Te-Mao; Wu, Yang-Chang; Tang, Chih-Hsin

2017-01-01

Pathophysiological events that modulate the progression of structural changes in osteoarthritis (OA) include the secretion of inflammatory molecules, such as proinflammatory cytokines. Interleukin-1beta (IL-1β) is the prototypical inflammatory cytokine that activates OA synovial cells to release cytokines and chemokines in support of the inflammatory response. The monocyte chemoattractant protein-1 (MCP-1/CCL2) is one of the key chemokines that regulate migration and infiltration of monocytes in response to inflammation. We show in this study that IL-1β-induced MCP-1 expression and monocyte migration in OA synovial fibroblasts (OASFs) is effectively inhibited by soya-cerebroside, an extract of Cordyceps militaris. We found that soya-cerebroside up-regulated of microRNA (miR)-432 expression via inhibiting AMPK and AKT signaling pathways in OASFs. Soya-cerebroside also effectively decreased monocyte infiltration and prevented cartilage degradation in a rat inflammatory model. Our findings are the first to demonstrate that soya-cerebroside inhibits monocyte/macrophage infiltration into synoviocytes, attenuating synovial inflammation and preventing cartilage damage by reducing MCP-1 expression in vitro and in vivo. Taken together, we suggest a novel therapeutic strategy based on the use of soya-cerebroside for the management of OA. PMID:28225075

Microwave-Assisted Extraction, Chemical Structures, and Chain Conformation of Polysaccharides from a Novel Cordyceps Sinensis Fungus UM01.

PubMed

Cheong, Kit-Leong; Wang, Lan-Ying; Wu, Ding-Tao; Hu, De-Jun; Zhao, Jing; Li, Shao-Ping

2016-09-01

Cordyceps sinensis is a well-known tonic food with broad medicinal properties. The aim of the present study was to investigate the optimization of microwave-assisted extraction (MAE) and characterize chemical structures and chain conformation of polysaccharides from a novel C. sinensis fungus UM01. Ion-exchange and gel filtration chromatography were used to purify the polysaccharides. The chemical structure of purified polysaccharide was determined through gas chromatography-mass spectrometry. Moreover, high performance size exclusion chromatography combined with refractive index detector and multiangle laser light scattering were conducted to analyze the molecular weight (Mw ) and chain conformation of purified polysaccharide. Based on the orthogonal design L9 , optimal MAE conditions could be obtained through 1300 W of microwave power, with a 5-min irradiation time at a solid to water ratio of 1:60, generating the highest extraction yield of 6.20%. Subsequently, the polysaccharide UM01-S1 was purified. The UM01-S1 is a glucan-type polysaccharide with a (1→4)-β-d-glucosyl backbone and branching points located at O-3 of Glcp with a terminal-d-Glcp. The Mw , radius of gyration (Rg ) and hydrodynamic radius (Rh ) of UM01-S1 were determined as 5.442 × 10(6)  Da, 21.8 and 20.2 nm, respectively. Using the polymer solution theory, the exponent (ν) value of the power law function was calculated as 0.38, and the shape factor (ρ = Rg /Rh ) was 1.079, indicating that UM01-S1 has a sphere-like conformation with a branched structure in an aqueous solution. These results provide fundamental information for the future application of polysaccharides from cultured C. sinensis in health and functional food area. © 2016 Institute of Food Technologists®

Application of microscopy in authentication of valuable Chinese medicine I--Cordyceps sinensis, its counterfeits, and related products.

PubMed

Au, Dawn; Wang, Lijing; Yang, Dajian; Mok, Daniel K W; Chan, Albert S C; Xu, Hongxi

2012-01-01

Light and polarized microscope was applied to authenticate 32 Cordyceps and 6 artificial counterfeits and 8 fermented Cordyceps as well as 7 Cordyceps capsules available in Hong Kong markets. Results showed that transverse sections of stroma and powder of larvae can be used to differentiate C. sinensis from its counterfeits. The fermented Cordyceps are in powder form. Among the eight fermented Cordyceps collected, half of them were pure; three were a mixture of fermented Cordyceps and soya beans; one was a mixture of unknown plant tissues and soya beans. For the seven Cordyceps capsules, the powders of five samples were a mixture of fermented Cordyceps and soya beans; the powders of other two were a mixture of C. sinensis stroma powder and fermented Cordyceps. The study indicated that the microscopy is an unambiguous method that requests fewer sample for the authentication of valuable Chinese medicine-C. sinensis and its related products. Copyright © 2011 Wiley Periodicals, Inc.

Quantitative profiling of sphingolipids in wild Cordyceps and its mycelia by using UHPLC-MS

PubMed Central

Mi, Jia-Ning; Wang, Jing-Rong; Jiang, Zhi-Hong

2016-01-01

In the present study, 101 sphingolipids in wild Cordyceps and its five mycelia were quantitatively profiled by using a fully validated UHPLC-MS method. The results revealed that a general rank order for the abundance of different classes of sphingolipids in wild Cordyceps and its mycelia is sphingoid bases/ceramides > phosphosphingolipids > glycosphingolipids. However, remarkable sphingolipid differences between wild Cordyceps and its mycelia were observed. One is that sphingoid base is the dominant sphingolipid in wild Cordyceps, whereas ceramide is the major sphingolipid in mycelia. Another difference is that the abundance of sphingomyelins in wild Cordyceps is almost 10-folds higher than those in most mycelia. The third one is that mycelia contain more inositol phosphorylceramides and glycosphingolipids than wild Cordyceps. Multivariate analysis was further employed to visualize the difference among wild Cordyceps and different mycelia, leading to the identification of respective sphingolipids as potential chemical markers for the differentiation of wild Cordyceps and its related mycelia. This study represents the first report on the quantitative profiling of sphingolipids in wild Cordyceps and its related mycelia, which provided comprehensive chemical evidence for the quality control and rational utilization of wild Cordyceps and its mycelia. PMID:26868933

Polysaccharides from Cordyceps sinensis mycelium ameliorate exhaustive swimming exercise-induced oxidative stress.

PubMed

Yan, Feng; Wang, Beibei; Zhang, Yan

2014-02-01

Cordyceps sinensis (Berk.) Sacc. (Clavicipitaceae) is a famous medicinal fungus (mushroom) in Chinese herbal medicine. Polysaccharides from Cordyceps sinensis (CSP) have been identified as active ingredients responsible for its biological activities. Although many pharmacological actions of CSP have received a great deal of attention, research in this area continues. The current study was designed to investigate the effects of CSP on exhaustive exercise-induced oxidative stress. The mice were divided into four groups: control (C), low-dose CSP treated (LC), intermediate-dose CSP treated (IC) and high-dose CSP treated (HC). The treated groups received CSP (100, 200 and 400 mg/kg, ig), while the control group received drinking water for 28 days, followed by being forced to undergo exhaustive swimming exercise, and some biochemical parameters including superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), malondialdehyde (MDA) and 8-hydroxy-2'-deoxyguanosine (8-OHdG) were measured using detection kits according to the manufacturers' instructions. Compared with the C group, exhaustive swimming time was significantly prolonged in the LC, IC and HC groups (p < 0.05); SOD activities in serum, liver and muscle were significantly higher in the IC and HC groups (p < 0.05); GPx activities in serum, liver and muscle were significantly higher in the LC, IC and HC groups (p < 0.05); CAT activities in serum, liver and muscle were significantly higher in the HC groups (p < 0.05); MDA and 8-OHdG levels in serum, liver and muscle were significantly lower in the LC, IC and HC groups (p < 0.05). The results obtained herein indicate that CSP could ameliorate exhaustive exercise-induced oxidative stress.

Effects of Cordyceps militaris (L.) Fr. fermentation on the nutritional, physicochemical, functional properties and angiotensin I converting enzyme inhibitory activity of red bean (Phaseolus angularis [Willd.] W.F. Wight.) flour.

PubMed

Xiao, Yu; Sun, Mingmei; Zhang, Qiuqin; Chen, Yulian; Miao, Junqing; Rui, Xin; Dong, Mingsheng

2018-04-01

The effects of solid-state fermentation with Cordyceps militaris (L.) Fr. on the nutritional, physicochemical, and functional properties as well as angiotensin I converting enzyme (ACE) inhibitory activity of red bean ( Phaseolus angularis [Willd.] W.F. Wight.) flour were determined. Fermentation increased the amount of small peptides but significantly decreased large peptides. Fermentation also increased proteins and essential amino acids (by 9.31 and 13.89%, respectively) and improved the in vitro protein digestibility (6.54%) of red beans. Moreover, fermentation increased the water holding capacity (from 2.36 to 2.59 mL/g), fat absorption capacity (from 84.65 to 114.55%), emulsion activity (from 10.96 to 52.77%), emulsion stability (from 5.43 to 53.82%), and foaming stability (from 11.95 to 20.68%). Fermented red bean flour achieved a lower least gelation concentration of 14% than that of the control (18%). In contrast to the non-fermented red bean, the fermented red bean showed ACE inhibitory activity, with IC 50 value of 0.63 mg protein/mL. Overall, fermentation improved the nutritional, physicochemical, and functional properties as well as the biological activity of red bean flour. Thus, fermented red bean flour may serve as a novel nutritional and functional ingredient for applications in food design.

[Impact of directly compressed auxiliary materials on powder property of fermented cordyceps powder].

PubMed

Chen, Li-Hua; Yue, Guo-Chao; Guan, Yong-Mei; Yang, Ming; Zhu, Wei-Feng

2014-01-01

To investigate such physical indexes as hygroscopicity, angle of repose, bulk density, fillibility of compression of mixed powder of directly compressed auxiliary materials and fermented cordyceps powder by using micromeritic study methods. The results showed that spray-dried lactose Flowlac100 and microcrystalline cellulose Avicel PH102 had better effect in liquidity and compressibility on fermented cordyceps powder than pregelatinized starch. The study on the impact of directly compressed auxiliary materials on the powder property of fermented cordyceps powder had guiding significant to the research of fermented cordyceps powder tablets, and could provide basis for the development of fermented cordyceps powder tablets.

The Chemical Constituents and Pharmacological Actions of Cordyceps sinensis

PubMed Central

Liu, Yi; Wang, Jihui; Wang, Wei; Zhang, Hanyue; Zhang, Xuelan; Han, Chunchao

2015-01-01

Cordyceps sinensis, also called DongChongXiaCao (winter worm, summer grass) in Chinese, is becoming increasingly popular and important in the public and scientific communities. This study summarizes the chemical constituents and their corresponding pharmacological actions of Cordyceps sinensis. Many bioactive components of Cordyceps sinensis have been extracted including nucleoside, polysaccharide, sterol, protein, amino acid, and polypeptide. In addition, these constituents' corresponding pharmacological actions were also shown in the study such as anti-inflammatory, antioxidant, antitumour, antiapoptosis, and immunomodulatory actions. Therefore can use different effects of C. sinensis against different diseases and provide reference for the study of Cordyceps sinensis in the future. PMID:25960753

[Separation, purification and primary reverse cholesterol transport study of Cordyceps militaris polysaccharide].

PubMed

Guo, Shou-Dong; Cui, Ying-Jie; Wang, Ren-Zhong; Wang, Ren-Yuan; Wu, Wen-Xue; Ma, Teng

2014-09-01

The authors designed to separate, purify and determine the monosaccharide composition of the polysaccharide from Cordyceps militaris, and study its effect on reverse cholesterol transport in vivo by isotope tracing assay. Polysaccharides were separate and purify by ion exchange column Q-sepharose Fast Flow and size exclusion column Sephacryl S200HR; the molecular weight and monosaccharide composition of the polysaccharides were determined by high performance gel permeation chromatography and high performance liquid chromatography coming with pre-column derivation, respectively. Finally, three purified polysaccharides CMBW1, CMBW2 and CMYW1 were obtained, their total carbohydrate contents were 87%, 89%, 95%, respectively; their protein contents were 6.5%, 1.3%, 2.8%, respectively; their molecular weights were 772.1, 20.9, 13.2 kDa, respectively; CMBW1 was composed of mannose, glucosamine, rhamnose, glucuronic acid, glucose, galactose and arabinose with a molar ratio of 7.25: 0.17: 1.29: 0.23: 6.30: 11.08: 0.79; CMBW2 was composed of mannose, glucosamine, galactose and arabinose with a molar ratio of 2.40: 0.16: 2.92: 0.24; CMYW1 was composed of mannose, glucosamine, glucuronic acid and glucose with a molar ratio of 0.59: 0.57: 0.45: 25.61. Polysaccharide at 50 mg x kg(-1) could significantly improve the transport of 3H- cholesterol to blood and excretion from feces. All of the three purified polysaccharides CMBW1, CMBW2 and CMYW1 were heteropolysaccharide; and they could improve reverse cholesterol transport in vivo, the underlying mechanisms are being studied.

Melanogenesis effect of Cordyceps militaris culture broth on the melanin formation of B16F0 melanoma cells.

PubMed

Cha, Jae-Young; Yang, Hyun-Ju; Park, Mi-Yeon; Choi, Seung-Tae; Moon, Hyung-In; Cho, Young-Su

2011-10-13

The effect of Cordyceps militaris culture broth (CMB) on melanogenesis in B16F0 melanoma cells was evaluated by measurement of the melanin concentration after 3 days of incubation. The B16F0 melanoma cells were treated with various concentrations of CMB 10-100 μg/mL and arbutin of 200 μM. Phenolic content and antioxidant activity of CMB were also measured. Phenolic content of CMB was 3.28 mg/g. The DPPH radical scavenging and ferric ion donating activities were 79.64% and 0.16, respectively. The melanin concentration and cell viability of melanoma cells by arbutin treatment decreased to 43% and 91% of the control, respectively. The CMB treatment showed a significant inhibitory effect of melanin production by 29%, 50%, and 56% at 50, 80, and 100 μg/mL concentration treatment, respectively, while over 90% of cells were viable. The CMB treatment at 50, 80, and 100 μg/mL concentrations in cultivation decreased extracellular melanin release induced by 3-isobutyl-1-methylxanthine (IBMX) treatment by 19%, 38%, and 48%, respectively. The CMB showed inhibitory activity against intracellular tyrosinase extracted from melanoma cells, while it had no inhibition on the activity of mushroom tyrosinase. The cellular glutathione contents were enhanced by CMB treatment in a concentration-dependent manner. These results suggested that CMB suppressed cellular tyrosinase activity and total melanin content in cultured B16F0 melanoma cells without any significant effects on cell proliferation and it might be candidate anti-melanogenic agent.

Cordyceps sinensis increases hypoxia tolerance by inducing heme oxygenase-1 and metallothionein via Nrf2 activation in human lung epithelial cells.

PubMed

Singh, Mrinalini; Tulsawani, Rajkumar; Koganti, Praveen; Chauhan, Amitabh; Manickam, Manimaran; Misra, Kshipra

2013-01-01

Cordyceps sinensis, an edible mushroom growing in Himalayan regions, is widely recognized in traditional system of medicine. In the present study, we report the efficacy of Cordyceps sinensis in facilitating tolerance to hypoxia using A549 cell line as a model system. Treatment with aqueous extract of Cordyceps sinensis appreciably attenuated hypoxia induced ROS generation, oxidation of lipids and proteins and maintained antioxidant status similar to that of controls via induction of antioxidant gene HO1 (heme oxygenase-1), MT (metallothionein) and Nrf2 (nuclear factor erythroid-derived 2-like 2). In contrast, lower level of NF κ B (nuclear factor kappaB) and tumor necrosis factor- α observed which might be due to higher levels of HO1, MT and transforming growth factor- β . Further, increase in HIF1 (hypoxia inducible factor-1) and its regulated genes; erythropoietin, vascular endothelial growth factor, and glucose transporter-1 was observed. Interestingly, Cordyceps sinensis treatment under normoxia did not regulate the expression HIF1, NF κ B and their regulated genes evidencing that Cordyceps sinensis per se did not have an effect on these transcription factors. Overall, Cordyceps sinensis treatment inhibited hypoxia induced oxidative stress by maintaining higher cellular Nrf2, HIF1 and lowering NF κ B levels. These findings provide a basis for possible use of Cordyceps sinensis in tolerating hypoxia.

Cordyceps sinensis Increases Hypoxia Tolerance by Inducing Heme Oxygenase-1 and Metallothionein via Nrf2 Activation in Human Lung Epithelial Cells

PubMed Central

Manickam, Manimaran; Misra, Kshipra

2013-01-01

Cordyceps sinensis, an edible mushroom growing in Himalayan regions, is widely recognized in traditional system of medicine. In the present study, we report the efficacy of Cordyceps sinensis in facilitating tolerance to hypoxia using A549 cell line as a model system. Treatment with aqueous extract of Cordyceps sinensis appreciably attenuated hypoxia induced ROS generation, oxidation of lipids and proteins and maintained antioxidant status similar to that of controls via induction of antioxidant gene HO1 (heme oxygenase-1), MT (metallothionein) and Nrf2 (nuclear factor erythroid-derived 2-like 2). In contrast, lower level of NFκB (nuclear factor kappaB) and tumor necrosis factor-α observed which might be due to higher levels of HO1, MT and transforming growth factor-β. Further, increase in HIF1 (hypoxia inducible factor-1) and its regulated genes; erythropoietin, vascular endothelial growth factor, and glucose transporter-1 was observed. Interestingly, Cordyceps sinensis treatment under normoxia did not regulate the expression HIF1, NFκB and their regulated genes evidencing that Cordyceps sinensis per se did not have an effect on these transcription factors. Overall, Cordyceps sinensis treatment inhibited hypoxia induced oxidative stress by maintaining higher cellular Nrf2, HIF1 and lowering NFκB levels. These findings provide a basis for possible use of Cordyceps sinensis in tolerating hypoxia. PMID:24063008

Effect of Cordyceps sinensis and taurine either alone or in combination on streptozotocin induced diabetes.

PubMed

El Zahraa Z El Ashry, Fatma; Mahmoud, Mona F; El Maraghy, Nabila N; Ahmed, Ahmed F

2012-03-01

The present study aimed to investigate the antidiabetic effects of Cordyceps sinensis, taurine and their combination in comparison with glibenclamide both in vivo and in vitro using streptozotocin rat model. The diabetic rats were orally given glibenclamide, C. sinensis, taurine or Cordyceps and taurine combination for 21 days. Their effects were studied both in vivo and in vitro. Oral administration of Cordyceps, taurine and their combination decreased serum glucose, fructosamine, total cholesterol, triglycerides levels, insulin resistance index and pancreatic malondialdehyde content. Cordyceps significantly increased serum insulin, HDL-cholesterol, total antioxidant capacity levels, β cell function percent, and pancreatic reduced glutathione (GSH) content. However, taurine was unable to elevate pancreatic GSH level to a significant level. These natural products and their combinations were more effective than glibenclamide in reducing insulin resistance index and they had stronger antioxidant properties. Cordyceps and taurine significantly enhanced glucose uptake by diaphragms of normal and diabetic rats in absence and presence of insulin. In conclusion, Cordyceps and taurine either alone or in combination have less potent hypoglycemic effects than glibenclamide; however, they have more ability to reduce insulin resistance and stronger antioxidant properties. Copyright © 2011 Elsevier Ltd. All rights reserved.

Analysis of the High-Performance Liquid Chromatography Fingerprints and Quantitative Analysis of Multicomponents by Single Marker of Products of Fermented Cordyceps sinensis

PubMed Central

Guan, Yong-mei; Jin, Chen; Zhu, Wei-feng; Yang, Ming

2018-01-01

Fermented Cordyceps sinensis, the succedaneum of Cordyceps sinensis which is extracted and separated from Cordyceps sinensis by artificial fermentation, is commonly used in eastern Asia in clinical treatments due to its health benefit. In this paper, a new strategy for differentiating and comprehensively evaluating the quality of products of fermented Cordyceps sinensis has been established, based on high-performance liquid chromatography (HPLC) fingerprint analysis combined with similar analysis (SA), hierarchical cluster analysis (HCA), and the quantitative analysis of multicomponents by single marker (QAMS). Ten common peaks were collected and analysed using SA, HCA, and QAMS. These methods indicated that 30 fermented Cordyceps sinensis samples could be categorized into two groups by HCA. Five peaks were identified as uracil, uridine, adenine, guanosine, and adenosine, and according to the results from the diode array detector, which can be used to confirm peak purity, the purities of these compounds were greater than 990. Adenosine was chosen as the internal reference substance. The relative correction factors (RCF) between adenosine and the other four nucleosides were calculated and investigated using the QAMS method. Meanwhile, the accuracy of the QAMS method was confirmed by comparing the results of that method with those of an external standard method with cosines of the angles between the groups. No significant difference between the two methods was observed. In conclusion, the method established herein was efficient, successful in identifying the products of fermented Cordyceps sinensis, and scientifically valid to be applicable in the systematic quality control of fermented Cordyceps sinensis products. PMID:29850373

Analysis of the High-Performance Liquid Chromatography Fingerprints and Quantitative Analysis of Multicomponents by Single Marker of Products of Fermented Cordyceps sinensis.

PubMed

Chen, Li-Hua; Wu, Yao; Guan, Yong-Mei; Jin, Chen; Zhu, Wei-Feng; Yang, Ming

2018-01-01

Fermented Cordyceps sinensis , the succedaneum of Cordyceps sinensis which is extracted and separated from Cordyceps sinensis by artificial fermentation, is commonly used in eastern Asia in clinical treatments due to its health benefit. In this paper, a new strategy for differentiating and comprehensively evaluating the quality of products of fermented Cordyceps sinensis has been established, based on high-performance liquid chromatography (HPLC) fingerprint analysis combined with similar analysis (SA), hierarchical cluster analysis (HCA), and the quantitative analysis of multicomponents by single marker (QAMS). Ten common peaks were collected and analysed using SA, HCA, and QAMS. These methods indicated that 30 fermented Cordyceps sinensis samples could be categorized into two groups by HCA. Five peaks were identified as uracil, uridine, adenine, guanosine, and adenosine, and according to the results from the diode array detector, which can be used to confirm peak purity, the purities of these compounds were greater than 990. Adenosine was chosen as the internal reference substance. The relative correction factors (RCF) between adenosine and the other four nucleosides were calculated and investigated using the QAMS method. Meanwhile, the accuracy of the QAMS method was confirmed by comparing the results of that method with those of an external standard method with cosines of the angles between the groups. No significant difference between the two methods was observed. In conclusion, the method established herein was efficient, successful in identifying the products of fermented Cordyceps sinensis , and scientifically valid to be applicable in the systematic quality control of fermented Cordyceps sinensis products.

[Cordyceps sinensis enhances lymphocyte proliferation and CD markers expression in simulated microgravity environment].

PubMed

Hao, Tong; Li, Jun-Jie; Du, Zhi-Yan; Duan, Cui-Mi; Wang, Yan-Meng; Wang, Chang-Yong; Song, Jing-Ping; Wang, Lin-Jie; Li, Ying-Hui; Wang, Yan

2012-10-01

This study was aimed to explore the effect of cordyceps sinensis enhancing lymphocyte proliferation and surface CD marker expression in simulated microgravity environment. The splenic lymphocytes were separated from mice and cultured in the rotary cell culture system simulated microgravity environment. The cells were treated with different concentration of cordyceps sinensis solution (0, 6.25, 12.5, 25 and 50 µg/ml) for 24, 48 and 72 h respectively, then the cells were harvested, and analyzed for cell proliferation and the expression of cell surface markers (CD4 and CD8). The results showed that under simulated microgravity environment, the lymphocyte proliferation was inhibited. When the concentration of cordyceps sinensis was 25 or 50 µg/ml, the lymphocyte proliferation, CD4 and CD8 expressions all increased, but 50 µg/ml cordyceps sinensis could inhibit the proliferation ability with the time prolonging. It is concluded that the suitable concentration of cordyceps sinensis displayed the ability to enhance the lymphocyte proliferation and CD marker expression in simulated microgravity environment. These results may be valuable for screening drugs which can be potentially against immunosuppression under simulated microgravity.

Cordycepin-enriched WIB801C from Cordyceps militaris inhibits ADP-induced [Ca(2+)] i mobilization and fibrinogen binding via phosphorylation of IP 3R and VASP.

PubMed

Lee, Dong-Ha; Kwon, Hyuk-Woo; Kim, Hyun-Hong; Lim, Deok Hwi; Nam, Gi Suk; Shin, Jung-Hae; Kim, Yun-Yi; Kim, Jong-Lae; Lee, Jong-Jin; Kwon, Ho-Kyun; Park, Hwa-Jin

2015-01-01

In this study, we investigated the effect of cordycepin-enriched (CE)-WIB801C from Cordyceps militaris on ADP (20 µM)-stimulated platelet aggregation. CE-WIB801C dose-dependently inhibited ADP-induced platelet aggregation, and its IC50 value was 18.5 μg/mL. CE-WIB801C decreased TXA2 production, but did not inhibit the activities of COX-1 and thromboxane synthase (TXAS) in ADP-activated platelets, which suggests that the inhibition of TXA2 production by CE-WIB801C is not resulted from the direct inhibition of COX-1 and TXAS. CE-WIB801C inhibited ATP release and [Ca(2+)]i mobilization, and increased cAMP level and IP3RI (Ser(1756)) phosphorylation in ADP-activated platelets. cAMP-dependent protein kinase (A-kinase) inhibitor Rp-8-Br-cAMPS increased CE-WIB801C-inhibited [Ca(2+)]i mobilization, and strongly inhibited CE-WIB801C-increased IP3RI (Ser(1756)) phosphorylation. CE-WIB801C elevated the phosphorylation of VASP (Ser(157)), an A-kinase substrate, but inhibited fibrinogen binding to αIIb/β3. These results suggest that CE-WIB801C-elevated cAMP involved in IP3RI (Ser(1756)) phosphorylation to inhibit [Ca(2+)]i mobilization and, VASP (Ser(157)) phosphorylation to inhibit αIIb/β3 activation. Therefore, in this study, we demonstrate that CE-WIB801C may have a preventive or therapeutic potential for platelet aggregation-mediated diseases, such as thrombosis, myocardial infarction, atherosclerosis, and ischemic cerebrovascular disease.

Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Geon Joon, E-mail: gjlee@kw.ac.kr; Sim, Geon Bo; Choi, Eun Ha

To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated watermore » (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.« less

Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

NASA Astrophysics Data System (ADS)

Lee, Geon Joon; Sim, Geon Bo; Choi, Eun Ha; Kwon, Young-Wan; Kim, Jun Young; Jang, Siun; Kim, Seong Hwan

2015-01-01

To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated water (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.

[Investigation of metabolic action of Cordyceps sinensis and its cultured mycelia on Escherichia coli by microcalorimetry].

PubMed

Zhou, Dan-Lei; Yan, Dan; Li, Bao-Cai; Wu, Yan-Shu; Xiao, Xiao-He

2009-06-01

This study is to investigate the effect of Cordyceps sinensis and its cultured mycelia on growth and metabolism of Escherichia coli, and microcalorimetric method was carried out to evaluate its biological activity. The study will provide the basis for the quality control of Cordyceps sinensis. Experimental result will show the effect of natural Cordyceps sinensis and its cultured mycelia on growth and metabolism of Escherichia coli, with index of P(1max) and effective rate (E) by microcalorimetry, the data of experiment were studied by cluster analysis. The results showed that Cordyceps sinensis and its cultured mycelia not only can promote growth and metabolism of Escherichia coli but also can regulate the balance of intestinal microecology efficiently. When the concentrations of samples > 6.0 mg mL(-1), natural Cordyceps sinensis can promote the growth and metabolism of Escherichia coli efficiently (P < 0.05) compared with the control group, and have better dose-effect relationship with concentration (r > 0.9), its cultured mycelia does not show conspicuous auxoaction (P > 0.05) and have not dose-effect relationship with concentration (r < 0.6); when the concentration of samples < 6.0 mg mL(-1), all samples does not show conspicuous auxoaction (P > 0.05). Natural Cordyceps sinensis and its cultured mycelia can be distinguished by cluster analysis. Microcalorimetry has a good prospect on the quality evaluation of the traditional Chinese medicine.

Observations on White Grubs Affecting Sugar Cane at the Juba Sugar Project, South-Western Somalia, in the 1980s, and Implications for Their Management

PubMed Central

Cock, Matthew J. W.; Allard, Gillian B.

2013-01-01

The authors made two visits to the Juba Sugar Project in south-west Somalia, at the beginning of the minor rains in October 1986, and at the beginning of the main rains in March 1987. Observations were made on morphospecies of scarabaeid white grub larvae, the adults, and the two associated for the key economic species, Cochliotis melolonthoides and Brachylepis werneri. Sampling larvae and adults by digging soil quadrats and adults by light trapping gave useful information on their biology and phenology. Sampling methods were evaluated and economic thresholds were extrapolated based on earlier work. Natural enemies were surveyed, and entomopathogenic nematodes and a cordyceps fungus (Ophiocordyceps barnesii) were considered to have potential to be used as biological control interventions. PMID:26464389

Observations on White Grubs Affecting Sugar Cane at the Juba Sugar Project, South-Western Somalia, in the 1980s, and Implications for Their Management.

PubMed

Cock, Matthew J W; Allard, Gillian B

2013-06-18

The authors made two visits to the Juba Sugar Project in south-west Somalia, at the beginning of the minor rains in October 1986, and at the beginning of the main rains in March 1987. Observations were made on morphospecies of scarabaeid white grub larvae, the adults, and the two associated for the key economic species, Cochliotis melolonthoides and Brachylepis werneri. Sampling larvae and adults by digging soil quadrats and adults by light trapping gave useful information on their biology and phenology. Sampling methods were evaluated and economic thresholds were extrapolated based on earlier work. Natural enemies were surveyed, and entomopathogenic nematodes and a cordyceps fungus (Ophiocordyceps barnesii) were considered to have potential to be used as biological control interventions.

Differentiation and quality estimation of Cordyceps with infrared spectroscopy

NASA Astrophysics Data System (ADS)

Yang, Ping; Song, Ping; Sun, Su-Qin; Zhou, Qun; Feng, Shu; Tao, Jia-Xun

2009-11-01

Heretofore, a scientific and systemic method for differentiation and quality estimation of a well-known Chinese traditional medicine, 'Cordyceps', has not been established in modern market. In this paper, Fourier-transform infrared spectroscopy (FTIR) and two-dimensional correlation infrared spectroscopy (2D-IR) are employed to propose a method for analysis of Cordyceps. It has presented that IR spectra of real Cordyceps of different origins and counterfeits have their own macroscopic fingerprints, with discriminated shapes, positions and intensities. Their secondary derivative spectra can amplify the differences and confirm the potentially characteristic IR absorption bands 1400-1700 cm -1 to be investigated in 2D-IR. Many characteristic fingerprints are discovered in 2D-IR spectra in the range of 1400-1700 cm -1 and hetero 2D spectra of 670-780 cm -1 × 1400-1700 cm -1. The different fingerprints display different chemical constitutes. Through the three steps, different Cordyceps and their counterfeits can be discriminated effectively and their qualities distinctly display. Successful analysis of eight Cordyceps capsule products has proved the practicability of the method, which can also be applied to the quality estimation of other Chinese traditional medicines.

Entomopathogens of Amazonian stick insects and locusts are members of the Beauveria species complex (Cordyceps sensu stricto).

PubMed

Sanjuan, Tatiana; Tabima, Javier; Restrepo, Silvia; Læssøe, Thomas; Spatafora, Joseph W; Franco-Molano, Ana Esperanza

2014-01-01

In the Amazon the only described species of Cordyceps sensu stricto (Hypocreales, Cordycipitaceae) that parasitize insects of Orthopterida (orders Orthoptera and Phasmida) are Cordyceps locustiphila and C. uleana. However, the type specimens for both taxa have been lost and the concepts of these species are uncertain. To achieve a more comprehensive understanding of the systematics of these species, collections of Cordyceps from the Amazon regions of Colombia, Ecuador and Guyana were subjected to morphological, ecological and molecular phylogenetic studies. Phylogenetic analyses were conducted on partial sequences of SSU, LSU, TEF, RPB1 and RPB2 nuclear loci. Two new species are proposed including C. diapheromeriphila, a parasite of Phasmida, and C. acridophila, a parasite of the superfamily Acridomorpha (Orthoptera), which is broadly distributed across the Amazon. For C. locustiphila a lectotypification and an epitypification are made. Cordyceps locustiphila is host specific with Colpolopha (Acridomorpha: Romaleidae), and its distribution coincides with that of its host. The phylogenetic placement of these three species was resolved with strong support in the Beauveria clade of Cordyceps s. str. (Cordycipitaceae). This relationship and the morphological similarity of their yellow stromata with known teleomorphs of the clade, suggest that the holomorphs of these species may include Beauveria or Beauveria-like anamorphs. The varying host specificity of the beauverioid Cordyceps species suggest the potential importance of identifying the natural host taxon before future consideration of strains for use in biological control of pest locusts.

[Quantitative analysis of nucleosides in four Cordyceps genus by HPLC].

PubMed

Qian, Zheng-Ming; Li, Wen-Qing; Wang, Chuan-Xi; Zhou, Miao-Xia; Sun, Min-Tian; Gao, Hao; Li, Wen-Jia

2016-07-01

To compare the main nucleosides in Cordyceps genus herbs (C. sinensis, C. millitaris, Hirsutella sinensis and C. sobolifera), an HPLC method for simultaneous determination of uridine, inosine, guanosine, adenosine and cordycepine in Cordyceps genus herbs was developed. The sample was extracted with 0.5% phosphoric acid solution to prepare test solution. The separation was performed on a Zorbax SB-Aq (4.6 mm×150 mm, 5 μm) column with gradient elution by 0.04 mol•L⁻¹ potassium dihydrogen phosphate solution and acetonitrile, column temperature 30 ℃,flow rate 0.8 mL•min⁻¹,and detection wavelength 260 nm. The content of nucleosides in four Cordyceps genus herbs was evaluated by fingerprint analysis and hierarchical cluster analysis (HCA). The calibration curves of five nucleosides showed good linear regression (r>0.99) and the average recoveries were between 95.0% and 105.0%. The contents of the five nucleosides in the four Cordyceps genus herbs were different and could be obviously distinguished by HCA. The fingerprint analysis result showed that the similarity between C. sinensis and the others was less than 0.9. The method was accurate and reliable, which can be used for quality control of Cordyceps genus herbs. Copyright© by the Chinese Pharmaceutical Association.

Cordyceps sinensis (a traditional Chinese medicine) for kidney transplant recipients.

PubMed

Hong, Tao; Zhang, Minghua; Fan, Junming

2015-10-12

Kidney transplantation is the treatment of choice for patients with end-stage kidney disease (ESKD). Rising ESKD prevalence has substantially increased numbers of kidney transplants performed. Maintenance immunosuppression is long-term treatment to prevent acute rejection and deterioration of graft function. Although immunosuppressive treatment using drugs such as calcineurin inhibitors (CNIs, such as cyclosporin A (CsA) or tacrolimus) reduce acute rejection rates, long-term allograft survival rates are not significantly enhanced. CNI-related adverse effects contribute to reduced quality of life among kidney transplant recipients. Adjuvant immunosuppressive therapies that could offer a synergetic immunosuppressive effect, while minimising toxicity and reducing side effects, have been explored recently. Cordyceps sinensis, (Cordyceps) a traditional Chinese medicine, is used as an adjuvant immunosuppressive agent in maintenance treatment for kidney transplantation recipients in China, but there is no consensus about its use as an adjuvant immunosuppressive treatment for kidney transplantation recipients. This review aimed to evaluate the benefits and potential adverse effects of Cordyceps as an adjuvant immunosuppressive treatment for kidney transplant recipients. We searched the Cochrane Kidney and Transplant Specialised Register through contact with the Trials Search Co-ordinator to 7 September 2015 using search terms relevant to this review. We also searched Chinese language databases and other resources. We included all randomised controlled trials (RCTs) and quasi-RCTs evaluating the benefits and potential side effects of Cordyceps sinensis for kidney transplant recipients, irrespective of blinding or publication language. An inclusion criterion was that baseline immunosuppressive therapy must be the same in all study arms. Two authors extracted data. We derived risk ratios (RR) for dichotomous data and mean differences (MD) for continuous data with 95% confidence intervals (CI). Our review included five studies (six reports; 447 participants) that assessed Cordyceps. Limited reporting of study methods and data meant that all included studies were assessed as having unclear risks of bias. The studies investigated Cordyceps compared with azathioprine (AZA) (4 studies, 265 participants) and Cordyceps plus low dose CsA versus standard dose CsA (1 study, 182 participants).Compared with AZA, Cordyceps showed no significant difference in graft or patient survival, but improved graft function and may reduce acute rejection episodes. Anaemia, leucopenia, and liver function improved, and incidence of infection may also be reduced.Compared with low dose CsA versus standard dose CsA, Cordyceps did not demonstrate any statistically significant differences in patient survival, graft loss, acute rejection or allograft function. There was limited low quality evidence to suggest benefits in pulmonary infection, serum albumin, serum uric acid levels, CNI nephrotoxicity and hepatotoxicity.None of the included studies reported on quality of life, and follow-up was short-term (three months to one year). Given the limited number of small studies, and high risk of bias, results should be interpreted with caution. Although there were some favourable aspects associated with Cordyceps, longer-term studies are needed to clarify any benefit-harm trade-off. Future studies should investigate the use of Cordyceps in combination with other immunosuppressive agents such as tacrolimus, mycophenolate mofetil or induction therapy. Such studies also need to be appropriately sized and powered.

Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches' Broom Disease

PubMed Central

2005-01-01

The basidiomycete fungus Crinipellis perniciosa (Stahel) Singer is the causal agent of Witches' Broom Disease of Cacao (Theobroma cacao L.) which is the main factor limiting cacao production in the Americas. Pod losses of up to 90% are experienced in affected areas as evidenced by the 50% drop in production in Bahia province, Brazil following the arrival of the C. perniciosa in the area in 1989. The disease has proven particularly difficult to control and many farmers in affected areas have given up cacao cultivation. In order to evaluate the potential of endophytes as a biological control agent of this phytopathogen, the endophytic fungal community of resistant and susceptible cacao plants as well as affected branches was studied between 2001 and 2002. The fungal community was identified by morphological traits and rDNA sequencing as belonging to the genera Acremonium, Blastomyces, Botryosphaeria, Cladosporium, Colletotrichum, Cordyceps, Diaporthe, Fusarium, Geotrichum, Gibberella, Gliocladium, Lasiodiplodia, Monilochoetes, Nectria, Pestalotiopsis, Phomopsis, Pleurotus, Pseudofusarium, Rhizopycnis, Syncephalastrum, Trichoderma, Verticillium and Xylaria. These fungi were evaluated both in vitro and in vivo by their ability to inhibit C. perniciosa. Among these, some were identified as potential antagonists, but only one fungus (Gliocladium catenulatum) reduced the incidence of Witches' Broom Disease in cacao seedlings to 70%. PMID:15951847

Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches' Broom Disease.

PubMed

Rubini, Marciano R; Silva-Ribeiro, Rute T; Pomella, Alan W V; Maki, Cristina S; Araújo, Welington L; Dos Santos, Deise R; Azevedo, João L

2005-01-01

The basidiomycete fungus Crinipellis perniciosa (Stahel) Singer is the causal agent of Witches' Broom Disease of Cacao (Theobromacacao L.) which is the main factor limiting cacao production in the Americas. Pod losses of up to 90% are experienced in affected areas as evidenced by the 50% drop in production in Bahia province, Brazil following the arrival of the C. perniciosa in the area in 1989. The disease has proven particularly difficult to control and many farmers in affected areas have given up cacao cultivation. In order to evaluate the potential of endophytes as a biological control agent of this phytopathogen, the endophytic fungal community of resistant and susceptible cacao plants as well as affected branches was studied between 2001 and 2002. The fungal community was identified by morphological traits and rDNA sequencing as belonging to the genera Acremonium, Blastomyces, Botryosphaeria, Cladosporium, Colletotrichum, Cordyceps, Diaporthe, Fusarium, Geotrichum, Gibberella, Gliocladium, Lasiodiplodia, Monilochoetes, Nectria, Pestalotiopsis, Phomopsis, Pleurotus, Pseudofusarium, Rhizopycnis, Syncephalastrum, Trichoderma, Verticillium and Xylaria. These fungi were evaluated both in vitro and in vivo by their ability to inhibit C. perniciosa. Among these, some were identified as potential antagonists, but only one fungus (Gliocladium catenulatum) reduced the incidence of Witches' Broom Disease in cacao seedlings to 70%.

Comparative genome analysis of entomopathogenic fungi reveals a complex set of secreted proteins.

PubMed

Staats, Charley Christian; Junges, Angela; Guedes, Rafael Lucas Muniz; Thompson, Claudia Elizabeth; de Morais, Guilherme Loss; Boldo, Juliano Tomazzoni; de Almeida, Luiz Gonzaga Paula; Andreis, Fábio Carrer; Gerber, Alexandra Lehmkuhl; Sbaraini, Nicolau; da Paixão, Rana Louise de Andrade; Broetto, Leonardo; Landell, Melissa; Santi, Lucélia; Beys-da-Silva, Walter Orlando; Silveira, Carolina Pereira; Serrano, Thaiane Rispoli; de Oliveira, Eder Silva; Kmetzsch, Lívia; Vainstein, Marilene Henning; de Vasconcelos, Ana Tereza Ribeiro; Schrank, Augusto

2014-09-29

Metarhizium anisopliae is an entomopathogenic fungus used in the biological control of some agricultural insect pests, and efforts are underway to use this fungus in the control of insect-borne human diseases. A large repertoire of proteins must be secreted by M. anisopliae to cope with the various available nutrients as this fungus switches through different lifestyles, i.e., from a saprophytic, to an infectious, to a plant endophytic stage. To further evaluate the predicted secretome of M. anisopliae, we employed genomic and transcriptomic analyses, coupled with phylogenomic analysis, focusing on the identification and characterization of secreted proteins. We determined the M. anisopliae E6 genome sequence and compared this sequence to other entomopathogenic fungi genomes. A robust pipeline was generated to evaluate the predicted secretomes of M. anisopliae and 15 other filamentous fungi, leading to the identification of a core of secreted proteins. Transcriptomic analysis using the tick Rhipicephalus microplus cuticle as an infection model during two periods of infection (48 and 144 h) allowed the identification of several differentially expressed genes. This analysis concluded that a large proportion of the predicted secretome coding genes contained altered transcript levels in the conditions analyzed in this study. In addition, some specific secreted proteins from Metarhizium have an evolutionary history similar to orthologs found in Beauveria/Cordyceps. This similarity suggests that a set of secreted proteins has evolved to participate in entomopathogenicity. The data presented represents an important step to the characterization of the role of secreted proteins in the virulence and pathogenicity of M. anisopliae.

Evaluation of anti-fatigue property of the extruded product of cereal grains mixed with Cordyceps militaris on mice.

PubMed

Zhong, Lei; Zhao, Liyan; Yang, Fangmei; Yang, Wenjian; Sun, Yong; Hu, Qiuhui

2017-01-01

Fatigue is a biological phenomenon that involves a feeling of extreme physical or mental tiredness that could potentially cause some severe chronic diseases. Recently, diet therapy has provided a new alternative to alleviate physical fatigue. In our previous study, addition of Cordyceps militaris ( C. militaris ) into an extruded product was shown to provide high nutrition and unique flavors; however, little is known whether this product has some scientific evidence regarding anti-fatigue property. The purpose of this study was to evaluate the anti-fatigue effects of extruded products of cereal grains (EC) and EC mixed with C. militaris (ECC). The mice were divided into seven groups: one group received distilled water (Control group, n  = 20), and the other groups received different dosages of EC (5, 10 and 20 g/kg body weight, n  = 20 per group) or of ECC (5, 10 and 20 g/kg body weight, n  = 20 per group) solution in water. All of the mice were administered with distilled water, EC or ECC continuously for 30 days by gavage and the anti-fatigue activity was evaluated using a weight-loaded swimming test, along with assessments of fatigue-related indicators. The mode of fighting fatigue was investigated by determining changes in exercise endurance and biochemical markers, including exhaustive swimming time, lactate dehydrogenase (LDH), blood lactic acid (BLA), creatine kinase (CK), blood urea nitrogen (BUN), malondialdehyde (MDA), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), catalase (CAT), and hepatic and muscle glycogen levels. EC and ECC prolonged the swimming endurance time of mice compared to the control. The content of BLA at high dose of ECC group (20 g/kg) was significantly lower than that in the negative control group. CK, BUN and MDA levels were significantly reduced by treatment with EC and ECC compared to the negative control, while the low and middle dose of EC had no significant effect on MDA levels. Additionally, only the middle and high dose of EC (10, 20 g/kg) could significantly decrease the BUN level. EC and ECC treatments increased glycogen, LDH, SOD, CAT and GSH-Px levels. Low and middle dose of EC had no significant effects on muscle glycogen. Moreover, low dose of EC could increase the level of SOD but it was not statistically significant. Compared to the EC treatment groups, ECC demonstrated the efficacy of anti-fatigue potential, particularly at a high dose of ECC, the best performance in relieving fatigue. These results suggest that EC and ECC could prevent exercise-induced fatigue in mice and ECC provided a better effect. In addition, C. militaris in ECC might play a crucial role in the anti-fatigue activity of ECC.

Cordycepin Induces Apoptosis and Inhibits Proliferation of Human Lung Cancer Cell Line H1975 via Inhibiting the Phosphorylation of EGFR.

PubMed

Wang, Zheng; Wu, Xue; Liang, Yan-Ni; Wang, Li; Song, Zhong-Xing; Liu, Jian-Li; Tang, Zhi-Shu

2016-09-27

Cordycepin is an active component of the traditional Chinese medicine Cordyceps sinensis and Cordyceps militaris with notable anticancer activity. Though the prominent inhibitory activity was reported in different kinds of cancer cell lines, the concrete mechanisms remain elusive. It was reported that cordycepin could be converted into tri-phosphates in vivo to confuse a number of enzymes and interfere the normal cell function. For the inhibitory mechanism of EGFR inhibitors and the structure similarity of ATP and tri-phosphated cordycepin, human lung cancer cell line H1975 was employed to investigate the inhibitory effect of cordycepin. The results showed that cordycepin could inhibit cell proliferation and induce apoptosis in a dose-dependent manner. Cell cycle analysis revealed that H1975 cells could be arrested at the G₀/G₁ phase after cordycepin treatment. The expression levels of apoptosis-related protein Caspase-3 and Bcl-2 and phosphorylated expression levels of EGFR, AKT and ERK1/2 were all decreased compared with the control group stimulated with EGF. However, the protein expression levels of proapoptotic protein Bax and cleaved caspase-3 were increased. These results implied that cordycepin could inhibit cell proliferation and induce apoptosis via the EGFR signaling pathway. Our results indicated that there was potential to seek a novel EGFR inhibitor from cordycepin and its chemical derivatives.

Isolation of the Entomopathogenic Fungal Strain Cod-MK1201 from a Cicada Nymph and Assessment of Its Antibacterial Activities.

PubMed

Sangdee, Kusavadee; Nakbanpote, Woranan; Sangdee, Aphidech

2015-01-01

The entomopathogenic fungus Cod-MK1201 was isolated from a dead cicada nymph. Three regions of ribosomal nuclear DNA, the internal transcribed spacers of nuclear ribosomal DNA repeats (ITS), the partial small subunit of rDNA (nrSSU) , and the partial large subunit of rDNA (nrLSU), and two protein-coding regions, the elongation factor 1α (EF-1α), and the largest subunit of the RNA polymerase II (rpb1) gene, were sequenced and used for fungal identification. The phylogenetic analysis of the ITS and the combined data set of the five genes indicated that the fungal isolate Cod-MK1201 is a new strain of Cordyceps sp. that is closely related to Cordyceps nipponica and C. kanzashiana. Crude extracts of mycelium-cultured Cod-MK1201 were obtained using distilled water and 50% (v/v) ethanol, and the antibacterial activity of each was determined. Both extracts had activity against Gram-positive and Gram-negative bacteria, but the ethanol extract was the more potent of the two. The antibacterial activity of the protein fractions of these extracts was also determined. The protein fraction from the ethanol extract was more antibacterial than the protein fraction from the aqueous extract. Three antibacterial constituents including adenosine, the total phenolic content (TPC), and the total flavonoid content (TFC) was also determined. The results showed that the adenosine content, the TPC, and the TFC of the ethanol extract were more active than those of the aqueous extract. Moreover, synergism was detected between these antibacterial constituents. In conclusion, the entomopathogenic fungal isolate Cod-MK1201 represents a natural source of antibacterial agents.

Genome Studies on Nematophagous and Entomogenous Fungi in China

PubMed Central

Zhang, Weiwei; Cheng, Xiaoli; Liu, Xingzhong; Xiang, Meichun

2016-01-01

The nematophagous and entomogenous fungi are natural enemies of nematodes and insects and have been utilized by humans to control agricultural and forestry pests. Some of these fungi have been or are being developed as biological control agents in China and worldwide. Several important nematophagous and entomogenous fungi, including nematode-trapping fungi (Arthrobotrys oligospora and Drechslerella stenobrocha), nematode endoparasite (Hirsutella minnesotensis), insect pathogens (Beauveria bassiana and Metarhizium spp.) and Chinese medicinal fungi (Ophiocordyceps sinensis and Cordyceps militaris), have been genome sequenced and extensively analyzed in China. The biology, evolution, and pharmaceutical application of these fungi and their interacting with host nematodes and insects revealed by genomes, comparing genomes coupled with transcriptomes are summarized and reviewed in this paper. PMID:29376926

Isolation, Culture and Characterization of Hirsutella sinensis Mycelium from Caterpillar Fungus Fruiting Body

PubMed Central

Ko, Yun-Fei; Liau, Jian-Ching; Lee, Chien-Sheng; Chiu, Chen-Yaw; Martel, Jan; Lin, Chuan-Sheng; Tseng, Shun-Fu; Ojcius, David M.; Lu, Chia-Chen; Lai, Hsin-Chih; Young, John D.

2017-01-01

The caterpillar fungus Ophiocordyceps sinensis (previously called Cordyceps sinensis) has been used for centuries in Asia as a tonic to improve health and longevity. Recent studies show that O. sinensis produces a wide range of biological effects on cells, laboratory animals and humans, including anti-fatigue, anti-infection, anti-inflammatory, antioxidant, and anti-tumor activities. In view of the rarity of O. sinensis fruiting bodies in nature, cultivation of its anamorph mycelium represents a useful alternative for large-scale production. However, O. sinensis fruiting bodies harvested in nature harbor several fungal contaminants, a phenomenon that led to the isolation and characterization of a large number of incorrect mycelium strains. We report here the isolation of a mycelium from a fruiting body of O. sinensis and we identify the isolate as O. sinensis’ anamorph (also called Hirsutella sinensis) based on multi-locus sequence typing of several fungal genes (ITS, nrSSU, nrLSU, RPB1, RPB2, MCM7, β-tubulin, TEF-1α, and ATP6). The main characteristics of the isolated mycelium, including its optimal growth at low temperature (16°C) and its biochemical composition, are similar to that of O. sinensis fruiting bodies, indicating that the mycelium strain characterized here may be used as a substitute for the rare and expensive O. sinensis fruiting bodies found in nature. PMID:28046129

Cordyceps sinensis protects against liver and heart injuries in a rat model of chronic kidney disease: a metabolomic analysis.

PubMed

Liu, Xia; Zhong, Fang; Tang, Xu-long; Lian, Fu-lin; Zhou, Qiao; Guo, Shan-mai; Liu, Jia-fu; Sun, Peng; Hao, Xu; Lu, Ying; Wang, Wei-ming; Chen, Nan; Zhang, Nai-xia

2014-05-01

To test the hypothesis that the traditional Chinese medicine Cordyceps sinensis could improve the metabolic function of extrarenal organs to achieve its anti-chronic kidney disease (CKD) effects. Male SD rats were divided into CKD rats (with 5/6-nephrectomy), CKD rats treated with Cordyceps sinensis (4 mg•kg-1•d-1, po), and sham-operated rats. After an 8-week treatment, metabolites were extracted from the hearts and livers of the rats, and then subjected to (1)H-NMR-based metabolomic analysis. Oxidative stress, energy metabolism, amino acid and protein metabolism and choline metabolism were considered as links between CKD and extrarenal organ dysfunction. Within the experimental period of 8 weeks, the metabolic disorders in the liver were more pronounced than in the heart, suggesting that CKD-related extrarenal organ dysfunctions occurred sequentially rather than simultaneously. Oral administration of Cordyceps sinensis exerted statistically significant rescue effects on the liver and heart by reversely regulating levels of those metabolites that are typically perturbed in CKD. Oral administration of Cordyceps sinensis significantly attenuates the liver and heart injuries in CKD rats. The (1)H NMR-based metabolomic approach has provided a systematic view for understanding of CKD and the drug treatment, which can also be used to elucidate the mechanisms of action of other traditional Chinese medicines.

Cordyceps sinensis protects against liver and heart injuries in a rat model of chronic kidney disease: a metabolomic analysis

PubMed Central

Liu, Xia; Zhong, Fang; Tang, Xu-long; Lian, Fu-lin; Zhou, Qiao; Guo, Shan-mai; Liu, Jia-fu; Sun, Peng; Hao, Xu; Lu, Ying; Wang, Wei-ming; Chen, Nan; Zhang, Nai-xia

2014-01-01

Aim: To test the hypothesis that the traditional Chinese medicine Cordyceps sinensis could improve the metabolic function of extrarenal organs to achieve its anti-chronic kidney disease (CKD) effects. Methods: Male SD rats were divided into CKD rats (with 5/6-nephrectomy), CKD rats treated with Cordyceps sinensis (4 mg•kg-1•d-1, po), and sham-operated rats. After an 8-week treatment, metabolites were extracted from the hearts and livers of the rats, and then subjected to 1H-NMR-based metabolomic analysis. Results: Oxidative stress, energy metabolism, amino acid and protein metabolism and choline metabolism were considered as links between CKD and extrarenal organ dysfunction. Within the experimental period of 8 weeks, the metabolic disorders in the liver were more pronounced than in the heart, suggesting that CKD-related extrarenal organ dysfunctions occurred sequentially rather than simultaneously. Oral administration of Cordyceps sinensis exerted statistically significant rescue effects on the liver and heart by reversely regulating levels of those metabolites that are typically perturbed in CKD. Conclusion: Oral administration of Cordyceps sinensis significantly attenuates the liver and heart injuries in CKD rats. The 1H NMR-based metabolomic approach has provided a systematic view for understanding of CKD and the drug treatment, which can also be used to elucidate the mechanisms of action of other traditional Chinese medicines. PMID:24632844

Cordyceps bassiana and production of stromata in vitro showing Beauveria anamorph in Korea

USDA-ARS?s Scientific Manuscript database

A Cordyceps species was found with Beauveria anamorph state on larval insect cadavers on Obong Mountsin in Gangwon Pronvince, Republic of Korea. Cultures from discharged ascospores formed an anamorph identifiable as Beauveria bassiana. This teleomorph-anamorph connection was also confirmed by the in...

Characterization of nucleosides and nucleobases in natural Cordyceps by HILIC-ESI/TOF/MS and HILIC-ESI/MS.

PubMed

Zhao, Heng-Qiang; Wang, Xiao; Li, Hong-Mei; Yang, Bin; Yang, Hong-Jun; Huang, Luqi

2013-08-15

A method combining hydrophilic interaction chromatography (HILIC) and electrospray ionization mass spectrometry (ESI-MS) was developed for the characterization and determination of natural Cordyceps. Separation was achieved on a Waters Xbridge Amide column with gradient elution. Identification of 15 target nucleosides and nucleobases was based on retention time, UV spectra and mass measurements of the protonated molecules ([M+H]⁺) and main fragment ions (ESI-TOF/MS). Eight non-target compounds were tentatively identified by ESI-TOF/MS. The 15 target compounds were quantified by HILIC-ESI-MS/MS using time-programmed selective ion monitoring or multiple reaction monitoring in positive-ion mode under optimized mass conditions. This technique showed good linearity, repeatability and recovery. This approach was also successfully implemented in the analysis of nucleosides and nucleobases in 12 batches of natural Cordyceps samples that were collected from different regions in China. The developed HILIC-ESI-MS method exhibited clear advantages in identifying and determining highly polar bioactive components in Cordyceps, as well as their quality control.

Cold generation of smoke flavour by the first phenolic acid decarboxylase from a filamentous ascomycete - Isaria farinosa.

PubMed

Linke, Diana; Riemer, Stephanie J L; Schimanski, Silke; Nieter, Annabel; Krings, Ulrich; Berger, Ralf G

2017-09-01

A decarboxylase (IfPAD) from the ascomycete Isaria farinosa converted ferulic acid to 4-vinylguaiacol (4-VG), a volatile which imparts the distinct "smoke flavor" of pyrolized wood. The activity was enhanced by adding (E)-ferulic acid to the culture medium and peaked with 3.6 U g -1 mycelium (1 μmol 4-VG min -1 ). The coding sequence of 543 bp was translated into a 25 kDa protein with a homology of 91 % to putative phenolic acid decarboxylases of its teleomorph, Cordyceps militaris, and Beauveria bassiana, the anamorph of Cordyceps bassiana. Cold shock expression in Escherichia coli yielded 411 U g -1 wet mass. Substrate conversion required a hydroxyl substituent para to a trans-unsaturated C3-side chain of the aromatic ring. K m and k cat /K m values were determined to 0.3 mM and 78.4 mM -1 s -1 for p-coumaric acid and 1.9 mM and 45.1 mM -1 s -1 for (E)-ferulic acid, respectively. The native enzyme and its recombinant counterpart showed pH-optima at pH 6.0 and pH 5.5, and low temperature optima of 19 °C and 14 °C, respectively. IfPAD produced 4-VG from destarched wheat bran and sugar beet fiber, confirming activity on complex plant biomass. This is the first report on the biochemical characterization of a phenolic acid decarboxylase from a filamentous ascomycete. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Simultaneous determination of nucleosides and their bases in Cordyceps sinensis and its substitutes by matrix solid-phase dispersion extraction and HPLC.

PubMed

Wang, Zhibing; Li, Na; Wang, Min; Wang, Yue; Du, Lin; Ji, Xiaofeng; Yu, Aimin; Zhang, Hanqi; Qiu, Fangping

2013-07-01

Nine nucleosides and nucleobases, including uracil, adenine, thymine, uridine, adenosine, thymidine, cytidine, guanosine, and cordycepin in natural Cordyceps sinensis, cultured Cordyceps mycelia, and Cordyceps fruiting bodies were extracted by matrix solid-phase dispersion (MSPD) and determined by HPLC. The experimental conditions for the MSPD extraction were optimized. Florisil was used as dispersant, petroleum ether as washing solvent, and methanol as elution solvent. The Florisil-to-sample ratio was selected to be 4:1 and no additional clean-up sorbent was needed. The calibration curves had good linear relationships (r > 0.9997). The LOD and LOQ were in the range of 12～79 and 41～265 ng/mL, respectively. The intra- and interday precision were lower than 8.3%. The recoveries were between 61.5 and 93.2%. The present method consumed less sample compared with ultrasonic extraction and heating reflux extraction (HRE). The extraction yields obtained by using the present method are much higher than those obtained by UE and comparable to those obtained by HRE. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Preventing Electromagnetic Pulse Irradiation Damage on Testis Using Selenium-rich Cordyceps Fungi. A Preclinical Study in Young Male Mice.

PubMed

Miao, Xia; Wang, Yafeng; Lang, Haiyang; Lin, Yanyun; Guo, Qiyan; Yang, Mingjuan; Guo, Juan; Zhang, Yanjun; Zhang, Jie; Liu, Junye; Liu, Yaning; Zeng, Lihua; Guo, Guozhen

2017-02-01

Networked 21st century society, globalization, and communications technologies are paralleled by the rise of electromagnetic energy intensity in our environments and the growing pressure of the environtome on human biology and health. The latter is the entire complement of environmental factors, including the electromagnetic energy and the technologies that generate them, enacting on the digital citizen in the new century. Electromagnetic pulse (EMP) irradiation might have serious damaging effects not only on electronic equipment but also in the whole organism and reproductive health, through nonthermal effects and oxidative stress. We sought to determine whether EMP exposure (1) induces biological damage on reproductive health and (2) the extent to which selenium-rich Cordyceps fungi (daily coadministration) offer protection on the testicles and spermatozoa. In a preclinical randomized study, 3-week-old male BALB/c mice were repeatedly exposed to EMP (peak intensity 200 kV/m, pulse edge 3.5 ns, pulse width 15 ns, 0.1 Hz, and 400 pulses/day) 5 days per week for four consecutive weeks, with or without coadministration of daily selenium-rich Cordyceps fungi (100 mg/kg). Testicular index and spermatozoa formation were measured at baseline and 1, 7, 14, 28, and 60 day time points after EMP exposure. The group without Cordyceps cotreatment displayed decreased spermatozoa formation, shrunk seminiferous tubule diameters, and diminished antioxidative capacity at 28 and 60 days after exposure (p < 0.05). The Cordyceps daily cotreatment alleviated the testicular damage by EMP exposure, increased spermatozoa formation, and reduced apoptotic spermatogenic cells. These observations warrant further preclinical and clinical studies as an innovative approach for potential protection against electromagnetic radiation in the current age of networked society and digital citizenship.

Analysis of Soluble Proteins in Natural Cordyceps sinensis from Different Producing Areas by Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis and Two-dimensional Electrophoresis

PubMed Central

Li, Chun-Hong; Zuo, Hua-Li; Zhang, Qian; Wang, Feng-Qin; Hu, Yuan-Jia; Qian, Zheng-Ming; Li, Wen-Jia; Xia, Zhi-Ning; Yang, Feng-Qing

2017-01-01

Background: As one of the bioactive components in Cordyceps sinensis (CS), proteins were rarely used as index components to study the correlation between the protein components and producing areas of natural CS. Objective: Protein components of 26 natural CS samples produced in Qinghai, Tibet, and Sichuan provinces were analyzed and compared to investigate the relationship among 26 different producing areas. Materials and Methods: Proteins from 26 different producing areas were extracted by Tris-HCl buffer with Triton X-100, and separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and two-dimensional electrophoresis (2-DE). Results: The SDS-PAGE results indicated that the number of protein bands and optical density curves of proteins in 26 CS samples was a bit different. However, the 2-DE results showed that the numbers and abundance of protein spots in protein profiles of 26 samples were obviously different and showed certain association with producing areas. Conclusions: Based on the expression values of matched protein spots, 26 batches of CS samples can be divided into two main categories (Tibet and Qinghai) by hierarchical cluster analysis. SUMMARY The number of protein bands and optical density curves of proteins in 26 Cordyceps sinensis samples were a bit different on the sodium dodecyl sulfate-polyacrylamide gel electrophoresis protein profilesNumbers and abundance of protein spots in protein profiles of 26 samples were obvious different on two-dimensional electrophoresis mapsTwenty-six different producing areas of natural Cordyceps sinensis samples were divided into two main categories (Tibet and Qinghai) by Hierarchical cluster analysis based on the values of matched protein spots. Abbreviations Used: SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis, 2-DE: Two-dimensional electrophoresis, Cordyceps sinensis: CS, TCMs: Traditional Chinese medicines PMID:28250651

Analysis of Soluble Proteins in Natural Cordyceps sinensis from Different Producing Areas by Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis and Two-dimensional Electrophoresis.

PubMed

Li, Chun-Hong; Zuo, Hua-Li; Zhang, Qian; Wang, Feng-Qin; Hu, Yuan-Jia; Qian, Zheng-Ming; Li, Wen-Jia; Xia, Zhi-Ning; Yang, Feng-Qing

2017-01-01

As one of the bioactive components in Cordyceps sinensis (CS), proteins were rarely used as index components to study the correlation between the protein components and producing areas of natural CS. Protein components of 26 natural CS samples produced in Qinghai, Tibet, and Sichuan provinces were analyzed and compared to investigate the relationship among 26 different producing areas. Proteins from 26 different producing areas were extracted by Tris-HCl buffer with Triton X-100, and separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and two-dimensional electrophoresis (2-DE). The SDS-PAGE results indicated that the number of protein bands and optical density curves of proteins in 26 CS samples was a bit different. However, the 2-DE results showed that the numbers and abundance of protein spots in protein profiles of 26 samples were obviously different and showed certain association with producing areas. Based on the expression values of matched protein spots, 26 batches of CS samples can be divided into two main categories (Tibet and Qinghai) by hierarchical cluster analysis. The number of protein bands and optical density curves of proteins in 26 Cordyceps sinensis samples were a bit different on the sodium dodecyl sulfate-polyacrylamide gel electrophoresis protein profilesNumbers and abundance of protein spots in protein profiles of 26 samples were obvious different on two-dimensional electrophoresis mapsTwenty-six different producing areas of natural Cordyceps sinensis samples were divided into two main categories (Tibet and Qinghai) by Hierarchical cluster analysis based on the values of matched protein spots. Abbreviations Used : SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis, 2-DE: Two-dimensional electrophoresis, Cordyceps sinensis : CS, TCMs: Traditional Chinese medicines.

[Studies on macroscopic and microscopic identification of Cordyceps sinensis and its counterfeits].

PubMed

Chan, Siutsau; Liu, Baoling; Zhao, Zhongzhen; Lam, Markin; Law, Kwokwai; Chen, Hubiao

2011-05-01

To provide a rapid, simple, accurate and reproducible identification method from which Cordyceps sinensis can be distinguished from other species. To observe the larva and stroma of Cordyceps family with macroscopic identification method, and with powder microscopic identification method. For macroscopic, only stroma of C. sinensis is mostly non-inflated, and un-obtuse at the tip, the caterpillar annulations of C. sinensis and the C. gracilis is distinct, about 20-30, and feet of above two are 8 pairs, 4 of 8 pairs are relatively distinct. The above appearance shows its unique characteristic. For microscopic identification, only C. sinensis exists microtrichia, the tip is pointed. The arranging order of stubby setae is irregular, the tip is blunt while the basal is gradually broader; the top of some setae bends slightly like a hook.

[Comparison and review on specifications of fermented Cordyceps sinensis products].

PubMed

Yang, Ping; Zhao, Xiao-Xia; Zhang, Yong-Wen

2018-02-01

There are five kinds of fermented Cordyceps crude drug and their preparations that have been approved as medicine on the market. Since the initial strains of the crude drug were all isolated from natural Cordyceps sinensis， they have similar names， chemical components and even clinical applications. However， because of the different strain species and fermentation processes， there was significant difference in quality. As a result， they should be clearly distinguished in clinical use. Most of the products were researched and developed during the 1980s and 1990s， so there was difference in quality standards for different products， and their quality control levels of some products were not perfect. At present， some of the products are approved as Chinese medicine， others are approved as chemical drugs， with a confusion in products name， management and clinical application. In this paper， the approval numbers， quality standards and clinical applications， and current problems of these products were summarized and compared; some suggestions were put forward， such as standardizing the product name， unifying the management of approval number category， and increasing the specific quality control attributes， in order to provide reference for standard implementation， quality control and drug regulation for fermented Cordyceps crude drugs and their preparations. Copyright© by the Chinese Pharmaceutical Association.

Release of feruloylated oligosaccharides from wheat bran through submerged fermentation by edible mushrooms.

PubMed

Xie, Chunyan; Wu, Zhiyan; Guo, Hongzhen; Gu, Zhenxin

2014-07-01

Wheat bran, a by-product of the flour industry, is believed to be a raw material for the production of feruloylated oligosaccharides (FOs) because of its high content of conjiont ferulic acid (FA). Studies were carried out to identify edible mushrooms that are able to release FOs from wheat bran. All the six tested mushrooms (Pleurotus ostreatus, Hericium erinaceum, Auricularia auricula, Cordyceps militaris, Agrocybe chaxingu, and Ganoderma lucium) were found to release FOs, and Agrocybe chaxingu had the highest yield, reaching 35.4 µM in wheat bran broth. Enzymes detection showed that these species secreted extracellular enzymes during fermentation, including cellulase and xylanase. Agrocybe chaxingu secreted the significant amount of xylanase (180 mU ml(-1) ), which was responsible for the release of FOs from wheat bran, while Hericium erinaceum secreted FA esterase which could disassemble FOs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Toxicity evaluation of cordycepin and its delivery system for sustained in vitro anti-lung cancer activity

NASA Astrophysics Data System (ADS)

Aramwit, Pornanong; Porasuphatana, Supatra; Srichana, Teerapol; Nakpheng, Titpawan

2015-03-01

In the previous study, we have found that the cordycepin which was extracted from Cordyceps mycelia produced by growing Cordyceps militaris on the dead larva of Bombyx mori silkworms showed the anti-proliferative effect toward lung cancer cells without toxicity to non-cancer cells. In this work, the cordycepin was tested for its in vitro mutagenicity and in vivo toxicity. From the Ames test and subacute toxicity test using oral administration in a rat model, the cordycepin was proved to be a non-mutagenic and non-toxic compound. The hematology and blood chemistry as well as the microanatomical characteristic of the tissues of rats fed with cordycepin every day for consecutive 30 days were comparable to those of the normal ones. Then, the cordycepin was incorporated in gelatin type A (GA) and gelatin type B (GB) nanoparticles aimed to sustain its release and activity. The cordycepin incorporated in both GA and GB nanoparticles showed the sustained release profiles. GA nanoparticles could encapsulate cordycepin at higher encapsulation efficiency due to the attractive electrostatic interaction between the positive-charged GA and the negative-charged cordycepin. However, GA nanoparticles released cordycepin at the higher amount possibly because of the large surface area of small size nanoparticles. Comparing to GB nanoparticles, the higher amount of cordycepin released from GA nanoparticles showed the higher anti-proliferative and anti-migratory effects on A549 lung cancer cells. In conclusion, GA nanoparticles were suggested as a suitable carrier for the sustained release of cordycepin. The GA nanoparticles releasing cordycepin could be an effective and non-invasive material for the treatment of lung cancer cells.

Ethanolic and aqueous extracts derived from Australian fungi inhibit cancer cell growth in vitro.

PubMed

Beattie, Karren D; Ulrich, Rahel; Grice, I Darren; Uddin, Shaikh J; Blake, Tony B; Wood, Kyle A; Steele, Jules; Iu, Fontaine; May, Tom W; Tiralongo, Evelin

2011-01-01

Fifteen Australian macrofungi were investigated for cytotoxic activity. Ethanol, cold and hot water extracts of each species were screened for cytotoxic activity against normal mouse fibroblast cells (NIH/3T3), healthy human epithelial kidney cells (HEK-293), four cancer cell lines, gastric adenocarcinoma cells (AGS), two mammary gland adenocarcinoma cells (MDA-MB-231, MCF7) and colorectal adenocarcinoma cells (HT-29) with a validated MTT assay. Most extracts derived from Omphalotus nidiformis, Cordyceps cranstounii and Cordyceps gunnii demonstrated significant cytotoxic activity toward a variety of cancer cell lines. In contrast only some extracts from Coprinus comatus, Cordyceps hawkesii, Hypholoma fasciculare, Lepista nuda, Leratiomyces ceres and Ophiocordyceps robertsii displayed significant cytotoxic activity, which was usually selective for only one or two cancer cell lines tested. The least cytotoxic species evaluated in this study were Agaricus bitorquis, Coprinopsis atrametaria, Psathyrella asperospora, Russula clelandii, Tricholoma sp. AU2 and Xerula mundroola.

[Preliminary study on correlation between diversity of soluble proteins and producing area of Cordyceps sinensis].

PubMed

Ren, Yan; Qiu, Yi; Wan, De-Guang; Lu, Xian-Ming; Guo, Jin-Lin

2013-05-01

To analyze the content and type of soluble proteins in Cordyceps sinensis from different producing areas and processed with different methods with bradford method and 2-DE technology, in order to discover significant differences in soluble proteins in C. sinensis processed with different methods and from different producing areas. The preliminary study indicated that the content and diversity of soluble proteins were related to producing areas and processing methods to some extent.

Functional study of Cordyceps sinensis and cordycepin in male reproduction: A review.

PubMed

Chen, Yung-Chia; Chen, Ying-Hui; Pan, Bo-Syong; Chang, Ming-Min; Huang, Bu-Miin

2017-01-01

Cordyceps sinensis has various biological and pharmacological functions, and it has been claimed as a tonic supplement for sexual and reproductive dysfunctions for a long time in oriental society. In this article, the in vitro and in vivo effects of C. sinensis and cordycepin on mouse Leydig cell steroidogenesis are briefly described, the stimulatory mechanisms are summarized, and the recent findings related to the alternative substances regulating male reproductive functions are also discussed. Copyright © 2016. Published by Elsevier B.V.

Phylogenetic-based nomenclatural proposals for Ophiocordycipitaceae (Hypocreales) with new combinations in Tolypocladium.

PubMed

Quandt, C Alisha; Kepler, Ryan M; Gams, Walter; Araújo, João P M; Ban, Sayaka; Evans, Harry C; Hughes, David; Humber, Richard; Hywel-Jones, Nigel; Li, Zengzhi; Luangsa-Ard, J Jennifer; Rehner, Stephen A; Sanjuan, Tatiana; Sato, Hiroki; Shrestha, Bhushan; Sung, Gi-Ho; Yao, Yi-Jian; Zare, Rasoul; Spatafora, Joseph W

2014-06-01

Ophiocordycipitaceae is a diverse family comprising ecologically, economically, medicinally, and culturally important fungi. The family was recognized due to the polyphyly of the genus Cordyceps and the broad diversity of the mostly arthropod-pathogenic lineages of Hypocreales. The other two cordyceps-like families, Cordycipitaceae and Clavicipitaceae, will be revised taxonomically elsewhere. Historically, many species were placed in Cordyceps, but other genera have been described in this family as well, including several based on anamorphic features. Currently there are 24 generic names in use across both asexual and sexual life stages for species of Ophiocordycipitaceae. To reflect changes in Art. 59 in the International Code of Nomenclature for algae, fungi, and plants (ICN), we propose to protect and to suppress names within Ophiocordycipitaceae, and to present taxonomic revisions in the genus Tolypocladium, based on rigorous and extensively sampled molecular phylogenetic analyses. When approaching this task, we considered the principles of priority, monophyly, minimizing taxonomic revisions, and the practical utility of these fungi within the wider biological research community.

Anti-fibrotic effect of Cordyceps sinensis polysaccharide: Inhibiting HSC activation, TGF-β1/Smad signalling, MMPs and TIMPs.

PubMed

Peng, Jinghua; Li, Xuemei; Feng, Qin; Chen, Liang; Xu, Lili; Hu, Yiyang

2013-06-01

Cordyceps sinensis has been used to treat liver disease in traditional Chinese medicine for thousands of years. Polysaccharide extracted from cultured Cordyceps sinensis mycelia (CS-PS) is the major active components of cordyceps sinensis with anti-liver injury effects. In the present study, the effects of CS-PS on hepatic stellate cell (HSC) activation, transforming growth factor-β1 (TGF-β1)/Smad pathway, as well as matrix metalloproteinase (MMP) 2, MMP9 and tissue inhibitor of metalloproteinase (TIMP) 1, TIMP2, were investigated in liver fibrosis in rats induced by carbon tetrachloride (CCl4). Colchicine was used as a positive control. The effect of CS-PS inhibition liver injury and fibrosis was confirmed by decreasing serum alanine aminotransferase, aspartate aminotransferase, total bilirubin, hepatic hydroxyproline and increasing serum albumin, as well as alleviation of histological changes, which was comparable to that of colchicine. With CS-PS treatment, hepatic α-smooth muscle actin, TGF-β1, TGF-β1 receptor (TβR)-I, TβR-II, p-Smad2, p-Smad3 and TIMP2 proteins expression were down-regulated comparing to that in CCl4 group. The activities of MMP2 and MMP9 in liver tissue were also inhibited in CS-PS-treated group. It is indicated that the effects of CS-PS anti-liver fibrosis are probably associated with the inhibition on HSC activation, TGF-β1/Smads signalling pathway, as well as MMP2, MMP9 activity and TIMP2 expression.

Successful Development of Cordyceps bassiana Stromata from Beauveria bassiana

PubMed Central

Lee, Je-O; Shrestha, Bhushan; Sung, Gi-Ho; Han, Sang-Kuk

2010-01-01

A specimen of Beauveria bassiana was collected from Yang-yang of Gangwon province, Korea in October 2006. Conidial isolates were prepared from the specimen by the dilution method and inoculated in brown rice medium for fruiting body production. After nearly two months incubation for perithecial stromata developed from single isolates as well as from their combinations. They were determined as Cordyceps bassiana by observing the stromatal characters and their conidial structures. This is the first report of the development of C. bassiana from B. bassiana cultures. PMID:23956619

Separation of cordycepin from Cordyceps militaris fermentation supernatant using preparative HPLC and evaluation of its antibacterial activity as an NAD+-dependent DNA ligase inhibitor

PubMed Central

Zhou, Xiaofeng; Cai, Guoqiang; He, Yi; Tong, Guotong

2016-01-01

Cordycepin exhibits various bio-activities, including anticancer, antibacterial, antiviral and immune regulation activities, and is a significant focus of research. However, the preparation of high-purity cordycepin remains challenging. Also, the molecular target with which cordycepin interacts to cause an antibacterial effect remains unknown. In the present study, cordycepin was prepared by preparative high-performance liquid chromatography (prep-HPLC) and the purity obtained was 99.6%, indicating that this technique may be useful for the large-scale isolation of cordycepin in the future. The results of computational molecular docking analysis indicated that the interaction energy between cordycepin and NAD+-dependent DNA ligase (LigA) was lower than that between cordycepin and other common antibacterial targets. The highly pure cordycepin obtained by prep-HPLC demonstrated inhibitory activity against LigA from various bacteria in vitro. In conclusion, cordycepin may be useful as a broad-spectrum antibiotic targeting LigA in various bacteria. PMID:27588098

Cytoprotective effect of polysaccharide isolated from different mushrooms against 7-ketocholesterol induced damage in mouse liver cell line (BNL CL. 2).

PubMed

Kim, Joo-Shin; Chung, Hau Yin; Na, Keun

2007-01-01

Cytoprotective ability of polysaccharides isolated from different edible mushrooms was investigated on the 7-ketocholesterol-induced damaged cell line. Polysaccharide extracts from six different edible mushrooms-Flammulina velutipes, Peurotus ostreatus, Lentinus edodes, Agrocybe aegerita, Agaricus blazei, and Cordyceps militaris- were prepared by hot water extraction and alcohol precipitation. Cytoprotective ability was evaluated by measuring the viable cells of the normal embryonic liver cell line (BNL CL. 2) in the presence of 7-ketocholesterol. At 80 microg/mL of 7-ketocholesterol, cytotoxicity was very high with a loss of 98% of viable cells after 20 h of incubation. With the addition of 200 microg/mL of each polysaccharide isolate to the cell line containing 80 microg/mL of 7-ketocholesterol, polysaccharide isolates from both Flammulina velutipes and Peurotus ostreatus could significantly inhibit the 7-ketochoelsterol-induced cytotoxicity in the cells. But other polysaccharide isolates were not effective in inhibiting cell damage caused by the oxLDL-induced cytotoxicity.

Cytoprotective effect of polysaccharide isolated from different mushrooms against 7-ketocholesterol induced damage in mouse liver cell line (BNL CL. 2)

PubMed Central

Chung, Hau Yin; Na, Keun

2007-01-01

Cytoprotective ability of polysaccharides isolated from different edible mushrooms was investigated on the 7-ketocholesterol-induced damaged cell line. Polysaccharide extracts from six different edible mushrooms-Flammulina velutipes, Peurotus ostreatus, Lentinus edodes, Agrocybe aegerita, Agaricus blazei, and Cordyceps militaris- were prepared by hot water extraction and alcohol precipitation. Cytoprotective ability was evaluated by measuring the viable cells of the normal embryonic liver cell line (BNL CL. 2) in the presence of 7-ketocholesterol. At 80 µg/mL of 7-ketocholesterol, cytotoxicity was very high with a loss of 98% of viable cells after 20 h of incubation. With the addition of 200 µg/mL of each polysaccharide isolate to the cell line containing 80 µg/mL of 7-ketocholesterol, polysaccharide isolates from both Flammulina velutipes and Peurotus ostreatus could significantly inhibit the 7-ketochoelsterol-induced cytotoxicity in the cells. But other polysaccharide isolates were not effective in inhibiting cell damage caused by the oxLDL-induced cytotoxicity. PMID:20368935

Therapeutic efficacy of a polysaccharide isolated from Cordyceps sinensis on hypertensive rats.

PubMed

Xiang, Feixiang; Lin, Liming; Hu, Min; Qi, Xiangqian

2016-01-01

This study was aimed to investigate the antihypertensive effect of a polysaccharide fraction from Cordyceps sinensis on spontaneously hypertensive rats (SHR). The CSP1, one component of Cordyceps sinensis polysaccharides (CSP), was obtained after water extraction, deproteinization, de-colorization and purification with DEAE-cellulose 52. And a more homogeneous component CSP1-2 was obtained using Sepharose CL-6B chromatography. CSP1-2 mainly consisted of mannose, glucose and galactose in a molar ratio of about 2:2:1 and its average molecular weight was approximately 2.70×10(4)Da. Pharmacological tests showed that CSP1, in which the CSP1-2 was its main component, had antihypertensive effect by stimulating the secretion of vasodilator NO, decreasing the level of ET-1, epinephrine, noradrenaline and angiotensin II, inhibiting the increase of transforming growth factor β1 (TGF-β1) and lowering the level of inflammatory mediator of C-reactive protein (CRP). These results suggested that CSP1 may possess high potential in treating hypertension. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of Cordyceps militaris spent mushroom substrate and Lactobacillus plantarum on mucosal, serum immunology and growth performance of Nile tilapia (Oreochromis niloticus).

PubMed

Van Doan, Hien; Hoseinifar, Seyed Hossein; Dawood, Mahmoud A O; Chitmanat, Chanagun; Tayyamath, Khambou

2017-11-01

An 8-weeks feeding trial was performed to investigate the possible effects of supplementation of Nile tilapia diet with Cordyceps militaris spent mushroom substrate (SMS) single or combined with Lactobacillus plantarum on immune parameters and growth performance. For this aim, Nile tilapia fingerlings were fed with four experimental diets namely: Diet 1 (0 - control), Diet 2 (10 g kg -1 SMS), Diet 3 (10 8  CFU g -1 L. plantarum), and Diet 4 (10 g kg -1 SMS + 10 8  CFU g -1 L. plantarum). At the end of feeding trial, skin mucus parameters, serum immune parameters, and growth performance were measured. The results indicated that supplementations SMS + L. plantarum or/and resulted in a significant increase in skin mucus lysozyme and peroxidase activities compared with the control group after 8 weeks of feeding trial (P < 0.05). The highest values of these parameters were recorded for fish fed both SMS + L. plantarum supplementations. Nonetheless, no significant difference was recorded between other supplemented groups (P < 0.05). For serum immunology, the results showed that serum lysozyme activity, alternative complement, phagocytosis, serum peroxidase, and respiratory burst activities were significantly higher in supplemented groups compared to the control (P < 0.05). The highest values were recorded in fish fed both SMS and L. plantarum with respect to the individual application. No significant differences were observed between fish fed SMS and L. plantarum (P < 0.05). Results on growth performance indicated that fish fed supplemented diets showed a statistically significant increase in the specific growth rate (SGR), weight gain (WG), final weight (FW) compared to the control group (P < 0.05). The highest SGR and WG values were observed in fish fed both dietary SMS and L. plantarum. However, no significant differences in these parameters were observed in fish fed SMS or L. plantarum alone (P > 0.05). The FCR was significantly lower in fish fed 10 g kg -1 SMS + 10 8  CFU g -1 L. plantarum than in other groups, while control group presented the highest values (P < 0.05). The present results suggested that the combination of these natural substances could be considered as potential feed-additives for aquaculture farmed fish. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Effect of Cordyceps sinensis on expressions of HIF-1α and VEGF in the kidney of rats with diabetic nephropathy].

PubMed

Yuan, Mingxia; Tang, Rong; Zhou, Qiaoling; Liu, Kanghan; Xiao, Zhou; Pouranan, Veeraragoo

2013-05-01

To examine the expressions of hypoxia inducible factor-1α (HIF-1α) and vascular endothelial growth factor (VEGF) in the kidney of rats with diabetic nephropathy before and after the treatment of Cordyceps sinensis, and to explore the mechanism of Cordyceps sinensis against hypoxia. The diabetes model was produced by intraperitoneal injection of 60 mg/kg streptozotocin, then the rats whose 24 h urine protein level was above 30 mg/d were thought to have suffered diabetic nephropathy. Thirty rats were randomly divided into a diabetic nephropathy group (DN group, n=15) and a Cordyceps sinensis group (CS group, n=15), and another 15 normal rats served as a normal control group (NC group, n=15). The CS group were intragastrically administered Cordyceps sinensis extract liquid [5.0 g/(kg.d)], the other groups were intragastrically administered drinking water of equal volume. Five rats in each group were killed after 2, 4, and 6 weeks. The 24 h urine protein excretion, urine β-N-acetyl glucosaminidase (NAGase) and serum creatinine were measured; the renal pathological changes were evaluated by HE and Masson staining; the mRNA and protein expressions of HIF-1α and VEGF were dectected by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemistry. Compared with the normal control group, the renal tubular vacuolar degeneration was obvious, and the glomerular mesangial matrix increased in the DN group. The 24 h urinary protein excretion, urine NAGase and serum creatinine also increased significantly (all P<0.05); the expressions of HIF-1α and VEGF in the renal tissue gradually increased with time, and the expression of HIF-1α was correlated with that of VEGF in the 2 groups (r=0.850, r=0.887, both P<0.05) . Compared with the DN group, the pathological changes were relieved, the 24 h urinary protein excretion, urine NAGase and serum creatinine level were decreased, and the expressions of HIF-1α and VEGF decreased in the CS group (all P<0.05), but they were still higher than those in the normal contral group (P<0.05). There was no significant difference in the mRNA and protein expression of HIF-1α between the 4th week and the 6th week after the treatment of CS (P>0.05). The expressions of HIF-1α and VEGF increase in the kidney of rats with diabetic nephropathy, and the positive correlation suggests that there is chronic hypoxia in the renal tissue of diabetic nephropathy. Cordyceps sinensis may protect against chronic hypoxia injury in diabetic nephropathy by lowering the expressions of HIF-1α and VEGF.

Hirsutella sinensis mycelium attenuates bleomycin-induced pulmonary inflammation and fibrosis in vivo

PubMed Central

Huang, Tsung-Teng; Lai, Hsin-Chih; Ko, Yun-Fei; Ojcius, David M.; Lan, Ying-Wei; Martel, Jan; Young, John D.; Chong, Kowit-Yu

2015-01-01

Hirsutella sinensis mycelium (HSM), the anamorph of Cordyceps sinensis, is a traditional Chinese medicine that has been shown to possess various pharmacological properties. We previously reported that this fungus suppresses interleukin-1β and IL-18 secretion by inhibiting both canonical and non-canonical inflammasomes in human macrophages. However, whether HSM may be used to prevent lung fibrosis and the mechanism underlying this activity remain unclear. Our results show that pretreatment with HSM inhibits TGF-β1–induced expression of fibronectin and α-SMA in lung fibroblasts. HSM also restores superoxide dismutase expression in TGF-β1–treated lung fibroblasts and inhibits reactive oxygen species production in lung epithelial cells. Furthermore, HSM pretreatment markedly reduces bleomycin–induced lung injury and fibrosis in mice. Accordingly, HSM reduces inflammatory cell accumulation in bronchoalveolar lavage fluid and proinflammatory cytokines levels in lung tissues. The HSM extract also significantly reduces TGF-β1 in lung tissues, and this effect is accompanied by decreased collagen 3α1 and α-SMA levels. Moreover, HSM reduces expression of the NLRP3 inflammasome and P2X7R in lung tissues, whereas it enhances expression of superoxide dismutase. These findings suggest that HSM may be used for the treatment of pulmonary inflammation and fibrosis. PMID:26497260

Selected herbals and human exercise performance.

PubMed

Bucci, L R

2000-08-01

Herbs have been used throughout history to enhance physical performance, but scientific scrutiny with controlled clinical trials has only recently been used to study such effects. The following herbs are currently used to enhance physical performance regardless of scientific evidence of effect: Chinese, Korean, and American ginsengs; Siberian ginseng, mahuang or Chinese ephedra; ashwagandha; rhodiola; yohimbe; CORDYCEPS: fungus, shilajit or mummio; smilax; wild oats; Muira puama; suma (ecdysterone); Tribulus terrestris; saw palmetto berries; beta-sitosterol and other related sterols; and wild yams (diosgenin). Controlled studies of Asian ginsengs found improvements in exercise performance when most of the following conditions were true: use of standardized root extracts, study duration (>8 wk, daily dose >1 g dried root or equivalent, large number of subjects, and older subjects. Improvements in muscular strength, maximal oxygen uptake, work capacity, fuel homeostasis, serum lactate, heart rate, visual and auditory reaction times, alertness, and psychomotor skills have also been repeatedly documented. Siberian ginseng has shown mixed results. Mahuang, ephedrine, and related alkaloids have not benefited physical performance except when combined with caffeine. Other herbs remain virtually untested. Future research on ergogenic effects of herbs should consider identity and amount of substance or presumed active ingredients administered, dose response, duration of test period, proper experimental controls, measurement of psychological and physiologic parameters (including antioxidant actions), and measurements of performance pertinent to intended uses.

Theoretical searches and spectral computations of preferred conformations of various absolute configurations for a cyclodipeptide, cordycedipeptide A from the culture liquid of Cordyceps sinensis

NASA Astrophysics Data System (ADS)

Mang, Chao-Yong; Liu, Cai-Ping; Liu, Guang-Ming; Jiang, Bei; Lan, Hai; Wu, Ke-Chen; Yan, Ya; Li, Hai-Fei; Yang, Ming-Hui; Zhao, Yu

2015-02-01

A cyclic dipeptide often has the multiple configurations and the abundant conformations. The density functional theory (DFT) method is used to search the preferred conformation of the most probable configuration for cordycedipeptide A isolated from the culture liquid of Cordyceps sinensis. The time-dependent DFT approach is exploited to describe the profile of electronic circular dichroism (CD). The calculated results show that the most probable configuration is 3S6R7S, whose preferred conformation has a negative optical rotation and a positive lowest energy electronic CD band.

Mining for hemicellulases in the fungus-growing termite Pseudacanthotermes militaris using functional metagenomics.

PubMed

Bastien, Géraldine; Arnal, Grégory; Bozonnet, Sophie; Laguerre, Sandrine; Ferreira, Fernando; Fauré, Régis; Henrissat, Bernard; Lefèvre, Fabrice; Robe, Patrick; Bouchez, Olivier; Noirot, Céline; Dumon, Claire; O'Donohue, Michael

2013-05-14

The metagenomic analysis of gut microbiomes has emerged as a powerful strategy for the identification of biomass-degrading enzymes, which will be no doubt useful for the development of advanced biorefining processes. In the present study, we have performed a functional metagenomic analysis on comb and gut microbiomes associated with the fungus-growing termite, Pseudacanthotermes militaris. Using whole termite abdomens and fungal-comb material respectively, two fosmid-based metagenomic libraries were created and screened for the presence of xylan-degrading enzymes. This revealed 101 positive clones, corresponding to an extremely high global hit rate of 0.49%. Many clones displayed either β-d-xylosidase (EC 3.2.1.37) or α-l-arabinofuranosidase (EC 3.2.1.55) activity, while others displayed the ability to degrade AZCL-xylan or AZCL-β-(1,3)-β-(1,4)-glucan. Using secondary screening it was possible to pinpoint clones of interest that were used to prepare fosmid DNA. Sequencing of fosmid DNA generated 1.46 Mbp of sequence data, and bioinformatics analysis revealed 63 sequences encoding putative carbohydrate-active enzymes, with many of these forming parts of sequence clusters, probably having carbohydrate degradation and metabolic functions. Taxonomic assignment of the different sequences revealed that Firmicutes and Bacteroidetes were predominant phyla in the gut sample, while microbial diversity in the comb sample resembled that of typical soil samples. Cloning and expression in E. coli of six enzyme candidates identified in the libraries provided access to individual enzyme activities, which all proved to be coherent with the primary and secondary functional screens. This study shows that the gut microbiome of P. militaris possesses the potential to degrade biomass components, such as arabinoxylans and arabinans. Moreover, the data presented suggests that prokaryotic microorganisms present in the comb could also play a part in the degradation of biomass within the termite mound, although further investigation will be needed to clarify the complex synergies that might exist between the different microbiomes that constitute the termitosphere of fungus-growing termites. This study exemplifies the power of functional metagenomics for the discovery of biomass-active enzymes and has provided a collection of potentially interesting biocatalysts for further study.

Vanadium-Enriched Cordyceps sinensis, a Contemporary Treatment Approach to Both Diabetes and Depression in Rats

PubMed Central

Guo, Jianyou; Li, ChangYu; Wang, Jie; Liu, Yongmei; Zhang, Jiahui

2011-01-01

This article studies a contemporary treatment approach toward both diabetes and depression management by vanadium-enriched Cordyceps sinensis (VECS). Streptozotocin-induced hyperglycemic rats were used in the study. After the rats were administered with VECS, a significant reduction in blood glucose levels was seen (P < .05) and the levels of serum insulin increased significantly (P < .05). At the same time, the study revealed a significant decrease in immobility with a corresponding increase in the swimming and climbing behavior in hyperglycemic rats following VECS treatment. The results described herein demonstrate that VECS is a contemporary treatment approach that advocates an aggressive stance toward both diabetes and depression management. PMID:21799679

Theoretical searches and spectral computations of preferred conformations of various absolute configurations for a cyclodipeptide, cordycedipeptide A from the culture liquid of Cordyceps sinensis.

PubMed

Mang, Chao-Yong; Liu, Cai-Ping; Liu, Guang-Ming; Jiang, Bei; Lan, Hai; Wu, Ke-Chen; Yan, Ya; Li, Hai-Fei; Yang, Ming-Hui; Zhao, Yu

2015-02-05

A cyclic dipeptide often has the multiple configurations and the abundant conformations. The density functional theory (DFT) method is used to search the preferred conformation of the most probable configuration for cordycedipeptide A isolated from the culture liquid of Cordyceps sinensis. The time-dependent DFT approach is exploited to describe the profile of electronic circular dichroism (CD). The calculated results show that the most probable configuration is 3S6R7S, whose preferred conformation has a negative optical rotation and a positive lowest energy electronic CD band. Copyright © 2014 Elsevier B.V. All rights reserved.

Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher Basidiomycetes mushrooms.

PubMed

Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P

2014-01-01

This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources of bioactive compounds.

[Amplicon density-weighted algorithms for analyzing dissimilarity and dynamic alterations of RAPD polymorphisms of Cordyceps sinensis].

PubMed

Yao, Yi-sang; Gao, Ling; Li, Yu-ling; Ma, Shao-li; Wu, Zi-mei; Tan, Ning-zhi; Wu, Jian-yong; Ni, Lu-qun; Zhu, Jia-shi

2014-08-18

To examine the dynamic maturational alterations of random amplified polymorphic DNA (RAPD) molecular marker polymorphism resulted from differential expressions of multiple fungi in the caterpillar body, stroma and ascocarp portion of Cordyceps sinensis (Cs). Used the fuzzy, integral RAPD molecular marker polymorphism method with 20 random primers; used density-weighted cluster algorithms and ZUNIX similarity equations; compared RAPD polymorphisms of the caterpillar body, stroma and ascocarp of Cs during maturation; and compared RAPD polymorphisms of Cs and Hirsutella sinensis (Hs). Density-unweighted algorithms neglected the differences in density of the DNA amplicons. Use of the density-weighted ZUNIX similarity equations and the clustering method integrated components of the amplicon density differences in similarity computations and clustering construction and prevented from the loss of the information of fungal genomes. An overall similarity 0.42 (< the overall dissimilarity 0.58) was observed for all compartments of Cs at different maturation stages. The similarities for the stromata or caterpillar bodies of Cs at 3 maturational stages were 0.57 or 0.50, respectively. During Cs maturation, there were dynamic Low→High→Low alterations of the RAPD polymorphisms between stromata and caterpillar bodies dissected from the same pieces of Cs. The polymorphic similarity was the highest (0.87) between the ascocarp and mature stroma, forming a clustering clade, while the premature stroma and caterpillar body formed another clade. These 2 clades merged into one cluster. Another clade containing the maturing stroma and caterpillar body merged with mature caterpillar body, forming another cluster. The RAPD polymorphic similarities between Hs and Cs samples were 0.55-0.69. Hs were separated from Cs clusters by the out-group control Paecilomyces militaris. The wealthy RAPD polymorphisms change dynamically in the Cs compartments with maturation. The different RAPD polymorphism for Hs from those for Cs supports the hypothesis of integrated micro-ecosystem Cs with multiple fungi, but does not support the "single fungal species" hypothesis for Cs and the anamorph-teleomorph connection between Hs and Cs.

Cordycepin (3'-deoxyadenosine) inhibits the growth of B16-BL6 mouse melanoma cells through the stimulation of adenosine A3 receptor followed by glycogen synthase kinase-3beta activation and cyclin D1 suppression.

PubMed

Yoshikawa, Noriko; Yamada, Shizuo; Takeuchi, Chihiro; Kagota, Satomi; Shinozuka, Kazumasa; Kunitomo, Masaru; Nakamura, Kazuki

2008-06-01

Cordyceps sinensis, a parasitic fungus on the larvae of Lepidoptera, has been used as a traditional Chinese medicine. We previously reported that the growth of B16-BL6 mouse melanoma (B16-BL6) cells was inhibited by cordycepin (3'-deoxyadenosine), an active ingredient of C. sinensis, and its effect was antagonized by MRS1191, a selective adenosine A3 receptor antagonist. In this study, the radioligand binding assay using [125I]-AB-MECA (a selective adenosine A3 receptor agonist) has shown that B16-BL6 cells express adenosine A3 receptors and that cordycepin binds to these receptors. We also confirmed the involvement of adenosine A3 receptors in the action of cordycepin using MRS1523 and MRS1220, specific adenosine A3 receptor antagonists. Next, indirubin, a glycogen synthase kinase-3beta (GSK-3beta) inhibitor, antagonized the growth suppression induced by cordycepin. Furthermore, the level of cyclin D1 protein in B16-BL6 cells was decreased by cordycepin using Western blot analysis. In conclusion, this study demonstrated that cordycepin inhibits the proliferation of B16-BL6 cells by stimulating adenosine A3 receptors followed by the Wnt signaling pathway, including GSK-3beta activation and cyclin D1 inhibition.

Selection of entomopathogenic fungi for aphid control.

PubMed

Vu, Van Hanh; Hong, Suk Il; Kim, Keun

2007-12-01

Twelve strains of entomopathogenic fungi such as Lecanicillium lecanii, Paecilomyces farinosus, Beauveria bassiana, Metarhizium anisopliae, Cordyceps scarabaeicola, and Nomuraea rileyi were screened for aphid control. At 25 degrees C and 75% relative humidity (RH), among tested entomopathogenic fungi, L. lecanii 41185 showed the highest virulent pathogenicity for both Myzus persicae and Aphis gossypii, and their control values were both nearly 100% 5 and 2 d after treatment, respectively. Moreover, at an RH of 45% and in a wide temperature range (20-30 degrees C), L. lecanii 41185 also exhibited the highest virulence to M. persicae. The control value of M. persicae and the 50% lethal time (LT50) decreased significantly as the applied conidial concentration increased. The 50% lethal concentration (LC50) of the conidial suspension of this fungus was determined to be 6.55x10(5) conidia/ml. The control values of M. persicae resulting from the application of 1x10(7) and 1x10(8) conidia/ml were nearly the same and were significantly higher than that of 1x10(6) conidia/ml. The tested entomopathogenic fungi grew in a broad temperature range (15-30 degrees C). Lecanicillium strains showed optimum growth at 25 degrees C. The aerial conidia of Lecanicillium strains also could germinate in a broad temperature range (15-30 degrees C) and L. lecanii 41185 was the only strain with conidial germination at 35 degrees C.

Neurite outgrowth stimulatory effects of culinary-medicinal mushrooms and their toxicity assessment using differentiating Neuro-2a and embryonic fibroblast BALB/3T3.

PubMed

Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary

2013-10-11

Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p < 0.05) promoted the neurite outgrowth in N2a cells by 38.4 ± 4.2%, 38.1 ± 2.6%, 33.4 ± 4.6%, 33.7 ± 1.5%, and 35.8 ± 3.4%; respectively. The IC50 values obtained from tetrazolium (MTT), neutral red uptake (NRU) and lactate dehydrogenase (LDH) release assays showed no toxic effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health.

Neurite outgrowth stimulatory effects of culinary-medicinal mushrooms and their toxicity assessment using differentiating Neuro-2a and embryonic fibroblast BALB/3T3

PubMed Central

2013-01-01

Background Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. Methods The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Results Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p < 0.05) promoted the neurite outgrowth in N2a cells by 38.4 ± 4.2%, 38.1 ± 2.6%, 33.4 ± 4.6%, 33.7 ± 1.5%, and 35.8 ± 3.4%; respectively. The IC50 values obtained from tetrazolium (MTT), neutral red uptake (NRU) and lactate dehydrogenase (LDH) release assays showed no toxic effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Conclusion Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health. PMID:24119256

[Study on the detection of active ingredient contents of Paecilomyces hepiali mycelium via near infrared spectroscopy].

PubMed

Teng, Wei-Zhuo; Song, Jia; Meng, Fan-Xin; Meng, Qing-Fan; Lu, Jia-Hui; Hu, Shuang; Teng, Li-Rong; Wang, Di; Xie, Jing

2014-10-01

Partial least squares (PLS) and radial basis function neural network (RBFNN) combined with near infrared spectros- copy (NIR) were applied to develop models for cordycepic acid, polysaccharide and adenosine analysis in Paecilomyces hepialid fermentation mycelium. The developed models possess well generalization and predictive ability which can be applied for crude drugs and related productions determination. During the experiment, 214 Paecilomyces hepialid mycelium samples were obtained via chemical mutagenesis combined with submerged fermentation. The contents of cordycepic acid, polysaccharide and adenosine were determined via traditional methods and the near infrared spectroscopy data were collected. The outliers were removed and the numbers of calibration set were confirmed via Monte Carlo partial least square (MCPLS) method. Based on the values of degree of approach (Da), both moving window partial least squares (MWPLS) and moving window radial basis function neural network (MWRBFNN) were applied to optimize characteristic wavelength variables, optimum preprocessing methods and other important variables in the models. After comparison, the RBFNN, RBFNN and PLS models were developed successfully for cordycepic acid, polysaccharide and adenosine detection, and the correlation between reference values and predictive values in both calibration set (R2c) and validation set (R2p) of optimum models was 0.9417 and 0.9663, 0.9803 and 0.9850, and 0.9761 and 0.9728, respectively. All the data suggest that these models possess well fitness and predictive ability.

Novel endophytic lineages of Tolypocladium provide new insights into the ecology and evolution of Cordyceps-like fungi.

PubMed

Gazis, Romina; Skaltsas, Demetra; Chaverri, Priscila

2014-01-01

The objective of this study was to identify a group of unknown endophytic fungal isolates from the living sapwood of wild and planted Hevea (rubber tree) populations. Three novel lineages of Tolypocladium are described based on molecular and morphological data. Findings from this study open a window for novel hypotheses regarding the ecology and role of endophytes within plant communities as well as trait evolution and potential forces driving diversification of Cordyceps-like fungi. This study stresses the importance of integrating asexual and sexual fungal states for a more complete understanding of the natural history of this diverse group. In addition, it highlights the study of fungi in the sapwood of tropical trees as habitat for the discovery of novel fungal lineages and substrate associations. © 2014 by The Mycological Society of America.

Effects of cordycepin on the microglia-overactivation-induced impairments of growth and development of hippocampal cultured neurons.

PubMed

Peng, Jie; Wang, Ping; Ge, Hongshan; Qu, Xianqin; Jin, Xingliang

2015-01-01

Microglial cells are normally activated in response to brain injury or immunological stimuli to protect central nervous system (CNS). However, over-activation of microglia conversely amplifies the inflammatory effects and mediates cellular degeneration, leading to the death of neurons. Recently, cordycepin, an active component found in Cordyceps militarisa known as a rare Chinese caterpillar fungus, has been reported as an effective drug for treating inflammatory diseases and cancer via unclear mechanisms. In this study, we attempted to identify the anti-inflammatory role of cordycepin and its protective effects on the impairments of neural growth and development induced by microglial over-activation. The results indicate that cordycepin could attenuate the lipopolysaccharide (LPS)-induced microglial activation, evidenced by the dramatically reduced release of TNF-α and IL-1β, as well as the down-regulation of mRNA levels of iNOS and COX-2 after cordycepin treatment. Besides, cordycepin reversed the LPS-induced activation of NF-κB pathway, resulting in anti-inflammatory effects. Furthermore, by employing the conditioned medium (CM), we found cordycepin was able to recover the impairments of neural growth and development in the primary hippocampal neurons cultured in LPS-CM, including cell viability, growth cone extension, neurite sprouting and outgrowth as well as spinogenesis. This study expands our knowledge of the anti-inflammatory function of cordycepin and paves the way for the biomedical applications of cordycepin in the therapies of neural injuries.

Determination of myriocin in natural and cultured Cordyceps cicadae using 9-fluorenylmethyl chloroformate derivatization and high-performance liquid chromatography with UV-detection.

PubMed

Yu, Jiawen; Xu, Hongjuan; Mo, Zhihong; Zhu, Huali; Mao, Xianbing

2009-07-01

A simple and sensitive reversed-phase liquid chromatographic method, based on the precolumn derivatization with 9-fluorenylmethyl chloroformate, was developed for the determination of myriocin. The derivatization reaction was performed in organic solvents of pyridine and tetrahydrofuran at 40 degrees C. Several factors influencing the derivative yield were investigated and optimized. The formed derivative was stable for more than 24 h at room temperature. The detection wavelength was 262 nm. The system offered the following analytical parameters: the limit of detection was 0.045 microg ml(-1), the linear correlation coefficient was 0.9963 and the linear range response was from 2.0 to 500.0 microg ml(-1). The precision of the method was <2.0%. As a preliminary application, the method has been successfully applied to the determination of myriocin in natural and cultured Cordyceps cicadae.

Polysaccharides in fungi. XXXII. Hypoglycemic activity and chemical properties of a polysaccharide from the cultural mycelium of Cordyceps sinensis.

PubMed

Kiho, T; Hui, J; Yamane, A; Ukai, S

1993-12-01

Crude polysaccharides were obtained from a hot-water extract and alkaline extracts of the cultural mycelium of Cordyceps sinensis. They showed significant activity in normal mice and streptozotocin-induced diabetic mice as a result of intraperitoneal (i.p.) injection. A crude polysaccharide (CS-OHEP) obtained from 5% sodium hydroxide extract slightly lowered the plasma glucose level in normal mice by oral (p.o.) administration. A neutral polysaccharide (CS-F30) exhibited higher hypoglycemic activity than its crude polysaccharide (CS-OHEP), exhibited by i.p. injection, and it significantly lowered the glucose level by p.o. administration (50 mg/kg). However, it hardly affected the plasma insulin level in normal mice. CS-F30 ([alpha]D + 21 degrees in water) is composed of galactose, glucose and mannose (molar percent, 62:28:10), and its molecular weight is about 45000.

4-Isopropyl-2,6-bis(1-phenylethyl)aniline 1, an Analogue of KTH-13 Isolated from Cordyceps bassiana, Inhibits the NF-κB-Mediated Inflammatory Response

PubMed Central

Yang, Woo Seok; Ratan, Zubair Ahmed; Kim, Gihyeon; Lee, Yunmi; Kim, Mi-Yeon; Kim, Jong-Hoon; Cho, Jae Youl

2015-01-01

The Cordyceps species has been a good source of compounds with anticancer and anti-inflammatory activities. Recently, we reported a novel compound (4-isopropyl-2,6-bis(1-phenylethyl)phenol, KTH-13) with anticancer activity isolated from Cordyceps bassiana and created several derivatives to increase its pharmacological activity. In this study, we tested one of the KTH-013 derivatives, 4-isopropyl-2,6-bis(1-phenylethyl)aniline 1 (KTH-13-AD1), with regard to anti-inflammatory activity under macrophage-mediated inflammatory conditions. KTH-13-AD1 clearly suppressed the production of nitric oxide (NO) and reactive oxygen species (ROS) in lipopolysaccharide (LPS) and sodium nitroprusside- (SNP-) treated macrophage-like cells (RAW264.7 cells). Similarly, this compound also reduced mRNA expression of inducible NO synthase (iNOS) and tumor necrosis factor-α (TNF-α), as analyzed by RT-PCR and real-time PCR. Interestingly, KTH-13-AD1 strongly diminished NF-κB-mediated luciferase activities and nuclear translocation of NF-κB family proteins. In accordance, KTH-13-AD1 suppressed the upstream signaling pathway of NF-κB activation, including IκBα, IKKα/β, AKT, p85/PI3K, and Src in a time- and dose-dependent manner. The autophosphorylation of Src and NF-κB observed during the overexpression of Src was also suppressed by KTH-13-AD1. These results strongly suggest that KTH-13-AD1 has strong anti-inflammatory features mediated by suppression of the Src/NF-κB regulatory loop. PMID:26819495

A review on the effects of current chemotherapy drugs and natural agents in treating non–small cell lung cancer

PubMed Central

Huang, Chih-Yang; Ju, Da-Tong; Chang, Chih-Fen; Muralidhar Reddy, P.; Velmurugan, Bharath Kumar

2017-01-01

Lung cancer is the leading cause of cancer deaths worldwide, and this makes it an attractive disease to review and possibly improve therapeutic treatment options. Surgery, radiation, chemotherapy, targeted treatments, and immunotherapy separate or in combination are commonly used to treat lung cancer. However, these treatment types may cause different side effects, and chemotherapy-based regimens appear to have reached a therapeutic plateau. Hence, effective, better-tolerated treatments are needed to address and hopefully overcome this conundrum. Recent advances have enabled biologists to better investigate the potential use of natural compounds for the treatment or control of various cancerous diseases. For the past 30 years, natural compounds have been the pillar of chemotherapy. However, only a few compounds have been tested in cancerous patients and only partial evidence is available regarding their clinical effectiveness. Herein, we review the research on using current chemotherapy drugs and natural compounds (Wortmannin and Roscovitine, Cordyceps militaris, Resveratrol, OSU03013, Myricetin, Berberine, Antroquinonol) and the beneficial effects they have on various types of cancers including non-small cell lung cancer. Based on this literature review, we propose the use of these compounds along with chemotherapy drugs in patients with advanced and/or refractory solid tumours. PMID:29130448

Pichia pastoris is a Suitable Host for the Heterologous Expression of Predicted Class I and Class II Hydrophobins for Discovery, Study, and Application in Biotechnology

PubMed Central

Gandier, Julie-Anne; Master, Emma R.

2018-01-01

The heterologous expression of proteins is often a crucial first step in not only investigating their function, but also in their industrial application. The functional assembly and aggregation of hydrophobins offers intriguing biotechnological applications from surface modification to drug delivery, yet make developing systems for their heterologous expression challenging. In this article, we describe the development of Pichia pastoris KM71H strains capable of solubly producing the full set of predicted Cordyceps militaris hydrophobins CMil1 (Class IA), CMil2 (Class II), and CMil3 (IM) at mg/L yields with the use of 6His-tags not only for purification but for their detection. This result further demonstrates the feasibility of using P. pastoris as a host organism for the production of hydrophobins from all Ascomycota Class I subdivisions (a classification our previous work defined) as well as Class II. We highlight the specific challenges related to the production of hydrophobins, notably the challenge in detecting the protein that will be described, in particular during the screening of transformants. Together with the literature, our results continue to show that P. pastoris is a suitable host for the soluble heterologous expression of hydrophobins with a wide range of properties. PMID:29303996

Pichia pastoris is a Suitable Host for the Heterologous Expression of Predicted Class I and Class II Hydrophobins for Discovery, Study, and Application in Biotechnology.

PubMed

Gandier, Julie-Anne; Master, Emma R

2018-01-05

The heterologous expression of proteins is often a crucial first step in not only investigating their function, but also in their industrial application. The functional assembly and aggregation of hydrophobins offers intriguing biotechnological applications from surface modification to drug delivery, yet make developing systems for their heterologous expression challenging. In this article, we describe the development of Pichia pastoris KM71H strains capable of solubly producing the full set of predicted Cordyceps militaris hydrophobins CMil1 (Class IA), CMil2 (Class II), and CMil3 (IM) at mg/L yields with the use of 6His-tags not only for purification but for their detection. This result further demonstrates the feasibility of using P. pastoris as a host organism for the production of hydrophobins from all Ascomycota Class I subdivisions (a classification our previous work defined) as well as Class II. We highlight the specific challenges related to the production of hydrophobins, notably the challenge in detecting the protein that will be described, in particular during the screening of transformants. Together with the literature, our results continue to show that P. pastoris is a suitable host for the soluble heterologous expression of hydrophobins with a wide range of properties.

A Contemporary Treatment Approach to Both Diabetes and Depression by Cordyceps sinensis, Rich in Vanadium

PubMed Central

Guo, Jian-You; Han, Chun-Chao

2010-01-01

Diabetes mellitus is accompanied by hormonal and neurochemical changes that can be associated with anxiety and depression. Both diabetes and depression negatively interact, in that depression leads to poor metabolic control and hyperglycemia exacerbates depression. We hypothesize one novel vanadium complex of vanadium-enriched Cordyceps sinensis (VECS), which is beneficial in preventing depression in diabetes, and influences the long-term course of glycemic control. Vanadium compounds have the ability to imitate the action of insulin, and this mimicry may have further favorable effects on the level of treatment satisfaction and mood. C. sinensis has an antidepressant-like activity, and attenuates the diabetes-induced increase in blood glucose concentrations. We suggest that the VECS may be a potential strategy for contemporary treatment of depression and diabetes through the co-effect of C. sinensis and vanadium. The validity of the hypothesis can most simply be tested by examining blood glucose levels, and swimming and climbing behavior in streptozotocin-induced hyperglycemic rats. PMID:19948751

Profiling metals in Cordyceps sinensis by using inductively coupled plasma mass spectrometry.

PubMed

Wei, Xin; Hu, Hankun; Zheng, Baogeng; Arslan, Zikri; Huang, Hung-Chung; Mao, Weidong; Liu, Yi-Ming

2017-01-28

Cordyceps sinensis ( C. sinensis ) is a natural product that has diverse nutritional and medicinal values. Since the availability of natural C. sinensis becomes limited its authentication and quality control is of high significance. Herein we report on profiling of metals in C. sinensis by using inductively coupled plasma mass spectrometry (ICP-MS). The analysis reveals that C. sinensis contains a wide array of essential elements, including P, Mg, Zn, Cu, Fe, etc. Toxic metals detected are Cd, Pb, and As. In all five samples analyzed Pb contents are below 2.0 ppm. Arsenic level in C. sinensis caterpillar is significantly higher than that in its mycelium and varies from 3.0 to 32 ppm likely due to soil contamination. It's for the first time demonstrated in this work that clustering analysis on the proposed metal profiles consisting of 24 elements is very useful to identify "abnormal" C. sinensis samples, thus adding another dimension to the effective means for authentication and quality assessment of this highly demanded previous natural product.

Physico-chemical properties and cytotoxic potential of Cordyceps sinensis metabolites.

PubMed

Lee, Eun-Jeong; Jang, Ka-Hee; Im, Seon-Young; Lee, Yoon-Kyung; Farooq, Muhammad; Farhoudi, Rozbeh; Lee, Dong-Jin

2015-01-01

This study was conducted to estimate the antioxidant activities, biochemical properties and biological activities of one of the entomopathogenic fungi, Cordyceps sinensis. Analysis of fungal metabolites indicated that the most abundant free sugar was glucose; the highest component of organic acids was citric acid from 10-day culture medium and the glutamate was the predominant amino acid observed from 3-day culture medium. Maximum total polyphenols and flavonoids were detected in the 15-day culture medium. For cytotoxicity test, three cancer cell lines, HepG2 (liver), MCF-7 (breast) and A549 (lung) were used. The IC50 values of the highest toxicity of HepG2 cell lines were observed from 10-day cultured medium, whereas the highest toxicity of MCF-7 and A549 was observed on 5-day cultured medium. This is the first study reporting on the strong antioxidant and cytotoxic potential of C. sinensis. Culture medium of C. sinensis may thus be used as an effective antioxidant and anticancer treatment of natural origin.

Treatment with Cordyceps sinensis enriches Treg population in peripheral lymph nodes and delays type I diabetes development in NOD mice.

PubMed

Wang, Mei-Fen; Zhu, Qing-Hua; He, Yu-Gong

2013-09-01

Cordyceps sinensis is a widely used Chinese traditional herb with a long history. In China C. sinensis is usually applied in the treatment of respiratory diseases, however, the efficacy of C. sinensis still lacks experimental evidence. Type I diabetes is a multi-factor related autoimmune disease caused by cellular-mediated destruction of insulin-producing pancreatic beta cells in the islets in human. We tested C. sinensis for its ability to work as an immune modulator in NOD mice, an animal model which mimicks the progression of type I diabetes in humans and found that treatment with C. sinensis extract could slow down disease development in NOD mice. Further research also suggested that treatment with C. sinensis extract increased the frequency of Treg cells and IFN-gama producing Th1 cells in peripheral lymph nodes. However, C. sinensis has no effect on the natural Treg cell differentiation in thymus.

Clavicipitaceous entomopathogens: New species of Metarhizium and a new genus Nigelia

USDA-ARS?s Scientific Manuscript database

In several surveys in the tropical forests in Thailand, specimens that looked morphologically similar to Metarhizium martialis and Cordyceps variegata, as well as Metarhizium species were collected and cultured in vitro. A combined phylogeny of several genes including the small (18S) and large (28S)...

[Study on arsenic speciation changes in crude and processed traditional Chinese medicines by HPLC-ICP-MS].

PubMed

Jin, Peng-fei; Wu, Xue-jun; Zou, Ding; Kuang, Yong-mei; Hu, Xin; Jiang, Wen-qing; Sun, Chun-hua

2011-03-01

A HPLC-ICP-MS method for simultaneous determination of As(III), As(V), MMA and DMA in traditional Chinese medicines (TCMs) was established, and the contents of As(III), As(V), MMA and DMA in a TCM with high total arsenic content (Cordyceps) and 5 crude and processed TCMs (Radix Astragali, Radix et Rhizoma Rhei, Radix Scutellariae, Radix Polygoni Multiflori and Radix Rehmanniae) were determined and analyzed. The method validation indicated that the correlative coefficients (r) for all speciations were bigger than 0.9984; the limits of quantitation (LOQ) were from 0.8 to 1.0 microg x L(-1); the reproducibility and stability were satisfactory with all RSDs less than 10%; the spiked recoveries ranged from 82.40% to 119.5%. The results of samples analysis showed that the inorganic arsenic (As(III) and As(V)) was the dominating speciation in the tested TCMs; MMA and DMA were not found in all plant resourced TCMs, but MMA was found in Cordyceps; all the tested TCMs indicated a content increasing of inorganic arsenic after processing.

[Study on distribution of five heavy metal elements in different parts of Cordyceps sinensis by microwave digestion ICP-MS].

PubMed

Zhou, Li; Hao, Qing-Xiu; Wang, Sheng; Yang, Quan; Kang, Chuan-Zhi; Yang, Wan-Zhen; Guo, Lan-Ping

2017-08-01

The contents of five heavy metals (Cu, Pb, As, Cd, Hg) in 17 batches of Cordyceps sinensis were determined by microwave digestion-ICP-MS, and their distribution in C. sinensis were analyzed. The results showed that the contents of Cu, Pb, Cd and Hg in all batches were in accordance with the international standards of Chinese Medicine-Chinese Herbal Medicine Heavy Metal Limit, with their contents in the stroma higher than that in the caterpillar body, and the excess rate of As, which mainly concentrated in the caterpillar body part of C. sinensis, was 88.24%, as the content of As in the caterpillar body was 7 to 12 fold of that in the stroma. In this study, the distribution of five heavy metals in C. sinensis was clarified, and the existing problems of arsenic limit of heavy metal in C. sinensis were analyzed, and some suggestions were put forward. It is hoped that the reference standard can be provided for the limited standard of arsenic in C. sinensis. Copyright© by the Chinese Pharmaceutical Association.

Improved production of jiangxienone in submerged fermentation of Cordyceps jiangxiensis under nitrogen deficiency.

PubMed

Jiang, Lu-Xi; Han, Li-Liang; Wang, Hui-Ping; Xu, Jun-Wei; Xiao, Jian-Hui

2018-06-14

Jiangxienone produced by Cordyceps jiangxiensis exhibits significant cytotoxicity and good selectivity against various human cancer cells, especially gastric cancer cells. In this work, the effect of nitrogen deficiency on the accumulation of jiangxienone and the transcription levels of jiangxienone biosynthesis genes was studied in submerged fermentation of C. jiangxiensis. Results showed that accumulation of jiangxienone was improved under nitrogen deficiency condition. A maximal jiangxienone content of 3.2 µg/g cell dry weight was reached at 5 mM glutamine, and it was about 8.9-fold higher than that obtained at 60 mM glutamine (control). The transcription levels of the biosynthetic pathway genes hmgr and sqs and the nitrogen regulatory gene areA were upregulated by 7-, 14-, and 28-fold, respectively, in culture with 5 mM glutamine compared to the control. It was hypothesized that the jiangxienone biosynthesis may involve the mevalonate pathway in C. jiangxiensis. Taken together, our study indicated that nitrogen deficiency is an efficient strategy for enhancing jiangxienone accumulation in submerged fermentation of C. jiangxiensis, which is useful for further understanding the regulation of jiangxienone biosynthesis.

Systematic revelation of the protective effect and mechanism of Cordycep sinensis on diethylnitrosamine-induced rat hepatocellular carcinoma with proteomics.

PubMed

Wang, Pei-Wen; Hung, Yu-Chiang; Li, Wen-Tai; Yeh, Chau-Ting; Pan, Tai-Long

2016-09-13

Cordyceps sinensis (C. sinensis) has been reported to treat liver diseases. Here, we investigated the inhibitory effect of C. sinensis on hepatocarcinoma in a diethylnitrosamine (DEN)-induced rat model with functional proteome tools.In the DEN-exposed group, levels of serum alanine aminotransferase and aspartate aminotransferase were increased while C. sinensis application remarkably inhibited the activities of these enzymes. Histopathological analysis also indicated that C. sinensis could substantially restore hypertrophic hepatocytes caused by DEN, suggesting that C. sinensis is effective in preventing DEN-induced hepatocarcinogenesis.We therefore comprehensively delineated the global protein alterations using a proteome platform. The most meaningful changes were found among proteins involved in oxidative stress and detoxification. Meanwhile, C. sinensis application could attenuate the carbonylation level of several enzymes as well as chaperone proteins. Network analysis implied that C. sinensis could obviously alleviate hepatocarcinoma via modulating redox imbalance, protein ubiquitination and tumor growth-associated transcription factors.Our findings provide new insight into the potential effects of C. sinensis in preventing carcinogenesis and might help in developing novel therapeutic strategies against chemical-induced hepatocarcinoma.

Cordyceps sinensis attenuates renal fibrosis and suppresses BAG3 induction in obstructed rat kidney.

PubMed

Du, Feng; Li, Si; Wang, Tian; Zhang, Hai-Yan; Zong, Zhi-Hong; Du, Zhen-Xian; Li, De-Tian; Wang, Hua-Qin; Liu, Bo; Miao, Jia-Ning; Bian, Xiao-Hui

2015-01-01

BAG3 regulates a number of cellular processes, including cell proliferation, apoptosis, adhesion and migration, and epithelial-mesenchymal transition (EMT). However, the role of BAG3 in renal tubular EMT and renal interstitial fibrosis remains elusive. This study aimed to examine the dynamic expression of BAG3 during renal fibrosis, and to investigate the efficacy of Cordyceps sinensis (C. sinensis) on renal fibrosis. A rat model of unilateral ureteral obstruction (UUO) was established, and the expression of BAG3 and α-SMA, and the efficacy of C. sinensis on renal fibrosis induced by UUO were examined. The results showed that UUO led to collagen accumulation, which was significantly suppressed by C. sinensis. UUO increased the expression of BAG3 and α-SMA, a mesenchymal marker, while UUO induced BAG3 and α-SMA expression was significantly inhibited by C. sinensis. In addition, immunohistochemical staining demonstrated that BAG3 immunoreactivity was restricted to tubular epithelium. In conclusion, BAG3 is a potential target for the prevention and/or treatment of renal fibrosis, and C. Sinensis is a promising agent for renal fibrosis.

Effects of extraction methods on the yield, chemical structure and anti-tumor activity of polysaccharides from Cordyceps gunnii mycelia.

PubMed

Zhu, Zhen-Yuan; Dong, Fengying; Liu, Xiaocui; Lv, Qian; YingYang; Liu, Fei; Chen, Ling; Wang, Tiantian; Wang, Zheng; Zhang, Yongmin

2016-04-20

This study was to investigate the effects of different extraction methods on the yield, chemical structure and antitumor activity of polysaccharides from Cordyceps gunnii (C. gunnii) mycelia. Five extraction methods were used to extract crude polysaccharides (CPS), which include room-temperature water extraction (RWE), hot-water extraction (HWE), microwave-assisted extraction (MAE), ultrasound-assisted extraction (UAE) and cellulase-assisted extraction (CAE). Then Sephadex G-100 was used for purification of CPS. As a result, the antitumor activities of CPS and PPS on S180 cells were evaluated. Five CPS and purified polysaccharides (PPS) were obtained. The yield of CPS by microwave-assisted extraction (CPSMAE) was the highest and its anti-tumor activity was the best and its macromolecular polysaccharide (3000-1000kDa) ratio was the largest. The PPS had the same monosaccharide composition, but their obvious difference was in the antitumor activity and the physicochemical characteristics, such as intrinsic viscosity, specific rotation, scanning electron microscopy and circular dichroism spectra. Copyright © 2015 Elsevier Ltd. All rights reserved.

The effects of Cordyceps sinensis phytoestrogen on estrogen deficiency-induced osteoporosis in ovariectomized rats.

PubMed

Zhang, Da-wei; Wang, Zhen-lin; Qi, Wei; Zhao, Guang-yue

2014-12-13

Isoflavones are naturally occurring plant chemicals belonging to the "phytoestrogen" class. The aim of the present study was to examine the effects of isoflavones obtained from Cordyceps sinensis (CSIF) on development of estrogen deficiency-induced osteoporosis in ovariectomized rats. After the rats were treated orally with CSIF, serum alkaline phosphatase (ALP), tartarate resistant acid phosphatase (TRAP), serum osteocalcin (OC), homocysteine (HCY), C-terminal crosslinked telopeptides of collagen type I (CTX), estradiol and interferonγ (IFN-γ) level were examined. At the same time, the urine calcium, plasma calcium, plasma phosphorus and the mass of uterus, thymus and body were also examined. The beneficial effects of CSIF on improvement of osteoporosis in rats were attributable mainly to decrease ALP activity, TRAP activity, CTX level and IFN-γ level. At the same time, CSIF also increase the OC and estradiol level in ovariectomized osteopenic rats. The histological examination clearly showed that dietary CSIF can prevent bone loss caused by estrogen deficiency. The significant estrogenic activity of CSIF demonstrated that CSIF has significant estrogenic effects in OVX rats.

Systematic revelation of the protective effect and mechanism of Cordycep sinensis on diethylnitrosamine-induced rat hepatocellular carcinoma with proteomics

PubMed Central

Wang, Pei-Wen; Hung, Yu-Chiang; Li, Wen-Tai; Yeh, Chau-Ting; Pan, Tai-Long

2016-01-01

Cordyceps sinensis (C. sinensis) has been reported to treat liver diseases. Here, we investigated the inhibitory effect of C. sinensis on hepatocarcinoma in a diethylnitrosamine (DEN)-induced rat model with functional proteome tools. In the DEN-exposed group, levels of serum alanine aminotransferase and aspartate aminotransferase were increased while C. sinensis application remarkably inhibited the activities of these enzymes. Histopathological analysis also indicated that C. sinensis could substantially restore hypertrophic hepatocytes caused by DEN, suggesting that C. sinensis is effective in preventing DEN-induced hepatocarcinogenesis. We therefore comprehensively delineated the global protein alterations using a proteome platform. The most meaningful changes were found among proteins involved in oxidative stress and detoxification. Meanwhile, C. sinensis application could attenuate the carbonylation level of several enzymes as well as chaperone proteins. Network analysis implied that C. sinensis could obviously alleviate hepatocarcinoma via modulating redox imbalance, protein ubiquitination and tumor growth–associated transcription factors. Our findings provide new insight into the potential effects of C. sinensis in preventing carcinogenesis and might help in developing novel therapeutic strategies against chemical-induced hepatocarcinoma. PMID:27531890

GC-MS Profiling of Volatile Components in Different Fermentation Products of Cordyceps Sinensis Mycelia.

PubMed

Zhang, Hongyang; Li, Yahui; Mi, Jianing; Zhang, Min; Wang, Yuerong; Jiang, Zhihong; Hu, Ping

2017-10-24

The fermentation products of Cordyceps sinensis ( C. sinensis ) mycelia are sustainable substitutes for natural C. sinensis . However, the volatile compositions of the commercial products are still unclear. In this paper, we have developed a simultaneous distillation-extraction (SDE) and gas chromatography-mass spectrometry (GC-MS) method for the profiling of volatile components in five fermentation products. A total of 64, 39, 56, 52, and 44 components were identified in the essential oils of Jinshuibao capsule (JSBC), Bailing capsule (BLC), Zhiling capsule (ZLC), Ningxinbao capsule (NXBC), and Xinganbao capsule (XGBC), respectively. 5,6-Dihydro-6-pentyl-2H-pyran-2-one (massoia lactone) was first discovered as the dominant component in JSBC volatiles. Fatty acids including palmitic acid (C16:0) and linoleic acid (C18:2) were also found to be major volatile compositions of the fermentation products. The multivariate partial least squares-discriminant analysis (PLS-DA) showed a clear discrimination among the different commercial products as well as the counterfeits. This study may provide further chemical evidences for the quality evaluation of the fermentation products of C. sinensis mycelia.

Chain conformation and immunomodulatory activity of a hyperbranched polysaccharide from Cordyceps sinensis.

PubMed

Wu, Ding-Tao; Meng, Lan-Zhen; Wang, Lan-Ying; Lv, Guang-Ping; Cheong, Kit-Leong; Hu, De-Jun; Guan, Jia; Zhao, Jing; Li, Shao-Ping

2014-09-22

A polysaccharide, named as cordysinan, extracted from natural Cordyceps sinensis, was identified as a hyperbranched heteropolysaccharide from the results of FT-IR, GC-MS, and carbohydrate analysis by carbohydrate gel electrophoresis analysis, as well as the degree of branching of cordysinan was 43.3%. The solution properties of cordysinan were investigated by using size exclusion chromatography coupled with multi-angle laser light scattering and triple detector array, respectively. The molecular weights, the radius of gyration and the intrinsic viscosity of cordysinan were determined as 22.45±0.26 kDa and 22.37 kDa, 15.4±2.4 nm and 1.41 mL/g, respectively. By applying the polymer solution theory, the exponent (ν and α) values of g1/2=kMwv and [η]=kMwα were calculated as 0.28 and 0.42, respectively, which firstly revealed that cordysinan existed as a globular shape in 0.9% NaCl aqueous solution. Moreover, the results showed that cordysinan could obviously stimulate macrophages functions. Copyright © 2014 Elsevier Ltd. All rights reserved.

Rhodiola crenulata- and Cordyceps sinensis-Based Supplement Boosts Aerobic Exercise Performance after Short-Term High Altitude Training

PubMed Central

Chen, Chung-Yu; Hou, Chien-Wen; Bernard, Jeffrey R.; Chen, Chiu-Chou; Hung, Ta-Cheng; Cheng, Lu-Ling; Liao, Yi-Hung

2014-01-01

Abstract Chen, Chung-Yu, Chien-Wen Hou, Jeffrey R. Bernard, Chiu-Chou Chen, Ta-Cheng Hung, Lu-Ling Cheng, Yi-Hung Liao, and Chia-Hua Kuo. Rhodiola crenulata- and Cordyceps sinensis-based supplement boosts aerobic exercise performance after short-term high altitude training. High Alt Med Biol 15:371–379, 2014.—High altitude training is a widely used strategy for improving aerobic exercise performance. Both Rhodiola crenulata (R) and Cordyceps sinensis (C) supplements have been reported to improve exercise performance. However, it is not clear whether the provision of R and C during high altitude training could further enhance aerobic endurance capacity. In this study, we examined the effect of R and C based supplementation on aerobic exercise capacity following 2-week high altitude training. Alterations to autonomic nervous system activity, circulatory hormonal, and hematological profiles were investigated. Eighteen male subjects were divided into two groups: Placebo (n=9) and R/C supplementation (RC, n=9). Both groups received either RC (R: 1400 mg+C: 600 mg per day) or the placebo during a 2-week training period at an altitude of 2200 m. After 2 weeks of altitude training, compared with Placebo group, the exhaustive run time was markedly longer (Placebo: +2.2% vs. RC: +5.7%; p<0.05) and the decline of parasympathetic (PNS) activity was significantly prevented in RC group (Placebo: −51% vs. RC: −41%; p<0.05). Red blood cell, hematocrit, and hemoglobin levels were elevated in both groups to a comparable extent after high altitude training (p<0.05), whereas the erythropoietin (EPO) level remained higher in the Placebo group (∼48% above RC values; p<0.05). The provision of an RC supplement during altitude training provides greater training benefits in improving aerobic performance. This beneficial effect of RC treatment may result from better maintenance of PNS activity and accelerated physiological adaptations during high altitude training. PMID:25251930

Regulation of the exopolysaccharide from an anamorph of Cordyceps sinensis on dendritic cell sarcoma (DCS) cell line.

PubMed

Song, Dan; He, Zhenyue; Wang, Chenhao; Yuan, Fengjiao; Dong, Ping; Zhang, Weiyun

2013-03-01

Cordyceps sinensis has been regarded as a precious tonic food and herbal medicine in China for thousands of years. The exopolysaccharide (EPS) from an anamorph of Cordyceps sinensis was found to have antitumor immunomodulatory activity. Mature dendritic cells play a role in initiating antitumor immunity, so we try to investigate the effects of EPS on the murine dendritic cell line DCS. Flow cytometry was used to assay the expression levels of cell surface molecules including major histocompatibility complex (MHC)-II, CD40, CD80, and CD86 of DCS cells and their ability to take up antigens. The ability of DCS cells to activate the proliferation of CTLL-2 T cells was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) method. IL-12 and TNF-α levels were detected using ELISA. Western blotting was performed to estimate the levels of phosphorylated Janus kinase 2 (p-JAK2), phosphorylated signal transducer and activator of transcription 3 (p-STAT3), nuclear factor-κB (NF-κB) p65 and p105. EPS increased the expressions of MHC-II, CD40, CD80, and CD86 of DCS cells and up-regulated their ability to take up antigens. EPS also enhanced their ability to activate the proliferation of CTLL-2 T cells. IL-12 and TNF-α secreted from DCS cells were up-regulated after EPS treatment. Furthermore, EPS significantly caused the decline of p-JAK2 and p-STAT3, significantly increased levels of NF-κB p65 in the nucleus and decreased levels of NF-κB p105 in the cytoplasm. EPS may induce DCS cells to exhibit mature characteristics, and the mechanism involved is probably related to the inhibition of the JAK2/STAT3 signal pathway and promotion of the NF-κB signal pathway.

Cordyceps sinensis extracts attenuate aortic transplant arteriosclerosis in rats.

PubMed

Zhang, Yan; Yang, Mei; Gong, Shuwen; Yang, Yu; Chen, Bicheng; Cai, Yong; Zheng, Shaoling; Yang, Yirong; Xia, Peng

2012-06-01

Transplant arteriosclerosis is a hallmark of chronic rejection and is still the major limiting factor affecting the success of long-term organ transplants. Development of transplant arteriosclerosis is refractory to conventional immunosuppressive drugs, and adequate therapy is not yet available. The aim of this study was to determine the role of Cordyceps sinensis extracts in reducing the formation of transplant arteriosclerosis in a rat aortic transplant model. Lewis rat aortic allografts were transplanted into Brown-Norway recipient rats. Recipients received 0.5, 1, 2, and 5 mg/kg of Cordyceps sinensis extracts (or control saline) daily via intragastric injection for 60 d. Grafts were harvested 60 d post-transplantation and intimal thickness determined microscopically following hematoxylin and eosin (H and E) staining and abdominal aorta protein profiles determined by Western blot analysis. Cellular localization was assessed by histology and immunohistochemistry and the serum analyzed for tumor necrosis factor alpha (TNF-α) and intercellular adhesion molecule-1 (ICAM-1) by enzyme-linked immunosorbent assay (ELISA). C. sinensis administration resulted in a significant reduction in neointimal formation (neointimal thickness 8.27 ± 1.95 μm [0.5 mg/kg], 3.69 ± 1.43 μm [1 mg/kg], 3.69 ± 1.43 μm [1 mg/kg], 3.69 ± 1.43 μm [1 mg/kg] versus 11.42 ± 2.67 μm [control]) and in the proliferative activity of vascular smooth muscle cells. In addition, localized expression of TNF-α and ICAM-1 in transplant aortas was characterized by immunohistochemistry and immunoblot analyses demonstrating that C. sinensis treatment significantly reduced TNF-α and ICAM-1 levels compared with levels observed in controls (P < 0.05). Serum TNF-α and ICAM-1 levels were significantly reduced in C. sinensis-treated animals compared with controls (P < 0.05). C. sinensis treatment effectively reduced the formation of transplant arteriosclerosis in a rat aortic transplant model. Copyright © 2012 Elsevier Inc. All rights reserved.

[Study on effect of cordyceps sinensis on early-stage silicotic pulmonary fibrosis in rabbits].

PubMed

Liu, Qianzhong; Zhang, Wei; Cui, Hongfu; Ying, Yanhong

2014-07-01

To establish a rabbit model of silicotic pulmonary fibrosis and to investigate the effect of cordyceps sinensis in this model. Thirty healthy male white rabbits were randomly divided into control group, silicosis model group, and intervention group. The rabbits in silicosis model group and intervention group received endotracheal perfusion of silicon dioxide suspension (120 mg/kg), and the control group was treated with the same volume of saline. All the rabbits were sacrificed 30 days later. The lung coefficient was calculated by comparing the lung weight and body weight; the right lung tissue was stained with hematoxylin-eosin (HE). The content of hydroxyproline in lung tissue was measured by alkaline hydrolysis. The mRNA levels of transforming growth factor beta 1 (TGF-β₁) and mothers against decapentaplegic homolog 7 (Smad7) in rabbit lung sections were determined by real-time PCR. No abnormalities were observed by HE staining in the lung tissues of control group, while fibrosis and silicotic nodules were discovered in the silicosis model group and intervention group. The lung coefficient and the content of hydroxyproline in lung tissue were significantly higher in the silicosis model group than in the control group and intervention group (P < 0.05 or P < 0.01). Compared with the control group, the silicosis model group and intervention group had significantly increased TGF-β₁ mRNA levels but significantly reduced Smad7 mRNA levels (P < 0.02). Compared with the silicosis model group, the intervention group had a significantly reduced TGF-β₁ mRNA level but a significantly increased Smad7 mRNA level (P < 0.05). Cordyceps sinensis is able to reduce the expression of TGF-β₁ mRNA and increase the expression of Smad7 mRNA in lung tissues of rabbits with silicotic pulmonary fibrosis, and thus postpone the progression of fibrosis.

Prevention of disuse osteoporosis in rats by Cordyceps sinensis extract.

PubMed

Qi, W; Yan, Y-B; Lei, W; Wu, Z-X; Zhang, Y; Liu, D; Shi, L; Cao, P-C; Liu, N

2012-09-01

Cordyceps sinensis has been known as a traditional medicine in China, and C. sinensis plus strontium could prevent osteoporosis in ovariectomized rats. The present study shows that daily oral administration of C. sinensis at higher doses in adult hind limb suspension rats can prevent disuse-induced bone loss and deterioration of trabecular microarchitecture. Cordyceps sinensis induces estradiol production and prevents osteoporosis in ovariectomized rats. This study was to examine whether C. sinensis can prevent disuse-induced osteoporosis. Rats were randomly divided into six groups, and five groups were treated with hind limb suspension (HLS). One HLS group received alendronate (2.0 mg/kg/day) orally, and to the three other HLS groups to each group, a different amount of C. sinensis (100, 300, and 500 mg/kg/day) was orally administered for 8 weeks before and after HLS. The remaining HLS group was set as a control without treatment. Each group consisted of 10 males and females. The body weights, biochemical parameters in serum and urine, bone mineral density (BMD), bone mineral content (BMC), mechanical testing, and bone microarchitecture were examined. Treatments with higher C. sinensis dosage (300 and 500 mg/kg/day) or alendronate had a positive effect on body weights, mechanical strength, BMD, and BMC compared to the other HLS groups. C. sinensis decreased markers of bone turnover dose dependently and increased the osteocalcin levels in HLS rats. The result of micro-CT analysis from the L4 vertebra showed that C. sinensis (500 mg/kg) significantly prevented the reduction of the bone volume fraction, connectivity density, trabeculae number, and thickness as well as improved the trabeculae separation and structure model index in HLS rats. The present study demonstrates that administration of C. sinensis at higher doses over an 8-week period can prevent the disuse osteoporosis in rats. It implies that C. sinensis might be an alternative therapy for prevention of disuse-induced osteoporosis also in humans.

"Coca got us here and now it's our weakness:" Fusarium oxysporum and the political ecology of a drug war policy alternative in Bolivia.

PubMed

Pearson, Zoe

2016-07-01

A strain of Fusarium oxysporum fungus is killing coca plants in the Chapare coca growing region of Bolivia. Coca farmers are already constrained in the amount of coca they can grow under the government's community-based coca control approach, "social control." Coca leaf is the main ingredient in cocaine, but it is also a traditional medicine and food, is economically vital to household incomes, and is a political symbol of the current government administration. Bolivia's approach to coca control, now administered without any United States military intervention, is an innovative example of experimentation with drug policy reform. This paper is based on ethnographic research including semi-structured interviews and observation. Coca growers are worried about the dire economic, social, and political consequences of the fungus' appearance and spread since summer 2013. They have two explanations for its origins: First, that it was sent by the United States government, which in the past was developing a strain of F. oxysporum for use in the drug war; Second, and the explanation of scientists, is that the outbreak is caused by the overuse of agrochemicals and other intensive agricultural practices. More than a matter of agroecology, the practices identified in the second explanation must be understood in terms of the persistence of the international drug prohibition regime. Bolivia's social control approach is a successful alternative to violent eradication measures, however the country is constrained to uphold the fundamental principles of supply-side control in order to be a respected partner in global drug control. The supply-side logics restricting social control make intensive agriculture practices attractive, but may have contributed to the fungus' proliferation and its continued spread. The fungus draws attention to the challenges of policy reform, new collateral damages of drug control, and role environmental factors can play in drug control politics. Copyright © 2016 Elsevier B.V. All rights reserved.

Occurrence and seasonal prevalence of the coconut mite, Aceria guerreronis (Eriophyidae), and associated arthropods in Oman.

PubMed

Al-Shanfari, Abdulaziz; Hountondji, Fabien C C; Al-Zawamri, Hamid; Rawas, Hassan; Al-Mashiki, Yussef; de Moraes, Gilberto J; Moore, Dave; Gowen, Simon R

2013-06-01

The coconut palm is an important crop in the sub arid coastal plain of Dhofar, Oman, for the high demand for its nut water and its use as ornamental plant. Damage of coconut fruits by the eriophyid mite Aceria guerreronis Keifer was first reported in that region in the late 1980s, but background information about the ecology of the pest in Oman was missing. Four surveys were conducted in different seasons from 2008 to 2009, to assess the distribution and prevalence of the coconut mite and its damage as well as the presence of natural enemies. Infestation by the coconut mite was conspicuous on most (99.7 %) palm trees, with 82.5 % damaged fruits. The average (± SE) density of coconut mites per fruit was 750 ± 56; this level of infestation led to the incidence of over 25 % of surface damage on more than half of the fruits. The mite appeared more abundant at the end of the cold season through the summer. No significant differences were observed between infestation levels on local varieties, hybrids and on dwarf varieties. Neoseiulus paspalivorus (De Leon), Cydnoseius negevi (Swirski & Amitai) and Amblyseius largoensis (Muma) were the predatory mites found under the bracts of over 30 % of the coconut fruits and on 68 % of the coconut trees. Considering all sampling dates and all varieties together, average (± SE) phytoseiid density was 1.4 ± 1.19 per fruit. Other mites found in the same habitat as A. guerreronis included the tarsonemids Steneotarsonemus furcatus De Leon and Nasutitarsonemus omani Lofego & Moraes. The pathogenic fungus Hirsutella thompsonii Fisher was rarely found infecting the coconut mite in Dhofar. Other fungal pathogens, namely Cordyceps sp. and Simplicillium sp., were more prevalent.

Afro-Asian cockroach from Chiapas amber and the lost Tertiary American entomofauna

NASA Astrophysics Data System (ADS)

Vršanský, Peter; Cifuentes-Ruiz, Paulina; Vidlička, Ľubomír; Čiampor, Fedor; Vega, Francisco J.

2011-10-01

Cockroach genera with synanthropic species (Blattella, Ectobius, Supella, Periplaneta, Diploptera and ?Blatta), as well as other insects such as honeybees, although natively limited to certain continents nowadays, had circumtropic distribution in the past. The ease of their reintroduction into their former range suggests a post-Early Miocene environmental stress which led to the extinction of cosmopolitan Tertiary entomofauna in the Americas, whilst in Eurasia, Africa and Australia this fauna survived. This phenomenon is demonstrated here on a low diversity (10 spp.) living cockroach genus Supella, which is peculiar for the circumtropical synanthropic brownbanded cockroach S. longipalpa and also for its exclusively free-living cavicolous species restricted to Africa. S. (Nemosupella) miocenica sp. nov. from the Miocene amber of Chiapas in Mexico is a sister species to the living S. mirabilis from the Lower Guinea forests and adjacent savannas. The difference is restricted to the shape of the central macula on the pronotum, and size, which may indicate the around-Miocene origin of the living, extremely polymorphic Supella species and possibly also the isochronic invasion into the Americas. The species also has a number of characteristics of the Asian (and possibly also Australian) uniform genus Allacta (falling within the generic variability of Supella) suggesting Supella is a direct ancestor of the former. The present species is the first significant evidence for incomplete hiati between well defined cockroach genera — a result of the extensive fossil record of the group. The reported specimen is covered by a mycelium of a parasitic fungus Cordyceps or Entomophthora.

Use of the entomopathogenic fungi Metarhizium anisopliae, Cordyceps bassiana and Isaria fumosorosea to control Diaphorina citri (Hemiptera: Psylidae) in Persian lime under field conditions

USDA-ARS?s Scientific Manuscript database

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), is a destructive insect pest in the citriculture, because it is an efficient vector of the proteobacteria, ‘Candidatus Liberibacter asiaticus’ (Las), ‘Ca. L. Africanus’ (Laf), and ‘Ca. L. Americanus’ (Lam). These bacteria c...

[Comparative study on specific chromatograms and main nucleosides of cultivated and wild Cordyceps sinensis].

PubMed

Zan, Ke; Huang, Li-Li; Guo, Li-Nong; Liu, Jie; Zheng, Jian; Ma, Shuang-Cheng; Qian, Zheng-Ming; Li, Wen-Jia

2017-10-01

This study is to establish the HPLC specific chromatogram and determine four main nucleosides of wild and cultivated Cordyceps sinensis. Uridine, inosine, guanosine and adenosine were selected as reference substance. HPLC analysis was performed on a Waters XSelect HSS T3 C₁₈ (4.6 mm×250 mm, 5 μm), with a mobile phase consisting of water(A)-acetonitrile (B) at a flow rate of 0.6 mL•min⁻¹ (0-5 min,0% B;5-15 min,0%-10% B, 15-30 min,10%-20% B, 30-33 min, 20%-50% B, 33-35 min, 50%-0% B, 35-40 min, 0% B). The detection wavelength was 260 nm and the column temperature was controlled at 30 ℃, and the injection volume was 5 μL. HPLC specific chromatogram of wild and cultivated C. sinensis was established and four main nucleosides were simultaneously determined by the above method. Specific chromatograms and contents of four main nucleosides showed no significant differences between cultivated and wild C. sinensis. These results can provide scientific evidences for further development and utilization of cultivated C. sinensis. Copyright© by the Chinese Pharmaceutical Association.

Combinatorial usage of fungal polysaccharides from Cordyceps sinensis and Ganoderma atrum ameliorate drug-induced liver injury in mice.

PubMed

Fan, Songtao; Huang, Xiaojun; Wang, Sunan; Li, Chang; Zhang, Zhihong; Xie, Mingyong; Nie, Shaoping

2018-05-15

This study investigated the possible protective effect of combined fungal polysaccharides (CFP), consisting of Cordyceps sinensis polysaccharides (CSP) and Ganoderma atrum polysaccharides (PSG) with well-defined structural characteristics, against cyclophosphamide (CTX)-induced hepatotoxicity in mice. Our results indicated CFP effectively prevented the liver injury by decreasing toxicity markers (aspartate transaminase, alanine aminotransferase and alkaline phosphatase). Further biochemical and molecular analysis indicated CSP particularly inhibited the activation of Toll-like receptor 9 (TLR9) and its related inflammatory signals, including pro-inflammatory cytokines, inducible nitric oxide synthase, and cyclooxygenase-2 to modulate hepatic inflammation response. Relatively, through activation of peroxisome proliferator-activated receptor α (PPARα), PSG increased hepatic glutathione peroxidase and glutathione content depleted by CTX, as well as prevented mitochondria-dependent apoptosis with regulation on Bcl-2 family proteins (Bad, Bax and Bcl-2). In addition, protective effect of CFP was associated with enhanced modulations on cellular oxidant/antioxidant imbalance, mitochondrial apoptotic pathway and pro-inflammatory factors via PPARα upregulation and TLR9 downregulation. Taking together, the combinatorial approach based on CSP and PSG presented a practical option for the management of drug-induced liver injury. Copyright © 2018 Elsevier Ltd. All rights reserved.

Using FT-NIR spectroscopy technique to determine arginine content in fermented Cordyceps sinensis mycelium.

PubMed

Xie, Chuanqi; Xu, Ning; Shao, Yongni; He, Yong

2015-01-01

This research investigated the feasibility of using Fourier transform near-infrared (FT-NIR) spectral technique for determining arginine content in fermented Cordyceps sinensis (C. sinensis) mycelium. Three different models were carried out to predict the arginine content. Wavenumber selection methods such as competitive adaptive reweighted sampling (CARS) and successive projections algorithm (SPA) were used to identify the most important wavenumbers and reduce the high dimensionality of the raw spectral data. Only a few wavenumbers were selected by CARS and CARS-SPA as the optimal wavenumbers, respectively. Among the prediction models, CARS-least squares-support vector machine (CARS-LS-SVM) model performed best with the highest values of the coefficient of determination of prediction (Rp(2)=0.8370) and residual predictive deviation (RPD=2.4741), the lowest value of root mean square error of prediction (RMSEP=0.0841). Moreover, the number of the input variables was forty-five, which only accounts for 2.04% of that of the full wavenumbers. The results showed that FT-NIR spectral technique has the potential to be an objective and non-destructive method to detect arginine content in fermented C. sinensis mycelium. Copyright © 2015 Elsevier B.V. All rights reserved.

Cordyceps sinensis prevents apoptosis in mouse liver with D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure.

PubMed

Cheng, Yu-Jung; Cheng, Shiu-Min; Teng, Yi-Hsien; Shyu, Woei-Cherng; Chen, Hsiu-Ling; Lee, Shin-Da

2014-01-01

Cordyceps sinensis (C. sinensis) has long been considered to be an herbal medicine and has been used in the treatment of various inflammatory diseases. The present study examined the cytoprotective properties of C. sinensis on D(+)-galactosamine (GalN)/lipopolysaccharide (LPS)-induced fulminant hepatic failure. Mice were randomly assigned into control, GalN/LPS, CS 20 mg and CS 40 mg groups (C. sinensis, oral gavage, five days/week, four weeks). After receiving saline or C. sinensis, mice were intraperitoneally given GalN (800 mg/kg)/LPS (10 μg/kg). The effects of C. sinensis on TNF-α, IL-10, AST, NO, SOD, and apoptoticrelated proteins after the onset of endotoxin intoxication were determined. Data demonstrated that GalN/LPS increased hepatocyte degeneration, circulating AST, TNF-α, IL-10, and hepatic apoptosis and caspase activity. C. sinensis pre-treatment reduced AST, TNF-α, and NO and increased IL-10 and SOD in GalN/LPS induced fulminant hepatic failure. C. sinensis attenuated the apoptosis of hepatocytes, as evidenced by the TUNEL and capase-3, 6 activity analyses. In summary, C. sinensis alleviates GalN/LPS-induced liver injury by modulating the cytokine response and inhibiting apoptosis.

Cordyceps sinensis polysaccharide inhibits PDGF-BB-induced inflammation and ROS production in human mesangial cells.

PubMed

Wang, Ying; Wang, Yan; Liu, Dan; Wang, Wang; Zhao, Huan; Wang, Min; Yin, Hongping

2015-07-10

CPS-F, a polysaccharide derived from Cordyceps sinensis, is a potential anti-inflammatory and anti-oxidative agent. We demonstrated that CPS-F not only inhibits platelet-derived growth factor BB (PDGF-BB)-induced intracellular reactive oxygen species (ROS) generation, and up-regulation of tumor necrosis factor-α (TNF-α), TNF-α receptor 1 (TNFR1), and monocyte chemotactic protein-1 (MCP-1), but also acts synergistically in combination with MAPK/ERK inhibitor U0126 and PI3K/Akt inhibitor LY294002. Additionally, up-regulation of pro-inflammatory factors was reversed by use of a combination of CPS-F and NADPH oxidase (NOX) inhibitor diphenyleneiodonium chloride (DPI) or silencing of NOX1. Furthermore, CPS-F prevents the PDGF receptor β (PDGFRβ) promoter activity induced by PDGF-BB in transfected cells and ameliorates increased levels of TNF-α, TNFR1, and MCP-1 when PDGFRβ is silenced, thereby suggesting that CPS-F possesses a bidirectional regulatory function. Our findings suggest CPS-F may exert its therapeutic effect for the treatment of glomerulonephritis related to human mesangial cells (HMCs) through the ERK1/2/Akt pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fast Simultaneous Determination of 13 Nucleosides and Nucleobases in Cordyceps sinensis by UHPLC-ESI-MS/MS.

PubMed

Zong, Shi-Yu; Han, Han; Wang, Bing; Li, Ning; Dong, Tina Ting-Xia; Zhang, Tong; Tsim, Karl W K

2015-12-04

A reliable ultra-high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry (UHPLC-ESI-MS/MS) method for the fast simultaneous determination of 13 nucleosides and nucleobases in Cordyceps sinensis (C. sinensis) with 2-chloroadenosine as internal standard was developed and validated. Samples were ultrasonically extracted in an ice bath thrice, and the optimum analyte separation was performed on an ACQUITY UPLC(TM) HSS C18 column (100 mm × 2.1 mm, 1.8 μm) with gradient elution. All targeted analytes were separated in 5.5 min. Furthermore, all calibration curves showed good linear regression (r > 0.9970) within the test ranges, and the limits of quantitation and detection of the 13 analytes were less than 150 and 75 ng/mL, respectively. The relative standard deviations (RSDs) of intra- and inter-day precisions were <6.23%. Recoveries of the quantified analytes ranged within 85.3%-117.3%, with RSD < 6.18%. The developed UHPLC-ESI-MS/MS method was successfully applied to determine nucleosides and nucleobases in 11 batches of C. sinensis samples from different regions in China. The range for the total content in the analyzed samples was 1329-2057 µg/g.

Cordyceps sinensis polysaccharide CPS-2 protects human mesangial cells from PDGF-BB-induced proliferation through the PDGF/ERK and TGF-β1/Smad pathways.

PubMed

Wang, Ying; Liu, Dan; Zhao, Huan; Jiang, Huixing; Luo, Chen; Wang, Min; Yin, Hongping

2014-02-15

CPS-2, a Cordyceps sinensis polysaccharide, has been demonstrated to have significant therapeutic activity against chronic renal failure. However, little is known about the underlying molecular mechanism. In this study, we found that CPS-2 could inhibit PDGF-BB-induced human mesangial cells (HMCs) proliferation in a dose-dependent manner. In addition, CPS-2 notably suppressed the expression of α-SMA, PDGF receptor-beta (PDGFRβ), TGF-β1, and Smad 3 in PDGF-BB-treated HMCs. Furthermore, PDGF-BB-stimulated ERK activation was significantly inhibited by CPS-2, and this inhibitory effect was synergistically potentiated by U0126. CPS-2 could prevent the PDGFRβ promoter activity induced by PDGF-BB, and return expression of PDGFRβ, TGF-β1, and TGFβRI to normal levels while cells were under PDGFRβ and ERK silencing conditions and transfected with DN-ERK. Taken together, these findings demonstrated that CPS-2 reduces PDGF-BB-induced cell proliferation through the PDGF/ERK and TGF-β1/Smad pathways, and it may have bi-directional regulatory effects on the PDGF/ERK cellular signaling pathway. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Metabolic Profiles and Free Radical Scavenging Activity of Cordyceps bassiana Fruiting Bodies According to Developmental Stage

PubMed Central

Hyun, Sun-Hee; Lee, Seok-Young; Sung, Gi-Ho; Kim, Seong Hwan; Choi, Hyung-Kyoon

2013-01-01

The metabolic profiles of Cordyceps bassiana according to fruiting body developmental stage were investigated using gas chromatography-mass spectrometry. We were able to detect 62 metabolites, including 48 metabolites from 70% methanol extracts and 14 metabolites from 100% n-hexane extracts. These metabolites were classified as alcohols, amino acids, organic acids, phosphoric acids, purine nucleosides and bases, sugars, saturated fatty acids, unsaturated fatty acids, or fatty amides. Significant changes in metabolite levels were found according to developmental stage. Relative levels of amino acids, purine nucleosides, and sugars were higher in development stage 3 than in the other stages. Among the amino acids, valine, isoleucine, lysine, histidine, glutamine, and aspartic acid, which are associated with ABC transporters and aminoacyl-tRNA biosynthesis, also showed higher levels in stage 3 samples. The free radical scavenging activities, which were significantly higher in stage 3 than in the other stages, showed a positive correlation with purine nucleoside metabolites such as adenosine, guanosine, and inosine. These results not only show metabolic profiles, but also suggest the metabolic pathways associated with fruiting body development stages in cultivated C. bassiana. PMID:24058459

Advances in Genomics of Entomopathogenic Fungi.

PubMed

Wang, J B; St Leger, R J; Wang, C

2016-01-01

Fungi are the commonest pathogens of insects and crucial regulators of insect populations. The rapid advance of genome technologies has revolutionized our understanding of entomopathogenic fungi with multiple Metarhizium spp. sequenced, as well as Beauveria bassiana, Cordyceps militaris, and Ophiocordyceps sinensis among others. Phylogenomic analysis suggests that the ancestors of many of these fungi were plant endophytes or pathogens, with entomopathogenicity being an acquired characteristic. These fungi now occupy a wide range of habitats and hosts, and their genomes have provided a wealth of information on the evolution of virulence-related characteristics, as well as the protein families and genomic structure associated with ecological and econutritional heterogeneity, genome evolution, and host range diversification. In particular, their evolutionary transition from plant pathogens or endophytes to insect pathogens provides a novel perspective on how new functional mechanisms important for host switching and virulence are acquired. Importantly, genomic resources have helped make entomopathogenic fungi ideal model systems for answering basic questions in parasitology, entomology, and speciation. At the same time, identifying the selective forces that act upon entomopathogen fitness traits could underpin both the development of new mycoinsecticides and further our understanding of the natural roles of these fungi in nature. These roles frequently include mutualistic relationships with plants. Genomics has also facilitated the rapid identification of genes encoding biologically useful molecules, with implications for the development of pharmaceuticals and the use of these fungi as bioreactors. Copyright © 2016 Elsevier Inc. All rights reserved.

Biodegradation of octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) by Phanerochaete chrysosporium: new insight into the degradation pathway.

PubMed

Fournier, Diane; Halasz, Annamaria; Thiboutot, Sonia; Ampleman, Guy; Manno, Dominic; Hawari, Jalal

2004-08-01

Octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) is a recalcitrant energetic chemical that tends to accumulate in soil, close to the surface. The present study describes the aerobic biodegradability of HMX using Phanerochaete chrysosporium. When added to 7 day old static P. chrysosporium liquid cultures, HMX (600 nmol) degraded within 25 days of incubation. The removal of HMX was concomitant with the formation of transient amounts of its mono-nitroso derivative (1-NO-HMX). The latter apparently degraded via two potential routes: the first involved N-denitration followed by hydrolytic ring cleavage, and the second involved alpha-hydroxylation prior to ring cleavage. The degradation of 1-NO-HMX gave the ring-cleavage product 4-nitro-2,4-diazabutanal (NDAB), nitrite (NO2 -), nitrous oxide (N2O), and formaldehyde (HCHO). Using [14C]-HMX, we obtained 14CO2 (70% in 50 days), representing three C atoms of HMX. Incubation of real soils, contaminated with either HMX (403 micromol kg(-1)) (military base soil) or HMX (3057 micromol kg(-1)), and RDX (342 micromol kg(-1)) (ammunition soil) with the fungus led to 75 and 19.8% mineralization of HMX (liberated 14CO2), respectively, also via the intermediary formation of 1-NO-HMX. Mineralization in the latter soil increased to 35% after the addition of glucose, indicating that a fungus-based remediation process for heavily contaminated soils is promising. The present findings improve our understanding about the degradation pathway of HMX and demonstrate the utility of using the robust and versatile fungus P. chrysosporium to develop effective remediation processes for the removal of HMX.

[Maturation of Cordyceps sinensis associates with alterations of fungal expressions of multiple Ophiocordyceps sinensis mutants in stroma of Cordyceps sinensis].

PubMed

Gao, Ling; Li, Xiao-hong; Zhao, Jian-qing; Lu, Ji-hong; Zhao, Jia-gang; Zhu, Jia-shi

2012-06-18

To examine maturational changes in expressions of Ophiocordyceps sinensis (O.sinensis) transition and transversion mutation genotypes in Cordyceps sinensis (C.sinensis) stroma. MassARRAY single nucleotide polymorphism (SNP) matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrum genotyping was used, and 8 SNP extension primers were designed based on the scattered, multiple point mutations of known sequences for the O.sinensis mutants within their internal transcribed spacer (ITS) segments. Of the extension primers, 5 (not capable of distinguishing between the 2 AT-biased genotypes) located in rDNA ITS1 and ITS2 regions: 067721-211, 067721-240, 067721-477, 067721-531 and 067721-581. The other 3 extension primers located in 5.8S rDNA region: 067740-324, 067740-328 and 067740-360, to distinguish between the 2 AT-biased genotypes. MS chromatograms at the 8 SNP sites showed dynamic alterations of mutant alleles in C.sinensis stroma. The allele for the AT-biased genotypes at 067721-211 site showed higher peak height than its GC-biased counterpart in the premature C.sinensis stroma, but disappeared with C.sinensis maturation. Chromatograms displayed not only the transition mutation alleles, but also transversion mutants. Some of the transversion mutation alleles displayed higher peak heights than those for GC- and AT-biased alleles, but their peak heights and detection rates tended to be decreased with C.sinensis maturation. When distinguishing between the 2 AT-biases, AB067744 and AB067740 genotype alleles co-existed in the premature C.sinensis stroma. The allele peak height for AB067744 genotype was greatly decreased with C.sinensis maturation, while that for AB067740 genotype increased. Co-existence of at least 5 transition and transversion mutant genotypes of O.sinensis and the dynamic changes in their expressions in C.sinensis stroma along with C.sinensis maturation may be of extreme importance in C.sinensis stroma germination and maturation, enabling C.sinensis to complete its life cycle.

Cordyceps sinensis health supplement enhances recovery from taxol-induced leukopenia.

PubMed

Liu, Wei-Chung; Chuang, Wei-Ling; Tsai, Min-Lung; Hong, Ji-Hong; McBride, William H; Chiang, Chi-Shiun

2008-04-01

This study aimed to evaluate the ability of the health food supplement Cordyceps sinensis (CS) to ameliorate suppressive effects of chemotherapy on bone marrow function as a model for cancer treatment. Mice were treated with Taxol (17 mg/kg body wt) one day before oral administration of a hot-water extract of CS (50 mg/kg daily) that was given daily for 3 weeks. White blood cell counts in peripheral blood of mice receiving Taxol were at 50% of normal levels on day 28 but had recovered completely in mice treated with CS. In vitro assays showed that CS enhanced the colony-forming ability of both granulocyte macrophage colony forming unit (GM-CFU) and osteogenic cells from bone marrow preparations and promoted the differentiation of bone marrow mesenchymal stromal cells into adipocytes, alkaline phosphatase-positive osteoblasts, and bone tissue. This result could be attributed to enhanced expression of Cbfa1 (core binding factor a) and BMP-2 (bone morphogenetic protein) with concurrent suppression of ODF (osteoclast differentiation factor/RANK [receptor activator of NF-kappaB]) ligand. In summary, CS enhances recovery of mice from leukopenia caused by Taxol treatment. It appears to do so by protecting both hematopoietic progenitor cells directly and the bone marrow stem cell niche through its effects on osteoblast differentiation.

Enhancement of cordyceps polysaccharide production via biosynthetic pathway analysis in Hirsutella sinensis.

PubMed

Lin, Shan; Liu, Zhi-Qiang; Baker, Peter James; Yi, Ming; Wu, Hui; Xu, Feng; Teng, Yi; Zheng, Yu-Guo

2016-11-01

The addition of various sulfates for enhanced cordyceps polysaccharide (CP) production in submerged cultivation of H. sinensis was investigated, and manganese sulfate was found the most effective. 2mM of manganese sulfate on 0day (d) was investigated as the optimal adding condition, and the CP production reached optimum with 5.33%, increasing by 93.3% compared with the control. Furthermore, the consumption of three main precursors of CP was studied over cultivation under two conditions. Intracellular mannose content decreased by 43.1% throughout 6days cultivation, which corresponded to CP accumulation rate sharply increased from 0 d to 6 d, and mannose was considered as the most preferred precursor for generating CP. Subsequently, mannose biosynthetic pathway was constructed and verified for the first time in H. sinensis, which constituted the important part of CP biosynthesis, and transcriptional levels of the biosynthetic genes were studied. Transcriptional level of gene cpsA was significantly up-regulated 5.35-fold and it was a key gene involved both in mannose and CP biosynthesis. This study demonstrated that manganese sulfate addition is an efficient and simple way to improve CP production. Transcriptional analysis based on biosynthetic pathway was helpful to find key genes and better understand CP biosynthesis. Copyright © 2016 Elsevier B.V. All rights reserved.

Highly Selective Bioconversion of Ginsenoside Rb1 to Compound K by the Mycelium of Cordyceps sinensis under Optimized Conditions.

PubMed

Wang, Wei-Nan; Yan, Bing-Xiong; Xu, Wen-Di; Qiu, Ye; Guo, Yun-Long; Qiu, Zhi-Dong

2015-10-23

Compound K (CK), a highly active and bioavailable derivative obtained from protopanaxadiol ginsenosides, displays a wide variety of pharmacological properties, especially antitumor activity. However, the inadequacy of natural sources limits its application in the pharmaceutical industry. In this study, we firstly discovered that Cordyceps sinensis was a potent biocatalyst for the biotransformation of ginsenoside Rb1 into CK. After a series of investigations on the biotransformation parameters, an optimal composition of the biotransformation culture was found to be lactose, soybean powder and MgSO₄ without controlling the pH. Also, an optimum temperature of 30 °C for the biotransformation process was suggested in a range of 25 °C-50 °C. Then, a biotransformation pathway of Rb1→Rd→F2→CK was established using high performance liquid chromatography/quadrupole time-of-flight mass spectrometry (HPLC-Q-TOF-MS). Our results demonstrated that the molar bioconversion rate of Rb1 to CK was more than 82% and the purity of CK produced by C. sinensis under the optimized conditions was more than 91%. In conclusion, the combination of C. sinensis and the optimized conditions is applicable for the industrial preparation of CK for medicinal purposes.

[Climate change impacts on yield of Cordyceps sinensis and research on yield prediction model of C. sinensis].

PubMed

Zhu, Shou-Dong; Huang, Lu-Qi; Guo, Lan-Ping; Ma, Xing-Tian; Hao, Qing-Xiu; Le, Zhi-Yong; Zhang, Xiao-Bo; Yang, Guang; Zhang, Yan; Chen, Mei-Lan

2017-04-01

Cordyceps sinensis is a Chinese unique precious herbal material, its genuine producing areas covering Naqu, Changdu in Qinghai Tibet Plateau, Yushu in Qinghai province and other regions. In recent 10 years, C. sinensis resources is decreasing as a result of the blindly and excessively perennial dug. How to rationally protect, develop and utilize of the valuable resources of C. sinensis has been referred to an important field of research on C. sinensis. The ecological environment and climate change trend of Qinghai Tibet plateau happens prior to other regions, which means that the distribution and evolution of C. sinensis are more obvious and intense than those of the other populations. Based on RS (remote sensing)/GIS(geographic information system) technology, this paper utilized the relationship between the snowline elevation, the average temperature, precipitation and sunshine hours in harvest period (April and may) of C. sinensis and the actual production of C. sinensis to establish a weighted geometric mean model. The model's prediction accuracy can reach 82.16% at least in forecasting C. sinensis year yield in Naqu area in every early June. This study can provide basic datum and information for supporting the C. sinensis industry healthful, sustainable development. Copyright© by the Chinese Pharmaceutical Association.

Mycology in the Chinese People’s Republic

DTIC Science & Technology

1960-03-11

by C." Chow. In 1935 he reported on Cordyceps - sinensis and Tremella fucimormis which are nathur common in Szechwan Province, on Armillaria elodes...species: uncinula sinensis Tai on Sophora japonica and Acer trifidum and Microsphaera securinega© Tai on Securinega fluggeoides. In the fifth report...8217in particular, on the’new combination of Doassan- siopsis horiana (P. Henri) Shen on Sagittaria trifolia L. (= S. Sinensis Sims). Later, in 1932,he

Insect symbiosis: derivation of yeast-like endosymbionts within an entomopathogenic filamentous lineage.

PubMed

Suh, S O; Noda, H; Blackwell, M

2001-06-01

Yeast-like endosymbionts (YLSs) of insects often are restricted to specific hosts and are essential to the host's survival. For example, in planthoppers (Homoptera: Delphacidae), endosymbionts function in sterol utilization and nitrogen recycling for the hosts. Our study, designed to investigate evolutionary changes in the YLS lineage involved in the planthopper association, strongly suggests an origin of the YLSs from within the filamentous ascomycetes (Euascomycetes), not the true yeasts (Saccharomycetes), as their morphology might indicate. During divergence of the planthopper YLSs, dramatic changes would have occurred in the insect-fungus interaction and the fungal morphology that have previously been undescribed in filamentous ascomycetes. Phylogenetic trees were based on individual and combined data sets of 2.6 kb of the nuclear small- and large-subunit ribosomal RNA genes for YLSs from three rice planthoppers (Laodelphax striatellus, Nilaparvata lugens, and Sogatella furcifera) compared with 56 other fungi. Parsimony analysis placed the planthopper YLSs within Cordyceps (Euascomycetes: Hypocreales: Clavicipitaceae), a genus of filamentous insects and a few fungal pathogenic ascomycetes. Another YLS species restricted to the aphid Hamiltonaphis styraci (Homoptera: Aphididae) was a sister taxon to the planthopper YLSS: Filamentous insect pathogens (Metarhizium and Beauveria) specific to the same species of insect hosts as the YLSs also formed lineages within the Clavicipitaceae, but these were distinct from the clade comprising YLS species. Trees constrained to include the YLSs in families of the Hypocreales other than the Clavicipitaceae were rejected by the Kishino-Hasegawa test. In addition, the results of this study support a hypothesis of two independent origins of insect-associated YLSs from among filamentous ascomycetes: the planthopper YLSs in the Clavicipitaceae and the YLSs associated with anobiid beetles (Symbiotaphrina species). Several lineages of true yeasts (Saccharomycetes) also formed endosymbiotic associations with beetles, but they were not closely related to either group derived from the filamentous ascomycetes.

Extracts of Cordyceps sinensis inhibit breast cancer cell metastasis via down-regulation of metastasis-related cytokines expression.

PubMed

Cai, Hongwei; Li, Jing; Gu, Baohua; Xiao, Ying; Chen, Rongsheng; Liu, Xiaoyu; Xie, Xiaomin; Cao, Li

2018-03-25

Cordyceps sinensis is a traditional Chinese medicine and has been used as adjuvant treatments for cancer and it has been also demonstrated to be effective in cancer patients. The objective of the present study is to investigate the anti-metastasis effects of water extracts of Cordyceps sinensis (WECS) in breast cancer and the potential mechanisms. The cytotoxicity of WECS on 4T1 breast cancer cells was evaluated in vitro using cell counting kit-8 (CCK8) assay. The in vivo anti-metastatic activity of intraperitoneally administered WECS and its effect on animal survival were measured in a mouse breast cancer metastasis model. To explore the molecular mechanisms of the anti-metastasis effect of WECS, the expression of matrix metalloprotein-9 (MMP-9) in serum was determined by enzyme-linked immunosorbent assay (ELISA). In addition, a protein array was used to examine the cytokine expression profiles in lung homogenates. Treatment with WECS (0.10-0.40mg/ml) significantly inhibited 4T1 cell viability in vitro. In animal studies, 50mg/kg WECS significantly reduced the number of metastatic lung nodules and the weight of lung, without affecting body weight of mice. Furthermore, WECS increased the survival rate of 4T1 tumor bearing mice in a dose dependent manner, and at high dose, WECS (50mg/kg) significantly increased the life span of the mice compared to untreated control group. The expression level of MMP-9 in serum was decreased about 50% in 50mg/kg WECS treated group compared to control group. The results of protein array showed that the expression of CC chemokine ligand 17 (CCL17), MMP-9, osteopontin (OPN), interleukin-33 (IL-33), CC chemokine ligand 12 (CCL12) and CC chemokine ligand 6 (CCL6) in the lungs of 4T1 tumor bearing mice was increased more than two fold compared with normal mice. Among them, the expression of CCL17, MMP-9, OPN, IL-33 was significantly reduced by treatment of 50mg/kg WECS. Our results demonstrated that WECS has potent anti-metastasis activity in a mouse breast cancer metastasis model possibly by down-regulation the expression of several metastasis-related cytokines. Copyright © 2017 Elsevier B.V. All rights reserved.

Determination of essential and toxic elements in Cordyceps kyushuensis Kawam by inductively coupled plasma mass spectrometry.

PubMed

Zhang, Guoying; Zhao, Yanxin; Liu, Fengjun; Ling, Jianya; Lin, Jianqiang; Zhang, Changkai

2013-01-01

In this study, a total of 20 elements (essential, non-essential and toxic): lithium (Li), sodium (Na), potassium (K), gallium (Ga), magnesium (Mg), zinc (Zn), iron (Fe), copper (Cu), manganese (Mn), vanadium (V), chromium (Cr), nickel (Ni), cobalt (Co), molybdenum (Mo), selenium (Se), barium (Ba), tin (Sn), arsenic (As), lead (Pb) cadmium (Cd) and mercury (Hg) in natural and cultured Cordyceps kyushuensis have been determined by means of inductively coupled plasma mass spectrometry (ICP-MS). Cultured stroma, natural stroma and natural worm were digested by microwave-assisted method before analysis. The proposed ICP-MS method was validated by analyzing a certified reference material (CRM) GBW10015 (spinach). The results of one-way analysis of variance (ANOVA) revealed that the element concentrations in the three kinds of samples were significantly different (p<0.05). Except for Mg, Zn, Cu, the values of other elemental contents were the highest in the stroma of natural C. kyushuensis. In comparison with the worm, the concentrations of determined elements in wild stroma were higher. The remarkable difference of elemental contents between cultured and natural stroma may be caused by distinct growing environment. This finding highlighted the usefulness of ICP-MS elemental analysis and enhanced the value of C. kyushuensis as a candidate for nourishing food based on its composition. Copyright © 2012 Elsevier B.V. All rights reserved.

Inhibition of TGF-β1/Smad signal pathway is involved in the effect of Cordyceps sinensis against renal fibrosis in 5/6 nephrectomy rats.

PubMed

Pan, Ming-Ming; Zhang, Ming-Hui; Ni, Hai-Feng; Chen, Jun-Feng; Xu, Min; Phillips, Aled Owain; Liu, Bi-Cheng

2013-08-01

The present study aimed to investigate the effects of Cordyceps sinensis on renal fibrosis and its possible mechanisms. Sprague-Dawley rats were randomly divided into three groups: sham operation (SHAM) group, 5/6 subtotal nephrectomy (SNx) untreated group, and 5/6 subtotal nephrectomy treated with C. sinensis (2.0 g/kg d) (CS) group. Rats were studied 12 weeks after the surgery, and the CS group presented with significantly lower proteinuria, and better renal function compared with the SNx group (p<0.05). Pathological study showed that the glomerulosclerosis tubulointerstitial injury score was significantly reduced in the CS group compared with the SNx group. Furthermore, the mRNA expression of TGF-β1, Smad2 and Smad3 and the protein expression of TGF-β1, TβRI, TβRII and p-Smad2/3 were attenuated by the C. sinensis treatment. In constrast, the mRNA and protein expression of Smad7 was upregulated. Furthermore, the expression of α-SMA and FSP1 was also significantly attenuated, accompanied by the increasing expression of E-cadherin, suggesting the inhibition of the epithelial-mesenchymal transition (EMT). C. sinensis exerted its antifibrotic effect on the SNx rats through the inhibition of the TGF-β1/Smad pathway. Copyright © 2013. Published by Elsevier Ltd.

Cardiovascular protection and antioxidant activity of the extracts from the mycelia of Cordyceps sinensis act partially via adenosine receptors.

PubMed

Yan, Xiao-Feng; Zhang, Zhong-Miao; Yao, Hong-Yi; Guan, Yan; Zhu, Jian-Ping; Zhang, Lin-Hui; Jia, Yong-Liang; Wang, Ru-Wei

2013-11-01

Mycelia of cultured Cordyceps sinensis (CS) is one of the most common substitutes for natural CS and was approved for arrhythmia in China. However, the role of CS in ameliorating injury during ischemia-reperfusion (I/R) is still unclear. We examined effects of extracts from CS on I/R and investigated the possible mechanisms. Post-ischemic coronary perfusion pressure, ventricular function, and coronary flow were measured using the Langendorff mouse heart model. Oxidative stress of cardiac homogenates was performed using an ELISA. Our results indicate that CS affords cardioprotection possibly through enhanced adenosine receptor activation. Cardioprotection was demonstrated by reduced post-ischemic diastolic dysfunction and improved recovery of pressure development and coronary flow. Treatment with CS largely abrogates oxidative stress and damage in glucose- or pyruvate-perfused hearts. Importantly, observed reductions in oxidative stress [glutathione disulfide (GSSG)]/[GSSG + glutathione] and [malondialdehyde (MDA)]/[superoxide dismutase + MDA] ratios as well as the resultant damage upon CS treatment correlate with functional markers of post-ischemic myocardial outcome. These effects of CS were partially blocked by 8-ρ-sulfophenyltheophylline, an adenosine receptor antagonist. Our results demonstrate a suppressive role of CS in ischemic contracture. Meanwhile, the results also suggest pre-ischemic adenosine receptor activation may be involved in reducing contracture in hearts pretreated with CS. Copyright © 2012 John Wiley & Sons, Ltd.

Construction of a Cordyceps sinensis exopolysaccharide-conjugated selenium nanoparticles and enhancement of their antioxidant activities.

PubMed

Xiao, Yidong; Huang, Qilin; Zheng, Zhaomin; Guan, Han; Liu, Shiyu

2017-06-01

A Cordyceps sinensis exopolysaccharide (EPS)-conjugated selenium nanoparticles (SeNPs) were successfully constructed through the reduction of SeO 3 2- . The EPS-SeNPs were characterized in terms of formation, morphology, size, Se distribution and phase by UV-vis, FT-IR, transmission electron microscopy (TEM), dynamic light scattering (DLS), energy dispersive X-ray (EDX) and wide angle X-ray diffraction (WAXD) measurements. Results revealed that the SeNPs conjugated to EPS were amorphous and could be well dispersed at a size range of 80-125nm. The interactions between the OH groups of EPS and SeNPs substituted for intermolecular interaction in native EPS to form new CO⋯Se bonds, resulting in good dispersion of SeNPs in the EPS matrix. Besides, the EPS-SeNPs at different Se/P ratios exhibited significant scavenging ability on superoxide anion radical (O 2 - ) and ABTS radical cation (ABTS + ) when compared to pure EPS, indicating that the conjugated SeNPs reinforced antioxidant effect of EPS. This work not only provides a simple and efficient way to construct well-dispersed SeNPs in aqueous system, and demonstrates the vital role of the EPS as a biopolymer template for dispersion, stabilization and size control of SeNPs, but also finds the EPS-SeNPs can potentially serve as a good antioxidant towards O 2 - and ABTS + . Copyright © 2017 Elsevier B.V. All rights reserved.

Cordyceps sinensis preserves intestinal mucosal barrier and may be an adjunct therapy in endotoxin-induced sepsis rat model: a pilot study

PubMed Central

Gu, Guo-Sheng; Ren, Jian-An; Li, Guan-Wei; Yuan, Yu-Jie; Li, Ning; Li, Jie-Shou

2015-01-01

Background: Cordyceps sinensis (C. sinensis), a traditional Chinese medicine, exhibits various pharmacological activities such as reparative, antioxidant, and apoptosis inhibitory effects. Intestinal barrier dysfunction plays a vital role in the progression of sepsis. We aimed to explore the effect of C. sinensis on the gut barrier and evaluate its efficacy in sepsis. Methods: A murine model of gut barrier dysfunction was created by intraperitoneal injection of endotoxin. C. sinensis or saline was administered orally after the induction of sepsis. Alterations of intestinal barrier were evaluated and compared in terms of epithelial cell apoptosis, proliferation index (PI), intercellular tight junction (TJ) and proliferating cell nuclear antigen (PCNA). Results: C. sinensis significantly decreased the percentage of apoptotic cells and promoted mucosal cells proliferation indicated by enhanced PI and PCNA expression in the intestinal mucosa compared to control group. The TJs between epithelial cells which were disrupted in septic rats were also restored by treatment of C. sinensis. In survival studies, C. sinensis was demonstrated to confer a protection against the lethal effect of sepsis. Conclusion: These results suggest that C. sinensis has gut barrier-protection effect in endotoxin-induced sepsis by promoting the proliferation and inhibiting the apoptosis of intestinal mucosal cells, as well as restoring the TJs of intestinal mucosa. C. sinensis may have the potential to be a useful adjunct therapy for sepsis. PMID:26221273

Cordyceps sinensis preserves intestinal mucosal barrier and may be an adjunct therapy in endotoxin-induced sepsis rat model: a pilot study.

PubMed

Gu, Guo-Sheng; Ren, Jian-An; Li, Guan-Wei; Yuan, Yu-Jie; Li, Ning; Li, Jie-Shou

2015-01-01

Cordyceps sinensis (C. sinensis), a traditional Chinese medicine, exhibits various pharmacological activities such as reparative, antioxidant, and apoptosis inhibitory effects. Intestinal barrier dysfunction plays a vital role in the progression of sepsis. We aimed to explore the effect of C. sinensis on the gut barrier and evaluate its efficacy in sepsis. A murine model of gut barrier dysfunction was created by intraperitoneal injection of endotoxin. C. sinensis or saline was administered orally after the induction of sepsis. Alterations of intestinal barrier were evaluated and compared in terms of epithelial cell apoptosis, proliferation index (PI), intercellular tight junction (TJ) and proliferating cell nuclear antigen (PCNA). C. sinensis significantly decreased the percentage of apoptotic cells and promoted mucosal cells proliferation indicated by enhanced PI and PCNA expression in the intestinal mucosa compared to control group. The TJs between epithelial cells which were disrupted in septic rats were also restored by treatment of C. sinensis. In survival studies, C. sinensis was demonstrated to confer a protection against the lethal effect of sepsis. These results suggest that C. sinensis has gut barrier-protection effect in endotoxin-induced sepsis by promoting the proliferation and inhibiting the apoptosis of intestinal mucosal cells, as well as restoring the TJs of intestinal mucosa. C. sinensis may have the potential to be a useful adjunct therapy for sepsis.

The first fossil fungus gardens of Isoptera: oldest evidence of symbiotic termite fungiculture (Miocene, Chad basin)

NASA Astrophysics Data System (ADS)

Duringer, Philippe; Schuster, Mathieu; Genise, Jorge F.; Likius, Andossa; Mackaye, Hassan Taisso; Vignaud, Patrick; Brunet, Michel

2006-12-01

Higher termites of the subfamily Macrotermitinae (fungus-growing termites) are known to build fungus gardens where a symbiotic fungus ( Termitomyces sp.) is cultivated. The fungus grows on a substrate called fungus comb, a structure built with the termites’ own faeces. Here we present the first fossil fungus combs ever found in the world. They were extracted from 7-million-year-old continental sandstone (Chad basin). Fossilized fungus combs have an ovoid morphology with a more or less flattened concave base and a characteristic general alveolar aspect. Under lens, they display a typical millimetre-scale pelletal structure. The latter, as well as the general shape and alveolar aspect, are similar to the morphology of fungus combs from extant fungus-growing termites.

Phytochemical and antimicrobial activities of Himalayan Cordyceps sinensis (Berk.) Sacc.

PubMed

Mamta; Mehrotra, Shubhi; Amitabh; Kirar, Vandana; Vats, Praveen; Nandi, Shoma Paul; Negi, P S; Misra, Kshipra

2015-01-01

This study evaluated the phytochemical and antimicrobial activities and also quantified bioactive nucleoside using high performance thin layer chromatography (HPTLC) of five extracts of Indian Himalayan Cordyceps sinensis prepared with different solvents employing accelerated solvent extraction (ASE) technique. The phytochemical potential of these extracts was quantified in terms of total phenolic and total flavonoid content while antioxidant activities were determined by 1,1-diphenyl-2-pycryl-hydrazyl (DPPH) and 2,2 -azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and ferric-reducing antioxidant power (FRAP) assays. Total reducing power (TRP) was determined by converting iron (III) into iron (II) reduction assay. CS(50%Alc) (15.1 ± 0.67mg/g of dry extract) and CS(100%Alc) (19.3 ± 0.33 mg/g of dry extract) showed highest phenolic and flavonoid content, respectively while CS(Aq) extract showed maximum antioxidant activity and the highest concentration of the three nucleosides (adenine 12.8 ± 0.49 mg/g, adenosine 0.36 ± 0.28 mg/g and uracil 0.14 ± 0.36 mg/g of dry extract) determined by HPTLC. The evaluation of extracts for antimicrobial activity against gram-negative and gram-positive bacterial strains showed CS(25%Alc), CS(75%Alc) and CS(100%Alc) extract to be more effective against E. coli, P. aerugenosa and B. subtilis giving 9, 7 and 6.5 mm of zone of inhibition (ZOI) in 93.75, 93.75 and 45 μg concentration, respectively, whereas CS(Aq) extract showed minimal inhibition against these.

The inhibitory mechanism of Cordyceps sinensis on cigarette smoke extract-induced senescence in human bronchial epithelial cells.

PubMed

Liu, Ailing; Wu, Jinxiang; Li, Aijun; Bi, Wenxiang; Liu, Tian; Cao, Liuzhao; Liu, Yahui; Dong, Liang

2016-01-01

Cellular senescence is a state of irreversible growth arrest induced either by telomere shortening (replicative senescence) or stress. The bronchial epithelial cell is often injured by inhaled toxic substances, such as cigarette smoke. In the present study, we investigated whether exposure to cigarette smoke extract (CSE) induces senescence of bronchial epithelial cells; and Cordyceps sinensis mechanism of inhibition of CSE-induced cellular senescence. Human bronchial epithelial cells (16HBE cells) cultured in vitro were treated with CSE and/or C. sinensis. p16, p21, and senescence-associated-galactosidase activity were used to detect cellular senescence with immunofluorescence, quantitative polymerase chain reaction, and Western blotting. Reactive oxygen species (ROS), PI3K/AKT/mTOR and their phosphorylated proteins were examined to testify the activation of signaling pathway by ROS fluorescent staining and Western blotting. Then, inhibitors of ROS and PI3K were used to further confirm the function of this pathway. Cellular senescence was upregulated by CSE treatment, and C. sinensis can decrease CSE-induced cellular senescence. Activation of ROS/PI3K/AKT/mTOR signaling pathway was enhanced by CSE treatment, and decreased when C. sinensis was added. Blocking ROS/PI3K/AKT/mTOR signaling pathway can attenuate CSE-induced cellular senescence. CSE can induce cellular senescence in human bronchial epithelial cells, and ROS/PI3K/AKT/mTOR signaling pathway may play an important role in this process. C. sinensis can inhibit the CSE-induced senescence.

Cordyceps sinensis inhibits airway remodeling in rats with chronic obstructive pulmonary disease

PubMed Central

Yang, Lei; Jiao, Xingai; Wu, Jinxiang; Zhao, Jiping; Liu, Tian; Xu, Jianfeng; Ma, Xiaohui; Cao, Liuzao; Liu, Lin; Liu, Yahui; Chi, Jingyu; Zou, Minfang; Li, Shuo; Xu, Jiawei; Dong, Liang

2018-01-01

Cordyceps sinensis is a traditional Chinese herbal medicine that has been used for centuries in Asia as a tonic to soothe the lung for the treatment of respiratory diseases. The aim of the present study was to determine the effects of C. sinensis on airway remodeling in chronic obstructive pulmonary disease (COPD) and investigate the underlying molecular mechanisms. Rats with COPD were orally administered C. sinensis at low, moderate or high doses (2.5, 5 or 7.5 g/kg/day, respectively) for 12 weeks. Airway tissue histopathology, lung inflammation and airway remodeling were evaluated. C. sinensis treatment significantly ameliorated airway wall thickening, involving collagen deposition, airway wall fibrosis, smooth muscle hypertrophy and epithelial hyperplasia in model rats with COPD. Additionally, C. sinensis administration in rats with COPD reduced inflammatory cell accumulation and decreased inflammatory cytokine production, including tumor necrosis factor-α, interleukin-8 and transforming growth factor (TGF)-β1 in bronchoalveolar lavage fluid. Meanwhile, the increased levels of α-smooth muscle actin and collagen I in the COPD group were also markedly decreased by C. sinensis treatment. Furthermore, compared with untreated rats with COPD, C. sinensis reduced the expression level of phosphorylated (p)-Smad2, p-Smad3, TGF-β1 and its receptors, with the concomitant increased expression of Smad7 in the lungs of rats with COPD. These results indicated that treatment with C. sinensis may be a useful approach for COPD therapy. PMID:29456676

Cordyceps sinensis inhibits airway remodeling in rats with chronic obstructive pulmonary disease.

PubMed

Yang, Lei; Jiao, Xingai; Wu, Jinxiang; Zhao, Jiping; Liu, Tian; Xu, Jianfeng; Ma, Xiaohui; Cao, Liuzao; Liu, Lin; Liu, Yahui; Chi, Jingyu; Zou, Minfang; Li, Shuo; Xu, Jiawei; Dong, Liang

2018-03-01

Cordyceps sinensis is a traditional Chinese herbal medicine that has been used for centuries in Asia as a tonic to soothe the lung for the treatment of respiratory diseases. The aim of the present study was to determine the effects of C. sinensi s on airway remodeling in chronic obstructive pulmonary disease (COPD) and investigate the underlying molecular mechanisms. Rats with COPD were orally administered C. sinensis at low, moderate or high doses (2.5, 5 or 7.5 g/kg/day, respectively) for 12 weeks. Airway tissue histopathology, lung inflammation and airway remodeling were evaluated. C. sinensis treatment significantly ameliorated airway wall thickening, involving collagen deposition, airway wall fibrosis, smooth muscle hypertrophy and epithelial hyperplasia in model rats with COPD. Additionally, C. sinensis administration in rats with COPD reduced inflammatory cell accumulation and decreased inflammatory cytokine production, including tumor necrosis factor-α, interleukin-8 and transforming growth factor (TGF)-β1 in bronchoalveolar lavage fluid. Meanwhile, the increased levels of α-smooth muscle actin and collagen I in the COPD group were also markedly decreased by C. sinensis treatment. Furthermore, compared with untreated rats with COPD, C. sinensis reduced the expression level of phosphorylated (p)-Smad2, p-Smad3, TGF-β1 and its receptors, with the concomitant increased expression of Smad7 in the lungs of rats with COPD. These results indicated that treatment with C. sinensis may be a useful approach for COPD therapy.

Therapeutic effect of captopril, pentoxifylline, and cordyceps sinensis in pre-hepatic portal hypertensive rats.

PubMed

Ahmed, Ahmed F; El-Maraghy, Nabila N; Abdel Ghaney, Rasha H; Elshazly, Shimaa M

2012-01-01

Portal hypertension is an important and potentially fatal complication of liver disease whereby cellular and fibrotic alterations manifest to increase portal venous pressure. The aim of this study is to investigate the effect of captopril, pentoxifylline (PTX), and cordyceps sinensis in pre-hepatic portal hypertensive rats. Wistar male rats were divided at random into 3 main groups: the first group: control rats. The second group: sham-operated rats and the third group: prehepatic portal hypertensive rats (PHPHT) induced by regulated pre-hepatic portal vein ligation. After 14 days, Group 3 was subdivided into 5 subgroups. Subgroup (1): portal vein-ligated (PVL) was killed at once; Subgroup (2): received distilled water for 30 days (untreated PVL group); subgroups 3-5 were treated with captopril (60 mg/kg, orally); PTX (100 mg/kg, orally); and C. sinensis (200 mg/kg, orally), respectively, as a single daily dose for 30 days. Portal pressure, nitric oxide (NO), antioxidant enzymes, Liver enzymes, and creatinine levels were measured to evaluate the status of the liver state. Portal vein ligation produced significant increments in liver enzymes, NO, creatinine and portal pressure concomitant with significant decrements in glutathione content and superoxide dismutase activity. Treatment with captopril, PTX, and C. sinensis resulted in a significant reduction in liver enzymes, NO, creatinine and portal pressure and observable increase in antioxidant enzymes. captopril, PTX, and C. sinensis have promising effect in controlling PHPHT and reducing hyperdynamic circulatory state through reduction of portal pressure and NO level.

[Effectiveness of cultured Cordyceps sinensis combined with glucocorticosteroid on pulmonary fibrosis induced by bleomycin in rats].

PubMed

Xu, Huijuan; Li, Shiyue; Lin, Yunen; Liu, Rong; Gu, Yingying; Liao, Dongjiang

2011-08-01

To study the treatment effects of cultured Cordyceps sinensis combined with glucocorticosteroid on experimental pulmonary fibrosis in rats induced by bleomycin. Fifty rats were randomly divided into five groups, including control group, model group, cultured C. sinensis groups, prednisone group, cultured C. sinensis combined with prednisone group. On experimental day 0, the rats were respectively intratracheally instilled with bleomycin, and rats in the control group and model group with the same volume of normal saline. One day after the injection, cultured C. sinensis and glucocorticosteroid was respectively given to rats daily by gastric gavage, while the same volume of normal saline was given to those in the control group and model group. On 28th d, bronchoalveolar lavage fluid (BALF) and lung tissue were collected. Histological changes of the lungs were evaluated by HE stain, Masson's trichrome stain. Collagen content of the lung tissue was assessed by hydroxyprolin concentration. Lung expression of CTGF protein was assessed by immunohistochemistry. The level of TGF-beta1 protein was measured by ELISA. Compared to model group, pulmonary fibrosis were alleviated in cultured C. sinensis and prednisone group, and CTGF expression, Hydroxyproline concentrations and protein TGF-beta1 were decreased. The combination effect of C. sinensis and prednisone group is augmented compared with using C. sinensis or prednisone group alone. The cultured C. sinensis and prednisone alleviates pulmonary fibrosis, and the combination use of both drugs has synergia effects in anti-fibrous degeneration.

A comparative proteomic characterization and nutritional assessment of naturally- and artificially-cultivated Cordyceps sinensis.

PubMed

Zhang, Xu; Liu, Qun; Zhou, Wei; Li, Ping; Alolga, Raphael N; Qi, Lian-Wen; Yin, Xiaojian

2018-06-15

Cordyceps sinensis has gained increasing attention due to its nutritional and medicinal properties. Herein, we employed label-free quantitative mass spectrometry to explore the proteome differences between naturally- and artificially-cultivated C. sinensis. A total of 22,829 peptides with confidence ≥95%, corresponding to 2541 protein groups were identified from the caterpillar bodies/stromata of 12 naturally- and artificially-cultivated samples of C. sinensis. Among them, 165 proteins showed significant differences between the samples of natural and artificial cultivation. These proteins were mainly involved in energy production/conversion, amino acid transport/metabolism, and transcription regulation. The proteomic results were confirmed by the identification of 4 significantly changed metabolites, thus, lysine, threonine, serine, and arginine via untargeted metabolomics. The change tendencies of these metabolites were partly in accordance with changes in abundance of the proteins, which was upstream of their synthetic pathways. In addition, the nutritional value in terms of the levels of nucleosides, nucleotides, and adenosine between the artificially- and naturally-cultivated samples was virtually same. These proteomic data will be useful for understanding the medicinal value of C. sinensis and serve as reference for its artificial cultivation. C. sinensis is a precious and valued medicinal product, the current basic proteome dataset would provide useful information to understand its development/infection processes as well as help to artificially cultivate it. This work would also provide basic proteome profile for further study of C. sinensis. Copyright © 2018. Published by Elsevier B.V.

Cordyceps sinensis Oral Liquid Inhibits Damage Induced by Oxygen and Glucose Deprivation in SH-SY5Y Cells.

PubMed

Zou, Ying-Xin; Liu, Yu-Xiang; Ruan, Ming-Hua; Zhou, Yi; Wang, Jia-Chun; Chu, Zhi-Yong

2016-01-01

Cordyceps sinensis has been used in traditional Chinese medicine for thousands of years. It has been demonstrated to have a variety of biological activities, and an extract of it has been demonstrated to possess a protective effect in occlusion-induced focal cerebral ischemia of the middle cerebral artery in rats. It could be explored as an agent for treatment of ischemic stroke, and the mechanisms need to be studied further. The study intended to investigate the protective effects of the Cordyceps sinensis oral liquid (CSOL) against damage induced by oxygen and glucose deprivation (OGD) in SH-SY5Y cells. DESIGN • The research team designed an in vitro study. The study occurred at the Naval Medical Research Institute in Shanghai, China. SH-SY5Y cells were exposed to CSOL in doses of 0.01, 0.03, 0.10, 0.30, and 1.00 mg/mL, creating 5 intervention groups. The OGD condition was induced by transfer of the cells from high-glucose Dulbecco's Modified Eagle's medium (DMEM) in a box gassed with air containing 5% CO2 to glucose-free DMEM in a box gassed with 94% N2, 5% CO2, and 1% O2. Like the cells for the interventions groups, the cells for a model group were cultured with high-glucose DMEM and were transferred to the OGD, but they received no dose of COSL. Cells in a control group were cultured with high-glucose DMEM, were not transferred to the OGD condition, and did not receive any dose of COSL. Cell viability was assayed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. The apoptosis and the mitochondrial membrane potential (MMP) were detected by flow cytometry, and the protein expression of caspase-3 was observed by western blot. After exposure to OGD, the cell viability of cells treated with 0.01, 0.03, 0.10, 0.30, and 1.00 mg/mL of CSOL increased in a dose-effect relationship. Compared with the cells in the model group, the treatment of CSOL at all the experimental concentrations significantly inhibited both the cell apoptosis (P < .01) and the capase-3 activation (P < .01). The MMP dissipation in the cells of the model group increased significantly compared with those of the control group (P < .01). The treatment with all doses of CSOL significantly inhibited the MMP dissipation (P < .01). CSOL protects against the damage induced by OGD through inhibiting the mitochondrial apoptosis pathway in SH-SY5Y cells.

Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lasure, Linda L; Dai, Ziyu

2008-10-21

The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.

[Effects of fungus on the growth of Dendrobium candidum and D. nobile in vitro culture].

PubMed

Song, J Y; Guo, S X

2001-12-01

To examine effects of fungus AR-18 (Epulorhiza sp.) on the growth of Dendrobium candidum and D. nobile in vitro culture. Effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when agar was used as rest, and effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when vermiculite was used as rest. In agar medium, effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were not significant (P > 0.05). However, in vermiculite medium, the effect of fungus AR-18 on fresh weight of D. nobile was significant (P < 0.05). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 16% compared with the non-inoculated ones (control). The effect of fungus AR-18 on dry weight of D. nobile was very significant (P < 0.01). Dry weight of D. nobile inoculated with fungus AR-18 was increased by 21% compared with the control. In vermiculite medium, the effect of combination treatment (Fungus AR-18 + Distilled H2O) on fresh weight of D. nobile was very significant (P < 0.01). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 47% compared with the control, while the effect of combination treatment (Fungus AR-18 + Nutrients) on fresh weight of D. nobile was not significant (P > 0.05). In addition, the effect of combinations treatment (Fungus AR-18 + Nutrients) and (Fungus AR-18 + Distilled H2O) on dry weight of D. nobile was not significant (P > 0.05). So the combination treatment (Fungus AR-18 + Distilled H2O) was the best for the growth of D. nobile. In vermiculite medium, effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum were not significant (P > 0.05). It is important in vitro culture to select a proper rest for the control of the growth of fungus to establish a beneficial symbiotic relationship between plants and fungi. If the fungus AR-18 is utilized as biological manure in got-up planting of D. nobile, a good result may be obtained.

Pulmonary aspergilloma

MedlinePlus

Aspergillosis is an infection caused by the fungus aspergillus. Aspergillomas are formed when the fungus grows in ... of fungus that causes disease in humans is Aspergillus fumigatus . Aspergillus is a common fungus. It grows ...

Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

2008-11-11

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

2008-11-11

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

2014-05-27

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

A double-blind, randomised, placebo-controlled trial of Ganoderma lucidum for the treatment of cardiovascular risk factors of metabolic syndrome.

PubMed

Klupp, Nerida L; Kiat, Hosen; Bensoussan, Alan; Steiner, Genevieve Z; Chang, Dennis H

2016-08-11

This study aimed to evaluate the efficacy and safety of Ganoderma lucidum for the treatment of hyperglycaemia and other cardiovascular risk components of metabolic syndrome using a prospective, double-blind, randomised, placebo-controlled trial. Eighty-four participants with type 2 diabetes mellitus and metabolic syndrome were randomised to one of three intervention groups: Ganoderma lucidum, Ganoderma lucidum with Cordyceps sinensis, or placebo. The dosage was 3 g/day of Ganoderma lucidum, with or without Cordyceps sinensis, for 16 weeks. The primary outcome measure was blood glucose (glycosylated haemoglobin [HbA1c] and fasting plasma glucose [FPG]); a number of secondary outcome measures were also tested. Data from the two intervention groups were combined. The combined intervention had no effect on any of the primary (baseline-adjusted difference in means: HbA1c = 0.13%, 95% CI [-0.35, 0.60], p = 0.60; FPG = 0.03 mmol/L, 95% CI [-0.90, 0.96], p = 0.95) or secondary outcome measures over the course of the 16-week trial, and no overall increased risk of adverse events with either active treatment. Evidence from this randomised clinical trial does not support the use of Ganoderma lucidum for treatment of cardiovascular risk factors in people with diabetes mellitus or metabolic syndrome. This Clinical Trial was registered with the Australian New Zealand Clinical Trials Registry on November 23, 2006. Trial ID: ACTRN12606000485538 and can be accessed here: https://www.anzctr.org.au/Trial/Registration/TrialReview.aspx?id=81705.

The inhibitory mechanism of Cordyceps sinensis on cigarette smoke extract-induced senescence in human bronchial epithelial cells

PubMed Central

Liu, Ailing; Wu, Jinxiang; Li, Aijun; Bi, Wenxiang; Liu, Tian; Cao, Liuzhao; Liu, Yahui; Dong, Liang

2016-01-01

Objectives Cellular senescence is a state of irreversible growth arrest induced either by telomere shortening (replicative senescence) or stress. The bronchial epithelial cell is often injured by inhaled toxic substances, such as cigarette smoke. In the present study, we investigated whether exposure to cigarette smoke extract (CSE) induces senescence of bronchial epithelial cells; and Cordyceps sinensis mechanism of inhibition of CSE-induced cellular senescence. Methods Human bronchial epithelial cells (16HBE cells) cultured in vitro were treated with CSE and/or C. sinensis. p16, p21, and senescence-associated-galactosidase activity were used to detect cellular senescence with immunofluorescence, quantitative polymerase chain reaction, and Western blotting. Reactive oxygen species (ROS), PI3K/AKT/mTOR and their phosphorylated proteins were examined to testify the activation of signaling pathway by ROS fluorescent staining and Western blotting. Then, inhibitors of ROS and PI3K were used to further confirm the function of this pathway. Results Cellular senescence was upregulated by CSE treatment, and C. sinensis can decrease CSE-induced cellular senescence. Activation of ROS/PI3K/AKT/mTOR signaling pathway was enhanced by CSE treatment, and decreased when C. sinensis was added. Blocking ROS/PI3K/AKT/mTOR signaling pathway can attenuate CSE-induced cellular senescence. Conclusion CSE can induce cellular senescence in human bronchial epithelial cells, and ROS/PI3K/AKT/mTOR signaling pathway may play an important role in this process. C. sinensis can inhibit the CSE-induced senescence. PMID:27555762

Cordyceps sinensis oral liquid prolongs the lifespan of the fruit fly, Drosophila melanogaster, by inhibiting oxidative stress.

PubMed

Zou, Yingxin; Liu, Yuxiang; Ruan, Minghua; Feng, Xu; Wang, Jiachun; Chu, Zhiyong; Zhang, Zesheng

2015-10-01

This study investigated the effect of Cordyceps sinensis oral liquid (CSOL) on the lifespan of Drosophila melanogaster (fruit fly). Following the lifelong treatment of fruit flies with CSOL, lifespan was examined. The activity of copper-zinc-containing superoxide dismutase 1 (SOD1), manganese-containing superoxide dismutase 2 (SOD2) and catalase (CAT), as well as the lipofuscin (LF) content were determined. The mRNA levels of SOD1, SOD2 and CAT were quantified by qPCR. Hydrogen peroxide (H2O2) and paraquat were used to mimic the effects of damage caused by acute oxidative stress. D-galactose was used to mimic chronic pathological aging. CSOL significantly prolonged the lifespan of the fruit flies under physiological conditions. The activity of SOD1 and CAT was upregulated, and LF accumulation was inhibited by CSOL. CSOL had no effect on the transcriptional levels (mRNA) of these enzymes. The survival time of the fruit flies which were negatively affected by exposure to H2O2 or paraquat was significantly prolonged by CSOL. In fruit flies pathologically aged by epxosure to D-galactose, CSOL also significantly prolonged their lifespan, upregulated the activity of SOD1 and CAT, and inhibited LF accumulation. The findings of our study indicate that CSOL prolongs the lifespan of fruit flies through an anti-oxidative stress pathway involving the upregulation of SOD1 and CAT activity and the inhibition of LF accumulation. CSOL may thus be explored as a novel agent for slowing the human aging process.

Therapeutic Effect of Captopril, Pentoxifylline, and Cordyceps Sinensis in Pre-Hepatic Portal Hypertensive Rats

PubMed Central

Ahmed, Ahmed F.; El-Maraghy, Nabila N.; Ghaney, Rasha H. Abdel; Elshazly, Shimaa M.

2012-01-01

Background/Aim: Portal hypertension is an important and potentially fatal complication of liver disease whereby cellular and fibrotic alterations manifest to increase portal venous pressure. The aim of this study is to investigate the effect of captopril, pentoxifylline (PTX), and cordyceps sinensis in pre-hepatic portal hypertensive rats. Settings and Design: Wister male rats were divided at random into 3 main groups: the first group: control rats. The second group: sham-operated rats and the third group: prehepatic portal hypertensive rats (PHPHT) induced by regulated pre-hepatic portal vein ligation. After 14 days, Group 3 was subdivided into 5 subgroups. Subgroup (1): portal vein-ligated (PVL) was killed at once; Subgroup (2): received distilled water for 30 days (untreated PVL group); subgroups 3-5 were treated with captopril (60 mg/kg, orally); PTX (100 mg/kg, orally); and C. sinensis (200 mg/kg, orally), respectively, as a single daily dose for 30 days. Patients and Methods: Portal pressure, nitric oxide (NO), antioxidant enzymes, Liver enzymes, and creatinine levels were measured to evaluate the status of the liver state. Results: Portal vein ligation produced significant increments in liver enzymes, NO, creatinine and portal pressure concomitant with significant decrements in glutathione content and superoxide dismutase activity. Treatment with captopril, PTX, and C. sinensis resulted in a significant reduction in liver enzymes, NO, creatinine and portal pressure and observable increase in antioxidant enzymes. Conclusions: captopril, PTX, and C. sinensis have promising effect in controlling PHPHT and reducing hyperdynamic circulatory state through reduction of portal pressure and NO level. PMID:22626797

A double-blind, randomised, placebo-controlled trial of Ganoderma lucidum for the treatment of cardiovascular risk factors of metabolic syndrome

PubMed Central

Klupp, Nerida L.; Kiat, Hosen; Bensoussan, Alan; Steiner, Genevieve Z.; Chang, Dennis H.

2016-01-01

This study aimed to evaluate the efficacy and safety of Ganoderma lucidum for the treatment of hyperglycaemia and other cardiovascular risk components of metabolic syndrome using a prospective, double-blind, randomised, placebo-controlled trial. Eighty-four participants with type 2 diabetes mellitus and metabolic syndrome were randomised to one of three intervention groups: Ganoderma lucidum, Ganoderma lucidum with Cordyceps sinensis, or placebo. The dosage was 3 g/day of Ganoderma lucidum, with or without Cordyceps sinensis, for 16 weeks. The primary outcome measure was blood glucose (glycosylated haemoglobin [HbA1c] and fasting plasma glucose [FPG]); a number of secondary outcome measures were also tested. Data from the two intervention groups were combined. The combined intervention had no effect on any of the primary (baseline-adjusted difference in means: HbA1c = 0.13%, 95% CI [−0.35, 0.60], p = 0.60; FPG = 0.03 mmol/L, 95% CI [−0.90, 0.96], p = 0.95) or secondary outcome measures over the course of the 16-week trial, and no overall increased risk of adverse events with either active treatment. Evidence from this randomised clinical trial does not support the use of Ganoderma lucidum for treatment of cardiovascular risk factors in people with diabetes mellitus or metabolic syndrome. This Clinical Trial was registered with the Australian New Zealand Clinical Trials Registry on November 23, 2006. Trial ID: ACTRN12606000485538 and can be accessed here: https://www.anzctr.org.au/Trial/Registration/TrialReview.aspx?id=81705. PMID:27511742

Cordyceps sinensis oral liquid prolongs the lifespan of the fruit fly, Drosophila melanogaster, by inhibiting oxidative stress

PubMed Central

ZOU, YINGXIN; LIU, YUXIANG; RUAN, MINGHUA; FENG, XU; WANG, JIACHUN; CHU, ZHIYONG; ZHANG, ZESHENG

2015-01-01

This study investigated the effect of Cordyceps sinensis oral liquid (CSOL) on the lifespan of Drosophila melanogaster (fruit fly). Following the lifelong treatment of fruit flies with CSOL, lifespan was examined. The activity of copper-zinc-containing superoxide dismutase 1 (SOD1), manganese-containing superoxide dismutase 2 (SOD2) and catalase (CAT), as well as the lipofuscin (LF) content were determined. The mRNA levels of SOD1, SOD2 and CAT were quantified by qPCR. Hydrogen peroxide (H2O2) and paraquat were used to mimic the effects of damage caused by acute oxidative stress. D-galactose was used to mimic chronic pathological aging. CSOL significantly prolonged the lifespan of the fruit flies under physiological conditions. The activity of SOD1 and CAT was upregulated, and LF accumulation was inhibited by CSOL. CSOL had no effect on the transcriptional levels (mRNA) of these enzymes. The survival time of the fruit flies which were negatively affected by exposure to H2O2 or paraquat was significantly prolonged by CSOL. In fruit flies pathologically aged by epxosure to D-galactose, CSOL also significantly prolonged their lifespan, upregulated the activity of SOD1 and CAT, and inhibited LF accumulation. The findings of our study indicate that CSOL prolongs the lifespan of fruit flies through an anti-oxidative stress pathway involving the upregulation of SOD1 and CAT activity and the inhibition of LF accumulation. CSOL may thus be explored as a novel agent for slowing the human aging process. PMID:26239097

Dentigerumycin: a bacterial mediator of an ant-fungus symbiosis

PubMed Central

Oh, Dong-Chan; Poulsen, Michael; Currie, Cameron R.; Clardy, Jon

2009-01-01

Fungus-growing ants engage in mutualistic associations with both the fungus they cultivate for food and actinobacteria (Pseudonocardia spp.) that produce selective antibiotics to defend that fungus from specialized fungal parasites. In the first system to be analyzed at the molecular level, the bacterium associated with the ant Apterostigma dentigerum produces dentigerumycin, a cyclic depsipeptide with highly modified amino acids, to selectively inhibit the parasitic fungus (Escovopsis sp.). PMID:19330011

Resistance to Black Dot in Potato

USDA-ARS?s Scientific Manuscript database

Black dot fungus can colonize tubers on the surface, in the stolon end, or in a combination of both.On the surface the fungus is prevalent as sclerotia, and in the stolon end the fungus colonizes the vascular tissuesas hyphae. The fungus is introduced to non-infested soils mostly by infected potato ...

THE IMPORTANCE OF ANIMAL INFECTIONS FOR THE HUMAN

DTIC Science & Technology

tuberculosis, leptospiroses. VIRUS-CAUSED ZOOANTHROPONOSES: Rickettsioses, ornithosis, lyssa, arboviroses. FUNGUS-CAUSED ANIMAL-HUMAN INFECTIONS: filamentous fungus, yeast fungus. PROTOZOA DISEASES: Toxoplasmoses .

Contamination of Pine Seeds by the Pitch Canker Fungus

Treesearch

L. David Dwinell; S.W. Fraedrich

1999-01-01

The pitch canker fungus, Fusarium subglutinans f. sp. pini, has been identified as a significant problem in man pine seed orchards and nursuries in the South. THe fungus causes strobilus mortality, seed deterioation, and cankers on the main stem, branches, and shoots of pines Dwinell and others 1985). The pitche canker fungus...

Native arbuscular mycorrhizal symbiosis alters foliar bacterial community composition.

PubMed

Poosakkannu, Anbu; Nissinen, Riitta; Kytöviita, Minna-Maarit

2017-11-01

The effects of arbuscular mycorrhizal (AM) fungi on plant-associated microbes are poorly known. We tested the hypothesis that colonization by an AM fungus affects microbial species richness and microbial community composition of host plant tissues. We grew the grass, Deschampsia flexuosa in a greenhouse with or without the native AM fungus, Claroideoglomus etunicatum. We divided clonally produced tillers into two parts: one inoculated with AM fungus spores and one without AM fungus inoculation (non-mycorrhizal, NM). We characterized bacterial (16S rRNA gene) and fungal communities (internal transcribed spacer region) in surface-sterilized leaf and root plant compartments. AM fungus inoculation did not affect microbial species richness or diversity indices in leaves or roots, but the AM fungus inoculation significantly affected bacterial community composition in leaves. A total of three OTUs in leaves belonging to the phylum Firmicutes positively responded to the presence of the AM fungus in roots. Another six OTUs belonging to the Proteobacteria (Alpha, Beta, and Gamma) and Bacteroidetes were significantly more abundant in NM plants when compared to AM fungus-inoculated plants. Further, there was a significant correlation between plant dry weight and leaf microbial community compositional shift. Also, there was a significant correlation between leaf bacterial community compositional shift and foliar nitrogen content changes due to AM fungus inoculation. The results suggest that AM fungus colonization in roots has a profound effect on plant physiology that is reflected in leaf bacterial community composition.

Final Environmental Assessment and Finding of No Significant Impact: Deployment of Up to Four F-16C Aircraft to the 133rd Airlift Wing for Air Sovereignty Alert Operations

DTIC Science & Technology

2007-11-01

species of moss FUNGI Endangered Fuscoboletinus weaverae . . . . . . . . . . . . . . a species of fungus Psathyrella cystidiosa...a species of fungus Psathyrella rhodospora . . . . . . . . . . . . . . . a species of fungus Special concern Laccaria trullisata...SC . . . . . . . . . caddisfly Psathyrella cystidiosa . . . . . . . . . . . . . . . . a species of fungus

Host deception: Predaceous fungus, esteya vermicola, entices pine wood nematode by mimicking the scent of its host pine for nutrient

USDA-ARS?s Scientific Manuscript database

A nematophagous fungus, Esteya vermicola, is recorded as the first endoparasitic fungus of pine wood nematode (PWN), Burasphelenchus xylophilus, in the last century. E. vermicola exhibited high infectivity toward PWN in the laboratory conditions and conidia spraying of this fungus on Japanese red pi...

HPLC-ICP-MS speciation analysis and risk assessment of arsenic in Cordyceps sinensis.

PubMed

Zuo, Tian-Tian; Li, Yao-Lei; Jin, Hong-Yu; Gao, Fei; Wang, Qi; Wang, Ya-Dan; Ma, Shuang-Cheng

2018-01-01

Cordyceps sinensis , one of the most valued traditional herbal medicines in China, contains high amount of arsenic. Considering the adverse health effects of arsenic, this is of particular concern. The aim of this study was to determine and analyze arsenic speciation in C. sinensis , and to measure the associated human health risks. We used microwave extraction and high-performance liquid chromatography coupled with inductively coupled plasma mass spectrometry to determine and analyze the arsenic content in C. sinensis , and measured the associated human health risks according to the hazard index (HI), lifetime cancer risk (CR), and target hazard quotient (THQ). The main arsenic speciation in C. sinensis were not the four organic arsenic compounds, including dimethyl arsenic, monomethyl arsenic, arsenobetaine, and arsenocholine, but comprised inorganic arsenic and other unknown risk arsenic compounds. HI scores indicated that the risk of C. sinensis was acceptable. CR results suggested that the cancer risk was greater than the acceptable lifetime risk of 10 -5 , even at low exposure levels. THQ results indicated that at the exposure level < 2.0 months/year, the arsenic was not likely to harm human health during a lifetime; however, if the exposure rate was > 3.0 months/year, the systemic effects of the arsenic in C. sinensis was of great concern. The arsenic in C. sinensis might not be free of risks. The suggested C. sinensis consumption rate of 2.0 months/year provided important insights into the ways by which to minimize potential health risks. Our study not only played the role of "cast a brick to attract jade" by which to analyze arsenic speciation in C. sinensis but also offered a promising strategy of risk assessment for harmful residues in traditional herbal medicines.

Cordyceps cicadae extracts ameliorate renal malfunction in a remnant kidney model*

PubMed Central

Zhu, Rong; Chen, Yi-ping; Deng, Yue-yi; Zheng, Rong; Zhong, Yi-fei; Wang, Lin; Du, Lan-ping

2011-01-01

Background and Objectives: Chronic kidney disease (CKD) is a growing public health problem with an urgent need for new pharmacological agents. Cordyceps cicadae is widely used in traditional Chinese medicine (TCM) and has potential renoprotective benefits. The current study aimed to determine any scientific evidence to support its clinical use. Methods: We analyzed the potential of two kinds of C. cicadae extract, total extract (TE) and acetic ether extract (AE), in treating kidney disease simulated by a subtotal nephrectomy (SNx) model. Sprague-Dawley rats were divided randomly into seven groups: sham-operated group, vehicle-treated SNx, Cozaar, 2 g/(kg∙d) TE SNx, 1 g/(kg∙d) TE SNx, 92 mg/(kg∙d) AE SNx, and 46 mg/(kg∙d) AE SNx. Renal injury was monitored using urine and serum analyses, and hematoxylin and eosin (HE) and periodic acid-Schiff (PAS) stainings were used to analyze the level of fibrosis. The expression of type IV collagen (Col IV), fibronectin (FN), transforming growth factor-β1 (TGF-β1), and connective tissue growth factor (CTGF) was detected by immunohistochemistry. Results: Renal injury, reflected in urine and serum analyses, and pathological changes induced by SNx were attenuated by TE and AE intervention. The depositions of Col IV and FN were also decreased by the treatments and were accompanied by reduced expression of TGF-β1 and CTGF. In some respects, 2 g/(kg∙d) of TE produced better effects than Cozaar. Conclusions: For the first time, we have shown that C. cicadae may inhibit renal fibrosis in vivo through the TGF-β1/CTGF pathway. Therefore, we conclude that the use of C. cicadae could provide a rational strategy for combating renal fibrosis. PMID:22135152

Rhodiola crenulata- and Cordyceps sinensis-based supplement boosts aerobic exercise performance after short-term high altitude training.

PubMed

Chen, Chung-Yu; Hou, Chien-Wen; Bernard, Jeffrey R; Chen, Chiu-Chou; Hung, Ta-Cheng; Cheng, Lu-Ling; Liao, Yi-Hung; Kuo, Chia-Hua

2014-09-01

High altitude training is a widely used strategy for improving aerobic exercise performance. Both Rhodiola crenulata (R) and Cordyceps sinensis (C) supplements have been reported to improve exercise performance. However, it is not clear whether the provision of R and C during high altitude training could further enhance aerobic endurance capacity. In this study, we examined the effect of R and C based supplementation on aerobic exercise capacity following 2-week high altitude training. Alterations to autonomic nervous system activity, circulatory hormonal, and hematological profiles were investigated. Eighteen male subjects were divided into two groups: Placebo (n=9) and R/C supplementation (RC, n=9). Both groups received either RC (R: 1400 mg+C: 600 mg per day) or the placebo during a 2-week training period at an altitude of 2200 m. After 2 weeks of altitude training, compared with Placebo group, the exhaustive run time was markedly longer (Placebo: +2.2% vs. RC: +5.7%; p<0.05) and the decline of parasympathetic (PNS) activity was significantly prevented in RC group (Placebo: -51% vs. RC: -41%; p<0.05). Red blood cell, hematocrit, and hemoglobin levels were elevated in both groups to a comparable extent after high altitude training (p<0.05), whereas the erythropoietin (EPO) level remained higher in the Placebo group (∼48% above RC values; p<0.05). The provision of an RC supplement during altitude training provides greater training benefits in improving aerobic performance. This beneficial effect of RC treatment may result from better maintenance of PNS activity and accelerated physiological adaptations during high altitude training.

Identification of chemical markers in Cordyceps sinensis by HPLC-MS/MS.

PubMed

Hu, Hankun; Xiao, Ling; Zheng, Baogen; Wei, Xin; Ellis, Alexis; Liu, Yi-Ming

2015-10-01

Authentication and quality assessment of Cordyceps sinensis, a precious and pricey natural product that offers a variety of health benefits, is highly significant. To identify effective chemical markers, authentic C. sinensis was thoroughly screened by using HPLC-MS/MS. In addition to many previously reported ingredients, two glycosides, i.e., cyclo-Ala-Leu-rhamnose and Phe-o-glucose, were detected for the first time in this material. Six ingredients detected, including cordycepin, D-mannitol, Phe, Phe-o-glucose, cyclo-Gly-Pro, and cyclo-Ala-Leu-rhamnose, were selected as a collection of chemical markers. An HPLC-MS/MS method was developed to simultaneously quantify them with sensitivity and specificity. The method had limits of detection ranging from 0.008 μg mL(-1) for cordycepin to 0.75 μg mL(-1) for cyclo-Gly-Pro. Recovery was found between 96 and 103 % in all tests. To evaluate the effectiveness of the marker collection proposed, five authentic C. sinensis samples and five samples of its substitutes were analyzed. Cordycepin, D-mannitol, and Phe were found present in all samples. The contents ranged from 0.0076 to 0.029 % (w/w) for cordycepin, 0.33 to 18.9 % for mannitol, and 0.0013 to 0.642 % for Phe. Interestingly, the two glycosides, Phe-o-glucose and cyclo-Ala-Leu-rhamnose, were detected only in authentic C. sinensis samples. These results indicated that the proposed protocol based on HPLC-MS/MS quantification of the markers might have a great potential in authentication and quality assessment of C. sinensis. Graphical abstract Chemical markers of C. sinensis identified in this work.

Cordyceps sinensis extract suppresses hypoxia-induced proliferation of rat pulmonary artery smooth muscle cells.

PubMed

Gao, Bao-an; Yang, Jun; Huang, Ji; Cui, Xiang-jun; Chen, Shi-xiong; Den, Hong-yan; Xiang, Guang-ming

2010-09-01

To investigate the effects of a Chinese herb Cordyceps sinensis (C. sinensis) extract on hypoxia-induced proliferation and the underlying mechanisms involved. This prospective study was carried out at the Central Laboratory of Yichang Central People's Hospital, Yichang, China from March 2008 to April 2010. The C. sinensis was extracted from the Chinese herb C. sinensis using aqueous alcohol extraction techniques. Forty healthy adult male Sprague Dawley rats were used in the study. The proliferation of pulmonary artery smooth muscle cells (PASMCs) was measured using 3-(4,5-dimethylthiazol-2-Yl)-2,5-diphenyltetrazolium bromide (MTT) assay, and cell viability was determined by trypan blue exclusion. Cell cycles were analyzed using FACSort flow cytometric analysis. The expression of proliferating cell nuclear antigen (PCNA), c-jun, and c-fos in rat PASMCs was determined by immunohistochemistry. We found an increased proliferation of PASMCs and increased expression of transcription factors, c-jun and c-fos in PASMCs cultured under hypoxic conditions. The C. sinensis extract significantly inhibited hypoxia-induced cell proliferation in a dose-dependent manner. In addition, C. sinensis extract also significantly inhibited the expression of PCNA, c-jun, and c-fos in these PASMCs. Our results indicated that C. sinensis extract inhibits hypoxia-induced proliferation of rat PASMCs, probably by suppressing the expression of PCNA, c-fos, c-jun, and decreasing the percentage of cells in synthesis phase, second gap phase, and mitotic phase in cell cycle (S+G2/M) phase. Our results therefore, provided novel evidence that C. sinensis extract may be used as a therapeutic reagent in the treatment of hypoxic pulmonary hypertension.

The Herbal Medicine Cordyceps sinensis Protects Pancreatic Beta Cells from Streptozotocin-Induced Endoplasmic Reticulum Stress.

PubMed

Liu, Hong; Cao, Diyong; Liu, Hua; Liu, Xinghai; Mai, Wenli; Lan, Haitao; Huo, Wen; Zheng, Qian

2016-08-01

Our previous work found that Cordyceps sinensis (CS) improves the activity and secretory function of pancreatic islet beta cells. The objective was to observe a further possible role of CS in the protection of insulin-secreting cells. A rat model of type 2 diabetes mellitus was developed with streptozotocin (STZ) and a high-energy fat diet (HFD). CS was administered in the successful model of rats with type 2 diabetes. After 4 weeks, the biochemistry index of blood samples was measured, and pathologic observation was performed by immunohistochemistry. In the rats with type 2 diabetes induced by a HFD and STZ, the levels of fasting blood glucose and fasting insulin were elevated, and the insulin sensitivity index was decreased. Pathologic examination found an increased number of apoptotic cells, an elevated protein expression of pro-apoptotic C/EBP homologous protein (CHOP) and an increased c-Jun level by means of JNK phosphorylation, responsive to the endoplasmic reticulum stress of islet beta cells. With treatment by CS for 4 weeks, the elevated levels of both fasting blood glucose and fasting insulin in the rats with type 2 diabetes were significantly lower, and the decreased insulin sensitivity index was reversed. Compared to the control rats with type 2 diabetes, CS application significantly reduced the number of apoptotic cells and decreased protein expression of both CHOP and c-Jun. The herbal compound CS could protect pancreatic beta cells from the pro-apoptotic endoplasmic reticulum stress induced by HFD-STZ. This suggests an alternative approach to treating type 2 diabetes. Copyright © 2016 Canadian Diabetes Association. Published by Elsevier Inc. All rights reserved.

1H NMR spectroscopy analysis of metabolites in the kidneys provides new insight into pathophysiological mechanisms: applications for treatment with Cordyceps sinensis.

PubMed

Zhong, Fang; Liu, Xia; Zhou, Qiao; Hao, Xu; Lu, Ying; Guo, Shanmai; Wang, Weiming; Lin, Donghai; Chen, Nan

2012-02-01

The number of patients with chronic kidney disease (CKD) is continuously growing worldwide. Treatment with traditional Chinese medicine might slow the progression of CKD. In this study, we evaluated the renal protective effects of the Chinese herb Cordyceps sinensis in rats with 5/6 nephrectomy. Male Sprague-Dawley mice (weighing 150-200 g) were subjected to 5/6 nephrectomy. The rats were divided into three groups: (i) untreated nephrectomized group (OP group, n = 16), (ii) oral administration of C. sinensis-treated (4 mg/kg/day) nephrectomized group (CS group, n = 16) and (iii) sham-operated group (SO group, n = 16). The rats were sacrificed at 4 and 8 weeks after 5/6 nephrectomy, and the kidneys, serum and urine were collected for (1)H nuclear magnetic resonance spectral analysis. Multivariate statistical techniques and statistical metabolic correlation comparison analysis were performed to identify metabolic changes in aqueous kidney extracts between these groups. Significant differences between these groups were discovered in the metabolic profiles of the biofluids and kidney extracts. Pathways including the citrate cycle, branched-chain amino acid metabolism and the metabolites that regulate permeate pressure were disturbed in the OP group compared to the SO group; in addition, these pathways were reversed by C. sinensis treatment. Biochemistry and electron microscopic images verified that C. sinensis has curative effects on chronic renal failure. These results were confirmed by metabonomics results. Our study demonstrates that C. sinensis has potential curative effects on CKD, and our metabonomics results provided new insight into the mechanism of treatment of this traditional Chinese medicine.

Anti-cancer effects of CME-1, a novel polysaccharide, purified from the mycelia of Cordyceps sinensis against B16-F10 melanoma cells.

PubMed

Jayakumar, Thanasekaran; Chiu, Chong-Chi; Wang, Shwu-Huey; Chou, Duen-Suey; Huang, Yung-Kai; Sheu, Joen-Rong

2014-01-01

Matrix metalloproteinases (MMPs) play important roles in the invasion and migration of cancer cells. In melanoma, several signaling pathways are constitutively activated. Among these, the mitogen-activated protein kinase (MAPKs) signaling pathways are activated through multiple signal transduction molecules and appear to play major roles in melanoma progression. Therefore, the inhibition of MAPK signaling might be a crucial role for the treatment of melanoma cancer. We examined the anticancer effect of CME-1, a novel water-soluble polysaccharide fraction, isolated from Cordyceps sinensis mycelia on B16-F10 melanoma cells. B16-F10 cells were exposed to different concentrations of CME-1 (250, 500 and 800 μg/ml) for 24 h in 5% CO² incubator at 37°C. Western blot analysis was performed to detect the expression of MMP-1, p-p38 MAPK, p-ERK1/2, and IkB-α in B16-F10 cells. Cell migration test was performed by wound healing migration assay. CME-1 suppresses cell migration in a concentration-dependent manner. Western blotting analysis revealed that CME-1 led to the reduction on the expression levels of MMP-1 and down regulated the expression of phosphorylated extracellular signal-regulated kinase (ERK1/2 and p38 mitogen-activated protein kinase (p38 MAPK). CME-1 restored the IkB-degradation in B16F10 cells. These results indicate that CME-1 inhibited MMP-1 expressions in B16F10 melanoma cells through either NF-kB or ERK/p38 MAPK down regulation thereby inhibiting B16F10 cell migration. Therefore, we proposed that CME-1 might be developed as a therapeutic potential candidate for the treatment of cancer metastasis.

Isolation and characterization of an ether-type polyurethane-degrading micro-organism and analysis of degradation mechanism by Alternaria sp.

PubMed

Matsumiya, Y; Murata, N; Tanabe, E; Kubota, K; Kubo, M

2010-06-01

To degrade ether-type polyurethane (ether-PUR), ether-PUR-degrading micro-organism was isolated. Moreover, ether-PUR-degrading mechanisms were analysed using model compounds of ether-PUR. A fungus designated as strain PURDK2, capable of changing the configuration of ether-PUR, has been isolated. This isolated fungus was identified as Alternaria sp. Using a scanning electron microscope, the grid structure of ether-PUR was shown to be melted and disrupted by the fungus. The degradation of ether-PUR by the fungus was analysed, and the ether-PUR was degraded by the fungus by about 27.5%. To analyse the urethane-bond degradation by the fungus, a degraded product of ethylphenylcarbamate was analysed using GC/MS. Aniline and ethanol were detected by degradation with the supernatant, indicating that the fungus secreted urethane-bond-degrading enzyme(s). PURDK2 also degraded urea bonds when diphenylmethane-4,4'-dibutylurea was used as a substrate. The enzyme(s) from PURDK2 degraded urethane and urea bonds to convert the high molecular weight structure of ether-PUR to small molecules; and then the fungus seems to use the small molecules as an energy source. Ether-PUR-degrading fungus, strain PURDK2, was isolated, and the urethane- and urea-bonds-degrading enzymes from strain PURDK2 could contribute to the material recycling of ether-PUR.

Histoplasmosis

MedlinePlus

... by the fungus Histoplasma. The fungus lives in soil. You get the infection by breathing in spores ... construction, gardening, or any activity that disturbs the soil can release fungus spores into the air. If ...

Blastomycosis

MedlinePlus

... dermatitidis fungus. The fungus is found in decaying wood and soil. Causes You can get blastomycosis by ... moist soil, most commonly where there is rotting wood and leaves. The fungus enters the body through ...

Scanning electron microscopy of Ancylostoma spp. dog infective larvae captured and destroyed by the nematophagous fungus Duddingtonia flagrans.

PubMed

Maciel, A S; Araújo, J V; Campos, A K; Benjamin, L A; Freitas, L G

2009-06-01

The interaction between the nematode-trapping fungus Duddingtonia flagrans (isolate CG768) against Ancylostoma spp. dog infective larvae (L(3)) was evaluated by means of scanning electron microscopy. Adhesive network trap formation was observed 6h after the beginning of the interaction, and the capture of Ancylostoma spp. L(3) was observed 8h after the inoculation these larvae on the cellulose membranes colonized by the fungus. Scanning electron micrographs were taken at 0, 12, 24, 36 and 48 h, where 0 is the time when Ancylostoma spp. L(3) was first captured by the fungus. Details of the capture structure formed by the fungus were described. Nematophagous Fungus Helper Bacteria (NHB) were found at interactions points between the D. flagrans and Ancylostoma spp. L(3). The cuticle penetration by the differentiated fungal hyphae with the exit of nematode internal contents was observed 36 h after the capture. Ancylostoma spp. L(3) were completely destroyed after 48 h of interaction with the fungus. The scanning electron microscopy technique was efficient on the study of this interaction, showing that the nematode-trapping fungus D. flagrans (isolate CG768) is a potential exterminator of Ancylostoma spp. L(3).

Growth inhibition of an Araucaria angustifolia (Coniferopsida) fungal seed pathogen, Neofusicoccum parvum, by soil streptomycetes

PubMed Central

2013-01-01

Background Araucariaceae are important forest trees of the southern hemisphere. Life expectancy of their seedlings can largely be reduced by fungal infections. In this study we have isolated and characterized such a fungus and investigated the potential of Streptomyces Actinobacteria from the respective rhizosphere to act as antagonists. Results The pathogenic fungus from Araucaria angustifolia seeds was identified by morphological markers (pore-associated Woronin-bodies) as belonging to the Pezizomycotina. Molecular data identified the fungus as Neofusicoccum parvum (Botryosphaeriaceae). Co-cultures on agar of this fungus with certain streptomycete isolates from the rhizosphere, and from the surface of Araucaria roots significantly reduced the growth of the fungus. HPLC analysis of the agar yielded streptomycete-specific exudate compounds which were partly identified. There were differences in compounds between single (bacteria, fungus) and dual cultures (bacteria + fungus). Conclusion Streptomycetes from the rhizosphere of Araucariaceae produce exudates which can suppress the development of pathogenic fungi in their seeds. PMID:23866024

Caecomyces sympodialis sp. nov., a new rumen fungus isolated from Bos indicus.

PubMed

Chen, Yo-Chia; Tsai, Sheng-Da; Cheng, Hsueh-Ling; Chien, Chiu-Yuan; Hu, Chun-Yi; Cheng, Tai-Yi

2007-01-01

A new anaerobic rumen fungus was isolated from the rumen fluid of a yellow cow (Bos indicus). This fungus appears to be a previously undescribed species of the genus Caecomyces, it possessing uniflagellate zoospores, a spherical holdfast, tubular sporangiophores and bulbous rhizoids. This new fungus also features distinctive multisporangiate thallus sympodially distributed on sporangiophores. The fungus resembles Caecomyces communis and C. equi in that it characterizes bulbous rhizoids and uniflagellate zoospores but differs from C. communis and C. equi in that it possesses multisporangiate and sympodial sporangia. This new fungus and Cyllamyces aberensis both reveal similar morphology during early thallus development in having a spherical holdfast, but they vary from unbranched sporangiophores and additional bulbous rhizoids. In addition, the molecular phylogenetic analyses ITS1 (internal transcribed spacer 1) also conform to the results of the morphological examinations of Caecomyces. For the mentioned reasons, this new species of fungus is described as Caecomyces sympodialis sp. nov. The genera of Neocallimasticaceae and species of Caecomyces are also keyed out.

Carbon dioxide sensing in an obligate insect-fungus symbiosis: CO2 preferences of leaf-cutting ants to rear their mutualistic fungus.

PubMed

Römer, Daniela; Bollazzi, Martin; Roces, Flavio

2017-01-01

Defense against biotic or abiotic stresses is one of the benefits of living in symbiosis. Leaf-cutting ants, which live in an obligate mutualism with a fungus, attenuate thermal and desiccation stress of their partner through behavioral responses, by choosing suitable places for fungus-rearing across the soil profile. The underground environment also presents hypoxic (low oxygen) and hypercapnic (high carbon dioxide) conditions, which can negatively influence the symbiont. Here, we investigated whether workers of the leaf-cutting ant Acromyrmex lundii use the CO2 concentration as an orientation cue when selecting a place to locate their fungus garden, and whether they show preferences for specific CO2 concentrations. We also evaluated whether levels preferred by workers for fungus-rearing differ from those selected for themselves. In the laboratory, CO2 preferences were assessed in binary choices between chambers with different CO2 concentrations, by quantifying number of workers in each chamber and amount of relocated fungus. Leaf-cutting ants used the CO2 concentration as a spatial cue when selecting places for fungus-rearing. A. lundii preferred intermediate CO2 levels, between 1 and 3%, as they would encounter at soil depths where their nest chambers are located. In addition, workers avoided both atmospheric and high CO2 levels as they would occur outside the nest and at deeper soil layers, respectively. In order to prevent fungus desiccation, however, workers relocated fungus to high CO2 levels, which were otherwise avoided. Workers' CO2 preferences for themselves showed no clear-cut pattern. We suggest that workers avoid both atmospheric and high CO2 concentrations not because they are detrimental for themselves, but because of their consequences for the symbiotic partner. Whether the preferred CO2 concentrations are beneficial for symbiont growth remains to be investigated, as well as whether the observed preferences for fungus-rearing influences the ants' decisions where to excavate new chambers across the soil profile.

Biological control of horse cyathostomin (Nematoda: Cyathostominae) using the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

PubMed

Braga, Fabio Ribeiro; Araújo, Jackson Victor; Silva, André Ricardo; Araujo, Juliana Milani; Carvalho, Rogério Oliva; Tavela, Alexandre Oliveira; Campos, Artur Kanadani; Carvalho, Giovanni Ribeiro

2009-08-26

The viability of a fungal formulation using the nematode-trapping fungus Duddingtonia flagrans was assessed for the biological control of horse cyathostomin. Two groups (fungus-treated and control without fungus treatment), consisting of eight crossbred mares (3-18 years of age) were fed on Cynodon sp. pasture naturally infected with equine cyathostome larvae. Each animal of the treated group received oral doses of sodium alginate mycelial pellets (1g/(10 kg live weight week)), during 6 months. Significant reduction (p<0.01) in the number of eggs per gram of feces and coprocultures was found for animals of the fungus-treated group compared with the control group. There was difference (p<0.01) of 78.5% reduction in herbage samples collected up to (0-20 cm) between the fungus-treated group and the control group, during the experimental period (May-October). Difference of 82.5% (p<0.01) was found between the fungus-treated group and the control group in the sampling distance (20-40 cm) from fecal pats. During the last 3 months of the experimental period (August, September and October), fungus-treated mares had significant weight gain (p<0.01) compared with the control group, an increment of 38 kg. The treatment with sodium alginate pellets containing the nematode-trapping fungus D. flagrans reduced cyathostomin in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in horses.

The status of the fungi-grower ants (Hymenoptera: Formicidae) in Puerto Rico and adjacent islands

Treesearch

J.A. Torres

1989-01-01

Ants of the tribe Attini (fungus grower) collect different organic materials that are used to grow a fungus. It was thought that the fungus mycelium was the only source of nutrition for these ants, but Quinlan and Cherrett found that Atta cephalotes (L.) squeezes oils from fresh leaves and uses them as food.  These oils supplement the fungus material eaten by this...

Rust-red stringy white rot: The Indian paint fungus, Echinodontium tinctorium

Treesearch

A. D. Wilson

1997-01-01

Older trees are more susceptible to damage by this fungus, although even very young trees are susceptible to infection. Infections occur most frequently in dense stands where selfpruning creates infection courts for the fungus.

Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies.

PubMed

Cloyd, Raymond A

2015-04-09

Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems.

Sequential batch culture studies for the decolorisation of reactive dye by Coriolus versicolor.

PubMed

Sanghi, Rashmi; Dixit, Awantika; Guha, Sauymen

2006-02-01

The white rot fungus Coriolus versicolor could decolorise reactive dye Remazol Brilliant Violet to almost 90%. The fungal mycelia removed color as well as COD up to 95% and 75%, respectively, in a batch reactor. Decolorising activity was observed during the repeated reuse of the fungus. It was possible to substantially increase the dye decolorising activity of the fungus by carefully selecting the operational conditions such as media composition, age of fungus and nitrogen source. The fungal pellets could be used for eight cycles during the long term operation, where medium and dye was replenished at the end of each cycle and the fungus was recycled. Presence of a nitrogen source and nutrient content of media played an important role in sustaining the decolorisation activity of the fungus. The form of nitrogen source (e.g. peptone vs. urea) was also important to maintain the decolorising activity with peptone showing better decolorisation.

Oligocene Termite Nests with In Situ Fungus Gardens from the Rukwa Rift Basin, Tanzania, Support a Paleogene African Origin for Insect Agriculture

PubMed Central

Roberts, Eric M.; Todd, Christopher N.; Aanen, Duur K.; Nobre, Tânia; Hilbert-Wolf, Hannah L.; O’Connor, Patrick M.; Tapanila, Leif; Mtelela, Cassy; Stevens, Nancy J.

2016-01-01

Based on molecular dating, the origin of insect agriculture is hypothesized to have taken place independently in three clades of fungus-farming insects: the termites, ants or ambrosia beetles during the Paleogene (66–24 Ma). Yet, definitive fossil evidence of fungus-growing behavior has been elusive, with no unequivocal records prior to the late Miocene (7–10 Ma). Here we report fossil evidence of insect agriculture in the form of fossil fungus gardens, preserved within 25 Ma termite nests from southwestern Tanzania. Using these well-dated fossil fungus gardens, we have recalibrated molecular divergence estimates for the origins of termite agriculture to around 31 Ma, lending support to hypotheses suggesting an African Paleogene origin for termite-fungus symbiosis; perhaps coinciding with rift initiation and changes in the African landscape. PMID:27333288

Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies

PubMed Central

Cloyd, Raymond A.

2015-01-01

Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems. PMID:26463188

Noninvasive medical management of fungus ball uropathy in a premature infant.

PubMed

Alkalay, A L; Srugo, I; Blifeld, C; Komaiko, M S; Pomerance, J J

1991-09-01

Unilateral renal obstruction secondary to fungus balls is described in a premature infant. Noninvasive medical management, which included amphotericin B and 5-flucytosine therapy and forced diuresis, resulted in disappearance of fungus balls and resolution of the obstruction.

THE ROLE OF PREDISPOSING FACTORS IN EXPERIMENTAL FUNGUS INFECTIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheldon, W.H.; Bauer, H.

Among other factors, the influence of ionizing radiations on susceptibility to fungus diseases is reviewed. X irradiation singly or in combination with cortisone administration has been employed in the study of experimental fungus diseases, and it has been shown that total-body radiation enhaaced infection with Candida albicans, Blastomyces dermatididis, and Cryptococcus neoformans in mice. Enhanced susceptibility to fungus infections following radiation therapy has also been reported, the mechanism resulting in lowered host resistance being presumably the same as in other infections. (BBB)

Exploring the potential for actinobacteria as defensive symbionts in fungus-growing termites.

PubMed

Visser, Anna A; Nobre, Tânia; Currie, Cameron R; Aanen, Duur K; Poulsen, Michael

2012-05-01

In fungus-growing termites, fungi of the subgenus Pseudoxylaria threaten colony health through substrate competition with the termite fungus (Termitomyces). The potential mechanisms with which termites suppress Pseudoxylaria have remained unknown. Here we explore if Actinobacteria potentially play a role as defensive symbionts against Pseudoxylaria in fungus-growing termites. We sampled for Actinobacteria from 30 fungus-growing termite colonies, spanning the three main termite genera and two geographically distant sites. Our isolations yielded 360 Actinobacteria, from which we selected subsets for morphological (288 isolates, grouped in 44 morphotypes) and for 16S rRNA (35 isolates, spanning the majority of morphotypes) characterisation. Actinobacteria were found throughout all sampled nests and colony parts and, phylogenetically, they are interspersed with Actinobacteria from origins other than fungus-growing termites, indicating lack of specificity. Antibiotic-activity screening of 288 isolates against the fungal cultivar and competitor revealed that most of the Actinobacteria-produced molecules with antifungal activity. A more detailed bioassay on 53 isolates, to test the specificity of antibiotics, showed that many Actinobacteria inhibit both Pseudoxylaria and Termitomyces, and that the cultivar fungus generally is more susceptible to inhibition than the competitor. This suggests that either defensive symbionts are not present in the system or that they, if present, represent a subset of the community isolated. If so, the antibiotics must be used in a targeted fashion, being applied to specific areas by the termites. We describe the first discovery of an assembly of antibiotic-producing Actinobacteria occurring in fungus-growing termite nests. However, due to the diversity found, and the lack of both phylogenetic and bioactivity specificity, further work is necessary for a better understanding of the putative role of antibiotic-producing bacteria in the fungus-growing termite mutualistic system.

Biological activities of ophiobolin K and 6-epi-ophiobolin K produced by the endophytic fungus Aspergillus calidoustus

USDA-ARS?s Scientific Manuscript database

The endophytic fungus, Aspergillus calidoustus, was isolated from the plant species Acanthospermum australe (Asteraceae). A dichloromethane extract of the fungus displayed antifungal, antiprotozoal, and cytotoxic activities. Aspergillus calidoustus was identified using molecular, physiological and m...

Effects of Some Pesticides on the Growth of ARF18 and Its Pathogenicity to Heterodera glycines

PubMed Central

Kim, D. G.; Riggs, R. D.

1998-01-01

The effects of 22 pesticides on the mycelial growth and pathogenicity of the biocontrol fungus ARFI8 to Heterodera glycines were tested in vitro. The chemicals were added to agar at 10, 100, and 1,000 ppm a.i.; a block of agar containing the fungus was added to each test concentration; and fungal growth was measured. Subsequently, a block of the fungus on the pesticide-containing agar was used to determine the ability of the fungus to parasitize eggs of H. glycines. Aldicarb, bentazone, and chlorothalonil had little or no effect on fungal growth, whereas benomyl and thiophanate methyl completely inhibited growth of the fungus at 10 ppm. The relative insensitivity of ARF18 to certain pesticides would permit selected use of those pesticides with ARF18 in an integrated control program if the effects on the fungus in the field are similar to results from petri dish studies. PMID:19274211

Performance of Metarhizium anisopliae-treated foam in combination with Phytoseiulus longipes Evans on Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae).

PubMed

Azandémè Hounmalon, Ginette Y; Maniania, Nguya K; Niassy, Saliou; Fellous, Simon; Kreiter, Serge; Delétré, Emilie; Fiaboe, Komi K; Martin, Thibaud

2018-05-13

Tetranychus evansi (Te) is an exotic pest of solanaceous crops in Africa. The predatory mite Phytoseiulus longipes (Pl) and the fungus Metarhizium anisopliae (Ma), are potential biocontrol agents of Te. The present study investigated efficacy of fungus-treated foam placed above or below the third Te-infested tomato leaf. The persistence of fungus-treated foam and the performance of Pl with or without fungus-treated foam were evaluated. The fungus-treated foam was effective when Te infestation was below the third tomato leaf as no damage was recorded on all upper tomato leaves up to 30 days post-treatment. However, in the control treatments, the infestation increased considerably from 9±0.3% to 100±0% at 15 days post-treatment. The reuse of the fungus-treated foam at 15, 30 and 45 days post-treatment resulted in 19±1.4%, 25±1.2% and 54±2.1% respective infestation by Te. The fungus-treated foam and Pl alone are efficient, but there is no benefit to combinting both against Te. The fungus-treated foam is an effective method to optimize the use of Ma in screenhouse conditions. These two control agents could be integrated in an IPM strategy for crops protection. However, these results need to be confirmed in large field trials. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Microsatellite variability in the entomopathogenic fungus Paeciolomyces fumosoroseus: genetic diversity and population structure

USDA-ARS?s Scientific Manuscript database

The hyphomycete Paecilomyces fumosoroseus (Pfr) is a geographically widespread fungus capable of infecting various insect hosts. The fungus has been used for the biological control of several important insect pests of agriculture. However knowledge of the fungus’ genetic diversity and population str...

Metacridamides A and B from the biocontrol fungus metarhizium acridum

USDA-ARS?s Scientific Manuscript database

Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola

USDA-ARS?s Scientific Manuscript database

The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers’ symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop ...

Speciation despite globally overlapping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming’s lucky fungus

USDA-ARS?s Scientific Manuscript database

Eighty years ago, Alexander Fleming described the antibiotic effects of a fungus that had contaminated his bacterial culture, kick starting the antimicrobial revolution. The fungus was later ascribed to a globally distributed asexual species, Penicillium chrysogenum. Recently, the species has been...

Mating and Progeny Isolation in The Corn Smut Fungus Ustilago maydis

USDA-ARS?s Scientific Manuscript database

The corn smut pathogen, Ustilago maydis (U. maydis) (DC.) Corda, is a semi-obligate plant pathogenic fungus in the phylum Basidiomycota (Alexopoulos, Mims and Blackwell, 1996). The fungus can be easily cultured in its haploid yeast phase on common laboratory media. However, to complete its sexual cy...

Chronicles of Fibroporia radiculosa (= Antrodia radiculosa) TFFH 294

Treesearch

Carol A. Clausen; Katie M. Jenkins

2011-01-01

The brown-rot fungus, Fibroporia radiculosa, has been included in numerous research studies because many isolates of this fungus demonstrate an unusually high tolerance to copper. This fungus has undergone several recognized changes in taxonomic nomenclature, and through DNA technology, scientists have correctly identified isolates that had been misidentified...

Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus

Treesearch

Bryn H. Daisy; Gary A. Strobel; Uvidelio Castillo; David Ezra; Joe Sears; David K. Weaver; Justin B. Runyon

2002-01-01

Muscodor vitigenus is a recently described endophytic fungus of Paullinia paullinioides, a liana growing in the understorey of the rainforests of the Peruvian Amazon. This fungus produces naphthalene under certain cultural conditions. Naphthalene produced by M. vitigenus was identified by gas chromatography/mass...

Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci.

PubMed

Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm

2015-09-01

A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.

Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants.

PubMed

Ruiz-González, Mario X; Malé, Pierre-Jean G; Leroy, Céline; Dejean, Alain; Gryta, Hervé; Jargeat, Patricia; Quilichini, Angélique; Orivel, Jérôme

2011-06-23

Ant-fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant-fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries.

Pathogenic nature of Syncephalastrum in Atta sexdens rubropilosa fungus gardens.

PubMed

Barcoto, Mariana O; Pedrosa, Felipe; Bueno, Odair C; Rodrigues, Andre

2017-05-01

Leaf-cutter ants are considered to be a major herbivore and agricultural pest in the Neotropics. They are often controlled by environmentally persistent insecticides. Biological control using pathogenic fungi is regarded as an alternative for the management of these insects. Here, we assess whether the filamentous fungus Syncephalastrum sp. is a pathogenic microorganism responsible for a characteristic disease in fungus gardens. We also characterise the damage caused by this fungus by evaluating physiological and behavioural responses of Atta sexdens rubropilosa subcolonies infected with Syncephalastrum sp. Syncephalastrum sp. fulfils Koch's postulates characterising it as a pathogenic microorganism. Ant workers recognise the infection and remove contaminated fragments from the fungus garden. Syncephalastrum sp. infection causes an interruption of foraging activity, an increase in ant mortality, subcolony deterioration and an increase in the amount of waste generated, all resulting in subcolony death. Syncephalastrum sp. also inhibits the ant fungal cultivar in vitro. The pathogenic effect of Syncephalastrum sp. does not depend on host morbidity or stress (e.g. worker mortality caused by an entomopathogenic fungus). Syncephalastrum sp. treatment resulted in progressive damage in subcolonies. The interactions among Syncephalastrum sp., fungus garden and ants offer new opportunities in integrated pest management of leaf-cutter ants. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Biological control of cyathostomin (Nematoda: Cyathostominae) with nematophagous fungus Monacrosporium thaumasium in tropical southeastern Brazil.

PubMed

Tavela, Alexandre de Oliveira; Araújo, Jackson Victor; Braga, Fábio Ribeiro; Silva, André Ricardo; Carvalho, Rogério Oliva; Araujo, Juliana Milani; Ferreira, Sebastião Rodrigo; Carvalho, Giovanni Ribeiro

2011-01-10

Horses are hosts to a wide variety of helminthes; the most important are the cyathostomin, or small strongyles. The viability of a fungal formulation (pellets) using the nematode-trapping fungus Monacrosporium thaumasium was assessed in biological control of horse cyathostomin. Two groups (fungus-treated and control) consisted of six mares in each group, crossbred (ages of 2.5 and 3.5 years), were placed in pastures of Cynodon sp. naturally infected with horse cyathostomin larvae. In the treated group, each animal received 1g/10 kg body weight (0.2g/10 kg live weight of fungus) of pellets of sodium alginate matrix containing the fungus M. thaumasium orally, twice a week for 6 months. In the control group, animals received (1g/10 kg body weight) of pellets without fungus. The egg count per gram of feces showed difference (p<0.01) in the animals treated with the fungus in relation to the control animals during all months of the experiment. The EPG percentage decrease were 87.5%, 89.7%, 68.3%, 58.7%, 52.5% and 35.2% during June, July, August, September, October and November, respectively. In faecal cultures, there was difference (p<0.05) among animals treated with fungus was found in relation to the control animals during all the experiment month, with percentage reduction of 67.5%, 61.4% and 31.8% in September, October and November, respectively. Difference (p<0.01) was observed in the recovery of infective larvae from pastures that were collected up to 20 cm from the dung pats in pastures in the group treated with the fungus in relation to the control group with a reduction of 60.9% and between 0-20 and 0-40 cm from the faecal pat reduction (p<0.01) was about 56% in the group treated with the fungus M. thaumasium in relation to the control group pasture. There was no difference (p>0.05) between the average weight gains in both animal groups. The treatment of horses with pellets containing the nematophagous fungus M. thaumasium can be effective in controlling cyathostomin in the tropical region of southeastern Brazil. Copyright © 2010 Elsevier B.V. All rights reserved.

Biochemical Characterization of Fungus Isolated during In vitro Propagation of Bambusa balcooa.

PubMed

Tyagi, Bhawna; Tewari, Salil; Dubey, Ashutosh

2018-01-01

Bambusa balcooa ( Poaceae: Bambusoideae ) is a multipurpose bamboo species, which is native of the Indian subcontinent. B. balcooa is regarded as one of the best species for scaffolding and building purposes because of its strong culm. Other uses include paper pulp, handicrafts, and products of the wood chip industry. Due to these various uses in industries, this species has been identified as one of the priority bamboos by the National Bamboo Mission. This study is designed to analyze the identification of fungus and develop the strategy to eliminate the contamination during in vitro establishment of B. balcooa through nodal part. Fungus contamination is a problem which is encountered during in vitro establishment of B. balcooa cultures. In the present study, fungus contamination from in vitro cultured plant has been isolated and subjected to partial sequence analysis of the 18S rRNA gene to identify the fungus strain. Experiments were designed to develop a strategy for removal of the fungus contamination with the help of antifungal compounds and commercial antimicrobial supplement supplied by HiMedia. Fusarium equiseti was identified as endophytic fungus. It was observed that antimicrobial supplement at concentration of 500 μl/l was more effective concentration to remove fungus contamination and not showed any detrimental effect on growth parameters of shoot. This experiment would help in identification and to get rid of fungal contamination and improve the in vitro establishment of B. balcooa cultures for large-scale propagation. Endogenous fungus was isolated from contaminated culture of B. balcooa , and it was identified as Fusarium equiseti and submitted to NCBI under accession no. KP274872. The endophytic fungus had shown substantial production of amylase, cellulase, and protease media. Gibberellic acid (GA 3 ) production by F. equiseti was maximum on the 7 th day on inoculation. Abbreviations used: B. balcooa : Bambusa balcooa , F. equiseti : Fusarium equiseti , PDA: Potato dextrose agar, PCR: Polymerase chain reaction, MS: Murashige and Skoog's, BAP: 6-Benzylaminopurine, ITS1/4: Internal transcribed spacer region 1/4, GA 3 : Gibberellic acid.

Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae)

PubMed Central

2014-01-01

Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month. PMID:24766705

Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae).

PubMed

Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I

2014-04-25

Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month.

Leaf-Cutter Ant Fungus Gardens Are Biphasic Mixed Microbial Bioreactors That Convert Plant Biomass to Polyols with Biotechnological Applications

PubMed Central

Somera, Alexandre F.; Lima, Adriel M.; dos Santos-Neto, Álvaro J.; Lanças, Fernando M.

2015-01-01

Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. PMID:25911490

Leaf-cutter ant fungus gardens are biphasic mixed microbial bioreactors that convert plant biomass to polyols with biotechnological applications.

PubMed

Somera, Alexandre F; Lima, Adriel M; Dos Santos-Neto, Álvaro J; Lanças, Fernando M; Bacci, Maurício

2015-07-01

Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Phomalactone from a phytopathogenic fungus infecting Zinnia elegans (Asteraceae) leaves

USDA-ARS?s Scientific Manuscript database

Zinnia elegans plants are infected by a fungus that causes necrosis with dark red spots particularly in late spring to the middle of summer in the Mid-South part of the United States. This fungal disease when untreated causes the leaves to wilt and eventually kills the plant. The fungus was isolated...

White-Nose Syndrome Fungus in a 1918 Bat Specimen from France.

PubMed

Campana, Michael G; Kurata, Naoko P; Foster, Jeffrey T; Helgen, Lauren E; Reeder, DeeAnn M; Fleischer, Robert C; Helgen, Kristofer M

2017-09-01

White-nose syndrome, first diagnosed in North America in 2006, causes mass deaths among bats in North America. We found the causative fungus, Pseudogymnoascus destructans, in a 1918 sample collected in Europe, where bats have now adapted to the fungus. These results are consistent with a Eurasian origin of the pathogen.

Contents and Structure Atta texana Nest in Summer

Treesearch

John C. Moser

1963-01-01

A large nest of Atta texana (Buckley) in central Louisiana was partially excavated in August 1960. Twelve dormancy, 5 detritus, and 93 fungus-garden cavities were found. Fungus-garden cavities near the surface outnumbered those at lower depths and contained most of the fungus material and brood. Inquilines were most numerous in detritus cavities....

Complete Genome of Enterobacteriaceae Bacterium Strain FGI 57, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

PubMed Central

Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

2013-01-01

The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353

Complete Genome of Serratia sp. Strain FGI 94, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

PubMed Central

Aylward, Frank O.; Tremmel, Daniel M.; Starrett, Gabriel J.; Bruce, David C.; Chain, Patrick; Chen, Amy; Davenport, Karen W.; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Teshima, Hazuki; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

2013-01-01

Serratia sp. strain FGI 94 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its 4.86-Mbp chromosome will help advance our knowledge of symbiotic interactions and plant biomass degradation in this ancient ant-fungus mutualism. PMID:23516234

Comparison of radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa forel in two culture media

PubMed Central

Miyashira, C.H.; Tanigushi, D.G.; Gugliotta, A.M.; Santos, D.Y.A.C.

2010-01-01

In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier. PMID:24031524

Does co-inoculation of Lactuca serriola with endophytic and arbuscular mycorrhizal fungi improve plant growth in a polluted environment?

PubMed

Ważny, Rafał; Rozpądek, Piotr; Jędrzejczyk, Roman J; Śliwa, Marta; Stojakowska, Anna; Anielska, Teresa; Turnau, Katarzyna

2018-04-01

Phytoremediation of polluted sites can be improved by co-inoculation with mycorrhizal and endophytic fungi. In this study, the effects of single- and co-inoculation of Lactuca serriola with an arbuscular mycorrhizal (AM) fungus, Rhizoglomus intraradices, and endophytic fungi, Mucor sp. or Trichoderma asperellum, on plant growth, vitality, toxic metal accumulation, sesquiterpene lactone production and flavonoid concentration in the presence of toxic metals were evaluated. Inoculation with the AM fungus increased biomass yield of the plants grown on non-polluted and polluted substrate. Co-inoculation with the AM fungus and Mucor sp. resulted in increased biomass yield of plants cultivated on the polluted substrate, whereas co-inoculation with T. asperellum and the AM fungus increased plant biomass on the non-polluted substrate. In the presence of Mucor sp., mycorrhizal colonization and arbuscule richness were increased in the non-polluted substrate. Co-inoculation with the AM fungus and Mucor sp. increased Zn concentration in leaves and roots. The concentration of sesquiterpene lactones in plant leaves was decreased by AM fungus inoculation in both substrates. Despite enhanced host plant costs caused by maintaining symbiosis with numerous microorganisms, interaction of wild lettuce with both mycorrhizal and endophytic fungi was more beneficial than that with a single fungus. The study shows the potential of double inoculation in unfavourable environments, including agricultural areas and toxic metal-polluted areas.

The Dynamics of Plant Cell-Wall Polysaccharide Decomposition in Leaf-Cutting Ant Fungus Gardens

PubMed Central

Harholt, Jesper; Willats, William G. T.; Boomsma, Jacobus J.

2011-01-01

The degradation of live plant biomass in fungus gardens of leaf-cutting ants is poorly characterised but fundamental for understanding the mutual advantages and efficiency of this obligate nutritional symbiosis. Controversies about the extent to which the garden-symbiont Leucocoprinus gongylophorus degrades cellulose have hampered our understanding of the selection forces that induced large scale herbivory and of the ensuing ecological footprint of these ants. Here we use a recently established technique, based on polysaccharide microarrays probed with antibodies and carbohydrate binding modules, to map the occurrence of cell wall polymers in consecutive sections of the fungus garden of the leaf-cutting ant Acromyrmex echinatior. We show that pectin, xyloglucan and some xylan epitopes are degraded, whereas more highly substituted xylan and cellulose epitopes remain as residuals in the waste material that the ants remove from their fungus garden. These results demonstrate that biomass entering leaf-cutting ant fungus gardens is only partially utilized and explain why disproportionally large amounts of plant material are needed to sustain colony growth. They also explain why substantial communities of microbial and invertebrate symbionts have evolved associations with the dump material from leaf-cutting ant nests, to exploit decomposition niches that the ant garden-fungus does not utilize. Our approach thus provides detailed insight into the nutritional benefits and shortcomings associated with fungus-farming in ants. PMID:21423735

Fungus-Specific Sirtuin HstD Coordinates Secondary Metabolism and Development through Control of LaeA

PubMed Central

Kawauchi, Moriyuki; Nishiura, Mika

2013-01-01

The sirtuins are members of the NAD+-dependent histone deacetylase family that contribute to various cellular functions that affect aging, disease, and cancer development in metazoans. However, the physiological roles of the fungus-specific sirtuin family are still poorly understood. Here, we determined a novel function of the fungus-specific sirtuin HstD/Aspergillus oryzae Hst4 (AoHst4), which is a homolog of Hst4 in A. oryzae yeast. The deletion of all histone deacetylases in A. oryzae demonstrated that the fungus-specific sirtuin HstD/AoHst4 is required for the coordination of fungal development and secondary metabolite production. We also show that the expression of the laeA gene, which is the most studied fungus-specific coordinator for the regulation of secondary metabolism and fungal development, was induced in a ΔhstD strain. Genetic interaction analysis of hstD/Aohst4 and laeA clearly indicated that HstD/AoHst4 works upstream of LaeA to coordinate secondary metabolism and fungal development. The hstD/Aohst4 and laeA genes are fungus specific but conserved in the vast family of filamentous fungi. Thus, we conclude that the fungus-specific sirtuin HstD/AoHst4 coordinates fungal development and secondary metabolism via the regulation of LaeA in filamentous fungi. PMID:23729383

Biological control of Ascaris suum eggs by Pochonia chlamydosporia fungus.

PubMed

Ferreira, Sebastião Rodrigo; de Araújo, Jackson Victor; Braga, Fábio Ribeiro; Araujo, Juliana Milani; Frassy, Luiza Neme; Ferreira, Aloízio Soares

2011-12-01

Ascaris suum is a gastrointestinal nematode parasite of swines. The aim of this study was to observe Pochonia chlamydosporia fungus on biological control of A. suum eggs after fungus passage through swines gastrointestinal tract. Eighteen pigs, previously dewormed, were randomly divided into three groups: group 1, treated with the fungus isolate VC4; group 2, treated with the fungus isolate VC1 and group 3 did not receive fungus (control). In the treated groups, each animal received a 9 g single dose of mycelium mass containing P. chlamydosporia (VC1 or VC4). Thereafter, animal fecal samples were collected at the following intervals: 8, 12, 24, 36, 48, 72 and 96 h after treatment beginning and these were poured in Petri dishes containing 2% water-agar culture medium. Then, 1,000 A. suum eggs were poured into each dish and kept in an incubator at 26 °C and in the dark for 30 days. After this period, approximately 100 eggs were removed from each Petri dish and morphologically analyzed under light microscopy following the ovicidal activity parameters. The higher percentage observed for isolated VC4 eggs destruction was 57.5% (36 h) after fungus administration and for isolate VC1 this percentage was 45.8% (24 h and 72 h) (p > 0.01). P. chlamydosporia remained viable after passing through the gastrointestinal tract of swines, maintaining its ability of destroying A. suum eggs.

The fungus gardens of leaf-cutter ants undergo a distinct physiological transition during biomass degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Eric L.; Aylward, Frank O.; Kim, Young-Mo

Leaf-cutter ants are dominant herbivores in ecosystems throughout the Neotropics. Rather than directly consuming the fresh foliar biomass they harvest, these ants use it to cultivate specialized fungus gardens. Although recent investigations have shed light on how plant biomass is degraded in fungus gardens, the cycling of nutrients that takes place in these specialized microbial ecosystems is still not well understood. Here, using metametabolomics and metaproteomics techniques, we examine the dynamics of nutrient turnover and biosynthesis in these gardens. Our results reveal that numerous free amino acids and sugars are depleted throughout the process of biomass degradation, indicating that easilymore » accessible nutrients from plant material are readily consumed by microbes in these ecosystems. Accumulation of cellobiose and lignin derivatives near the end of the degradation process is consistent with previous findings of cellulases and laccases produced by Leucoagaricus gongylophorus, the fungus cultivated by leaf-cutter ants. Our results also suggest that ureides may be an important source of nitrogen in fungus gardens, especially during nitrogen-limiting conditions. No free arginine was detected in our metametabolomics experiments despite evidence that the host ants cannot produce this amino acid, suggesting that biosynthesis of this metabolite may be tightly regulated in the fungus garden. These results provide new insights into the dynamics of nutrient cycling that underlie this important ant-fungus symbiosis.« less

Do novel genotypes drive the success of an invasive bark beetle–fungus complex? Implications for potential reinvasion

Treesearch

Min Lu; Michael J. Wingfield; Nancy Gillette; Jiang-Hua Sun

2011-01-01

Novel genotypes often arise during biological invasions, but their role in invasion success has rarely been elucidated. Here we examined the population genetics and behavior of the fungus, Leptographium procerum, vectored by a highly invasive bark beetle, Dendroctonus valens, to determine whether genetic changes in the fungus...

Association of the Pitch Canker Fungus with Cones and Seeds of Pines

Treesearch

L. David Dwinell

1998-01-01

The pitch canker fungus, Fusarium subglutinans f. sp.pini, causes the mortality of female flowers and mature cones, and can infect and destroy gametophyte tissues of seeds of several pine species in the southeastern U.S. The fungus can also be associated with the seed coats of apparently healthy, viable pine seeds. The pitch canker...

Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.

ERIC Educational Resources Information Center

Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.

1997-01-01

Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…

Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

Treesearch

Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

2018-01-01

Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

Mosquitocidal activity of a naturally occurring isochroman and synthetic analogs from the plant pathogenic fungus, Diaporthe eres against Aedes aegypti ( Diptera: Culicidae)

USDA-ARS?s Scientific Manuscript database

The culture filtrate of a plant pathogenic fungus that infects English ivy (Hegera helix) was investigated for mosquitocidal constituents by bioassay guided isolation. The fungus responsible for pathogenic effects on the plant Hegera helix has been identified as Diaporthe eres by molecular technique...

Reproduction of a woodwasp, Urocerus japonicus (Hymenoptera: Siricidae) using no maternal symbiotic fungus

Treesearch

Hideshi Fukuda

2003-01-01

Most woodwasps (Siricidae) are symbiotically associated with the specific fungus, Amylostereum spp. Female adults inoculate the fungus during their oviposition in sapwood of the host trees (Morgan 1968). Woodwasp larvae can digest sapwood with low nutritional quality with the aid of symbiosis (Kukor and Martin 1983). In the earlier study, we...

Using copper sulfate to control egg fungus at Keo Fish Farm

USDA-ARS?s Scientific Manuscript database

Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab has been working on gaining FDA-approval to use copper sulfate to control fungus on catfish eggs, so we were con...

Culture Conditions for Production of Biomass, Adenosine, and Cordycepin from Cordyceps sinensis CS1197: Optimization by Desirability Function Method

PubMed Central

Ghatnur, Shashidhar M.; Parvatam, Giridhar; Balaraman, Manohar

2015-01-01

Background: Cordyceps sinensis (CS) is a traditional Chinese medicine contains potent active metabolites such as nucleosides and polysaccharides. The submerged cultivation technique is studied for the large scale production of CS for biomass and metabolites production. Objective: To optimize culture conditions for large-scale production of CS1197 biomass and metabolites production. Materials and Methods: The CS1197 strain of CS was isolated from dead larvae of natural CS and the authenticity was assured by the presence of two major markers adenosine and cordycepin by high performance liquid chromatography and mass spectrometry. A three-level Box-Behnken design was employed to optimize process parameters culturing temperature, pH, and inoculum volume for the biomass yield, adenosine and cordycepin. The experimental results were regressed to a second-order polynomial equation by a multiple regression analysis for the prediction of biomass yield, adenosine and cordycepin production. Multiple responses were optimized based on desirability function method. Results: The desirability function suggested the process conditions temperature 28°C, pH 7 and inoculum volume 10% for optimal production of nutraceuticals in the biomass. The water extracts from dried CS1197 mycelia showed good inhibition for 2 diphenyl-1-picrylhydrazyl and 2,2-azinobis-(3-ethyl-benzo-thiazoline-6-sulfonic acid-free radicals. Conclusion: The result suggests that response surface methodology-desirability function coupled approach can successfully optimize the culture conditions for CS1197. SUMMARY Authentication of CS1197 strain by the presence of adenosine and cordycepin and culturing period was determined to be for 14 daysContent of nucleosides in natural CS was found higher than in cultured CS1197 myceliumBox-Behnken design to optimize critical cultural conditions: temperature, pH and inoculum volumeWater extract showed better antioxidant activity proving credible source of natural antioxidants. PMID:26929580

Altered proteomic polymorphisms in the caterpillar body and stroma of natural Cordyceps sinensis during maturation.

PubMed

Dong, Yun-Zi; Zhang, Li-Juan; Wu, Zi-Mei; Gao, Ling; Yao, Yi-Sang; Tan, Ning-Zhi; Wu, Jian-Yong; Ni, Luqun; Zhu, Jia-Shi

2014-01-01

To examine the maturational changes in proteomic polymorphisms resulting from differential expression by multiple intrinsic fungi in the caterpillar body and stroma of natural Cordyceps sinensis (Cs), an integrated micro-ecosystem. The surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF MS) biochip technique was used to profile the altered protein compositions in the caterpillar body and stroma of Cs during its maturation. The MS chromatograms were analyzed using density-weighted algorithms to examine the similarities and cluster relationships among the proteomic polymorphisms of the Cs compartments and the mycelial products Hirsutella sinensis (Hs) and Paecilomyces hepiali (Ph). SELDI-TOF MS chromatograms displayed dynamic proteomic polymorphism alterations among samples from the different Cs compartments during maturation. More than 1,900 protein bands were analyzed using density-weighted ZUNIX similarity equations and clustering methods, revealing integral polymorphism similarities of 57.4% between the premature and mature stromata and 42.8% between the premature and mature caterpillar bodies. The across-compartment similarity was low, ranging from 10.0% to 18.4%. Consequently, each Cs compartment (i.e., the stroma and caterpillar body) formed a clustering clade, and the 2 clades formed a Cs cluster. The polymorphic similarities ranged from 0.51% to 1.04% between Hs and the Cs compartments and were 2.8- to 4.8-fold higher (1.92%-4.34%) between Ph and the Cs compartments. The Hs and Ph mycelial samples formed isolated clades outside of the Cs cluster. Proteomic polymorphisms in the caterpillar body and stroma of Cs change dynamically during maturation. The proteomic polymorphisms in Hs and Ph differ from those in Cs, suggesting the presence of multiple Cs-associated fungi and multiple Ophiocordyceps sinensis genotypes with altered differential protein expression in the Cs compartments during maturation. In conjunction with prior mycological and molecular observations, the findings from this proteomic study support the integrated micro-ecosystem hypothesis for natural Cs.

Cordyceps sinensis promotes immune regulation and enhances bacteriostatic activity of PA-824 via IL-10 in Mycobacterium tuberculosis disease

PubMed Central

Li, D.G.; Ren, Z.X.

2017-01-01

PA-824 is a novel bicyclic nitroimidazole anti-tuberculosis (TB) drug. Cordyceps sinensis (Berk.) Sacc. (CS) was proven to be a good immunomodulatory compound. This research aimed to investigate the effect of CS on PA-824 in Mycobacterium tuberculosis (M.tb) infected mice (female CBA/J mice, 6 to 8 weeks of age and 20±2 g of weight). Mice were randomly assigned to 4 groups: PA-824, CS, PA-824+CS, and control. To verify the effect of PA-824 and CS on M.tb, after drug administration, mice lungs were harvested and bacterial colony formations were measured. Cells were isolated from infected lungs and spleens to analyze the percentage of CD4+ T cells (CD11a positive). Lung cells were cultured to detect the secretion of interferon-γ (IFN-γ) and interleukin-10 (IL-10) by ELISA. IFN-γ and IL-10 double-positive CD4+ cells in peripheral blood were measured by flow cytometry. The expression levels of IL-2 and IL-10 in mice lungs were analyzed by real-time PCR and western blot. Results showed that PA-824 combined with CS led to the lowest lung colony-forming units (CFU) counts among treated groups. Furthermore, this beneficial outcome might be associated with the decreased CD11a on CD4+ cells in mice lungs and spleens. Moreover, the suppressed secretion of IFN-γ and IL-10, and IL-10 expressions, as well as the decreased IFN-γ and IL-10 double-positive CD4+ cells in blood, could also be associated with the positive effect. However, no significant effect on IL-2 production was found. The combination of PA-824 and CS had more effective bacteriostatic and immunomodulatory effects on M.tb infected mice than PA-824 alone. In conclusion, CS has the potential to be an effective adjuvant in TB treatment. PMID:28793052

Antagonistic interaction between cordyceps sinensis and exercise on protection in fulminant hepatic failure.

PubMed

Cheng, Yu-Jung; Shyu, Woei-Cherng; Teng, Yi-Hsien; Lan, Yu-Hsuan; Lee, Shin-Da

2014-01-01

Herb supplements are widely used by Asian athletes; however, there are no studies evaluated the co-effects of exercise and herb supplements on hepatic failure. In this study, D-GalN/LPS-induced fulminant hepatic failure was used to examine whether there are synergistic or antagonistic effects of exercise and Cordyceps sinensis (CS). Mice were randomly divided into eight groups: control, swimming exercise for four weeks, D-GalN/LPS challenge, swimming exercise plus D-GalN/LPS, 20 mg/kg or 40 mg/kg CS pretreated for four weeks plus D-GalN/LPS, and swimming exercise combined with 20 mg/kg or 40 mg/kg CS pretreatment plus D-GalN/LPS. Either exercise or 40 mg/kg CS pretreatment alone significantly decreased D-GalN/LPS-induced TNF-α, AST, NO, apoptotic-related proteins, and hepatocyte apoptosis. Exercise or 40 mg/kg CS alone increased the IL-10 and D-GalN/LPS-suppressed Superoxide Dismutase (SOD) level. However, no protective or worse effect was observed in the mice treated with exercise preconditioning combined 40 mg/kg CS compared to those receive exercise alone or CS alone. TNF-α, AST, NO level, caspase-3 activity, and hepatocytes apoptosis were not significantly different in the exercise combined with 40 mg/kg CS compared to mice challenged with D-GalN/LPS. The IL-10 level was significantly decreased after D-GalN/LPS stimulation in the mice received exercise combined with 40 mg/kg CS, indicating the combination strongly reduced the anti-inflammatory effect. In summary, preconditioning exercise or CS pretreatment alone can protect mice from septic liver damage, but in contrast, the combination of exercise and CS does not produce any benefit. The antagonistic interactions between exercise and CS imply taking CS is not recommended for people who undertake regular exercise.

Effect of Cordyceps sinensis on renal function of patients with chronic allograft nephropathy.

PubMed

Zhang, Zhihong; Wang, Xiangwei; Zhang, Yuanning; Ye, Gang

2011-01-01

To investigate the effect of Cordyceps sinensis (Bailing capsule, fermented agent of C. sinensis) on renal function of patients with chronic allograft nephropathy (CAN). A total of 231 CAN patients who underwent transplantation between 2005 and 2008 and experienced chronic graft dysfunction were randomly divided into 2 groups. Patients in group A (n = 122) were treated with immunosuppressive agents and C. sinensis (2.0 g/day, 3 times a day), while patients in group B (n = 109) were treated with traditional immunosuppressive drugs. Serum creatinine (SCr), blood urea nitrogen (BUN), creatinine clearance rate (C(Cr)) and urinary protein in 24 h (24-hour Upro) of all patients were measured before and after treatment. Urinary concentrations of transforming growth factor (TGF)-β(1), retinol-binding protein (RBP) and β(2)-microglobulin (β(2)-MG) were detected at the same time. After 6-month treatment with C. sinensis, SCr and C(Cr) in group A were significantly improved (p < 0.05), while there was no significant improvement observed for group B. There was no significant change in BUN in groups A and B (p > 0.05). 24-hour Upro, RBP and β(2)-MG were lower in group A after treatment with C. sinensis (p < 0.05 or p < 0.01), and urinary TGF-β(1) in group A was significantly lower than the values before C. sinensis treatment (p < 0.05), but showed no change in patients of group B. In group A, renal function had improved in 72 cases, stabilized in 38 cases, and worsened in 12 cases. In group B, renal function had improved in 14 cases, stabilized in 50 cases, and worsened in 45 cases (p < 0.05). C. sinensis therapy is advantageous in improving renal function of CAN patients by retarding CAN progression. Copyright © 2011 S. Karger AG, Basel.

Altered Proteomic Polymorphisms in the Caterpillar Body and Stroma of Natural Cordyceps sinensis during Maturation

PubMed Central

Wu, Zi-Mei; Gao, Ling; Yao, Yi-Sang; Tan, Ning-Zhi; Wu, Jian-Yong; Ni, Luqun; Zhu, Jia-Shi

2014-01-01

Objective To examine the maturational changes in proteomic polymorphisms resulting from differential expression by multiple intrinsic fungi in the caterpillar body and stroma of natural Cordyceps sinensis (Cs), an integrated micro-ecosystem. Methods The surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF MS) biochip technique was used to profile the altered protein compositions in the caterpillar body and stroma of Cs during its maturation. The MS chromatograms were analyzed using density-weighted algorithms to examine the similarities and cluster relationships among the proteomic polymorphisms of the Cs compartments and the mycelial products Hirsutella sinensis (Hs) and Paecilomyces hepiali (Ph). Results: SELDI-TOF MS chromatograms displayed dynamic proteomic polymorphism alterations among samples from the different Cs compartments during maturation. More than 1,900 protein bands were analyzed using density-weighted ZUNIX similarity equations and clustering methods, revealing integral polymorphism similarities of 57.4% between the premature and mature stromata and 42.8% between the premature and mature caterpillar bodies. The across-compartment similarity was low, ranging from 10.0% to 18.4%. Consequently, each Cs compartment (i.e., the stroma and caterpillar body) formed a clustering clade, and the 2 clades formed a Cs cluster. The polymorphic similarities ranged from 0.51% to 1.04% between Hs and the Cs compartments and were 2.8- to 4.8-fold higher (1.92%–4.34%) between Ph and the Cs compartments. The Hs and Ph mycelial samples formed isolated clades outside of the Cs cluster. Conclusion Proteomic polymorphisms in the caterpillar body and stroma of Cs change dynamically during maturation. The proteomic polymorphisms in Hs and Ph differ from those in Cs, suggesting the presence of multiple Cs-associated fungi and multiple Ophiocordyceps sinensis genotypes with altered differential protein expression in the Cs compartments during maturation. In conjunction with prior mycological and molecular observations, the findings from this proteomic study support the integrated micro-ecosystem hypothesis for natural Cs. PMID:25310818

Cordyceps sinensis promotes immune regulation and enhances bacteriostatic activity of PA-824 via IL-10 in Mycobacterium tuberculosis disease.

PubMed

Li, D G; Ren, Z X

2017-08-07

PA-824 is a novel bicyclic nitroimidazole anti-tuberculosis (TB) drug. Cordyceps sinensis (Berk.) Sacc. (CS) was proven to be a good immunomodulatory compound. This research aimed to investigate the effect of CS on PA-824 in Mycobacterium tuberculosis (M.tb) infected mice (female CBA/J mice, 6 to 8 weeks of age and 20±2 g of weight). Mice were randomly assigned to 4 groups: PA-824, CS, PA-824+CS, and control. To verify the effect of PA-824 and CS on M.tb, after drug administration, mice lungs were harvested and bacterial colony formations were measured. Cells were isolated from infected lungs and spleens to analyze the percentage of CD4+ T cells (CD11a positive). Lung cells were cultured to detect the secretion of interferon-γ (IFN-γ) and interleukin-10 (IL-10) by ELISA. IFN-γ and IL-10 double-positive CD4+ cells in peripheral blood were measured by flow cytometry. The expression levels of IL-2 and IL-10 in mice lungs were analyzed by real-time PCR and western blot. Results showed that PA-824 combined with CS led to the lowest lung colony-forming units (CFU) counts among treated groups. Furthermore, this beneficial outcome might be associated with the decreased CD11a on CD4+ cells in mice lungs and spleens. Moreover, the suppressed secretion of IFN-γ and IL-10, and IL-10 expressions, as well as the decreased IFN-γ and IL-10 double-positive CD4+ cells in blood, could also be associated with the positive effect. However, no significant effect on IL-2 production was found. The combination of PA-824 and CS had more effective bacteriostatic and immunomodulatory effects on M.tb infected mice than PA-824 alone. In conclusion, CS has the potential to be an effective adjuvant in TB treatment.

Mucormycosis (Mucor fungus ball) of the maxillary sinus.

PubMed

Cho, Hang Sun; Yang, Hoon Shik; Kim, Kyung Soo

2014-01-01

A fungus ball is an extramucosal fungal proliferation that completely fills one or more paranasal sinuses and usually occurs as a unilateral infection. It is mainly caused by Aspergillus spp in an immunocompetent host, but some cases of paranasal fungal balls reportedly have been caused by Mucor spp. A Mucor fungus ball is usually found in the maxillary sinus and/or the sphenoid sinus and may be black in color. Patients with mucormycosis, or a Mucor fungal ball infection, usually present with facial pain or headache. On computed tomography, there are no pathognomonic findings that are conclusive for a diagnosis of mucormycosis. In this article we report a case of mucormycosis in a 56-year-old woman and provide a comprehensive review of the literature on the "Mucor fungus ball." To the best of our knowledge, 5 case reports (8 patients) have been published in which the fungus ball was thought to be caused by Mucor spp.

Biosynthesis of size-controlled gold nanoparticles using fungus, Penicillium sp.

PubMed

Zhang, Xiaorong; He, Xiaoxiao; Wang, Kemin; Wang, Yonghong; Li, Huimin; Tan, Weihong

2009-10-01

The unique optoelectronic and physicochemical properties of gold nanoparticles are significantly dependent on the particle size, shape and structure. In this paper, biosynthesis of size-controlled gold nanoparticles using fungus Penicillium sp. is reported. Fungus Penicillium sp. could successfully bioreduce and nucleate AuCl4(-) ions, and lead to the assembly and formation of intracellular Au nanoparticles with spherical morphology and good monodispersity after exposure to HAuCl4 solution. Reaction temperature, as an important physiological parameter for fungus Penicillium sp. growth, could significantly control the size of the biosynthesized Au nanoparticles. The biological compositions and FTIR spectra analysis of fungus Penicillium sp. exposed to HAuCl4 solution indicated the intracellular reducing sugar played an important role in the occurrence of intracellular reduction of AuCl4(-) ions and the growth of gold nanoparticles. Furthermore, the intracellular gold nanoparticles could be easily separated from the fungal cell lysate by ultrasonication and centrifugation.

Chytrid fungus parasitizing the wild amphibian Leptodactylus ocellatus (Anura: Leptodactylidae) in Argentina.

PubMed

Herrera, Raúl A; Steciow, Mónica M; Natale, Guillermo S

2005-05-20

The present contribution is the first report of parasitosis by a chytrid fungus in wild anuran amphibians in Argentina, as well as the first case of amphibian mortality documented to date in Argentina. We report the presence of the chytrid fungus in dead adult Leptodactylus ocellatus. It has been suggested that chytridiomycosis is the main cause of death in several amphibian populations worldwide. Our study demonstrates that chytridiomycosis afflicts L. ocellatus, a common widespread amphibian species, and is the first report of chytridiomycosis in the Argentinian lowlands. The occurrence at this latitude would indicate an extended distribution of this fungus in wildlife populations. It is also the first report of amphibian mortality due to chytrid fungus in our country. It is noteworthy that the site of collection is situated very close to sea level in a temperate climate zone and that this represents the southern most record for South American wild amphibians.

Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luey, J.; Brouns, T.M.; Elliott, M.L.

1990-11-01

The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable formore » the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs.« less

The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica.

PubMed

Torii, Masato; Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-Ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

2014-06-01

In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven.

The Evolutionary Innovation of Nutritional Symbioses in Leaf-Cutter Ants

PubMed Central

Aylward, Frank O.; Currie, Cameron R.; Suen, Garret

2012-01-01

Fungus-growing ants gain access to nutrients stored in plant biomass through their association with a mutualistic fungus they grow for food. This 50 million-year-old obligate mutualism likely facilitated some of these species becoming dominant Neotropical herbivores that can achieve immense colony sizes. Recent culture-independent investigations have shed light on the conversion of plant biomass into nutrients within ant fungus gardens, revealing that this process involves both the fungal cultivar and a symbiotic community of bacteria including Enterobacter, Klebsiella, and Pantoea species. Moreover, the genome sequences of the leaf-cutter ants Atta cephalotes and Acromyrmex echinatior have provided key insights into how this symbiosis has shaped the evolution of these ants at a genetic level. Here we summarize the findings of recent research on the microbial community dynamics within fungus-growing ant fungus gardens and discuss their implications for this ancient symbiosis. PMID:26467948

Deciphering the molecular mechanisms behind cellulase production in Trichoderma reesei, the hyper-cellulolytic filamentous fungus.

PubMed

Shida, Yosuke; Furukawa, Takanori; Ogasawara, Wataru

2016-09-01

The filamentous fungus Trichoderma reesei is a potent cellulase producer and the best-studied cellulolytic fungus. A lot of investigations not only on glycoside hydrolases produced by T. reesei, but also on the machinery controlling gene expression of these enzyme have made this fungus a model organism for cellulolytic fungi. We have investigated the T. reesei strain including mutants developed in Japan in detail to understand the molecular mechanisms that control the cellulase gene expression, the biochemical and morphological aspects that could favor this phenotype, and have attempted to generate novel strains that may be appropriate for industrial use. Subsequently, we developed recombinant strains by combination of these insights and the heterologous-efficient saccharifing enzymes. Resulting enzyme preparations were highly effective for saccharification of various biomass. In this review, we present some of the salient findings from the recent biochemical, morphological, and molecular analyses of this remarkable cellulase hyper-producing fungus.

Fungal decay resistance of wood reacted with phosphorus pentoxide-amine system

Treesearch

Hong-Lin Lee; George C. Chen; Roger M. Rowell

2004-01-01

Resistance of wood reacted in situ with phosphorus pentoxide-amine to the brown-rot fungus Gloeophyllum trabeum and white-rot fungus Trametes versicolor was examined. Wood reacted with either octyl, tribromo, or nitro derivatives were more resistant to both fungi. Threshold retention values of phosphoramide-reacted wood to white-rot fungus T. versicolor ranged from 2.9...

Serpula lacrymans, the dry rot fungus and tolerance towards copper-based wood preservatives

Treesearch

Anne Christine Steenkjaer Hastrup; Frederick Green; Carol Clausen; Bo Jensen

2005-01-01

Serpula lacrymans (Wulfen : Fries) Schröter, the dry rot fungus, is considered the most economically important wood decay fungus in temperate regions of the world i.e. northern Europe, Japan and Australia. Previously copper based wood preservatives were the most commonly used preservatives for pressure treatment of wood for building constructions. Because of a...

Arbuscular mycorrhizal fungus inoculation reduces the drought-resistance advantage of endophyte-infected versus endophyte-free Leymus chinensis.

PubMed

Liu, Hui; Chen, Wei; Wu, Man; Wu, Rihan; Zhou, Yong; Gao, Yubao; Ren, Anzhi

2017-11-01

Grasses can be infected simultaneously by endophytic fungi and arbuscular mycorrhizal (AM) fungi. In this study, we tested the hypothesis that endophyte-associated drought resistance of a native grass was affected by an AM fungus. In a greenhouse experiment, we compared the performance of endophyte-infected (EI) and endophyte-free (EF) Leymus chinensis, a dominant species native to the Inner Mongolia steppe, under altered water and AM fungus availability. The results showed that endophyte infection significantly increased drought resistance of the host grass, but the beneficial effects were reduced by AM fungus inoculation. In the mycorrhizal-non-inoculated (MF) treatment, EI plants accumulated significantly more biomass, had greater proline and total phenolic concentration, and lower malondialdehyde concentration than EF plants. In the mycorrhizal-inoculation (MI) treatment, however, no significant difference occurred in either growth or physiological characters measured between EI and EF plants. AM fungus inoculation enhanced drought resistance of EF plants but had no significant effect on drought resistance of EI plants, thus AM fungus inoculation reduced the difference between EI and EF plants. Our findings highlight the importance of interactions among multiple microorganisms for plant performance under drought stress.

Improving Efficacy of Beauveria bassiana against Stored Grain Beetles with a Synergistic Co-Formulant

PubMed Central

Storm, Clare; Scoates, Freya; Nunn, Adam; Potin, Olivier; Dillon, Aoife

2016-01-01

The potential of a dry powder co-formulant, kaolin, to improve the control of storage beetles by the entomopathogenic fungus Beauveria bassiana, isolate IMI389521, was investigated. The response of Oryzaephilus surinamensis adults to the fungus when applied to wheat at 1 × 1010 conidia per kg with and without kaolin at 1.74 g per kg wheat was assessed. Addition of kaolin increased control from 46% to 88% at day 7 and from 81% to 99% at day 14 post-treatment. Following this the dose response of O. surinamensis and Tribolium confusum to both kaolin and the fungus was investigated. Synergistic effects were evident against O. surinamensis at ≥0.96 g of kaolin per kg of wheat when combined with the fungus at all concentrations tested. For T. confusum, adult mortality did not exceed 55%, however, the larvae were extremely susceptible with almost complete suppression of adult emergence at the lowest fungal rate tested even without the addition of kaolin. Finally, the dose response of Sitophilus granarius to the fungus at 15 and 25 °C, with and without kaolin at 1 g per kg of wheat, was examined. Improvements in efficacy were achieved by including kaolin at every fungal rate tested and by increasing the temperature. Kaolin by itself was not effective, only when combined with the fungus was an effect observed, indicating that kaolin was having a synergistic effect on the fungus. PMID:27571107

Nature of the interactions between hypocrealean fungi and the mutualistic fungus of leaf-cutter ants.

PubMed

Varanda-Haifig, Sadala Schmidt; Albarici, Tatiane Regina; Nunes, Pablo Henrique; Haifig, Ives; Vieira, Paulo Cezar; Rodrigues, Andre

2017-04-01

Leaf-cutter ants cultivate and feed on the mutualistic fungus, Leucoagaricus gongylophorus, which is threatened by parasitic fungi of the genus Escovopsis. The mechanism of Escovopsis parasitism is poorly understood. Here, we assessed the nature of the antagonism of different Escovopsis species against its host. We also evaluated the potential antagonism of Escovopsioides, a recently described fungal genus from the attine ant environment whose role in the colonies of these insects is unknown. We performed dual-culture assays to assess the interactions between L. gongylophorus and both fungi. We also evaluated the antifungal activity of compounds secreted by the latter on L. gongylophorus growth using crude extracts of Escovopsis spp. and Escovopsioides nivea obtained either in (1) absence or (2) presence of the mutualistic fungus. The physical interaction between these fungi and the mutualistic fungus was examined under scanning electron microscopy (SEM). Escovopsis spp. and E. nivea negatively affected the growth of L. gongylophorus, which was also significantly inhibited by both types of crude extract. These results indicate that Escovopsis spp. and E. nivea produce antifungal metabolites against the mutualistic fungus. SEM showed that Escovopsis spp. and E. nivea maintained physical contact with the mutualistic fungus, though no specialised structures related to mycoparasitism were observed. These results showed that Escovopsis is a destructive mycoparasite that needs physical contact for the death of the mutualistic fungus to occur. Also, our findings suggest that E. nivea is an antagonist of the ant fungal cultivar.

Efficacy of the nematode-trapping fungus Duddingtonia flagrans against three species of gastro-intestinal nematodes in laboratory faecal cultures from sheep and goats.

PubMed

Waghorn, T S; Leathwick, D M; Chen, L-Y; Skipp, R A

2003-12-30

The ability of the nematode-killing fungus Duddingtonia flagrans to reduce number of infective larvae of three species of gastro-intestinal parasitic nematodes developing in dung was investigated in both goats and sheep. Groups of lambs and kids (12-20 weeks old) were given mono-specific infections of Haemonchus contortus, Ostertagia (Teladorsagia) circumcincta or Trichostrongylus colubriformis. Following patency of the infections (t1) faecal samples were collected for determination of faecal nematode egg count (FEC) and culture of parasite larvae. Groups of animals were then dosed on 2 consecutive days with one of the two dose rates of the fungus (250,000 or 500,000 spores/kg liveweight). One (t2) and 5 (t3) days after the second dose of fungus samples were again collected for FEC and culture. The number of larvae recovered from the faecal cultures at t1 and t3 were used as controls to assess the efficacy of the experimental treatment at t2. Average efficacy was 78% with group means ranging from 40 to 93%. Dose rate of fungus appeared to influence efficacy against O. circumcincta but not against H. contortus or T. colubriformis. Overall, there were no differences in the efficacy of the fungus against any of the parasite species or in either host animal. The results of this trial indicate the potential use of this fungus as a broad spectrum anti-parasite agent for use in both goats and sheep.

Draft genome sequence of the fungus associated with oak-wilt mortality in South Korea, Raffaelea quercus-mongolicae KACC44405

Treesearch

Jongbum Jeon; Ki-Tae Kim; Hyeunjeong Song; Gir-Won Lee; Kyeongchae Cheong; Hyunbin Kim; Gobong Choi; Yong-Hwan Lee; Jane E. Stewart; Ned B. Klopfenstein; Mee-Sook Kim

2017-01-01

The fungus Raffaelea quercus-mongolicae is the causal agent of Korean oak wilt, a disease associated with mass mortality of oak trees (e.g., Quercus spp.). The fungus is vectored and dispersed by the ambrosia beetle, Platypus koryoensis. Here, we present the 27.0-Mb draft genome sequence of R. quercus-mongolicae strain KACC44405.

Characteristics of a newly isolated fungus Geotrichum candidum Dec 1 with broad degradation spectrum of xenobiotic compounds.

PubMed

Shoda, M

2003-01-01

A newly isolated fungus, Geotrichum candidum Dec 1 (abbreviated as Dec 1), was found to have the ability to degrade many xenobiotic compounds such as synthetic dyes, food coloring agents, molasses, organic halogens, lignin and kraft pulp effluents. The broad spectrum of the degradation of these compounds are associated mainly with peroxidases produced by the fungus.

Cutinase in Cryphonectria parasitica, the chestnut blight fungus: suppression of cutinase gene expression in isogenic hypovirulent strains containing double-stranded RNAs

Treesearch

D.A. ​Varley; G.K. Podila; S.T. Hiremath

1992-01-01

Plant-pathogenic fungi produce cutinase, an enzyme required to degrade plant cuticles and facilitate penetration into the host. The absence of cutinase or a decrease in its production has been associated with a decrease in pathogenicity of the fungus. A set of isogenic strains of Cryphonectria parasitica, the chestnut blight fungus, was tested for...

First unusual case of keratitis in Europe due to the rare fungus Metarhizium anisopliae.

PubMed

Dorin, Josephine; Debourgogne, Anne; Zaïdi, Mohamed; Bazard, Marie-Christine; Machouart, Marie

2015-05-01

Metarhizium anisopliae is a fungus utilized worldwide for insect-pest biocontrol. Few M. anisopliae infections have been reported previously. Here, M. anisopliae was isolated from a corneal ulcer in a healthy man. It is the first ocular case in France and Europe of this extremely rare fungus in humans. Copyright © 2015 Elsevier GmbH. All rights reserved.

Symbiosis-regulated expression of an acetyl-CoA acetyltransferase gene in the ectomycorrhizal fungus Laccaria bicolor

Treesearch

Shiv T. Hiremath; Sujata Balasubramanian; Jun Zheng; Gopi K. Podila

2006-01-01

The ectomycorrhiza is a symbiotic organ generated from the intricate association of fungal hyphae and plant root. The establishment of the ectomycorrhiza is a coordinated process of cross-talk between plant and fungus, followed by metabolic, developmental, and structural changes in the fungus, resulting in its growth toward the root. The initial stages of the symbiotic...

Genetic diversity and population structure of Raffaelea quercus-mongolicae, a fungus associated with oak mortality in South Korea

Treesearch

M. -S. Kim; P. A. Hohenlohe; K. -H. Kim; S. -T. Seo; Ned Klopfenstein

2016-01-01

Raffaelea quercus-mongolicae is a fungus associated with oak wilt and deemed to cause extensive oak mortality in South Korea. Since the discovery of this fungus on a dead Mongolian oak (Quercus mongolica) in 2004, the mortality continued to spread southwards in South Korea. Despite continued expansion of the disease and associated significant impacts on forest...

[Scytalidium dimidiatum an opportunistic fungus for both man and Mangifera indica trees in Venezuela].

PubMed

Padin, Carmiña; Fernández-Zeppenfeldt, Guillermo; Yegres, Francisco; Richard-Yegres, Nicole

2005-09-01

The purpose of this study was to confirm the presence of Scytalidium dimidiatum on Mangifera indica (mango) trees, in a plantation managed by a diabetic patient with a white grain mycetoma of the foot caused by the same fungus. Samples from necrotic apices, roots, burned leaves and rotten stems from eight trees were processed by the Smith and Furcolow's mineral oil technique (modified). Several isolates from the apex material and clinical samples from the diabetic patient isolated in pure culture a fungus with the macroscopic and microscopic characteristics of that in S. dimidiatum. This fungus should be considered as an opportunistic microorganism for both humans and M. indica.

Isocoumarin Derivatives from the Sea Squirt-derived Fungus Penicillium stoloniferum QY2-10 and the Halotolerant Fungus Penicillium notatum B-52.

PubMed

Xin, Zhi-Hong; Tian, Li; Zhu, Tian-Jiao; Wang, Wen-Liang; Du, Lin; Fang, Yu-Chun; Gu, Qian-Qun; Zhu, Wei-Ming

2007-07-01

Two isocoumarin derivatives, stoloniferol A (1) and B (2), a known 5alpha, 8alpha-epidioxy-23-methyl-(22E, 24R)-ergosta-6, 22-dien-3beta-ol (3), and a known dihydrocitrinone (4) were isolated from the ethyl acetate extract of the sea squirt-derived fungus, Penicillium stoloniferum QY2-10, and a halophilic fungus, Penicillium notatum B-52, respectively. Their structures were elucidated by spectroscopic methods and optical rotation. The stereochemistry of 2 was determined on the basis of different NOE experiments and chemical transformation. Compound 3 showed cytotoxicity against P388 cells, with an IC50 value of 4.07 microM.

The chestnut blight fungus for studies on virus/host and virus/virus interactions: from a natural to a model host.

PubMed

Eusebio-Cope, Ana; Sun, Liying; Tanaka, Toru; Chiba, Sotaro; Kasahara, Shin; Suzuki, Nobuhiro

2015-03-01

The chestnut blight fungus, Cryphonectria parasitica, is an important plant pathogenic ascomycete. The fungus hosts a wide range of viruses and now has been established as a model filamentous fungus for studying virus/host and virus/virus interactions. This is based on the development of methods for artificial virus introduction and elimination, host genome manipulability, available host genome sequence with annotations, host mutant strains, and molecular tools. Molecular tools include sub-cellular distribution markers, gene expression reporters, and vectors with regulatable promoters that have been long available for unicellular organisms, cultured cells, individuals of animals and plants, and certain filamentous fungi. A comparison with other filamentous fungi such as Neurospora crassa has been made to establish clear advantages and disadvantages of C. parasitica as a virus host. In addition, a few recent studies on RNA silencing vs. viruses in this fungus are introduced. Copyright © 2014 Elsevier Inc. All rights reserved.

Greater taxol yield of fungus Pestalotiopsis hainanensis from dermatitic scurf of the giant panda (Ailuropoda melanoleuca).

PubMed

Gu, Yu; Wang, Yanlin; Ma, Xiaoping; Wang, Chengdong; Yue, Guizhou; Zhang, Yuetian; Zhang, Yunyan; Li, Shanshan; Ling, Shanshan; Liu, Xiaomin; Wen, Xintian; Cao, Sanjie; Huang, Xiaobo; Deng, Junliang; Zuo, Zhicai; Yu, Shumin; Shen, Liuhong; Wu, Rui

2015-01-01

While taxol yields of fungi from non-animal sources are still low, whether Pestalotiopsis hainanensis isolated from the scurf of a dermatitic giant panda, Ailuropoda melanoleuca, provides a greater taxol yield remains unknown. The objective of the study was to determine the corresponding taxol yield. The structure of the taxol produced by the fungus was evaluated by thin layer chromatography (TLC), ultraviolet (UV) spectroscopy, high-performance liquid chromatography (HPLC), (1)H and (13)C nuclear magnetic resonance spectroscopy ((1)H-NMR and (13)C-NMR), and time-of-flight mass spectrometry (TOF-MS), with standard taxol as a control. The results demonstrated that the P. hainanensis fungus produced taxol, which had the same structure as the standard taxol and yield of 1,466.87 μg/L. This fungal taxol yield from the dermatitic giant panda was significantly greater than those of fungus from non-animal sources. The taxol-producing fungus may be a potential candidate for the production of taxol on an industrial scale.

The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica

PubMed Central

Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

2014-01-01

In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven. PMID:25071395

Genome Sequence of the Mucoromycotina Fungus Umbelopsis isabellina, an Effective Producer of Lipids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takeda, Itaru; Tamano, Koichi; Yamane, Noriko

2014-02-27

Umbelopsis isabellina is a fungus in the subdivision Mucoromycotina, many members of which have been shown to be oleaginous and have become important organisms for producing oil because of their high level of intracellular lipid accumulation from various feedstocks. The genome sequence of U. isabellina NBRC 7884 was determined and annotated, and this information might provide insights into the oleaginous properties of this fungus.

Phylogenetic placement of an unusual coral mushroom challenges the classic hypothesis of strict coevolution in the Apterostigma pilosum group ant-fungus mutualism

Treesearch

Bryn T.M. Dentinger; D.Jean Lodge; Andrew B. Munkacsi; Dennis E. Desjardin; David J. McLaughlin

2009-01-01

The ~50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus ...

Fingerprints of a forest fungus: Swiss needle cast, carbon isotopes, carbohydrates, and growth in Douglas-fir

Treesearch

Andrea Watts; Frederick Meinzer; Brandy J. Saffell

2014-01-01

Swiss needle cast is caused by a fungus native to the Pacific Northwest. Its host is Douglas-fir, an iconic evergreen tree in the region. The fungus does not kill its host, but it adversely affects the tree's growth. The fungal fruiting bodies block the stomata, small openings on the underside of the needle where carbon dioxide, water vapor, and other gases are...

The genome of an industrial workhorse : sequencing of the filamentous fungus Aspergillus niger offers new opportunities for the production of specialty chemicals and enzymes

Treesearch

Dan Cullen

2007-01-01

Few microbes compare with the filamentous fungus Aspergillus niger in its ability to produce prodigious amounts of useful chemicals and enzymes. This fungus is the principal source of citric acid for food, beverages and pharmaceuticals and of several important commercial enzymes, including glucoamylase, which is widely used for the conversion of starch to food syrups...

Histopathology of cutaneous sporotrichosis in Rio de Janeiro: a series of 119 consecutive cases.

PubMed

Quintella, Leonardo Pereira; Passos, Sonia Regina Lambert; do Vale, Antônio Carlos Francesconi; Galhardo, Maria Clara Gutierrez; Barros, Monica Bastos De Lima; Cuzzi, Tullia; Reis, Rosani Dos Santos; de Carvalho, Maria Helena Galdino Figueiredo; Zappa, Mônica Barbato; Schubach, Armando De Oliveira

2011-01-01

Sporotrichosis is the most common subcutaneous mycosis in Rio de Janeiro. Histopathological examination reveals diffuse granulomatous and suppurative dermatitis, and the fungus is rarely identifiable in tissue. We describe the histopathological features of cutaneous sporotrichosis, and investigate the association between them and the lack of visualization of the fungus. A total of 119 samples of confirmed sporotrichosis cases were studied. The characteristics of the inflammatory infiltrate, the presence of epidermal changes, necrosis and fibrosis, and the parasite burden were analyzed. The association between histopathological changes and the lack of visualization of the fungus was evaluated using prevalence ratios. Granulomas were observed in all samples, suppurative granulomas in 100 (84%) and diffuse dermatitis in 114 (95.8%). Liquefaction and caseous necrosis were present in 78 (65.5%) and 52 (43.7%) samples, respectively. The fungus was not seen in 77 (64.7%) samples. Epithelioid, tuberculoid or foreign-body-type granulomas, caseous, fibrinoid or absent necrosis, predominance of lymphocytes among nonphagocytic cells and fibrosis were associated with the lack of visualization of the fungus. The histopathological characteristics of sporotrichosis were variable when the causative fungus was not seen. In a proper context, the diagnosis of sporotrichosis remains a potential consideration even in the absence of demonstrable yeast. Copyright © 2010 John Wiley & Sons A/S.

Comparative effects of native filamentous and arbuscular mycorrhizal fungi in the establishment of an autochthonous, leguminous shrub growing in a metal-contaminated soil.

PubMed

Carrasco, L; Azcón, R; Kohler, J; Roldán, A; Caravaca, F

2011-02-15

The aim of this study was to assess the effectiveness of inoculation with a native arbuscular mycorrhizal (AM) fungus, Glomus mosseae (Nicol. and Gerd.) Gerd. and Trappe, or a filamentous fungus, Penicillium aurantiogriseum Dierckx 1901, on the establishment of Coronilla juncea L. seedlings grown in a polluted, semiarid soil. For that, root and shoot biomass, nutrient uptake, mycorrhizal colonisation and nitrate reductase (NR) and phosphatase activities were analysed. Six months after planting, the shoot biomass of C. juncea was increased only by the inoculation with G. mosseae (by about 62% compared with non-mycorrhizal plants). The shoot NR and root acid phosphatase activities were increased more by inoculation with G. mosseae than with P. aurantiogriseum inoculation. The root NR activity and foliar nutrient contents were increased only by the inoculation with the AM fungus. The root Zn and Cu decreased with the AM fungus. In conclusion, the autochthonous AM fungus was an effective inoculant with regard to stimulating growth and alleviating heavy metal toxicity for plants growing on a soil contaminated by multiple heavy metals. Inoculation with an autochthonous, filamentous fungus does not seem to be a good strategy for phytoremediation of such problematic sites. Copyright © 2011 Elsevier B.V. All rights reserved.

Synergistic interaction between the fungus Beauveria bassiana and desiccant dusts applied against poultry red mites (Dermanyssus gallinae).

PubMed

Steenberg, Tove; Kilpinen, Ole

2014-04-01

The poultry red mite, Dermanyssus gallinae, is a major pest in egg production, feeding on laying hens. Widely used non-chemical control methods include desiccant dusts, although their persistence under field conditions is often short. Entomopathogenic fungi may also hold potential for mite control, but these fungi often take several days to kill mites. Laboratory experiments were carried out to study the efficacy of 3 types of desiccant dusts, the fungus Beauveria bassiana and combinations of the two control agents against D. gallinae. There was significant synergistic interaction between each of the desiccant dusts and the fungus, with observed levels of mite mortality significantly higher than those expected for an additive effect (up to 38 % higher). Synergistic interaction between desiccant dust and fungus was found also when different application methods were used for the fungus and at different levels of relative humidity. Although increased levels of mortality were reached due to the synergistic interaction, the speed of lethal action was not influenced by combining the two components. The persistence of the control agents applied separately or in combination did not change over a period of 4 weeks. Overall, combinations of desiccant dusts and fungus conidia seem to hold considerable promise for future non-chemical control of poultry red mites.

Phomalactone from a Phytopathogenic Fungus Infecting ZINNIA elegans (ASTERACEAE) Leaves.

PubMed

Meepagala, Kumudini M; Johnson, Robert D; Techen, Natascha; Wedge, David E; Duke, Stephen O

2015-07-01

Zinnia elegans Jacq. plants are infected by a fungus that causes dark red spots with necrosis on leaves, particularly in late spring to the middle of summer in the Mid-South of the United States. This fungal disease causes the leaves to wilt and eventually kills the plant. The fungus was isolated, cultured in potato dextrose broth, and identified as Nigrospora sphaerica by molecular techniques. Two major lactone metabolites (phomalactone and catenioblin A) were isolated from liquid culture of N. sphaerica isolated from Z. elegans. When injected into leaves of Z. elegans, phomalactone caused lesions similar to those of the fungus. The lesion sizes were proportional to the concentration of the phomalactone. Phomalactone, but not catenioblin A, was phytotoxic to Z. elegans and other plant species by inhibition of seedling growth and by causing electrolyte leakage from photosynthetic tissues of both Z. elegans leaves and cucumber cotyledons. This latter effect may be related to the wilting caused by the fungus in mature Z. elegans plants. Phomalactone was moderately fungicidal to Coletotrichum fragariae and two Phomopsis species, indicating that the compound may keep certain other fungi from encroaching into plant tissue that N. sphaerica has infected. Production of large amounts of phomalactone by N. sphaerica contributes to the pathogenic behavior of this fungus, and may have other ecological functions in the interaction of N. sphaerica with other fungi. This is the first report of isolation of catenioblin A from a plant pathogenic fungus. The function of catenioblin A is unclear, as it was neither significantly phyto- nor fungitoxic.

Fungus symbionts colonizing the galleries of the ambrosia beetle Platypus quercivorus.

PubMed

Endoh, Rikiya; Suzuki, Motofumi; Okada, Gen; Takeuchi, Yuko; Futai, Kazuyoshi

2011-07-01

Isolations were made to determine the fungal symbionts colonizing Platypus quercivorus beetle galleries of dead or dying Quercus laurifolia, Castanopsis cuspidata, Quercus serrata, Quercus crispula, and Quercus robur. For these studies, logs from oak wilt-killed trees were collected from Kyoto Prefecture, Japan. Fungi were isolated from the: (1) entrances of beetle galleries, (2) vertical galleries, (3) lateral galleries, and (4) the larval cradle of P. quercivorus in each host tree. Among the fungus colonies which appeared on YM agar plates, 1,219 were isolated as the representative isolates for fungus species inhabiting in the galleries based on their cultural characteristics. The validity of the visual classification of the fungus colonies was checked and if necessary properly corrected using microsatellite-primed PCR fingerprints. The nucleotide sequence of the D1/D2 region of the large subunit nuclear rRNA gene detected 38 fungus species (104 strains) of which three species, i.e., Candida sp. 3, Candida kashinagacola (both yeasts), and the filamentous fungus Raffaelea quercivora were isolated from all the tree species. The two yeasts were most prevalent in the interior of galleries, regardless of host tree species, suggesting their close association with the beetle. A culture-independent method, terminal restriction fragment length polymorphism (T-RFLP) analysis was also used to characterize the fungus flora of beetle galleries. T-RFLP patterns showed that yeast species belonging to the genus Ambrosiozyma frequently occurred on the gallery walls along with the two Candida species. Ours is the first report showing the specific fungi inhabiting the galleries of a platypodid ambrosia beetle.

Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aylward, Frank O.; Burnum-Johnson, Kristin E.; Tringe, Susannah G.

Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass ismore » degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.« less

Species-specific ant brain manipulation by a specialized fungal parasite.

PubMed

de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P

2014-08-29

A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation by this specialized fungus and therefore represent a major advancement towards an understanding of the molecular mechanisms underlying this phenomenon.

Pneumocystis jiroveci pneumonia

MedlinePlus

Pneumocystis pneumonia; Pneumocystosis; PCP; Pneumocystis carinii ... This type of pneumonia is caused by the fungus Pneumocystis jiroveci . This fungus is common in the environment and rarely causes illness in ...

A specialized fungal parasite (Massospora cicadina) hijacks the sexual signals of periodical cicadas (Hemiptera: Cicadidae: Magicicada).

PubMed

Cooley, John R; Marshall, David C; Hill, Kathy B R

2018-01-23

Male periodical cicadas (Magicicada spp.) infected with conidiospore-producing ("Stage I") infections of the entomopathogenic fungus Massospora cicadina exhibit precisely timed wing-flick signaling behavior normally seen only in sexually receptive female cicadas. Male wing-flicks attract copulation attempts from conspecific males in the chorus; close contact apparently spreads the infective conidiospores. In contrast, males with "Stage II" infections that produce resting spores that wait for the next cicada generation do not produce female-specific signals. We propose that these complex fungus-induced behavioral changes, which resemble apparently independently derived changes in other cicada-Massospora systems, represent a fungus "extended phenotype" that hijacks cicadas, turning them into vehicles for fungus transmission at the expense of the cicadas' own interests.

Patterns of functional enzyme activity in fungus farming ambrosia beetles.

PubMed

De Fine Licht, Henrik H; Biedermann, Peter H W

2012-06-06

In wood-dwelling fungus-farming weevils, the so-called ambrosia beetles (Curculionidae: Scolytinae and Platypodinae), wood in the excavated tunnels is used as a medium for cultivating fungi by the combined action of digging larvae (which create more space for the fungi to grow) and of adults sowing and pruning the fungus. The beetles are obligately dependent on the fungus that provides essential vitamins, amino acids and sterols. However, to what extent microbial enzymes support fungus farming in ambrosia beetles is unknown. Here we measure (i) 13 plant cell-wall degrading enzymes in the fungus garden microbial consortium of the ambrosia beetle Xyleborinus saxesenii, including its primary fungal symbionts, in three compartments of laboratory maintained nests, at different time points after gallery foundation and (ii) four specific enzymes that may be either insect or microbially derived in X. saxesenii adult and larval individuals. We discovered that the activity of cellulases in ambrosia fungus gardens is relatively small compared to the activities of other cellulolytic enzymes. Enzyme activity in all compartments of the garden was mainly directed towards hemicellulose carbohydrates such as xylan, glucomannan and callose. Hemicellulolytic enzyme activity within the brood chamber increased with gallery age, whereas irrespective of the age of the gallery, the highest overall enzyme activity were detected in the gallery dump material expelled by the beetles. Interestingly endo-β-1,3(4)-glucanase activity capable of callose degradation was identified in whole-body extracts of both larvae and adult X. saxesenii, whereas endo-β-1,4-xylanase activity was exclusively detected in larvae. Similar to closely related fungi associated with bark beetles in phloem, the microbial symbionts of ambrosia beetles hardly degrade cellulose. Instead, their enzyme activity is directed mainly towards comparatively more easily accessible hemicellulose components of the ray-parenchyma cells in the wood xylem. Furthermore, the detection of xylanolytic enzymes exclusively in larvae (which feed on fungus colonized wood) and not in adults (which feed only on fungi) indicates that only larvae (pre-) digest plant cell wall structures. This implies that in X. saxesenii and likely also in many other ambrosia beetles, adults and larvae do not compete for the same food within their nests - in contrast, larvae increase colony fitness by facilitating enzymatic wood degradation and fungus cultivation.

Fungal arthritis

MedlinePlus

... examine you. Tests that may be ordered include: Culture of joint fluid that grows fungus Joint x-ray showing joint changes Positive antibody test (serology) for fungal disease Synovial biopsy showing fungus

Colonization by the arbuscular mycorrhizal fungus Glomus versiforme induces a defense response against the root-knot nematode Meloidogyne incognita in the grapevine (Vitis amurensis Rupr.), which includes transcriptional activation of the class III chitinase gene VCH3.

PubMed

Li, Hai-Yan; Yang, Guo-Dong; Shu, Huai-Rui; Yang, Yu-Tao; Ye, Bao-Xing; Nishida, Ikuo; Zheng, Cheng-Chao

2006-01-01

Inoculation of the grapevine (Vitis amurensis Rupr.) with the arbuscular mycorrhizal (AM) fungus Glomus versiforme significantly increased resistance against the root-knot nematode (RKN) Meloidogyne incognita. Studies using relative quantitative reverse transcription-PCR (RQRT-PCR) analysis of grapevine root inoculation with the AM fungus revealed an up-regulation of VCH3 transcripts. This increase was greater than that observed following infection with RKN. However, inoculation of the mycorrhizal grapevine roots with RKN was able to enhance VCH3 transcript expression further. Moreover, the increase in VCH3 transcripts appeared to result in a higher level of resistance against subsequent RKN infection. Constitutive expression of VCH3 cDNA in transgenic tobacco under the control of the cauliflower mosaic virus 35S promoter also conferred resistance against RKN, but had no significant effect on the growth of the AM fungus. We analyzed beta-glucuronidase (GUS) activity directed by a 1,216 bp VCH3 promoter in transgenic tobacco following inoculation with both the AM fungus and RKN. GUS activity was negligible in the root tissues before inoculation, and was more effectively induced after inoculation with the AM fungus than with RKN. Moreover, GUS staining in the mycorrhizal transgenic tobacco roots was enhanced by subsequent RKN infection, and was found ubiquitously throughout the whole root tissue. Together, these results suggest that AM fungus induced a defense response against RKN in the mycorrhizal grapevine roots, which appeared to involve transcriptional control of VCH3 expression throughout the whole root tissue.

A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

PubMed

Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

2013-06-01

The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Mucor indicus: biology and industrial application perspectives: a review.

PubMed

Karimi, Keikhosro; Zamani, Akram

2013-01-01

Mucor indicus, one of the most important strains of zygomycetes fungi, has been the subject of several studies since a couple of hundred years ago. This fungus, regarded as a non-pathogenic dimorphic microorganism, is used for production of several beers and foods. Morphology of the fungus can be manipulated and well controlled by changing a number of parameters. Furthermore, M. indicus can grow on a variety of substrates including lignocellulosic hydrolysates which are mixtures of hexoses, pentoses, and different severe fermentation inhibitors. Indeed, high yield ethanol production is among the most important features of this strain. Presence of considerable amounts of chitosan in the cell wall is another important aspect of the fungus. Besides production of ethanol and chitosan, the biomass of this fungus has shown a great potential to be used as a rich nutritional source, e.g. fish feed. The fungus is also among the oleaginous fungi and produces high amounts of polyunsaturated fatty acids particularly γ-linolenic acid. Furthermore, the biomass autolysate has a high potential for yeast extract replacement in fermentation by the fungus. Additionally, the strain has shown promising results in heavy metal removal from wastewaters. This review discusses different aspects of biology and industrial application perspectives of M. indicus. Furthermore, open areas for the future basic and applied levels of research are also presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Biological control of trichostrongyles in beef cattle by the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

PubMed

Assis, R C L; Luns, F D; Araújo, J V; Braga, F R

2012-11-01

The efficacy of a fungal formulation based on the nematophagous fungus Duddingtonia flagrans was assessed in the control of cattle trichostrongyles. Twenty male Nellore calves, six-month-old, divided in two groups (fungus-treated and control without fungus) were fed on a pasture of Brachiaria decumbens naturally infected with larvae of bovine trichostrongyles. Animals of the treated group received doses of sodium alginate mycelial pellets orally (1 g/10 kg live weight, twice a week), for 12 months. Feces samples were collected for egg count (eggs per gram of feces-EPG) and coprocultures during 12 months. There was a significant reduction in EPG (56.7%) and infective larvae (L3) in coprocultures (60.5%) for animals of the treated group in relation to the control group at the end of the study. There was a significant reduction of L3 (64.5%) in herbage samples collected up to 0-20 cm from fecal pats and 73.2% in distant samples (20-40 cm) between the fungus-treated group and the control group. The treatment with sodium alginate pellets containing the nematode trapping fungus D. flagrans reduced trichostrongylid in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in beef cattle. Copyright © 2012 Elsevier Inc. All rights reserved.

The nematophagous fungus Monacrosporium thaumasium and its nematicidal activity on Angiostrongylus vasorum.

PubMed

Soares, Filippe Elias de Freitas; Braga, Fabio Ribeiro; de Araújo, Jackson Victor; Lima, Walter dos Santos; de Queiroz, José Humberto

2015-01-01

The dog acts as a reservoir and environmental disseminator of potentially zoonotic parasites. The objective of this work was to study the fungus Monacrosporium thaumasium regarding its nematicidal potential in laboratory trials and its proteolytic profile. The in vitro test was carried out through two assays (A and B). In assay A, conidia of the fungus N34a were added in positive coprocultures for Angiostrongylus vasorum. In assay B, crude extract (treated group) and distilled water (control group) were added to coprocultures. Next, the proteolytic profile of crude extract of the nematophagous fungus M. thaumasium (NF34a) was revealed by performing a zymogram. There was a reduction (p<0.01) in the averages of larvae recovered from the treated groups (conidia and crude extract) in relation to control groups. The zymogram suggested that the nematophagous fungus M. thaumasium produces a protease of approximately 40 kDa. The results of this work confirm that the conidia as well as the crude extract of the fungus M. thaumasium may be used to control A. vasorum L1. The proteolytic profile suggested the presence of one protease (Mt1) of approximately 40 kDa that in the future may be used in biological control of L1 of this nematode. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Paracoccidioidomycosis

MedlinePlus

... brasiliensis . Spores of the fungus, which grow in soil, may be inhaled. Most people have no symptoms, ... inhaling spores of the fungus, which grow in soil. Paracoccidioidomycosis usually involves the lungs, skin, mouth, throat, ...

Histoplasmosis

MedlinePlus

... by the fungus. Soil that contains bird or bat droppings may have larger amounts of this fungus. ... by reducing exposure to dust in chicken coops, bat caves, and other high-risk locations. Wear masks ...

Histoplasmosis

MedlinePlus

... is a disease caused by a fungus (or mold) called Histoplasma. The fungus is common in the eastern and central United States. It grows in soil and material contaminated with bat or bird droppings. ...

Approaches for monitoring the release of Pochonia chlamydosporia var. catenulata, a biocontrol agent of root-knot nematodes.

PubMed

Atkins, Simon D; Hidalgo-Diaz, Leopoldo; Clark, Ian M; Morton, C Oliver; de Oca, Nivian Montes; Gray, Paul A; Kerry, Brian R

2003-02-01

Pochonia chlamydosporia var. catenulata is a potential biocontrol agent against root-knot nematodes. Diagnosis of isolates has relied on morphological identification, and is both time-consuming and difficult. beta-tubulin primers have been developed for the identification of this fungus that were specific enough to distinguish between varieties of the fungus within the same species. Separate primers have been developed for the specific detection of P. chlamydosporia var. catenulata based on ITS sequences, which were able to detect the fungus in soil from various sites in Cuba where the biocontrol agent had been added. When the PCR diagnosis was combined with serial dilution of soil samples on selective medium, colonies were rapidly identified. The fungus was still present, albeit at low densities, in soils inoculated five years previously. The development of a baiting method allowed quick in situ screening of the isolates' ability to infect nematode eggs, and when combined with PCR diagnosis both varieties of the fungus could be detected in infected eggs. RFLP analysis of ITS sequences from P. chlamydosporia provided an extra level of discrimination between isolates.

50 CFR Appendix A to Part 622 - Species Tables

Code of Federal Regulations, 2013 CFR

2013-10-01

... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

50 CFR Appendix A to Part 622 - Species Tables

Code of Federal Regulations, 2014 CFR

2014-10-01

... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

[Analysis of hot spots and trend of molecular pharmacognosy research based on project supported by National Natural Science Foundation of 1995-2014].

PubMed

Wang, Jun-Wen; Liu, Yang; Tong, Yuan-Yuan; Yang, Ce; Li, Hai-Yan

2016-05-01

This study collected 1995-2014 molecular pharmacognosy study, a total of 595 items, funded by Natural Science Foundation of China (NSFC). TDA and Excel software were used to analyze the data of the projects about general situation, hot spots of research with rank analytic and correlation analytic methods. Supported by NSFC molecular pharmacognosy projects and funding a gradual increase in the number of, the proportion of funds for pharmaceutical research funding tends to be stable; mainly supported by molecular biology methods of genuine medicinal materials, secondary metabolism and Germplasm Resources Research; hot drugs including Radix Salviae Miltiorrhizae, Radix Rehmanniae, Cordyceps sinensis, hot contents including tanshinone biosynthesis, Rehmannia glutinosa continuous cropping obstacle. Copyright© by the Chinese Pharmaceutical Association.

First report of Albizia lebbeck dieback caused by Scytalidium dimidiatum in Oman.

PubMed

Elshafie, Abdulkadir E; Ba-Omar, Taher

2002-01-01

Over 200 Albizia lebbeck trees at Sultan Qaboos University campus wilted and died. The symptoms were dieback of large branches due to infection by Scytalidium dimidiatum. The fungus has also infected Ficus benghalensis, F. carica, F. retusa, Thespesia populnea, Delonix regia and Peltophorum petrocarpum. This is the first report of the fungus in Oman and on A. lebbeck, T. populnea, D. regia and P. petrocarpum. The strain of this fungus has not been found to cause human disease in Oman.

Antimicrobials from the marine algal endophyte Penicillium sp.

PubMed

Flewelling, Andrew J; Johnson, John A; Gray, Christopher A

2013-03-01

An endophytic fungus identified as Penicillium sp. was isolated from the brown alga Fucus spiralis collected from the Shetland Islands, United Kingdom. Bioassay-guided fractionation of an extract of the fungus led to the isolation of cladosporin, epiepoformin, phyllostine, and patulin, all of which showed antimicrobial activity against either Staphylococcus aureus or Pseudomonas aeruginosa. Cladosporin has not previously been identified from a fungus of the genus Penicillium, and, despite being biosynthetically related, epiepoformin, phyllostine and patulin have not been previously reported from one source.

Quantitative evaluation of protocorm growth and fungal colonization in Bletilla striata (Orchidaceae) reveals less-productive symbiosis with a non-native symbiotic fungus.

PubMed

Yamamoto, Tatsuki; Miura, Chihiro; Fuji, Masako; Nagata, Shotaro; Otani, Yuria; Yagame, Takahiro; Yamato, Masahide; Kaminaka, Hironori

2017-02-21

In nature, orchid plants depend completely on symbiotic fungi for their nutrition at the germination and the subsequent seedling (protocorm) stages. However, only limited quantitative methods for evaluating the orchid-fungus interactions at the protocorm stage are currently available, which greatly constrains our understanding of the symbiosis. Here, we aimed to improve and integrate quantitative evaluations of the growth and fungal colonization in the protocorms of a terrestrial orchid, Blettila striata, growing on a plate medium. We achieved both symbiotic and asymbiotic germinations for the terrestrial orchid B. striata. The protocorms produced by the two germination methods grew almost synchronously for the first three weeks. At week four, however, the length was significantly lower in the symbiotic protocorms. Interestingly, the dry weight of symbiotic protocorms did not significantly change during the growth period, which implies that there was only limited transfer of carbon compounds from the fungus to the protocorms in this relationship. Next, to evaluate the orchid-fungus interactions, we developed an ink-staining method to observe the hyphal coils in protocorms without preparing thin sections. Crushing the protocorm under the coverglass enables us to observe all hyphal coils in the protocorms with high resolution. For this observation, we established a criterion to categorize the stages of hyphal coils, depending on development and degradation. By counting the symbiotic cells within each stage, it was possible to quantitatively evaluate the orchid-fungus symbiosis. We describe a method for quantitative evaluation of orchid-fungus symbiosis by integrating the measurements of plant growth and fungal colonization. The current study revealed that although fungal colonization was observed in the symbiotic protocorms, the weight of the protocorm did not significantly increase, which is probably due to the incompatibility of the fungus in this symbiosis. These results suggest that fungal colonization and nutrition transfer can be differentially regulated in the symbiosis. The evaluation methods developed in this study can be used to study various quantitative aspects of the orchid-fungus symbiosis.

FLUORESCENT-SERIOLOGICAL INVESTIGATIONS OF A PATHOGENIC FUNGUS (SPOROTRICHUM SCHENCKII),

DTIC Science & Technology

coloration of numerous other species of fungus no cross reactions with Sporotrichum schenkii were found. The use of this fluorescent coloring method for the diagnosis of Sporotrichosis is suggested. (Author)

Athlete's Foot

MedlinePlus

... this page. Please enable Javascript in your browser. Athlete's Foot Athlete's foot is a skin infection caused by fungus. A ... the body; on the foot, it is called athlete’s foot, or tinea pedis. Fungus commonly attacks the feet ...

The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

PubMed

Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

2010-03-01

The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

The Hidden Habit of the Entomopathogenic Fungus Beauveria bassiana: First Demonstration of Vertical Plant Transmission

PubMed Central

Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

2014-01-01

Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120–140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum. PMID:24551242

Distribution and environmental persistence of the causative agent of white-nose syndrome, Geomyces destructans, in bat hibernacula of the eastern United States

USGS Publications Warehouse

Lorch, Jeffrey M.; Muller, Laura K.; Russell, Robin E.; O'Connor, Michael; Lindner, Daniel L.; Blehert, David S.

2013-01-01

White-nose syndrome (WNS) is an emerging disease of hibernating bats caused by the recently described fungus Geomyces destructans. First isolated in 2008, the origins of this fungus in North America and its ability to persist in the environment remain undefined. To investigate the correlation between manifestation of WNS and distribution of G. destructans in the U.S., we analyzed sediment samples collected from 55 bat hibernacula (caves and mines) both within and outside the known range of WNS using a newly developed real-time PCR assay. Geomyces destructans was detected in 17 of 21 sites within the known range of WNS at the time the samples were collected; the fungus was not found in 28 sites beyond the known range of the disease at the time that environmental samples were collected. These data indicate that distribution of G. destructans is correlated with disease in hibernating bats and support the hypothesis that the fungus is likely an exotic species in North America. Additionally, we examined whether G. destructans persists in infested bat hibernacula when bats are absent. Sediment samples were collected from 14 WNS-positive hibernacula, and the samples were screened for viable fungus using a culture technique. Viable G. destructans was cultivated from 7 of the 14 sites sampled during late summer when bats were no longer in hibernation, suggesting the fungus can persist in the environment in the absence of bat hosts for long periods of time.

The hidden habit of the entomopathogenic fungus Beauveria bassiana: first demonstration of vertical plant transmission.

PubMed

Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

2014-01-01

Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120-140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum.

Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.

2012-09-01

Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence andmore » three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.« less

Trichoderma virens as a biocontrol of Toxocara canis: In vivo evaluation.

PubMed

de Souza Maia Filho, Fernando; da Silva Fonseca, Anelise Oliveira; Persici, Beatriz Maroneze; de Souza Silveira, Julia; Braga, Caroline Quintana; Pötter, Luciana; de Avila Botton, Sônia; Brayer Pereira, Daniela Isabel

Microorganisms have been widely studied as biological control agents of parasites of medical and veterinary importance. Coprophagous arthropods, bacteria and fungi are among the different organisms evaluated as potential biological control agents. Nematophagous fungi capture and digest the free forms of nematodes in the soil. Due to its zoonotic potential, Toxocara canis have been brought to the attention of researchers. The aim of the present study was to determine whether the administration of embryonated T. canis eggs exposed to the nematophagous fungus Trichoderma virens reduces parasite infection in experimental animals. Embryonated T. canis eggs were exposed to T. virens mycelium for 15 days at 25°C. Subsequently, 100 fungus-exposed eggs were orally administered to 20 Swiss mice. As a positive control, another 20 mice received 100 embryonated eggs that were not exposed to the fungus. After 48h, the animals were killed, and heart, lungs and liver were harvested for the recovery of larvae. The organs of the animals that received embryonated T. canis eggs exposed to the fungus showed a lower mean larval recovery when compared with the animals that received embryonated eggs without fungus exposure (p<0.05). The exposure of T. canis eggs to T. virens reduces the experimental infection, demonstrating the potential of this nematophagous fungus as a biocontrol agent. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Fungus-insect gall of Phlebopus portentosus.

PubMed

Zhang, Chun-Xia; He, Ming-Xia; Cao, Yang; Liu, Jing; Gao, Feng; Wang, Wen-Bing; Ji, Kai-Ping; Shao, Shi-Cheng; Wang, Yun

2015-01-01

Phlebopus portentosus is a popular edible wild mushroom found in the tropical Yunnan, China, and northern Thailand. In its natural habitats, a gall often has been found on some plant roots, around which fungal fruiting bodies are produced. The galls are different from common insect galls in that their cavity walls are not made from plant tissue but rather from the hyphae of P. portentosus. Therefore we have termed this phenomenon "fungus-insect gall". Thus far six root mealy bug species in the family Pseudococcidae that form fungus-insect galls with P. portentosus have been identified: Formicococcus polysperes, Geococcus satellitum, Planococcus minor, Pseudococcus cryptus, Paraputo banzigeri and Rastrococcus invadens. Fungus-insect galls were found on the roots of more than 21 plant species, including Delonix regia, Citrus maxima, Coffea arabica and Artocarpus heterophyllus. Greenhouse inoculation trials showed that fungus-insect galls were found on the roots of A. heterophyllus 1 mo after inoculation. The galls were subglobose to globose, fulvous when young and became dark brown at maturation. Each gall harbored one or more mealy bugs and had a chimney-like vent for ventilation and access to the gall. The cavity wall had three layers. Various shaped mealy bug wax deposits were found inside the wall. Fungal hyphae invaded the epidermis of plant roots and sometimes even the cortical cells during the late stage of gall development. The identity of the fungus inside the cavity was confirmed by molecular methods. © 2015 by The Mycological Society of America.

Viral repression of fungal pheromone precursor gene expression.

PubMed

Zhang, L; Baasiri, R A; Van Alfen, N K

1998-02-01

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G alpha(i) subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete.

Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens.

PubMed

Aylward, Frank O; Burnum, Kristin E; Scott, Jarrod J; Suen, Garret; Tringe, Susannah G; Adams, Sandra M; Barry, Kerrie W; Nicora, Carrie D; Piehowski, Paul D; Purvine, Samuel O; Starrett, Gabriel J; Goodwin, Lynne A; Smith, Richard D; Lipton, Mary S; Currie, Cameron R

2012-09-01

Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant neotropical herbivores cultivate symbiotic fungus gardens on large quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers. Using metagenomic and metaproteomic techniques, we characterize the bacterial diversity and physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter and Escherichia. We show that these bacterial communities possess genes associated with lignocellulose degradation and diverse biosynthetic pathways, suggesting that they play a role in nutrient cycling by converting the nitrogen-poor forage of the ants into B-vitamins, amino acids and other cellular components. Our metaproteomic analysis confirms that bacterial glycosyl hydrolases and proteins with putative biosynthetic functions are produced in both field-collected and laboratory-reared colonies. These results are consistent with the hypothesis that fungus gardens are specialized fungus-bacteria communities that convert plant material into energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities in the ecology and evolution of herbivorous metazoans.

An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat

PubMed Central

Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L.; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F.; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A.; Schweizer, Patrick

2016-01-01

Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici. Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei. Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus. PMID:28018377

An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat.

PubMed

Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A; Schweizer, Patrick

2016-01-01

Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8 ) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici . Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei . Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus.

Fabrication of a superhydrophobic surface with fungus-cleaning properties on brazed aluminum for industrial application in heat exchangers

NASA Astrophysics Data System (ADS)

Lee, Jeong-Won; Hwang, Woonbong

2018-06-01

Extensive research has been carried out concerning the application of superhydrophobic coating in heat exchangers, but little is known about the application of this technique to brazed aluminum heat exchangers (BAHEs). In this work, we describe a new superhydrophobic coating method, which is suitable for BAHE use on an industrial scale. We first render the BAHE superhydrophobic by fabricating micro/nanostructures using solution dipping followed by fluorination. After the complete removal of the silicon residue, we verify using surface analysis that the BAHE surface is perfectly superhydrophobic. We also studied the fungus-cleaning properties of the superhydrophobic surface by growing fungus for 4 weeks in a moist environment on BAHE fins with and without superhydrophobic coating. We observed that, whereas the fungus grown on the untreated fins is extremely difficult to remove, the fungus on the fins with the superhydrophobic coating can be removed easily with only a modest amount of water. We also found that the coated BAHE fins exhibit excellent resistance to moisture. The superhydrophobic coating method that we propose is therefore expected to have a major impact in the heating, ventilating and air conditioning industry market.

Vertical transmission as the key to the colonization of Madagascar by fungus-growing termites?

PubMed Central

Nobre, T.; Eggleton, P.; Aanen, D. K.

2010-01-01

The mutualism between fungus-growing termites (Macrotermitinae) and their mutualistic fungi (Termitomyces) began in Africa. The fungus-growing termites have secondarily colonized Madagascar and only a subset of the genera found in Africa is found on this isolated island. Successful long-distance colonization may have been severely constrained by the obligate interaction of the termites with fungal symbionts and the need to acquire these symbionts secondarily from the environment for most species (horizontal symbiont transmission). Consistent with this hypothesis, we show that all extant species of fungus-growing termites of Madagascar are the result of a single colonization event of termites belonging to one of the only two groups with vertical symbiont transmission, and we date this event at approximately 13 Mya (Middle/Upper Miocene). Vertical symbiont transmission may therefore have facilitated long-distance dispersal since both partners disperse together. In contrast to their termite hosts, the fungal symbionts have colonized Madagascar multiple times, suggesting that the presence of fungus-growing termites may have facilitated secondary colonizations of the symbiont. Our findings indicate that the absence of the right symbionts in a new environment can prevent long-distance dispersal of symbioses relying on horizontal symbiont acquisition. PMID:19828546

Serine proteases activity is important for the interaction of nematophagous fungus Duddingtonia flagrans with infective larvae of trichostrongylides and free-living nematodes Panagrellus spp.

PubMed

Cruz, Daniela G; Costa, Luana M; Rocha, Letícia O; Retamal, Claudio A; Vieira, Ricardo A M; Seabra, Sergio H; Silva, Carlos P; DaMatta, Renato A; Santos, Clóvis P

2015-08-01

The nematode-trapping fungus Duddingtonia flagrans has been studied as a possible control method for gastrointestinal nematodes of livestock animals. These fungi capture and infect the nematode by cuticle penetration, immobilization, and digestion of the internal contents. It has been suggested that this sequence of events occurs by a combination of physical and enzymatical activities. The aim of this study was to investigate the participation of proteolytic enzymatic activity during the interaction of the nematophagous fungus D. flagrans with infective larvae of trichostrongylides and the free-living nematode Panagrellus spp. Protease inhibitors used interfered in the predatory activity of D. flagrans. However, only PMSF significantly reduced the mean number of Panagrellus spp. captured by D. flagrans in comparison with the control. The experiment with fluorogenic substrate showed that maximum urokinase activity during the interaction of the fungus with the infective larvae of trichostrongylides or Panagrellus spp. occurred within 7 or 1 h of incubation, respectively. The protease activity, especially of the serine class, may be important during the interaction between the fungus and nematodes. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

[Biochemical basis of tolerance to osmotic stress in phytopathogenic fungus: The case of Macrophomina phaseolina (Tassi) Goid.

PubMed

Martínez-Villarreal, Rodolfo; Garza-Romero, Tamar S; Moreno-Medina, Víctor R; Hernández-Delgado, Sanjuana; Mayek-Pérez, Netzahualcoyotl

Fungus Macrophomina phaseolina (Tassi) Goid. is the causative agent of charcoal rot disease which causes significant yield losses in major crops such as maize, sorghum, soybean and common beans in Mexico. This fungus is a facultative parasite which shows broad ability to adapt itself to stressed environments where water deficits and/or high temperature stresses commonly occur. These environmental conditions are common for most cultivable lands throughout Mexico. Here we describe some basic facts related to the etiology and epidemiology of the fungus as well as to the importance of responses to stressed environments, particularly to water deficits, based on morphology and growth traits, as well as on physiology, biochemistry and pathogenicity of fungus M. phaseolina. To conclude, we show some perspectives related to future research into the genus, which emphasize the increasing need to improve the knowledge based on the application of both traditional and biotechnological tools in order to elucidate the mechanisms of resistance to environmental stress which can be extrapolated to other useful organisms to man. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus.

PubMed

Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk; Lee, Tae Soo

2016-03-01

Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously.

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2012 CFR

2012-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2013 CFR

2013-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2011 CFR

2011-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

Genetic Recombination

ERIC Educational Resources Information Center

Whitehouse, H. L. K.

1973-01-01

Discusses the mechanisms of genetic recombination with particular emphasis on the study of the fungus Sordaria brevicollis. The study of recombination is facilitated by the use of mutants of this fungus in which the color of the ascospores is affected. (JR)

Inhibitory mechanisms of CME-1, a novel polysaccharide from the mycelia of Cordyceps sinensis, in platelet activation.

PubMed

Chang, Yi; Hsu, Wen-Hsien; Lu, Wan-Jung; Jayakumar, Thanasekaran; Liao, Jiun-Cheng; Lin, Mei-Jiun; Wang, Shwu-Huey; Geraldine, Pitchairaj; Lin, Kuan-Hung; Sheu, Joen-Rong

2015-01-01

CME-1 is a polysaccharide purified from the mycelia of medicinal mushroom Cordyceps sinensis, its molecular weight was determined to be 27.6 kDa by using nuclear magnetic resonance and gas chromatography-mass spectrometry. The initiation of arterial thromboses is relevant to various cardiovascular diseases (CVDs) and is believed to involve platelet activation. Our recent study exhibited that CME-1 has potent antiplatelet activity via the activation of adenylate cyclase/cyclic AMP ex vivo and in vivo. The aggregometry, and immunoblotting were used in this study. In this study, the mechanisms of CME-1 in platelet activation is further investigated and found that CME-1 inhibited platelet aggregation as well as the ATP-release reaction, relative intracellular [Ca(+2)] mobilization, and the phosphorylation of phospholipase C (PLC)γ2 and protein kinase C (PKC) stimulated by collagen. CME-1 has no effects on inhibiting either convulxin, an agonist of glycoprotein VI, or aggretin, an agonist of integrin α2β1 stimulated platelet aggregation. Moreover, this compound markedly diminished thrombin and arachidonic acid (AA) induced phosphorylation of p38 mitogen-activated protein kinase (MAPK), extracellular signal-regulated kinase 2, c-Jun N-terminal kinase 1, and Akt. Treatment with SQ22536, an inhibitor of adenylate cyclase, markedly diminished the CME-1-mediated increasing of cyclic AMP level and reversed prostaglandin E1- or CME-1-mediated inhibition of platelet aggregation and p38 MAPK and Akt phosphorylation stimulated by thrombin or AA. Furthermore, phosphodiesterase activity of human platelets was not altered by CME-1. The crucial finding of this study is that the antiplatelet activity of CME-1 may initially inhibit the PLCγ2-PKC-p47 cascade, and inhibit PI3-kinase/Akt and MAPK phosphorylation through adenylate cyclase/ cyclic AMP activation, then inhibit intracellular [Ca(+2)] mobilization, and, ultimately, inhibit platelet activation. The novel role of CME-1 in antiplatelet activity indicates that this compound exhibits high therapeutic potential for treating or preventing CVDs.

Cultured Mycelium Cordyceps sinensis allevi¬ates CCl4-induced liver inflammation and fibrosis in mice by activating hepatic natural killer cells.

PubMed

Peng, Yuan; Huang, Kai; Shen, Li; Tao, Yan-yan; Liu, Cheng-hai

2016-02-01

Recent evidence shows that cultured mycelium Cordyceps sinensis (CMCS) effectively protects against liver fibrosis in mice. Here, we investigated whether the anti-fibrotic action of CMCS was related to its regulation of the activity of hepatic natural killer (NK) cells in CCl4-treated mice. C57BL/6 mice were injected with 10% CCl4 (2 mL/kg, ip) 3 times per week for 4 weeks, and received CMCS (120 mg·kg(-1)·d(-1), ig) during this period. In another part of experiments, the mice were also injected with an NK cell-deleting antibody ASGM-1 (20 μg, ip) 5 times in the first 3 weeks. After the mice were sacrificed, serum liver function, and liver inflammation, hydroxyproline content and collagen deposition were assessed. The numbers of hepatic NK cells and expression of NKG2D (activation receptor of NK cells) on isolated liver lymphocytes were analyzed using flow cytometry. Desmin expression and cell apoptosis in liver tissues were studied using desmin staining and TUNEL assay, respectively. The levels of α-SMA, TGF-β, RAE-1δ and RAE-1ε in liver tissues were determined by RT-qPCR. In CCl4-treated mice, CMCS administration significantly improved liver function, attenuated liver inflammation and fibrosis, and increased the numbers of hepatic NK cells and expression level of NKG2D on hepatic NK cells. Furthermore, CMCS administration significantly decreased desmin expression in liver tissues, and increased TUNEL staining adjacent to hepatic stellate cells. Injection with NK cell-deleting ASGM-1 not only diminished the numbers of hepatic NK cells, but also greatly accelerated liver inflammation and fibrosis in CCl4-treated mice. In CCl4-treated mice with NK cell depletion, CMCS administration decelerated the rate of liver fibrosis development, and mildly upregulated the numbers of hepatic NK cells but without changing NKG2D expression. CMCS alleviates CCl4-induced liver inflammation and fibrosis via promoting activation of hepatic NK cells. CMCS partially reverses ASGM-1-induced depletion of hepatic NK cells.

Ex vivo and in vivo studies of CME-1, a novel polysaccharide purified from the mycelia of Cordyceps sinensis that inhibits human platelet activation by activating adenylate cyclase/cyclic AMP.

PubMed

Lu, Wan-Jung; Chang, Nen-Chung; Jayakumar, Thanasekaran; Liao, Jiun-Cheng; Lin, Mei-Jiun; Wang, Shwu-Huey; Chou, Duen-Suey; Thomas, Philip Aloysius; Sheu, Joen-Rong

2014-12-01

CME-1, a novel water-soluble polysaccharide, was purified from the mycelia of Cordyceps sinensis, and its chemical structure was characterized to contain mannose and galactose in a ratio of 4:6 (27.6 kDa). CME-1 was originally observed to exert a potent inhibitory effect on tumor migration and a cytoprotective effect against oxidative stress. Activation of platelets caused by arterial thrombosis is relevant to various cardiovascular diseases (CVDs). However, no data are available concerning the effects of CME-1 on platelet activation. Hence, the purpose of this study was to examine the ex vivo and in vivo antithrombotic effects of CME-1 and its possible mechanisms in platelet activation. The aggregometry, immunoblotting, flow cytometric analysis and platelet functional analysis were used in this study. CME-1 (2.3-7.6 μM) exhibited highly potent activity in inhibiting human platelet aggregation when stimulated by collagen, thrombin, and arachidonic acid but not by U46619. CME-1 inhibited platelet activation accompanied by inhibiting Akt, mitogen-activated protein kinases (MAPKs), thromboxane B2 (TxB2) and hydroxyl radical (OH(●)) formation. However, CME-1 interrupted neither FITC-triflavin nor FITC-collagen binding to platelets. CME-1 markedly increased cyclic AMP levels, but not cyclic GMP levels, and stimulated vasodilator-stimulated phosphoprotein (VASP) phosphorylation. SQ22536, an inhibitor of adenylate cyclase, but not ODQ, an inhibitor of guanylate cyclase, obviously reversed the CME-1-mediated effects on platelet aggregation and vasodilator-stimulated phosphoprotein (VASP), Akt, p38 MAPK phosphorylation, and TxB2 formation. CME-1 substantially prolonged the closure time of whole blood and the occlusion time of platelet plug formation. This study demonstrates for the first time that CME-1 exhibits highly potent antiplatelet activity that may initially activate adenylate cyclase/cyclic AMP and, subsequently, inhibit intracellular signals (such as Akt and MAPKs), ultimately inhibiting platelet activation. This novel role of CME-1 indicates that CME-1 exhibits high potential for application in treating and preventing CVDs. Copyright © 2014 Elsevier Ltd. All rights reserved.

Chemical constituents of the mangrove-associated fungus Capnodium sp. SZ-F22. A new eremophilane sesquiterpene.

PubMed

He, Haibing; Ma, Zhongjun; Wang, Qianqian; Liu, Yu; Xu, Hualin

2016-07-01

A new eremophilane sesquiterpene, capnodiumone (1), along with five known eremophilane sesquiterpenes (2-6) and eight other compounds (7-14), have been isolated from a mangrove-associated fungus Capnodium sp. SZ-F22. The chemical structures were elucidated on the basis of extensive spectroscopic analysis. The broth extract of the fungus exhibited a good inhibitory effect on the mycelium growth against Fusarium graminearum at 100 μg/mL, however, all the 14 compounds showed no expected antifungal activity. The probable reasons were discussed.

The research of using Co-60 γ ray to sterilize different mediums for edible fungus

NASA Astrophysics Data System (ADS)

Guozhu, Li; Zhenqian, Guan; Hengshou, Zhao

1993-10-01

The present experiment has been carried out by using different dosage of Co—60 γ ray for radiation sterilization of five kinds of cultural materials of edible fungus, The results indicated that sterilization dosage of sawdust is 22 kGy. that of cotton—seed shell and the rest are 26 kGy. We conclude that using Co-60 γ ray to sterilize the cultura 1 materials of edible fungus is a secure and saving labor and energy new method which could sterilize thoroughly.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Colonization of soil by Histoplasma capsulatum: II. Effect of bat guano added to an area of reduced colonization.

PubMed

Hasenclever, H F; Piggott, W R

1976-07-01

Application of bat guano to an area with reduced but detectable colonization by Histoplasma capsulatum had no quantitative effect on the fungus. After seeding the guano treated area and an untreated area with a soil culture of the fungus, a quantitative effect was noted in the treated area but the period of survival did not appear to be extended. Twenty-four months after seeding, the fungus was no longer detectable in the study areas and they have remained negative for more than a year.

Process for producing ethanol from plant biomass using the fungus paecilomyces sp.

DOEpatents

Wu, Jung Fu

1989-01-01

A process for producing ethanol from plant biomass is disclosed. The process in cludes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces, which has the ability to ferment both cellobiose and xylose to ethanol, is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate.

Process for producing ethanol from plant biomass using the fungus Paecilomyces sp

DOEpatents

Wu, J.F.

1985-08-08

A process for producing ethanol from plant biomass is disclosed. The process includes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces which has the ability to ferment both cellobiose and xylose to ethanol is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate. 5 figs., 3 tabs.

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia.

PubMed

Gabriel, Frédéric; D'Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2013-02-09

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries.

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia

PubMed Central

Gabriel, Frédéric; D’Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2013-01-01

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries. PMID:24432214

Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites

PubMed Central

Pedersen, Kristine S. K.; Aanen, Duur K.

2017-01-01

ABSTRACT Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ. Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. PMID:29269491

Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites.

PubMed

da Costa, Rafael R; Hu, Haofu; Pilgaard, Bo; Vreeburg, Sabine M E; Schückel, Julia; Pedersen, Kristine S K; Kračun, Stjepan K; Busk, Peter K; Harholt, Jesper; Sapountzis, Panagiotis; Lange, Lene; Aanen, Duur K; Poulsen, Michael

2018-03-01

Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. Copyright © 2018 da Costa et al.

76 FR 7095 - Avocados Grown in South Florida; Increased Assessment Rate

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-09

... Red Bay Ambrosia beetle. The beetle carries the Laurel Wilt fungus which can infect and kill avocado trees. Research into the beetle and fungus had been funded by the University of Florida. However, the...

Focus on Fungi

ERIC Educational Resources Information Center

Flannery, Maura C.

2004-01-01

A mention of "The Fungus Fighters: Two Women Scientists and Their Discovery" by Richard Baldwin and discovery of a huge fungus of the species Armillaria bulbosa and A. ostoyae are presented. Other aspects like fungal infections and shifting relationships are discussed.

Multifarious plant growth promotion by an entomopathogenic fungus Lecanicillium psalliotae.

PubMed

Senthil Kumar, C M; Jacob, T K; Devasahayam, S; Thomas, Stephy; Geethu, C

2018-03-01

An entomopathogenic fungus, Lecanicillium psalliotae strain IISR-EPF-02 previously found infectious to cardamom thrips, Sciothrips cardamomi promoted plant growth in cardamom, Elettaria cardamomum. The isolate exhibited direct plant growth promoting traits by production of indole-3-acetic acid and ammonia and by solubilizing inorganic phosphate and zinc. It also showed indirect plant growth promoting traits by producing siderophores and cell wall-degrading enzymes like, α-amylases, cellulases and proteases. In pot culture experiments, application of the fungus at the root zone of cardamom seedlings significantly increased shoot and root length, shoot and root biomass, number of secondary roots and leaves and leaf chlorophyll content compared to untreated plants. This is the first report on the plant growth promoting traits of this fungus. The entomopathogenic and multifarious growth promoting traits of L. psalliotae strain IISR-EPF-02 suggest that it has great potential for exploitation in sustainable agriculture. Copyright © 2017 Elsevier GmbH. All rights reserved.

Myco-fluidics: The fluid dynamics of fungal chimerism

NASA Astrophysics Data System (ADS)

Roper, Marcus; Hickey, Patrick; Dressaire, Emilie; Roch, Sebastien

2012-11-01

Chimeras-fantastical creatures formed as amalgams of many animals-have captured the human imagination since Ancient times. But they are also surprisingly common in Nature. The syncytial cells of filamentous fungi harbor large numbers of nuclei bathed in a single cytoplasm. As a fungus grows these nuclei become genetically diverse, either from mutation or from exchange of nuclei between different fungal individuals, a process that is known to increase the virulence of the fungus and its adaptability. By directly measuring nuclear movement in the model ascomycete fungus Neurospora crassa, we show that the fungus' tolerance for internal genetic diversity is enabled by hydrodynamic mixing of nuclei acting at all length scales within the fungal mycelium. Mathematical modeling and experiments in a mutant with altered mycelial morphology reveal some of the exquisite hydraulic engineering necessary to create these mixing flows from spatially coarse pressure gradients.

Investigating the effects of laser beams (532 and 660 nm) in annihilation of pistachio mould fungus using spectrophotometry analysis

NASA Astrophysics Data System (ADS)

Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.

2010-09-01

When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.

Genome characteristics reveal the impact of lichenization on lichen-forming fungus Endocarpon pusillum Hedwig (Verrucariales, Ascomycota)

PubMed Central

2014-01-01

Background Lichen is a classic mutualistic organism and the lichenization is one of the fungal symbioses. The lichen-forming fungus Endocarpon pusillum is living in symbiosis with the green alga Diplosphaera chodatii Bialsuknia as a lichen in the arid regions. Results 454 and Illumina technologies were used to sequence the genome of E. pusillum. A total of 9,285 genes were annotated in the 37.5 Mb genome of E. pusillum. Analyses of the genes provided direct molecular evidence for certain natural characteristics, such as homothallic reproduction and drought-tolerance. Comparative genomics analysis indicated that the expansion and contraction of some protein families in the E. pusillum genome reflect the specific relationship with its photosynthetic partner (D. chodatii). Co-culture experiments using the lichen-forming fungus E. pusillum and its algal partner allowed the functional identification of genes involved in the nitrogen and carbon transfer between both symbionts, and three lectins without signal peptide domains were found to be essential for the symbiotic recognition in the lichen; interestingly, the ratio of the biomass of both lichen-forming fungus and its photosynthetic partner and their contact time were found to be important for the interaction between these two symbionts. Conclusions The present study lays a genomic analysis of the lichen-forming fungus E. pusillum for demonstrating its general biological features and the traits of the interaction between this fungus and its photosynthetic partner D. chodatii, and will provide research basis for investigating the nature of its drought resistance and symbiosis. PMID:24438332

Impact of Climate Change on Potential Distribution of Chinese Caterpillar Fungus (Ophiocordyceps sinensis) in Nepal Himalaya

PubMed Central

Shrestha, Uttam Babu; Bawa, Kamaljit S.

2014-01-01

Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11–4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species. PMID:25180515

Impact of climate change on potential distribution of Chinese caterpillar fungus (Ophiocordyceps sinensis) in Nepal Himalaya.

PubMed

Shrestha, Uttam Babu; Bawa, Kamaljit S

2014-01-01

Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11-4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species.

Pycnoscelus surinamensis cockroach gut microbiota respond consistently to a fungal diet without mirroring those of fungus-farming termites.

PubMed

Richards, Callum; Otani, Saria; Mikaelyan, Aram; Poulsen, Michael

2017-01-01

The gut microbiotas of cockroaches and termites play important roles in the symbiotic digestion of dietary components, such as lignocellulose. Diet has been proposed as a primary determinant of community structure within the gut, acting as a selection force to shape the diversity observed within this "bioreactor", and as a key factor for the divergence of the termite gut microbiota from the omnivorous cockroach ancestor. The gut microbiota in most termites supports primarily the breakdown of lignocellulose, but the fungus-farming sub-family of higher termites has become similar in gut microbiota to the ancestral omnivorous cockroaches. To assess the importance of a fungus diet as a driver of community structure, we compare community compositions in the guts of experimentally manipulated Pycnoscelus surinamensis cockroaches fed on fungus cultivated by fungus-farming termites. MiSeq amplicon analysis of gut microbiotas from 49 gut samples showed a step-wise gradient pattern in community similarity that correlated with an increase in the proportion of fungal material provided to the cockroaches. Comparison of the taxonomic composition of manipulated communities to that of gut communities of a fungus-feeding termite species showed that although some bacteria OTUs shared by P. surinamensis and the farming termites increased in the guts of cockroaches on a fungal diet, cockroach communities remained distinct from those of termites. These results demonstrate that a fungal diet can play a role in structuring gut community composition, but at the same time exemplifies how original community compositions constrain the magnitude of such change.

Viral Repression of Fungal Pheromone Precursor Gene Expression

PubMed Central

Zhang, Lei; Baasiri, Rudeina A.; Van Alfen, Neal K.

1998-01-01

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a Gαi subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete. PMID:9447992

Aerial application of the insect-killing fungus Lecanicillium muscarium in a microfactory formulation for hemlock woolly adelgid suppression

Treesearch

Scott Costa; Karen Felton; Bradley Onken; Richard Reardon; Rusty. Rhea

2011-01-01

Forest populations of hemlock woolly adelgid (HWA) were reduced using an operational formulation of the insect-killing fungus Lecanicillium muscarium when it was supported by microfactory formulation technology.

Evolutionary patterns of proteinase activity in attine ant fungus gardens

PubMed Central

2011-01-01

Background Attine ants live in symbiosis with a basidiomycetous fungus that they rear on a substrate of plant material. This indirect herbivory implies that the symbiosis is likely to be nitrogen deprived, so that specific mechanisms may have evolved to enhance protein availability. We therefore hypothesized that fungal proteinase activity may have been under selection for efficiency and that different classes of proteinases might be involved. Results We determined proteinase activity profiles across a wide pH range for fungus gardens of 14 Panamanian species of fungus-growing ants, representing eight genera. We mapped these activity profiles on an independently obtained molecular phylogeny of the symbionts and show that total proteinase activity in lower attine symbionts peaks at ca. pH 6. The higher attine symbionts that have no known free-living relatives had much higher proteinase activities than the lower attine symbionts. Their total in vitro proteinase activity peaked at pH values around 5, which is close to the pH that the ants maintain in their fungus gardens, suggesting that the pH optimum of fungal proteinases may have changed after the irreversible domestication of evolutionary more derived fungal symbionts. This notion is also supported by buffering capacities of fungus gardens at pH 5.2 being remarkably high, and suggests that the fungal symbiont actively helps to maintain garden acidity at this specific level. Metalloproteinases dominated the activity profiles of lower attine gardens and may thus represent the ancestral type of proteinase production, whereas serine proteinase activity dominated the activity profiles of the higher attine gardens reared by Trachymyrmex and Sericomyrmex, suggesting that there may be trade-offs in the production of these enzyme classes. Remarkably, the single symbiont that is shared by species of the crown group of Atta and Acromyrmex leaf-cutting ants mostly showed metalloproteinase activity, suggesting that recurrent changes in enzyme production may have occurred throughout the domestication history of fungus-garden symbionts. Conclusions Proteinase pH optima and buffering capacities of fungal symbionts appear to have evolved remarkable adaptations to living in obligate symbiosis with farming ants. Although the functional roles of serine and metalloproteinases in fungus gardens are unknown, the differential production of these classes of proteolytic enzymes suggest that substrate specificity may be important and that trade-offs may prevent the simultaneous upregulation of both classes of enzymes. PMID:21247468

Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium (1988)

EPA Science Inventory

Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [14C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble met...

CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
Da as determ...

CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

Parasitic Aspects of a Fairy Ring Fungus, Marasmius oreades

Treesearch

T. H. Filer

1965-01-01

Marasmius oreades parasitizes Poa pratensis, Festuca rubra, and Agrostis tenuis. The fungus penetrates the root directly in all three species and does not require natural openings or wounds. The mycelium ramifies in the cortical cells and destroys the cell contents.

Cyclodepsipeptides, sesquiterpenoids, and other cytotoxic metabolites from the filamentous fungus Trichothecium sp. (MSX 51320).

PubMed

Sy-Cordero, Arlene A; Graf, Tyler N; Adcock, Audrey F; Kroll, David J; Shen, Qi; Swanson, Steven M; Wani, Mansukh C; Pearce, Cedric J; Oberlies, Nicholas H

2011-10-28

Two new cyclodepsipeptides (1 and 2), two new sesquiterpenoids (3 and 4), and the known compounds guangomide A (5), roseotoxin S, and three simple trichothecenes were isolated from the cytotoxic organic extract of a terrestrial filamentous fungus, Trichothecium sp. The structures were determined using NMR spectroscopy and mass spectrometry. Absolute configurations of the cyclodepsipeptides were established by employing chiral HPLC, while the relative configurations of 3 and 4 were determined via NOESY data. The isolation of guangomide A was of particular interest, since it was reported previously from a marine-derived fungus.

A virus in a fungus in a plant: Three-way symbiosis required for thermal tolerance

USGS Publications Warehouse

Marquez, L.M.; Redman, R.S.; Rodriguez, R.J.; Roossinck, M.J.

2007-01-01

A mutualistic association between a fungal endophyte and a tropical panic grass allows both organisms to grow at high soil temperatures. We characterized a virus from this fungus that is involved in the mutualistic interaction. Fungal isolates cured of the virus are unable to confer heat tolerance, but heat tolerance is restored after the virus is reintroduced. The virus-infected fungus confers heat tolerance not only to its native monocot host but also to a eudicot host, which suggests that the underlying mechanism involves pathways conserved between these two groups of plants.

Effects Sprayed Solution of Salicylic Acid to Prevent of Wilt Disease Caused by Fussarium oxysporium

NASA Astrophysics Data System (ADS)

Yousif, Dina. Y. M.

2018-05-01

The current search aimed to detective the effect of sprayed solution of salicylic acid on plant and leaves of sweet green pepper (Capsicum annuum) for control the pathogen Fussarium oxysporium compering with control plant and leaves. Results indicated that, the spray of salicylic acid at concentration 0.5 g/L is effecting the fungal infection through prevent transport fungus F. oxysporum to the neighboring green pepper plant. The number of dead green pepper plant after sprayed with solution of salicylic acid and only water they were (4, 6, and 3) (8, 9, and 10) respectively. While the experimental infection of green pepper leaves after inoculated the fungus as local spot by scorching small spots of these leaves with the aid of hot nail. These spots were then exposed to the 0.5 g/L aqueous solution salicylic acid before and after the inoculation of the fungus. The spray of salicylic acid before 24 and 48 hour prevent the development of disease and make a good protection of the mention leaves from infection with this fungus, the diameter of leaves lesion (1,1.5 cm) respectively. while the ability of fungus to grow after 24 and 48 hour from salicylic acid treatment was markedly reduce as compared with control, such treatment show slow growth of pathogen infect.

Changes in selected enzyme activities during growth of pure and mixed cultures of the white-rot decay fungus Trametes versicolor and the potential biocontrol fungus Trichoderma harzianum.

PubMed

Freitag, M; Morrell, J J

1992-04-01

Two filamentous fungi, the white-rot fungus Trametes versicolor and the soil fungus and potential biocontrol organism Trichoderma harzianum, have been grown in pure and mixed cultures on low-N (0.4 mM) and high-N (4 mM) defined synthetic media to determine the activities of selected wood-degrading enzymes such as cellobiase, cellulase, laccase, and peroxidases. Growth characteristics and enzyme activities were examined for potential correlations. Such correlations would allow the use of simple enzyme assays for measuring biomass development and would facilitate predictions about competitiveness of species in mixed fungal cultures. Our results show that while laccase and Poly Red-478 peroxidase activities indicate survival of the decay fungus, none of the monitored extracellular enzymes can serve as a quantitative indicator for biomass accumulation. As expected, the level of available nitrogen affected the production of the enzymes monitored: in low-N media, specific cellobiase, specific cellulase, and peroxidase activities were enhanced, while laccase activities were reduced. Most importantly, laccase activities of Trametes versicolor, and to a smaller extent, cellobiase activities of both fungi, were significantly induced in mixed cultures of Trametes versicolor and Trichoderma harzianum.

An arbuscular mycorrhizal fungus and Epichloë festucae var. lolii reduce Bipolaris sorokiniana disease incidence and improve perennial ryegrass growth.

PubMed

Li, Fang; Guo, Yan'e; Christensen, Michael J; Gao, Ping; Li, Yanzhong; Duan, Tingyu

2018-02-01

Leaf spot of perennial ryegrass (Lolium perenne) caused by Bipolaris sorokiniana is an important disease in temperate regions of the world. We designed this experiment to test for the combined effects of the arbuscular mycorrhizal (AM) fungus Claroideoglomus etunicatum and the grass endophyte fungus Epichloë festucae var. lolii on growth and disease occurrence in perennial ryegrass. The results show that C. etunicatum increased plant P uptake and total dry weight and that this beneficial effect was slightly enhanced when in association with the grass endophyte. The presence in plants of both the endophyte and B. sorokiniana decreased AM fungal colonization. Plants inoculated with B. sorokiniana showed the typical leaf spot symptoms 2 weeks after inoculation and the lowest disease incidence was with plants that were host to both C. etunicatum and E. festucae var. lolii. Plants with these two fungi had much higher activity of peroxidases (POD), superoxide dismutase (SOD) and catalase (CAT) and lower values of malondialdehyde (MDA) and hydrogen peroxide (H 2 O 2 ). The AM fungus C. etunicatum and the grass endophyte fungus E. festucae var. lolii have the potential to promote perennial ryegrass growth and resistance to B. sorokiniana leaf spot.

Cuticle hydrolysis in four medically important fly species by enzymes of the entomopathogenic fungus Conidiobolus coronatus.

PubMed

Boguś, M I; Włóka, E; Wrońska, A; Kaczmarek, A; Kazek, M; Zalewska, K; Ligęza-Żuber, M; Gołębiowski, M

2017-03-01

Entomopathogenic fungi infect insects via penetration through the cuticle, which varies remarkably in chemical composition across species and life stages. Fungal infection involves the production of enzymes that hydrolyse cuticular proteins, chitin and lipids. Host specificity is associated with fungus-cuticle interactions related to substrate utilization and resistance to host-specific inhibitors. The soil fungus Conidiobolus coronatus (Constantin) (Entomophthorales: Ancylistaceae) shows virulence against susceptible species. The larvae and pupae of Calliphora vicina (Robineau-Desvoidy) (Diptera: Calliphoridae), Calliphora vomitoria (Linnaeus), Lucilia sericata (Meigen) (Diptera: Calliphoridae) and Musca domestica (Linnaeus) (Diptera: Muscidae) are resistant, but adults exposed to C. coronatus quickly perish. Fungus was cultivated for 3 weeks in a minimal medium. Cell-free filtrate, for which activity of elastase, N-acetylglucosaminidase, chitobiosidase and lipase was determined, was used for in vitro hydrolysis of the cuticle from larvae, puparia and adults. Amounts of amino acids, N-glucosamine and fatty acids released were measured after 8 h of incubation. The effectiveness of fungal enzymes was correlated with concentrations of compounds detected in the cuticles of tested insects. Positive correlations suggest compounds used by the fungus as nutrients, whereas negative correlations may indicate compounds responsible for insect resistance. Adult deaths result from the ingestion of conidia or fungal excretions. © 2016 The Royal Entomological Society.

Acromyrmex Leaf-Cutting Ants Have Simple Gut Microbiota with Nitrogen-Fixing Potential

PubMed Central

Zhukova, Mariya; Hansen, Lars H.; Sørensen, Søren J.; Schiøtt, Morten

2015-01-01

Ants and termites have independently evolved obligate fungus-farming mutualisms, but their gardening procedures are fundamentally different, as the termites predigest their plant substrate whereas the ants deposit it directly on the fungus garden. Fungus-growing termites retained diverse gut microbiota, but bacterial gut communities in fungus-growing leaf-cutting ants have not been investigated, so it is unknown whether and how they are specialized on an exclusively fungal diet. Here we characterized the gut bacterial community of Panamanian Acromyrmex species, which are dominated by only four bacterial taxa: Wolbachia, Rhizobiales, and two Entomoplasmatales taxa. We show that the Entomoplasmatales can be both intracellular and extracellular across different gut tissues, Wolbachia is mainly but not exclusively intracellular, and the Rhizobiales species is strictly extracellular and confined to the gut lumen, where it forms biofilms along the hindgut cuticle supported by an adhesive matrix of polysaccharides. Tetracycline diets eliminated the Entomoplasmatales symbionts but hardly affected Wolbachia and only moderately reduced the Rhizobiales, suggesting that the latter are protected by the biofilm matrix. We show that the Rhizobiales symbiont produces bacterial NifH proteins that have been associated with the fixation of nitrogen, suggesting that these compartmentalized hindgut symbionts alleviate nutritional constraints emanating from an exclusive fungus garden diet reared on a substrate of leaves. PMID:26048932

Dissection of niche competition between introduced and indigenous arbuscular mycorrhizal fungi with respect to soybean yield responses.

PubMed

Niwa, Rieko; Koyama, Takuya; Sato, Takumi; Adachi, Katsuki; Tawaraya, Keitaro; Sato, Shusei; Hirakawa, Hideki; Yoshida, Shigenobu; Ezawa, Tatsuhiro

2018-05-09

Arbuscular mycorrhizal (AM) fungi associate with most land plants and deliver phosphorus to the host. Identification of biotic/abiotic factors that determine crop responses to AM fungal inoculation is an essential step for successful application of the fungi in sustainable agriculture. We conducted three field trials on soybean with a commercial inoculum and developed a new molecular tool to dissect interactions between the inoculum and indigenous fungi on the MiSeq sequencing platform. Regression analysis indicated that sequence read abundance of the inoculum fungus was the most significant factor that determined soybean yield responses to the inoculation, suggesting that dominance of the inoculum fungus is a necessary condition for positive yield responses. Agricultural practices (fallow/cropping in the previous year) greatly affected the colonization levels (i.e. read abundances) of the inoculum fungus via altering the propagule density of indigenous AM fungi. Analysis of niche competition revealed that the inoculum fungus competed mainly with the indigenous fungi that are commonly distributed in the trial sites, probably because their life-history strategy is the same as that of the inoculum fungus. In conclusion, we provide a new framework for evaluating the significance of environmental factors towards successful application of AM fungi in agriculture.

Characteristics of uranium biosorption from aqueous solutions on fungus Pleurotus ostreatus.

PubMed

Zhao, Changsong; Liu, Jun; Tu, Hong; Li, Feize; Li, Xiyang; Yang, Jijun; Liao, Jiali; Yang, Yuanyou; Liu, Ning; Sun, Qun

2016-12-01

Uranium(VI) biosorption from aqueous solutions was investigated in batch studies by using fungus Pleurotus ostreatus biomass. The optimal biosorption conditions were examined by investigating the reaction time, biomass dosage, pH, temperature, and uranium initial concentration. The interaction between fungus biomass and uranium was confirmed using Fourier transformed infrared (FT-IR), scanning electronic microscopy energy dispersive X-ray (SEM-EDX), and X-ray photoelectron spectroscopy (XPS) analysis. Results exhibited that the maximum biosorption capacity of uranium on P. ostreatus was 19.95 ± 1.17 mg/g at pH 4.0. Carboxylic, amine, as well as hydroxyl groups were involved in uranium biosorption according to FT-IR analysis. The pseudo-second-order model properly evaluated the U(VI) biosorption on fungus P. ostreatus biomass. The Langmuir equation provided better fitting in comparison with Freundlich isotherm models. The obtained thermodynamic parameters suggested that biosorption is feasible, endothermic, and spontaneous. SEM-EDX and XPS were additionally conducted to comprehend the biosorption process that could be described as a complex process involving several mechanisms of physical adsorption, chemisorptions, and ion exchange. Results obtained from this work indicated that fungus P. ostreatus biomass can be used as potential biosorbent to eliminate uranium or other radionuclides from aqueous solutions.

Influence of Cadmium and Mercury on Activities of Ligninolytic Enzymes and Degradation of Polycyclic Aromatic Hydrocarbons by Pleurotus ostreatus in Soil

PubMed Central

Baldrian, Petr; in der Wiesche, Carsten; Gabriel, Jiří; Nerud, František; Zadražil, František

2000-01-01

The white-rot fungus Pleurotus ostreatus was able to degrade the polycyclic aromatic hydrocarbons (PAHs) benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a]pyrene, dibenzo[a,h]anthracene, and benzo[ghi]perylene in nonsterile soil both in the presence and in the absence of cadmium and mercury. During 15 weeks of incubation, recovery of individual compounds was 16 to 69% in soil without additional metal. While soil microflora contributed mostly to degradation of pyrene (82%) and benzo[a]anthracene (41%), the fungus enhanced the disappearance of less-soluble polycyclic aromatic compounds containing five or six aromatic rings. Although the heavy metals in the soil affected the activity of ligninolytic enzymes produced by the fungus (laccase and Mn-dependent peroxidase), no decrease in PAH degradation was found in soil containing Cd or Hg at 10 to 100 ppm. In the presence of cadmium at 500 ppm in soil, degradation of PAHs by soil microflora was not affected whereas the contribution of fungus was negligible, probably due to the absence of Mn-dependent peroxidase activity. In the presence of Hg at 50 to 100 ppm or Cd at 100 to 500 ppm, the extent of soil colonization by the fungus was limited. PMID:10831426

Termites promote resistance of decomposition to spatiotemporal variability in rainfall.

PubMed

Veldhuis, Michiel P; Laso, Francisco J; Olff, Han; Berg, Matty P

2017-02-01

The ecological impact of rapid environmental change will depend on the resistance of key ecosystems processes, which may be promoted by species that exert strong control over local environmental conditions. Recent theoretical work suggests that macrodetritivores increase the resistance of African savanna ecosystems to changing climatic conditions, but experimental evidence is lacking. We examined the effect of large fungus-growing termites and other non-fungus-growing macrodetritivores on decomposition rates empirically with strong spatiotemporal variability in rainfall and temperature. Non-fungus-growing larger macrodetritivores (earthworms, woodlice, millipedes) promoted decomposition rates relative to microbes and small soil fauna (+34%) but both groups reduced their activities with decreasing rainfall. However, fungus-growing termites increased decomposition rates strongest (+123%) under the most water-limited conditions, making overall decomposition rates mostly independent from rainfall. We conclude that fungus-growing termites are of special importance in decoupling decomposition rates from spatiotemporal variability in rainfall due to the buffered environment they create within their extended phenotype (mounds), that allows decomposition to continue when abiotic conditions outside are less favorable. This points at a wider class of possibly important ecological processes, where soil-plant-animal interactions decouple ecosystem processes from large-scale climatic gradients. This may strongly alter predictions from current climate change models. © 2016 by the Ecological Society of America.

Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus

PubMed Central

Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk

2016-01-01

Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously. PMID:27103854

The development of a spatially-explicit, individual-based, disease model for frogs and the chytrid fungus

EPA Science Inventory

Background / Question / Methods The fungal pathogen, Batrachochytrium dendrobatidis (BD), has been associated with amphibian population declines and even extinctions worldwide. Transmission of the fungus between amphibian hosts occurs via motile zoospores, which are produced on...

BIODEGRADATION OF CRYSTAL VIOLET BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM

EPA Science Inventory

Biodegradation of crystal violet (N,N,N',N',N",N"-hexamethylpararosaniline) in ligninolytic (nitrogen-limited) cultures of the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance of crystal violet and by the identification of three metabolites (N,N,...

7 CFR 810.302 - Definitions of other terms.

Code of Federal Regulations, 2010 CFR

2010-01-01

... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...

7 CFR 810.302 - Definitions of other terms.

Code of Federal Regulations, 2011 CFR

2011-01-01

... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...

Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents

USDA-ARS?s Scientific Manuscript database

The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...

The widely used ATB FUNGUS 3 automated readings in China and its misleading high MICs of Candida spp. to azoles: challenges for developing countries' clinical microbiology labs.

PubMed

Zhang, Li; Wang, He; Xiao, Meng; Kudinha, Timothy; Mao, Lei-Li; Zhao, Hao-Ran; Kong, Fanrong; Xu, Ying-Chun

2014-01-01

The rapid development in the clinical microbiology diagnostic assays presents more challenges for developing countries than for the developed world, especially in the area of test validation before the introduction of new tests. Here we report on the misleading high MICs of Candida spp. to azoles using the ATB FUNGUS 3 (bioMérieux, La Balme-les Grottes, France) with automated readings in China to highlight the dangers of introducing a diagnostic assay without validation. ATB FUNGUS 3 is the most commonly used commercial antifungal susceptibility testing method in China. An in-depth analysis of data showed higher levels of resistance to azoles when ATB FUNGUS 3 strips were read automatically than when read visually. Based on this finding, the performance of ATB FUNGUS 3, read both visually and automatically, was evaluated by testing 218 isolates of five clinically important Candida species, using broth microdilution (BMD) following CLSI M27-A3 as the gold-standard. The overall essential agreement (EA) between ATB visual readings and BMD was 99.1%. In contrast, the ATB automated readings showed higher discrepancies with BMD, with overall EA of 86.2%, and specifically lower EA was observed for fluconazole (80.7%), voriconazole (77.5%), and itraconazole (73.4%), which was most likely due to the trailing effect of azoles. The major errors in azole drug susceptibilities by ATB automated readings is a concern in China that can result in misleading clinical antifungal drug selection and pseudo high rates of antifungal resistance. Therefore, the ATB visual reading is generally recommended. In the meantime, we propose a practical algorithm to be followed for ATB FUNGUS 3 antifungal susceptibility for Candida spp. before the improvement in the automated reading system.

Magnaporthe oryzae Glycine-Rich Secretion Protein, Rbf1 Critically Participates in Pathogenicity through the Focal Formation of the Biotrophic Interfacial Complex

PubMed Central

Ishii-Minami, Naoko; Kawahara, Yoshihiro; Yoshida, Yuri; Okada, Kazunori; Ando, Sugihiro; Matsumura, Hideo; Terauchi, Ryohei; Minami, Eiichi; Nishizawa, Yoko

2016-01-01

Magnaporthe oryzae, the fungus causing rice blast disease, should contend with host innate immunity to develop invasive hyphae (IH) within living host cells. However, molecular strategies to establish the biotrophic interactions are largely unknown. Here, we report the biological function of a M. oryzae-specific gene, R equired-for-Focal- B IC- F ormation 1 (RBF1). RBF1 expression was induced in appressoria and IH only when the fungus was inoculated to living plant tissues. Long-term successive imaging of live cell fluorescence revealed that the expression of RBF1 was upregulated each time the fungus crossed a host cell wall. Like other symplastic effector proteins of the rice blast fungus, Rbf1 accumulated in the biotrophic interfacial complex (BIC) and was translocated into the rice cytoplasm. RBF1-knockout mutants (Δrbf1) were severely deficient in their virulence to rice leaves, but were capable of proliferating in abscisic acid-treated or salicylic acid-deficient rice plants. In rice leaves, Δrbf1 inoculation caused necrosis and induced defense-related gene expression, which led to a higher level of diterpenoid phytoalexin accumulation than the wild-type fungus did. Δrbf1 showed unusual differentiation of IH and dispersal of the normally BIC-focused effectors around the short primary hypha and the first bulbous cell. In the Δrbf1-invaded cells, symplastic effectors were still translocated into rice cells but with a lower efficiency. These data indicate that RBF1 is a virulence gene essential for the focal BIC formation, which is critical for the rice blast fungus to suppress host immune responses. PMID:27711180

Colony Size Affects the Efficacy of Bait Containing Chlorfluazuron Against the Fungus-Growing Termite Macrotermes gilvus (Blattodea: Termitidae).

PubMed

Lee, Ching-Chen; Neoh, Kok-Boon; Lee, Chow-Yang

2014-12-01

The efficacy of chitin synthesis inhibitors (CSIs) against fungus-growing termites is known to vary. In this study, 0.1% chlorfluazuron (CFZ) cellulose bait was tested against medium and large field colonies of Macrotermes gilvus (Hagen). The termite mounds were dissected to determine the health of the colony. Individual termites (i.e., workers and larvae) and fungus combs were subjected to gas chromatography-mass spectrometry (GC-MS) analysis to detect the presence of CFZ. In this study, 540.0 ± 25.8 g (or equivalent to 540.0 ± 25.8 mg active ingredient) and 680.0 ± 49.0 g (680.0 ± 49.0 mg active ingredient) of bait matrix were removed by the medium- and large-sized colonies, respectively, after baiting. All treated medium-sized colonies were moribund. The dead termites were scattered in the mound, larvae were absent, population size had decreased by 90%, and the queens appeared unhealthy. In contrast, no or limited effects were found in large-sized colonies. Only trace amounts of CFZ were detected in workers, larvae, and fungus combs, and the population of large-sized colonies had declined by only up to 40%. This might be owing to the presence of large amount of basidiomycete fungus and a drastic decrease of CFZ content per unit fungus comb (a main food source of larvae) in the large-sized colonies, and hence reduced the toxic effect and longer time is required to accumulate the lethal dose in larvae. Nevertheless, we do not deny the possibility of CSI bait eliminating or suppressing the higher termite if the test colonies could pick up adequate lethal dose by installing more bait stations and prolonging the baiting period. © 2014 Entomological Society of America.

Utilizing fungus myceliated grain for molt induction and performance in commercial laying hens.

PubMed

Willis, W L; Isikhuemhen, O S; Allen, J W; Byers, A; King, K; Thomas, C

2009-10-01

Molting in poultry is used to rejuvenate hens for a second or third laying cycle. Feed withdrawal was once the most effective method used for molt induction; however, it has being phased out due to food safety and animal welfare concerns. This study evaluated the utilization of fungus myceliated grain as a safe and effective alternative for inducing molt, enhancing immunity, reducing Salmonella growth, and returning to egg production. Laying hens were subjected to 1 of 5 treatments: 1) nonfed (NF), 2) full-fed (FF), 3) fungus myceliated meal (FM), 4) 90% fungus myceliated meal+10% standard layer ration (FM-90), and 5) 90% alfalfa meal+10% fungus myceliated meal (AF-90). Each treatment condition was replicated 9 times during a 9-d molt period. The results revealed that egg production for treatments 1 and 3 ceased completely by d 5, whereas hens in treatments 4 and 5 ceased egg production by d 6. The percentage of BW loss decreased significantly (P<0.05) in treatments 1 (57%), 2 (8%), 3 (35%), 4 (37%), and 5 (44%). Ovary weights of hens fed all molting diets decreased significantly from the full-fed control but did not differ significantly (P<0.05) from each other. Salmonella population in the crop, ovary, and ceca from hens differed significantly (P<0.05) among treatments. Return to egg production differed between treatments with higher production beginning in treatment 3 and ending in treatment 5. Antibody titers did differ (P<0.05) among treatments. From these results, fungus myceliated meal appears to be a viable alternative to conventional feed withdrawal and other methods for the successful induction of molt and retention of postmolt performance.

Identifying the core microbial community in the gut of fungus-growing termites.

PubMed

Otani, Saria; Mikaelyan, Aram; Nobre, Tânia; Hansen, Lars H; Koné, N'Golo A; Sørensen, Søren J; Aanen, Duur K; Boomsma, Jacobus J; Brune, Andreas; Poulsen, Michael

2014-09-01

Gut microbes play a crucial role in decomposing lignocellulose to fuel termite societies, with protists in the lower termites and prokaryotes in the higher termites providing these services. However, a single basal subfamily of the higher termites, the Macrotermitinae, also domesticated a plant biomass-degrading fungus (Termitomyces), and how this symbiont acquisition has affected the fungus-growing termite gut microbiota has remained unclear. The objective of our study was to compare the intestinal bacterial communities of five genera (nine species) of fungus-growing termites to establish whether or not an ancestral core microbiota has been maintained and characterizes extant lineages. Using 454-pyrosequencing of the 16S rRNA gene, we show that gut communities have representatives of 26 bacterial phyla and are dominated by Firmicutes, Bacteroidetes, Spirochaetes, Proteobacteria and Synergistetes. A set of 42 genus-level taxa was present in all termite species and accounted for 56-68% of the species-specific reads. Gut communities of termites from the same genus were more similar than distantly related species, suggesting that phylogenetic ancestry matters, possibly in connection with specific termite genus-level ecological niches. Finally, we show that gut communities of fungus-growing termites are similar to cockroaches, both at the bacterial phylum level and in a comparison of the core Macrotermitinae taxa abundances with representative cockroach, lower termite and higher nonfungus-growing termites. These results suggest that the obligate association with Termitomyces has forced the bacterial gut communities of the fungus-growing termites towards a relatively uniform composition with higher similarity to their omnivorous relatives than to more closely related termites. © 2014 John Wiley & Sons Ltd.

Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump.

PubMed

Arenas, Andrés; Roces, Flavio

2017-01-01

Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden.

Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump

PubMed Central

Roces, Flavio

2017-01-01

Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden. PMID:28273083

Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

PubMed

Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

2003-08-01

Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

Relating coccidioidomycosis (Valley Fever) incidence via to soil moisture conditions

USDA-ARS?s Scientific Manuscript database

Coccidioidomycosis (also called Valley fever) is caused by a soil-borne fungus, Coccidioides spp., in arid regions of the southwestern United States. Though some who develop infections from this fungus remain asymptomatic, others develop respiratory disease as a consequence. Less commonly, severe ...

Development of 11 polymorphic microsatellite markers for the blackberry rust fungus Phragmidium violaceum

USDA-ARS?s Scientific Manuscript database

Eleven polymorphic microsatellite markers were developed for the Uredinales fungus Phragmidium violaceum, which causes leaf rust on European blackberry (Rubus fruticosus L. aggregate). Allele frequency ranged between two and seventeen alleles per locus with no evidence of linkage disequilibrium amon...

Brown spot needle disease--biology and control in Scotch pine plantations.

Treesearch

Darroll D. Skilling; Thomas H. Nicholls

1975-01-01

An application section briefly describes and illustrates the symptoms, hosts, life history of the brown spot needlecast fungus (Scirrhia acicola), and recommends chemical and cultural control methods. A documentation section details the research on the biology and control of the fungus.

Inferring outcrossing in the homothallic fungus Sclerotinia sclerotiorum using linkage disequilibrium decay

USDA-ARS?s Scientific Manuscript database

The occurrence and frequency of outcrossing in homothallic fungal species in nature is an unresolved question. Here we report detection of frequent outcrossing in the homothallic fungus Sclerotinia sclerotiorum. In using multilocus linkage disequilibrium (LD) to infer recombination among microsatell...

Entomology: A Bee Farming a Fungus.

PubMed

Oldroyd, Benjamin P; Aanen, Duur K

2015-11-16

Farming is done not only by humans, but also by some ant, beetle and termite species. With the discovery of a stingless bee farming a fungus that provides benefits to its larvae, bees can be added to this list. Copyright © 2015 Elsevier Ltd. All rights reserved.

Commandra Blister Rust

Treesearch

David W. Johnson

1986-01-01

Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

Analysis of Volatile Organic Compounds Emitted by Plant Growth-Promoting Fungus Phoma sp. GS8-3 for Growth Promotion Effects on Tobacco

PubMed Central

Naznin, Hushna Ara; Kimura, Minako; Miyazawa, Mitsuo; Hyakumachi, Mitsuro

2013-01-01

We extracted volatile organic compounds (VOCs) emitted by a plant growth-promoting fungus (PGPF) Phoma sp. GS8-3 by gas chromatography and identified them by mass spectrometry. All of the identified compounds belonged to C4-C8 hydrocarbons. Volatiles varied in number and quantity by the culture period of the fungus (in days). 2-Methyl-propanol and 3-methyl-butanol formed the main components of the volatile blends for all the culture periods of fungus. Growth-promoting effects of the identified synthetic compounds were analyzed individually and in blends using tobacco plants. We found that the mixture of volatiles extracted from 3-day-old culture showed significant growth promotion in tobacco in vitro. The volatile blend showed better growth promotion at lower than higher concentrations. Our results confirm the potential role of volatile organic compounds in the mechanism of growth enhancement by GS8-3. PMID:23080408

Continuous xylanase production with Aspergillus nidulans under pyridoxine limitation using a trickle bed reactor.

PubMed

Müller, Michael; Prade, Rolf A; Segato, Fernando; Atiyeh, Hasan K; Wilkins, Mark R

2015-01-01

A trickle bed reactor (TBR) with recycle was designed and tested using Aspergillus nidulans with a pyridoxine marker and over-expressing/secreting recombinant client xylanase B (XynB). The pyridoxine marker prevented the fungus from synthesizing its own pyridoxine and fungus was unable to grow when no pyridoxine was present in the medium; however, enzyme production was unaffected. Uncontrolled mycelia growth that led to clogging of the TBR was observed when fungus without a pyridoxine marker was used for XynB production. Using the fungus with pyridoxine marker, the TBR was operated continuously for 18 days and achieved a XynB output of 41 U/ml with an influent and effluent flow rate of 0.5 ml/min and a recycle flow rate of 56 ml/min. Production yields in the TBR were 1.4 times greater than a static tray culture and between 1.1 and 67 times greater than yields for SSF enzyme production stated in the literature. Copyright © 2015 Elsevier Ltd. All rights reserved.

The toxicosis of Embellisia fungi from locoweed (Oxytropis lambertii) is similar to locoweed toxicosis in rats.

PubMed

McLain-Romero, J; Creamer, R; Zepeda, H; Strickland, J; Bell, G

2004-07-01

Locoweeds cause significant livestock poisoning and economic loss in the western United States. The toxicity of Embellisia sp. fungi isolated from locoweed was compared with locoweed toxicity using the rat as a model. Rats were fed diets containing locoweed, fungus and alfalfa, or alfalfa. Locoweed- and fungus-fed rats consumed swainsonine-containing food at approximately 1.3 mg x kg(-1) x d(-1), gained less weight (P = 0.001) and ate less than controls. Swainsonine is the principal agent responsible for inducing locoism in animals. The concentrations of alkaline phosphatase and aspartate aminotransferase enzymes were greater (P < 0.05) in serum of locoweed- and fungus-fed rats compared with control rats. Similar intracellular vacuolation was observed in renal, pancreatic, and hepatic tissues of rats that consumed either locoweed or fungus. Rats that ate locoweed or Embellisia fungi displayed indistinguishable toxicity symptoms. The Embellisia fungi from locoweed can induce toxicity without the plants. Locoism management strategies need to involve management of the Embellisia fungi.

Lignocellulose degradation patterns, structural changes, and enzyme secretion by Inonotus obliquus on straw biomass under submerged fermentation.

PubMed

Xu, Xiangqun; Xu, Zhiqi; Shi, Song; Lin, Mengmeng

2017-10-01

This study examined the white rot fungus I. obliquus on the degradation of three types of straw biomass and the production of extracellular lignocellulolytic enzymes under submerged fermentation. The fungus process resulted in a highest lignin loss of 72%, 39%, and 47% in wheat straw, rice straw, and corn stover within 12days, respectively. In merely two days, the fungus selectively degraded wheat straw lignin by 37%, with only limited cellulose degradation (13%). Fourier transform infrared spectroscopy revealed that the fungus most effectively degraded the wheat straw lignin and rice straw crystalline cellulose. Scanning electronic microscopy showed the most pronounced structural changes in wheat straw. High activities of manganese peroxidase (159.0U/mL) and lignin peroxidase (123.4U/mL) were observed in wheat straw culture on Day 2 and 4, respectively. Rice straw was the best substrate to induce the production of cellulase and xylanase. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lignocellulose pretreatment in a fungus-cultivating termite

DOE PAGES

Li, Hongjie; Yelle, Daniel J.; Li, Chang; ...

2017-04-19

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less

Mathematical modeling on obligate mutualism: Interactions between leaf-cutter ants and their fungus garden.

PubMed

Kang, Yun; Clark, Rebecca; Makiyama, Michael; Fewell, Jennifer

2011-11-21

We propose a simple mathematical model by applying Michaelis-Menton equations of enzyme kinetics to study the mutualistic interaction between the leaf cutter ant and its fungus garden at the early stage of colony expansion. We derive sufficient conditions on the extinction and coexistence of these two species. In addition, we give a region of initial condition that leads to the extinction of two species when the model has an interior attractor. Our global analysis indicates that the division of labor by worker ants and initial conditions are two important factors that determine whether leaf cutter ants' colonies and their fungus garden can survive and grow or not. We validate the model by comparing model simulations and data on fungal and ant colony growth rates under laboratory conditions. We perform sensitive analysis of the model based on the experimental data to gain more biological insights on ecological interactions between leaf-cutter ants and their fungus garden. Finally, we give conclusions and discuss potential future work. Published by Elsevier Ltd.

Biotransformation of ginsenoside Rb1 to ginsenoside C-K by endophytic fungus Arthrinium sp. GE 17-18 isolated from Panax ginseng.

PubMed

Fu, Y; Yin, Z-H; Wu, L-P; Yin, C-R

2016-09-01

This research aimed to isolate β-glycosidase-producing endophytic fungus in Panax ginseng to achieve biotransformation of ginsenoside Rb1 to ginsenoside C-K. Of these 15 β-glucosidase-producing endophytic fungus isolated from ginseng roots, a β-glucosidase-producing endophytic fungi GE 17-18 could hydrolyse major ginsenosides Rb1 to minor ginsenoside C-K with metabolic pathways: ginsenoside Rb1→ginsenoside Rd→ginsenoside F2→ginsenoside C-K. Phylogenetic analysis of ITS gene sequences indicated that the strain GE 17-18 belongs to the genus Arthrinium and is most closely related to Arthrinium sp. HQ832803.1. This is the first study to provide information of cultivable β-glycosidase-producing Endophytic fungus in Panax ginseng. The strain GE 17-18 has potential to be applied on the preparation for minor ginsenoside C-K in pharmaceutical industry. © 2016 The Society for Applied Microbiology.

Lignocellulose pretreatment in a fungus-cultivating termite

PubMed Central

Li, Hongjie; Yelle, Daniel J.; Li, Chang; Yang, Mengyi; Ke, Jing; Zhang, Ruijuan; Liu, Yu; Zhu, Na; Liang, Shiyou; Mo, Xiaochang; Currie, Cameron R.; Mo, Jianchu

2017-01-01

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid of various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation. PMID:28424249

Lignocellulose pretreatment in a fungus-cultivating termite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Hongjie; Yelle, Daniel J.; Li, Chang

Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less

Fate of Residual Lignin during Delignification of Kraft Pulp by Trametes versicolor

PubMed Central

Reid, Ian D.

1998-01-01

The fungus Trametes versicolor can delignify and brighten kraft pulps. To better understand the mechanism of this biological bleaching and the by-products formed, I traced the transformation of pulp lignin during treatment with the fungus. Hardwood and softwood kraft pulps containing 14C-labelled residual lignin were prepared by laboratory pulping of lignin-labelled aspen and spruce wood and then incubated with T. versicolor. After initially polymerizing the lignin, the fungus depolymerized it to alkali-extractable forms and then to soluble forms. Most of the labelled carbon accumulated in the water-soluble pool. The extractable and soluble products were oligomeric; single-ring aromatic products were not detected. The mineralization of the lignin carbon to CO2 varied between experiments, up to 22% in the most vigorous cultures. The activities of the known enzymes laccase and manganese peroxidase did not account for all of the lignin degradation that took place in the T. versicolor cultures. This fungus may produce additional enzymes that could be useful in enzyme bleaching systems. PMID:9603823

Epiphytic lichen mycota of the virgin forest reserve Rajhenavski Rog (Slovenia)

PubMed Central

Bilovitz, Peter O.; Batič, Franc; Mayrhofer, Helmut

2012-01-01

A list of 128 taxa (127 species) of lichens, 6 species of lichenicolous fungi and 2 non-lichenized fungi traditionally included in lichenological literature from the virgin forest Rajhenavski Rog and its surroundings in the southeastern part of Slovenia is presented. The lichen Gyalecta derivata, the lichenicolous fungus Homostegia piggotii, and the non-lichenized fungus Mycomicrothelia pachnea are new to Slovenia. The lichenized fungi Chaenotheca trichialis, C. xyloxena, Lecanactis abietina, Lecanora thysanophora, Pertusaria ophthalmiza, the lichenicolous fungi Monodictys epilepraria, Tremella hypogymniae, Taeniolella friesii, and the non-lichenized fungus Chaenothecopsis pusilla are new to the Dinaric phytogeographical region of Slovenia. PMID:22942459

Intersporal Genetic Variation of Gigaspora margarita, a Vesicular Arbuscular Mycorrhizal Fungus, Revealed by M13 Minisatellite-Primed PCR.

PubMed

Zeze, A; Sulistyowati, E; Ophel-Keller, K; Barker, S; Smith, S

1997-02-01

Spores of vesicular arbuscular mycorrhizal (VAM) fungi contain thousands of nuclei. In order to understand the karyotic structure of a VAM fungus spore, the genetic variation of the first generation of spores from a VAM fungus (Gigaspora margarita) was examined. Spores originating from both single- and multispore inoculations of the species G. margarita were analyzed by M13 minisatellite-primed PCR. In both cases, different fingerprints were obtained from individual spores with few spores exhibiting similar fingerprints. These results can be explained only by a heterokaryotic status of the nuclear population within a spore.

Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

NASA Astrophysics Data System (ADS)

Matsuura, Shu; Miyazima, Sasuke

Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

PubMed

Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

2008-06-01

The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

Pestalotiopamide E, a new amide from the endophytic fungus Pestalotiopsis sp.

PubMed

Xu, Jing; Lin, Qiang; Wang, Bin; Wray, Victor; Lin, Wen-Han; Proksch, Peter

2011-04-01

Chemical examination of the endophytic fungus Pestalotiopsis sp., isolated from the leaves of the Chinese mangrove Rhizophora mucronata, yielded a new amide called pestalotiopamide E (1). The structure of the new compound was unambiguously elucidated on the basis of extensive spectroscopic data analysis.

Development of a greenhouse-based inoculation protocol for the fungus Colletotrichum cereale pathogenic to annual bluegrass (Poa annua)

USDA-ARS?s Scientific Manuscript database

The fungus Colletotrichum cereale incites anthracnose disease on Poa annua (annual bluegrass) turfgrass. Anthracnose disease is geographically widespread highly destructive, with infections by C. cereale resulting in extensive turfgrass loss. Comprehensive research aimed at controlling turfgrass a...

An in vivo transcriptome for entomopathogenic fungus Metarhizium robertsii ARSEF 2575

USDA-ARS?s Scientific Manuscript database

Molecular mechanisms underlying the pathogenic process of the insect pathogen Metarhizium robertsii ARSEF 2575 in its host are only partially understood. To probe the transcriptional responses of the fungus during the interaction with insects, we have developed a method to specifically recover patho...

Strategies for durable resistance to the grapevine powdery mildew fungus, Erysiphe necator

USDA-ARS?s Scientific Manuscript database

Nearly all cultivars of Vitis vinifera are highly susceptible to the grapevine powdery mildew fungus, Erysiphe necator. Grape breeders around the world are working to introgress resistance from wild Vitis. Of the widely-used introgressions, most involve dominant, race-specific resistance phenotype...

Protection against common bean rust conferred by a gene silencing method

USDA-ARS?s Scientific Manuscript database

Rust disease of the dry bean plant, Phaseolus vulgaris, is caused by the fungus Uromyces appendiculatus. The fungus acquires its nutrients and energy from bean leaves using a specialized cell structure, the haustorium, through which it secretes effector proteins that contribute to pathogenicity by ...

Draft genome sequence of a monokaryotic model brown-rot fungus Postia (Rhodonia) placenta SB12

Treesearch

Jill Gaskell; Phil Kersten; Luis F. Larrondo; Paulo Canessa; Diego Martinez; David Hibbett; Monika Schmoll; Christian P. Kubicek; Angel T. Martinez; Jagjit Yadav; Emma Master; Jon Karl Magnuson; Debbie Yaver; Randy Berka; Kathleen Lail; Cindy Chen; Kurt LaButti; Matt Nolan; Anna Lipzen; Andrea Aerts; Robert Riley; Kerrie Barry; Bernard Henrissat; Robert Blanchette; Igor V. Grigoriev; Dan Cullen

2017-01-01

We report the genome of Postia (Rhodonia) placenta MAD-SB12, a homokaryotic wood decay fungus (Basidiomycota, Polyporales). Intensively studied as a representative brown rot decayer, the gene complement is consistent with the rapid depolymerization of cellulose but not lignin.

Biological pretreatment of corn stover with white-rot fungus for improved enzymatic hydrolysis

USDA-ARS?s Scientific Manuscript database

Biological pretreatment of lignocellulosic biomass by white-rot fungus can represent a low-cost and eco-friendly alternative to harsh physical, chemical or physico-chemical pretreatment methods to facilitate enzymatic hydrolysis. However, fungal pretreatment can cause carbohydrate loss and it is, th...

Sirococcus Shoot Blight

Treesearch

Thomas H. Nicholls; Kathryn Robbins

1984-01-01

Sirococcus shoot blight, caused by the fungus Sirococcus strobilinus Preuss, affects conifers in the Northern United States and southern Canada. The fungus infects the new shoots; diseased seedlings and saplings are especially affected. In the United States, sirococcus shoot blight has become increasingly widespread since the early 1970's. When favorable...

Compatibility of the insect pathogenic fungus Beauveria bassiana with neem against sweetpotato whitefly, Bemisia tabaci, on eggplant

USDA-ARS?s Scientific Manuscript database

A study on the compatibility of the entomopathogenic fungus Beauveria bassiana (Balsamo) Vuillemin (Ascomycota: Hypocreales) with neem was conducted against sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), on eggplant. Initially, three concentrations of B. bassiana (106, 1...

Suppression of aflatoxin production in Aspergillus species by selected peanut (Arachis hypogaea) stilbenoids

USDA-ARS?s Scientific Manuscript database

Aspergillus (A.) flavus is a soil fungus that commonly invades peanut seeds and often produces the carcinogenic aflatoxins. Under favorable conditions, the fungus-challenged peanut plant produces and accumulates resveratrol and its prenylated derivatives in response to such invasion. These prenylate...

Advances in molecular and genomic research to safeguard food and feed supply from aflatoxin contamination

USDA-ARS?s Scientific Manuscript database

Worldwide recognition that aflatoxin contamination of agricultural commodities by the fungus Aspergillus flavus is a global problem which has significantly benefitted from global collaboration for understanding the contaminating fungus as well as for developing and implementing solutions against the...

Wood decay fungus Flavodon ambrosius (Basidiomycota: Polyporales) is widely farmed by two genera of ambrosia beetles

Treesearch

You Li; Craig Christopher Bateman; James Skelton; Michelle Alice Jusino; Zachary John Nolen; David Rabern Simmons; Jiri Hulcr

2017-01-01

The ambrosia fungus Flavodon ambrosius is the primary nutritional mutualist of ambrosia beetles Ambrosiodmus and Ambrosiophilus in North America. F. ambrosius is the only known ambrosial basidiomycete, unique in its efficient lignocellulose degradation. F. ambrosius is associated with...

Intercontinental divergence in the Populus-associated ectomycorrhizal fungus, Tricholoma populinum

Treesearch

L.C. Grubisha; N. Levsen; M.S. Olson; D.L. Taylor

2012-01-01

The ectomycorrhizal fungus Tricholoma populinum is host-specific with Populus species. T. populinum has wind-dispersed progagules and may be capable of long-distance dispersal. In this study, we tested the hypothesis of a panmictic population between Scandinavia and North America. DNA sequences from five...

Neem oil increases the efficiency of the entomopathogenic fungus Metarhizium anisopliae for the control of Aedes aegypti (Diptera: Culicidae) larvae.

PubMed

Gomes, Simone A; Paula, Adriano R; Ribeiro, Anderson; Moraes, Catia O P; Santos, Jonathan W A B; Silva, Carlos P; Samuels, Richard I

2015-12-30

Entomopathogenic fungi are potential candidates for use in integrated vector management and many isolates are compatible with synthetic and natural insecticides. Neem oil was tested separately and in combination with the entomopathogenic fungus Metarhizium anisopliae against larvae of the dengue vector Aedes aegypti. Our aim was to increase the effectiveness of the fungus for the control of larval mosquito populations. Commercially available neem oil was used at concentrations ranging from 0.0001 to 1%. Larval survival rates were monitored over a 7 day period following exposure to neem. The virulence of the fungus M. anisopliae was confirmed using five conidial concentrations (1 × 10(5) to 1 × 10(9) conidia mL(-1)) and survival monitored over 7 days. Two concentrations of fungal conidia were then tested together with neem (0.001%). Survival curve comparisons were carried out using the Log-rank test and end-point survival rates were compared using one-way ANOVA. 1% neem was toxic to A. aegypti larvae reducing survival to 18% with S50 of 2 days. Neem had no effect on conidial germination or fungal vegetative growth in vitro. Larval survival rates were reduced to 24% (S50 = 3 days) when using 1 × 10(9) conidia mL(-1). Using 1 × 10(8) conidia mL(-1), 30% survival (S50 = 3 days) was observed. We tested a "sub-lethal" neem concentration (0.001%) together with these concentrations of conidia. For combinations of neem + fungus, the survival rates were significantly lower than the survival rates seen for fungus alone or for neem alone. Using a combination of 1 × 10(7) conidia mL(-1) + neem (0.001%), the survival rates were 36%, whereas exposure to the fungus alone resulted in 74% survival and exposure to neem alone resulted in 78% survival. When using 1 × 10(8) conidia mL(-1), the survival curves were modified, with a combination of the fungus + neem resulting in 12% survival, whilst the fungus alone at this concentration also significantly reduced survival rates (28%). The use of adjuvants is an important strategy for maintaining/increasing fungal virulence and/or shelf-life. The addition of neem to conidial suspensions improved virulence, significantly reducing larval survival times and percentages.

Fungal Production and Manipulation of Plant Hormones.

PubMed

Fonseca, Sandra; Radhakrishnan, Dhanya; Prasad, Kalika; Chini, Andrea

2018-01-01

Living organisms are part of a highly interconnected web of interactions, characterised by species nurturing, competing, parasitizing and preying on one another. Plants have evolved cooperative as well as defensive strategies to interact with neighbour organisms. Among these, the plant-fungus associations are very diverse, ranging from pathogenic to mutualistic. Our current knowledge of plant-fungus interactions suggests a sophisticated coevolution to ensure dynamic plant responses to evolving fungal mutualistic/pathogenic strategies. The plant-fungus communication relies on a rich chemical language. To manipulate the plant defence mechanisms, fungi produce and secrete several classes of biomolecules, whose modeof- action is largely unknown. Upon perception of the fungi, plants produce phytohormones and a battery of secondary metabolites that serve as defence mechanism against invaders or to promote mutualistic associations. These mutualistic chemical signals can be co-opted by pathogenic fungi for their own benefit. Among the plant molecules regulating plant-fungus interaction, phytohormones play a critical role since they modulate various aspects of plant development, defences and stress responses. Intriguingly, fungi can also produce phytohormones, although the actual role of fungalproduced phytohormones in plant-fungus interactions is poorly understood. Here, we discuss the recent advances in fungal production of phytohormone, their putative role as endogenous fungal signals and how fungi manipulate plant hormone balance to their benefits. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

De novo genome assembly of the soil-borne fungus and tomato pathogen Pyrenochaeta lycopersici

PubMed Central

2014-01-01

Background Pyrenochaeta lycopersici is a soil-dwelling ascomycete pathogen that causes corky root rot disease in tomato (Solanum lycopersicum) and other Solanaceous crops, reducing fruit yields by up to 75%. Fungal pathogens that infect roots receive less attention than those infecting the aerial parts of crops despite their significant impact on plant growth and fruit production. Results We assembled a 54.9Mb P. lycopersici draft genome sequence based on Illumina short reads, and annotated approximately 17,000 genes. The P. lycopersici genome is closely related to hemibiotrophs and necrotrophs, in agreement with the phenotypic characteristics of the fungus and its lifestyle. Several gene families related to host–pathogen interactions are strongly represented, including those responsible for nutrient absorption, the detoxification of fungicides and plant cell wall degradation, the latter confirming that much of the genome is devoted to the pathogenic activity of the fungus. We did not find a MAT gene, which is consistent with the classification of P. lycopersici as an imperfect fungus, but we observed a significant expansion of the gene families associated with heterokaryon incompatibility (HI). Conclusions The P. lycopersici draft genome sequence provided insight into the molecular and genetic basis of the fungal lifestyle, characterizing previously unknown pathogenic behaviors and defining strategies that allow this asexual fungus to increase genetic diversity and to acquire new pathogenic traits. PMID:24767544

Fungus-Farming Termites Selectively Bury Weedy Fungi that Smell Different from Crop Fungi.

PubMed

Katariya, Lakshya; Ramesh, Priya B; Gopalappa, Thejashwini; Desireddy, Sathish; Bessière, Jean-Marie; Borges, Renee M

2017-10-01

Mutualistic associations such as the fungal farms of insects are prone to parasitism and are consequently vulnerable to attack by weeds and pests. Therefore, efficient farm management requires quick detection of weeds for their elimination. Furthermore, if the available weedicides are non-specific, then the ability of insects to discriminate between crop and weeds becomes essential for targeted application of such compounds. Here, we demonstrate for the first time in fungus-farming insects, that worker castes of the fungus-growing termite Odontotermes obesus discriminate between their crop (Termitomyces) and the weedy (Pseudoxylaria) fungi, even if exposed to only fungal scents. Termites respond to the presence of fungal mycelium or scent alone, by burying the weed with the offered material such as soil or agar, possibly anointing the weed with chemicals in the process. The scent profiles of crop and weedy fungi are distinct and the differences are likely exploited by termites to selectively mount their defences. Sesquiterpene compounds such as aristolene and viridiflorol, which are absent from crop odours, may constitute the "weedy scent". Our results provide a general mechanism of how other fungus-farming insects could avoid indiscriminate application of non-specific fungicides which could lead to poisoning their crops, and have bearing on the stability of the mutualism between termites and their crop fungus in the face of parasitism by weedy fungi.

Molecular Genetics of Beauveria bassiana Infection of Insects.

PubMed

Ortiz-Urquiza, A; Keyhani, N O

2016-01-01

Research on the insect pathogenic filamentous fungus, Beauveria bassiana has witnessed significant growth in recent years from mainly physiological studies related to its insect biological control potential, to addressing fundamental questions regarding the underlying molecular mechanisms of fungal development and virulence. This has been in part due to a confluence of robust genetic tools and genomic resources for the fungus, and recognition of expanded ecological interactions with which the fungus engages. Beauveria bassiana is a broad host range insect pathogen that has the ability to form intimate symbiotic relationships with plants. Indeed, there is an increasing realization that the latter may be the predominant environmental interaction in which the fungus participates, and that insect parasitism may be an opportunist lifestyle evolved due to the carbon- and nitrogen-rich resources present in insect bodies. Here, we will review progress on the molecular genetics of B. bassiana, which has largely been directed toward identifying genetic pathways involved in stress response and virulence assumed to have practical applications in improving the insect control potential of the fungus. Important strides have also been made in understanding aspects of B. bassiana development. Finally, although increasingly apparent in a number of studies, there is a need for progressing beyond phenotypic mutant characterization to sufficiently investigate the molecular mechanisms underlying B. bassiana's unique and diverse lifestyles as saprophyte, insect pathogen, and plant mutualist. Copyright © 2016 Elsevier Inc. All rights reserved.

Preliminary data on growth and enzymatic abilities of soil fungus Humicolopsis cephalosporioides at different incubation temperatures.

PubMed

Elíades, Lorena Alejandra; Cabello, Marta N; Pancotto, Verónica; Moretto, Alicia; Rago, María Melisa; Saparrat, Mario C N

2015-01-01

Nothofagus pumilio (Poepp & Endl.) Krasser, known as "lenga" is the most important timber wood species in southernmost Patagonia (Argentina). Humicolopsis cephalosporioides Cabral & Marchand is a soil fungus associated with Nothofagus pumilio forests, which has outstanding cellulolytic activity. However, there is no information about the ability of this fungus to use organic substrates other than cellulose, and its ability to produce different enzyme systems, as well as its response to temperature. The aim of this study was to examine the role of H. cephalosporioides in degradation processes in N. pumilio forests in detail by evaluating the in vitro ability of four isolates of this fungus to grow and produce different lytic enzyme systems, and their response to incubation temperature. The ability of the fungi to grow and produce enzyme systems was estimated by inoculating them on agar media with specific substrates, and the cultures were incubated at three temperatures. A differential behavior of each strain in levels of growth and enzyme activity was found according to the medium type and/or incubation temperature. A intra-specific variability was found in H. cephalosporioides. Likewise a possible link between the saprotrophic role of this fungus in N. pumilio forests and the degradation of organic matter under stress conditions, such as those from frosty environments, was also discussed. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

A nonpathogenic Fusarium oxysporum strain enhances phytoextraction of heavy metals by the hyperaccumulator Sedum alfredii Hance.

PubMed

Zhang, Xincheng; Lin, Li; Chen, Mingyue; Zhu, Zhiqiang; Yang, Weidong; Chen, Bao; Yang, Xiaoe; An, Qianli

2012-08-30

Low biomass and shallow root systems limit the application of heavy metal phytoextraction by hyperaccumulators. Plant growth-promoting microbes may enhance hyperaccumulators'phytoextraction. A heavy metal-resistant fungus belonged to the Fusarium oxysporum complex was isolated from the Zn/Cd co-hyperaccumulator Sedum alfredii Hance grown in a Pb/Zn mined area. This Fusarium fungus was not pathogenic to plants but promoted host growth. Hydroponic experiments showed that 500 μM Zn(2+) or 50 μM Cd(2+) combined with the fungus increased root length, branches, and surface areas, enhanced nutrient uptake and chlorophyll synthesis, leading to more vigorous hyperaccumulators with greater root systems. Soil experiments showed that the fungus increased root and shoot biomass and S. alfredii-mediated heavy metal availabilities, uptake, translocation or concentrations, and thus increased phytoextraction of Zn (144% and 44%), Cd (139% and 55%), Pb (84% and 85%) and Cu (63% and 77%) from the original Pb/Zn mined soil and a multi-metal contaminated paddy soil. Together, the nonpathogenic Fusarium fungus was able to increase S. alfredii root systems and function, metal availability and accumulation, plant biomass, and thus phytoextraction efficiency. This study showed a great application potential for culturable indigenous fungi other than symbiotic mycorrhizas to enhance the phytoextraction by hyperaccumulators. Copyright © 2012 Elsevier B.V. All rights reserved.

Penicillium sp. as an organism that degrades endosulfan and reduces its genotoxic effects.

PubMed

Romero-Aguilar, Mariana; Tovar-Sánchez, Efrain; Sánchez-Salinas, Enrique; Mussali-Galante, Patricia; Sánchez-Meza, Juan Carlos; Castrejón-Godínez, María Luisa; Dantán-González, Edgar; Trujillo-Vera, Miguel Ángel; Ortiz-Hernández, Ma Laura

2014-01-01

Endosulfan is an organochloride and persistent pesticide that has caused concern because of its impact in the environment and its toxicity to and bioaccumulation in living organisms. In this study, we isolated an endosulfan-degrading fungus from the activated sludge from an industrial wastewater treatment plant. Through repetitive enrichment and successive subculture in media containing endosulfan as the sole carbon source, a fungus designated CHE 23 was isolated. Based on a phylogenetic analysis, strain CHE 23 was assigned to the genus Penicillium sp. In a mineral salt medium with 50 mg/l endosulfan as the sole source carbon, CHE 23 removed the added endosulfan in a period of six days. To verify the decrease in endosulfan toxicity due to the activity of the fungus, we performed genotoxicity tests trough the single cell gel electrophoresis assay or comet assay, with Eisenia fetida as the bioindicator species. This organism was exposed to the supernatants of the culture of the fungus and endosulfan. Our results indicated that the genotoxicity of endosulfan was completely reduced due the activity of this fungus. These results suggest that the Penicillium sp. CHE 23 strain can be used to degrade endosulfan residues and/or for water and soil bioremediation processes without causing toxicity problems, which are probably due to the generation of no-toxic metabolites during biodegradation.

Benzyl Derivatives with in Vitro Binding Affinity for Human Opioid Receptors and Cannabinoid Receptors from the Fungus Eurotium repens

USDA-ARS?s Scientific Manuscript database

Bioassay-guided fractionation of the fungus Eurotium repens resulted in the isolation of two benzyl derivatives, repenol A (1) and repenol B (2). Seven known secondary metabolites were also isolated including five benzaldehyde compounds, flavoglaucin (3), tetrahydroauroglaucin (4), dihydroauroglauci...

Influence of Procerum Root Disease on the Water Relations of Eastern White Pine (Pinus strobus L.)

Treesearch

J.R. Butnor; J.R. Seiler; J.A. Gray

2000-01-01

Procerum root disease (PRD) is caused by the deuteromycete fungus Leptogruphium procerum (Kendr.) Wingf, formerly Verticic ladiella procera (Kendr.) and is most commonly isolated from Pinus sp. L., though the fungus has been isolated from other conifer species including Fraser fir (Abies fraseri...

Curvularin and dehydrocurvularin as phytotoxic constituents from curvularia intermedia infecting pandanus amaryllifolius

USDA-ARS?s Scientific Manuscript database

Microbes are good sources of biologically active compounds that can be used as pharmaceuticals and agrochemicals. As part of our continuous efforts in search for biopesticides from natural sources, a fungus was isolated from leaves of Pandanus amaryllifolius that showed severe necrosis. This fungus ...

TREATMENT OF A PENTACHLOROPHENOL AND CREOSOTE-CONTAMINATED SOIL USING THE LIGNIN-DEGRADING FUNGUS PHANERO- CHAETE SORDIDA: A FIELD DEMONSTRATION

EPA Science Inventory

The feasibility of large-scale fungal bioaugmentation was evaluated by assessing the ability of the lignin-degrading fungus Phanerochaete sordida to decrease the soil concentrations of pentachlorophenol (PCP) and 13 priority pollutant polynuclear aromatic (PNA) creosote component...

Fungus Amongus

ERIC Educational Resources Information Center

Wakeley, Deidra

2005-01-01

This role-playing simulation is designed to help teach middle level students about the typical lifecycle of a fungus. In this interactive simulation, students assume the roles of fungi, spores, living and dead organisms, bacteria, and rain. As they move around a playing field collecting food and water chips, they discover how the organisms…

Using enzymes and microorganisms to modify the mycotoxin deoxynivalenol

USDA-ARS?s Scientific Manuscript database

Deoxynivalenol (DON) is a trichothecene mycotoxin produced by the fungus Fusarium graminearum that contaminates staple crops such as wheat, barley, and maize when they are infected with this fungus. New strategies are needed to mitigate DON. We screened for microbes that could grow in the presence o...

Comparative genomic analysis in the fungus Fusarium for production of toxins of concern to food safety

USDA-ARS?s Scientific Manuscript database

SUMMARY Comparative analysis of 207 genomes representing 159 species of the fungus Fusarium detected 9403 known and putative secondary metabolite (SM) biosynthetic gene clusters. The clusters included those responsible for synthesis of mycotoxins, plant hormones and pigments, and varied in distribut...

The Impact of Culture Age, Aeration, and Agitation on the Production of Microsclerotia of the Entomopathogenic Fungus Metarhizium anisopliae Using 100-Liter Fermentors

USDA-ARS?s Scientific Manuscript database

Microsclerotia are desiccation-tolerant, compact hyphal aggregates produced by numerous fungi as overwintering structures. We recently discovered that the entomopathogenic fungus Metarhizium anisopliae produced microsclerotia during liquid culture fermentation. When air-dried microsclerotial granu...

Wood-decay abilities of grapevine trunk pathogens Diaporthe ampelina, Diplodia seriata, Eutypa lata, and Neofusicoccum parvum

USDA-ARS?s Scientific Manuscript database

Trunk pathogens are fungi that infect grapevine wood through pruning wounds and destroy fruiting positions, thereby impacting grape production. Neofusicoccum parvum (causal fungus of Botryosphaeria dieback) and Eutypa lata (causal fungus of Eutypa dieback) cause chronic infections (cankers) of the t...

The rust fungus Gymnosporangium in Korea including two new species, G. monticola and G. unicorne

USDA-ARS?s Scientific Manuscript database

A survey was conducted of species of the rust fungus Gymnosporangium in Korea. The previously known species were recollected, namely Gymnosporangium asiaticum, G. clavariiforme, G. globosum, G. japonicum, and G. yamadae. Although G. cornutum was reported from Korea, collections similar to that speci...

A small cysteine-rich protein from the Asian soybean rust fungus, Phakopsora pachyrhizi, suppresses plant immunity

USDA-ARS?s Scientific Manuscript database

The Asian soybean rust fungus, Phakopsora pachyrhizi, is an obligate pathogen capable of causing explosive disease epidemics that drastically reduce the yield of soybean (Glycine max). Currently, the molecular mechanisms by which P. pachyrhizi and other rust fungi cause disease are poorly understood...

Copper sulfate controls fungus on mat-spawned largemouth bass eggs

USDA-ARS?s Scientific Manuscript database

Copper sulfate (CuSO4) is widely used by the catfish and hybrid striped bass industries as an economical treatment to control fungus (Saprolegnia spp.) on eggs; these industries use hatching troughs and McDonald jars, respectively, in moderate alkalinity waters. This study determined the effectivene...

Report membrane transport of lactic acid in the filamentous fungus Rhizopus

USDA-ARS?s Scientific Manuscript database

The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

Analysis of a Functional Lactate Permease in the Fungus Rhizopus

USDA-ARS?s Scientific Manuscript database

The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

Cold Tolerance of Pityophthorus juglandis (Coleoptera: Scolytidae) From Northern California

Treesearch

Andrea R. Hefty; Steven J. Seybold; Brian H. Aukema; Robert C. Venette

2017-01-01

Winter survivorship of insects is determined by a combination of physiological, behavioral, and microhabitat characteristics. We characterized the cold tolerance of the walnut twig beetle, Pityophthorus juglandis Blackman, a domestic alien invasive bark beetle that vectors a phytopathogenic fungus. The beetle and fungus cause thousand cankers...

Cellular development associated with induced secondary metabolism in the filamentous fungus Fusarium graminearum

USDA-ARS?s Scientific Manuscript database

Several species of the filamentous fungus Fusarium colonize plants and produce toxic small molecules that contaminate agricultural products, rendering them unsuitable for consumption. Among the most destructive of these species is F. graminearum, which causes disease in wheat and barley and often in...

Effect of biochar soil-amendments on Allium porrum growth, arbuscular mycorrhizal fungus colonization

USDA-ARS?s Scientific Manuscript database

Aims: Examine the interaction of biochar addition and arbuscular mycorrhizal [AM] fungus inoculation upon growth and Zn and Cu uptake by Allium porrum L. in heavy metal amended soil mix, and relate these responses to physicochemical properties of the biochars. Methods: The experiment was a complete ...

Black Stain Root Disease of Conifers (FIDL)

Treesearch

Paul F. Hessburg; Donald J. Goheen; Robert V. Bega

1995-01-01

The black stain fungus?Leptographium wageneri (Kendrick) Wingfield*?infects and kills several species of western conifers. The fungus colonizes water-conducting tissues of the host's roots, root collars, and lower stems, ultimately blocking the movement of water to foliage. Severely infected trees exhibit wilting symptoms characteristic of vascular wilt diseases...

Differential gene expression during conidiation in the grape powdery mildew fungus, Erysiphe necator

USDA-ARS?s Scientific Manuscript database

Asexual sporulation (conidiation) is coordinately regulated in the grape powdery mildew fungus Erysiphe necator, but nothing is known about its genetic regulation. We hypothesized that genes required for conidiation in other fungi would be up-regulated at conidiophore initiation and/or full conidia...

Isolation and identification of nematode-antagonistic compounds from the fungus Aspergillus candidus

USDA-ARS?s Scientific Manuscript database

An isolate of the fungus Aspergillus candidus was tested for production of nematicidal compounds. Adults of the nematode Ditylenchus destructor were completely inactive after 24 hr exposure to soy medium in which A. candidus was cultured. Column, thin layer and preparative chromatographies, and spec...

Development of molecular markers for breeding for disease resistant crops

USDA-ARS?s Scientific Manuscript database

Rice blast disease caused by the filamentous ascomycetes fungus Magnaporthe oryzae and sheath blight disease caused by the soil borne fungus Rhizocotonia solani are the two major rice diseases that threaten stable rice production in the USA and worldwide. These two diseases have been managed with a ...

Polymorphic sequence-characterized codominant loci in the chestnut blight fungus, Cryphonectria parasitica

Treesearch

J. E. Davis; Thomas L. Kubisiak; M. G. Milgroom

2005-01-01

Studies on the population biology of the chestnut blight fungus, Cryphonectria parasitica, have previously been carried out with dominant restriction fragment length polymorphism (RFLP) fingerprinting markers. In this study, we described the development of 11 condominant markers from randomly amplified polymorphic DNAs (RAPDs). RAPD fragments were...

Secondary metabolites produced by solid fermentation of the marine-derived fungus Penicillium commune QSD-17.

PubMed

Gao, Shu-Shan; Shang, Zhuo; Li, Xiao-Ming; Li, Chun-Shun; Cui, Chuan-Ming; Wang, Bin-Gui

2012-01-01

The marine sediment-derived fungus Penicillium commune QSD-17 was re-investigated and cultured on rice solid medium. Two new compounds, isophomenone (1) and 3-deacetylcitreohybridonol (2), together with seven known derivatives (3-9), were identified. Their structures were determined by spectroscopic analysis.

Metacridamides A and B, bioactive macrocycles from conidia of the entomopathogenic fungus Metarhizium acridum

USDA-ARS?s Scientific Manuscript database

Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. Its conidia produce two novel 17-membered macrocycles, metacridamides A (1) and B (2), which consist of a Phe unit condensed with a nonaketide....

Confirming QTL for aflatoxin resistance from Mp313E in different genetic backgrounds

USDA-ARS?s Scientific Manuscript database

The fungus Aspergillus flavus (Link:Fr) causes ear rot of maize (Zea mays L.) and produces the toxic metabolic product aflatoxin. One particularly effective method to control the fungus is via host plant resistance, but while several resistant breeding lines have been identified, transferring the r...