Sample records for fungus laetiporus sulphureus

  1. Optimal conditions of mycelia growth of Laetiporus sulphureus sensu lato

    PubMed Central

    Luangharn, Thatsanee; Karunarathna, Samantha C.; Hyde, Kevin D.; Chukeatirote, Ekachai

    2014-01-01

    Laetiporus sulphureus is an edible wood-rotting basidiomycete, growing on decaying logs, stumps, and trunks of many deciduous and coniferous tree species. This fungus produces relatively large striking yellowish or orange-coloured bracket-like fruitbodies. L. sulphureus is widely consumed as a nutritional food because of its fragrance and texture. In this study, two L. sulphureus strains, MFLUCC 12-0546 and MFLUCC 12-0547, isolated from Chiang Rai, Thailand, were investigated for optimal conditions of mycelia growth. Potato dextrose agar and malt extract agar were observed as the favourable medium for mycelia growth. The optimum pH and temperature for the mushroom mycelia were 6–8 and 25–30°C, respectively. PMID:25544934

  2. Purification and characterization of a thermostable beta-1,3-1,4-glucanase from Laetiporus sulphureus var. miniatus.

    PubMed

    Hong, Mi-Ri; Kim, Yeong-Su; Joo, Ah-Reum; Lee, Jung-Kul; Kim, Yeong-Suk; Oh, Deok-Kun

    2009-08-01

    A beta-1,3-1,4-glucanase from the fungus Laetiporus sulphureus var. miniatus was purified as a single 26 kDa band by ammonium sulfate precipitation, HiTrap Q HP, and UNO Q ion-exchange chromatography, with a specific activity of 29 U/mg. The molecular mass of the native enzyme was 52 kDa as a dimer by gel filtration. beta-1,3-1,4-Glucanase showed optimum activity at pH 4.0 and 75 degrees . The half-lives of the enzyme at 70 degrees and 75 degrees were 152 h and 22 h, respectively. The enzyme showed the highest activity for barley beta- glucan as beta-1,3-1,4-glucan among the tested polysaccharides and p-nitrophenyl-beta-D-glycosides with a K(m) of 0.67 mg/ml, a k(cat) of 13.5 s(-1) and a k(cat)/K(m) of 20 mg/ml/s.

  3. Incompatibility groups among North American populations Laetiporus sulphureus sensu lato

    Treesearch

    Mark T. Banik; Harold H. Burdsall

    2000-01-01

    Mycelial interactions and allozyme analysis for glucose&phosphate isomerase activity were used to evaluate compatibility of pairings of single spore isolates (SSIs) within and between Laetiporus restriction groups (LRGs). SSIs from six collections of LRG II were completely compatible. SSIs from four LRG III collections from western North America were completely...

  4. Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

    PubMed

    Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

    2012-01-01

    Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

  5. Study on chemical, bioactive and food preserving properties of Laetiporus sulphureus (Bull.: Fr.) Murr.

    PubMed

    Petrović, Jovana; Stojković, Dejan; Reis, Filipa S; Barros, Lillian; Glamočlija, Jasmina; Ćirić, Ana; Ferreira, Isabel C F R; Soković, Marina

    2014-07-25

    Laetiporus sulphureus (Bull.: Fr.) Murr. was studied to determine the nutritional value, bioactive compounds, in vitro antioxidants, and antimicrobial and antitumor activities. The studied mushroom is a rich source of carbohydrates and proteins. Mannitol and trehalose were the main free sugars. In addition, the polyunsaturated fatty acids α-, γ- and δ-tocopherols were found. Oxalic and citric acids were the most abundant organic acids; cinnamic and p-hydroxybenzoic acids were quantified in the methanolic extract and could be related to the antioxidant properties. It was the polysaccharidic extract that exhibited higher antioxidant and antimicrobial activities, indicating that the compounds present in this extract possess stronger bioactivity. Only the polysaccharidic extract revealed antiproliferative activity in human tumor cell lines. In addition, a suitable model system with chicken pâté was developed to test the antimicrobial preserving properties of L. sulphureus. The methanolic extract was used to examine in situ preserving properties against Aspergillus flavus and demonstrated excellent preserving potential.

  6. [Antimicrobial activity of Laetiporus sulphureus strains grown in submerged culture].

    PubMed

    Ershova, E Iu; Tikhonova, O V; Lur'e, L M; Efremenkova, O V; Kamzolkina, O V; Dudnik, Iu V

    2003-01-01

    Cultural conditions for growth and fruit body formation were elaborated to four strains of Laetiporus sulphureus isolated from nature. All strains demonstrated antimicrobial activity against a wide spectrum of gram-positive and gram-negative bacteria during agar and submerged cultivation including methicillin-resistant strain of Staphylococcus aureus (MRSA) and glycopeptide-resistant strain of Leuconostoc mesenteroides. Antifungal activity was not found. The level of antimicrobial activity during submerged cultivation reached maximum after seven days of growth on specific medium with soybean meal and corn liquid; the next four weeks its increasing was not so manifested. Antimicrobial activity correlated with orange pigment secretion and cultural liquid acidification to pH 2.0-2.8 that indicates on acid nature of synthesized products.

  7. Remediation capacity of Cd and Pb ions by mycelia of Imleria badia, Laetiporus sulphureus, and Agaricus bisporus in vitro cultures.

    PubMed

    Kryczyk, Agata; Piotrowska, Joanna; Sito, Magdalena; Sulkowska-Ziaja, Katarzyna; Dobosz, Konrad; Opoka, Włodzimierz; Muszyńska, Bożena

    2017-09-02

    The goal of this study was to evaluate cadmium and lead accumulation ability of in vitro cultures biomass containing selected edible mushroom species derived from the environment (Laetiporus sulphureus, Imleria badia) and those of commercial origin (Agaricus bisporus). Atomic absorption spectrometry was used to evaluate the content of Cd(II) and Pb(II) on the medium supplemented with Cd(II) or Pb(II), each of them at the same concentration of 5·10 -5 M. The highest concentration of Cd(II) ions was determined in the biomass from L. sulphureus in vitro cultures, while the highest concentration of Pb(II) ions was found in the biomass from A. bisporus in vitro cultures. The greatest Cd(II) and Pb(II) accumulation ability in mycelium per dry weight was shown for L. sulphureus. Among the test species, biomass of A. bisporus showed the lowest ability for the bioaccumulation of Cd(II); however, comparable ability for the remediation of Pb(II) was provided by the biomasses from A. bisporus and I. badia in vitro cultures. The results confirm the possibility of using these mushroom species for remediation and indicate the relationship between bioaccumulation of heavy metals and the test species.

  8. Laetiporus sulphureus, edible mushroom from Serbia: investigation on volatile compounds, in vitro antimicrobial activity and in situ control of Aspergillus flavus in tomato paste.

    PubMed

    Petrović, Jovana; Glamočlija, Jasmina; Stojković, Dejan S; Ćirić, Ana; Nikolić, Miloš; Bukvički, Danka; Guerzoni, Maria Elisabetta; Soković, Marina D

    2013-09-01

    The volatile compounds of fruiting bodies of wild Laetiporus sulphureus (Bull.) Murrill, growing on willow trees from Serbia, were isolated and extracted using methanol, acetone and dichloromethane and investigated by GC/MS-SPME. A total of 56 components were identified in the extracts. Hydrocarbons predominated (76.90%, 77.20%, and 43.10%) in dichloromethane, acetone and methanol extracts, respectively. Fatty acids, esters and sesquiterpenes were present in amounts equal or lower than 2.00%. Ketones were represented with moderate amount with the exception of methanol extract where it reached as much as 28.90% of the total investigated compounds. Extracts were also tested for antimicrobial activity with and without the addition of food additive - potassium disulfite in vitro against eight bacterial and eight fungal species, and in situ in tomato paste against Aspergillus flavus. All the tested extracts showed good antimicrobial activity, but methanol extract with addition of E224 showed the best antimicrobial activity in vitro. In situ results indicate complete inhibition of A. flavus growth in tomato paste after 15 days of the treatment. This study is the first report on volatile composition of L. sulphureus growing wild in Serbia. We describe for the first time the application of its extract as antifungal food preservative. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Protective Effect of Eburicoic Acid of the Chicken of the Woods Mushroom, Laetiporus sulphureus (Higher Basidiomycetes), Against Gastric Ulcers in Mice.

    PubMed

    Wang, Junzhi; Sun, Wenjun; Luo, Huajun; He, Haibo; Deng, Weiqiao; Zou, Kun; Liu, Can; Song, Jing; Huang, Wenfeng

    2015-01-01

    In this study, we investigated the anti-inflammatory and tumor-inhibiting effects of eburicoic acid, the main bioactive component in the Laetiporus sulphureus, on gastric ulcers. A total of 48 Kunming mice were randomly divided into six groups: control, model, OL (omeprazole, 20 mg/kg/day, orally), EA-L (eburicoic acid, 10 mg/kg/day, orally), EA-M (eburicoic acid, 20 mg/kg/day, orally), and EA-H (eburicoic acid, 40 mg/kg/day, orally). Gastric ulcers were induced in mice by administering 80% ethanol containing 15 mg/mL aspirin (10.0 mL/kg, i.g.) 4 hours after drug administration on day 5. The ulcer index and H+/K+-ATPase activity were evaluated in vivo. Computer-aided molecular docking simulated the interaction between eburicoic acid and H+/K+-ATPase. The results showed that the oral administration of eburicoic acid protected the gastric mucosa from gastric lesions morphologically and especially attenuated H+/K+-ATPase activity. The results of this study indicate that the gastric protective effect of eburicoic acid might inhibit gastric acid.

  10. Single-step affinity and cost-effective purification of recombinant proteins using the Sepharose-binding lectin-tag from the mushroom Laetiporus sulphureus as fusion partner.

    PubMed

    Li, Xiao-Jing; Liu, Jin-Ling; Gao, Dong-Sheng; Wan, Wen-Yan; Yang, Xia; Li, Yong-Tao; Chang, Hong-Tao; Chen, Lu; Wang, Chuan-Qing; Zhao, Jun

    2016-03-01

    Previous research showed that a lectin from the mushroom Laetiporus sulphureus, designed LSL, bound to Sepharose and could be eluted by lactose. In this study, by taking advantage of the strong affinity of LSL-tag for Sepharose, we developed a single-step purification method for LSL-tagged fusion proteins. We utilized unmodified Sepharose-4B as a specific adsorbent and 0.2 M lactose solution as an elution buffer. Fusion proteins of LSL-tag and porcine circovirus capsid protein, designated LSL-Cap was recovered with purity of 90 ± 4%, and yield of 87 ± 3% from crude extract of recombinant Escherichia coli. To enable the remove of LSL-tag, tobacco etch virus (TEV) protease recognition sequence was placed downstream of LSL-tag in the expression vector, and LSL-tagged TEV protease, designated LSL-TEV, was also expressed in E. coli., and was recovered with purity of 82 ± 5%, and yield of 85 ± 2% from crude extract of recombinant E. coli. After digestion of LSL-tagged recombinant proteins with LSL-TEV, the LSL tag and LSL-TEV can be easily removed by passing the digested products through the Sepharose column. It is of worthy noting that the Sepharose can be reused after washing with PBS. The LSL affinity purification method enables rapid and inexpensive purification of LSL-tagged fusion proteins and scale-up production of native proteins. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Mushrooms Collected from Deogyu Mountain, Muju, Korea and Their Antioxidant Activity

    PubMed Central

    Kim, Seong-Eun; Lee, In-Kyoung; Jung, Yun-A; Yeom, Ji-Hee; Ki, Dae-Won; Lee, Myeong-Seok; Song, Ja-Gyeong; Jin, Yong-Ju; Seok, Soon-Ja

    2012-01-01

    Mushrooms collected from Deogyu mountain, Korea, in 2011, were identified as four classes, four orders, 13 families, 22 genera, and 33 species. In particular, agaricales was most abundant and comprised more than 70%. Their antioxidant activities were estimated using three different bioassay methods, the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) radical scavenging assay, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging assay, and reducing power assay. As a result, the methanol extracts of Stereum ostrea, Laetiporus sulphureus var. miniatus, and Tyromyces sambuceus exhibited potent antioxidant activity in all bioassays tested. PMID:22870057

  12. Molecular profiling and bioactive potential of an endophytic fungus Aspergillus sulphureus isolated from Sida acuta: a medicinal plant.

    PubMed

    Murali, M; Mahendra, C; Hema, P; Rajashekar, N; Nataraju, A; Sudarshana, M S; Amruthesh, K N

    2017-12-01

    Sida acuta Burm.f. (Malvaceae) extracts are reported to have applications against malaria, diuretic, antipyretic, nervous and urinary diseases. No fungal endophytes of S. acuta are reported. Isolation, identification and evaluation of antibacterial, antioxidant, anticancer and haemolytic potential of fungal endophytes from the ethnomedcinal plant S. acuta. Sida acuta stem segments were placed on PDA medium to isolate endophytic fungi. The fungus was identified by genomic DNA analysis and phylogenetic tree was constructed using ITS sequences (GenBank) to confirm species. The antibacterial efficacy of Aspergillus sulphureus MME12 ethyl acetate extract was tested against Gram-positive and Gram-negative pathogenic bacteria. DPPH free radical scavenging activity, anticancer and DNA fragmentation against EAC cells, and direct haemolytic activity (100-500 μg/mL) using human erythrocytes were determined. The ethyl acetate extract of A. sulphureus (Fresen.) Wehmer (Trichocomaceae) demonstrated significant antibacterial potential against Staphylococcus aureus, Bacillus subtilis, Escherichia coli and Salmonella typhi compared to streptomycin. MIC against test pathogens was in the range of 15.6-62.5 μg/mL. The antioxidant results revealed significant RSA from 12.43% to 62.02% (IC 50  = 350.4 μg/mL, p ≤ 0.05). MME12 offered considerable inhibition of EAC proliferation (23% to 84%, IC 50  = 216.7 μg/mL, p ≤ 0.05) supported by DNA fragmentation studies. The extract also offered insignificant haemolysis (5.6%) compared to Triton X-100. A single endophytic fungus, A. sulphureus MME12 was isolated and identified using molecular profiling. The above-mentioned findings support the pharmacological application of A. sulphureus MME12 extract and demand for purification of the active principle(s).

  13. Detecting volatile compounds from Kraft lignin degradation in the headspace of microbial cultures by selected ion flow tube mass spectrometry (SIFT-MS).

    PubMed

    Gibson, Andrew; Malek, Lada; Dekker, Robert F H; Ross, Brian

    2015-05-01

    Selected Ion Flow Tube Mass Spectrometry (SIFT-MS) was used to quantify methanol and other volatile compounds in the headspace of one bacterial and 12 fungal lignin-degrading microbial cultures. Cultures were grown in 250 mL Erlenmeyer flasks capped with aluminum foil containing 40 mL of nutrient media using Kraft lignin (0.3% w/v) as the sole carbon source. Analysis was done using SIFT-MS with H3O(+) and NO(+) precursors. Product ions were identified with multiple ion mode (MIM). Full scan (FS) mode was used to identify other compounds of interest. Absidia cylindrospora, Ischnoderma resinosum and Pholiota aurivella increased headspace methanol concentration by 136 ppb, 1196 ppb and 278 ppb, respectively, while Flammulina velutipes and Laetiporus sulphureus decreased concentration below ambient levels. F. velutipes and L. sulphureus were found to produce products of methanol oxidation (formaldehyde and formic acid) and were likely metabolizing methanol. Some additional unidentified compounds generated by the fungal cultures are intriguing and will require further study. SIFT-MS can be used to quantify methanol and other volatile compounds in the headspace of microbial cultures and has the potential to be a rapid, sensitive, non-invasive tool useful in elucidating the mechanisms of lignin degradative pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Control of oral human papillomavirus (HPV) by medicinal mushrooms, Trametes versicolor and Ganoderma lucidum: a preliminary clinical trial.

    PubMed

    Donatini, Bruno

    2014-01-01

    This preliminary randomized study investigated the efficacy of medicinal mushrooms, Trametes versicolor (TV), Ganoderma lucidum (GL), and Laetiporus sulphureus (LS), on the clearance of oral human papillomavirus (HPV, serotypes 16 and 18). Among 472 patients who underwent oral swabs for gingivitis, 61 patients were positive for HPV16 or HPV18. Twenty patients were included in group 1 (LS) and 41 patients were included in group 2 (TV+GL) for 2 months. Polymerase chain reaction (PCR) for HPV was performed at inclusion and after 2 months. In group 1, the clearance was equal to 5% after 2 months of treatment. In group 2, the clearance was equal to 88% (P<0.001). The detection of HPV16 or HPV18 could become relevant in routine since positivity is frequent and because a harmless and costless treatment may exist. The use of TV+GL for the clearance of oral HPV deserves further investigation.

  15. Molecular basis of toxicity of Clostridium perfringens epsilon toxin.

    PubMed

    Bokori-Brown, Monika; Savva, Christos G; Fernandes da Costa, Sérgio P; Naylor, Claire E; Basak, Ajit K; Titball, Richard W

    2011-12-01

    Clostridium perfringens ε-toxin is produced by toxinotypes B and D strains. The toxin is the aetiological agent of dysentery in newborn lambs but is also associated with enteritis and enterotoxaemia in goats, calves and foals. It is considered to be a potential biowarfare or bioterrorism agent by the US Government Centers for Disease Control and Prevention. The relatively inactive 32.9 kDa prototoxin is converted to active mature toxin by proteolytic cleavage, either by digestive proteases of the host, such as trypsin and chymotrypsin, or by C. perfringens λ-protease. In vivo, the toxin appears to target the brain and kidneys, but relatively few cell lines are susceptible to the toxin, and most work has been carried out using Madin-Darby canine kidney (MDCK) cells. The binding of ε-toxin to MDCK cells and rat synaptosomal membranes is associated with the formation of a stable, high molecular weight complex. The crystal structure of ε-toxin reveals similarity to aerolysin from Aeromonas hydrophila, parasporin-2 from Bacillus thuringiensis and a lectin from Laetiporus sulphureus. Like these toxins, ε-toxin appears to form heptameric pores in target cell membranes. The exquisite specificity of the toxin for specific cell types suggests that it binds to a receptor found only on these cells. © 2011 The Authors Journal compilation © 2011 FEBS.

  16. A new species of Laetiporus (Basidiomycota, Polyporales) from the Caribbean basin

    Treesearch

    Mark T. Banik; Daniel L. Lindner; Beatriz Ortiz-Santana; Deborah J. Lodge

    2012-01-01

    Laetiporus caribensis is described as a new species, causing brown rot on hardwoods in the Caribbean basin. Laetiporus caribensis is distinguished from described species in the genus by smaller basidiospores. In addition, single spore isolates of L. caribensis are incompatible with those of the known species of...

  17. Genetic Relationships among Different Chemotypes of Lupinus sulphureus.

    PubMed

    Cook, Daniel; Mott, Ivan W; Larson, Steven R; Lee, Stephen T; Johnson, Robert; Stonecipher, Clinton A

    2018-02-28

    Lupines (Lupinus spp.) are a common plant legume species found on western U.S. rangelands. Lupinus spp. may contain quinolizidine and/or piperidine alkaloids that can be toxic and/or teratogenic to grazing livestock. Alkaloid profiles may vary between and within a species. The objectives of this study were to (1) further explore the characteristic alkaloid profiles of Lupinus sulphureus using field collections and (2) explore the phylogenetic relationship of the different populations and chemotypes of L. sulphureus using the amplified fragment length polymorphism method of DNA fingerprinting, thus providing possible explanations to the phenomena of multiple chemotypes within a species. A total of 49 accessions of L. sulphureus were classified into seven chemotypes. The DNA profiles showed that one L. sulphureus chemotype, chemotype A, is genetically divergent from the other chemotypes of L. sulphureus, suggesting that it represents an unresolved lupine taxon, possibly a new lupine species. Additionally, the different chemotypes of L. sulphureus represented different genetic groups, as shown by Bayesian cluster analysis and principle component analysis.

  18. European medicinal polypores--a modern view on traditional uses.

    PubMed

    Grienke, Ulrike; Zöll, Margit; Peintner, Ursula; Rollinger, Judith M

    2014-07-03

    In particular five polypore species, i.e. Laetiporus sulphureus, Fomes fomentarius, Fomitopsis pinicola, Piptoporus betulinus, and Laricifomes officinalis, have been widely used in central European folk medicines for the treatment of various diseases, e.g. dysmenorrhoea, haemorrhoids, bladder disorders, pyretic diseases, treatment of coughs, cancer, and rheumatism. Prehistoric artefacts going back to over 5000 years underline the long tradition of using polypores for various applications ranging from food or tinder material to medicinal-spiritual uses as witnessed by two polypore species found among items of Ötzi, the Iceman. The present paper reviews the traditional uses, phytochemistry, and biological activity of the five mentioned polypores. All available information on the selected polypore taxa used in traditional folk medicine was collected through evaluation of literature in libraries and searches in online databases using SciFinder and Web of Knowledge. Mycochemical studies report the presence of many primary (e.g. polysaccharides) and secondary metabolites (e.g. triterpenes). Crude extracts and isolated compounds show a wide spectrum of biological properties, such as anti-inflammatory, cytotoxic, and antimicrobial activities. The investigated polypores possess a longstanding ethnomycological tradition in Europe. Here, we compile biological results which highlight their therapeutic value. Moreover, this work provides a solid base for further investigations on a molecular level, both compound- and target-wise. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. Molecular phylogeny of Laetiporus and other brown rot polypore genera in North America

    Treesearch

    Daniel L. Lindner; Mark T. Banik

    2008-01-01

    Phylogenetic relationships were investigated among North American species of Laetiporus, Leptoporus, Phaeolus, Pycnoporellus, and Wolfiporia using ITS, nuclear large subunit and mitochondrial small subunit rDNA sequences. Members of these genera have poroid hymenophores, simple septate hyphae and cause brown rots in a variety of...

  20. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Treesearch

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  1. Phylogeny, divergence time and historical biogeography of Laetiporus (Basidiomycota, Polyporales).

    PubMed

    Song, Jie; Cui, Bao-Kai

    2017-04-20

    The aim of this study was to characterize the molecular relationship, origin and historical biogeography of the species in important brown rot fungal genus Laetiporus from East Asia, Europe, Pan-America, Hawaii and South Africa. We used six genetic markers to estimate a genus-level phylogeny including (1) the internal transcribed spacer (ITS), (2) nuclear large subunit rDNA (nrLSU), (3) nuclear small subunit rDNA (nrSSU), (4) translation elongation factor 1-α (EF-1α), (5) DNA-directed RNA polymerase II subunit 2 (RPB2), and (6) mitochondrial small subunit rDNA (mtSSU). Results of multi-locus phylogenetic analyses show clade support for at least seventeen species-level lineages including two new Laetiporus in China. Molecular dating using BEAST estimated the present crown group diverged approximately 20.16 million years ago (Mya) in the early Miocene. Biogeographic analyses using RASP indicated that Laetiporus most likely originated in temperate zones with East Asia and North America having the highest probability (48%) of being the ancestral area. Four intercontinental dispersal routes and a possible concealed dispersal route were established for the first time.

  2. The Alkaloid Profiles of Lupinus sulphureus

    USDA-ARS?s Scientific Manuscript database

    Lupines are common plants found on the rangelands in the western United States. Lupines are known to contain alkaloids that can be toxic and teratogenic causing congenital birth defects (crooked calf disease). One such lupine, Lupinus sulphureus, occurs in parts of Oregon, Washington, and British ...

  3. Elimination of field colonies of a mound-building termite Globitermes sulphureus (Isoptera: Termitidae) by bistrifluron bait.

    PubMed

    Neoh, Kok-Boon; Jalaludin, Nur Atiqah; Lee, Chow-Yang

    2011-04-01

    The efficacy of Xterm, which contains 1% bistrifluron, in the form of cellulose bait pellets was evaluated for its efficacy in eradicating field colonies of the mound-building termite Globitermes sulphureus (Haviland) (Isoptera: Termitidae). The termite mounds were dissected at the end of the experiment to determine whether the colonies were eliminated. By approximately 2 mo postbaiting, the body of termite workers appeared marble white, and mites were present on the body. The soldier-worker ratio increased drastically in the colonies, and the wall surface of the mounds started to erode. Colony elimination required at least a 4-mo baiting period. Mound dissection revealed wet carton materials (food store) that were greatly consumed and overgrown by fast-growing fungi. Decaying cadavers were scattered all over the nests. On average, 84.1 +/- 16.4 g of bait matrix (68.9 +/- 13.4%, an equivalent of 841 +/- 164 mg of bistrifluron) was consumed in each colony. Moreover, we found that a mere 143 mg of bistrifluron was sufficient to eliminate a colony of C. sulphureus.

  4. Ethnomycological study in the Kilum-Ijim mountain forest, Northwest Region, Cameroon.

    PubMed

    Teke, N A; Kinge, T R; Bechem, E; Nji, T M; Ndam, L M; Mih, A M

    2018-04-02

    Majority of the people in rural areas depend on traditional fungi-based medicines to combat different illnesses. This ethnomycological survey was undertaken to document the traditional knowledge of mushrooms among the communities in the Kilum-Ijim mountain forest reserve. Although macrofungi are exploited for food and medicine, their ethnomycological knowledge has not been documented in this ecosystem. A field study was carried out between 2014 and 2015; 14 mushrooms used by the local communities were collected and identified using the polymorphism of the ribosomal ITS1, 5.8S, and ITS2 regions. Semi-structured questionnaires, focus group discussions, and pictorial method were used to collect information on edibility, local names, indigenous knowledge, and the role of macrofungi in ten communities. Ethnomycological findings revealed that mushrooms were used as food and medicine, while the non-edible species were regarded as food from Satan. Eight species, Polyporus tenuiculus, Termitomyces striatus, Termitomyces microcarpus Auricularia polytricha, Laetiporus sulphureus, Termitomyces sp.1, Termitomyces sp.2, and Polyporus dictyopus, were reported as edible and Auricularia polytricha, Daldinia concentrica, Ganoderma applanatum, Lentinus squarrosulus, Polyporus dictyopus, Termitomyces microcarpus, Trametes versicolor, Vascellum pretense and Xylaria sp., were used as medicine in traditional health care. Local names were found to be a very important factor in distinguishing between edible, medicinal, and poisonous mushrooms. Edible mushrooms are called "awo'oh" in Belo and "Kiwoh" in Oku. Poisonous mushrooms were commonly referred to as "awo'oh Satan" in Belo and "Kiwohfiyini" in Oku. Mushrooms were highly valued as a source of protein and as a substitute for meat in their diets. It is worth noting that Polyporus dictyopus was reported here for the first time in literature as an edible mushroom species. Local knowledge of medicinal mushrooms in the treatment of different illness still exists in all ten villages surveyed. Elderly men and women appear to play an important role in primary health care services in these communities. This survey underscores the need to preserve and document traditional knowledge of the different medicinal mushrooms used in treating different illnesses and for more future scientific research on the mushrooms to determine their efficacy and their safety.

  5. Cloning, functional expression, and characterization of a chalcone 3-hydroxylase from Cosmos sulphureus.

    PubMed

    Schlangen, Karin; Miosic, Silvija; Thill, Jana; Halbwirth, Heidi

    2010-07-01

    A chalcone 3-hydroxylase (CH3H) cDNA clone was isolated and characterized from Cosmos sulphureus petals accumulating butein (2',3,4,4'-tetrahydroxychalcone) derivatives as yellow flower pigments. The recombinant protein catalyses the introduction of an additional hydroxyl group in the B-ring of chalcones, a reaction with high similarity to the hydroxylation of flavonoids catalysed by the well-studied flavonoid 3'-hydroxylase (F3'H). CH3H shows high specificity for chalcones, but a low F3'H activity was also detected. By contrast, the common F3'H from C. sulphureus does not accept chalcones as substrates and is therefore unlikely to be involved in the creation of the B-ring hydroxylation pattern of the yellow flower pigments. CH3H was primarily expressed in young buds, the main tissue for chalcone pigment formation. Expression levels in open flowers and 3-d-old seedlings were lower and almost no CH3H expression was observed in leaves. F3'H, in contrast, showed the highest expression also in buds, but comparable expression rates in all other tissues tested. Recombinant hybrid proteins constructed from CH3H and F3'H fragments demonstrated that amino acid residues at a substrate recognition site and an insertion of four amino acid residues in a putative loop region have an impact on chalcone acceptance. This is the first identification of a CH3H cDNA from any plant species.

  6. Comparative studies on lignin and polycyclic aromatic hydrocarbons degradation by basidiomycetes fungi.

    PubMed

    Arun, A; Eyini, M

    2011-09-01

    A total of 130 wild basidiomycetes fungi were collected and identified. The polycyclic aromatic hydrocarbons (PAHs) degradation by the potential Phellinus sp., Polyporus sulphureus (in liquid state fermentation (LSF), solid state fermentation (SSF), in soil) and lignin biodegradation were compared with those of a bacterial isolate and their corresponding cocultures. The PAHs degradation was higher in LSF and the efficiency of the organisms declined in SSF and in soil treatment. Phellinus sp. showed better degradation in SSF and in soil. Bacillus pumilus showed higher degradation in LSF. B. pumilus was seen to have lower lignin degradation than the fungal cultures and the cocultures could not enhance the degradation. Phellinus sp. which had higher PAHs and lignin degradation showed higher biosurfactant production than other organism. Manganese peroxidase (MnP) was the predominant enzyme in Phellinus sp. while lignin peroxidase (Lip) was predominant in P. sulphureus. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Genotypic and phenotypic diversity in tropical strains of Aspergillus spp. (section Circumdati) isolated from insects.

    PubMed

    Moraes, Aurea; Holanda, Veronica; Zahner, Viviane

    2006-04-01

    The morphology, multilocus enzyme electrophoresis (MLEE), and RAPD-PCR profiles of a panel of 63 strains of Aspergilus section Circumdati, all isoloated from Brazilian insects, were examined. When compared to the descriptions reported in the literature, differences were observed in terms of colony diameter for the representatives studies. Numerical taxonomy based on data generated by MLEE identified two distinct subgroups among the A. ochraceus isolates. In addition, phosphoglucose isomerase (GPI-1) was detected only in A. sclerotiorum, while phosphofructokinase (FK-1) and acid phosphatase (ACP-2) were present only in strains of A. sulphureus, suggesting that these alleles (bands) could be used for species-specific detection. Using RAPD-PCR, species-specific molecular markers were identified for both A. petrakii and A. sulphureus. These results are important from the taxonomic viewpoint and may also be used in the design of screening programs for the isoloation of new strains.

  8. Transgenic apple plants overexpressing the chalcone 3-hydroxylase gene of Cosmos sulphureus show increased levels of 3-hydroxyphloridzin and reduced susceptibility to apple scab and fire blight.

    PubMed

    Hutabarat, Olly Sanny; Flachowsky, Henryk; Regos, Ionela; Miosic, Silvija; Kaufmann, Christine; Faramarzi, Shadab; Alam, Mohammed Zobayer; Gosch, Christian; Peil, Andreas; Richter, Klaus; Hanke, Magda-Viola; Treutter, Dieter; Stich, Karl; Halbwirth, Heidi

    2016-05-01

    Overexpression of chalcone-3-hydroxylase provokes increased accumulation of 3-hydroxyphloridzin in Malus . Decreased flavonoid concentrations but unchanged flavonoid class composition were observed. The increased 3-hydroxyphlorizin contents correlate well with reduced susceptibility to fire blight and scab. The involvement of dihydrochalcones in the apple defence mechanism against pathogens is discussed but unknown biosynthetic steps in their formation hamper studies on their physiological relevance. The formation of 3-hydroxyphloretin is one of the gaps in the pathway. Polyphenol oxidases and cytochrome P450 dependent enzymes could be involved. Hydroxylation of phloretin in position 3 has high similarity to the B-ring hydroxylation of flavonoids catalysed by the well-known flavonoid 3'-hydroxylase (F3'H). Using recombinant F3'H and chalcone 3-hydroxylase (CH3H) from Cosmos sulphureus we show that F3'H and CH3H accept phloretin to some extent but higher conversion rates are obtained with CH3H. To test whether CH3H catalyzes the hydroxylation of dihydrochalcones in planta and if this could be of physiological relevance, we created transgenic apple trees harbouring CH3H from C. sulphureus. The three transgenic lines obtained showed lower polyphenol concentrations but no shift between the main polyphenol classes dihydrochalcones, flavonols, hydroxycinnamic acids and flavan 3-ols. Increase of 3-hydroxyphloridzin within the dihydrochalcones and of epicatechin/catechin within soluble flavan 3-ols were observed. Decreased activity of dihydroflavonol 4-reductase and chalcone synthase/chalcone isomerase could partially explain the lower polyphenol concentrations. In comparison to the parent line, the transgenic CH3H-lines showed a lower disease susceptibility to fire blight and apple scab that correlated with the increased 3-hydroxyphlorizin contents.

  9. Chemical characterisation and hepatoprotective potential of Cosmos sulphureus Cav. and Cosmos bipinnatus Cav.

    PubMed

    Saleem, Mohammad; Ali, Hafiz Akbar; Akhtar, Muhammad Furqan; Saleem, Uzma; Saleem, Ammara; Irshad, Iram

    2017-12-11

    This study was conducted to validate the hepatoprotective activity of Cosmos sulphureus and Cosmos bipinnatus. Aqua-methanolic extracts of both plants were evaluated for the presence of various phyto-constituents through HPLC. Different doses of both plant extracts were administered to rats for nine days. Standard control was silymarin 100 mg/kg. Paracetamol 1 gm/kg was administered 3 h post treatment on 9th day for induction of hepatotoxicity. Blood was collected for the evaluation of liver biochemical markers and livers were removed for histopathological evaluation 24 h post-paracetamol treatment. HPLC analysis revealed the presence of quercetin, gallic acid, caffeic acid and chlorogenic acid in both plant extracts. The extracts of both plants decreased the level of alanine aminotransaminase and total bilirubin significantly (p < 0.05), dose dependently and protected hepatocytes from paracetamol-induced hepatotoxicity. It can be concluded that both plants may possess hepatoprotective activity possibly due to the presence of quercetin and phenolic compounds.

  10. Intragenomic variation in the ITS rDNA region obscures phylogenetic relationships and inflates estimates of operational taxonomic units in genus Laetiporus

    Treesearch

    Daniel L. Lindner; Mark T. Banik

    2011-01-01

    Regions of rDNA are commonly used to infer phylogenetic relationships among fungal species and as DNA barcodes for identification. These regions occur in large tandem arrays, and concerted evolution is believed to reduce intragenomic variation among copies within these arrays, although some variation still might exist. Phylogenetic studies typically use consensus...

  11. Alkaloid Profiling as an Approach to Differentiate Lupinus garfieldensis, Lupinus sabinianus and Lupinus sericeus.

    PubMed

    Cook, Daniel; Lee, Stephen T; Pfister, James A; Stonecipher, Clint A; Welch, Kevin D; Green, Benedict T; Panter, Kip E

    2012-01-01

    Many species in the Lupinus genus are poorly defined morphologically, potentially resulting in improper taxonomic identification. Lupine species may contain quinolizidine and/or piperidine alkaloids that can be acutely toxic and/or teratogenic, the latter resulting in crooked calf disease. To identify characteristic alkaloid profiles of Lupinus sabinianus, L. garfieldensis and L. sericeus which would aid in discriminating these species from each other and from L. sulphureus. Quinolizidine and piperidine alkaloids were extracted from herbarium specimens and recent field collections of L. sabinianus, L. garfieldensis and L. sericeus. The alkaloid composition of each species was defined using GC-FID and GC-MS and compared using multivariate statistics. Each of the three species investigated contained a diagnostic chemical fingerprint composed of quinolizidine and/or piperidine alkaloids. The alkaloid profiles of Lupinus sabinianus, L. garfieldensis and L. sericeus can be used as a tool to discriminate these species from each other and L. sulphureus as long as one considers locality of the collection in the case of L. sabinianus. Published 2011. This article is a US Government work and is in the public domain in the USA.

  12. Lupine-Induced 'Crooked Calf Disease' in Washington and Oregon: Identification of the alkaloid profiles of Lupinus sericeus, Lupinus sulphureus, and Lupinus leucophyllus

    USDA-ARS?s Scientific Manuscript database

    Lupines are common plants found on the rangelands in the western United States. Lupines are known to contain alkaloids that can be toxic and teratogenic causing congenital birth defects (crooked calf disease). Lupine-induced crooked calf disease cases are documented in North-eastern Oregon and the...

  13. Do Termites Avoid Carcasses? Behavioral Responses Depend on the Nature of the Carcasses

    PubMed Central

    Neoh, Kok-Boon; Yeap, Beng-Keok; Tsunoda, Kunio; Yoshimura, Tsuyoshi; Lee, Chow-Yang

    2012-01-01

    Background Undertaking behavior is a significant adaptation to social life in enclosed nests. Workers are known to remove dead colony members from the nest. Such behavior prevents the spread of pathogens that may be detrimental to a colony. To date, little is known about the ethological aspects of how termites deal with carcasses. Methodology and Principal Findings In this study, we tested the responses to carcasses of four species from different subterranean termite taxa: Coptotermes formosanus Shiraki and Reticulitermes speratus (Kolbe) (lower termites) and Microcerotermes crassus Snyder and Globitermes sulphureus Haviland (higher termites). We also used different types of carcasses (freshly killed, 1-, 3-, and 7-day-old, and oven-killed carcasses) and mutilated nestmates to investigate whether the termites exhibited any behavioral responses that were specific to carcasses in certain conditions. Some behavioral responses were performed specifically on certain types of carcasses or mutilated termites. C. formosanus and R. speratus exhibited the following behaviors: (1) the frequency and time spent in antennating, grooming, and carcass removal of freshly killed, 1-day-old, and oven-killed carcasses were high, but these behaviors decreased as the carcasses aged; (2) the termites repeatedly crawled under the aging carcass piles; and (3) only newly dead termites were consumed as a food source. In contrast, M. crassus and G. sulphureus workers performed relatively few behavioral acts. Our results cast a new light on the previous notion that termites are necrophobic in nature. Conclusion We conclude that the behavioral response towards carcasses depends largely on the nature of the carcasses and termite species, and the response is more complex than was previously thought. Such behavioral responses likely are associated with the threat posed to the colony by the carcasses and the feeding habits and nesting ecology of a given species. PMID:22558452

  14. The first fossil fungus gardens of Isoptera: oldest evidence of symbiotic termite fungiculture (Miocene, Chad basin)

    NASA Astrophysics Data System (ADS)

    Duringer, Philippe; Schuster, Mathieu; Genise, Jorge F.; Likius, Andossa; Mackaye, Hassan Taisso; Vignaud, Patrick; Brunet, Michel

    2006-12-01

    Higher termites of the subfamily Macrotermitinae (fungus-growing termites) are known to build fungus gardens where a symbiotic fungus ( Termitomyces sp.) is cultivated. The fungus grows on a substrate called fungus comb, a structure built with the termites’ own faeces. Here we present the first fossil fungus combs ever found in the world. They were extracted from 7-million-year-old continental sandstone (Chad basin). Fossilized fungus combs have an ovoid morphology with a more or less flattened concave base and a characteristic general alveolar aspect. Under lens, they display a typical millimetre-scale pelletal structure. The latter, as well as the general shape and alveolar aspect, are similar to the morphology of fungus combs from extant fungus-growing termites.

  15. Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lasure, Linda L; Dai, Ziyu

    2008-10-21

    The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.

  16. [Effects of fungus on the growth of Dendrobium candidum and D. nobile in vitro culture].

    PubMed

    Song, J Y; Guo, S X

    2001-12-01

    To examine effects of fungus AR-18 (Epulorhiza sp.) on the growth of Dendrobium candidum and D. nobile in vitro culture. Effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when agar was used as rest, and effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when vermiculite was used as rest. In agar medium, effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were not significant (P > 0.05). However, in vermiculite medium, the effect of fungus AR-18 on fresh weight of D. nobile was significant (P < 0.05). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 16% compared with the non-inoculated ones (control). The effect of fungus AR-18 on dry weight of D. nobile was very significant (P < 0.01). Dry weight of D. nobile inoculated with fungus AR-18 was increased by 21% compared with the control. In vermiculite medium, the effect of combination treatment (Fungus AR-18 + Distilled H2O) on fresh weight of D. nobile was very significant (P < 0.01). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 47% compared with the control, while the effect of combination treatment (Fungus AR-18 + Nutrients) on fresh weight of D. nobile was not significant (P > 0.05). In addition, the effect of combinations treatment (Fungus AR-18 + Nutrients) and (Fungus AR-18 + Distilled H2O) on dry weight of D. nobile was not significant (P > 0.05). So the combination treatment (Fungus AR-18 + Distilled H2O) was the best for the growth of D. nobile. In vermiculite medium, effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum were not significant (P > 0.05). It is important in vitro culture to select a proper rest for the control of the growth of fungus to establish a beneficial symbiotic relationship between plants and fungi. If the fungus AR-18 is utilized as biological manure in got-up planting of D. nobile, a good result may be obtained.

  17. Pulmonary aspergilloma

    MedlinePlus

    Aspergillosis is an infection caused by the fungus aspergillus. Aspergillomas are formed when the fungus grows in ... of fungus that causes disease in humans is Aspergillus fumigatus . Aspergillus is a common fungus. It grows ...

  18. Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

    DOEpatents

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  19. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    DOEpatents

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  20. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    DOEpatents

    Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

    2014-05-27

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  1. A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

    PubMed

    Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

    2007-11-01

    The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

  2. Dentigerumycin: a bacterial mediator of an ant-fungus symbiosis

    PubMed Central

    Oh, Dong-Chan; Poulsen, Michael; Currie, Cameron R.; Clardy, Jon

    2009-01-01

    Fungus-growing ants engage in mutualistic associations with both the fungus they cultivate for food and actinobacteria (Pseudonocardia spp.) that produce selective antibiotics to defend that fungus from specialized fungal parasites. In the first system to be analyzed at the molecular level, the bacterium associated with the ant Apterostigma dentigerum produces dentigerumycin, a cyclic depsipeptide with highly modified amino acids, to selectively inhibit the parasitic fungus (Escovopsis sp.). PMID:19330011

  3. Resistance to Black Dot in Potato

    USDA-ARS?s Scientific Manuscript database

    Black dot fungus can colonize tubers on the surface, in the stolon end, or in a combination of both.On the surface the fungus is prevalent as sclerotia, and in the stolon end the fungus colonizes the vascular tissuesas hyphae. The fungus is introduced to non-infested soils mostly by infected potato ...

  4. THE IMPORTANCE OF ANIMAL INFECTIONS FOR THE HUMAN

    DTIC Science & Technology

    tuberculosis, leptospiroses. VIRUS-CAUSED ZOOANTHROPONOSES: Rickettsioses, ornithosis, lyssa, arboviroses. FUNGUS-CAUSED ANIMAL-HUMAN INFECTIONS: filamentous fungus, yeast fungus. PROTOZOA DISEASES: Toxoplasmoses .

  5. Contamination of Pine Seeds by the Pitch Canker Fungus

    Treesearch

    L. David Dwinell; S.W. Fraedrich

    1999-01-01

    The pitch canker fungus, Fusarium subglutinans f. sp. pini, has been identified as a significant problem in man pine seed orchards and nursuries in the South. THe fungus causes strobilus mortality, seed deterioation, and cankers on the main stem, branches, and shoots of pines Dwinell and others 1985). The pitche canker fungus...

  6. Native arbuscular mycorrhizal symbiosis alters foliar bacterial community composition.

    PubMed

    Poosakkannu, Anbu; Nissinen, Riitta; Kytöviita, Minna-Maarit

    2017-11-01

    The effects of arbuscular mycorrhizal (AM) fungi on plant-associated microbes are poorly known. We tested the hypothesis that colonization by an AM fungus affects microbial species richness and microbial community composition of host plant tissues. We grew the grass, Deschampsia flexuosa in a greenhouse with or without the native AM fungus, Claroideoglomus etunicatum. We divided clonally produced tillers into two parts: one inoculated with AM fungus spores and one without AM fungus inoculation (non-mycorrhizal, NM). We characterized bacterial (16S rRNA gene) and fungal communities (internal transcribed spacer region) in surface-sterilized leaf and root plant compartments. AM fungus inoculation did not affect microbial species richness or diversity indices in leaves or roots, but the AM fungus inoculation significantly affected bacterial community composition in leaves. A total of three OTUs in leaves belonging to the phylum Firmicutes positively responded to the presence of the AM fungus in roots. Another six OTUs belonging to the Proteobacteria (Alpha, Beta, and Gamma) and Bacteroidetes were significantly more abundant in NM plants when compared to AM fungus-inoculated plants. Further, there was a significant correlation between plant dry weight and leaf microbial community compositional shift. Also, there was a significant correlation between leaf bacterial community compositional shift and foliar nitrogen content changes due to AM fungus inoculation. The results suggest that AM fungus colonization in roots has a profound effect on plant physiology that is reflected in leaf bacterial community composition.

  7. Final Environmental Assessment and Finding of No Significant Impact: Deployment of Up to Four F-16C Aircraft to the 133rd Airlift Wing for Air Sovereignty Alert Operations

    DTIC Science & Technology

    2007-11-01

    species of moss FUNGI Endangered Fuscoboletinus weaverae . . . . . . . . . . . . . . a species of fungus Psathyrella cystidiosa...a species of fungus Psathyrella rhodospora . . . . . . . . . . . . . . . a species of fungus Special concern Laccaria trullisata...SC . . . . . . . . . caddisfly Psathyrella cystidiosa . . . . . . . . . . . . . . . . a species of fungus

  8. Host deception: Predaceous fungus, esteya vermicola, entices pine wood nematode by mimicking the scent of its host pine for nutrient

    USDA-ARS?s Scientific Manuscript database

    A nematophagous fungus, Esteya vermicola, is recorded as the first endoparasitic fungus of pine wood nematode (PWN), Burasphelenchus xylophilus, in the last century. E. vermicola exhibited high infectivity toward PWN in the laboratory conditions and conidia spraying of this fungus on Japanese red pi...

  9. Isolation and characterization of an ether-type polyurethane-degrading micro-organism and analysis of degradation mechanism by Alternaria sp.

    PubMed

    Matsumiya, Y; Murata, N; Tanabe, E; Kubota, K; Kubo, M

    2010-06-01

    To degrade ether-type polyurethane (ether-PUR), ether-PUR-degrading micro-organism was isolated. Moreover, ether-PUR-degrading mechanisms were analysed using model compounds of ether-PUR. A fungus designated as strain PURDK2, capable of changing the configuration of ether-PUR, has been isolated. This isolated fungus was identified as Alternaria sp. Using a scanning electron microscope, the grid structure of ether-PUR was shown to be melted and disrupted by the fungus. The degradation of ether-PUR by the fungus was analysed, and the ether-PUR was degraded by the fungus by about 27.5%. To analyse the urethane-bond degradation by the fungus, a degraded product of ethylphenylcarbamate was analysed using GC/MS. Aniline and ethanol were detected by degradation with the supernatant, indicating that the fungus secreted urethane-bond-degrading enzyme(s). PURDK2 also degraded urea bonds when diphenylmethane-4,4'-dibutylurea was used as a substrate. The enzyme(s) from PURDK2 degraded urethane and urea bonds to convert the high molecular weight structure of ether-PUR to small molecules; and then the fungus seems to use the small molecules as an energy source. Ether-PUR-degrading fungus, strain PURDK2, was isolated, and the urethane- and urea-bonds-degrading enzymes from strain PURDK2 could contribute to the material recycling of ether-PUR.

  10. Histoplasmosis

    MedlinePlus

    ... by the fungus Histoplasma. The fungus lives in soil. You get the infection by breathing in spores ... construction, gardening, or any activity that disturbs the soil can release fungus spores into the air. If ...

  11. Blastomycosis

    MedlinePlus

    ... dermatitidis fungus. The fungus is found in decaying wood and soil. Causes You can get blastomycosis by ... moist soil, most commonly where there is rotting wood and leaves. The fungus enters the body through ...

  12. Scanning electron microscopy of Ancylostoma spp. dog infective larvae captured and destroyed by the nematophagous fungus Duddingtonia flagrans.

    PubMed

    Maciel, A S; Araújo, J V; Campos, A K; Benjamin, L A; Freitas, L G

    2009-06-01

    The interaction between the nematode-trapping fungus Duddingtonia flagrans (isolate CG768) against Ancylostoma spp. dog infective larvae (L(3)) was evaluated by means of scanning electron microscopy. Adhesive network trap formation was observed 6h after the beginning of the interaction, and the capture of Ancylostoma spp. L(3) was observed 8h after the inoculation these larvae on the cellulose membranes colonized by the fungus. Scanning electron micrographs were taken at 0, 12, 24, 36 and 48 h, where 0 is the time when Ancylostoma spp. L(3) was first captured by the fungus. Details of the capture structure formed by the fungus were described. Nematophagous Fungus Helper Bacteria (NHB) were found at interactions points between the D. flagrans and Ancylostoma spp. L(3). The cuticle penetration by the differentiated fungal hyphae with the exit of nematode internal contents was observed 36 h after the capture. Ancylostoma spp. L(3) were completely destroyed after 48 h of interaction with the fungus. The scanning electron microscopy technique was efficient on the study of this interaction, showing that the nematode-trapping fungus D. flagrans (isolate CG768) is a potential exterminator of Ancylostoma spp. L(3).

  13. Growth inhibition of an Araucaria angustifolia (Coniferopsida) fungal seed pathogen, Neofusicoccum parvum, by soil streptomycetes

    PubMed Central

    2013-01-01

    Background Araucariaceae are important forest trees of the southern hemisphere. Life expectancy of their seedlings can largely be reduced by fungal infections. In this study we have isolated and characterized such a fungus and investigated the potential of Streptomyces Actinobacteria from the respective rhizosphere to act as antagonists. Results The pathogenic fungus from Araucaria angustifolia seeds was identified by morphological markers (pore-associated Woronin-bodies) as belonging to the Pezizomycotina. Molecular data identified the fungus as Neofusicoccum parvum (Botryosphaeriaceae). Co-cultures on agar of this fungus with certain streptomycete isolates from the rhizosphere, and from the surface of Araucaria roots significantly reduced the growth of the fungus. HPLC analysis of the agar yielded streptomycete-specific exudate compounds which were partly identified. There were differences in compounds between single (bacteria, fungus) and dual cultures (bacteria + fungus). Conclusion Streptomycetes from the rhizosphere of Araucariaceae produce exudates which can suppress the development of pathogenic fungi in their seeds. PMID:23866024

  14. Caecomyces sympodialis sp. nov., a new rumen fungus isolated from Bos indicus.

    PubMed

    Chen, Yo-Chia; Tsai, Sheng-Da; Cheng, Hsueh-Ling; Chien, Chiu-Yuan; Hu, Chun-Yi; Cheng, Tai-Yi

    2007-01-01

    A new anaerobic rumen fungus was isolated from the rumen fluid of a yellow cow (Bos indicus). This fungus appears to be a previously undescribed species of the genus Caecomyces, it possessing uniflagellate zoospores, a spherical holdfast, tubular sporangiophores and bulbous rhizoids. This new fungus also features distinctive multisporangiate thallus sympodially distributed on sporangiophores. The fungus resembles Caecomyces communis and C. equi in that it characterizes bulbous rhizoids and uniflagellate zoospores but differs from C. communis and C. equi in that it possesses multisporangiate and sympodial sporangia. This new fungus and Cyllamyces aberensis both reveal similar morphology during early thallus development in having a spherical holdfast, but they vary from unbranched sporangiophores and additional bulbous rhizoids. In addition, the molecular phylogenetic analyses ITS1 (internal transcribed spacer 1) also conform to the results of the morphological examinations of Caecomyces. For the mentioned reasons, this new species of fungus is described as Caecomyces sympodialis sp. nov. The genera of Neocallimasticaceae and species of Caecomyces are also keyed out.

  15. Carbon dioxide sensing in an obligate insect-fungus symbiosis: CO2 preferences of leaf-cutting ants to rear their mutualistic fungus.

    PubMed

    Römer, Daniela; Bollazzi, Martin; Roces, Flavio

    2017-01-01

    Defense against biotic or abiotic stresses is one of the benefits of living in symbiosis. Leaf-cutting ants, which live in an obligate mutualism with a fungus, attenuate thermal and desiccation stress of their partner through behavioral responses, by choosing suitable places for fungus-rearing across the soil profile. The underground environment also presents hypoxic (low oxygen) and hypercapnic (high carbon dioxide) conditions, which can negatively influence the symbiont. Here, we investigated whether workers of the leaf-cutting ant Acromyrmex lundii use the CO2 concentration as an orientation cue when selecting a place to locate their fungus garden, and whether they show preferences for specific CO2 concentrations. We also evaluated whether levels preferred by workers for fungus-rearing differ from those selected for themselves. In the laboratory, CO2 preferences were assessed in binary choices between chambers with different CO2 concentrations, by quantifying number of workers in each chamber and amount of relocated fungus. Leaf-cutting ants used the CO2 concentration as a spatial cue when selecting places for fungus-rearing. A. lundii preferred intermediate CO2 levels, between 1 and 3%, as they would encounter at soil depths where their nest chambers are located. In addition, workers avoided both atmospheric and high CO2 levels as they would occur outside the nest and at deeper soil layers, respectively. In order to prevent fungus desiccation, however, workers relocated fungus to high CO2 levels, which were otherwise avoided. Workers' CO2 preferences for themselves showed no clear-cut pattern. We suggest that workers avoid both atmospheric and high CO2 concentrations not because they are detrimental for themselves, but because of their consequences for the symbiotic partner. Whether the preferred CO2 concentrations are beneficial for symbiont growth remains to be investigated, as well as whether the observed preferences for fungus-rearing influences the ants' decisions where to excavate new chambers across the soil profile.

  16. Biological control of horse cyathostomin (Nematoda: Cyathostominae) using the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

    PubMed

    Braga, Fabio Ribeiro; Araújo, Jackson Victor; Silva, André Ricardo; Araujo, Juliana Milani; Carvalho, Rogério Oliva; Tavela, Alexandre Oliveira; Campos, Artur Kanadani; Carvalho, Giovanni Ribeiro

    2009-08-26

    The viability of a fungal formulation using the nematode-trapping fungus Duddingtonia flagrans was assessed for the biological control of horse cyathostomin. Two groups (fungus-treated and control without fungus treatment), consisting of eight crossbred mares (3-18 years of age) were fed on Cynodon sp. pasture naturally infected with equine cyathostome larvae. Each animal of the treated group received oral doses of sodium alginate mycelial pellets (1g/(10 kg live weight week)), during 6 months. Significant reduction (p<0.01) in the number of eggs per gram of feces and coprocultures was found for animals of the fungus-treated group compared with the control group. There was difference (p<0.01) of 78.5% reduction in herbage samples collected up to (0-20 cm) between the fungus-treated group and the control group, during the experimental period (May-October). Difference of 82.5% (p<0.01) was found between the fungus-treated group and the control group in the sampling distance (20-40 cm) from fecal pats. During the last 3 months of the experimental period (August, September and October), fungus-treated mares had significant weight gain (p<0.01) compared with the control group, an increment of 38 kg. The treatment with sodium alginate pellets containing the nematode-trapping fungus D. flagrans reduced cyathostomin in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in horses.

  17. The status of the fungi-grower ants (Hymenoptera: Formicidae) in Puerto Rico and adjacent islands

    Treesearch

    J.A. Torres

    1989-01-01

    Ants of the tribe Attini (fungus grower) collect different organic materials that are used to grow a fungus. It was thought that the fungus mycelium was the only source of nutrition for these ants, but Quinlan and Cherrett found that Atta cephalotes (L.) squeezes oils from fresh leaves and uses them as food.  These oils supplement the fungus material eaten by this...

  18. Rust-red stringy white rot: The Indian paint fungus, Echinodontium tinctorium

    Treesearch

    A. D. Wilson

    1997-01-01

    Older trees are more susceptible to damage by this fungus, although even very young trees are susceptible to infection. Infections occur most frequently in dense stands where selfpruning creates infection courts for the fungus.

  19. Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies.

    PubMed

    Cloyd, Raymond A

    2015-04-09

    Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems.

  20. Sequential batch culture studies for the decolorisation of reactive dye by Coriolus versicolor.

    PubMed

    Sanghi, Rashmi; Dixit, Awantika; Guha, Sauymen

    2006-02-01

    The white rot fungus Coriolus versicolor could decolorise reactive dye Remazol Brilliant Violet to almost 90%. The fungal mycelia removed color as well as COD up to 95% and 75%, respectively, in a batch reactor. Decolorising activity was observed during the repeated reuse of the fungus. It was possible to substantially increase the dye decolorising activity of the fungus by carefully selecting the operational conditions such as media composition, age of fungus and nitrogen source. The fungal pellets could be used for eight cycles during the long term operation, where medium and dye was replenished at the end of each cycle and the fungus was recycled. Presence of a nitrogen source and nutrient content of media played an important role in sustaining the decolorisation activity of the fungus. The form of nitrogen source (e.g. peptone vs. urea) was also important to maintain the decolorising activity with peptone showing better decolorisation.

  1. Oligocene Termite Nests with In Situ Fungus Gardens from the Rukwa Rift Basin, Tanzania, Support a Paleogene African Origin for Insect Agriculture

    PubMed Central

    Roberts, Eric M.; Todd, Christopher N.; Aanen, Duur K.; Nobre, Tânia; Hilbert-Wolf, Hannah L.; O’Connor, Patrick M.; Tapanila, Leif; Mtelela, Cassy; Stevens, Nancy J.

    2016-01-01

    Based on molecular dating, the origin of insect agriculture is hypothesized to have taken place independently in three clades of fungus-farming insects: the termites, ants or ambrosia beetles during the Paleogene (66–24 Ma). Yet, definitive fossil evidence of fungus-growing behavior has been elusive, with no unequivocal records prior to the late Miocene (7–10 Ma). Here we report fossil evidence of insect agriculture in the form of fossil fungus gardens, preserved within 25 Ma termite nests from southwestern Tanzania. Using these well-dated fossil fungus gardens, we have recalibrated molecular divergence estimates for the origins of termite agriculture to around 31 Ma, lending support to hypotheses suggesting an African Paleogene origin for termite-fungus symbiosis; perhaps coinciding with rift initiation and changes in the African landscape. PMID:27333288

  2. Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies

    PubMed Central

    Cloyd, Raymond A.

    2015-01-01

    Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems. PMID:26463188

  3. Noninvasive medical management of fungus ball uropathy in a premature infant.

    PubMed

    Alkalay, A L; Srugo, I; Blifeld, C; Komaiko, M S; Pomerance, J J

    1991-09-01

    Unilateral renal obstruction secondary to fungus balls is described in a premature infant. Noninvasive medical management, which included amphotericin B and 5-flucytosine therapy and forced diuresis, resulted in disappearance of fungus balls and resolution of the obstruction.

  4. Qualitative and Quantitative Analysis of Flower Pigments in Chocolate Cosmos, Cosmos atrosanguineus, and its Hybrids.

    PubMed

    Amamiya, Kotarou; Iwashina, Tsukasa

    2016-01-01

    Two major anthocyanins, cyanidin 3-O-glucoside and 3-O-rutinoside, were isolated from the black flowers of Cosmos atrosanguineus cultivar 'Choco Mocha', together with three minor anthocyanins, cyanidin 3-O-malonylglucoside, pelargonidin 3-O-glucoside and 3-O-rutinoside. A chalcone, butein 4'-O-glucoside and three minor flavanones were isolated from the red flowers of C. atrosanguineis x C. sulphureus cultivar 'Rouge Rouge'. The anthocyanins and chalcone accumulation of cultivar 'Choco Mocha' and its hybrid cultivars 'Brown Rouge', 'Forte Rouge', 'Rouge Rouge' and 'Noel Rouge' was surveyed by quantitative HPLC. Total anthocyanins of black flower cultivars 'Choco Mocha' and 'Brown Rouge' were 3-4-folds higher than that of the red flower cultivar 'Noel Rouge'. On the other hand, total chalcone of 'Noel Rouge' was 10-77-folds higher compared with those of other cultivars, 'Brown Rouge', 'Forte Rouge' and 'Rouge Rouge'. It was shown that the flower color variations from red to black of Chocolate Cosmos and its hybrids are due to the difference in the relative amounts of anthocyanins and chalcone.

  5. THE ROLE OF PREDISPOSING FACTORS IN EXPERIMENTAL FUNGUS INFECTIONS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheldon, W.H.; Bauer, H.

    Among other factors, the influence of ionizing radiations on susceptibility to fungus diseases is reviewed. X irradiation singly or in combination with cortisone administration has been employed in the study of experimental fungus diseases, and it has been shown that total-body radiation enhaaced infection with Candida albicans, Blastomyces dermatididis, and Cryptococcus neoformans in mice. Enhanced susceptibility to fungus infections following radiation therapy has also been reported, the mechanism resulting in lowered host resistance being presumably the same as in other infections. (BBB)

  6. Exploring the potential for actinobacteria as defensive symbionts in fungus-growing termites.

    PubMed

    Visser, Anna A; Nobre, Tânia; Currie, Cameron R; Aanen, Duur K; Poulsen, Michael

    2012-05-01

    In fungus-growing termites, fungi of the subgenus Pseudoxylaria threaten colony health through substrate competition with the termite fungus (Termitomyces). The potential mechanisms with which termites suppress Pseudoxylaria have remained unknown. Here we explore if Actinobacteria potentially play a role as defensive symbionts against Pseudoxylaria in fungus-growing termites. We sampled for Actinobacteria from 30 fungus-growing termite colonies, spanning the three main termite genera and two geographically distant sites. Our isolations yielded 360 Actinobacteria, from which we selected subsets for morphological (288 isolates, grouped in 44 morphotypes) and for 16S rRNA (35 isolates, spanning the majority of morphotypes) characterisation. Actinobacteria were found throughout all sampled nests and colony parts and, phylogenetically, they are interspersed with Actinobacteria from origins other than fungus-growing termites, indicating lack of specificity. Antibiotic-activity screening of 288 isolates against the fungal cultivar and competitor revealed that most of the Actinobacteria-produced molecules with antifungal activity. A more detailed bioassay on 53 isolates, to test the specificity of antibiotics, showed that many Actinobacteria inhibit both Pseudoxylaria and Termitomyces, and that the cultivar fungus generally is more susceptible to inhibition than the competitor. This suggests that either defensive symbionts are not present in the system or that they, if present, represent a subset of the community isolated. If so, the antibiotics must be used in a targeted fashion, being applied to specific areas by the termites. We describe the first discovery of an assembly of antibiotic-producing Actinobacteria occurring in fungus-growing termite nests. However, due to the diversity found, and the lack of both phylogenetic and bioactivity specificity, further work is necessary for a better understanding of the putative role of antibiotic-producing bacteria in the fungus-growing termite mutualistic system.

  7. Biological activities of ophiobolin K and 6-epi-ophiobolin K produced by the endophytic fungus Aspergillus calidoustus

    USDA-ARS?s Scientific Manuscript database

    The endophytic fungus, Aspergillus calidoustus, was isolated from the plant species Acanthospermum australe (Asteraceae). A dichloromethane extract of the fungus displayed antifungal, antiprotozoal, and cytotoxic activities. Aspergillus calidoustus was identified using molecular, physiological and m...

  8. Effects of Some Pesticides on the Growth of ARF18 and Its Pathogenicity to Heterodera glycines

    PubMed Central

    Kim, D. G.; Riggs, R. D.

    1998-01-01

    The effects of 22 pesticides on the mycelial growth and pathogenicity of the biocontrol fungus ARFI8 to Heterodera glycines were tested in vitro. The chemicals were added to agar at 10, 100, and 1,000 ppm a.i.; a block of agar containing the fungus was added to each test concentration; and fungal growth was measured. Subsequently, a block of the fungus on the pesticide-containing agar was used to determine the ability of the fungus to parasitize eggs of H. glycines. Aldicarb, bentazone, and chlorothalonil had little or no effect on fungal growth, whereas benomyl and thiophanate methyl completely inhibited growth of the fungus at 10 ppm. The relative insensitivity of ARF18 to certain pesticides would permit selected use of those pesticides with ARF18 in an integrated control program if the effects on the fungus in the field are similar to results from petri dish studies. PMID:19274211

  9. Performance of Metarhizium anisopliae-treated foam in combination with Phytoseiulus longipes Evans on Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae).

    PubMed

    Azandémè Hounmalon, Ginette Y; Maniania, Nguya K; Niassy, Saliou; Fellous, Simon; Kreiter, Serge; Delétré, Emilie; Fiaboe, Komi K; Martin, Thibaud

    2018-05-13

    Tetranychus evansi (Te) is an exotic pest of solanaceous crops in Africa. The predatory mite Phytoseiulus longipes (Pl) and the fungus Metarhizium anisopliae (Ma), are potential biocontrol agents of Te. The present study investigated efficacy of fungus-treated foam placed above or below the third Te-infested tomato leaf. The persistence of fungus-treated foam and the performance of Pl with or without fungus-treated foam were evaluated. The fungus-treated foam was effective when Te infestation was below the third tomato leaf as no damage was recorded on all upper tomato leaves up to 30 days post-treatment. However, in the control treatments, the infestation increased considerably from 9±0.3% to 100±0% at 15 days post-treatment. The reuse of the fungus-treated foam at 15, 30 and 45 days post-treatment resulted in 19±1.4%, 25±1.2% and 54±2.1% respective infestation by Te. The fungus-treated foam and Pl alone are efficient, but there is no benefit to combinting both against Te. The fungus-treated foam is an effective method to optimize the use of Ma in screenhouse conditions. These two control agents could be integrated in an IPM strategy for crops protection. However, these results need to be confirmed in large field trials. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Microsatellite variability in the entomopathogenic fungus Paeciolomyces fumosoroseus: genetic diversity and population structure

    USDA-ARS?s Scientific Manuscript database

    The hyphomycete Paecilomyces fumosoroseus (Pfr) is a geographically widespread fungus capable of infecting various insect hosts. The fungus has been used for the biological control of several important insect pests of agriculture. However knowledge of the fungus’ genetic diversity and population str...

  11. Metacridamides A and B from the biocontrol fungus metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

  12. RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola

    USDA-ARS?s Scientific Manuscript database

    The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers’ symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop ...

  13. Speciation despite globally overlapping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming’s lucky fungus

    USDA-ARS?s Scientific Manuscript database

    Eighty years ago, Alexander Fleming described the antibiotic effects of a fungus that had contaminated his bacterial culture, kick starting the antimicrobial revolution. The fungus was later ascribed to a globally distributed asexual species, Penicillium chrysogenum. Recently, the species has been...

  14. Mating and Progeny Isolation in The Corn Smut Fungus Ustilago maydis

    USDA-ARS?s Scientific Manuscript database

    The corn smut pathogen, Ustilago maydis (U. maydis) (DC.) Corda, is a semi-obligate plant pathogenic fungus in the phylum Basidiomycota (Alexopoulos, Mims and Blackwell, 1996). The fungus can be easily cultured in its haploid yeast phase on common laboratory media. However, to complete its sexual cy...

  15. Chronicles of Fibroporia radiculosa (= Antrodia radiculosa) TFFH 294

    Treesearch

    Carol A. Clausen; Katie M. Jenkins

    2011-01-01

    The brown-rot fungus, Fibroporia radiculosa, has been included in numerous research studies because many isolates of this fungus demonstrate an unusually high tolerance to copper. This fungus has undergone several recognized changes in taxonomic nomenclature, and through DNA technology, scientists have correctly identified isolates that had been misidentified...

  16. Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus

    Treesearch

    Bryn H. Daisy; Gary A. Strobel; Uvidelio Castillo; David Ezra; Joe Sears; David K. Weaver; Justin B. Runyon

    2002-01-01

    Muscodor vitigenus is a recently described endophytic fungus of Paullinia paullinioides, a liana growing in the understorey of the rainforests of the Peruvian Amazon. This fungus produces naphthalene under certain cultural conditions. Naphthalene produced by M. vitigenus was identified by gas chromatography/mass...

  17. Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci.

    PubMed

    Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm

    2015-09-01

    A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.

  18. Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants.

    PubMed

    Ruiz-González, Mario X; Malé, Pierre-Jean G; Leroy, Céline; Dejean, Alain; Gryta, Hervé; Jargeat, Patricia; Quilichini, Angélique; Orivel, Jérôme

    2011-06-23

    Ant-fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant-fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries.

  19. Pathogenic nature of Syncephalastrum in Atta sexdens rubropilosa fungus gardens.

    PubMed

    Barcoto, Mariana O; Pedrosa, Felipe; Bueno, Odair C; Rodrigues, Andre

    2017-05-01

    Leaf-cutter ants are considered to be a major herbivore and agricultural pest in the Neotropics. They are often controlled by environmentally persistent insecticides. Biological control using pathogenic fungi is regarded as an alternative for the management of these insects. Here, we assess whether the filamentous fungus Syncephalastrum sp. is a pathogenic microorganism responsible for a characteristic disease in fungus gardens. We also characterise the damage caused by this fungus by evaluating physiological and behavioural responses of Atta sexdens rubropilosa subcolonies infected with Syncephalastrum sp. Syncephalastrum sp. fulfils Koch's postulates characterising it as a pathogenic microorganism. Ant workers recognise the infection and remove contaminated fragments from the fungus garden. Syncephalastrum sp. infection causes an interruption of foraging activity, an increase in ant mortality, subcolony deterioration and an increase in the amount of waste generated, all resulting in subcolony death. Syncephalastrum sp. also inhibits the ant fungal cultivar in vitro. The pathogenic effect of Syncephalastrum sp. does not depend on host morbidity or stress (e.g. worker mortality caused by an entomopathogenic fungus). Syncephalastrum sp. treatment resulted in progressive damage in subcolonies. The interactions among Syncephalastrum sp., fungus garden and ants offer new opportunities in integrated pest management of leaf-cutter ants. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Biological control of cyathostomin (Nematoda: Cyathostominae) with nematophagous fungus Monacrosporium thaumasium in tropical southeastern Brazil.

    PubMed

    Tavela, Alexandre de Oliveira; Araújo, Jackson Victor; Braga, Fábio Ribeiro; Silva, André Ricardo; Carvalho, Rogério Oliva; Araujo, Juliana Milani; Ferreira, Sebastião Rodrigo; Carvalho, Giovanni Ribeiro

    2011-01-10

    Horses are hosts to a wide variety of helminthes; the most important are the cyathostomin, or small strongyles. The viability of a fungal formulation (pellets) using the nematode-trapping fungus Monacrosporium thaumasium was assessed in biological control of horse cyathostomin. Two groups (fungus-treated and control) consisted of six mares in each group, crossbred (ages of 2.5 and 3.5 years), were placed in pastures of Cynodon sp. naturally infected with horse cyathostomin larvae. In the treated group, each animal received 1g/10 kg body weight (0.2g/10 kg live weight of fungus) of pellets of sodium alginate matrix containing the fungus M. thaumasium orally, twice a week for 6 months. In the control group, animals received (1g/10 kg body weight) of pellets without fungus. The egg count per gram of feces showed difference (p<0.01) in the animals treated with the fungus in relation to the control animals during all months of the experiment. The EPG percentage decrease were 87.5%, 89.7%, 68.3%, 58.7%, 52.5% and 35.2% during June, July, August, September, October and November, respectively. In faecal cultures, there was difference (p<0.05) among animals treated with fungus was found in relation to the control animals during all the experiment month, with percentage reduction of 67.5%, 61.4% and 31.8% in September, October and November, respectively. Difference (p<0.01) was observed in the recovery of infective larvae from pastures that were collected up to 20 cm from the dung pats in pastures in the group treated with the fungus in relation to the control group with a reduction of 60.9% and between 0-20 and 0-40 cm from the faecal pat reduction (p<0.01) was about 56% in the group treated with the fungus M. thaumasium in relation to the control group pasture. There was no difference (p>0.05) between the average weight gains in both animal groups. The treatment of horses with pellets containing the nematophagous fungus M. thaumasium can be effective in controlling cyathostomin in the tropical region of southeastern Brazil. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Biochemical Characterization of Fungus Isolated during In vitro Propagation of Bambusa balcooa.

    PubMed

    Tyagi, Bhawna; Tewari, Salil; Dubey, Ashutosh

    2018-01-01

    Bambusa balcooa ( Poaceae: Bambusoideae ) is a multipurpose bamboo species, which is native of the Indian subcontinent. B. balcooa is regarded as one of the best species for scaffolding and building purposes because of its strong culm. Other uses include paper pulp, handicrafts, and products of the wood chip industry. Due to these various uses in industries, this species has been identified as one of the priority bamboos by the National Bamboo Mission. This study is designed to analyze the identification of fungus and develop the strategy to eliminate the contamination during in vitro establishment of B. balcooa through nodal part. Fungus contamination is a problem which is encountered during in vitro establishment of B. balcooa cultures. In the present study, fungus contamination from in vitro cultured plant has been isolated and subjected to partial sequence analysis of the 18S rRNA gene to identify the fungus strain. Experiments were designed to develop a strategy for removal of the fungus contamination with the help of antifungal compounds and commercial antimicrobial supplement supplied by HiMedia. Fusarium equiseti was identified as endophytic fungus. It was observed that antimicrobial supplement at concentration of 500 μl/l was more effective concentration to remove fungus contamination and not showed any detrimental effect on growth parameters of shoot. This experiment would help in identification and to get rid of fungal contamination and improve the in vitro establishment of B. balcooa cultures for large-scale propagation. Endogenous fungus was isolated from contaminated culture of B. balcooa , and it was identified as Fusarium equiseti and submitted to NCBI under accession no. KP274872. The endophytic fungus had shown substantial production of amylase, cellulase, and protease media. Gibberellic acid (GA 3 ) production by F. equiseti was maximum on the 7 th day on inoculation. Abbreviations used: B. balcooa : Bambusa balcooa , F. equiseti : Fusarium equiseti , PDA: Potato dextrose agar, PCR: Polymerase chain reaction, MS: Murashige and Skoog's, BAP: 6-Benzylaminopurine, ITS1/4: Internal transcribed spacer region 1/4, GA 3 : Gibberellic acid.

  2. Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae)

    PubMed Central

    2014-01-01

    Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month. PMID:24766705

  3. Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae).

    PubMed

    Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I

    2014-04-25

    Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month.

  4. Leaf-Cutter Ant Fungus Gardens Are Biphasic Mixed Microbial Bioreactors That Convert Plant Biomass to Polyols with Biotechnological Applications

    PubMed Central

    Somera, Alexandre F.; Lima, Adriel M.; dos Santos-Neto, Álvaro J.; Lanças, Fernando M.

    2015-01-01

    Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. PMID:25911490

  5. Leaf-cutter ant fungus gardens are biphasic mixed microbial bioreactors that convert plant biomass to polyols with biotechnological applications.

    PubMed

    Somera, Alexandre F; Lima, Adriel M; Dos Santos-Neto, Álvaro J; Lanças, Fernando M; Bacci, Maurício

    2015-07-01

    Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Phomalactone from a phytopathogenic fungus infecting Zinnia elegans (Asteraceae) leaves

    USDA-ARS?s Scientific Manuscript database

    Zinnia elegans plants are infected by a fungus that causes necrosis with dark red spots particularly in late spring to the middle of summer in the Mid-South part of the United States. This fungal disease when untreated causes the leaves to wilt and eventually kills the plant. The fungus was isolated...

  7. White-Nose Syndrome Fungus in a 1918 Bat Specimen from France.

    PubMed

    Campana, Michael G; Kurata, Naoko P; Foster, Jeffrey T; Helgen, Lauren E; Reeder, DeeAnn M; Fleischer, Robert C; Helgen, Kristofer M

    2017-09-01

    White-nose syndrome, first diagnosed in North America in 2006, causes mass deaths among bats in North America. We found the causative fungus, Pseudogymnoascus destructans, in a 1918 sample collected in Europe, where bats have now adapted to the fungus. These results are consistent with a Eurasian origin of the pathogen.

  8. Contents and Structure Atta texana Nest in Summer

    Treesearch

    John C. Moser

    1963-01-01

    A large nest of Atta texana (Buckley) in central Louisiana was partially excavated in August 1960. Twelve dormancy, 5 detritus, and 93 fungus-garden cavities were found. Fungus-garden cavities near the surface outnumbered those at lower depths and contained most of the fungus material and brood. Inquilines were most numerous in detritus cavities....

  9. Complete Genome of Enterobacteriaceae Bacterium Strain FGI 57, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

    PubMed Central

    Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

    2013-01-01

    The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353

  10. Complete Genome of Serratia sp. Strain FGI 94, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

    PubMed Central

    Aylward, Frank O.; Tremmel, Daniel M.; Starrett, Gabriel J.; Bruce, David C.; Chain, Patrick; Chen, Amy; Davenport, Karen W.; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Teshima, Hazuki; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

    2013-01-01

    Serratia sp. strain FGI 94 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its 4.86-Mbp chromosome will help advance our knowledge of symbiotic interactions and plant biomass degradation in this ancient ant-fungus mutualism. PMID:23516234

  11. Comparison of radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa forel in two culture media

    PubMed Central

    Miyashira, C.H.; Tanigushi, D.G.; Gugliotta, A.M.; Santos, D.Y.A.C.

    2010-01-01

    In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier. PMID:24031524

  12. Does co-inoculation of Lactuca serriola with endophytic and arbuscular mycorrhizal fungi improve plant growth in a polluted environment?

    PubMed

    Ważny, Rafał; Rozpądek, Piotr; Jędrzejczyk, Roman J; Śliwa, Marta; Stojakowska, Anna; Anielska, Teresa; Turnau, Katarzyna

    2018-04-01

    Phytoremediation of polluted sites can be improved by co-inoculation with mycorrhizal and endophytic fungi. In this study, the effects of single- and co-inoculation of Lactuca serriola with an arbuscular mycorrhizal (AM) fungus, Rhizoglomus intraradices, and endophytic fungi, Mucor sp. or Trichoderma asperellum, on plant growth, vitality, toxic metal accumulation, sesquiterpene lactone production and flavonoid concentration in the presence of toxic metals were evaluated. Inoculation with the AM fungus increased biomass yield of the plants grown on non-polluted and polluted substrate. Co-inoculation with the AM fungus and Mucor sp. resulted in increased biomass yield of plants cultivated on the polluted substrate, whereas co-inoculation with T. asperellum and the AM fungus increased plant biomass on the non-polluted substrate. In the presence of Mucor sp., mycorrhizal colonization and arbuscule richness were increased in the non-polluted substrate. Co-inoculation with the AM fungus and Mucor sp. increased Zn concentration in leaves and roots. The concentration of sesquiterpene lactones in plant leaves was decreased by AM fungus inoculation in both substrates. Despite enhanced host plant costs caused by maintaining symbiosis with numerous microorganisms, interaction of wild lettuce with both mycorrhizal and endophytic fungi was more beneficial than that with a single fungus. The study shows the potential of double inoculation in unfavourable environments, including agricultural areas and toxic metal-polluted areas.

  13. The Dynamics of Plant Cell-Wall Polysaccharide Decomposition in Leaf-Cutting Ant Fungus Gardens

    PubMed Central

    Harholt, Jesper; Willats, William G. T.; Boomsma, Jacobus J.

    2011-01-01

    The degradation of live plant biomass in fungus gardens of leaf-cutting ants is poorly characterised but fundamental for understanding the mutual advantages and efficiency of this obligate nutritional symbiosis. Controversies about the extent to which the garden-symbiont Leucocoprinus gongylophorus degrades cellulose have hampered our understanding of the selection forces that induced large scale herbivory and of the ensuing ecological footprint of these ants. Here we use a recently established technique, based on polysaccharide microarrays probed with antibodies and carbohydrate binding modules, to map the occurrence of cell wall polymers in consecutive sections of the fungus garden of the leaf-cutting ant Acromyrmex echinatior. We show that pectin, xyloglucan and some xylan epitopes are degraded, whereas more highly substituted xylan and cellulose epitopes remain as residuals in the waste material that the ants remove from their fungus garden. These results demonstrate that biomass entering leaf-cutting ant fungus gardens is only partially utilized and explain why disproportionally large amounts of plant material are needed to sustain colony growth. They also explain why substantial communities of microbial and invertebrate symbionts have evolved associations with the dump material from leaf-cutting ant nests, to exploit decomposition niches that the ant garden-fungus does not utilize. Our approach thus provides detailed insight into the nutritional benefits and shortcomings associated with fungus-farming in ants. PMID:21423735

  14. Fungus-Specific Sirtuin HstD Coordinates Secondary Metabolism and Development through Control of LaeA

    PubMed Central

    Kawauchi, Moriyuki; Nishiura, Mika

    2013-01-01

    The sirtuins are members of the NAD+-dependent histone deacetylase family that contribute to various cellular functions that affect aging, disease, and cancer development in metazoans. However, the physiological roles of the fungus-specific sirtuin family are still poorly understood. Here, we determined a novel function of the fungus-specific sirtuin HstD/Aspergillus oryzae Hst4 (AoHst4), which is a homolog of Hst4 in A. oryzae yeast. The deletion of all histone deacetylases in A. oryzae demonstrated that the fungus-specific sirtuin HstD/AoHst4 is required for the coordination of fungal development and secondary metabolite production. We also show that the expression of the laeA gene, which is the most studied fungus-specific coordinator for the regulation of secondary metabolism and fungal development, was induced in a ΔhstD strain. Genetic interaction analysis of hstD/Aohst4 and laeA clearly indicated that HstD/AoHst4 works upstream of LaeA to coordinate secondary metabolism and fungal development. The hstD/Aohst4 and laeA genes are fungus specific but conserved in the vast family of filamentous fungi. Thus, we conclude that the fungus-specific sirtuin HstD/AoHst4 coordinates fungal development and secondary metabolism via the regulation of LaeA in filamentous fungi. PMID:23729383

  15. Biological control of Ascaris suum eggs by Pochonia chlamydosporia fungus.

    PubMed

    Ferreira, Sebastião Rodrigo; de Araújo, Jackson Victor; Braga, Fábio Ribeiro; Araujo, Juliana Milani; Frassy, Luiza Neme; Ferreira, Aloízio Soares

    2011-12-01

    Ascaris suum is a gastrointestinal nematode parasite of swines. The aim of this study was to observe Pochonia chlamydosporia fungus on biological control of A. suum eggs after fungus passage through swines gastrointestinal tract. Eighteen pigs, previously dewormed, were randomly divided into three groups: group 1, treated with the fungus isolate VC4; group 2, treated with the fungus isolate VC1 and group 3 did not receive fungus (control). In the treated groups, each animal received a 9 g single dose of mycelium mass containing P. chlamydosporia (VC1 or VC4). Thereafter, animal fecal samples were collected at the following intervals: 8, 12, 24, 36, 48, 72 and 96 h after treatment beginning and these were poured in Petri dishes containing 2% water-agar culture medium. Then, 1,000 A. suum eggs were poured into each dish and kept in an incubator at 26 °C and in the dark for 30 days. After this period, approximately 100 eggs were removed from each Petri dish and morphologically analyzed under light microscopy following the ovicidal activity parameters. The higher percentage observed for isolated VC4 eggs destruction was 57.5% (36 h) after fungus administration and for isolate VC1 this percentage was 45.8% (24 h and 72 h) (p > 0.01). P. chlamydosporia remained viable after passing through the gastrointestinal tract of swines, maintaining its ability of destroying A. suum eggs.

  16. The fungus gardens of leaf-cutter ants undergo a distinct physiological transition during biomass degradation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Eric L.; Aylward, Frank O.; Kim, Young-Mo

    Leaf-cutter ants are dominant herbivores in ecosystems throughout the Neotropics. Rather than directly consuming the fresh foliar biomass they harvest, these ants use it to cultivate specialized fungus gardens. Although recent investigations have shed light on how plant biomass is degraded in fungus gardens, the cycling of nutrients that takes place in these specialized microbial ecosystems is still not well understood. Here, using metametabolomics and metaproteomics techniques, we examine the dynamics of nutrient turnover and biosynthesis in these gardens. Our results reveal that numerous free amino acids and sugars are depleted throughout the process of biomass degradation, indicating that easilymore » accessible nutrients from plant material are readily consumed by microbes in these ecosystems. Accumulation of cellobiose and lignin derivatives near the end of the degradation process is consistent with previous findings of cellulases and laccases produced by Leucoagaricus gongylophorus, the fungus cultivated by leaf-cutter ants. Our results also suggest that ureides may be an important source of nitrogen in fungus gardens, especially during nitrogen-limiting conditions. No free arginine was detected in our metametabolomics experiments despite evidence that the host ants cannot produce this amino acid, suggesting that biosynthesis of this metabolite may be tightly regulated in the fungus garden. These results provide new insights into the dynamics of nutrient cycling that underlie this important ant-fungus symbiosis.« less

  17. Do novel genotypes drive the success of an invasive bark beetle–fungus complex? Implications for potential reinvasion

    Treesearch

    Min Lu; Michael J. Wingfield; Nancy Gillette; Jiang-Hua Sun

    2011-01-01

    Novel genotypes often arise during biological invasions, but their role in invasion success has rarely been elucidated. Here we examined the population genetics and behavior of the fungus, Leptographium procerum, vectored by a highly invasive bark beetle, Dendroctonus valens, to determine whether genetic changes in the fungus...

  18. Association of the Pitch Canker Fungus with Cones and Seeds of Pines

    Treesearch

    L. David Dwinell

    1998-01-01

    The pitch canker fungus, Fusarium subglutinans f. sp.pini, causes the mortality of female flowers and mature cones, and can infect and destroy gametophyte tissues of seeds of several pine species in the southeastern U.S. The fungus can also be associated with the seed coats of apparently healthy, viable pine seeds. The pitch canker...

  19. Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.

    ERIC Educational Resources Information Center

    Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.

    1997-01-01

    Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…

  20. Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

    Treesearch

    Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

    2018-01-01

    Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

  1. Mosquitocidal activity of a naturally occurring isochroman and synthetic analogs from the plant pathogenic fungus, Diaporthe eres against Aedes aegypti ( Diptera: Culicidae)

    USDA-ARS?s Scientific Manuscript database

    The culture filtrate of a plant pathogenic fungus that infects English ivy (Hegera helix) was investigated for mosquitocidal constituents by bioassay guided isolation. The fungus responsible for pathogenic effects on the plant Hegera helix has been identified as Diaporthe eres by molecular technique...

  2. Reproduction of a woodwasp, Urocerus japonicus (Hymenoptera: Siricidae) using no maternal symbiotic fungus

    Treesearch

    Hideshi Fukuda

    2003-01-01

    Most woodwasps (Siricidae) are symbiotically associated with the specific fungus, Amylostereum spp. Female adults inoculate the fungus during their oviposition in sapwood of the host trees (Morgan 1968). Woodwasp larvae can digest sapwood with low nutritional quality with the aid of symbiosis (Kukor and Martin 1983). In the earlier study, we...

  3. Using copper sulfate to control egg fungus at Keo Fish Farm

    USDA-ARS?s Scientific Manuscript database

    Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab has been working on gaining FDA-approval to use copper sulfate to control fungus on catfish eggs, so we were con...

  4. Mucormycosis (Mucor fungus ball) of the maxillary sinus.

    PubMed

    Cho, Hang Sun; Yang, Hoon Shik; Kim, Kyung Soo

    2014-01-01

    A fungus ball is an extramucosal fungal proliferation that completely fills one or more paranasal sinuses and usually occurs as a unilateral infection. It is mainly caused by Aspergillus spp in an immunocompetent host, but some cases of paranasal fungal balls reportedly have been caused by Mucor spp. A Mucor fungus ball is usually found in the maxillary sinus and/or the sphenoid sinus and may be black in color. Patients with mucormycosis, or a Mucor fungal ball infection, usually present with facial pain or headache. On computed tomography, there are no pathognomonic findings that are conclusive for a diagnosis of mucormycosis. In this article we report a case of mucormycosis in a 56-year-old woman and provide a comprehensive review of the literature on the "Mucor fungus ball." To the best of our knowledge, 5 case reports (8 patients) have been published in which the fungus ball was thought to be caused by Mucor spp.

  5. Biosynthesis of size-controlled gold nanoparticles using fungus, Penicillium sp.

    PubMed

    Zhang, Xiaorong; He, Xiaoxiao; Wang, Kemin; Wang, Yonghong; Li, Huimin; Tan, Weihong

    2009-10-01

    The unique optoelectronic and physicochemical properties of gold nanoparticles are significantly dependent on the particle size, shape and structure. In this paper, biosynthesis of size-controlled gold nanoparticles using fungus Penicillium sp. is reported. Fungus Penicillium sp. could successfully bioreduce and nucleate AuCl4(-) ions, and lead to the assembly and formation of intracellular Au nanoparticles with spherical morphology and good monodispersity after exposure to HAuCl4 solution. Reaction temperature, as an important physiological parameter for fungus Penicillium sp. growth, could significantly control the size of the biosynthesized Au nanoparticles. The biological compositions and FTIR spectra analysis of fungus Penicillium sp. exposed to HAuCl4 solution indicated the intracellular reducing sugar played an important role in the occurrence of intracellular reduction of AuCl4(-) ions and the growth of gold nanoparticles. Furthermore, the intracellular gold nanoparticles could be easily separated from the fungal cell lysate by ultrasonication and centrifugation.

  6. Chytrid fungus parasitizing the wild amphibian Leptodactylus ocellatus (Anura: Leptodactylidae) in Argentina.

    PubMed

    Herrera, Raúl A; Steciow, Mónica M; Natale, Guillermo S

    2005-05-20

    The present contribution is the first report of parasitosis by a chytrid fungus in wild anuran amphibians in Argentina, as well as the first case of amphibian mortality documented to date in Argentina. We report the presence of the chytrid fungus in dead adult Leptodactylus ocellatus. It has been suggested that chytridiomycosis is the main cause of death in several amphibian populations worldwide. Our study demonstrates that chytridiomycosis afflicts L. ocellatus, a common widespread amphibian species, and is the first report of chytridiomycosis in the Argentinian lowlands. The occurrence at this latitude would indicate an extended distribution of this fungus in wildlife populations. It is also the first report of amphibian mortality due to chytrid fungus in our country. It is noteworthy that the site of collection is situated very close to sea level in a temperate climate zone and that this represents the southern most record for South American wild amphibians.

  7. Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luey, J.; Brouns, T.M.; Elliott, M.L.

    1990-11-01

    The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable formore » the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs.« less

  8. The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica.

    PubMed

    Torii, Masato; Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-Ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

    2014-06-01

    In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven.

  9. The Evolutionary Innovation of Nutritional Symbioses in Leaf-Cutter Ants

    PubMed Central

    Aylward, Frank O.; Currie, Cameron R.; Suen, Garret

    2012-01-01

    Fungus-growing ants gain access to nutrients stored in plant biomass through their association with a mutualistic fungus they grow for food. This 50 million-year-old obligate mutualism likely facilitated some of these species becoming dominant Neotropical herbivores that can achieve immense colony sizes. Recent culture-independent investigations have shed light on the conversion of plant biomass into nutrients within ant fungus gardens, revealing that this process involves both the fungal cultivar and a symbiotic community of bacteria including Enterobacter, Klebsiella, and Pantoea species. Moreover, the genome sequences of the leaf-cutter ants Atta cephalotes and Acromyrmex echinatior have provided key insights into how this symbiosis has shaped the evolution of these ants at a genetic level. Here we summarize the findings of recent research on the microbial community dynamics within fungus-growing ant fungus gardens and discuss their implications for this ancient symbiosis. PMID:26467948

  10. Deciphering the molecular mechanisms behind cellulase production in Trichoderma reesei, the hyper-cellulolytic filamentous fungus.

    PubMed

    Shida, Yosuke; Furukawa, Takanori; Ogasawara, Wataru

    2016-09-01

    The filamentous fungus Trichoderma reesei is a potent cellulase producer and the best-studied cellulolytic fungus. A lot of investigations not only on glycoside hydrolases produced by T. reesei, but also on the machinery controlling gene expression of these enzyme have made this fungus a model organism for cellulolytic fungi. We have investigated the T. reesei strain including mutants developed in Japan in detail to understand the molecular mechanisms that control the cellulase gene expression, the biochemical and morphological aspects that could favor this phenotype, and have attempted to generate novel strains that may be appropriate for industrial use. Subsequently, we developed recombinant strains by combination of these insights and the heterologous-efficient saccharifing enzymes. Resulting enzyme preparations were highly effective for saccharification of various biomass. In this review, we present some of the salient findings from the recent biochemical, morphological, and molecular analyses of this remarkable cellulase hyper-producing fungus.

  11. Fungal decay resistance of wood reacted with phosphorus pentoxide-amine system

    Treesearch

    Hong-Lin Lee; George C. Chen; Roger M. Rowell

    2004-01-01

    Resistance of wood reacted in situ with phosphorus pentoxide-amine to the brown-rot fungus Gloeophyllum trabeum and white-rot fungus Trametes versicolor was examined. Wood reacted with either octyl, tribromo, or nitro derivatives were more resistant to both fungi. Threshold retention values of phosphoramide-reacted wood to white-rot fungus T. versicolor ranged from 2.9...

  12. Serpula lacrymans, the dry rot fungus and tolerance towards copper-based wood preservatives

    Treesearch

    Anne Christine Steenkjaer Hastrup; Frederick Green; Carol Clausen; Bo Jensen

    2005-01-01

    Serpula lacrymans (Wulfen : Fries) Schröter, the dry rot fungus, is considered the most economically important wood decay fungus in temperate regions of the world i.e. northern Europe, Japan and Australia. Previously copper based wood preservatives were the most commonly used preservatives for pressure treatment of wood for building constructions. Because of a...

  13. Arbuscular mycorrhizal fungus inoculation reduces the drought-resistance advantage of endophyte-infected versus endophyte-free Leymus chinensis.

    PubMed

    Liu, Hui; Chen, Wei; Wu, Man; Wu, Rihan; Zhou, Yong; Gao, Yubao; Ren, Anzhi

    2017-11-01

    Grasses can be infected simultaneously by endophytic fungi and arbuscular mycorrhizal (AM) fungi. In this study, we tested the hypothesis that endophyte-associated drought resistance of a native grass was affected by an AM fungus. In a greenhouse experiment, we compared the performance of endophyte-infected (EI) and endophyte-free (EF) Leymus chinensis, a dominant species native to the Inner Mongolia steppe, under altered water and AM fungus availability. The results showed that endophyte infection significantly increased drought resistance of the host grass, but the beneficial effects were reduced by AM fungus inoculation. In the mycorrhizal-non-inoculated (MF) treatment, EI plants accumulated significantly more biomass, had greater proline and total phenolic concentration, and lower malondialdehyde concentration than EF plants. In the mycorrhizal-inoculation (MI) treatment, however, no significant difference occurred in either growth or physiological characters measured between EI and EF plants. AM fungus inoculation enhanced drought resistance of EF plants but had no significant effect on drought resistance of EI plants, thus AM fungus inoculation reduced the difference between EI and EF plants. Our findings highlight the importance of interactions among multiple microorganisms for plant performance under drought stress.

  14. Improving Efficacy of Beauveria bassiana against Stored Grain Beetles with a Synergistic Co-Formulant

    PubMed Central

    Storm, Clare; Scoates, Freya; Nunn, Adam; Potin, Olivier; Dillon, Aoife

    2016-01-01

    The potential of a dry powder co-formulant, kaolin, to improve the control of storage beetles by the entomopathogenic fungus Beauveria bassiana, isolate IMI389521, was investigated. The response of Oryzaephilus surinamensis adults to the fungus when applied to wheat at 1 × 1010 conidia per kg with and without kaolin at 1.74 g per kg wheat was assessed. Addition of kaolin increased control from 46% to 88% at day 7 and from 81% to 99% at day 14 post-treatment. Following this the dose response of O. surinamensis and Tribolium confusum to both kaolin and the fungus was investigated. Synergistic effects were evident against O. surinamensis at ≥0.96 g of kaolin per kg of wheat when combined with the fungus at all concentrations tested. For T. confusum, adult mortality did not exceed 55%, however, the larvae were extremely susceptible with almost complete suppression of adult emergence at the lowest fungal rate tested even without the addition of kaolin. Finally, the dose response of Sitophilus granarius to the fungus at 15 and 25 °C, with and without kaolin at 1 g per kg of wheat, was examined. Improvements in efficacy were achieved by including kaolin at every fungal rate tested and by increasing the temperature. Kaolin by itself was not effective, only when combined with the fungus was an effect observed, indicating that kaolin was having a synergistic effect on the fungus. PMID:27571107

  15. Nature of the interactions between hypocrealean fungi and the mutualistic fungus of leaf-cutter ants.

    PubMed

    Varanda-Haifig, Sadala Schmidt; Albarici, Tatiane Regina; Nunes, Pablo Henrique; Haifig, Ives; Vieira, Paulo Cezar; Rodrigues, Andre

    2017-04-01

    Leaf-cutter ants cultivate and feed on the mutualistic fungus, Leucoagaricus gongylophorus, which is threatened by parasitic fungi of the genus Escovopsis. The mechanism of Escovopsis parasitism is poorly understood. Here, we assessed the nature of the antagonism of different Escovopsis species against its host. We also evaluated the potential antagonism of Escovopsioides, a recently described fungal genus from the attine ant environment whose role in the colonies of these insects is unknown. We performed dual-culture assays to assess the interactions between L. gongylophorus and both fungi. We also evaluated the antifungal activity of compounds secreted by the latter on L. gongylophorus growth using crude extracts of Escovopsis spp. and Escovopsioides nivea obtained either in (1) absence or (2) presence of the mutualistic fungus. The physical interaction between these fungi and the mutualistic fungus was examined under scanning electron microscopy (SEM). Escovopsis spp. and E. nivea negatively affected the growth of L. gongylophorus, which was also significantly inhibited by both types of crude extract. These results indicate that Escovopsis spp. and E. nivea produce antifungal metabolites against the mutualistic fungus. SEM showed that Escovopsis spp. and E. nivea maintained physical contact with the mutualistic fungus, though no specialised structures related to mycoparasitism were observed. These results showed that Escovopsis is a destructive mycoparasite that needs physical contact for the death of the mutualistic fungus to occur. Also, our findings suggest that E. nivea is an antagonist of the ant fungal cultivar.

  16. Efficacy of the nematode-trapping fungus Duddingtonia flagrans against three species of gastro-intestinal nematodes in laboratory faecal cultures from sheep and goats.

    PubMed

    Waghorn, T S; Leathwick, D M; Chen, L-Y; Skipp, R A

    2003-12-30

    The ability of the nematode-killing fungus Duddingtonia flagrans to reduce number of infective larvae of three species of gastro-intestinal parasitic nematodes developing in dung was investigated in both goats and sheep. Groups of lambs and kids (12-20 weeks old) were given mono-specific infections of Haemonchus contortus, Ostertagia (Teladorsagia) circumcincta or Trichostrongylus colubriformis. Following patency of the infections (t1) faecal samples were collected for determination of faecal nematode egg count (FEC) and culture of parasite larvae. Groups of animals were then dosed on 2 consecutive days with one of the two dose rates of the fungus (250,000 or 500,000 spores/kg liveweight). One (t2) and 5 (t3) days after the second dose of fungus samples were again collected for FEC and culture. The number of larvae recovered from the faecal cultures at t1 and t3 were used as controls to assess the efficacy of the experimental treatment at t2. Average efficacy was 78% with group means ranging from 40 to 93%. Dose rate of fungus appeared to influence efficacy against O. circumcincta but not against H. contortus or T. colubriformis. Overall, there were no differences in the efficacy of the fungus against any of the parasite species or in either host animal. The results of this trial indicate the potential use of this fungus as a broad spectrum anti-parasite agent for use in both goats and sheep.

  17. Draft genome sequence of the fungus associated with oak-wilt mortality in South Korea, Raffaelea quercus-mongolicae KACC44405

    Treesearch

    Jongbum Jeon; Ki-Tae Kim; Hyeunjeong Song; Gir-Won Lee; Kyeongchae Cheong; Hyunbin Kim; Gobong Choi; Yong-Hwan Lee; Jane E. Stewart; Ned B. Klopfenstein; Mee-Sook Kim

    2017-01-01

    The fungus Raffaelea quercus-mongolicae is the causal agent of Korean oak wilt, a disease associated with mass mortality of oak trees (e.g., Quercus spp.). The fungus is vectored and dispersed by the ambrosia beetle, Platypus koryoensis. Here, we present the 27.0-Mb draft genome sequence of R. quercus-mongolicae strain KACC44405.

  18. Characteristics of a newly isolated fungus Geotrichum candidum Dec 1 with broad degradation spectrum of xenobiotic compounds.

    PubMed

    Shoda, M

    2003-01-01

    A newly isolated fungus, Geotrichum candidum Dec 1 (abbreviated as Dec 1), was found to have the ability to degrade many xenobiotic compounds such as synthetic dyes, food coloring agents, molasses, organic halogens, lignin and kraft pulp effluents. The broad spectrum of the degradation of these compounds are associated mainly with peroxidases produced by the fungus.

  19. Cutinase in Cryphonectria parasitica, the chestnut blight fungus: suppression of cutinase gene expression in isogenic hypovirulent strains containing double-stranded RNAs

    Treesearch

    D.A. ​Varley; G.K. Podila; S.T. Hiremath

    1992-01-01

    Plant-pathogenic fungi produce cutinase, an enzyme required to degrade plant cuticles and facilitate penetration into the host. The absence of cutinase or a decrease in its production has been associated with a decrease in pathogenicity of the fungus. A set of isogenic strains of Cryphonectria parasitica, the chestnut blight fungus, was tested for...

  20. First unusual case of keratitis in Europe due to the rare fungus Metarhizium anisopliae.

    PubMed

    Dorin, Josephine; Debourgogne, Anne; Zaïdi, Mohamed; Bazard, Marie-Christine; Machouart, Marie

    2015-05-01

    Metarhizium anisopliae is a fungus utilized worldwide for insect-pest biocontrol. Few M. anisopliae infections have been reported previously. Here, M. anisopliae was isolated from a corneal ulcer in a healthy man. It is the first ocular case in France and Europe of this extremely rare fungus in humans. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Symbiosis-regulated expression of an acetyl-CoA acetyltransferase gene in the ectomycorrhizal fungus Laccaria bicolor

    Treesearch

    Shiv T. Hiremath; Sujata Balasubramanian; Jun Zheng; Gopi K. Podila

    2006-01-01

    The ectomycorrhiza is a symbiotic organ generated from the intricate association of fungal hyphae and plant root. The establishment of the ectomycorrhiza is a coordinated process of cross-talk between plant and fungus, followed by metabolic, developmental, and structural changes in the fungus, resulting in its growth toward the root. The initial stages of the symbiotic...

  2. Genetic diversity and population structure of Raffaelea quercus-mongolicae, a fungus associated with oak mortality in South Korea

    Treesearch

    M. -S. Kim; P. A. Hohenlohe; K. -H. Kim; S. -T. Seo; Ned Klopfenstein

    2016-01-01

    Raffaelea quercus-mongolicae is a fungus associated with oak wilt and deemed to cause extensive oak mortality in South Korea. Since the discovery of this fungus on a dead Mongolian oak (Quercus mongolica) in 2004, the mortality continued to spread southwards in South Korea. Despite continued expansion of the disease and associated significant impacts on forest...

  3. [Scytalidium dimidiatum an opportunistic fungus for both man and Mangifera indica trees in Venezuela].

    PubMed

    Padin, Carmiña; Fernández-Zeppenfeldt, Guillermo; Yegres, Francisco; Richard-Yegres, Nicole

    2005-09-01

    The purpose of this study was to confirm the presence of Scytalidium dimidiatum on Mangifera indica (mango) trees, in a plantation managed by a diabetic patient with a white grain mycetoma of the foot caused by the same fungus. Samples from necrotic apices, roots, burned leaves and rotten stems from eight trees were processed by the Smith and Furcolow's mineral oil technique (modified). Several isolates from the apex material and clinical samples from the diabetic patient isolated in pure culture a fungus with the macroscopic and microscopic characteristics of that in S. dimidiatum. This fungus should be considered as an opportunistic microorganism for both humans and M. indica.

  4. Isocoumarin Derivatives from the Sea Squirt-derived Fungus Penicillium stoloniferum QY2-10 and the Halotolerant Fungus Penicillium notatum B-52.

    PubMed

    Xin, Zhi-Hong; Tian, Li; Zhu, Tian-Jiao; Wang, Wen-Liang; Du, Lin; Fang, Yu-Chun; Gu, Qian-Qun; Zhu, Wei-Ming

    2007-07-01

    Two isocoumarin derivatives, stoloniferol A (1) and B (2), a known 5alpha, 8alpha-epidioxy-23-methyl-(22E, 24R)-ergosta-6, 22-dien-3beta-ol (3), and a known dihydrocitrinone (4) were isolated from the ethyl acetate extract of the sea squirt-derived fungus, Penicillium stoloniferum QY2-10, and a halophilic fungus, Penicillium notatum B-52, respectively. Their structures were elucidated by spectroscopic methods and optical rotation. The stereochemistry of 2 was determined on the basis of different NOE experiments and chemical transformation. Compound 3 showed cytotoxicity against P388 cells, with an IC50 value of 4.07 microM.

  5. Arbuscular mycorrhizas are present on Spitsbergen.

    PubMed

    Newsham, K K; Eidesen, P B; Davey, M L; Axelsen, J; Courtecuisse, E; Flintrop, C; Johansson, A G; Kiepert, M; Larsen, S E; Lorberau, K E; Maurset, M; McQuilkin, J; Misiak, M; Pop, A; Thompson, S; Read, D J

    2017-10-01

    A previous study of 76 plant species on Spitsbergen in the High Arctic concluded that structures resembling arbuscular mycorrhizas were absent from roots. Here, we report a survey examining the roots of 13 grass and forb species collected from 12 sites on the island for arbuscular mycorrhizal (AM) colonisation. Of the 102 individuals collected, we recorded AM endophytes in the roots of 41 plants of 11 species (Alopecurus ovatus, Deschampsia alpina, Festuca rubra ssp. richardsonii, putative viviparous hybrids of Poa arctica and Poa pratensis, Poa arctica ssp. arctica, Trisetum spicatum, Coptidium spitsbergense, Ranunculus nivalis, Ranunculus pygmaeus, Ranunculus sulphureus and Taraxacum arcticum) sampled from 10 sites. Both coarse AM endophyte, with hyphae of 5-10 μm width, vesicles and occasional arbuscules, and fine endophyte, consisting of hyphae of 1-3 μm width and sparse arbuscules, were recorded in roots. Coarse AM hyphae, vesicles, arbuscules and fine endophyte hyphae occupied 1.0-30.7, 0.8-18.3, 0.7-11.9 and 0.7-12.8% of the root lengths of colonised plants, respectively. Principal component analysis indicated no associations between the abundances of AM structures in roots and edaphic factors. We conclude that the AM symbiosis is present in grass and forb roots on Spitsbergen.

  6. The chestnut blight fungus for studies on virus/host and virus/virus interactions: from a natural to a model host.

    PubMed

    Eusebio-Cope, Ana; Sun, Liying; Tanaka, Toru; Chiba, Sotaro; Kasahara, Shin; Suzuki, Nobuhiro

    2015-03-01

    The chestnut blight fungus, Cryphonectria parasitica, is an important plant pathogenic ascomycete. The fungus hosts a wide range of viruses and now has been established as a model filamentous fungus for studying virus/host and virus/virus interactions. This is based on the development of methods for artificial virus introduction and elimination, host genome manipulability, available host genome sequence with annotations, host mutant strains, and molecular tools. Molecular tools include sub-cellular distribution markers, gene expression reporters, and vectors with regulatable promoters that have been long available for unicellular organisms, cultured cells, individuals of animals and plants, and certain filamentous fungi. A comparison with other filamentous fungi such as Neurospora crassa has been made to establish clear advantages and disadvantages of C. parasitica as a virus host. In addition, a few recent studies on RNA silencing vs. viruses in this fungus are introduced. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Greater taxol yield of fungus Pestalotiopsis hainanensis from dermatitic scurf of the giant panda (Ailuropoda melanoleuca).

    PubMed

    Gu, Yu; Wang, Yanlin; Ma, Xiaoping; Wang, Chengdong; Yue, Guizhou; Zhang, Yuetian; Zhang, Yunyan; Li, Shanshan; Ling, Shanshan; Liu, Xiaomin; Wen, Xintian; Cao, Sanjie; Huang, Xiaobo; Deng, Junliang; Zuo, Zhicai; Yu, Shumin; Shen, Liuhong; Wu, Rui

    2015-01-01

    While taxol yields of fungi from non-animal sources are still low, whether Pestalotiopsis hainanensis isolated from the scurf of a dermatitic giant panda, Ailuropoda melanoleuca, provides a greater taxol yield remains unknown. The objective of the study was to determine the corresponding taxol yield. The structure of the taxol produced by the fungus was evaluated by thin layer chromatography (TLC), ultraviolet (UV) spectroscopy, high-performance liquid chromatography (HPLC), (1)H and (13)C nuclear magnetic resonance spectroscopy ((1)H-NMR and (13)C-NMR), and time-of-flight mass spectrometry (TOF-MS), with standard taxol as a control. The results demonstrated that the P. hainanensis fungus produced taxol, which had the same structure as the standard taxol and yield of 1,466.87 μg/L. This fungal taxol yield from the dermatitic giant panda was significantly greater than those of fungus from non-animal sources. The taxol-producing fungus may be a potential candidate for the production of taxol on an industrial scale.

  8. The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica

    PubMed Central

    Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

    2014-01-01

    In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven. PMID:25071395

  9. Genome Sequence of the Mucoromycotina Fungus Umbelopsis isabellina, an Effective Producer of Lipids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takeda, Itaru; Tamano, Koichi; Yamane, Noriko

    2014-02-27

    Umbelopsis isabellina is a fungus in the subdivision Mucoromycotina, many members of which have been shown to be oleaginous and have become important organisms for producing oil because of their high level of intracellular lipid accumulation from various feedstocks. The genome sequence of U. isabellina NBRC 7884 was determined and annotated, and this information might provide insights into the oleaginous properties of this fungus.

  10. Phylogenetic placement of an unusual coral mushroom challenges the classic hypothesis of strict coevolution in the Apterostigma pilosum group ant-fungus mutualism

    Treesearch

    Bryn T.M. Dentinger; D.Jean Lodge; Andrew B. Munkacsi; Dennis E. Desjardin; David J. McLaughlin

    2009-01-01

    The ~50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus ...

  11. Fingerprints of a forest fungus: Swiss needle cast, carbon isotopes, carbohydrates, and growth in Douglas-fir

    Treesearch

    Andrea Watts; Frederick Meinzer; Brandy J. Saffell

    2014-01-01

    Swiss needle cast is caused by a fungus native to the Pacific Northwest. Its host is Douglas-fir, an iconic evergreen tree in the region. The fungus does not kill its host, but it adversely affects the tree's growth. The fungal fruiting bodies block the stomata, small openings on the underside of the needle where carbon dioxide, water vapor, and other gases are...

  12. The genome of an industrial workhorse : sequencing of the filamentous fungus Aspergillus niger offers new opportunities for the production of specialty chemicals and enzymes

    Treesearch

    Dan Cullen

    2007-01-01

    Few microbes compare with the filamentous fungus Aspergillus niger in its ability to produce prodigious amounts of useful chemicals and enzymes. This fungus is the principal source of citric acid for food, beverages and pharmaceuticals and of several important commercial enzymes, including glucoamylase, which is widely used for the conversion of starch to food syrups...

  13. Histopathology of cutaneous sporotrichosis in Rio de Janeiro: a series of 119 consecutive cases.

    PubMed

    Quintella, Leonardo Pereira; Passos, Sonia Regina Lambert; do Vale, Antônio Carlos Francesconi; Galhardo, Maria Clara Gutierrez; Barros, Monica Bastos De Lima; Cuzzi, Tullia; Reis, Rosani Dos Santos; de Carvalho, Maria Helena Galdino Figueiredo; Zappa, Mônica Barbato; Schubach, Armando De Oliveira

    2011-01-01

    Sporotrichosis is the most common subcutaneous mycosis in Rio de Janeiro. Histopathological examination reveals diffuse granulomatous and suppurative dermatitis, and the fungus is rarely identifiable in tissue. We describe the histopathological features of cutaneous sporotrichosis, and investigate the association between them and the lack of visualization of the fungus. A total of 119 samples of confirmed sporotrichosis cases were studied. The characteristics of the inflammatory infiltrate, the presence of epidermal changes, necrosis and fibrosis, and the parasite burden were analyzed. The association between histopathological changes and the lack of visualization of the fungus was evaluated using prevalence ratios. Granulomas were observed in all samples, suppurative granulomas in 100 (84%) and diffuse dermatitis in 114 (95.8%). Liquefaction and caseous necrosis were present in 78 (65.5%) and 52 (43.7%) samples, respectively. The fungus was not seen in 77 (64.7%) samples. Epithelioid, tuberculoid or foreign-body-type granulomas, caseous, fibrinoid or absent necrosis, predominance of lymphocytes among nonphagocytic cells and fibrosis were associated with the lack of visualization of the fungus. The histopathological characteristics of sporotrichosis were variable when the causative fungus was not seen. In a proper context, the diagnosis of sporotrichosis remains a potential consideration even in the absence of demonstrable yeast. Copyright © 2010 John Wiley & Sons A/S.

  14. Comparative effects of native filamentous and arbuscular mycorrhizal fungi in the establishment of an autochthonous, leguminous shrub growing in a metal-contaminated soil.

    PubMed

    Carrasco, L; Azcón, R; Kohler, J; Roldán, A; Caravaca, F

    2011-02-15

    The aim of this study was to assess the effectiveness of inoculation with a native arbuscular mycorrhizal (AM) fungus, Glomus mosseae (Nicol. and Gerd.) Gerd. and Trappe, or a filamentous fungus, Penicillium aurantiogriseum Dierckx 1901, on the establishment of Coronilla juncea L. seedlings grown in a polluted, semiarid soil. For that, root and shoot biomass, nutrient uptake, mycorrhizal colonisation and nitrate reductase (NR) and phosphatase activities were analysed. Six months after planting, the shoot biomass of C. juncea was increased only by the inoculation with G. mosseae (by about 62% compared with non-mycorrhizal plants). The shoot NR and root acid phosphatase activities were increased more by inoculation with G. mosseae than with P. aurantiogriseum inoculation. The root NR activity and foliar nutrient contents were increased only by the inoculation with the AM fungus. The root Zn and Cu decreased with the AM fungus. In conclusion, the autochthonous AM fungus was an effective inoculant with regard to stimulating growth and alleviating heavy metal toxicity for plants growing on a soil contaminated by multiple heavy metals. Inoculation with an autochthonous, filamentous fungus does not seem to be a good strategy for phytoremediation of such problematic sites. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Synergistic interaction between the fungus Beauveria bassiana and desiccant dusts applied against poultry red mites (Dermanyssus gallinae).

    PubMed

    Steenberg, Tove; Kilpinen, Ole

    2014-04-01

    The poultry red mite, Dermanyssus gallinae, is a major pest in egg production, feeding on laying hens. Widely used non-chemical control methods include desiccant dusts, although their persistence under field conditions is often short. Entomopathogenic fungi may also hold potential for mite control, but these fungi often take several days to kill mites. Laboratory experiments were carried out to study the efficacy of 3 types of desiccant dusts, the fungus Beauveria bassiana and combinations of the two control agents against D. gallinae. There was significant synergistic interaction between each of the desiccant dusts and the fungus, with observed levels of mite mortality significantly higher than those expected for an additive effect (up to 38 % higher). Synergistic interaction between desiccant dust and fungus was found also when different application methods were used for the fungus and at different levels of relative humidity. Although increased levels of mortality were reached due to the synergistic interaction, the speed of lethal action was not influenced by combining the two components. The persistence of the control agents applied separately or in combination did not change over a period of 4 weeks. Overall, combinations of desiccant dusts and fungus conidia seem to hold considerable promise for future non-chemical control of poultry red mites.

  16. Phomalactone from a Phytopathogenic Fungus Infecting ZINNIA elegans (ASTERACEAE) Leaves.

    PubMed

    Meepagala, Kumudini M; Johnson, Robert D; Techen, Natascha; Wedge, David E; Duke, Stephen O

    2015-07-01

    Zinnia elegans Jacq. plants are infected by a fungus that causes dark red spots with necrosis on leaves, particularly in late spring to the middle of summer in the Mid-South of the United States. This fungal disease causes the leaves to wilt and eventually kills the plant. The fungus was isolated, cultured in potato dextrose broth, and identified as Nigrospora sphaerica by molecular techniques. Two major lactone metabolites (phomalactone and catenioblin A) were isolated from liquid culture of N. sphaerica isolated from Z. elegans. When injected into leaves of Z. elegans, phomalactone caused lesions similar to those of the fungus. The lesion sizes were proportional to the concentration of the phomalactone. Phomalactone, but not catenioblin A, was phytotoxic to Z. elegans and other plant species by inhibition of seedling growth and by causing electrolyte leakage from photosynthetic tissues of both Z. elegans leaves and cucumber cotyledons. This latter effect may be related to the wilting caused by the fungus in mature Z. elegans plants. Phomalactone was moderately fungicidal to Coletotrichum fragariae and two Phomopsis species, indicating that the compound may keep certain other fungi from encroaching into plant tissue that N. sphaerica has infected. Production of large amounts of phomalactone by N. sphaerica contributes to the pathogenic behavior of this fungus, and may have other ecological functions in the interaction of N. sphaerica with other fungi. This is the first report of isolation of catenioblin A from a plant pathogenic fungus. The function of catenioblin A is unclear, as it was neither significantly phyto- nor fungitoxic.

  17. Fungus symbionts colonizing the galleries of the ambrosia beetle Platypus quercivorus.

    PubMed

    Endoh, Rikiya; Suzuki, Motofumi; Okada, Gen; Takeuchi, Yuko; Futai, Kazuyoshi

    2011-07-01

    Isolations were made to determine the fungal symbionts colonizing Platypus quercivorus beetle galleries of dead or dying Quercus laurifolia, Castanopsis cuspidata, Quercus serrata, Quercus crispula, and Quercus robur. For these studies, logs from oak wilt-killed trees were collected from Kyoto Prefecture, Japan. Fungi were isolated from the: (1) entrances of beetle galleries, (2) vertical galleries, (3) lateral galleries, and (4) the larval cradle of P. quercivorus in each host tree. Among the fungus colonies which appeared on YM agar plates, 1,219 were isolated as the representative isolates for fungus species inhabiting in the galleries based on their cultural characteristics. The validity of the visual classification of the fungus colonies was checked and if necessary properly corrected using microsatellite-primed PCR fingerprints. The nucleotide sequence of the D1/D2 region of the large subunit nuclear rRNA gene detected 38 fungus species (104 strains) of which three species, i.e., Candida sp. 3, Candida kashinagacola (both yeasts), and the filamentous fungus Raffaelea quercivora were isolated from all the tree species. The two yeasts were most prevalent in the interior of galleries, regardless of host tree species, suggesting their close association with the beetle. A culture-independent method, terminal restriction fragment length polymorphism (T-RFLP) analysis was also used to characterize the fungus flora of beetle galleries. T-RFLP patterns showed that yeast species belonging to the genus Ambrosiozyma frequently occurred on the gallery walls along with the two Candida species. Ours is the first report showing the specific fungi inhabiting the galleries of a platypodid ambrosia beetle.

  18. Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aylward, Frank O.; Burnum-Johnson, Kristin E.; Tringe, Susannah G.

    Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass ismore » degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.« less

  19. Species-specific ant brain manipulation by a specialized fungal parasite.

    PubMed

    de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P

    2014-08-29

    A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation by this specialized fungus and therefore represent a major advancement towards an understanding of the molecular mechanisms underlying this phenomenon.

  20. Pneumocystis jiroveci pneumonia

    MedlinePlus

    Pneumocystis pneumonia; Pneumocystosis; PCP; Pneumocystis carinii ... This type of pneumonia is caused by the fungus Pneumocystis jiroveci . This fungus is common in the environment and rarely causes illness in ...

  1. A specialized fungal parasite (Massospora cicadina) hijacks the sexual signals of periodical cicadas (Hemiptera: Cicadidae: Magicicada).

    PubMed

    Cooley, John R; Marshall, David C; Hill, Kathy B R

    2018-01-23

    Male periodical cicadas (Magicicada spp.) infected with conidiospore-producing ("Stage I") infections of the entomopathogenic fungus Massospora cicadina exhibit precisely timed wing-flick signaling behavior normally seen only in sexually receptive female cicadas. Male wing-flicks attract copulation attempts from conspecific males in the chorus; close contact apparently spreads the infective conidiospores. In contrast, males with "Stage II" infections that produce resting spores that wait for the next cicada generation do not produce female-specific signals. We propose that these complex fungus-induced behavioral changes, which resemble apparently independently derived changes in other cicada-Massospora systems, represent a fungus "extended phenotype" that hijacks cicadas, turning them into vehicles for fungus transmission at the expense of the cicadas' own interests.

  2. Patterns of functional enzyme activity in fungus farming ambrosia beetles.

    PubMed

    De Fine Licht, Henrik H; Biedermann, Peter H W

    2012-06-06

    In wood-dwelling fungus-farming weevils, the so-called ambrosia beetles (Curculionidae: Scolytinae and Platypodinae), wood in the excavated tunnels is used as a medium for cultivating fungi by the combined action of digging larvae (which create more space for the fungi to grow) and of adults sowing and pruning the fungus. The beetles are obligately dependent on the fungus that provides essential vitamins, amino acids and sterols. However, to what extent microbial enzymes support fungus farming in ambrosia beetles is unknown. Here we measure (i) 13 plant cell-wall degrading enzymes in the fungus garden microbial consortium of the ambrosia beetle Xyleborinus saxesenii, including its primary fungal symbionts, in three compartments of laboratory maintained nests, at different time points after gallery foundation and (ii) four specific enzymes that may be either insect or microbially derived in X. saxesenii adult and larval individuals. We discovered that the activity of cellulases in ambrosia fungus gardens is relatively small compared to the activities of other cellulolytic enzymes. Enzyme activity in all compartments of the garden was mainly directed towards hemicellulose carbohydrates such as xylan, glucomannan and callose. Hemicellulolytic enzyme activity within the brood chamber increased with gallery age, whereas irrespective of the age of the gallery, the highest overall enzyme activity were detected in the gallery dump material expelled by the beetles. Interestingly endo-β-1,3(4)-glucanase activity capable of callose degradation was identified in whole-body extracts of both larvae and adult X. saxesenii, whereas endo-β-1,4-xylanase activity was exclusively detected in larvae. Similar to closely related fungi associated with bark beetles in phloem, the microbial symbionts of ambrosia beetles hardly degrade cellulose. Instead, their enzyme activity is directed mainly towards comparatively more easily accessible hemicellulose components of the ray-parenchyma cells in the wood xylem. Furthermore, the detection of xylanolytic enzymes exclusively in larvae (which feed on fungus colonized wood) and not in adults (which feed only on fungi) indicates that only larvae (pre-) digest plant cell wall structures. This implies that in X. saxesenii and likely also in many other ambrosia beetles, adults and larvae do not compete for the same food within their nests - in contrast, larvae increase colony fitness by facilitating enzymatic wood degradation and fungus cultivation.

  3. Fungal arthritis

    MedlinePlus

    ... examine you. Tests that may be ordered include: Culture of joint fluid that grows fungus Joint x-ray showing joint changes Positive antibody test (serology) for fungal disease Synovial biopsy showing fungus

  4. Colonization by the arbuscular mycorrhizal fungus Glomus versiforme induces a defense response against the root-knot nematode Meloidogyne incognita in the grapevine (Vitis amurensis Rupr.), which includes transcriptional activation of the class III chitinase gene VCH3.

    PubMed

    Li, Hai-Yan; Yang, Guo-Dong; Shu, Huai-Rui; Yang, Yu-Tao; Ye, Bao-Xing; Nishida, Ikuo; Zheng, Cheng-Chao

    2006-01-01

    Inoculation of the grapevine (Vitis amurensis Rupr.) with the arbuscular mycorrhizal (AM) fungus Glomus versiforme significantly increased resistance against the root-knot nematode (RKN) Meloidogyne incognita. Studies using relative quantitative reverse transcription-PCR (RQRT-PCR) analysis of grapevine root inoculation with the AM fungus revealed an up-regulation of VCH3 transcripts. This increase was greater than that observed following infection with RKN. However, inoculation of the mycorrhizal grapevine roots with RKN was able to enhance VCH3 transcript expression further. Moreover, the increase in VCH3 transcripts appeared to result in a higher level of resistance against subsequent RKN infection. Constitutive expression of VCH3 cDNA in transgenic tobacco under the control of the cauliflower mosaic virus 35S promoter also conferred resistance against RKN, but had no significant effect on the growth of the AM fungus. We analyzed beta-glucuronidase (GUS) activity directed by a 1,216 bp VCH3 promoter in transgenic tobacco following inoculation with both the AM fungus and RKN. GUS activity was negligible in the root tissues before inoculation, and was more effectively induced after inoculation with the AM fungus than with RKN. Moreover, GUS staining in the mycorrhizal transgenic tobacco roots was enhanced by subsequent RKN infection, and was found ubiquitously throughout the whole root tissue. Together, these results suggest that AM fungus induced a defense response against RKN in the mycorrhizal grapevine roots, which appeared to involve transcriptional control of VCH3 expression throughout the whole root tissue.

  5. A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

    PubMed

    Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

    2013-06-01

    The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Mucor indicus: biology and industrial application perspectives: a review.

    PubMed

    Karimi, Keikhosro; Zamani, Akram

    2013-01-01

    Mucor indicus, one of the most important strains of zygomycetes fungi, has been the subject of several studies since a couple of hundred years ago. This fungus, regarded as a non-pathogenic dimorphic microorganism, is used for production of several beers and foods. Morphology of the fungus can be manipulated and well controlled by changing a number of parameters. Furthermore, M. indicus can grow on a variety of substrates including lignocellulosic hydrolysates which are mixtures of hexoses, pentoses, and different severe fermentation inhibitors. Indeed, high yield ethanol production is among the most important features of this strain. Presence of considerable amounts of chitosan in the cell wall is another important aspect of the fungus. Besides production of ethanol and chitosan, the biomass of this fungus has shown a great potential to be used as a rich nutritional source, e.g. fish feed. The fungus is also among the oleaginous fungi and produces high amounts of polyunsaturated fatty acids particularly γ-linolenic acid. Furthermore, the biomass autolysate has a high potential for yeast extract replacement in fermentation by the fungus. Additionally, the strain has shown promising results in heavy metal removal from wastewaters. This review discusses different aspects of biology and industrial application perspectives of M. indicus. Furthermore, open areas for the future basic and applied levels of research are also presented. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Biological control of trichostrongyles in beef cattle by the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

    PubMed

    Assis, R C L; Luns, F D; Araújo, J V; Braga, F R

    2012-11-01

    The efficacy of a fungal formulation based on the nematophagous fungus Duddingtonia flagrans was assessed in the control of cattle trichostrongyles. Twenty male Nellore calves, six-month-old, divided in two groups (fungus-treated and control without fungus) were fed on a pasture of Brachiaria decumbens naturally infected with larvae of bovine trichostrongyles. Animals of the treated group received doses of sodium alginate mycelial pellets orally (1 g/10 kg live weight, twice a week), for 12 months. Feces samples were collected for egg count (eggs per gram of feces-EPG) and coprocultures during 12 months. There was a significant reduction in EPG (56.7%) and infective larvae (L3) in coprocultures (60.5%) for animals of the treated group in relation to the control group at the end of the study. There was a significant reduction of L3 (64.5%) in herbage samples collected up to 0-20 cm from fecal pats and 73.2% in distant samples (20-40 cm) between the fungus-treated group and the control group. The treatment with sodium alginate pellets containing the nematode trapping fungus D. flagrans reduced trichostrongylid in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in beef cattle. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. The nematophagous fungus Monacrosporium thaumasium and its nematicidal activity on Angiostrongylus vasorum.

    PubMed

    Soares, Filippe Elias de Freitas; Braga, Fabio Ribeiro; de Araújo, Jackson Victor; Lima, Walter dos Santos; de Queiroz, José Humberto

    2015-01-01

    The dog acts as a reservoir and environmental disseminator of potentially zoonotic parasites. The objective of this work was to study the fungus Monacrosporium thaumasium regarding its nematicidal potential in laboratory trials and its proteolytic profile. The in vitro test was carried out through two assays (A and B). In assay A, conidia of the fungus N34a were added in positive coprocultures for Angiostrongylus vasorum. In assay B, crude extract (treated group) and distilled water (control group) were added to coprocultures. Next, the proteolytic profile of crude extract of the nematophagous fungus M. thaumasium (NF34a) was revealed by performing a zymogram. There was a reduction (p<0.01) in the averages of larvae recovered from the treated groups (conidia and crude extract) in relation to control groups. The zymogram suggested that the nematophagous fungus M. thaumasium produces a protease of approximately 40 kDa. The results of this work confirm that the conidia as well as the crude extract of the fungus M. thaumasium may be used to control A. vasorum L1. The proteolytic profile suggested the presence of one protease (Mt1) of approximately 40 kDa that in the future may be used in biological control of L1 of this nematode. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  9. Paracoccidioidomycosis

    MedlinePlus

    ... brasiliensis . Spores of the fungus, which grow in soil, may be inhaled. Most people have no symptoms, ... inhaling spores of the fungus, which grow in soil. Paracoccidioidomycosis usually involves the lungs, skin, mouth, throat, ...

  10. Histoplasmosis

    MedlinePlus

    ... by the fungus. Soil that contains bird or bat droppings may have larger amounts of this fungus. ... by reducing exposure to dust in chicken coops, bat caves, and other high-risk locations. Wear masks ...

  11. Histoplasmosis

    MedlinePlus

    ... is a disease caused by a fungus (or mold) called Histoplasma. The fungus is common in the eastern and central United States. It grows in soil and material contaminated with bat or bird droppings. ...

  12. Approaches for monitoring the release of Pochonia chlamydosporia var. catenulata, a biocontrol agent of root-knot nematodes.

    PubMed

    Atkins, Simon D; Hidalgo-Diaz, Leopoldo; Clark, Ian M; Morton, C Oliver; de Oca, Nivian Montes; Gray, Paul A; Kerry, Brian R

    2003-02-01

    Pochonia chlamydosporia var. catenulata is a potential biocontrol agent against root-knot nematodes. Diagnosis of isolates has relied on morphological identification, and is both time-consuming and difficult. beta-tubulin primers have been developed for the identification of this fungus that were specific enough to distinguish between varieties of the fungus within the same species. Separate primers have been developed for the specific detection of P. chlamydosporia var. catenulata based on ITS sequences, which were able to detect the fungus in soil from various sites in Cuba where the biocontrol agent had been added. When the PCR diagnosis was combined with serial dilution of soil samples on selective medium, colonies were rapidly identified. The fungus was still present, albeit at low densities, in soils inoculated five years previously. The development of a baiting method allowed quick in situ screening of the isolates' ability to infect nematode eggs, and when combined with PCR diagnosis both varieties of the fungus could be detected in infected eggs. RFLP analysis of ITS sequences from P. chlamydosporia provided an extra level of discrimination between isolates.

  13. 50 CFR Appendix A to Part 622 - Species Tables

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

  14. 50 CFR Appendix A to Part 622 - Species Tables

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

  15. First report of Albizia lebbeck dieback caused by Scytalidium dimidiatum in Oman.

    PubMed

    Elshafie, Abdulkadir E; Ba-Omar, Taher

    2002-01-01

    Over 200 Albizia lebbeck trees at Sultan Qaboos University campus wilted and died. The symptoms were dieback of large branches due to infection by Scytalidium dimidiatum. The fungus has also infected Ficus benghalensis, F. carica, F. retusa, Thespesia populnea, Delonix regia and Peltophorum petrocarpum. This is the first report of the fungus in Oman and on A. lebbeck, T. populnea, D. regia and P. petrocarpum. The strain of this fungus has not been found to cause human disease in Oman.

  16. Antimicrobials from the marine algal endophyte Penicillium sp.

    PubMed

    Flewelling, Andrew J; Johnson, John A; Gray, Christopher A

    2013-03-01

    An endophytic fungus identified as Penicillium sp. was isolated from the brown alga Fucus spiralis collected from the Shetland Islands, United Kingdom. Bioassay-guided fractionation of an extract of the fungus led to the isolation of cladosporin, epiepoformin, phyllostine, and patulin, all of which showed antimicrobial activity against either Staphylococcus aureus or Pseudomonas aeruginosa. Cladosporin has not previously been identified from a fungus of the genus Penicillium, and, despite being biosynthetically related, epiepoformin, phyllostine and patulin have not been previously reported from one source.

  17. Quantitative evaluation of protocorm growth and fungal colonization in Bletilla striata (Orchidaceae) reveals less-productive symbiosis with a non-native symbiotic fungus.

    PubMed

    Yamamoto, Tatsuki; Miura, Chihiro; Fuji, Masako; Nagata, Shotaro; Otani, Yuria; Yagame, Takahiro; Yamato, Masahide; Kaminaka, Hironori

    2017-02-21

    In nature, orchid plants depend completely on symbiotic fungi for their nutrition at the germination and the subsequent seedling (protocorm) stages. However, only limited quantitative methods for evaluating the orchid-fungus interactions at the protocorm stage are currently available, which greatly constrains our understanding of the symbiosis. Here, we aimed to improve and integrate quantitative evaluations of the growth and fungal colonization in the protocorms of a terrestrial orchid, Blettila striata, growing on a plate medium. We achieved both symbiotic and asymbiotic germinations for the terrestrial orchid B. striata. The protocorms produced by the two germination methods grew almost synchronously for the first three weeks. At week four, however, the length was significantly lower in the symbiotic protocorms. Interestingly, the dry weight of symbiotic protocorms did not significantly change during the growth period, which implies that there was only limited transfer of carbon compounds from the fungus to the protocorms in this relationship. Next, to evaluate the orchid-fungus interactions, we developed an ink-staining method to observe the hyphal coils in protocorms without preparing thin sections. Crushing the protocorm under the coverglass enables us to observe all hyphal coils in the protocorms with high resolution. For this observation, we established a criterion to categorize the stages of hyphal coils, depending on development and degradation. By counting the symbiotic cells within each stage, it was possible to quantitatively evaluate the orchid-fungus symbiosis. We describe a method for quantitative evaluation of orchid-fungus symbiosis by integrating the measurements of plant growth and fungal colonization. The current study revealed that although fungal colonization was observed in the symbiotic protocorms, the weight of the protocorm did not significantly increase, which is probably due to the incompatibility of the fungus in this symbiosis. These results suggest that fungal colonization and nutrition transfer can be differentially regulated in the symbiosis. The evaluation methods developed in this study can be used to study various quantitative aspects of the orchid-fungus symbiosis.

  18. FLUORESCENT-SERIOLOGICAL INVESTIGATIONS OF A PATHOGENIC FUNGUS (SPOROTRICHUM SCHENCKII),

    DTIC Science & Technology

    coloration of numerous other species of fungus no cross reactions with Sporotrichum schenkii were found. The use of this fluorescent coloring method for the diagnosis of Sporotrichosis is suggested. (Author)

  19. Athlete's Foot

    MedlinePlus

    ... this page. Please enable Javascript in your browser. Athlete's Foot Athlete's foot is a skin infection caused by fungus. A ... the body; on the foot, it is called athlete’s foot, or tinea pedis. Fungus commonly attacks the feet ...

  20. The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

    PubMed

    Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

    2010-03-01

    The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

  1. The Hidden Habit of the Entomopathogenic Fungus Beauveria bassiana: First Demonstration of Vertical Plant Transmission

    PubMed Central

    Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

    2014-01-01

    Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120–140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum. PMID:24551242

  2. Distribution and environmental persistence of the causative agent of white-nose syndrome, Geomyces destructans, in bat hibernacula of the eastern United States

    USGS Publications Warehouse

    Lorch, Jeffrey M.; Muller, Laura K.; Russell, Robin E.; O'Connor, Michael; Lindner, Daniel L.; Blehert, David S.

    2013-01-01

    White-nose syndrome (WNS) is an emerging disease of hibernating bats caused by the recently described fungus Geomyces destructans. First isolated in 2008, the origins of this fungus in North America and its ability to persist in the environment remain undefined. To investigate the correlation between manifestation of WNS and distribution of G. destructans in the U.S., we analyzed sediment samples collected from 55 bat hibernacula (caves and mines) both within and outside the known range of WNS using a newly developed real-time PCR assay. Geomyces destructans was detected in 17 of 21 sites within the known range of WNS at the time the samples were collected; the fungus was not found in 28 sites beyond the known range of the disease at the time that environmental samples were collected. These data indicate that distribution of G. destructans is correlated with disease in hibernating bats and support the hypothesis that the fungus is likely an exotic species in North America. Additionally, we examined whether G. destructans persists in infested bat hibernacula when bats are absent. Sediment samples were collected from 14 WNS-positive hibernacula, and the samples were screened for viable fungus using a culture technique. Viable G. destructans was cultivated from 7 of the 14 sites sampled during late summer when bats were no longer in hibernation, suggesting the fungus can persist in the environment in the absence of bat hosts for long periods of time.

  3. The hidden habit of the entomopathogenic fungus Beauveria bassiana: first demonstration of vertical plant transmission.

    PubMed

    Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

    2014-01-01

    Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120-140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum.

  4. Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.

    2012-09-01

    Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence andmore » three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.« less

  5. Trichoderma virens as a biocontrol of Toxocara canis: In vivo evaluation.

    PubMed

    de Souza Maia Filho, Fernando; da Silva Fonseca, Anelise Oliveira; Persici, Beatriz Maroneze; de Souza Silveira, Julia; Braga, Caroline Quintana; Pötter, Luciana; de Avila Botton, Sônia; Brayer Pereira, Daniela Isabel

    Microorganisms have been widely studied as biological control agents of parasites of medical and veterinary importance. Coprophagous arthropods, bacteria and fungi are among the different organisms evaluated as potential biological control agents. Nematophagous fungi capture and digest the free forms of nematodes in the soil. Due to its zoonotic potential, Toxocara canis have been brought to the attention of researchers. The aim of the present study was to determine whether the administration of embryonated T. canis eggs exposed to the nematophagous fungus Trichoderma virens reduces parasite infection in experimental animals. Embryonated T. canis eggs were exposed to T. virens mycelium for 15 days at 25°C. Subsequently, 100 fungus-exposed eggs were orally administered to 20 Swiss mice. As a positive control, another 20 mice received 100 embryonated eggs that were not exposed to the fungus. After 48h, the animals were killed, and heart, lungs and liver were harvested for the recovery of larvae. The organs of the animals that received embryonated T. canis eggs exposed to the fungus showed a lower mean larval recovery when compared with the animals that received embryonated eggs without fungus exposure (p<0.05). The exposure of T. canis eggs to T. virens reduces the experimental infection, demonstrating the potential of this nematophagous fungus as a biocontrol agent. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  6. Fungus-insect gall of Phlebopus portentosus.

    PubMed

    Zhang, Chun-Xia; He, Ming-Xia; Cao, Yang; Liu, Jing; Gao, Feng; Wang, Wen-Bing; Ji, Kai-Ping; Shao, Shi-Cheng; Wang, Yun

    2015-01-01

    Phlebopus portentosus is a popular edible wild mushroom found in the tropical Yunnan, China, and northern Thailand. In its natural habitats, a gall often has been found on some plant roots, around which fungal fruiting bodies are produced. The galls are different from common insect galls in that their cavity walls are not made from plant tissue but rather from the hyphae of P. portentosus. Therefore we have termed this phenomenon "fungus-insect gall". Thus far six root mealy bug species in the family Pseudococcidae that form fungus-insect galls with P. portentosus have been identified: Formicococcus polysperes, Geococcus satellitum, Planococcus minor, Pseudococcus cryptus, Paraputo banzigeri and Rastrococcus invadens. Fungus-insect galls were found on the roots of more than 21 plant species, including Delonix regia, Citrus maxima, Coffea arabica and Artocarpus heterophyllus. Greenhouse inoculation trials showed that fungus-insect galls were found on the roots of A. heterophyllus 1 mo after inoculation. The galls were subglobose to globose, fulvous when young and became dark brown at maturation. Each gall harbored one or more mealy bugs and had a chimney-like vent for ventilation and access to the gall. The cavity wall had three layers. Various shaped mealy bug wax deposits were found inside the wall. Fungal hyphae invaded the epidermis of plant roots and sometimes even the cortical cells during the late stage of gall development. The identity of the fungus inside the cavity was confirmed by molecular methods. © 2015 by The Mycological Society of America.

  7. Viral repression of fungal pheromone precursor gene expression.

    PubMed

    Zhang, L; Baasiri, R A; Van Alfen, N K

    1998-02-01

    Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G alpha(i) subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete.

  8. Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens.

    PubMed

    Aylward, Frank O; Burnum, Kristin E; Scott, Jarrod J; Suen, Garret; Tringe, Susannah G; Adams, Sandra M; Barry, Kerrie W; Nicora, Carrie D; Piehowski, Paul D; Purvine, Samuel O; Starrett, Gabriel J; Goodwin, Lynne A; Smith, Richard D; Lipton, Mary S; Currie, Cameron R

    2012-09-01

    Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant neotropical herbivores cultivate symbiotic fungus gardens on large quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers. Using metagenomic and metaproteomic techniques, we characterize the bacterial diversity and physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter and Escherichia. We show that these bacterial communities possess genes associated with lignocellulose degradation and diverse biosynthetic pathways, suggesting that they play a role in nutrient cycling by converting the nitrogen-poor forage of the ants into B-vitamins, amino acids and other cellular components. Our metaproteomic analysis confirms that bacterial glycosyl hydrolases and proteins with putative biosynthetic functions are produced in both field-collected and laboratory-reared colonies. These results are consistent with the hypothesis that fungus gardens are specialized fungus-bacteria communities that convert plant material into energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities in the ecology and evolution of herbivorous metazoans.

  9. An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat

    PubMed Central

    Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L.; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F.; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A.; Schweizer, Patrick

    2016-01-01

    Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici. Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei. Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus. PMID:28018377

  10. An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat.

    PubMed

    Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A; Schweizer, Patrick

    2016-01-01

    Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8 ) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici . Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei . Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus.

  11. Unintentional ingestion of Cordyceps fungus-infected cicada nymphs causing ibotenic acid poisoning in Southern Vietnam.

    PubMed

    Doan, Uyen Vy; Mendez Rojas, Bomar; Kirby, Ralph

    2017-09-01

    Cordyceps fungus found in infected cicada nymphs ("cicada flowers") is utilized in traditional Chinese medicine. Cordyceps fungus toxicity in humans has not been previously reported. We report 60 cases of apparent Cordyceps poisoning in Southern Vietnam. We retrospectively collected demographic and clinical data from the medical records (21 cases) and by telephone interview (39 cases) of patients admitted to seven hospitals in Southern Vietnam following ingestion of cicada flowers between 2008 and 2015. We also determined the species of Cordyceps present in the cicada flowers and performed a partial chemical analysis of the fungus. Sixty cases of toxic effects following ingestion of cicada flowers were documented. Symptom onset occurred within 60 minutes following ingestion. Symptoms included dizziness, vomiting, salivation, mydriasis, jaw stiffness, urinary retention, seizures, agitated delirium, hallucinations, somnolence and coma. None of the patients suffered liver or kidney injury. There was one fatality. The Cordyceps fungus involved in these poisoning was identified as Ophiocordyceps heteropoda. The presence of ibotenic acid was confirmed, but musimol and muscarine were absent. Cicada infected with Ophiocordyceps heteropoda in Vietnam contain ibotenic acid and are associated with a clinical syndrome consistent with its effects.

  12. Fabrication of a superhydrophobic surface with fungus-cleaning properties on brazed aluminum for industrial application in heat exchangers

    NASA Astrophysics Data System (ADS)

    Lee, Jeong-Won; Hwang, Woonbong

    2018-06-01

    Extensive research has been carried out concerning the application of superhydrophobic coating in heat exchangers, but little is known about the application of this technique to brazed aluminum heat exchangers (BAHEs). In this work, we describe a new superhydrophobic coating method, which is suitable for BAHE use on an industrial scale. We first render the BAHE superhydrophobic by fabricating micro/nanostructures using solution dipping followed by fluorination. After the complete removal of the silicon residue, we verify using surface analysis that the BAHE surface is perfectly superhydrophobic. We also studied the fungus-cleaning properties of the superhydrophobic surface by growing fungus for 4 weeks in a moist environment on BAHE fins with and without superhydrophobic coating. We observed that, whereas the fungus grown on the untreated fins is extremely difficult to remove, the fungus on the fins with the superhydrophobic coating can be removed easily with only a modest amount of water. We also found that the coated BAHE fins exhibit excellent resistance to moisture. The superhydrophobic coating method that we propose is therefore expected to have a major impact in the heating, ventilating and air conditioning industry market.

  13. Vertical transmission as the key to the colonization of Madagascar by fungus-growing termites?

    PubMed Central

    Nobre, T.; Eggleton, P.; Aanen, D. K.

    2010-01-01

    The mutualism between fungus-growing termites (Macrotermitinae) and their mutualistic fungi (Termitomyces) began in Africa. The fungus-growing termites have secondarily colonized Madagascar and only a subset of the genera found in Africa is found on this isolated island. Successful long-distance colonization may have been severely constrained by the obligate interaction of the termites with fungal symbionts and the need to acquire these symbionts secondarily from the environment for most species (horizontal symbiont transmission). Consistent with this hypothesis, we show that all extant species of fungus-growing termites of Madagascar are the result of a single colonization event of termites belonging to one of the only two groups with vertical symbiont transmission, and we date this event at approximately 13 Mya (Middle/Upper Miocene). Vertical symbiont transmission may therefore have facilitated long-distance dispersal since both partners disperse together. In contrast to their termite hosts, the fungal symbionts have colonized Madagascar multiple times, suggesting that the presence of fungus-growing termites may have facilitated secondary colonizations of the symbiont. Our findings indicate that the absence of the right symbionts in a new environment can prevent long-distance dispersal of symbioses relying on horizontal symbiont acquisition. PMID:19828546

  14. Serine proteases activity is important for the interaction of nematophagous fungus Duddingtonia flagrans with infective larvae of trichostrongylides and free-living nematodes Panagrellus spp.

    PubMed

    Cruz, Daniela G; Costa, Luana M; Rocha, Letícia O; Retamal, Claudio A; Vieira, Ricardo A M; Seabra, Sergio H; Silva, Carlos P; DaMatta, Renato A; Santos, Clóvis P

    2015-08-01

    The nematode-trapping fungus Duddingtonia flagrans has been studied as a possible control method for gastrointestinal nematodes of livestock animals. These fungi capture and infect the nematode by cuticle penetration, immobilization, and digestion of the internal contents. It has been suggested that this sequence of events occurs by a combination of physical and enzymatical activities. The aim of this study was to investigate the participation of proteolytic enzymatic activity during the interaction of the nematophagous fungus D. flagrans with infective larvae of trichostrongylides and the free-living nematode Panagrellus spp. Protease inhibitors used interfered in the predatory activity of D. flagrans. However, only PMSF significantly reduced the mean number of Panagrellus spp. captured by D. flagrans in comparison with the control. The experiment with fluorogenic substrate showed that maximum urokinase activity during the interaction of the fungus with the infective larvae of trichostrongylides or Panagrellus spp. occurred within 7 or 1 h of incubation, respectively. The protease activity, especially of the serine class, may be important during the interaction between the fungus and nematodes. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  15. [Biochemical basis of tolerance to osmotic stress in phytopathogenic fungus: The case of Macrophomina phaseolina (Tassi) Goid.

    PubMed

    Martínez-Villarreal, Rodolfo; Garza-Romero, Tamar S; Moreno-Medina, Víctor R; Hernández-Delgado, Sanjuana; Mayek-Pérez, Netzahualcoyotl

    Fungus Macrophomina phaseolina (Tassi) Goid. is the causative agent of charcoal rot disease which causes significant yield losses in major crops such as maize, sorghum, soybean and common beans in Mexico. This fungus is a facultative parasite which shows broad ability to adapt itself to stressed environments where water deficits and/or high temperature stresses commonly occur. These environmental conditions are common for most cultivable lands throughout Mexico. Here we describe some basic facts related to the etiology and epidemiology of the fungus as well as to the importance of responses to stressed environments, particularly to water deficits, based on morphology and growth traits, as well as on physiology, biochemistry and pathogenicity of fungus M. phaseolina. To conclude, we show some perspectives related to future research into the genus, which emphasize the increasing need to improve the knowledge based on the application of both traditional and biotechnological tools in order to elucidate the mechanisms of resistance to environmental stress which can be extrapolated to other useful organisms to man. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus.

    PubMed

    Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk; Lee, Tae Soo

    2016-03-01

    Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously.

  17. 46 CFR 164.018-9 - Design requirements.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

  18. 46 CFR 164.018-9 - Design requirements.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

  19. 46 CFR 164.018-9 - Design requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

  20. 46 CFR 164.018-9 - Design requirements.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

  1. Genetic Recombination

    ERIC Educational Resources Information Center

    Whitehouse, H. L. K.

    1973-01-01

    Discusses the mechanisms of genetic recombination with particular emphasis on the study of the fungus Sordaria brevicollis. The study of recombination is facilitated by the use of mutants of this fungus in which the color of the ascospores is affected. (JR)

  2. Chemical constituents of the mangrove-associated fungus Capnodium sp. SZ-F22. A new eremophilane sesquiterpene.

    PubMed

    He, Haibing; Ma, Zhongjun; Wang, Qianqian; Liu, Yu; Xu, Hualin

    2016-07-01

    A new eremophilane sesquiterpene, capnodiumone (1), along with five known eremophilane sesquiterpenes (2-6) and eight other compounds (7-14), have been isolated from a mangrove-associated fungus Capnodium sp. SZ-F22. The chemical structures were elucidated on the basis of extensive spectroscopic analysis. The broth extract of the fungus exhibited a good inhibitory effect on the mycelium growth against Fusarium graminearum at 100 μg/mL, however, all the 14 compounds showed no expected antifungal activity. The probable reasons were discussed.

  3. The research of using Co-60 γ ray to sterilize different mediums for edible fungus

    NASA Astrophysics Data System (ADS)

    Guozhu, Li; Zhenqian, Guan; Hengshou, Zhao

    1993-10-01

    The present experiment has been carried out by using different dosage of Co—60 γ ray for radiation sterilization of five kinds of cultural materials of edible fungus, The results indicated that sterilization dosage of sawdust is 22 kGy. that of cotton—seed shell and the rest are 26 kGy. We conclude that using Co-60 γ ray to sterilize the cultura 1 materials of edible fungus is a secure and saving labor and energy new method which could sterilize thoroughly.

  4. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  5. Colonization of soil by Histoplasma capsulatum: II. Effect of bat guano added to an area of reduced colonization.

    PubMed

    Hasenclever, H F; Piggott, W R

    1976-07-01

    Application of bat guano to an area with reduced but detectable colonization by Histoplasma capsulatum had no quantitative effect on the fungus. After seeding the guano treated area and an untreated area with a soil culture of the fungus, a quantitative effect was noted in the treated area but the period of survival did not appear to be extended. Twenty-four months after seeding, the fungus was no longer detectable in the study areas and they have remained negative for more than a year.

  6. Process for producing ethanol from plant biomass using the fungus paecilomyces sp.

    DOEpatents

    Wu, Jung Fu

    1989-01-01

    A process for producing ethanol from plant biomass is disclosed. The process in cludes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces, which has the ability to ferment both cellobiose and xylose to ethanol, is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate.

  7. Process for producing ethanol from plant biomass using the fungus Paecilomyces sp

    DOEpatents

    Wu, J.F.

    1985-08-08

    A process for producing ethanol from plant biomass is disclosed. The process includes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces which has the ability to ferment both cellobiose and xylose to ethanol is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate. 5 figs., 3 tabs.

  8. A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia.

    PubMed

    Gabriel, Frédéric; D'Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

    2013-02-09

    We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries.

  9. A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia

    PubMed Central

    Gabriel, Frédéric; D’Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

    2013-01-01

    We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries. PMID:24432214

  10. Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites

    PubMed Central

    Pedersen, Kristine S. K.; Aanen, Duur K.

    2017-01-01

    ABSTRACT Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ. Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. PMID:29269491

  11. Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites.

    PubMed

    da Costa, Rafael R; Hu, Haofu; Pilgaard, Bo; Vreeburg, Sabine M E; Schückel, Julia; Pedersen, Kristine S K; Kračun, Stjepan K; Busk, Peter K; Harholt, Jesper; Sapountzis, Panagiotis; Lange, Lene; Aanen, Duur K; Poulsen, Michael

    2018-03-01

    Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. Copyright © 2018 da Costa et al.

  12. 76 FR 7095 - Avocados Grown in South Florida; Increased Assessment Rate

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-09

    ... Red Bay Ambrosia beetle. The beetle carries the Laurel Wilt fungus which can infect and kill avocado trees. Research into the beetle and fungus had been funded by the University of Florida. However, the...

  13. Focus on Fungi

    ERIC Educational Resources Information Center

    Flannery, Maura C.

    2004-01-01

    A mention of "The Fungus Fighters: Two Women Scientists and Their Discovery" by Richard Baldwin and discovery of a huge fungus of the species Armillaria bulbosa and A. ostoyae are presented. Other aspects like fungal infections and shifting relationships are discussed.

  14. Multifarious plant growth promotion by an entomopathogenic fungus Lecanicillium psalliotae.

    PubMed

    Senthil Kumar, C M; Jacob, T K; Devasahayam, S; Thomas, Stephy; Geethu, C

    2018-03-01

    An entomopathogenic fungus, Lecanicillium psalliotae strain IISR-EPF-02 previously found infectious to cardamom thrips, Sciothrips cardamomi promoted plant growth in cardamom, Elettaria cardamomum. The isolate exhibited direct plant growth promoting traits by production of indole-3-acetic acid and ammonia and by solubilizing inorganic phosphate and zinc. It also showed indirect plant growth promoting traits by producing siderophores and cell wall-degrading enzymes like, α-amylases, cellulases and proteases. In pot culture experiments, application of the fungus at the root zone of cardamom seedlings significantly increased shoot and root length, shoot and root biomass, number of secondary roots and leaves and leaf chlorophyll content compared to untreated plants. This is the first report on the plant growth promoting traits of this fungus. The entomopathogenic and multifarious growth promoting traits of L. psalliotae strain IISR-EPF-02 suggest that it has great potential for exploitation in sustainable agriculture. Copyright © 2017 Elsevier GmbH. All rights reserved.

  15. Myco-fluidics: The fluid dynamics of fungal chimerism

    NASA Astrophysics Data System (ADS)

    Roper, Marcus; Hickey, Patrick; Dressaire, Emilie; Roch, Sebastien

    2012-11-01

    Chimeras-fantastical creatures formed as amalgams of many animals-have captured the human imagination since Ancient times. But they are also surprisingly common in Nature. The syncytial cells of filamentous fungi harbor large numbers of nuclei bathed in a single cytoplasm. As a fungus grows these nuclei become genetically diverse, either from mutation or from exchange of nuclei between different fungal individuals, a process that is known to increase the virulence of the fungus and its adaptability. By directly measuring nuclear movement in the model ascomycete fungus Neurospora crassa, we show that the fungus' tolerance for internal genetic diversity is enabled by hydrodynamic mixing of nuclei acting at all length scales within the fungal mycelium. Mathematical modeling and experiments in a mutant with altered mycelial morphology reveal some of the exquisite hydraulic engineering necessary to create these mixing flows from spatially coarse pressure gradients.

  16. Investigating the effects of laser beams (532 and 660 nm) in annihilation of pistachio mould fungus using spectrophotometry analysis

    NASA Astrophysics Data System (ADS)

    Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.

    2010-09-01

    When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.

  17. Genome characteristics reveal the impact of lichenization on lichen-forming fungus Endocarpon pusillum Hedwig (Verrucariales, Ascomycota)

    PubMed Central

    2014-01-01

    Background Lichen is a classic mutualistic organism and the lichenization is one of the fungal symbioses. The lichen-forming fungus Endocarpon pusillum is living in symbiosis with the green alga Diplosphaera chodatii Bialsuknia as a lichen in the arid regions. Results 454 and Illumina technologies were used to sequence the genome of E. pusillum. A total of 9,285 genes were annotated in the 37.5 Mb genome of E. pusillum. Analyses of the genes provided direct molecular evidence for certain natural characteristics, such as homothallic reproduction and drought-tolerance. Comparative genomics analysis indicated that the expansion and contraction of some protein families in the E. pusillum genome reflect the specific relationship with its photosynthetic partner (D. chodatii). Co-culture experiments using the lichen-forming fungus E. pusillum and its algal partner allowed the functional identification of genes involved in the nitrogen and carbon transfer between both symbionts, and three lectins without signal peptide domains were found to be essential for the symbiotic recognition in the lichen; interestingly, the ratio of the biomass of both lichen-forming fungus and its photosynthetic partner and their contact time were found to be important for the interaction between these two symbionts. Conclusions The present study lays a genomic analysis of the lichen-forming fungus E. pusillum for demonstrating its general biological features and the traits of the interaction between this fungus and its photosynthetic partner D. chodatii, and will provide research basis for investigating the nature of its drought resistance and symbiosis. PMID:24438332

  18. Impact of Climate Change on Potential Distribution of Chinese Caterpillar Fungus (Ophiocordyceps sinensis) in Nepal Himalaya

    PubMed Central

    Shrestha, Uttam Babu; Bawa, Kamaljit S.

    2014-01-01

    Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11–4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species. PMID:25180515

  19. Impact of climate change on potential distribution of Chinese caterpillar fungus (Ophiocordyceps sinensis) in Nepal Himalaya.

    PubMed

    Shrestha, Uttam Babu; Bawa, Kamaljit S

    2014-01-01

    Climate change has already impacted ecosystems and species and substantial impacts of climate change in the future are expected. Species distribution modeling is widely used to map the current potential distribution of species as well as to model the impact of future climate change on distribution of species. Mapping current distribution is useful for conservation planning and understanding the change in distribution impacted by climate change is important for mitigation of future biodiversity losses. However, the current distribution of Chinese caterpillar fungus, a flagship species of the Himalaya with very high economic value, is unknown. Nor do we know the potential changes in suitable habitat of Chinese caterpillar fungus caused by future climate change. We used MaxEnt modeling to predict current distribution and changes in the future distributions of Chinese caterpillar fungus in three future climate change trajectories based on representative concentration pathways (RCPs: RCP 2.6, RCP 4.5, and RCP 6.0) in three different time periods (2030, 2050, and 2070) using species occurrence points, bioclimatic variables, and altitude. About 6.02% (8,989 km2) area of the Nepal Himalaya is suitable for Chinese caterpillar fungus habitat. Our model showed that across all future climate change trajectories over three different time periods, the area of predicted suitable habitat of Chinese caterpillar fungus would expand, with 0.11-4.87% expansion over current suitable habitat. Depending upon the representative concentration pathways, we observed both increase and decrease in average elevation of the suitable habitat range of the species.

  20. Pycnoscelus surinamensis cockroach gut microbiota respond consistently to a fungal diet without mirroring those of fungus-farming termites.

    PubMed

    Richards, Callum; Otani, Saria; Mikaelyan, Aram; Poulsen, Michael

    2017-01-01

    The gut microbiotas of cockroaches and termites play important roles in the symbiotic digestion of dietary components, such as lignocellulose. Diet has been proposed as a primary determinant of community structure within the gut, acting as a selection force to shape the diversity observed within this "bioreactor", and as a key factor for the divergence of the termite gut microbiota from the omnivorous cockroach ancestor. The gut microbiota in most termites supports primarily the breakdown of lignocellulose, but the fungus-farming sub-family of higher termites has become similar in gut microbiota to the ancestral omnivorous cockroaches. To assess the importance of a fungus diet as a driver of community structure, we compare community compositions in the guts of experimentally manipulated Pycnoscelus surinamensis cockroaches fed on fungus cultivated by fungus-farming termites. MiSeq amplicon analysis of gut microbiotas from 49 gut samples showed a step-wise gradient pattern in community similarity that correlated with an increase in the proportion of fungal material provided to the cockroaches. Comparison of the taxonomic composition of manipulated communities to that of gut communities of a fungus-feeding termite species showed that although some bacteria OTUs shared by P. surinamensis and the farming termites increased in the guts of cockroaches on a fungal diet, cockroach communities remained distinct from those of termites. These results demonstrate that a fungal diet can play a role in structuring gut community composition, but at the same time exemplifies how original community compositions constrain the magnitude of such change.

  1. Viral Repression of Fungal Pheromone Precursor Gene Expression

    PubMed Central

    Zhang, Lei; Baasiri, Rudeina A.; Van Alfen, Neal K.

    1998-01-01

    Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a Gαi subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete. PMID:9447992

  2. [Termites (Isoptera) in forest ecosystems of Cat Tien National Park (Southern Vietnam)].

    PubMed

    Beliaeva, N V; Tiunov, A V

    2010-01-01

    The species composition and termite community populations were studied and the total land termites biomass was estimated in five forest habitats of Cat Tien National Park, Southern Vietnam. Twenty-four species of two families, Rhinotermitidae (1 species) and Termitidae (23 species), the predominant representatives of the subfamily Macrotermitinae, were found in mounds and in soil samples. On the test plots the density of termite mounds averaged 68 per hectare, primarily the mounds of three Macrotermes species. Destructive sampling allowed estimation of the caste composition and total community biomass based on six termite mounds of the prevailing species (Globitermes sulphureus, Microcerotermes burmanicus, Macrotermes carbonarius, M. gilvus, M. malaccensis, and Hypotermes obscuriceps). The total number of termites in the nests ranged from 65 000 to 3 150 000 individuals with the total biomass ranging from 185 to 2440 g live weight. The total abundance of nesting Macrotermes species alone could conservatively be estimated as 2.5 million individuals and 20.5 kg live weight per hectare. The number of soil- and litter-feeding termites averaged for the test plots was estimated at about 60 ind./m2. Four species dominating on the test plots (M. carbonarius, M. gilvus, M. malaccensis, and H. obscuriceps) belong to active tree litter feeders.

  3. Plants used traditionally to treat malaria in Brazil: the archives of Flora Medicinal

    PubMed Central

    Botsaris, Alexandros S

    2007-01-01

    The archives of Flora Medicinal, an ancient pharmaceutical laboratory that supported ethnomedical research in Brazil for more than 30 years, were searched for plants with antimalarial use. Forty plant species indicated to treat malaria were described by Dr. J. Monteiro da Silva (Flora Medicinal leader) and his co-workers. Eight species, Bathysa cuspidata, Cosmos sulphureus, Cecropia hololeuca, Erisma calcaratum, Gomphrena arborescens, Musa paradisiaca, Ocotea odorifera, and Pradosia lactescens, are related as antimalarial for the first time in ethnobotanical studies. Some species, including Mikania glomerata, Melampodium divaricatum, Galipea multiflora, Aspidosperma polyneuron, and Coutarea hexandra, were reported to have activity in malaria patients under clinical observation. In the information obtained, also, there were many details about the appropriate indication of each plant. For example, some plants are indicated to increase others' potency. There are also plants that are traditionally employed for specific symptoms or conditions that often accompany malaria, such as weakness, renal failure or cerebral malaria. Many plants that have been considered to lack activity against malaria due to absence of in vitro activity against Plasmodium can have other mechanisms of action. Thus researchers should observe ethnomedical information before deciding which kind of screening should be used in the search of antimalarial drugs. PMID:17472740

  4. Aerial application of the insect-killing fungus Lecanicillium muscarium in a microfactory formulation for hemlock woolly adelgid suppression

    Treesearch

    Scott Costa; Karen Felton; Bradley Onken; Richard Reardon; Rusty. Rhea

    2011-01-01

    Forest populations of hemlock woolly adelgid (HWA) were reduced using an operational formulation of the insect-killing fungus Lecanicillium muscarium when it was supported by microfactory formulation technology.

  5. Evolutionary patterns of proteinase activity in attine ant fungus gardens

    PubMed Central

    2011-01-01

    Background Attine ants live in symbiosis with a basidiomycetous fungus that they rear on a substrate of plant material. This indirect herbivory implies that the symbiosis is likely to be nitrogen deprived, so that specific mechanisms may have evolved to enhance protein availability. We therefore hypothesized that fungal proteinase activity may have been under selection for efficiency and that different classes of proteinases might be involved. Results We determined proteinase activity profiles across a wide pH range for fungus gardens of 14 Panamanian species of fungus-growing ants, representing eight genera. We mapped these activity profiles on an independently obtained molecular phylogeny of the symbionts and show that total proteinase activity in lower attine symbionts peaks at ca. pH 6. The higher attine symbionts that have no known free-living relatives had much higher proteinase activities than the lower attine symbionts. Their total in vitro proteinase activity peaked at pH values around 5, which is close to the pH that the ants maintain in their fungus gardens, suggesting that the pH optimum of fungal proteinases may have changed after the irreversible domestication of evolutionary more derived fungal symbionts. This notion is also supported by buffering capacities of fungus gardens at pH 5.2 being remarkably high, and suggests that the fungal symbiont actively helps to maintain garden acidity at this specific level. Metalloproteinases dominated the activity profiles of lower attine gardens and may thus represent the ancestral type of proteinase production, whereas serine proteinase activity dominated the activity profiles of the higher attine gardens reared by Trachymyrmex and Sericomyrmex, suggesting that there may be trade-offs in the production of these enzyme classes. Remarkably, the single symbiont that is shared by species of the crown group of Atta and Acromyrmex leaf-cutting ants mostly showed metalloproteinase activity, suggesting that recurrent changes in enzyme production may have occurred throughout the domestication history of fungus-garden symbionts. Conclusions Proteinase pH optima and buffering capacities of fungal symbionts appear to have evolved remarkable adaptations to living in obligate symbiosis with farming ants. Although the functional roles of serine and metalloproteinases in fungus gardens are unknown, the differential production of these classes of proteolytic enzymes suggest that substrate specificity may be important and that trade-offs may prevent the simultaneous upregulation of both classes of enzymes. PMID:21247468

  6. Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium (1988)

    EPA Science Inventory

    Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [14C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble met...

  7. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  8. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  9. Parasitic Aspects of a Fairy Ring Fungus, Marasmius oreades

    Treesearch

    T. H. Filer

    1965-01-01

    Marasmius oreades parasitizes Poa pratensis, Festuca rubra, and Agrostis tenuis. The fungus penetrates the root directly in all three species and does not require natural openings or wounds. The mycelium ramifies in the cortical cells and destroys the cell contents.

  10. Cyclodepsipeptides, sesquiterpenoids, and other cytotoxic metabolites from the filamentous fungus Trichothecium sp. (MSX 51320).

    PubMed

    Sy-Cordero, Arlene A; Graf, Tyler N; Adcock, Audrey F; Kroll, David J; Shen, Qi; Swanson, Steven M; Wani, Mansukh C; Pearce, Cedric J; Oberlies, Nicholas H

    2011-10-28

    Two new cyclodepsipeptides (1 and 2), two new sesquiterpenoids (3 and 4), and the known compounds guangomide A (5), roseotoxin S, and three simple trichothecenes were isolated from the cytotoxic organic extract of a terrestrial filamentous fungus, Trichothecium sp. The structures were determined using NMR spectroscopy and mass spectrometry. Absolute configurations of the cyclodepsipeptides were established by employing chiral HPLC, while the relative configurations of 3 and 4 were determined via NOESY data. The isolation of guangomide A was of particular interest, since it was reported previously from a marine-derived fungus.

  11. A virus in a fungus in a plant: Three-way symbiosis required for thermal tolerance

    USGS Publications Warehouse

    Marquez, L.M.; Redman, R.S.; Rodriguez, R.J.; Roossinck, M.J.

    2007-01-01

    A mutualistic association between a fungal endophyte and a tropical panic grass allows both organisms to grow at high soil temperatures. We characterized a virus from this fungus that is involved in the mutualistic interaction. Fungal isolates cured of the virus are unable to confer heat tolerance, but heat tolerance is restored after the virus is reintroduced. The virus-infected fungus confers heat tolerance not only to its native monocot host but also to a eudicot host, which suggests that the underlying mechanism involves pathways conserved between these two groups of plants.

  12. Effects Sprayed Solution of Salicylic Acid to Prevent of Wilt Disease Caused by Fussarium oxysporium

    NASA Astrophysics Data System (ADS)

    Yousif, Dina. Y. M.

    2018-05-01

    The current search aimed to detective the effect of sprayed solution of salicylic acid on plant and leaves of sweet green pepper (Capsicum annuum) for control the pathogen Fussarium oxysporium compering with control plant and leaves. Results indicated that, the spray of salicylic acid at concentration 0.5 g/L is effecting the fungal infection through prevent transport fungus F. oxysporum to the neighboring green pepper plant. The number of dead green pepper plant after sprayed with solution of salicylic acid and only water they were (4, 6, and 3) (8, 9, and 10) respectively. While the experimental infection of green pepper leaves after inoculated the fungus as local spot by scorching small spots of these leaves with the aid of hot nail. These spots were then exposed to the 0.5 g/L aqueous solution salicylic acid before and after the inoculation of the fungus. The spray of salicylic acid before 24 and 48 hour prevent the development of disease and make a good protection of the mention leaves from infection with this fungus, the diameter of leaves lesion (1,1.5 cm) respectively. while the ability of fungus to grow after 24 and 48 hour from salicylic acid treatment was markedly reduce as compared with control, such treatment show slow growth of pathogen infect.

  13. Changes in selected enzyme activities during growth of pure and mixed cultures of the white-rot decay fungus Trametes versicolor and the potential biocontrol fungus Trichoderma harzianum.

    PubMed

    Freitag, M; Morrell, J J

    1992-04-01

    Two filamentous fungi, the white-rot fungus Trametes versicolor and the soil fungus and potential biocontrol organism Trichoderma harzianum, have been grown in pure and mixed cultures on low-N (0.4 mM) and high-N (4 mM) defined synthetic media to determine the activities of selected wood-degrading enzymes such as cellobiase, cellulase, laccase, and peroxidases. Growth characteristics and enzyme activities were examined for potential correlations. Such correlations would allow the use of simple enzyme assays for measuring biomass development and would facilitate predictions about competitiveness of species in mixed fungal cultures. Our results show that while laccase and Poly Red-478 peroxidase activities indicate survival of the decay fungus, none of the monitored extracellular enzymes can serve as a quantitative indicator for biomass accumulation. As expected, the level of available nitrogen affected the production of the enzymes monitored: in low-N media, specific cellobiase, specific cellulase, and peroxidase activities were enhanced, while laccase activities were reduced. Most importantly, laccase activities of Trametes versicolor, and to a smaller extent, cellobiase activities of both fungi, were significantly induced in mixed cultures of Trametes versicolor and Trichoderma harzianum.

  14. An arbuscular mycorrhizal fungus and Epichloë festucae var. lolii reduce Bipolaris sorokiniana disease incidence and improve perennial ryegrass growth.

    PubMed

    Li, Fang; Guo, Yan'e; Christensen, Michael J; Gao, Ping; Li, Yanzhong; Duan, Tingyu

    2018-02-01

    Leaf spot of perennial ryegrass (Lolium perenne) caused by Bipolaris sorokiniana is an important disease in temperate regions of the world. We designed this experiment to test for the combined effects of the arbuscular mycorrhizal (AM) fungus Claroideoglomus etunicatum and the grass endophyte fungus Epichloë festucae var. lolii on growth and disease occurrence in perennial ryegrass. The results show that C. etunicatum increased plant P uptake and total dry weight and that this beneficial effect was slightly enhanced when in association with the grass endophyte. The presence in plants of both the endophyte and B. sorokiniana decreased AM fungal colonization. Plants inoculated with B. sorokiniana showed the typical leaf spot symptoms 2 weeks after inoculation and the lowest disease incidence was with plants that were host to both C. etunicatum and E. festucae var. lolii. Plants with these two fungi had much higher activity of peroxidases (POD), superoxide dismutase (SOD) and catalase (CAT) and lower values of malondialdehyde (MDA) and hydrogen peroxide (H 2 O 2 ). The AM fungus C. etunicatum and the grass endophyte fungus E. festucae var. lolii have the potential to promote perennial ryegrass growth and resistance to B. sorokiniana leaf spot.

  15. Cuticle hydrolysis in four medically important fly species by enzymes of the entomopathogenic fungus Conidiobolus coronatus.

    PubMed

    Boguś, M I; Włóka, E; Wrońska, A; Kaczmarek, A; Kazek, M; Zalewska, K; Ligęza-Żuber, M; Gołębiowski, M

    2017-03-01

    Entomopathogenic fungi infect insects via penetration through the cuticle, which varies remarkably in chemical composition across species and life stages. Fungal infection involves the production of enzymes that hydrolyse cuticular proteins, chitin and lipids. Host specificity is associated with fungus-cuticle interactions related to substrate utilization and resistance to host-specific inhibitors. The soil fungus Conidiobolus coronatus (Constantin) (Entomophthorales: Ancylistaceae) shows virulence against susceptible species. The larvae and pupae of Calliphora vicina (Robineau-Desvoidy) (Diptera: Calliphoridae), Calliphora vomitoria (Linnaeus), Lucilia sericata (Meigen) (Diptera: Calliphoridae) and Musca domestica (Linnaeus) (Diptera: Muscidae) are resistant, but adults exposed to C. coronatus quickly perish. Fungus was cultivated for 3 weeks in a minimal medium. Cell-free filtrate, for which activity of elastase, N-acetylglucosaminidase, chitobiosidase and lipase was determined, was used for in vitro hydrolysis of the cuticle from larvae, puparia and adults. Amounts of amino acids, N-glucosamine and fatty acids released were measured after 8 h of incubation. The effectiveness of fungal enzymes was correlated with concentrations of compounds detected in the cuticles of tested insects. Positive correlations suggest compounds used by the fungus as nutrients, whereas negative correlations may indicate compounds responsible for insect resistance. Adult deaths result from the ingestion of conidia or fungal excretions. © 2016 The Royal Entomological Society.

  16. Acromyrmex Leaf-Cutting Ants Have Simple Gut Microbiota with Nitrogen-Fixing Potential

    PubMed Central

    Zhukova, Mariya; Hansen, Lars H.; Sørensen, Søren J.; Schiøtt, Morten

    2015-01-01

    Ants and termites have independently evolved obligate fungus-farming mutualisms, but their gardening procedures are fundamentally different, as the termites predigest their plant substrate whereas the ants deposit it directly on the fungus garden. Fungus-growing termites retained diverse gut microbiota, but bacterial gut communities in fungus-growing leaf-cutting ants have not been investigated, so it is unknown whether and how they are specialized on an exclusively fungal diet. Here we characterized the gut bacterial community of Panamanian Acromyrmex species, which are dominated by only four bacterial taxa: Wolbachia, Rhizobiales, and two Entomoplasmatales taxa. We show that the Entomoplasmatales can be both intracellular and extracellular across different gut tissues, Wolbachia is mainly but not exclusively intracellular, and the Rhizobiales species is strictly extracellular and confined to the gut lumen, where it forms biofilms along the hindgut cuticle supported by an adhesive matrix of polysaccharides. Tetracycline diets eliminated the Entomoplasmatales symbionts but hardly affected Wolbachia and only moderately reduced the Rhizobiales, suggesting that the latter are protected by the biofilm matrix. We show that the Rhizobiales symbiont produces bacterial NifH proteins that have been associated with the fixation of nitrogen, suggesting that these compartmentalized hindgut symbionts alleviate nutritional constraints emanating from an exclusive fungus garden diet reared on a substrate of leaves. PMID:26048932

  17. Dissection of niche competition between introduced and indigenous arbuscular mycorrhizal fungi with respect to soybean yield responses.

    PubMed

    Niwa, Rieko; Koyama, Takuya; Sato, Takumi; Adachi, Katsuki; Tawaraya, Keitaro; Sato, Shusei; Hirakawa, Hideki; Yoshida, Shigenobu; Ezawa, Tatsuhiro

    2018-05-09

    Arbuscular mycorrhizal (AM) fungi associate with most land plants and deliver phosphorus to the host. Identification of biotic/abiotic factors that determine crop responses to AM fungal inoculation is an essential step for successful application of the fungi in sustainable agriculture. We conducted three field trials on soybean with a commercial inoculum and developed a new molecular tool to dissect interactions between the inoculum and indigenous fungi on the MiSeq sequencing platform. Regression analysis indicated that sequence read abundance of the inoculum fungus was the most significant factor that determined soybean yield responses to the inoculation, suggesting that dominance of the inoculum fungus is a necessary condition for positive yield responses. Agricultural practices (fallow/cropping in the previous year) greatly affected the colonization levels (i.e. read abundances) of the inoculum fungus via altering the propagule density of indigenous AM fungi. Analysis of niche competition revealed that the inoculum fungus competed mainly with the indigenous fungi that are commonly distributed in the trial sites, probably because their life-history strategy is the same as that of the inoculum fungus. In conclusion, we provide a new framework for evaluating the significance of environmental factors towards successful application of AM fungi in agriculture.

  18. Characteristics of uranium biosorption from aqueous solutions on fungus Pleurotus ostreatus.

    PubMed

    Zhao, Changsong; Liu, Jun; Tu, Hong; Li, Feize; Li, Xiyang; Yang, Jijun; Liao, Jiali; Yang, Yuanyou; Liu, Ning; Sun, Qun

    2016-12-01

    Uranium(VI) biosorption from aqueous solutions was investigated in batch studies by using fungus Pleurotus ostreatus biomass. The optimal biosorption conditions were examined by investigating the reaction time, biomass dosage, pH, temperature, and uranium initial concentration. The interaction between fungus biomass and uranium was confirmed using Fourier transformed infrared (FT-IR), scanning electronic microscopy energy dispersive X-ray (SEM-EDX), and X-ray photoelectron spectroscopy (XPS) analysis. Results exhibited that the maximum biosorption capacity of uranium on P. ostreatus was 19.95 ± 1.17 mg/g at pH 4.0. Carboxylic, amine, as well as hydroxyl groups were involved in uranium biosorption according to FT-IR analysis. The pseudo-second-order model properly evaluated the U(VI) biosorption on fungus P. ostreatus biomass. The Langmuir equation provided better fitting in comparison with Freundlich isotherm models. The obtained thermodynamic parameters suggested that biosorption is feasible, endothermic, and spontaneous. SEM-EDX and XPS were additionally conducted to comprehend the biosorption process that could be described as a complex process involving several mechanisms of physical adsorption, chemisorptions, and ion exchange. Results obtained from this work indicated that fungus P. ostreatus biomass can be used as potential biosorbent to eliminate uranium or other radionuclides from aqueous solutions.

  19. Influence of Cadmium and Mercury on Activities of Ligninolytic Enzymes and Degradation of Polycyclic Aromatic Hydrocarbons by Pleurotus ostreatus in Soil

    PubMed Central

    Baldrian, Petr; in der Wiesche, Carsten; Gabriel, Jiří; Nerud, František; Zadražil, František

    2000-01-01

    The white-rot fungus Pleurotus ostreatus was able to degrade the polycyclic aromatic hydrocarbons (PAHs) benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a]pyrene, dibenzo[a,h]anthracene, and benzo[ghi]perylene in nonsterile soil both in the presence and in the absence of cadmium and mercury. During 15 weeks of incubation, recovery of individual compounds was 16 to 69% in soil without additional metal. While soil microflora contributed mostly to degradation of pyrene (82%) and benzo[a]anthracene (41%), the fungus enhanced the disappearance of less-soluble polycyclic aromatic compounds containing five or six aromatic rings. Although the heavy metals in the soil affected the activity of ligninolytic enzymes produced by the fungus (laccase and Mn-dependent peroxidase), no decrease in PAH degradation was found in soil containing Cd or Hg at 10 to 100 ppm. In the presence of cadmium at 500 ppm in soil, degradation of PAHs by soil microflora was not affected whereas the contribution of fungus was negligible, probably due to the absence of Mn-dependent peroxidase activity. In the presence of Hg at 50 to 100 ppm or Cd at 100 to 500 ppm, the extent of soil colonization by the fungus was limited. PMID:10831426

  20. Termites promote resistance of decomposition to spatiotemporal variability in rainfall.

    PubMed

    Veldhuis, Michiel P; Laso, Francisco J; Olff, Han; Berg, Matty P

    2017-02-01

    The ecological impact of rapid environmental change will depend on the resistance of key ecosystems processes, which may be promoted by species that exert strong control over local environmental conditions. Recent theoretical work suggests that macrodetritivores increase the resistance of African savanna ecosystems to changing climatic conditions, but experimental evidence is lacking. We examined the effect of large fungus-growing termites and other non-fungus-growing macrodetritivores on decomposition rates empirically with strong spatiotemporal variability in rainfall and temperature. Non-fungus-growing larger macrodetritivores (earthworms, woodlice, millipedes) promoted decomposition rates relative to microbes and small soil fauna (+34%) but both groups reduced their activities with decreasing rainfall. However, fungus-growing termites increased decomposition rates strongest (+123%) under the most water-limited conditions, making overall decomposition rates mostly independent from rainfall. We conclude that fungus-growing termites are of special importance in decoupling decomposition rates from spatiotemporal variability in rainfall due to the buffered environment they create within their extended phenotype (mounds), that allows decomposition to continue when abiotic conditions outside are less favorable. This points at a wider class of possibly important ecological processes, where soil-plant-animal interactions decouple ecosystem processes from large-scale climatic gradients. This may strongly alter predictions from current climate change models. © 2016 by the Ecological Society of America.

  1. Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus

    PubMed Central

    Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk

    2016-01-01

    Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously. PMID:27103854

  2. The development of a spatially-explicit, individual-based, disease model for frogs and the chytrid fungus

    EPA Science Inventory

    Background / Question / Methods The fungal pathogen, Batrachochytrium dendrobatidis (BD), has been associated with amphibian population declines and even extinctions worldwide. Transmission of the fungus between amphibian hosts occurs via motile zoospores, which are produced on...

  3. BIODEGRADATION OF CRYSTAL VIOLET BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM

    EPA Science Inventory

    Biodegradation of crystal violet (N,N,N',N',N",N"-hexamethylpararosaniline) in ligninolytic (nitrogen-limited) cultures of the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance of crystal violet and by the identification of three metabolites (N,N,...

  4. 7 CFR 810.302 - Definitions of other terms.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...

  5. 7 CFR 810.302 - Definitions of other terms.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... computation of total dockage. (e) Ergot. Sclerotia (sclerotium, sing.) of the fungus, Claviceps species, which.... (h) Sclerotia (Sclerotium, sing.). Dark colored or black resting bodies of the fungi Sclerotinia and Claviceps. (i) Sclerotinia. Genus name which includes the fungus Sclerotinia sclerotiorum which produces...

  6. Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents

    USDA-ARS?s Scientific Manuscript database

    The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...

  7. The widely used ATB FUNGUS 3 automated readings in China and its misleading high MICs of Candida spp. to azoles: challenges for developing countries' clinical microbiology labs.

    PubMed

    Zhang, Li; Wang, He; Xiao, Meng; Kudinha, Timothy; Mao, Lei-Li; Zhao, Hao-Ran; Kong, Fanrong; Xu, Ying-Chun

    2014-01-01

    The rapid development in the clinical microbiology diagnostic assays presents more challenges for developing countries than for the developed world, especially in the area of test validation before the introduction of new tests. Here we report on the misleading high MICs of Candida spp. to azoles using the ATB FUNGUS 3 (bioMérieux, La Balme-les Grottes, France) with automated readings in China to highlight the dangers of introducing a diagnostic assay without validation. ATB FUNGUS 3 is the most commonly used commercial antifungal susceptibility testing method in China. An in-depth analysis of data showed higher levels of resistance to azoles when ATB FUNGUS 3 strips were read automatically than when read visually. Based on this finding, the performance of ATB FUNGUS 3, read both visually and automatically, was evaluated by testing 218 isolates of five clinically important Candida species, using broth microdilution (BMD) following CLSI M27-A3 as the gold-standard. The overall essential agreement (EA) between ATB visual readings and BMD was 99.1%. In contrast, the ATB automated readings showed higher discrepancies with BMD, with overall EA of 86.2%, and specifically lower EA was observed for fluconazole (80.7%), voriconazole (77.5%), and itraconazole (73.4%), which was most likely due to the trailing effect of azoles. The major errors in azole drug susceptibilities by ATB automated readings is a concern in China that can result in misleading clinical antifungal drug selection and pseudo high rates of antifungal resistance. Therefore, the ATB visual reading is generally recommended. In the meantime, we propose a practical algorithm to be followed for ATB FUNGUS 3 antifungal susceptibility for Candida spp. before the improvement in the automated reading system.

  8. Magnaporthe oryzae Glycine-Rich Secretion Protein, Rbf1 Critically Participates in Pathogenicity through the Focal Formation of the Biotrophic Interfacial Complex

    PubMed Central

    Ishii-Minami, Naoko; Kawahara, Yoshihiro; Yoshida, Yuri; Okada, Kazunori; Ando, Sugihiro; Matsumura, Hideo; Terauchi, Ryohei; Minami, Eiichi; Nishizawa, Yoko

    2016-01-01

    Magnaporthe oryzae, the fungus causing rice blast disease, should contend with host innate immunity to develop invasive hyphae (IH) within living host cells. However, molecular strategies to establish the biotrophic interactions are largely unknown. Here, we report the biological function of a M. oryzae-specific gene, R equired-for-Focal- B IC- F ormation 1 (RBF1). RBF1 expression was induced in appressoria and IH only when the fungus was inoculated to living plant tissues. Long-term successive imaging of live cell fluorescence revealed that the expression of RBF1 was upregulated each time the fungus crossed a host cell wall. Like other symplastic effector proteins of the rice blast fungus, Rbf1 accumulated in the biotrophic interfacial complex (BIC) and was translocated into the rice cytoplasm. RBF1-knockout mutants (Δrbf1) were severely deficient in their virulence to rice leaves, but were capable of proliferating in abscisic acid-treated or salicylic acid-deficient rice plants. In rice leaves, Δrbf1 inoculation caused necrosis and induced defense-related gene expression, which led to a higher level of diterpenoid phytoalexin accumulation than the wild-type fungus did. Δrbf1 showed unusual differentiation of IH and dispersal of the normally BIC-focused effectors around the short primary hypha and the first bulbous cell. In the Δrbf1-invaded cells, symplastic effectors were still translocated into rice cells but with a lower efficiency. These data indicate that RBF1 is a virulence gene essential for the focal BIC formation, which is critical for the rice blast fungus to suppress host immune responses. PMID:27711180

  9. Colony Size Affects the Efficacy of Bait Containing Chlorfluazuron Against the Fungus-Growing Termite Macrotermes gilvus (Blattodea: Termitidae).

    PubMed

    Lee, Ching-Chen; Neoh, Kok-Boon; Lee, Chow-Yang

    2014-12-01

    The efficacy of chitin synthesis inhibitors (CSIs) against fungus-growing termites is known to vary. In this study, 0.1% chlorfluazuron (CFZ) cellulose bait was tested against medium and large field colonies of Macrotermes gilvus (Hagen). The termite mounds were dissected to determine the health of the colony. Individual termites (i.e., workers and larvae) and fungus combs were subjected to gas chromatography-mass spectrometry (GC-MS) analysis to detect the presence of CFZ. In this study, 540.0 ± 25.8 g (or equivalent to 540.0 ± 25.8 mg active ingredient) and 680.0 ± 49.0 g (680.0 ± 49.0 mg active ingredient) of bait matrix were removed by the medium- and large-sized colonies, respectively, after baiting. All treated medium-sized colonies were moribund. The dead termites were scattered in the mound, larvae were absent, population size had decreased by 90%, and the queens appeared unhealthy. In contrast, no or limited effects were found in large-sized colonies. Only trace amounts of CFZ were detected in workers, larvae, and fungus combs, and the population of large-sized colonies had declined by only up to 40%. This might be owing to the presence of large amount of basidiomycete fungus and a drastic decrease of CFZ content per unit fungus comb (a main food source of larvae) in the large-sized colonies, and hence reduced the toxic effect and longer time is required to accumulate the lethal dose in larvae. Nevertheless, we do not deny the possibility of CSI bait eliminating or suppressing the higher termite if the test colonies could pick up adequate lethal dose by installing more bait stations and prolonging the baiting period. © 2014 Entomological Society of America.

  10. Utilizing fungus myceliated grain for molt induction and performance in commercial laying hens.

    PubMed

    Willis, W L; Isikhuemhen, O S; Allen, J W; Byers, A; King, K; Thomas, C

    2009-10-01

    Molting in poultry is used to rejuvenate hens for a second or third laying cycle. Feed withdrawal was once the most effective method used for molt induction; however, it has being phased out due to food safety and animal welfare concerns. This study evaluated the utilization of fungus myceliated grain as a safe and effective alternative for inducing molt, enhancing immunity, reducing Salmonella growth, and returning to egg production. Laying hens were subjected to 1 of 5 treatments: 1) nonfed (NF), 2) full-fed (FF), 3) fungus myceliated meal (FM), 4) 90% fungus myceliated meal+10% standard layer ration (FM-90), and 5) 90% alfalfa meal+10% fungus myceliated meal (AF-90). Each treatment condition was replicated 9 times during a 9-d molt period. The results revealed that egg production for treatments 1 and 3 ceased completely by d 5, whereas hens in treatments 4 and 5 ceased egg production by d 6. The percentage of BW loss decreased significantly (P<0.05) in treatments 1 (57%), 2 (8%), 3 (35%), 4 (37%), and 5 (44%). Ovary weights of hens fed all molting diets decreased significantly from the full-fed control but did not differ significantly (P<0.05) from each other. Salmonella population in the crop, ovary, and ceca from hens differed significantly (P<0.05) among treatments. Return to egg production differed between treatments with higher production beginning in treatment 3 and ending in treatment 5. Antibody titers did differ (P<0.05) among treatments. From these results, fungus myceliated meal appears to be a viable alternative to conventional feed withdrawal and other methods for the successful induction of molt and retention of postmolt performance.

  11. Identifying the core microbial community in the gut of fungus-growing termites.

    PubMed

    Otani, Saria; Mikaelyan, Aram; Nobre, Tânia; Hansen, Lars H; Koné, N'Golo A; Sørensen, Søren J; Aanen, Duur K; Boomsma, Jacobus J; Brune, Andreas; Poulsen, Michael

    2014-09-01

    Gut microbes play a crucial role in decomposing lignocellulose to fuel termite societies, with protists in the lower termites and prokaryotes in the higher termites providing these services. However, a single basal subfamily of the higher termites, the Macrotermitinae, also domesticated a plant biomass-degrading fungus (Termitomyces), and how this symbiont acquisition has affected the fungus-growing termite gut microbiota has remained unclear. The objective of our study was to compare the intestinal bacterial communities of five genera (nine species) of fungus-growing termites to establish whether or not an ancestral core microbiota has been maintained and characterizes extant lineages. Using 454-pyrosequencing of the 16S rRNA gene, we show that gut communities have representatives of 26 bacterial phyla and are dominated by Firmicutes, Bacteroidetes, Spirochaetes, Proteobacteria and Synergistetes. A set of 42 genus-level taxa was present in all termite species and accounted for 56-68% of the species-specific reads. Gut communities of termites from the same genus were more similar than distantly related species, suggesting that phylogenetic ancestry matters, possibly in connection with specific termite genus-level ecological niches. Finally, we show that gut communities of fungus-growing termites are similar to cockroaches, both at the bacterial phylum level and in a comparison of the core Macrotermitinae taxa abundances with representative cockroach, lower termite and higher nonfungus-growing termites. These results suggest that the obligate association with Termitomyces has forced the bacterial gut communities of the fungus-growing termites towards a relatively uniform composition with higher similarity to their omnivorous relatives than to more closely related termites. © 2014 John Wiley & Sons Ltd.

  12. Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump.

    PubMed

    Arenas, Andrés; Roces, Flavio

    2017-01-01

    Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden.

  13. Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump

    PubMed Central

    Roces, Flavio

    2017-01-01

    Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden. PMID:28273083

  14. Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

    PubMed

    Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

    2003-08-01

    Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

  15. Relating coccidioidomycosis (Valley Fever) incidence via to soil moisture conditions

    USDA-ARS?s Scientific Manuscript database

    Coccidioidomycosis (also called Valley fever) is caused by a soil-borne fungus, Coccidioides spp., in arid regions of the southwestern United States. Though some who develop infections from this fungus remain asymptomatic, others develop respiratory disease as a consequence. Less commonly, severe ...

  16. Development of 11 polymorphic microsatellite markers for the blackberry rust fungus Phragmidium violaceum

    USDA-ARS?s Scientific Manuscript database

    Eleven polymorphic microsatellite markers were developed for the Uredinales fungus Phragmidium violaceum, which causes leaf rust on European blackberry (Rubus fruticosus L. aggregate). Allele frequency ranged between two and seventeen alleles per locus with no evidence of linkage disequilibrium amon...

  17. Brown spot needle disease--biology and control in Scotch pine plantations.

    Treesearch

    Darroll D. Skilling; Thomas H. Nicholls

    1975-01-01

    An application section briefly describes and illustrates the symptoms, hosts, life history of the brown spot needlecast fungus (Scirrhia acicola), and recommends chemical and cultural control methods. A documentation section details the research on the biology and control of the fungus.

  18. Inferring outcrossing in the homothallic fungus Sclerotinia sclerotiorum using linkage disequilibrium decay

    USDA-ARS?s Scientific Manuscript database

    The occurrence and frequency of outcrossing in homothallic fungal species in nature is an unresolved question. Here we report detection of frequent outcrossing in the homothallic fungus Sclerotinia sclerotiorum. In using multilocus linkage disequilibrium (LD) to infer recombination among microsatell...

  19. Entomology: A Bee Farming a Fungus.

    PubMed

    Oldroyd, Benjamin P; Aanen, Duur K

    2015-11-16

    Farming is done not only by humans, but also by some ant, beetle and termite species. With the discovery of a stingless bee farming a fungus that provides benefits to its larvae, bees can be added to this list. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Commandra Blister Rust

    Treesearch

    David W. Johnson

    1986-01-01

    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  1. Analysis of Volatile Organic Compounds Emitted by Plant Growth-Promoting Fungus Phoma sp. GS8-3 for Growth Promotion Effects on Tobacco

    PubMed Central

    Naznin, Hushna Ara; Kimura, Minako; Miyazawa, Mitsuo; Hyakumachi, Mitsuro

    2013-01-01

    We extracted volatile organic compounds (VOCs) emitted by a plant growth-promoting fungus (PGPF) Phoma sp. GS8-3 by gas chromatography and identified them by mass spectrometry. All of the identified compounds belonged to C4-C8 hydrocarbons. Volatiles varied in number and quantity by the culture period of the fungus (in days). 2-Methyl-propanol and 3-methyl-butanol formed the main components of the volatile blends for all the culture periods of fungus. Growth-promoting effects of the identified synthetic compounds were analyzed individually and in blends using tobacco plants. We found that the mixture of volatiles extracted from 3-day-old culture showed significant growth promotion in tobacco in vitro. The volatile blend showed better growth promotion at lower than higher concentrations. Our results confirm the potential role of volatile organic compounds in the mechanism of growth enhancement by GS8-3. PMID:23080408

  2. Continuous xylanase production with Aspergillus nidulans under pyridoxine limitation using a trickle bed reactor.

    PubMed

    Müller, Michael; Prade, Rolf A; Segato, Fernando; Atiyeh, Hasan K; Wilkins, Mark R

    2015-01-01

    A trickle bed reactor (TBR) with recycle was designed and tested using Aspergillus nidulans with a pyridoxine marker and over-expressing/secreting recombinant client xylanase B (XynB). The pyridoxine marker prevented the fungus from synthesizing its own pyridoxine and fungus was unable to grow when no pyridoxine was present in the medium; however, enzyme production was unaffected. Uncontrolled mycelia growth that led to clogging of the TBR was observed when fungus without a pyridoxine marker was used for XynB production. Using the fungus with pyridoxine marker, the TBR was operated continuously for 18 days and achieved a XynB output of 41 U/ml with an influent and effluent flow rate of 0.5 ml/min and a recycle flow rate of 56 ml/min. Production yields in the TBR were 1.4 times greater than a static tray culture and between 1.1 and 67 times greater than yields for SSF enzyme production stated in the literature. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. The toxicosis of Embellisia fungi from locoweed (Oxytropis lambertii) is similar to locoweed toxicosis in rats.

    PubMed

    McLain-Romero, J; Creamer, R; Zepeda, H; Strickland, J; Bell, G

    2004-07-01

    Locoweeds cause significant livestock poisoning and economic loss in the western United States. The toxicity of Embellisia sp. fungi isolated from locoweed was compared with locoweed toxicity using the rat as a model. Rats were fed diets containing locoweed, fungus and alfalfa, or alfalfa. Locoweed- and fungus-fed rats consumed swainsonine-containing food at approximately 1.3 mg x kg(-1) x d(-1), gained less weight (P = 0.001) and ate less than controls. Swainsonine is the principal agent responsible for inducing locoism in animals. The concentrations of alkaline phosphatase and aspartate aminotransferase enzymes were greater (P < 0.05) in serum of locoweed- and fungus-fed rats compared with control rats. Similar intracellular vacuolation was observed in renal, pancreatic, and hepatic tissues of rats that consumed either locoweed or fungus. Rats that ate locoweed or Embellisia fungi displayed indistinguishable toxicity symptoms. The Embellisia fungi from locoweed can induce toxicity without the plants. Locoism management strategies need to involve management of the Embellisia fungi.

  4. Lignocellulose degradation patterns, structural changes, and enzyme secretion by Inonotus obliquus on straw biomass under submerged fermentation.

    PubMed

    Xu, Xiangqun; Xu, Zhiqi; Shi, Song; Lin, Mengmeng

    2017-10-01

    This study examined the white rot fungus I. obliquus on the degradation of three types of straw biomass and the production of extracellular lignocellulolytic enzymes under submerged fermentation. The fungus process resulted in a highest lignin loss of 72%, 39%, and 47% in wheat straw, rice straw, and corn stover within 12days, respectively. In merely two days, the fungus selectively degraded wheat straw lignin by 37%, with only limited cellulose degradation (13%). Fourier transform infrared spectroscopy revealed that the fungus most effectively degraded the wheat straw lignin and rice straw crystalline cellulose. Scanning electronic microscopy showed the most pronounced structural changes in wheat straw. High activities of manganese peroxidase (159.0U/mL) and lignin peroxidase (123.4U/mL) were observed in wheat straw culture on Day 2 and 4, respectively. Rice straw was the best substrate to induce the production of cellulase and xylanase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Lignocellulose pretreatment in a fungus-cultivating termite

    DOE PAGES

    Li, Hongjie; Yelle, Daniel J.; Li, Chang; ...

    2017-04-19

    Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less

  6. Mathematical modeling on obligate mutualism: Interactions between leaf-cutter ants and their fungus garden.

    PubMed

    Kang, Yun; Clark, Rebecca; Makiyama, Michael; Fewell, Jennifer

    2011-11-21

    We propose a simple mathematical model by applying Michaelis-Menton equations of enzyme kinetics to study the mutualistic interaction between the leaf cutter ant and its fungus garden at the early stage of colony expansion. We derive sufficient conditions on the extinction and coexistence of these two species. In addition, we give a region of initial condition that leads to the extinction of two species when the model has an interior attractor. Our global analysis indicates that the division of labor by worker ants and initial conditions are two important factors that determine whether leaf cutter ants' colonies and their fungus garden can survive and grow or not. We validate the model by comparing model simulations and data on fungal and ant colony growth rates under laboratory conditions. We perform sensitive analysis of the model based on the experimental data to gain more biological insights on ecological interactions between leaf-cutter ants and their fungus garden. Finally, we give conclusions and discuss potential future work. Published by Elsevier Ltd.

  7. Biotransformation of ginsenoside Rb1 to ginsenoside C-K by endophytic fungus Arthrinium sp. GE 17-18 isolated from Panax ginseng.

    PubMed

    Fu, Y; Yin, Z-H; Wu, L-P; Yin, C-R

    2016-09-01

    This research aimed to isolate β-glycosidase-producing endophytic fungus in Panax ginseng to achieve biotransformation of ginsenoside Rb1 to ginsenoside C-K. Of these 15 β-glucosidase-producing endophytic fungus isolated from ginseng roots, a β-glucosidase-producing endophytic fungi GE 17-18 could hydrolyse major ginsenosides Rb1 to minor ginsenoside C-K with metabolic pathways: ginsenoside Rb1→ginsenoside Rd→ginsenoside F2→ginsenoside C-K. Phylogenetic analysis of ITS gene sequences indicated that the strain GE 17-18 belongs to the genus Arthrinium and is most closely related to Arthrinium sp. HQ832803.1. This is the first study to provide information of cultivable β-glycosidase-producing Endophytic fungus in Panax ginseng. The strain GE 17-18 has potential to be applied on the preparation for minor ginsenoside C-K in pharmaceutical industry. © 2016 The Society for Applied Microbiology.

  8. Lignocellulose pretreatment in a fungus-cultivating termite

    PubMed Central

    Li, Hongjie; Yelle, Daniel J.; Li, Chang; Yang, Mengyi; Ke, Jing; Zhang, Ruijuan; Liu, Yu; Zhu, Na; Liang, Shiyou; Mo, Xiaochang; Currie, Cameron R.; Mo, Jianchu

    2017-01-01

    Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid of various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation. PMID:28424249

  9. Lignocellulose pretreatment in a fungus-cultivating termite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Hongjie; Yelle, Daniel J.; Li, Chang

    Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating termite system, we reveal unprecedentedly rapid lignin depolymerization and degradation by combining laboratory feeding experiments, lignocellulosic compositional measurements, electron microscopy, 2D-NMR, and thermochemolysis. In a gut transit time of under 3.5 h, in young worker termites, poplar lignin sidechains are extensively cleaved and the polymer is significantly depleted, leaving a residue almost completely devoid ofmore » various condensed units that are traditionally recognized to be the most recalcitrant. Subsequently, the fungus-comb microbiome preferentially uses xylose and cleaves polysaccharides, thus facilitating final utilization of easily digestible oligosaccharides by old worker termites. This complementary symbiotic pretreatment process in the fungus-growing termite symbiosis reveals a previously unappreciated natural system for efficient lignocellulose degradation.« less

  10. Fate of Residual Lignin during Delignification of Kraft Pulp by Trametes versicolor

    PubMed Central

    Reid, Ian D.

    1998-01-01

    The fungus Trametes versicolor can delignify and brighten kraft pulps. To better understand the mechanism of this biological bleaching and the by-products formed, I traced the transformation of pulp lignin during treatment with the fungus. Hardwood and softwood kraft pulps containing 14C-labelled residual lignin were prepared by laboratory pulping of lignin-labelled aspen and spruce wood and then incubated with T. versicolor. After initially polymerizing the lignin, the fungus depolymerized it to alkali-extractable forms and then to soluble forms. Most of the labelled carbon accumulated in the water-soluble pool. The extractable and soluble products were oligomeric; single-ring aromatic products were not detected. The mineralization of the lignin carbon to CO2 varied between experiments, up to 22% in the most vigorous cultures. The activities of the known enzymes laccase and manganese peroxidase did not account for all of the lignin degradation that took place in the T. versicolor cultures. This fungus may produce additional enzymes that could be useful in enzyme bleaching systems. PMID:9603823

  11. Epiphytic lichen mycota of the virgin forest reserve Rajhenavski Rog (Slovenia)

    PubMed Central

    Bilovitz, Peter O.; Batič, Franc; Mayrhofer, Helmut

    2012-01-01

    A list of 128 taxa (127 species) of lichens, 6 species of lichenicolous fungi and 2 non-lichenized fungi traditionally included in lichenological literature from the virgin forest Rajhenavski Rog and its surroundings in the southeastern part of Slovenia is presented. The lichen Gyalecta derivata, the lichenicolous fungus Homostegia piggotii, and the non-lichenized fungus Mycomicrothelia pachnea are new to Slovenia. The lichenized fungi Chaenotheca trichialis, C. xyloxena, Lecanactis abietina, Lecanora thysanophora, Pertusaria ophthalmiza, the lichenicolous fungi Monodictys epilepraria, Tremella hypogymniae, Taeniolella friesii, and the non-lichenized fungus Chaenothecopsis pusilla are new to the Dinaric phytogeographical region of Slovenia. PMID:22942459

  12. Intersporal Genetic Variation of Gigaspora margarita, a Vesicular Arbuscular Mycorrhizal Fungus, Revealed by M13 Minisatellite-Primed PCR.

    PubMed

    Zeze, A; Sulistyowati, E; Ophel-Keller, K; Barker, S; Smith, S

    1997-02-01

    Spores of vesicular arbuscular mycorrhizal (VAM) fungi contain thousands of nuclei. In order to understand the karyotic structure of a VAM fungus spore, the genetic variation of the first generation of spores from a VAM fungus (Gigaspora margarita) was examined. Spores originating from both single- and multispore inoculations of the species G. margarita were analyzed by M13 minisatellite-primed PCR. In both cases, different fingerprints were obtained from individual spores with few spores exhibiting similar fingerprints. These results can be explained only by a heterokaryotic status of the nuclear population within a spore.

  13. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    NASA Astrophysics Data System (ADS)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  14. Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

    PubMed

    Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

    2008-06-01

    The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

  15. Pestalotiopamide E, a new amide from the endophytic fungus Pestalotiopsis sp.

    PubMed

    Xu, Jing; Lin, Qiang; Wang, Bin; Wray, Victor; Lin, Wen-Han; Proksch, Peter

    2011-04-01

    Chemical examination of the endophytic fungus Pestalotiopsis sp., isolated from the leaves of the Chinese mangrove Rhizophora mucronata, yielded a new amide called pestalotiopamide E (1). The structure of the new compound was unambiguously elucidated on the basis of extensive spectroscopic data analysis.

  16. Development of a greenhouse-based inoculation protocol for the fungus Colletotrichum cereale pathogenic to annual bluegrass (Poa annua)

    USDA-ARS?s Scientific Manuscript database

    The fungus Colletotrichum cereale incites anthracnose disease on Poa annua (annual bluegrass) turfgrass. Anthracnose disease is geographically widespread highly destructive, with infections by C. cereale resulting in extensive turfgrass loss. Comprehensive research aimed at controlling turfgrass a...

  17. An in vivo transcriptome for entomopathogenic fungus Metarhizium robertsii ARSEF 2575

    USDA-ARS?s Scientific Manuscript database

    Molecular mechanisms underlying the pathogenic process of the insect pathogen Metarhizium robertsii ARSEF 2575 in its host are only partially understood. To probe the transcriptional responses of the fungus during the interaction with insects, we have developed a method to specifically recover patho...

  18. Strategies for durable resistance to the grapevine powdery mildew fungus, Erysiphe necator

    USDA-ARS?s Scientific Manuscript database

    Nearly all cultivars of Vitis vinifera are highly susceptible to the grapevine powdery mildew fungus, Erysiphe necator. Grape breeders around the world are working to introgress resistance from wild Vitis. Of the widely-used introgressions, most involve dominant, race-specific resistance phenotype...

  19. Protection against common bean rust conferred by a gene silencing method

    USDA-ARS?s Scientific Manuscript database

    Rust disease of the dry bean plant, Phaseolus vulgaris, is caused by the fungus Uromyces appendiculatus. The fungus acquires its nutrients and energy from bean leaves using a specialized cell structure, the haustorium, through which it secretes effector proteins that contribute to pathogenicity by ...

  20. Draft genome sequence of a monokaryotic model brown-rot fungus Postia (Rhodonia) placenta SB12

    Treesearch

    Jill Gaskell; Phil Kersten; Luis F. Larrondo; Paulo Canessa; Diego Martinez; David Hibbett; Monika Schmoll; Christian P. Kubicek; Angel T. Martinez; Jagjit Yadav; Emma Master; Jon Karl Magnuson; Debbie Yaver; Randy Berka; Kathleen Lail; Cindy Chen; Kurt LaButti; Matt Nolan; Anna Lipzen; Andrea Aerts; Robert Riley; Kerrie Barry; Bernard Henrissat; Robert Blanchette; Igor V. Grigoriev; Dan Cullen

    2017-01-01

    We report the genome of Postia (Rhodonia) placenta MAD-SB12, a homokaryotic wood decay fungus (Basidiomycota, Polyporales). Intensively studied as a representative brown rot decayer, the gene complement is consistent with the rapid depolymerization of cellulose but not lignin.

  1. Biological pretreatment of corn stover with white-rot fungus for improved enzymatic hydrolysis

    USDA-ARS?s Scientific Manuscript database

    Biological pretreatment of lignocellulosic biomass by white-rot fungus can represent a low-cost and eco-friendly alternative to harsh physical, chemical or physico-chemical pretreatment methods to facilitate enzymatic hydrolysis. However, fungal pretreatment can cause carbohydrate loss and it is, th...

  2. Sirococcus Shoot Blight

    Treesearch

    Thomas H. Nicholls; Kathryn Robbins

    1984-01-01

    Sirococcus shoot blight, caused by the fungus Sirococcus strobilinus Preuss, affects conifers in the Northern United States and southern Canada. The fungus infects the new shoots; diseased seedlings and saplings are especially affected. In the United States, sirococcus shoot blight has become increasingly widespread since the early 1970's. When favorable...

  3. Compatibility of the insect pathogenic fungus Beauveria bassiana with neem against sweetpotato whitefly, Bemisia tabaci, on eggplant

    USDA-ARS?s Scientific Manuscript database

    A study on the compatibility of the entomopathogenic fungus Beauveria bassiana (Balsamo) Vuillemin (Ascomycota: Hypocreales) with neem was conducted against sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), on eggplant. Initially, three concentrations of B. bassiana (106, 1...

  4. Suppression of aflatoxin production in Aspergillus species by selected peanut (Arachis hypogaea) stilbenoids

    USDA-ARS?s Scientific Manuscript database

    Aspergillus (A.) flavus is a soil fungus that commonly invades peanut seeds and often produces the carcinogenic aflatoxins. Under favorable conditions, the fungus-challenged peanut plant produces and accumulates resveratrol and its prenylated derivatives in response to such invasion. These prenylate...

  5. Advances in molecular and genomic research to safeguard food and feed supply from aflatoxin contamination

    USDA-ARS?s Scientific Manuscript database

    Worldwide recognition that aflatoxin contamination of agricultural commodities by the fungus Aspergillus flavus is a global problem which has significantly benefitted from global collaboration for understanding the contaminating fungus as well as for developing and implementing solutions against the...

  6. Wood decay fungus Flavodon ambrosius (Basidiomycota: Polyporales) is widely farmed by two genera of ambrosia beetles

    Treesearch

    You Li; Craig Christopher Bateman; James Skelton; Michelle Alice Jusino; Zachary John Nolen; David Rabern Simmons; Jiri Hulcr

    2017-01-01

    The ambrosia fungus Flavodon ambrosius is the primary nutritional mutualist of ambrosia beetles Ambrosiodmus and Ambrosiophilus in North America. F. ambrosius is the only known ambrosial basidiomycete, unique in its efficient lignocellulose degradation. F. ambrosius is associated with...

  7. Intercontinental divergence in the Populus-associated ectomycorrhizal fungus, Tricholoma populinum

    Treesearch

    L.C. Grubisha; N. Levsen; M.S. Olson; D.L. Taylor

    2012-01-01

    The ectomycorrhizal fungus Tricholoma populinum is host-specific with Populus species. T. populinum has wind-dispersed progagules and may be capable of long-distance dispersal. In this study, we tested the hypothesis of a panmictic population between Scandinavia and North America. DNA sequences from five...

  8. Neem oil increases the efficiency of the entomopathogenic fungus Metarhizium anisopliae for the control of Aedes aegypti (Diptera: Culicidae) larvae.

    PubMed

    Gomes, Simone A; Paula, Adriano R; Ribeiro, Anderson; Moraes, Catia O P; Santos, Jonathan W A B; Silva, Carlos P; Samuels, Richard I

    2015-12-30

    Entomopathogenic fungi are potential candidates for use in integrated vector management and many isolates are compatible with synthetic and natural insecticides. Neem oil was tested separately and in combination with the entomopathogenic fungus Metarhizium anisopliae against larvae of the dengue vector Aedes aegypti. Our aim was to increase the effectiveness of the fungus for the control of larval mosquito populations. Commercially available neem oil was used at concentrations ranging from 0.0001 to 1%. Larval survival rates were monitored over a 7 day period following exposure to neem. The virulence of the fungus M. anisopliae was confirmed using five conidial concentrations (1 × 10(5) to 1 × 10(9) conidia mL(-1)) and survival monitored over 7 days. Two concentrations of fungal conidia were then tested together with neem (0.001%). Survival curve comparisons were carried out using the Log-rank test and end-point survival rates were compared using one-way ANOVA. 1% neem was toxic to A. aegypti larvae reducing survival to 18% with S50 of 2 days. Neem had no effect on conidial germination or fungal vegetative growth in vitro. Larval survival rates were reduced to 24% (S50 = 3 days) when using 1 × 10(9) conidia mL(-1). Using 1 × 10(8) conidia mL(-1), 30% survival (S50 = 3 days) was observed. We tested a "sub-lethal" neem concentration (0.001%) together with these concentrations of conidia. For combinations of neem + fungus, the survival rates were significantly lower than the survival rates seen for fungus alone or for neem alone. Using a combination of 1 × 10(7) conidia mL(-1) + neem (0.001%), the survival rates were 36%, whereas exposure to the fungus alone resulted in 74% survival and exposure to neem alone resulted in 78% survival. When using 1 × 10(8) conidia mL(-1), the survival curves were modified, with a combination of the fungus + neem resulting in 12% survival, whilst the fungus alone at this concentration also significantly reduced survival rates (28%). The use of adjuvants is an important strategy for maintaining/increasing fungal virulence and/or shelf-life. The addition of neem to conidial suspensions improved virulence, significantly reducing larval survival times and percentages.

  9. Fungal Production and Manipulation of Plant Hormones.

    PubMed

    Fonseca, Sandra; Radhakrishnan, Dhanya; Prasad, Kalika; Chini, Andrea

    2018-01-01

    Living organisms are part of a highly interconnected web of interactions, characterised by species nurturing, competing, parasitizing and preying on one another. Plants have evolved cooperative as well as defensive strategies to interact with neighbour organisms. Among these, the plant-fungus associations are very diverse, ranging from pathogenic to mutualistic. Our current knowledge of plant-fungus interactions suggests a sophisticated coevolution to ensure dynamic plant responses to evolving fungal mutualistic/pathogenic strategies. The plant-fungus communication relies on a rich chemical language. To manipulate the plant defence mechanisms, fungi produce and secrete several classes of biomolecules, whose modeof- action is largely unknown. Upon perception of the fungi, plants produce phytohormones and a battery of secondary metabolites that serve as defence mechanism against invaders or to promote mutualistic associations. These mutualistic chemical signals can be co-opted by pathogenic fungi for their own benefit. Among the plant molecules regulating plant-fungus interaction, phytohormones play a critical role since they modulate various aspects of plant development, defences and stress responses. Intriguingly, fungi can also produce phytohormones, although the actual role of fungalproduced phytohormones in plant-fungus interactions is poorly understood. Here, we discuss the recent advances in fungal production of phytohormone, their putative role as endogenous fungal signals and how fungi manipulate plant hormone balance to their benefits. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. De novo genome assembly of the soil-borne fungus and tomato pathogen Pyrenochaeta lycopersici

    PubMed Central

    2014-01-01

    Background Pyrenochaeta lycopersici is a soil-dwelling ascomycete pathogen that causes corky root rot disease in tomato (Solanum lycopersicum) and other Solanaceous crops, reducing fruit yields by up to 75%. Fungal pathogens that infect roots receive less attention than those infecting the aerial parts of crops despite their significant impact on plant growth and fruit production. Results We assembled a 54.9Mb P. lycopersici draft genome sequence based on Illumina short reads, and annotated approximately 17,000 genes. The P. lycopersici genome is closely related to hemibiotrophs and necrotrophs, in agreement with the phenotypic characteristics of the fungus and its lifestyle. Several gene families related to host–pathogen interactions are strongly represented, including those responsible for nutrient absorption, the detoxification of fungicides and plant cell wall degradation, the latter confirming that much of the genome is devoted to the pathogenic activity of the fungus. We did not find a MAT gene, which is consistent with the classification of P. lycopersici as an imperfect fungus, but we observed a significant expansion of the gene families associated with heterokaryon incompatibility (HI). Conclusions The P. lycopersici draft genome sequence provided insight into the molecular and genetic basis of the fungal lifestyle, characterizing previously unknown pathogenic behaviors and defining strategies that allow this asexual fungus to increase genetic diversity and to acquire new pathogenic traits. PMID:24767544

  11. Fungus-Farming Termites Selectively Bury Weedy Fungi that Smell Different from Crop Fungi.

    PubMed

    Katariya, Lakshya; Ramesh, Priya B; Gopalappa, Thejashwini; Desireddy, Sathish; Bessière, Jean-Marie; Borges, Renee M

    2017-10-01

    Mutualistic associations such as the fungal farms of insects are prone to parasitism and are consequently vulnerable to attack by weeds and pests. Therefore, efficient farm management requires quick detection of weeds for their elimination. Furthermore, if the available weedicides are non-specific, then the ability of insects to discriminate between crop and weeds becomes essential for targeted application of such compounds. Here, we demonstrate for the first time in fungus-farming insects, that worker castes of the fungus-growing termite Odontotermes obesus discriminate between their crop (Termitomyces) and the weedy (Pseudoxylaria) fungi, even if exposed to only fungal scents. Termites respond to the presence of fungal mycelium or scent alone, by burying the weed with the offered material such as soil or agar, possibly anointing the weed with chemicals in the process. The scent profiles of crop and weedy fungi are distinct and the differences are likely exploited by termites to selectively mount their defences. Sesquiterpene compounds such as aristolene and viridiflorol, which are absent from crop odours, may constitute the "weedy scent". Our results provide a general mechanism of how other fungus-farming insects could avoid indiscriminate application of non-specific fungicides which could lead to poisoning their crops, and have bearing on the stability of the mutualism between termites and their crop fungus in the face of parasitism by weedy fungi.

  12. Molecular Genetics of Beauveria bassiana Infection of Insects.

    PubMed

    Ortiz-Urquiza, A; Keyhani, N O

    2016-01-01

    Research on the insect pathogenic filamentous fungus, Beauveria bassiana has witnessed significant growth in recent years from mainly physiological studies related to its insect biological control potential, to addressing fundamental questions regarding the underlying molecular mechanisms of fungal development and virulence. This has been in part due to a confluence of robust genetic tools and genomic resources for the fungus, and recognition of expanded ecological interactions with which the fungus engages. Beauveria bassiana is a broad host range insect pathogen that has the ability to form intimate symbiotic relationships with plants. Indeed, there is an increasing realization that the latter may be the predominant environmental interaction in which the fungus participates, and that insect parasitism may be an opportunist lifestyle evolved due to the carbon- and nitrogen-rich resources present in insect bodies. Here, we will review progress on the molecular genetics of B. bassiana, which has largely been directed toward identifying genetic pathways involved in stress response and virulence assumed to have practical applications in improving the insect control potential of the fungus. Important strides have also been made in understanding aspects of B. bassiana development. Finally, although increasingly apparent in a number of studies, there is a need for progressing beyond phenotypic mutant characterization to sufficiently investigate the molecular mechanisms underlying B. bassiana's unique and diverse lifestyles as saprophyte, insect pathogen, and plant mutualist. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Preliminary data on growth and enzymatic abilities of soil fungus Humicolopsis cephalosporioides at different incubation temperatures.

    PubMed

    Elíades, Lorena Alejandra; Cabello, Marta N; Pancotto, Verónica; Moretto, Alicia; Rago, María Melisa; Saparrat, Mario C N

    2015-01-01

    Nothofagus pumilio (Poepp & Endl.) Krasser, known as "lenga" is the most important timber wood species in southernmost Patagonia (Argentina). Humicolopsis cephalosporioides Cabral & Marchand is a soil fungus associated with Nothofagus pumilio forests, which has outstanding cellulolytic activity. However, there is no information about the ability of this fungus to use organic substrates other than cellulose, and its ability to produce different enzyme systems, as well as its response to temperature. The aim of this study was to examine the role of H. cephalosporioides in degradation processes in N. pumilio forests in detail by evaluating the in vitro ability of four isolates of this fungus to grow and produce different lytic enzyme systems, and their response to incubation temperature. The ability of the fungi to grow and produce enzyme systems was estimated by inoculating them on agar media with specific substrates, and the cultures were incubated at three temperatures. A differential behavior of each strain in levels of growth and enzyme activity was found according to the medium type and/or incubation temperature. A intra-specific variability was found in H. cephalosporioides. Likewise a possible link between the saprotrophic role of this fungus in N. pumilio forests and the degradation of organic matter under stress conditions, such as those from frosty environments, was also discussed. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  14. A nonpathogenic Fusarium oxysporum strain enhances phytoextraction of heavy metals by the hyperaccumulator Sedum alfredii Hance.

    PubMed

    Zhang, Xincheng; Lin, Li; Chen, Mingyue; Zhu, Zhiqiang; Yang, Weidong; Chen, Bao; Yang, Xiaoe; An, Qianli

    2012-08-30

    Low biomass and shallow root systems limit the application of heavy metal phytoextraction by hyperaccumulators. Plant growth-promoting microbes may enhance hyperaccumulators'phytoextraction. A heavy metal-resistant fungus belonged to the Fusarium oxysporum complex was isolated from the Zn/Cd co-hyperaccumulator Sedum alfredii Hance grown in a Pb/Zn mined area. This Fusarium fungus was not pathogenic to plants but promoted host growth. Hydroponic experiments showed that 500 μM Zn(2+) or 50 μM Cd(2+) combined with the fungus increased root length, branches, and surface areas, enhanced nutrient uptake and chlorophyll synthesis, leading to more vigorous hyperaccumulators with greater root systems. Soil experiments showed that the fungus increased root and shoot biomass and S. alfredii-mediated heavy metal availabilities, uptake, translocation or concentrations, and thus increased phytoextraction of Zn (144% and 44%), Cd (139% and 55%), Pb (84% and 85%) and Cu (63% and 77%) from the original Pb/Zn mined soil and a multi-metal contaminated paddy soil. Together, the nonpathogenic Fusarium fungus was able to increase S. alfredii root systems and function, metal availability and accumulation, plant biomass, and thus phytoextraction efficiency. This study showed a great application potential for culturable indigenous fungi other than symbiotic mycorrhizas to enhance the phytoextraction by hyperaccumulators. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Penicillium sp. as an organism that degrades endosulfan and reduces its genotoxic effects.

    PubMed

    Romero-Aguilar, Mariana; Tovar-Sánchez, Efrain; Sánchez-Salinas, Enrique; Mussali-Galante, Patricia; Sánchez-Meza, Juan Carlos; Castrejón-Godínez, María Luisa; Dantán-González, Edgar; Trujillo-Vera, Miguel Ángel; Ortiz-Hernández, Ma Laura

    2014-01-01

    Endosulfan is an organochloride and persistent pesticide that has caused concern because of its impact in the environment and its toxicity to and bioaccumulation in living organisms. In this study, we isolated an endosulfan-degrading fungus from the activated sludge from an industrial wastewater treatment plant. Through repetitive enrichment and successive subculture in media containing endosulfan as the sole carbon source, a fungus designated CHE 23 was isolated. Based on a phylogenetic analysis, strain CHE 23 was assigned to the genus Penicillium sp. In a mineral salt medium with 50 mg/l endosulfan as the sole source carbon, CHE 23 removed the added endosulfan in a period of six days. To verify the decrease in endosulfan toxicity due to the activity of the fungus, we performed genotoxicity tests trough the single cell gel electrophoresis assay or comet assay, with Eisenia fetida as the bioindicator species. This organism was exposed to the supernatants of the culture of the fungus and endosulfan. Our results indicated that the genotoxicity of endosulfan was completely reduced due the activity of this fungus. These results suggest that the Penicillium sp. CHE 23 strain can be used to degrade endosulfan residues and/or for water and soil bioremediation processes without causing toxicity problems, which are probably due to the generation of no-toxic metabolites during biodegradation.

  16. Benzyl Derivatives with in Vitro Binding Affinity for Human Opioid Receptors and Cannabinoid Receptors from the Fungus Eurotium repens

    USDA-ARS?s Scientific Manuscript database

    Bioassay-guided fractionation of the fungus Eurotium repens resulted in the isolation of two benzyl derivatives, repenol A (1) and repenol B (2). Seven known secondary metabolites were also isolated including five benzaldehyde compounds, flavoglaucin (3), tetrahydroauroglaucin (4), dihydroauroglauci...

  17. Influence of Procerum Root Disease on the Water Relations of Eastern White Pine (Pinus strobus L.)

    Treesearch

    J.R. Butnor; J.R. Seiler; J.A. Gray

    2000-01-01

    Procerum root disease (PRD) is caused by the deuteromycete fungus Leptogruphium procerum (Kendr.) Wingf, formerly Verticic ladiella procera (Kendr.) and is most commonly isolated from Pinus sp. L., though the fungus has been isolated from other conifer species including Fraser fir (Abies fraseri...

  18. Curvularin and dehydrocurvularin as phytotoxic constituents from curvularia intermedia infecting pandanus amaryllifolius

    USDA-ARS?s Scientific Manuscript database

    Microbes are good sources of biologically active compounds that can be used as pharmaceuticals and agrochemicals. As part of our continuous efforts in search for biopesticides from natural sources, a fungus was isolated from leaves of Pandanus amaryllifolius that showed severe necrosis. This fungus ...

  19. TREATMENT OF A PENTACHLOROPHENOL AND CREOSOTE-CONTAMINATED SOIL USING THE LIGNIN-DEGRADING FUNGUS PHANERO- CHAETE SORDIDA: A FIELD DEMONSTRATION

    EPA Science Inventory

    The feasibility of large-scale fungal bioaugmentation was evaluated by assessing the ability of the lignin-degrading fungus Phanerochaete sordida to decrease the soil concentrations of pentachlorophenol (PCP) and 13 priority pollutant polynuclear aromatic (PNA) creosote component...

  20. Fungus Amongus

    ERIC Educational Resources Information Center

    Wakeley, Deidra

    2005-01-01

    This role-playing simulation is designed to help teach middle level students about the typical lifecycle of a fungus. In this interactive simulation, students assume the roles of fungi, spores, living and dead organisms, bacteria, and rain. As they move around a playing field collecting food and water chips, they discover how the organisms…

  1. Using enzymes and microorganisms to modify the mycotoxin deoxynivalenol

    USDA-ARS?s Scientific Manuscript database

    Deoxynivalenol (DON) is a trichothecene mycotoxin produced by the fungus Fusarium graminearum that contaminates staple crops such as wheat, barley, and maize when they are infected with this fungus. New strategies are needed to mitigate DON. We screened for microbes that could grow in the presence o...

  2. Comparative genomic analysis in the fungus Fusarium for production of toxins of concern to food safety

    USDA-ARS?s Scientific Manuscript database

    SUMMARY Comparative analysis of 207 genomes representing 159 species of the fungus Fusarium detected 9403 known and putative secondary metabolite (SM) biosynthetic gene clusters. The clusters included those responsible for synthesis of mycotoxins, plant hormones and pigments, and varied in distribut...

  3. The Impact of Culture Age, Aeration, and Agitation on the Production of Microsclerotia of the Entomopathogenic Fungus Metarhizium anisopliae Using 100-Liter Fermentors

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia are desiccation-tolerant, compact hyphal aggregates produced by numerous fungi as overwintering structures. We recently discovered that the entomopathogenic fungus Metarhizium anisopliae produced microsclerotia during liquid culture fermentation. When air-dried microsclerotial granu...

  4. Wood-decay abilities of grapevine trunk pathogens Diaporthe ampelina, Diplodia seriata, Eutypa lata, and Neofusicoccum parvum

    USDA-ARS?s Scientific Manuscript database

    Trunk pathogens are fungi that infect grapevine wood through pruning wounds and destroy fruiting positions, thereby impacting grape production. Neofusicoccum parvum (causal fungus of Botryosphaeria dieback) and Eutypa lata (causal fungus of Eutypa dieback) cause chronic infections (cankers) of the t...

  5. The rust fungus Gymnosporangium in Korea including two new species, G. monticola and G. unicorne

    USDA-ARS?s Scientific Manuscript database

    A survey was conducted of species of the rust fungus Gymnosporangium in Korea. The previously known species were recollected, namely Gymnosporangium asiaticum, G. clavariiforme, G. globosum, G. japonicum, and G. yamadae. Although G. cornutum was reported from Korea, collections similar to that speci...

  6. A small cysteine-rich protein from the Asian soybean rust fungus, Phakopsora pachyrhizi, suppresses plant immunity

    USDA-ARS?s Scientific Manuscript database

    The Asian soybean rust fungus, Phakopsora pachyrhizi, is an obligate pathogen capable of causing explosive disease epidemics that drastically reduce the yield of soybean (Glycine max). Currently, the molecular mechanisms by which P. pachyrhizi and other rust fungi cause disease are poorly understood...

  7. Copper sulfate controls fungus on mat-spawned largemouth bass eggs

    USDA-ARS?s Scientific Manuscript database

    Copper sulfate (CuSO4) is widely used by the catfish and hybrid striped bass industries as an economical treatment to control fungus (Saprolegnia spp.) on eggs; these industries use hatching troughs and McDonald jars, respectively, in moderate alkalinity waters. This study determined the effectivene...

  8. Report membrane transport of lactic acid in the filamentous fungus Rhizopus

    USDA-ARS?s Scientific Manuscript database

    The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

  9. Analysis of a Functional Lactate Permease in the Fungus Rhizopus

    USDA-ARS?s Scientific Manuscript database

    The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

  10. Cold Tolerance of Pityophthorus juglandis (Coleoptera: Scolytidae) From Northern California

    Treesearch

    Andrea R. Hefty; Steven J. Seybold; Brian H. Aukema; Robert C. Venette

    2017-01-01

    Winter survivorship of insects is determined by a combination of physiological, behavioral, and microhabitat characteristics. We characterized the cold tolerance of the walnut twig beetle, Pityophthorus juglandis Blackman, a domestic alien invasive bark beetle that vectors a phytopathogenic fungus. The beetle and fungus cause thousand cankers...

  11. Cellular development associated with induced secondary metabolism in the filamentous fungus Fusarium graminearum

    USDA-ARS?s Scientific Manuscript database

    Several species of the filamentous fungus Fusarium colonize plants and produce toxic small molecules that contaminate agricultural products, rendering them unsuitable for consumption. Among the most destructive of these species is F. graminearum, which causes disease in wheat and barley and often in...

  12. Effect of biochar soil-amendments on Allium porrum growth, arbuscular mycorrhizal fungus colonization

    USDA-ARS?s Scientific Manuscript database

    Aims: Examine the interaction of biochar addition and arbuscular mycorrhizal [AM] fungus inoculation upon growth and Zn and Cu uptake by Allium porrum L. in heavy metal amended soil mix, and relate these responses to physicochemical properties of the biochars. Methods: The experiment was a complete ...

  13. Black Stain Root Disease of Conifers (FIDL)

    Treesearch

    Paul F. Hessburg; Donald J. Goheen; Robert V. Bega

    1995-01-01

    The black stain fungus?Leptographium wageneri (Kendrick) Wingfield*?infects and kills several species of western conifers. The fungus colonizes water-conducting tissues of the host's roots, root collars, and lower stems, ultimately blocking the movement of water to foliage. Severely infected trees exhibit wilting symptoms characteristic of vascular wilt diseases...

  14. Differential gene expression during conidiation in the grape powdery mildew fungus, Erysiphe necator

    USDA-ARS?s Scientific Manuscript database

    Asexual sporulation (conidiation) is coordinately regulated in the grape powdery mildew fungus Erysiphe necator, but nothing is known about its genetic regulation. We hypothesized that genes required for conidiation in other fungi would be up-regulated at conidiophore initiation and/or full conidia...

  15. Isolation and identification of nematode-antagonistic compounds from the fungus Aspergillus candidus

    USDA-ARS?s Scientific Manuscript database

    An isolate of the fungus Aspergillus candidus was tested for production of nematicidal compounds. Adults of the nematode Ditylenchus destructor were completely inactive after 24 hr exposure to soy medium in which A. candidus was cultured. Column, thin layer and preparative chromatographies, and spec...

  16. Development of molecular markers for breeding for disease resistant crops

    USDA-ARS?s Scientific Manuscript database

    Rice blast disease caused by the filamentous ascomycetes fungus Magnaporthe oryzae and sheath blight disease caused by the soil borne fungus Rhizocotonia solani are the two major rice diseases that threaten stable rice production in the USA and worldwide. These two diseases have been managed with a ...

  17. Polymorphic sequence-characterized codominant loci in the chestnut blight fungus, Cryphonectria parasitica

    Treesearch

    J. E. Davis; Thomas L. Kubisiak; M. G. Milgroom

    2005-01-01

    Studies on the population biology of the chestnut blight fungus, Cryphonectria parasitica, have previously been carried out with dominant restriction fragment length polymorphism (RFLP) fingerprinting markers. In this study, we described the development of 11 condominant markers from randomly amplified polymorphic DNAs (RAPDs). RAPD fragments were...

  18. Secondary metabolites produced by solid fermentation of the marine-derived fungus Penicillium commune QSD-17.

    PubMed

    Gao, Shu-Shan; Shang, Zhuo; Li, Xiao-Ming; Li, Chun-Shun; Cui, Chuan-Ming; Wang, Bin-Gui

    2012-01-01

    The marine sediment-derived fungus Penicillium commune QSD-17 was re-investigated and cultured on rice solid medium. Two new compounds, isophomenone (1) and 3-deacetylcitreohybridonol (2), together with seven known derivatives (3-9), were identified. Their structures were determined by spectroscopic analysis.

  19. Metacridamides A and B, bioactive macrocycles from conidia of the entomopathogenic fungus Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. Its conidia produce two novel 17-membered macrocycles, metacridamides A (1) and B (2), which consist of a Phe unit condensed with a nonaketide....

  20. Confirming QTL for aflatoxin resistance from Mp313E in different genetic backgrounds

    USDA-ARS?s Scientific Manuscript database

    The fungus Aspergillus flavus (Link:Fr) causes ear rot of maize (Zea mays L.) and produces the toxic metabolic product aflatoxin. One particularly effective method to control the fungus is via host plant resistance, but while several resistant breeding lines have been identified, transferring the r...

  1. Meroterpenoids with antiproliferative activity from a Hawaiian-plant associated fungus Peyronellaea coffeae-arabicae FT238

    USDA-ARS?s Scientific Manuscript database

    Three unusual polyketide-sesquiterpene metabolites peyronellins A-C (1-3), along with the new epoxyphomalin analog 11-dehydroxy epoxyphomalin A (4), have been isolated from the endophytic fungus Peyronellaea cof feae-arabicae FT238, which was isolated from the native Hawaiian plant Pritchardia lowre...

  2. OXIDATION OF PERSISTANT ENVIRONMENTAL POLLUTANTS BY A WHITE ROT FUNGUS

    EPA Science Inventory

    The white rot fungus Phanerochaete chrysosporium degraded DDT [1,1,-bis(4-chlorophenyl)-2,2,2-trichloroethane], 3,4,3',4'-tetrachlorobiphenyl, 2,4,5,2',-4',5'-hexachlorobiphenyl, 2,3,7,8-tetrachlorodibenzo-p-dioxin, lindane (1,2,3,4,5,6-hexachlorocylohexane), and benzo[a]pyrene t...

  3. Integrated genomic and transcriptomic analysis reveals mycoparasitism as the ancestoral life style of Trichoderma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kubicek, Christian P.; Herrera-Estrella, Alfredo; Seidl, Verena

    2011-04-29

    Mycoparasitism, a lifestyle where one fungus is parasitic on another fungus has special relevance when the prey is a plant pathogen, providing a strategy for biological control of pests for plant protection. Probably, the most studied biocontrol agents are species of the genus Hypocrea/Trichoderma.

  4. Diseases of pines caused by the pitch canker fungus

    Treesearch

    L. David Dwinell; Stephen W. Fraedrich; D. Adams

    2001-01-01

    Fusarium subglutinans f. sp. pini, the pitch canker fungus, causes a number of serious diseases of Pinus species. The pathogen infects a variety of vegetative and reproductive pine structures at different stages of maturity and produces a diversity of symptoms. When the pathogen infects the woody vegetative...

  5. Temperature determines symbiont abundance in a multipartite bark beetle-fungus ectosymbiosis

    Treesearch

    D. L. Six; B. J. Bentz

    2007-01-01

    In this study, we report evidence that temperature plays a key role in determining the relative abundance of two mutualistic fungi associated with an economically and ecologically important bark beetle, Dendroctonus ponderosae. The symbiotic fungi possess different optimal temperature ranges. These differences determine which fungus is vectored by...

  6. TESTING OF THE INSECT PEST CONTROL FUNGUS BEAUVERIA BASSIANA IN GRASS SHRIMP PALAEMONETES PUGIO

    EPA Science Inventory

    Embryos, larvae and adult grass shrimp Palaemonetes pugio were exposed to spores of the insect-control fungus Beauveria bassiana. onidiospores attached to embryos held by gravid females and remained with the egg mass for at least 6 d. In the first experiment where individual deve...

  7. 78 FR 69817 - Certain Preserved Mushrooms From the People's Republic of China: Preliminary Results and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-21

    ... Enforcement and Compliance, ``Deadlines Affected by the Shutdown of the Federal Government'' (October 18, 2013...) Fujian Pinghe Baofeng Canned Foods; (6) Fujian Yuxing Fruits and Vegetables Foodstuffs Development Co...) Shandong Fengyu Edible Fungus Corporation Ltd.; (13) Shandong Jiufa Edible Fungus Corporation, Ltd.; (14...

  8. First report of Pantoea ananatis (Syn. Erwinia uredovora) being associated with peanut rust in Georgia

    USDA-ARS?s Scientific Manuscript database

    Peanut rust is caused by the fungus Puccinia arachidis. This disease, if not treated can cause severe damage and defoliation. While sequencing DNA of urediniospores of the rust fungus, BLAST analysis detected many sequences corresponding to the bacterial species Pantoea ananatis. This bacterium, ...

  9. Trouble in the aquatic world: how wildlife professionals are battling amphibian declines

    Treesearch

    Deanna H. Olson; Tara Chestnut

    2014-01-01

    Aparasitic fungus, similar to the one that caused the extinction of numerous tropical frog and toad species, is killing salamanders in Europe. Scientists first identified the fungus, Batrachochytrium salamandrivorans, in 2013 as the culprit behind the death of fire salamanders (Salamandra salamandra) in the Netherlands (Martel...

  10. Scleroderris Canker of Northern Conifers

    Treesearch

    Darroll D. Skilling; James T. O' Brien; James A. Bell

    1979-01-01

    Scleroderris canker, caused by the fungus Gremmeniella abietina-Scleroderris lagerbergii (Lagerb.) Morelet, has caused extensive mortality in conifer plantations and forest nurseries in the northeast and north central United States and eastern Canada. Two strains of the fungus are known in North America. The Lake States strain, present throughout northeastern North...

  11. ENVIRONMENTAL AND POTASSIUM CHLORATE EFFECTS ON THE GROWTH OF CHAETOMIUM GLOBOSUM

    EPA Science Inventory

    Mold has been blamed for causing human health problems at work and at home. One fungus often found in indoor environments is Chaetomium globosum. This fungus produces sexual reproductive structures called perithecia (Fig. 2) that can be easily visualized on a media plate. Malt ex...

  12. The fungus Ustilago maydis, from the aztec cuisine to the research laboratory.

    PubMed

    Ruiz-Herrera, J; Martínez-Espinoza, A D

    1998-06-01

    Ustilago maydis is a plant pathogen fungus responsible for corn smut. It has a complex life cycle. In its saprophitic stage, it grows as haploid yeast cells, while in the invasive stage it grows as a mycelium formed by diploid cells. Thus, a correlation exists between genetic ploidy, pathogenicity and morphogenesis. Dimorphism can be modulated in vitro by changing environmental parameters such as pH. Studies with auxotrophic mutants have shown that polyamines play a central role in regulating dimorphism. Molecular biology approaches are being employed for the analysis of fundamental aspects of the biology of this fungus, such as mating type regulation, dimorphism or cell wall biogenesis.

  13. Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

    PubMed

    Wang, J W; Wu, J H; Huang, W Y; Tan, R X

    2006-03-01

    The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

  14. Sarcoid-like lesions in Paracoccidioidomycosis: immunological factors*

    PubMed Central

    de Medeiros, Vanessa Lucília Silveira; Arruda, Lúcia

    2013-01-01

    The clinical presentation of paracoccidioidomycosis is spectral. Spontaneous cure, state of latency or active disease with different levels of severity can occur after the hematogenous dissemination. The morphology and number of skin lesions will depend on the interaction of host immunity, which is specific and individual, and fungus virulence. Some individuals have natural good immunity, which added to the low virulence of the fungus maintain the presence of well-marked granulomas with no microorganism and negative serology for a long time, making the diagnosis a challenge. Factors inherent to the fungus, however, may modulate the immune response and modify the clinical picture over the time. We present a sarcoidosis-like clinical presentation and discuss the immunological factors involved. PMID:23539015

  15. Meroterpenoids and isoberkedienolactone from endophytic fungus Penicillium sp. associated with Dysosma versipellis.

    PubMed

    Li, Jun-Wei; Duan, Rui-Gang; Zou, Jian-Hua; Chen, Ri-Dao; Chen, Xiao-Guang; Dai, Jun-Gui

    2014-06-01

    Seven meroterpenoids and five small-molecular precursors were isolated from Penicillium sp., an endophytic fungus from Dysosma versipellis. The structures of new compounds, 11beta-acetoxyisoaustinone (1) and isoberkedienolactone (2) were elucidated based on analysis of the spectral data, and the absolute configuration of 2 was established by TDDFT ECD calculation with satisfactory match to its experimental ECD data. Meroterpenoids originated tetraketide and pentaketide precursors, resepectively, were found to be simultaneously produced in specific fungus of Penicillium species. These compounds showed weak cytotoxicity in vitro against HCT-116, HepG2, BGC-823, NCI-H1650, and A2780 cell lines with IC 50 > 10 micromol x L(-1).

  16. Trichopeptides A and B, trichocyclodipeptides A-C, new peptides from the ascomycete fungus Stagonospora trichophoricola.

    PubMed

    Chen, Zhengkun; Xu, Xiuli; Ren, Jinwei; Wang, Wenzhao; Liu, Xingzhong; Li, Erwei

    2017-08-01

    Trichopeptides A (1) and B (2), new linear tetrapeptide and tripeptide, respectively, and three new diketopiperazines trichocyclodipeptides A-C (3-5) were isolated from the fermentation of the ascomycete fungus Stagonospora trichophoricola, a fungus isolated from the soil sample surrounding the fruiting body of Ophiocordyceps sinensis in Maqin Country, Qinghai Province, People's Republic of China. Their structures were primarily elucidated by interpretation of NMR and MS experiments. The absolute configurations of 1-5 were assigned through Marfey's method on their acid hydrolyzates. Compound 3 showed antifungal activity against Candida albicans with the IC 50 and MIC values of 22 and 90 μg ml -1 , respectively.

  17. Study of coatings for improved fire and decay resistance of mine timbers

    NASA Technical Reports Server (NTRS)

    Baum, B.

    1977-01-01

    The purpose of this program was to find a fire- and rot-retardant polymer/fungicide reaction product for coating mine timbers. Fire-retardant polymers were screened as films and coatings on fir wood. Curable polyimide appeared to be flame retardant and evolved a minimum of fumes when exposed to a flame. Several organic and metal, low toxicity, fungicides were reacted with the polyimide in-situ on the wood. These coated samples were screened for fungus resistance. All formulations rated well - even the polyimide film without additives was fungicidal. The fir wood control itself resisted internal damage during the ten weeks of fungus exposure. A more severe test for fungus resistance will be required.

  18. The link between rapid enigmatic amphibian decline and the globally emerging chytrid fungus.

    PubMed

    Lötters, Stefan; Kielgast, Jos; Bielby, Jon; Schmidtlein, Sebastian; Bosch, Jaime; Veith, Michael; Walker, Susan F; Fisher, Matthew C; Rödder, Dennis

    2009-09-01

    Amphibians are globally declining and approximately one-third of all species are threatened with extinction. Some of the most severe declines have occurred suddenly and for unknown reasons in apparently pristine habitats. It has been hypothesized that these "rapid enigmatic declines" are the result of a panzootic of the disease chytridiomycosis caused by globally emerging amphibian chytrid fungus. In a Species Distribution Model, we identified the potential distribution of this pathogen. Areas and species from which rapid enigmatic decline are known significantly overlap with those of highest environmental suitability to the chytrid fungus. We confirm the plausibility of a link between rapid enigmatic decline in worldwide amphibian species and epizootic chytridiomycosis.

  19. Ramularia collo-cygni--An Emerging Pathogen of Barley Crops.

    PubMed

    Havis, Neil D; Brown, James K M; Clemente, Gladys; Frei, Peter; Jedryczka, Malgorzata; Kaczmarek, Joanna; Kaczmarek, Maciej; Matusinsky, Pavel; McGrann, Graham R D; Pereyra, Sylvia; Piotrowska, Marta; Sghyer, Hind; Tellier, Aurelien; Hess, Michael

    2015-07-01

    Ramularia collo-cygni is the biotic factor responsible for the disease Ramularia leaf spot (RLS) of barley (Hordeum vulgare). Despite having been described over 100 years ago and being considered a minor disease in some countries, the fungus is attracting interest in the scientific community as a result of the increasing number of recorded economically damaging disease epidemics. New reports of disease spread and fungal identification using molecular diagnostics have helped redefine RLS as a global disease. This review describes recent developments in our understanding of the biology and epidemiology of the fungus, outlines advances made in the field of the genetics of both the fungus and host, and summarizes the control strategies currently available.

  20. Mode of Infection of Metarhizium spp. Fungus and Their Potential as Biological Control Agents

    PubMed Central

    Aw, Kimberly Moon San; Hue, Seow Mun

    2017-01-01

    Chemical insecticides have been commonly used to control agricultural pests, termites, and biological vectors such as mosquitoes and ticks. However, the harmful impacts of toxic chemical insecticides on the environment, the development of resistance in pests and vectors towards chemical insecticides, and public concern have driven extensive research for alternatives, especially biological control agents such as fungus and bacteria. In this review, the mode of infection of Metarhizium fungus on both terrestrial and aquatic insect larvae and how these interactions have been widely employed will be outlined. The potential uses of Metarhizium anisopliae and Metarhizium acridum biological control agents and molecular approaches to increase their virulence will be discussed. PMID:29371548

  1. Identification and sequence determination of a new chrysovirus infecting the entomopathogenic fungus Isaria javanica.

    PubMed

    Herrero, Noemi

    2017-04-01

    A new double-stranded RNA (dsRNA) mycovirus has been identified in the isolate NB IFR-19 of the entomopathogenic fungus Isaria javanica. Isaria javanica chrysovirus-1 (IjCV-1) constitutes a new member of the Chrysoviridae family, and its genome is made up of four dsRNA elements designated dsRNA1, 2, 3 and 4 from largest to smallest. dsRNA1 and dsRNA2 encode an RNA-dependent RNA polymerase (RdRp) and a coat protein (CP), respectively. dsRNA3 and 4 encode hypothetical proteins of unknown function. IjCV-1 constitutes the first report of a chrysovirus infecting the entomopathogenic fungus Isaria javanica.

  2. An arabinobio-hydrolase (Arb93B) from Fusarium graminearum is associated with wheat head blight disease

    USDA-ARS?s Scientific Manuscript database

    Fusarium head blight (FHB), caused by the fungus Fusarium graminearum, is one of the most important diseases of wheat and barley worldwide. FHB not only reduces crop yield, but the fungus also contaminates grains with mycotoxins, which are harmful to humans and animals. A previous study demonstrated...

  3. Low prevalence of chytrid fungus (Batrachochytrium dendrobatidis) in amphibians of U.S

    Treesearch

    Blake R. Hossack; Michael J. Adams; Evan H. Campbell Grant; Christopher A. Pearl; James B. Bettaso; William J. Barichivich; Winsor H. Lowe; Kimberly True; Joy L. Ware; Paul Stephen Corn

    2010-01-01

    Many declines of amphibian populations have been associated with chytridiomycosis, a disease caused by the aquatic fungus Batrachochytrium dendrobatidis (Bd). Despite the relatively high prevalence of chytridiomycosis in stream amphibians globally, most surveys in North America have focused primarily on wetland-associated species, which are frequently infected. To...

  4. Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

    USDA-ARS?s Scientific Manuscript database

    ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

  5. Effect of sterilizing treatments on survival and growth of hybrid poplar cuttings

    Treesearch

    Harold F. Ford

    1954-01-01

    Fungus diseases of poplars might be spread to new locations if hybrid poplar cuttings (now being test-planted in various parts of the northeast) were not sterilized before shipment. Among these diseases are the canker-producing fungi Septoria musiva and Dothichiza populea and the leafblotch fungus Septotinia populiperda.

  6. Field evaluation of soybean lines from a new source of resistance to Cercospora kikuchii, 2013

    USDA-ARS?s Scientific Manuscript database

    Purple seed stain, which is caused by the fungus Cercospora kikuchii, is an important seed disease which causes soybean seed quality losses when environmental conditions favor its growth, and harvest is delayed due to wet field conditions. Frogeye leaf spot caused by the fungus Cercospora sojina is...

  7. Allelochemical effects of volatile compounds and organic extracts from Muscodor yucatanensis, a tropical endophytic fungus from Bursera simaruba

    USDA-ARS?s Scientific Manuscript database

    Muscodor yucatanensis, a recently described endophytic fungus, was isolated from the leaves of Bursera simaruba (Burseraceae) growing in the dry, semideciduous tropical forest of the Ecological Reserve El Eden, Quintana Roo, Mexico. In the present study we tested in vitro the mixture of volatile org...

  8. BIODEGRADATION OF DDT [1,1,1-TRICHLORO-2,2-BIS(4- CHLOROPHENYL) ETHANE] BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    EPA Science Inventory

    Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the form...

  9. Tracking the footsteps of an invasive plant pathogen: Intercontinental phylogeographic structure of the white-pine-blister-rust fungus, Cronartium ribicola

    Treesearch

    Bryce A. Richardson; Mee-Sook Kim; Ned B. Klopfenstein; Yuko Ota; Kwan Soo Woo; Richard C. Hamelin

    2009-01-01

    Presently, little is known about the worldwide genetic structure, diversity, or evolutionary relationships of the white-pineblister-rust fungus, Cronartium ribicola. A collaborative international effort is underway to determine the phylogeographic relationships among Asian, European, and North American sources of C. ribicola and...

  10. Control of Liriomyza trifolii (Diptera: Agromyzidae) in cut flowers using Isaria fumosorosea (Hypocreales: Cordycipitaceae) alone and in combination with insecticides

    USDA-ARS?s Scientific Manuscript database

    The generalist entomopathogenic fungus, Isaria fumosorosea (Wize) Brown and Smith (Hypocreales: Cordycipitaceae) strain Apopka-97 has exhibited significant potential as a biological control agent of several important pests both in the field and greenhouse. Although this fungus has never been tested ...

  11. Dynamic changes of rice blast fungus in the USA through six decades

    USDA-ARS?s Scientific Manuscript database

    Rice blast disease caused by the fungus Magnaporthe oryzae is a serious rice disease in the USA and worldwide. M. oryzae is highly adaptive and changeable due to the instability of its genome and resistance genes which are effective only when M. oryzae isolates contain the cognate avirulence (AVR) g...

  12. Red Fox as Sentinel for Blastomyces dermatitidis, Ontario, Canada.

    PubMed

    Nemeth, Nicole M; Campbell, G Douglas; Oesterle, Paul T; Shirose, Lenny; McEwen, Beverly; Jardine, Claire M

    2016-07-01

    Blastomyces dermatitidis, a fungus that can cause fatal infection in humans and other mammals, is not readily recoverable from soil, its environmental reservoir. Because of the red fox's widespread distribution, susceptibility to B. dermatitidis, close association with soil, and well-defined home ranges, this animal has potential utility as a sentinel for this fungus.

  13. Thielavins A, J and K: alpha-glucosidase inhibitors from MEXU 27095, an endophytic fungus from Hintonia latiflora

    USDA-ARS?s Scientific Manuscript database

    Bioassay-guided fractionation of the bio-active organic extract obtained from solid-media culture of MEXU 27095, an endophytic fungus isolated from the Mexican medicinal plant Hintonia latiflora (Rubiaceae), led to separation of three tridepsides which were identified as thielavins A, J and K. All ...

  14. A simple culture method inducing sexual reproduction by Fusarium graminearum, the primary causal agent of Fusarium head blight

    USDA-ARS?s Scientific Manuscript database

    The homothallic ascomycete fungus Fusarium graminearum is the primary causal agent of Fusarium head blight (FHB), a devastating disease of wheat and barley worldwide. The fungus undergoes both asexual and sexual stages in its life cycle. The asexual stage produces conidiospores, whereas the sexual s...

  15. Influence of Populus Genotype on Gene Expression by the Wood Decay Fungus Phanerochaete chrysosporium

    Treesearch

    Jill Gaskell; Amber Marty; Michael Mozuch; Philip J. Kersten; Sandra Splinter Bondurant; Grzegorz Sabat; Ali Azarpira; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Dan Cullen

    2014-01-01

    We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba tremula) and syringyl (S)-rich transgenic derivatives. Acombination ofmicroarrays and liquid chromatography- tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793...

  16. Sudden Oak Death - Eastern (Pest Alert)

    Treesearch

    Joseph O' Brien; Manfred Mielke; Steve Oak; Bruce Moltzan

    2002-01-01

    A phenomenon known as Sudden Oak Death was first reported in 1995 in central coastal California. Since then, tens of thousands of tanoaks (Lithocarpus densiflorus), coast live oaks (Quercus agrifolia), and California black oaks (Quercus kelloggii) have been killed by a newly identified fungus, Phytophthora ramorum. On these hosts, the fungus causes a bleeding canker on...

  17. Draft Genome Sequence of the Patulin-Producing Fungus Paecilomyces niveus Strain CO7.

    PubMed

    Biango-Daniels, Megan N; Wang, Tristan W; Hodge, Kathie T

    2018-06-21

    Paecilomyces niveus is an extremotolerant fungus with surprising powers to survive high temperatures and infect apples and aphids. These abilities make it a formidable enemy in food and agricultural environments. In addition, it produces patulin, the most significant mycotoxin in apples. Copyright © 2018 Biango-Daniels et al.

  18. Thousand cankers disease: Geosmithia morbida spores isolated from a weevil

    Treesearch

    Michele Warmund; Jerry. Van Sambeek

    2014-01-01

    Recently, Geosmithia morbida, the canker-causing fungus associated with thousand cankers disease, was isolated from Stenomimus pallidus weevils found on two stressed black walnut trees in Yellowwood State Forest near Nashville, Indiana. This is the first report of Geosmithia fungus occurring on an insect other than the walnut twig beetle (Pityophthorus juglandis)....

  19. Lignocellulose pretreatment in a fungus-cultivating termite

    Treesearch

    Hongjie Li; Daniel J. Yelle; Chang Li; Mengyi Yang; Jing Ke; Ruijuan Zhang; Yu Liu; Na Zhu; Shiyou Liang; Xiaochang Mo; John Ralph; Cameron R. Currie; Jianchu Mo

    2017-01-01

    Depolymerizing lignin, the complex phenolic polymer fortifying plant cell walls, is an essential but challenging starting point for the lignocellulosics industries. The variety of ether– and carbon–carbon interunit linkages produced via radical coupling during lignification limit chemical and biological depolymerization efficiency. In an ancient fungus-cultivating...

  20. Sudden oak death: disease trends in Marin county plots after one year

    Treesearch

    Brice A. McPherson; David L. Wood; Andrew J. Storer; Nina Maggi Kelly; Richard B. Standiford

    2002-01-01

    Sudden oak death has emerged as a major threat to the oak forests of California. In oaks and tanoak, this disease complex consists of a previously unreported fungus-like pathogen, Phytophthora ramorum, insects (bark and ambrosia beetles), and a secondary fungus, Hypoxylon thouarsianum. Species monitored in this study were coast...

  1. First Report of Botrytis cinerea as a Postharvest Pathogen of Blueberry in Korea

    PubMed Central

    Cheon, Mi-Geon; Choi, Okhee; Kim, Jinwoo

    2011-01-01

    Gray mold of blueberry caused by Botrytis sp. is reported for the first time in Korea. A detailed description of the fungus is given, along with its rDNA internal transcribed spacer sequence. The fungus was identified as Botrytis cinerea based on mycological characteristics and molecular data. PMID:22783073

  2. Gene action and linkage of avirulence genes to DNA makers in the rust fungus Puccinia graminis

    Treesearch

    P. J. Zambino; A. R. Kubelik; L. J. Szabo

    2000-01-01

    Two strains of the wheat stem rust fungus, Puccinia graminis f. sp. tritici, were crossed on barberry, and a single F1 progeny strain was seifed. The parents, F1 and 81 F2 progeny were examined for virulence phenotypes on wheat differential cultivars carrying stem...

  3. Characterization of molecular identity and pathogenicity of rice blast fungus in Hunan province of China

    USDA-ARS?s Scientific Manuscript database

    Characterization of molecular identity and pathogenicity of the rice blast fungus benefits the deployment of effective blast resistance (R) genes. In order to identify blast resistance genes in rice producing areas where most of the hybrid rice is grown in Hunan province, 182 M. oryzae strains were ...

  4. A novel fungal hyperparasite of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust

    USDA-ARS?s Scientific Manuscript database

    Puccinia striiformis f. sp. tritici (Pst), the causal fungus of wheat stripe rust, was previously reported to be infected by Lecanicillium lecanii, Microdochium nivale and Typhula idahoensis. Here, we report a novel hyperparasite on Pst. This hyperparasitic fungus was identified as Cladosporium clad...

  5. Identification of major blast resistance genes in the southern US

    USDA-ARS?s Scientific Manuscript database

    Resistance (R) genes in rice play important roles in preventing infections of rice blast fungus, Magnaporthe oryzae. In order to identify more R genes for different rice growing areas in the Southern US, an extensive field survey of the blast fungus was performed from 2012 to 2013. A total of 500 is...

  6. On-farm AM fungus inoculum production: a complete how-to on-farm am fungus inoculum production

    USDA-ARS?s Scientific Manuscript database

    Arbuscular mycorrhizal (AM) fungi are beneficial soil fungi that form a symbiosis with the majority of crop plants. The benefits to the plant include increased nutrient uptake and disease and drought resistance. This makes utilization of the symbiosis a potentially important part in ensuring the s...

  7. Dothistroma Needle Blight of Pines

    Treesearch

    Glenn W. Peterson

    1982-01-01

    Dothistroma blight is a devastating foliar disease of a wide range of pine species. The causal fungus, Dothistroma pini Hulbary, infects and kills needles. Premature defoliation caused by this fungus has resulted in complete failure of most ponderosa pine plantings in States east of the Great Plains. In the central and southern Great Plains, D. pini damages Austrian...

  8. Relationship between canopy structure, microclimate, and Swiss needle cast severity among different ages of Douglas-fir forests

    EPA Science Inventory

    Swiss needle cast (SNC) is an endemic disease of Douglas-fir caused by Phaeocryptopus gaeumannii. The fungus infects newly emerged needles between May and August. As the fungus develops, its fruiting bodies (pseudothecia) block the stomata and inhibit gas exchange, reducing the p...

  9. Hickory Mortality

    Treesearch

    USDA Forest Service Northern Area State & Private Forestry and Region 8

    1994-01-01

    Mortality of bitternut and shagbark hickory has been observed in Wisconsin since the late 1980's. This is similar to occurrences in the 1960's. The recent tree mortality has been associated with attacks by the hickory bark beetle, Scolytus quadrispinosus Say, and a newly discovered fungus in the genus Ceratocystis (tentatively C. caryae). The fungus can be...

  10. Oviposition behavior and survival of Tamarixia radiata (Hymenoptera: Eulophidae), an ectoparasitoid of the Asian citrus psyllid, Diaphorina citri (Hemiptera: Liviidae), on hosts exposed to an entomopathogenic fungus

    USDA-ARS?s Scientific Manuscript database

    Antagonistic interactions between the nymphal parasitoid, Tamarixia radiata Waterston (Hymenoptera: Eulophidae), and the ARSEF 3581 isolate of the entomopathogenic fungus, Isaria fumosorosea Wize (Hypocreales: Cordycipitaceae) could disrupt biological control of the Asian citrus psyllid, Diaphorina ...

  11. The origin of Ceratocystis fagacearum, the oak wilt fungus

    Treesearch

    Jennifer Juzwik; Thomas C. Harrington; William L. MacDonald; David N. Appel

    2008-01-01

    The oak wilt pathogen, Ceratocystis fagacearum, may be another example of a damaging, exotic species in forest ecosystems in the United States. Though C. fagacearum has received much research attention, the origin of the fungus is unknown. The pathogen may have been endemic at a low incidence until increased disturbances, changes...

  12. Dissolved oxygen levels affect dimorphic growth by the entomopathogenic fungus Isaria fumosorosea

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Isaria fumosorosea is capable of dimorphic growth (hyphal or yeast-like) in submerged culture. In shake flask studies, we evaluated the impact of aeration on the mode of growth of I. fumosorosea. Using 250 mL baffled Erlenmeyer flasks, culture volumes of 50, 100, 150, a...

  13. Using copper sulfate on hybrid striped bass eggs to control fungus and increase survival

    USDA-ARS?s Scientific Manuscript database

    A major obstacle in fish hatcheries is the inevitable fungal growth on eggs. Copper sulfate (CuSO4) is commonly used for fungus control in channel catfish hatcheries that use troughs, but effectiveness on fish eggs hatched using different systems has only recently been investigated. Fish were spawn...

  14. Microsatellite DNA suggests regional structure in the fusiform rust fungus Cronartium quercuum f. sp fusiforme

    Treesearch

    T.L Kubisiak; J.H. Roberds; P.C. Spaine; R.L. Doudrick

    2004-01-01

    This paper reports results obtained from microsatellite DNA analysis of genetic structure for populations of the native fungus Cronartium quercuum f. sp fusiforme infecting loblolly pine (Pinus taeda L.) over much of this host's natural range. Mostly all fusiform rust galls formed under field conditions are...

  15. Global distribution of the pitch canker fungus

    Treesearch

    L. David Dwinell

    1998-01-01

    The pitch canker fungus, Fusarium subglutinans f. sp. pini, causes diseases of pines in the United States, Haiti, Japan, Mexico, Spain, and South Africa. Pitch canker was first reported in Virginia pine in North Carolina in 1946. Although the disease was reported in Haitian pine in 1953, pitch canker was generally considered a...

  16. Rapid detection method for fusaric acid-producing species of Fusarium by PCR

    USDA-ARS?s Scientific Manuscript database

    Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...

  17. Melanin and the ecology of southern pine beetle associated fungi

    Treesearch

    Kier D. Klepzig

    2006-01-01

    I report here a series of initial investigations into effects of melanins on the interactions of the three primary species of fungi associated with the southern pine beetle (SPB), and into possible means for mitigating the damaging activities of the melanistic fungus, Ophiostoma minus. Growth of the SPB mutualistic fungus Entomocorticium...

  18. Using copper sulfate to control egg fungus at Keo Fish Farm

    USDA-ARS?s Scientific Manuscript database

    Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab had just successfully completed an effectiveness study that was needed in our pursuit of gaining FDA-approval to...

  19. Aggregation and feeding behavior of the formosan subterranean termite (Isoptera: Rhinotermitidae) on wood decayed by three species of wood rot fungi

    USDA-ARS?s Scientific Manuscript database

    Aggregation and feeding behavior of the Formosan subterranean termite, Coptotermes formosanus Shiraki, was evaluated on wood decayed by three species of fungus that use different enzymatic pathways to degrade lignocellulose, the brown rot fungus, Gloeophyllum trabeum and two white rot fungi, Phanero...

  20. Draft Genome Sequence of a Rare Smut Relative, Tilletiaria anomala UBC 951

    DOE PAGES

    Toome, Merje; Kuo, Alan; Henrissat, Bernard; ...

    2014-06-12

    We present the draft genome sequence of the smut fungus Tilletiaria anomala UBC 951 (Basidiomycota, Ustilaginomycotina). The sequenced genome size is 18.7 Mb, consisting of 289 scaffolds and a total of 6,810 predicted genes. This is the first genome sequence published for a fungus in the order Georgefisheriales (Exobasidiomycetes).

  1. Translocation and incorporation of strontium carbonate derived strontium into calcium oxalate crystals by the wood decay fungus Resinicium bicolor

    Treesearch

    Jon H. Connolly; Walter C. Shortle; Jody Jellison

    1999-01-01

    The white-rot wood decay fungus Resinicium bicolor (Abertini & Schwein.: Fr.) Parmasto was studied for its ability to solubilize and translocate ions from the naturally occurring mineral strontianite. Resinicium bicolor colonized a soil mixture culture medium containing strontianite sand, solubilized strontium ions from this...

  2. Lethality of the entomogenous fungus Beauveria bassiana strain NI8 on Lygus lineolaris (Hemiptera: Miridae) and its possible impact on beneficial arthropods

    USDA-ARS?s Scientific Manuscript database

    Bioassays were conducted to examine the pathogenicity of the fungus Beauveria bassiana (Balsamo) Vuillemin (Ascomycota: Hypocreales) strain NI8 against Lygus lineolaris (Palisot de Beauvois) and its impact on natural enemies including Apis mellifera L., Crysoperla rufrilabris Burmeister, Orius insid...

  3. Fun Microbiology: How To Measure Growth of a Fungus.

    ERIC Educational Resources Information Center

    Mitchell, James K.; And Others

    1997-01-01

    Describes an experiment to demonstrate a simple method for measuring fungus growth by monitoring the effect of temperature on the growth of Trichoderma viride. Among the advantages that this experimental model provides is introducing students to the importance of using the computer as a scientific tool for analyzing and presenting data. (AIM)

  4. Polyketide-Terpene Hybrid Metabolites from an Endolichenic Fungus Pestalotiopsis sp.

    PubMed

    Yuan, Chao; Ding, Gang; Wang, Hai-Ying; Guo, Yu-Hua; Shang, Hai; Ma, Xiao-Jun; Zou, Zhong-Mei

    2017-01-01

    Five new polyketide-terpene hybrid metabolites ( 1 - 5 ) with highly functionalized groups, together with six known derivatives ( 6 - 11 ), were isolated from the endolichenic fungus Pestalotiopsis sp. Their structures were elucidated by extensive NMR experiments including 1 H, 13 C, HMQC, COSY, and HMBC. The relative configurations of the new compounds were determined by analysis of coupling constants and ROESY correlations. The absolute configurations especially the secondary alcohol at C-15 in 1 and secondary alcohol at C-14 in 5 were established via the CD experiments of the in situ formed [Rh 2 (OCOCF 3 ) 4 ] complex with the acetonide derivatives. These compounds were tested for their inhibition activity against six plant pathogens. Compounds 1 and 5 exhibited pronounced efficiency against Fusarium oxysporum , and compounds 5 and 6 potently inhibited Fusarium gramineum with MIC value of 8  µ g/mL, which revealed the plausible ecological role of endolichenic fungus in providing chemical protection for its host lichen in the fungus-plant relationship. The biosynthetic pathway of compounds 1 - 11 was postulated for the first time, which paved the way for its further biosynthesis research.

  5. Biomimetics of silver nanoparticles by white rot fungus, Phaenerochaete chrysosporium.

    PubMed

    Vigneshwaran, Nadanathangam; Kathe, Arati A; Varadarajan, P V; Nachane, Rajan P; Balasubramanya, R H

    2006-11-01

    Extracellular synthesis of silver nanoparticles by a white rot fungus, Phaenerochaete chrysosporium is reported in this paper. Incubation of P. chrysosporium mycelium with silver nitrate solution produced silver nanoparticles in 24h. These silver nanoparticles were characterized by means of UV-vis spectroscopy, X-ray diffraction analysis, scanning electron microscopy, transmission electron microscopy, and photoluminescence spectroscopy. The synthesized silver nanoparticles absorbed maximum at 470 nm in the visible region. XRD spectrum of the silver nanoparticles confirmed the formation of metallic silver. The SEM characterization of the fungus reacted on the Ag+ indicated that the protein might be responsible for the stabilization of silver nanoparticles. This result was further supported by the TEM examination. Though shape variation was noticed, majority of the nanoparticles were found to be of pyramidal shape as seen under TEM. Photoluminescence spectrum showed a broad emission peak of silver nanoparticles at 423 nm when excited at 350 nm. Apart from eco-friendliness, fungus as bio-manufacturing unit will give us an added advantage in ease of handling when compared to other classes of microorganisms.

  6. Effects of 20 standard amino acids on the growth, total fatty acids production, and γ-linolenic acid yield in Mucor circinelloides.

    PubMed

    Tang, Xin; Zhang, Huaiyuan; Chen, Haiqin; Chen, Yong Q; Chen, Wei; Song, Yuanda

    2014-12-01

    Twenty standard amino acids were examined as single nitrogen source on the growth, total fatty acids production, and yield of γ-linolenic acid (GLA) in Mucor circinelloides. Of the amino acids, tyrosine gave the highest biomass and lipid accumulation and thus resulted in a high GLA yield with respective values of 17.8 g/L, 23 % (w/w, dry cell weight, DCW), and 0.81 g/L, which were 36, 25, and 72 % higher than when the fungus was grown with ammonium tartrate. To find out the potential mechanism underlying the increased lipid accumulation of M. circinelloides when grown on tyrosine, the activity of lipogenic enzymes of the fungus during lipid accumulation phase was measured. The enzyme activities of glucose 6-phosphate dehydrogenase, 6-phosphogluconate dehydrogenase, and ATP-citrate lyase were up-regulated, while NADP-isocitrate dehydrogenase was down-regulated by tyrosine during the lipid accumulation phase of the fungus which suggested that these enzymes may be involved in the increased lipid biosynthesis by tyrosine in this fungus.

  7. Abscisic acid negatively regulates post-penetration resistance of Arabidopsis to the biotrophic powdery mildew fungus.

    PubMed

    Xiao, Xiang; Cheng, Xi; Yin, Kangquan; Li, Huali; Qiu, Jin-Long

    2017-08-01

    Pytohormone abscisic acid (ABA) plays important roles in defense responses. Nonetheless, how ABA regulates plant resistance to biotrophic fungi remains largely unknown. Arabidopsis ABA-deficient mutants, aba2-1 and aba3-1, displayed enhanced resistance to the biotrophic powdery mildew fungus Golovinomyces cichoracearum. Moreover, exogenously administered ABA increased the susceptibility of Arabidopsis to G. cichoracearum. Arabidopsis ABA perception components mutants, abi1-1 and abi2-1, also displayed similar phenotypes to ABA-deficient mutants in resistance to G. cichoracearum. However, the resistance to G. cichoracearum is not changed in downstream ABA signaling transduction mutants, abi3-1, abi4-1, and abi5-1. Microscopic examination revealed that hyphal growth and conidiophore production of G. cichoracearum were compromised in the ABA deficient mutants, even though pre-penetration and penetration growth of the fungus were not affected. In addition, salicylic acid (SA) and MPK3 are found to be involved in ABA-regulated resistance to G. cichoracearum. Our work demonstrates that ABA negatively regulates post-penetration resistance of Arabidopsis to powdery mildew fungus G. cichoracearum, probably through antagonizing the function of SA.

  8. Carbohydrate-active enzymes from the zygomycete fungus Rhizopus oryzae: a highly specialized approach to carbohydrate degradation depicted at genome level

    PubMed Central

    2011-01-01

    Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy) annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs) and a high number of glycosyl transferases (GTs) and carbohydrate esterases (CEs). A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars), chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota. PMID:21241472

  9. Microbially Influenced Corrosion of 304 Stainless Steel and Titanium by P. variotii and A. niger in Humid Atmosphere

    NASA Astrophysics Data System (ADS)

    Zhang, Dawei; Zhou, Feichi; Xiao, Kui; Cui, Tianyu; Qian, Hongchong; Li, Xiaogang

    2015-07-01

    Microbially induced corrosion (MIC) poses significant threats to reliability and safety of engineering materials and structures. While most MIC studies focus on prokaryotic bacteria such as sulfate-reducing bacteria, the influence of fungi on corrosion behaviors of metals has not been adequately reported. In this study, 304 stainless steel and titanium were exposed to two very common fungi, Paecilomyces variotii, Aspergillus niger and their mixtures under highly humid atmosphere. The initial corrosion behaviors within 28 days were studied via scanning Kelvin probe, which showed marked surface ennoblement and increasingly heterogeneous potential distribution upon prolonged fungus exposure. Using stereomicroscopy, fungus growth as well as corrosion morphology of 304 stainless steel and titanium were also evaluated after a long-term exposure for 60 days. The presence of fungi decreased the corrosion resistance for both 304 stainless steel and titanium. Titanium showed higher resistance to fungus growth and the induced corrosion. Exposure to the mixed strains resulted in the highest fungus growth rate but the mildest corrosion, possibly due to the decreased oxygen level by increased fungal activities.

  10. Effect of salinity medium on antioxidant and antidiabetic activity marine endophytic fungus of asperegillus elegans ptf 9

    NASA Astrophysics Data System (ADS)

    Mulyani, Hani; Artanti, Nina; Fitria, Irni; Filailla, Euis; Kandace, Yoice Sri; Udin, Linar Zalinar

    2017-11-01

    Our previous studies on screening of antioxidant activities from various endophytic fungi isolated from marine bioata showed that A. elegans PTF9 isolated from sea weed is one of the fungus that has good antioxidant activity. In current study we reported the effect of medium salinity (0, 3 and 10% salt in PDB medium) on antioxidant and antidiabetes activity of mycelium and filtrate ethyl acetate extracts of A. elegans Ptf 9. The antioxidant assay was conducted using DPPH free radical scavenging activity method. The antidiabetes assay was conducted using a-glucosidase inhibitory activity method. The results showed that the best antioxidant activity was obtained from filtrate extract of fungus cultures with 0% salt (IC50=1.56 ppm), whereas the best antidiabetes activity was obtained from filtrate extract of fungus culture with 10% salt (IC50= 3.64 ppm). Addition of salt reduced the antioxidant activity, but not the antidiabetes activity. The results suggest that A. elegans PTF9 showed potential for further studies on isolation of antioxidant and antidiabetes lead compounds that could be use for further development of new drugs.

  11. Potential for spread of the white-nose fungus (Pseudogymnoascus destructans) in the Americas: use of Maxent and NicheA to assure strict model transference.

    PubMed

    Escobar, Luis E; Lira-Noriega, Andrés; Medina-Vogel, Gonzalo; Townsend Peterson, A

    2014-11-01

    Emerging infectious diseases can present serious threats to wildlife, even to the point of causing extinction. Whitenose fungus (Pseudogymnoascus destructans) is causing an epizootic in bats that is expanding rapidly, both geographically and taxonomically. Little is known of the ecology and distributional potential of this intercontinental pathogen. We address this gap via ecological niche models that characterise coarse resolution niche differences between fungus populations on different continents, identifying areas potentially vulnerable to infection in South America. Here we explore a novel approach to identifying areas of potential distribution across novel geographic regions that avoids perilious extrapolation into novel environments. European and North American fungus populations show differential use of environmental space, but rather than niche differentiation, we find that changes are best attributed to climatic differences between the two continents. Suitable areas for spread of the pathogen were identified across southern South America; however caution should be taken to avoid underestimating the potential for spread of this pathogen in South America.

  12. A fibronectin receptor on Candida albicans mediates adherence of the fungus to extracellular matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klotz, S.A.; Smith, R.L.

    1991-03-01

    Binding of fibronectin, an extracellular matrix (ECM) protein, to Candida albicans was measured, and adherence of the fungus to immobilized ECM proteins, fibronectin, laminin, types I and IV collagen, and subendothelial ECM was studied. 125I-labeled fibronectin was inhibited from binding to the fungus by unlabeled human plasma fibronectin and by Arg-Gly-Asp (RGD), Gly-Arg-Gly-Glu-Ser-Pro (GRGESP), and Gly-Arg-Gly-Asp-Thr-Pro (GRGDTP), but binding was not inhibited by Gly-Arg-Gly-Asp-Ser-Pro. Soluble fibronectin, RGD, GRGESP, and GRGDTP also inhibited fungal adherence to the individual immobilized ECM proteins in a complex pattern, but only soluble fibronectin (10(-7) M) inhibited fungal adherence to subendothelial ECM. Thus, C. albicans possessesmore » at least one type of cell surface receptor for binding soluble fibronectin that can be inhibited with peptides. This receptor apparently is used to bind the fungus to immobilized ECM proteins and to subendothelial ECM and may play a role in the initiation of disseminated disease by bloodborne fungi by providing for adherence of the microorganisms to ECM proteins.« less

  13. The fungus that came in from the cold: dry rot's pre-adapted ability to invade buildings.

    PubMed

    Balasundaram, S V; Hess, J; Durling, M B; Moody, S C; Thorbek, L; Progida, C; LaButti, K; Aerts, A; Barry, K; Grigoriev, I V; Boddy, L; Högberg, N; Kauserud, H; Eastwood, D C; Skrede, I

    2018-03-01

    Many organisms benefit from being pre-adapted to niches shaped by human activity, and have successfully invaded man-made habitats. One such species is the dry rot fungus Serpula lacrymans, which has a wide distribution in buildings in temperate and boreal regions, where it decomposes coniferous construction wood. Comparative genomic analyses and growth experiments using this species and its wild relatives revealed that S. lacrymans evolved a very effective brown rot decay compared to its wild relatives, enabling an extremely rapid decay in buildings under suitable conditions. Adaptations in intracellular transport machineries promoting hyphal growth, and nutrient and water transport may explain why it is has become a successful invader of timber in houses. Further, we demonstrate that S. lacrymans has poor combative ability in our experimental setup, compared to other brown rot fungi. In sheltered indoor conditions, the dry rot fungus may have limited encounters with other wood decay fungi compared to its wild relatives. Overall, our analyses indicate that the dry rot fungus is an ecological specialist with poor combative ability against other fungi.

  14. Overexpression of the wasabi defensin gene confers enhanced resistance to blast fungus ( Magnaporthe grisea) in transgenic rice.

    PubMed

    Kanzaki, H.; Nirasawa, S.; Saitoh, H.; Ito, M.; Nishihara, M.; Terauchi, R.; Nakamura, I.

    2002-11-01

    Transgenic rice ( Oryza sativa cv. Sasanishiki) overexpressing the wasabi defensin gene, a plant defensin effective against the rice blast fungus, was generated by Agrobacterium tumefaciens-mediated transformation. Twenty-two T2 homozygous lines harboring the wasabi defensin gene were challenged by the blast fungus. Transformants exhibited resistance to rice blast at various levels. The inheritance of the resistance over generations was investigated. T3 plants derived from two highly blast-resistant T2 lines (WT14-5 and WT43-5) were challenged with the blast fungus using the press-injured spots method. The average size of disease lesions of the transgenic line WT43-5 was reduced to about half of that of non-transgenic plants. The 5-kDa peptide, corresponding to the processed form of the wasabi defensin, was detected in the total protein fraction extracted from the T3 progeny. Transgenic rice plants overproducing wasabi defensin are expected to possess a durable and wide-spectrum resistance (i.e. field resistance) against various rice blast races.

  15. Muscodor kashayum sp. nov. – a new volatile anti-microbial producing endophytic fungus

    PubMed Central

    Meshram, Vineet; Kapoor, Neha; Saxena, Sanjai

    2014-01-01

    Muscodor kashayum (MycoBank no.: MB 803800; GenBank no.: KC481680) is a newly described endophytic fungus of a medicinal plant Aegle marmelos (Bael tree), growing in the tropical conserved rainforest in the Western Ghats of India. Muscodor kashayum possesses distinct morphological, molecular and physiological features from the earlier reported Muscodor species. The fungus forms characteristic rings of the ropy mycelium on potato dextrose agar medium. This sterile fungus is characterised by the presence of a pungent smell which is attributable to a blend of more than 23 volatile organic constituents, predominantly 3-cyclohexen-1-ol,1-(1,5-dimethyl-4-hexenyl)-4-methyl; 1,6-dioxacyclododecane-7,12-dione; 2,6-bis(1,1-dimethylethyl)-4-(1-oxopropyl) phenol; 2,4-di-tert-butylthiophenol and 4-octadecylmorpholine. In the in vitro anti-microbial assay using M. kashayum, growth of 75% of test fungi/yeasts and 72% of the test bacteria were completely inhibited. Therefore, M. Kashayum holds potential for future application to be used as a myco-fumigation agent. PMID:24587960

  16. Identification and Characterization of Lipopeptides from Bacillus subtilis B1 Against Sapstain Fungus of Rubberwood Through MALDI-TOF-MS and RT-PCR.

    PubMed

    Sajitha, K L; Dev, Suma Arun; Maria Florence, E J

    2016-07-01

    Bacillus subtilis is a potent biocontrol agent producing a wide array of antifungal lipopeptides for the inhibition of fungal growth. B. subtilis B1 isolated from market-available compost provided an efficient control of rubberwood sapstain fungus, Lasiodiplodia theobromae. The current study is aimed to identify and characterize the lipopeptides responsible for the biocontrol of rubberwood sapstain fungus by Bacillus subtilis B1. The bacterial whole-cell surface extract from the dual culture of B. subtilis B1 and sapstain fungus (L. theobromae) was analysed using MALDI-TOF-MS. The protonated as well as sodium, potassium adducts of homologues of iturin C, surfactin, bacillomycin D and fengycin A and B were identified and expression of the lipopeptide biosynthetic genes could be confirmed through RT-PCR. This is the first report of mycobacillin and trimethylsilyl derivative of bacilysin during antagonism through MALDI-TOF-MS. MALDI-TOF-MS with RT-PCR offered easy platforms to characterize the antifungal lipopeptides. The identification of antifungal lipopeptides can lead to the formulation of prospective biocontrol by-products which have wide-scale utility.

  17. Comparative vesicle proteomics reveals selective regulation of protein expression in chestnut blight fungus by a hypovirus.

    PubMed

    Wang, Jinzi; Wang, Fangzhen; Feng, Youjun; Mi, Ke; Chen, Qi; Shang, Jinjie; Chen, Baoshan

    2013-01-14

    The chestnut blight fungus (Cryphonectria parasitica) and hypovirus constitute a model system to study fungal pathogenesis and mycovirus-host interaction. Knowledge in this field has been gained largely from investigations at gene transcription level so far. Here we report a systematic analysis of the vesicle proteins of the host fungus with/without hypovirus infection. Thirty-three differentially expressed protein spots were identified in the purified vesicle protein samples by two-dimensional electrophoresis and mass spectrometry. Down-regulated proteins were mostly cargo proteins involved in primary metabolism and energy generation and up-regulated proteins were mostly vesicle associated proteins and ABC transporter. A virus-encoded protein p48 was found to have four forms with different molecular mass in vesicles from the virus-infected strain. While a few of the randomly selected differentially expressed proteins were in accordance with their transcription profiles, majority were not in agreement with their mRNA accumulation patterns, suggesting that an extensive post-transcriptional regulation may have occurred in the host fungus upon a hypovirus infection. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Treatment of a Textile Effluent from Dyeing with Cochineal Extracts Using Trametes versicolor Fungus

    PubMed Central

    Arroyo-Figueroa, Gabriela; Ruiz-Aguilar, Graciela M. L.; López-Martínez, Leticia; González-Sánchez, Guillermo; Cuevas-Rodríguez, Germán; Rodríguez-Vázquez, Refugio

    2011-01-01

    Trametes versicolor (Tv) fungus can degrade synthetic dyes that contain azo groups, anthraquinone, triphenylmethane polymers, and heterocyclic groups. However, no references have been found related to the degradation of natural dyes, such as the carminic acid that is contained in the cochineal extract. Experiments to determine the decolorization of the effluent used in the cotton dyeing process with cochineal extract by means of Tv fungus were done. Treatments to determine decolorization in the presence or absence of Kirk's medium, glucose, and fungus, with an addition of 50% (v v-1) of nonsterilized effluent were performed. Physicochemical characterization was performed at the start and end of the treatment. Degradation kinetics were determined. A direct relationship was found between the dry weight of fungi, pH, and the decolorization system, with higher decolorization at lower pH levels (pH ~4.3). High decolorization (81% ± 0.09; 88% ± 0.17; and 99% ± 0.04) for three of the eight treatments (Kirk's medium without glucose, Kirk's medium with glucose, and without medium with glucose, respectively) was found. Toxicity tests determined an increase in the initial effluent toxicity (7.33 TU) compared with the final treatment (47.73 TU) in a period of 11 days. For this system, a degradation sequence of the carminic acid structure present in the effluent by the Tv fungus is suggested, in which it is seen that metabolites still containing aromatic structures are generated. PMID:21552764

  19. Bryophytes and lichens: Small but indispensable forest dwellers

    USGS Publications Warehouse

    Hutten, Martin; Woodward, Andrea

    2002-01-01

    * What is a Bryophyte? * Bryophytes are the small green plants commonly known as mosses, liverworts and hornworts. Compared to plants, they have primitive tissues for conducting food and water, and they lack a protective outer surface to maintain water balance. Most bryophytes, because they lack tissues such as roots, obtain their water through direct surface contact with their environment. During dry weather they have the capacity to withstand complete dehydration. Bryophytes that are dry may appear dead but will regain normal function when moisture is available. Instead of producing seeds, bryophytes can either reproduce sexually by means of spores, or asexually when small pieces break off and grow into new individuals. * What is a Lichen? * Lichens are dual organisms consisting of a fungus and an alga or a cyanobacterium. The fungus provides the alga with structure, protection, nutrients, and water absorbed from the atmosphere and the substrate (e.g., soil, rotten logs, tree branches). In return, the alga provides carbohydrates from photosynthesis to the fungus. Algae from some lichens grow independently of the fungus, but in lichen form, the algae can inhabit more challenging environments than when growing alone. Most lichens can reproduce asexually. They either produce specialized propagules containing both partners, or parts of the lichen simply break, allowing both the fungus and the alga to disperse together. In some lichens, the fungal partner reproduces sexually by releasing spores, but the partner alga must be present in order for a lichen to reform.

  20. Amphibians acquire resistance to live and dead fungus overcoming fungal immunosuppression.

    PubMed

    McMahon, Taegan A; Sears, Brittany F; Venesky, Matthew D; Bessler, Scott M; Brown, Jenise M; Deutsch, Kaitlin; Halstead, Neal T; Lentz, Garrett; Tenouri, Nadia; Young, Suzanne; Civitello, David J; Ortega, Nicole; Fites, J Scott; Reinert, Laura K; Rollins-Smith, Louise A; Raffel, Thomas R; Rohr, Jason R

    2014-07-10

    Emerging fungal pathogens pose a greater threat to biodiversity than any other parasitic group, causing declines of many taxa, including bats, corals, bees, snakes and amphibians. Currently, there is little evidence that wild animals can acquire resistance to these pathogens. Batrachochytrium dendrobatidis is a pathogenic fungus implicated in the recent global decline of amphibians. Here we demonstrate that three species of amphibians can acquire behavioural or immunological resistance to B. dendrobatidis. Frogs learned to avoid the fungus after just one B. dendrobatidis exposure and temperature-induced clearance. In subsequent experiments in which B. dendrobatidis avoidance was prevented, the number of previous exposures was a negative predictor of B. dendrobatidis burden on frogs and B. dendrobatidis-induced mortality, and was a positive predictor of lymphocyte abundance and proliferation. These results suggest that amphibians can acquire immunity to B. dendrobatidis that overcomes pathogen-induced immunosuppression and increases their survival. Importantly, exposure to dead fungus induced a similar magnitude of acquired resistance as exposure to live fungus. Exposure of frogs to B. dendrobatidis antigens might offer a practical way to protect pathogen-naive amphibians and facilitate the reintroduction of amphibians to locations in the wild where B. dendrobatidis persists. Moreover, given the conserved nature of vertebrate immune responses to fungi and the fact that many animals are capable of learning to avoid natural enemies, these results offer hope that other wild animal taxa threatened by invasive fungi might be rescued by management approaches based on herd immunity.

  1. Treatment of a textile effluent from dyeing with cochineal extracts using Trametes versicolor fungus.

    PubMed

    Arroyo-Figueroa, Gabriela; Ruiz-Aguilar, Graciela M L; López-Martínez, Leticia; González-Sánchez, Guillermo; Cuevas-Rodríguez, Germán; Rodríguez-Vázquez, Refugio

    2011-05-05

    Trametes versicolor (Tv) fungus can degrade synthetic dyes that contain azo groups, anthraquinone, triphenylmethane polymers, and heterocyclic groups. However, no references have been found related to the degradation of natural dyes, such as the carminic acid that is contained in the cochineal extract. Experiments to determine the decolorization of the effluent used in the cotton dyeing process with cochineal extract by means of Tv fungus were done. Treatments to determine decolorization in the presence or absence of Kirk's medium, glucose, and fungus, with an addition of 50% (v v-1) of nonsterilized effluent were performed. Physicochemical characterization was performed at the start and end of the treatment. Degradation kinetics were determined. A direct relationship was found between the dry weight of fungi, pH, and the decolorization system, with higher decolorization at lower pH levels (pH ~4.3). High decolorization (81% ± 0.09; 88% ± 0.17; and 99% ± 0.04) for three of the eight treatments (Kirk's medium without glucose, Kirk's medium with glucose, and without medium with glucose, respectively) was found. Toxicity tests determined an increase in the initial effluent toxicity (7.33 TU) compared with the final treatment (47.73 TU) in a period of 11 days. For this system, a degradation sequence of the carminic acid structure present in the effluent by the Tv fungus is suggested, in which it is seen that metabolites still containing aromatic structures are generated.

  2. Evidence for biological shaping of hair ice

    NASA Astrophysics Data System (ADS)

    Hofmann, D.; Preuss, G.; Mätzler, C.

    2015-07-01

    An unusual ice type, called hair ice, grows on the surface of dead wood of broad-leaf trees at temperatures slightly below 0 °C. We describe this phenomenon and present physical, chemical, and biological investigations to gain insight in the properties and processes related to hair ice. Tests revealed that the biological activity of a winter-active fungus is required in the wood for enabling the growth of hair ice. We confirmed the fungus hypothesis originally suggested by Wegener (1918) by reproducing hair ice on wood samples. Treatment by heat and fungicide suppresses the formation of hair ice. Fruiting bodies of Asco- and Basidiomycota are identified on hair-ice-carrying wood. One species, Exidiopsis effusa (Ee), was present on all investigated samples. Both hair-ice-producing wood samples and those with killed fungus show essentially the same temperature variation, indicating that the heat produced by fungal metabolism is very small, that the freezing rate is not influenced by the fungus activity, and that ice segregation is the common mechanism of ice growth on the wood surface. The fungus plays the role of shaping the ice hairs and preventing them from recrystallisation. Melted hair ice indicates the presence of organic matter. Chemical analyses show a complex mixture of several thousand CHO(N,S) compounds similar to fulvic acids in dissolved organic matter (DOM). The evaluation reveals decomposed lignin as being the main constituent. Further work is needed to clarify its role in hair-ice growth and to identify the recrystallisation inhibitor.

  3. Evidence for biological shaping of hair ice

    NASA Astrophysics Data System (ADS)

    Hofmann, D.; Preuss, G.; Mätzler, C.

    2015-04-01

    An unusual ice type, called hair ice, grows on the surface of dead wood of broad-leaf trees at temperatures slightly below 0 °C. We describe this phenomenon and present physical, chemical, and biological investigations to gain insight in the properties and processes related to hair ice. Tests revealed that the biological activity of a winter-active fungus is required in the wood for enabling the growth of hair ice. We confirmed the fungus hypothesis originally suggested by Wegener (1918) by reproducing hair ice on wood samples. Treatment by heat and fungicide, respectively, suppresses the formation of hair ice. Fruiting bodies of Asco- and Basidiomycota are identified on hair-ice carrying wood. One species, Exidiopsis effusa (Ee), has been present on all investigated samples. Both hair-ice producing wood samples and those with killed fungus show essentially the same temperature variation, indicating that the heat produced by fungal metabolism is very small, that the freezing rate is not influenced by the fungus activity and that ice segregation is the common mechanism of ice growth at the wood surface. The fungus plays the role of shaping the ice hairs and to prevent them from recrystallisation. Melted hair ice indicates the presence of organic matter. Chemical analyses show a complex mixture of several thousand CHO(N,S)-compounds similar to fulvic acids in dissolved organic matter (DOM). The evaluation reveals decomposed lignin as the main constituent. Further work is needed to clarify its role in hair-ice growth and to identify the recrystallisation inhibitor.

  4. A Brazilian social bee must cultivate fungus to survive.

    PubMed

    Menezes, Cristiano; Vollet-Neto, Ayrton; Marsaioli, Anita Jocelyne; Zampieri, Davila; Fontoura, Isabela Cardoso; Luchessi, Augusto Ducati; Imperatriz-Fonseca, Vera Lucia

    2015-11-02

    The nests of social insects provide suitable microenvironments for many microorganisms as they offer stable environmental conditions and a rich source of food [1-4]. Microorganisms in turn may provide several benefits to their hosts, such as nutrients and protection against pathogens [1, 4-6]. Several examples of symbiosis between social insects and microorganisms have been found in ants and termites. These symbioses have driven the evolution of complex behaviors and nest structures associated with the culturing of the symbiotic microorganisms [5, 7, 8]. However, while much is known about these relationships in many species of ants and termites, symbiotic relationships between microorganisms and social bees have been poorly explored [3, 4, 9, 10]. Here, we report the first case of an obligatory relationship between the Brazilian stingless bee Scaptotrigona depilis and a fungus of the genus Monascus (Ascomycotina). Fungal mycelia growing on the provisioned food inside the brood cell are eaten by the larva. Larvae reared in vitro on sterilized larval food supplemented with fungal mycelia had a much higher survival rate (76%) compared to larvae reared under identical conditions but without fungal mycelia (8% survival). The fungus was found to originate from the material from which the brood cells are made. Since the bees recycle and transport this material between nests, fungus would be transferred to newly built cells and also to newly founded nests. This is the first report of a fungus cultivation mutualism in a social bee. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Paracoccidioides brasiliensis interferes on dendritic cells maturation by inhibiting PGE2 production.

    PubMed

    Fernandes, Reginaldo K; Bachiega, Tatiana F; Rodrigues, Daniela R; Golim, Marjorie de A; Dias-Melicio, Luciane A; Balderramas, Helanderson de A; Kaneno, Ramon; Soares, Ângela M V C

    2015-01-01

    Paracoccidioidomycosis (PCM) is a systemic mycosis, endemic in most Latin American countries, especially in Brazil, whose etiologic agent is the thermodimorphic fungus of the genus Paracoccidioides, comprising cryptic species of Paracoccidioides brasiliensis, S1, PS2, PS3 and Paracoccidioides lutzii. The mechanisms involved in the initial interaction of the fungus with cells of the innate immune response, as dendritic cells (DCs), deserve to be studied. Prostaglandins (PGs) are eicosanoids that play an important role in modulating functions of immune cells including DCs. Here we found that human immature DCs derived from the differentiation of monocytes cultured with GM-CSF and IL-4 release substantial concentrations of PGE2, which, however, were significantly inhibited after challenge with P. brasiliensis. In vitro blocking of pattern recognition receptors (PRRs) by monoclonal antibodies showed the involvement of mannose receptor (MR) in PGE2 inhibition by the fungus. In addition, phenotyping assays showed that after challenge with the fungus, DCs do not change their phenotype of immature cells to mature ones, as well as do not produce IL-12 p70 or adequate concentrations of TNF-α. Assays using exogenous PGE2 confirmed an association between PGE2 inhibition and failure of cells to phenotypically mature in response to P. brasiliensis. We conclude that a P. brasiliensis evasion mechanism exists associated to a dysregulation on DC maturation. These findings may provide novel information for the understanding of the complex interplay between the host and this fungus.

  6. Immune-physiological aspects of synergy between avermectins and the entomopathogenic fungus Metarhizium robertsii in Colorado potato beetle larvae.

    PubMed

    Tomilova, Oksana G; Kryukov, Vadim Yu; Duisembekov, Bahytzhan A; Yaroslavtseva, Olga N; Tyurin, Maksim V; Kryukova, Natalia A; Skorokhod, Valery; Dubovskiy, Ivan M; Glupov, Viktor V

    2016-10-01

    The interaction between the entomopathogenic fungus Metarhizium robertsii and natural avermectin metabolites of the actinomycete Streptomyces avermitilis were investigated on Colorado potato beetle larvae. A synergy in the mortality of larvae was detected after simultaneous treatment with half-lethal doses of avermectins (commercial name actarophit) 0.005% and fungus (5×10 5 conidia/ml). The treatment with avermectins led to rapid fungal colonization of the hemolymph. The defense strategies of insects infected by fungus and treated with avermectins and untreated insects were compared to investigate the mechanisms of this synergy. We have shown an increase in hemocytes, especially immunocompetent cells - plasmatocytes and granular cells in the initial stages of mycosis (third day post inoculation). In contrast, avermectins suppressed cellular immunity in hemolymph. Specifically, avermectins dramatically decreased the count of granular cells in larvae infected and uninfected with fungus. Apoptosis inducement and hemocyte necrosis under the influence of avermectins has been shown in vitro as one of the possible reasons for hemocyte mortality. In addition, avermectins enhanced the activity of phenoloxidases in integuments and hemolymph and increased the activity of glutathione-S-transferases activity in the fat body and hemolymph of infected and uninfected larvae, thereby intensifying the development of fungal infection by M. robertsii in Colorado potato beetle larvae. The combination of fungal infection and avermectins constitutes a new perspective for developing multicomponent bioinsecticides. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Identification of Immunity-Related Genes in Dialeurodes citri against Entomopathogenic Fungus Lecanicillium attenuatum by RNA-Seq Analysis.

    PubMed

    Yu, Shijiang; Ding, Lili; Luo, Ren; Li, Xiaojiao; Yang, Juan; Liu, Haoqiang; Cong, Lin; Ran, Chun

    2016-01-01

    Dialeurodes citri is a major pest in citrus producing areas, and large-scale outbreaks have occurred increasingly often in recent years. Lecanicillium attenuatum is an important entomopathogenic fungus that can parasitize and kill D. citri. We separated the fungus from corpses of D. citri larvae. However, the sound immune defense system of pests makes infection by an entomopathogenic fungus difficult. Here we used RNA sequencing technology (RNA-Seq) to build a transcriptome database for D. citri and performed digital gene expression profiling to screen genes that act in the immune defense of D. citri larvae infected with a pathogenic fungus. De novo assembly generated 84,733 unigenes with mean length of 772 nt. All unigenes were searched against GO, Nr, Swiss-Prot, COG, and KEGG databases and a total of 28,190 (33.3%) unigenes were annotated. We identified 129 immunity-related unigenes in transcriptome database that were related to pattern recognition receptors, information transduction factors and response factors. From the digital gene expression profile, we identified 441 unigenes that were differentially expressed in D. citri infected with L. attenuatum. Through calculated Log2Ratio values, we identified genes for which fold changes in expression were obvious, including cuticle protein, vitellogenin, cathepsin, prophenoloxidase, clip-domain serine protease, lysozyme, and others. Subsequent quantitative real-time polymerase chain reaction analysis verified the results. The identified genes may serve as target genes for microbial control of D. citri.

  8. Entomopathogenicity and Biological Attributes of Himalayan Treasured Fungus Ophiocordyceps sinensis (Yarsagumba)

    PubMed Central

    Baral, Bikash

    2017-01-01

    Members of the entomophagous fungi are considered very crucial in the fungal domain relative to their natural phenomenon and economic perspectives; however, inadequate knowledge of their mechanisms of interaction keeps them lagging behind in parallel studies of fungi associated with agro-ecology, forest pathology and medical biology. Ophiocordyceps sinensis (syn. Cordyceps sinensis), an intricate fungus-caterpillar complex after it parasitizes the larva of the moth, is a highly prized medicinal fungus known widely for ages due to its peculiar biochemical assets. Recent technological innovations have significantly contributed a great deal to profiling the variable clinical importance of this fungus and other related fungi with similar medicinal potential. However, a detailed mechanism behind fungal pathogenicity and fungal-insect interactions seems rather ambiguous and is poorly justified, demanding special attention. The goal of the present review is to divulge an update on the published data and provides promising insights on different biological events that have remained underemphasized in previous reviews on fungal biology with relation to life-history trade-offs, host specialization and selection pressures. The infection of larvae by a fungus is not a unique event in Cordyceps; hence, other fungal species are also reviewed for effective comparison. Conceivably, the rationale and approaches behind the inheritance of pharmacological abilities acquired and stored within the insect framework at a time when they are completely hijacked and consumed by fungal parasites, and the molecular mechanisms involved therein, are clearly documented. PMID:29371523

  9. Identification of Immunity-Related Genes in Dialeurodes citri against Entomopathogenic Fungus Lecanicillium attenuatum by RNA-Seq Analysis

    PubMed Central

    Yu, Shijiang; Ding, Lili; Luo, Ren; Li, Xiaojiao; Yang, Juan; Liu, Haoqiang; Cong, Lin; Ran, Chun

    2016-01-01

    Dialeurodes citri is a major pest in citrus producing areas, and large-scale outbreaks have occurred increasingly often in recent years. Lecanicillium attenuatum is an important entomopathogenic fungus that can parasitize and kill D. citri. We separated the fungus from corpses of D. citri larvae. However, the sound immune defense system of pests makes infection by an entomopathogenic fungus difficult. Here we used RNA sequencing technology (RNA-Seq) to build a transcriptome database for D. citri and performed digital gene expression profiling to screen genes that act in the immune defense of D. citri larvae infected with a pathogenic fungus. De novo assembly generated 84,733 unigenes with mean length of 772 nt. All unigenes were searched against GO, Nr, Swiss-Prot, COG, and KEGG databases and a total of 28,190 (33.3%) unigenes were annotated. We identified 129 immunity-related unigenes in transcriptome database that were related to pattern recognition receptors, information transduction factors and response factors. From the digital gene expression profile, we identified 441 unigenes that were differentially expressed in D. citri infected with L. attenuatum. Through calculated Log2Ratio values, we identified genes for which fold changes in expression were obvious, including cuticle protein, vitellogenin, cathepsin, prophenoloxidase, clip-domain serine protease, lysozyme, and others. Subsequent quantitative real-time polymerase chain reaction analysis verified the results. The identified genes may serve as target genes for microbial control of D. citri. PMID:27644092

  10. The relationship between an endangered North American tree and an endophytic fungus.

    PubMed

    Lee, J C; Yang, X; Schwartz, M; Strobel, G; Clardy, J

    1995-11-01

    The Florida torreya (Torreya taxifolia) began a catastrophic decline in the late 1950s and is now the rarest tree in North America for which a full species designation has been established. The trees have common plant disease symptoms, but the reason for the decline has never been identified. T. taxifolia's imminent extinction gains special poignancy through its close relationship to the Pacific yew (Taxus brevifolia), which produces the potent anticancer agent, taxol. An examination of the endophytic fungal communities of wild torreyas consistently found a filamentous fungus, Pestalotiopsis microspora, associated with diseased trees and also with most symptomless trees. P. microspora can be cultured in the laboratory, and when it is introduced into greenhouse-grown torreyas, it causes disease symptoms similar to those seen in the field. The fungus can then be reisolated from these deliberately infected trees. The phytotoxins pestalopyrone, hydroxypestalopyrone and pestaloside have been isolated and characterized from axenic fungal cultures, and both pestalopyrone and hydroxypestalopyrone can be isolated from artificially infected torreyas. In addition, pestaloside has antifungal activity against other fungal endophytes of T. taxifolia. The filamentous fungus, P. microspora, has an endophytic-pathologic relationship with T. taxifolia. The fungus resides in the inner bark of symptomless trees, and physiological or environmental factors could trigger its pathological activity. P. microspora produces the phytotoxins pestalopyrone, hydroxypestalopyrone, and pestaloside which give rise to the disease. Pestaloside, which also has antifungal activity, could reduce competition from other fungal endophytes within the host.

  11. Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

    PubMed Central

    Aylward, Frank O; Burnum, Kristin E; Scott, Jarrod J; Suen, Garret; Tringe, Susannah G; Adams, Sandra M; Barry, Kerrie W; Nicora, Carrie D; Piehowski, Paul D; Purvine, Samuel O; Starrett, Gabriel J; Goodwin, Lynne A; Smith, Richard D; Lipton, Mary S; Currie, Cameron R

    2012-01-01

    Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant neotropical herbivores cultivate symbiotic fungus gardens on large quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers. Using metagenomic and metaproteomic techniques, we characterize the bacterial diversity and physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter and Escherichia. We show that these bacterial communities possess genes associated with lignocellulose degradation and diverse biosynthetic pathways, suggesting that they play a role in nutrient cycling by converting the nitrogen-poor forage of the ants into B-vitamins, amino acids and other cellular components. Our metaproteomic analysis confirms that bacterial glycosyl hydrolases and proteins with putative biosynthetic functions are produced in both field-collected and laboratory-reared colonies. These results are consistent with the hypothesis that fungus gardens are specialized fungus–bacteria communities that convert plant material into energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities in the ecology and evolution of herbivorous metazoans. PMID:22378535

  12. Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

    PubMed Central

    Aylward, Frank O.; Burnum-Johnson, Kristin E.; Tringe, Susannah G.; Teiling, Clotilde; Tremmel, Daniel M.; Moeller, Joseph A.; Scott, Jarrod J.; Barry, Kerrie W.; Piehowski, Paul D.; Nicora, Carrie D.; Malfatti, Stephanie A.; Monroe, Matthew E.; Purvine, Samuel O.; Goodwin, Lynne A.; Smith, Richard D.; Weinstock, George M.; Gerardo, Nicole M.; Suen, Garret; Lipton, Mary S.

    2013-01-01

    Plants represent a large reservoir of organic carbon comprised primarily of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous fungus that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass is degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and, using genomic and metaproteomic tools, we investigate its role in lignocellulose degradation in the gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in ant gardens and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that likely play an important role in lignocellulose degradation. Our study provides a detailed analysis of plant biomass degradation in leaf-cutter ant fungus gardens and insight into the enzymes underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar. PMID:23584789

  13. Bioactive Constituents from an Endophytic Fungus, Penicillium polonicum NFW9, Associated with Taxus fauna.

    PubMed

    Fatima, Nighat; Sripisut, Tawanun; Youn, Ui J; Ahmed, Safia; Ul-Haq, Ihsan; Munoz-Acuna, Ulyana; Simmons, Charles J; Qazi, Muneer A; Jadoon, Muniba; Tan, Ghee T; de Blanco, Esperanza J C; Chang, Leng C

    2017-01-01

    Endophytic fungi are being recognized as vital and untapped sources of a variety of structurally novel and unique bioactive secondary metabolites in the field of natural products drug discovery. Herein, this study reports the isolation and characterization of secondary metabolites from an endophytic fungus Penicillium polonicum (NFW9) associated with Taxus fuana. The extracts of the endophytic fungus cultured on potato dextrose agar were purified using several chromatographic techniques. Biological evaluation was performed based on their abilities to inhibit tumor necrosis factor-alpha (TNF-α)-induced nuclear factor-kappa B (NF-κB) and cytotoxicity assays. Bioactivity-directed fractionation of the ethyl acetate extract of a fermentation culture of an endophytic fungus, Penicillium polonicum led to the isolation of a dimeric anthraquinone, (R)- 1,1',3,3',5,5'-hexahydroxy-7,7'-dimethyl[2,2'-bianthracene]-9,9',10,10'-tetraone (1), a steroidal furanoid (-)-wortmannolone (2), along with three other compounds (3-4). Moreover, this is the first report on the isolation of compound 1 from an endophytic fungus. All purified metabolites were characterized by NMR and MS data analyses. The stereo structure of compound 1 was determined by the measurement of specific optical rotation and CD spectrum. The relative stereochemistry of 2 was confirmed by single-crystal X-ray diffraction. Compounds 2-3 showed inhibitory activities in the TNF-α-induced NF-κB assay with IC50 values in the range of 0.47-2.11 µM. Compounds 1, 4 and 5 showed moderate inhibition against NF-κB and cancer cell lines. The endophytic fungus Penicillium polonicum of Taxus fuana is capable of producing biologically active natural compounds. Our results provide a scientific rationale for further chemical investigations into endophyte-producing natural products, drug discovery and development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Metabolic responses of Beauveria bassiana to hydrogen peroxide-induced oxidative stress using an LC-MS-based metabolomics approach.

    PubMed

    Zhang, Chen; Wang, Wei; Lu, Ruili; Jin, Song; Chen, Yihui; Fan, Meizhen; Huang, Bo; Li, Zengzhi; Hu, Fenglin

    2016-06-01

    The entomopathogenic fungus, Beauveria bassiana, is commonly used as a biological agent for pest control. Environmental and biological factors expose the fungus to oxidative stress; as a result, B. bassiana has adopted a number of anti-oxidant mechanisms. In this study, we investigated metabolites of B. bassiana that are formed in response to oxidative stress from hydrogen peroxide (H2O2) by using a liquid chromatography mass spectrometry (LC-MS) approach. Partial least-squares discriminant analysis (PLS-DA) revealed differences between the control and the H2O2-treated groups. Hierarchical cluster analysis (HCA) showed 18 up-regulated metabolites and 25 down-regulated metabolites in the H2O2-treated fungus. Pathway analysis indicated that B. bassiana may be able to alleviate oxidative stress by enhancing lipid catabolism and glycometabolism, thus decreasing membrane polarity and preventing polar H2O2 or ROS from permeating into fungal cells and protecting cells against oxidative injury. Meanwhile, most of the unsaturated fatty acids that are derived from glycerophospholipids hydrolysis can convert into oxylipins through autoxidation, which can prevent the reactive oxygen of H2O2 from attacking important macromolecules of the fungus. Results showed also that H2O2 treatment can enhance mycotoxins production which implies that oxidative stress may be able to increase the virulence of the fungus. In comparison to the control group, citric acid and UDP-N-acetylglucosamine were down-regulated, which suggested that metabolic flux was occurring to the TCA cycle and enhancing carbohydrate metabolism. The findings from this study will contribute to the understanding of how the molecular mechanisms of fungus respond to environmental and biological stress factors as well as how the manipulation of such metabolisms may lead to selection of more effective fungal strains for pest control. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Rice Blast Fungus (Magnaporthe oryzae) Infects Arabidopsis via a Mechanism Distinct from That Required for the Infection of Rice1[W][OA

    PubMed Central

    Park, Ju-Young; Jin, Jianming; Lee, Yin-Won; Kang, Seogchan; Lee, Yong-Hwan

    2009-01-01

    Magnaporthe oryzae is a hemibiotrophic fungal pathogen that causes rice (Oryza sativa) blast. Although M. oryzae as a whole infects a wide variety of monocotyledonous hosts, no dicotyledonous plant has been reported as a host. We found that two rice pathogenic strains of M. oryzae, KJ201 and 70-15, interacted differentially with 16 ecotypes of Arabidopsis (Arabidopsis thaliana). Strain KJ201 infected all ecotypes with varying degrees of virulence, whereas strain 70-15 caused no symptoms in certain ecotypes. In highly susceptible ecotypes, small chlorotic lesions appeared on infected leaves within 3 d after inoculation and subsequently expanded across the affected leaves. The fungus produced spores in susceptible ecotypes but not in resistant ecotypes. Fungal cultures recovered from necrotic lesions caused the same symptoms in healthy plants, satisfying Koch's postulates. Histochemical analyses showed that infection by the fungus caused an accumulation of reactive oxygen species and eventual cell death. Similar to the infection process in rice, the fungus differentiated to form appressorium and directly penetrated the leaf surface in Arabidopsis. However, the pathogenic mechanism in Arabidopsis appears distinct from that in rice; three fungal genes essential for pathogenicity in rice played only limited roles in causing disease symptoms in Arabidopsis, and the fungus seems to colonize Arabidopsis as a necrotroph through the secretion of phytotoxic compounds, including 9,12-octadecadienoic acid. Expression of PR-1 and PDF1.2 was induced in response to infection by the fungus, suggesting the activation of salicylic acid- and jasmonic acid/ethylene-dependent signaling pathways. However, the roles of these signaling pathways in defense against M. oryzae remain unclear. In combination with the wealth of genetic and genomic resources available for M. oryzae, this newly established pathosystem allows comparison of the molecular and cellular mechanisms underlying pathogenesis and host defense in two well-studied model plants. PMID:18987215

  16. Ecology of coarse wood decomposition by the saprotrophic fungus Fomes fomentarius.

    PubMed

    Větrovský, Tomáš; Voříšková, Jana; Snajdr, Jaroslav; Gabriel, Jiří; Baldrian, Petr

    2011-07-01

    Saprotrophic wood-inhabiting basidiomycetes are the most important decomposers of lignin and cellulose in dead wood and as such they attracted considerable attention. The aims of this work were to quantify the activity and spatial distribution of extracellular enzymes in coarse wood colonised by the white-rot basidiomycete Fomes fomentarius and in adjacent fruitbodies of the fungus and to analyse the diversity of the fungal and bacterial community in a fungus-colonised wood and its potential effect on enzyme production by F. fomentarius. Fungus-colonised wood and fruitbodies were collected in low management intensity forests in the Czech Republic. There were significant differences in enzyme production by F. fomentarius between Betula pendula and Fagus sylvatica wood, the activity of cellulose and xylan-degrading enzymes was significantly higher in beech wood than in birch wood. Spatial analysis of a sample B. pendula log segment proved that F. fomentarius was the single fungal representative found in the log. There was a high level of spatial variability in the amount of fungal biomass detected, but no effects on enzyme activities were observed. Samples from the fruiting body showed high β-glucosidase and chitinase activities compared to wood samples. Significantly higher levels of xylanase and cellobiohydrolase were found in samples located near the fruitbody (proximal), and higher laccase and Mn-peroxidase activities were found in the distal ones. The microbial community in wood was dominated by the fungus (fungal to bacterial DNA ratio of 62-111). Bacterial abundance composition was lower in proximal than distal parts of wood by a factor of 24. These results show a significant level of spatial heterogeneity in coarse wood. One of the explanations may be the successive colonization of wood by the fungus: due to differential enzyme production, the rates of biodegradation of coarse wood are also spatially inhomogeneous.

  17. Pathogenic and enzyme activities of the entomopathogenic fungus Tolypocladium cylindrosporum (Ascomycota: Hypocreales) from Tierra del Fuego, Argentina.

    PubMed

    Scorsetti, Ana C; Elíades, Lorena A; Stenglein, Sebastián A; Cabello, Marta N; Pelizza, Sebastián A; Saparrat, Mario C N

    2012-06-01

    Tolypocladium cylindrosporum is an entomopathogenic fungi that has been studied as a biological control agent against insects of several orders. The fungus has been isolated from the soil as well as from insects of the orders Coleoptera, Lepidoptera, Diptera and Hymenoptera. In this study, we analyzed the ability of a strain of T cylindrosporum, isolated from soil samples taken in Tierra del Fuego, Argentina, to produce hydrolytic enzymes, and to study the relationship of those activities to the fungus pathogenicity against pest aphids. We have made the traditional and molecular characterization of this strain of T cylindrosporum. The expression of hydrolase activity in the fungal strain was estimated at three incubation temperatures (4 degreeC, 12 degreeC and 24 degreeC), on different agar media supplemented with the following specific substrates: chitin azure, Tween 20, casein, and urea for chitinase, lipase, protease, and urease activity, respectively. The hydrolytic-enzyme activity was estimated qualitatively according to the presence of a halo of clarification through hydrolase action, besides was expressed semi-quantitatively as the ratio between the hydrolytic-halo and colony diameters. The pathogenicity of the fungus was tested on adults of the aphid Rhopalosiphum padi at three temperatures of incubation (4 degree C, 12 degree C and 24 degree C). The suspension was adjusted to a concentration of 1x10(7) conidia/ml. In pathogenicity assays at seven days post-inoculation, the fungus caused the mortality of adults of Ropalosiphum padi at different temperatures also showed a broad ability to grow on several agar-culture media, supplemented with different carbon sources at the three incubation temperatures tested. Although, the growth was greater with higher incubation temperatures (with maximum levels at 24 degreeC), the fungus reached similar colony diameters after 15 days of incubation on the medium supplemented with Tween 20 at the lower two incubation temperatures of 4 degreeC or 12 degreeC. In accordance with the results on colony diameters, the fungus revealed an ability to degrade casein, chitin derivatives, Tween 20, and urea as evidenced by the appearance of a halo around the fungal colony. Because of its origin and temperature tolerance, this Argentine strain has great potential for use as a biocontrol agent for insect pest control in cold and temperate environments.

  18. Susceptibility of adult female Aedes aegypti (Diptera: Culicidae) to the entomopathogenic fungus Metarhizium anisopliae is modified following blood feeding.

    PubMed

    Paula, Adriano R; Carolino, Aline T; Silva, Carlos P; Samuels, Richard I

    2011-05-26

    The mosquito Aedes aegypti, vector of dengue fever, is a target for control by entomopathogenic fungi. Recent studies by our group have shown the susceptibility of adult A. aegypti to fungal infection by Metarhizium anisopliae. This fungus is currently being tested under field conditions. However, it is unknown whether blood-fed A. aegypti females are equally susceptible to infection by entomopathogenic fungi as sucrose fed females. Insect populations will be composed of females in a range of nutritional states. The fungus should be equally efficient at reducing survival of insects that rest on fungus impregnated surfaces following a blood meal as those coming into contact with fungi before host feeding. This could be an important factor when considering the behavior of A. aegypti females that can blood feed on multiple hosts over a short time period. Female A. aegypti of the Rockefeller strain and a wild strain were infected with two isolates of the entomopathogenic fungus M. anisopliae (LPP 133 and ESALQ 818) using an indirect contact bioassay at different times following blood feeding. Survival rates were monitored on a daily basis and one-way analysis of variance combined with Duncan's post-hoc test or Log-rank survival curve analysis were used for statistical comparisons of susceptibility to infection. Blood feeding rapidly reduced susceptibility to infection, determined by the difference in survival rates and survival curves, when females were exposed to either of the two M. anisopliae isolates. Following a time lag which probably coincided with digestion of the blood meal (96-120 h post-feeding), host susceptibility to infection returned to pre-blood fed (sucrose fed) levels. Reduced susceptibility of A. aegypti to fungi following a blood meal is of concern. Furthermore, engorged females seeking out intra-domicile resting places post-blood feeding, would be predicted to rest for prolonged periods on fungus impregnated black cloths, thus optimizing infection rates. It should be remembered that lowered susceptibility was only a temporary phenomenon and this may not necessarily occur when mosquitoes are infected with other fungal isolates. These results may have implications for field testing of entomopathogenic fungi by our group and further studies should be carried out to better understand the insect-fungus interaction.

  19. Cnidarian-derived filamentous fungi from Brazil: isolation, characterisation and RBBR decolourisation screening.

    PubMed

    Da Silva, M; Passarini, M R Z; Bonugli, R C; Sette, L D

    2008-12-01

    Marine-derived fungi represent a valuable source of structurally novel and biologically active metabolites of industrial interest. They also have drawn attention for their capacity to degrade several pollutants, including textile dyes, organochlorides and polycyclic aromatic hydrocarbons (PAHs), among others. The fungal tolerance to higher concentrations of salt might be considered an advantage for bioremediation processes in the marine environment. Therefore, filamentous fungi were isolated from cnidarians (scleractinian coral and zoanthids) collected from the north coast of São Paulo State, Brazil. A total of 144 filamentous fungi were morphologically and molecularly characterised. Among them there were several species of Penicillium and Aspergillus, in addition to Cladosporium spp., Eutypella sp., Fusarium spp., Khuskia sp., Mucor sp., Peacilomyces sp., Phoma sp. and Trichoderma spp. These fungi were tested regarding their decolourisation activity for Remazol Brilliant Blue R (RBBR), a textile dye used as an initial screening for PAH-degrading fungi. The most efficient fungi for RBBR decolourisation after 12 days were Penicillium citrinum CBMAI 853 (100%), Aspergillus sulphureus CBMAI 849 (95%), Cladosporium cladosporioides CBMAI 857 (93%) and Trichoderma sp. CBMAI 852 (89%). Besides its efficiency for dye decolourisation within liquid media, C. cladosporioides CBMAI 857 also decolourised dye on solid media, forming a decolourisation halo. Further research on the biotechnological potential, including studies on PAH metabolism, of these selected fungi are in progress.

  20. Genetic diversity of Cosmos species revealed by RAPD and ISSR markers.

    PubMed

    Rodríguez-Bernal, A; Piña-Escutia, J L; Vázquez-García, L M; Arzate-Fernández, A M

    2013-12-04

    The genus Cosmos is native of America and is constituted by 34 species; 28 of them are endemic of Mexico. The cosmos are used as a nematicide, antimalarial, and antioxidative agent. The aim of this study was to estimate the genetic diversity among 7 cosmos species based on random amplified polymorphic DNA (RAPD) and inter-simple sequences repeats (ISSR) markers. With RAPD markers, the obtained polymorphism was 91.7 % and the genetic diversity was 0.33, whereas these values were 65.6%, and 0.22 from ISSR markers, respectively, indicating the presence of high genetic diversity among the Cosmos species that were analyzed. The unweighted pair group method with arithmetic mean dendrograms that were obtained with both markers were notably similar, revealing 2 clusters and indicating a clear genetic differentiation among the Cosmos species that were assessed. The first cluster comprised the species Cosmos sulphureus, Cosmos pacificus, and Cosmos diversifolius, while the second cluster included the species Cosmos purpureus, Cosmos crithmifolius, Cosmos bipinnatus, and Cosmos parviflorus. Besides this, the Cosmos species were clustered according to their collection sites. The Mantel test corroborates the correlation between the genetic distance and the geographic altitude of each Cosmos species. The results suggest that it is necessary to preserve the Cosmos species in their natural habitat in addition to the germoplasm collection for ex situ conservation.

  1. Hemp Sesbania (Sesbania exaltata) control in rice (Oryza sativa) with the bioherbicidal fungus Colletotrichum gloeosporioides f. sp. aeschynomene formulated in an invert emulsion

    USDA-ARS?s Scientific Manuscript database

    In greenhouse and field experiments, an invert emulsion (MSG 8.25) was tested with dried, formulated spores of the bioherbicidal fungus Colletotrichum gloeosporioides f. sp. aeschynomene, a highly virulent pathogen of the leguminous weed Aeschynomene virginica (northern jointvetch), but considered “...

  2. Scenes of Devastation: Chasing Hawaii's Deadly Ohia Fungus | Hawaii Public

    Science.gov Websites

    Scenes of Devastation: Chasing Hawaii's Deadly Ohia Fungus By Molly Solomon * Mar 25, 2016 TweetShareGoogle+Email Molly Solomon Rapid Ohia Death has devastated native forests on Hawaii Island, especially in Lower Puna subdivisions like Leilani Estates. Credit Molly Solomon One of Hawai'i's oldest and most

  3. HOW to Save Dutch Elm Diseased Trees by Pruning

    Treesearch

    J.R. Allison; G.F. Gregory

    1979-01-01

    Dutch elm disease (DED), caused by the fungus, Ceratocystis ulmi, is the most devastating shade tree disease in the United States. Healthy elms can become diseased by 1) elm bark beetles that carry the fungus from elm to elm, or 2) through root grafting with already infected trees. Along with wilt symptoms, streaking (sapwood discoloration), a characteristic internal...

  4. Leafspot of Black Cherry (Pest Alert)

    Treesearch

    USDA Forest Service

    1992-01-01

    A leafspot caused by the fungus Blumeriella jaapii can damage black cherry seedlings in both forests and nurseries. The disease was formerly know as Coccomyces leafspot (from the genus of synonyms for the causal fungus). Affected leaves bear spots that initially are purple. In moist conditions, light-colored spore masses may ooze from fruiting bodies in these spots on...

  5. Draft genome sequence of the white-rot fungus Obba rivulosa 3A-2

    Treesearch

    Otto Miettinen; Robert Riley; Kerrie Barry; Daniel Cullen; Ronald P. de Vries; Matthieu Hainaut; Annele Hatakka; Bernard Henrissat; Kristiina Hilden; Rita Kuo; Kurt LaButti; Anna Lipzen; Miia R. Makela; Laura Sandor; Joseph W. Spatafora; Igor V. Grigoriev; David S. Hibbett

    2016-01-01

    We report here the first genome sequence of the white-rot fungus Obba rivulsa (Polyporales, Basidiomycota), a polypore known for its lignin-decomposing ability. The genome is based on the homokaryon 3A-2 originating in Finland. The genome is typical in size and carbohydrate active enzyme (CAZy) content for wood-decomposing basidiomycetes.

  6. Effect of Metarhizium anisopliae (Ascomycete), Cypermethrin, and D-limonene, alone and combined, on larval mortality of Rhipicephalus sanguineus (Acari: Ixodidae)

    USDA-ARS?s Scientific Manuscript database

    The effect of the fungus Metarhizium anisopliae Ma14 strain, D-limonene and cypermethrin, alone and combined, on the mortality of Rhipicephalus sanguineus larvae was evaluated. Eight groups with 25 tick larvae were inoculated with the fungus, eight groups were treated with cypermethrin, eight groups...

  7. BIOTRANSFORMATION OF 2,4,6-TRINITROTOLUENE (TNT) BY A PLANT-ASSOCIATED FUNGUS FUSARIUM OXYSPORUM

    EPA Science Inventory

    The capability of a plant-associated fungus, Fusarium oxyvorum, to transform TNT in liquid cultures was investigated. TNT was transformed into 2-amino-4, 6-dinitrotoluene (2-A-DNT), 4-amino-2, 6-dinitrotoluene (4-A- DNT), and 2, 4-diamino-6-nitrotoluene (2, 4-DAT) via 2- and 4-hy...

  8. Metabolites from the endophytic fungus Sporormiella minimoides isolated from Hintonia latiflora

    USDA-ARS?s Scientific Manuscript database

    An extract of the solid cultures of Sporormiella minimoides (Sporormiaceae) isolated as an endophytic fungus from Hintonia latiflora (Rubiaceae), yielded three polyketides, 3,6-dimethoxy-8-methyl-1H,6H-benzo[de]isochromene-1,9-dione, 3-hydroxy-1,6,10-trimethoxy-8-methyl-1H,3H-benzo[de]isochromen-9-o...

  9. New brefeldins and penialidins from marine fungus Penicillium janthinellum DT-F29.

    PubMed

    Cheng, Xiangwei; Yu, Liyan; Wang, Qianqian; Ding, Wanjing; Chen, Zhe; Ma, Zhongjun

    2018-02-01

    A fermentation of marine fungus Penicillium janthinellum DT-F29 on solid rice medium led to the isolation of three new compounds, brefeldin D (1) and penialidins D-E (5-6), along with other five known brefeldins and penialidins. The structures of above compounds were determined on the basis of MS and NMR analysis.

  10. A new polyoxygenated farnesylcyclohexenone from Fungus Penicillium sp.

    PubMed

    Yang, Yabin; Yang, Fangfang; Zhao, Lixing; Duang, Rongting; Chen, Guangyi; Li, Xiaozhan; Li, Qiling; Qin, Shaohuan; Ding, Zhongtao

    2016-01-01

    A new polyoxygenated farnesylcyclohexenone, peniginsengin A (1), was isolated from the fermentation of Penicillium sp. YIM PH30003, an endophytic fungus associated with Panax notoginseng (Burk.) F. H. Chen. The structure was assigned based on a combination of 1 D and 2 D NMR and mass spectral data. The cytotoxicity and antimicrobial activities of compound 1 were investigated.

  11. First report of a sexual state in an ambrosia fungus: Ambrosiella cleistominuta sp. nov. associated with the ambrosia beetle Anisandrus maiche

    USDA-ARS?s Scientific Manuscript database

    Genera of ambrosia beetles in the tribe Xyleborini with large, mesonotal mycangia host unique fungal symbionts in the genus Ambrosiella. The symbiont of a recent invasive to the USA from Asia, Anisandrus maiche, had not been previously characterized. We consistently isolated a novel fungus, Ambrosie...

  12. Effects of the Chytrid fungus on the Tarahumara frog (Rana tarahumarae) in Arizona and Sonora, Mexico

    Treesearch

    Stephen F. Hale; Philip C. Rosen; James L. Jarchow; Gregory A. Bradley

    2005-01-01

    We conducted histological analyses on museum specimens collected 1975-1999 from 10 sites in Arizona and Sonora to test for the pathogenic chytrid fungus (Batrachochytrium dendrobatidis) in ranid frogs, focusing on the Tarahumara frog (Rana tarahumarae). During 1981-2000, frogs displaying disease signs were found in the field, and...

  13. Determination of the absolute configuration of Chaetoviridins and other bioactive Azaphilones from the endophytic fungus Chaetomium globosum

    USDA-ARS?s Scientific Manuscript database

    Chemical investigation of an endophytic fungus Chaetomium globosum isolated from leaves of Wikstroemia uva-ursi led to the isolation of a new azaphilone, chaetoviridin J (1), and a new stereoisomer, chaetoviridin K (2), along with four known derivatives (3–6). The structures of azaphilones were dete...

  14. Heterogeneous occupancy and density estimates of the pathogenic fungus Batrachochytrium dendrobatidis in waters of North America

    Treesearch

    Tara Chestnut; Chauncey Anderson; Radu Popa; Andrew R. Blaustein; Mary Voytek; Deanna H. Olson; Julie Kirshtein

    2014-01-01

    Biodiversity losses are occurring worldwide due to a combination of stressors. For example, by one estimate, 40% of amphibian species are vulnerable to extinction, and disease is one threat to amphibian populations. The emerging infectious disease chytridiomycosis, caused by the aquatic fungus Batrachochytrium dendrobatidis (Bd), is a contributor to amphibian declines...

  15. Trappeindia himalayensis gen. et sp. nov., a sequestrate fungus with potential affinity to Strobilomyces (Basidiomycotina, Boletales)

    Treesearch

    M.A. Castellano; S.L. Miller; L. Singh; T.N. Lakhanpal

    2012-01-01

    An unusual sequestrate fungus forming ectomycorrhizae with Cedrus deodora (Roxb.) Laud. forms sporocarps in the northwestern Himalayas of India during spring. It has a dark brown to black peridium with a solid, white to brown, loculate gleba containing spherical, reticulate spores. It resembles no described genus and is described here as ...

  16. Tolerance of Serpula lacrymans to copper-based wood preservatives

    Treesearch

    Anne Christine Steenkjaer Hastrup; Frederick Green; Carol A. Clausen; Bo Jensen

    2005-01-01

    Serpula lacrymans, the dry rot fungus, is considered the most economically important wood decay fungus in certain temperate regions of the world, namely northern Europe, Japan, and Australia. Previously, copper-based wood preservatives were commonly used for pressure treatment of wood for building construction, but some decay fungi are known to be copper tolerant. In...

  17. The isolation of Phoma eupyrena from a human lesion.

    PubMed

    Bakerspigel, A; Lowe, D; Rostas, A

    1981-06-01

    A strain of the soil-borne fungus Phoma eupyrena was isolated from the skin of an 18-month-old boy who had a crusting, erythematous, perioral eruption of one month's duration. Treatment with clotrimazole, 15% zinc oxide paste, and dimethicone resulted in eradication of the fungus and in complete healing of the lesions in eight weeks.

  18. Effects of urbanization on the occurrence of Batrachochytrium dendrobatidis: do urban environments provide refuge from the amphibian chytrid fungus?

    Treesearch

    Daniel Saenz; Taylor L. Hall; Matthew A. Kwiatkowski

    2015-01-01

    Batrachochytrium dendrobatidis (Bd) is a widespread pathogenic fungus that is known to cause the disease, chytridiomycosis, which can be lethal to many amphibians. We compared occurrence rates on spring peepers (Pseudacris crucifer) in urban and forested breeding sites in eastern Texas, USA. All study sites were at...

  19. Gene Expression Analysis of Copper Tolerance and Wood Decay in the Brown Rot Fungus Fibroporia radiculosa

    Treesearch

    J. D. Tang; L. A. Parker; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; D. D. Nicholas; S. V. Diehl

    2013-01-01

    High-throughput transcriptomics was used to identify Fibroporia radiculosa genes that were differentially regulated during colonization of wood treated with a copper-based preservative. The transcriptome was profiled at two time points while the fungus was growing on wood treated with micronized copper quat (MCQ). A total of 917 transcripts were...

  20. Control of common bunt of wheat under field conditions with the biofumigant fungus Muscodor albus.

    USDA-ARS?s Scientific Manuscript database

    Field experiments were conducted to evaluate the biological control potential of the fungus Muscodor albus, when applied as a seed treatment or an in furrow soil treatment, for control of common bunt (CB) of wheat caused by Tilletia caries. For seed treatments, dry rye grain culture of M. albus wa...

  1. Ascospore dispersal of Ceratocystiopsis ranaculosus, a mycangial fungus of the southern pine beetle

    Treesearch

    John C. Moser; Thelma J. Perry; J. Robert Bridges; Hui-Fen Yin

    1995-01-01

    Ascospores of the heterothallic fungus Ceratocystiopsis ranaculosus were found in the sporothecae of three mite species of the genus Tarsonemus.These mites were phoretic on the coniferous bark beetles Dendroctonus frontalis, D. brevicomis, and Ips acuminatus.Ceratocystiopsis ranaculosus inhabits the mycangium of both Dendroctonus species as conidia in a budding yeast-...

  2. Whole genome comparison of Aspergillus flavus L-morphotype strain NRRL 3357 (type) and S-morphotype strain AF70

    USDA-ARS?s Scientific Manuscript database

    Aspergillus flavus is a saprophytic fungus that infects corn, peanuts, tree nuts and other agriculturally important crops. Once the crop is infected the fungus has the potential to secrete one or more mycotoxins, the most carcinogenic of which is aflatoxin. Aflatoxin contaminated crops are deemed un...

  3. Improved mortality of the Formosan subterranean termite by fungi, when amended with cuticle-degrading enzymes or eicosanoid biosynthesis inhibitors

    USDA-ARS?s Scientific Manuscript database

    Formosan subterranean termites (FST) were exposed to spores of the fungus Beauveria pseudobassiana (Bpb) strain 8046 to determine virulence of the fungus. Once Bpb was determined to cause mortality of FST it was combined with enzymes capable of degrading the insect cuticle to measure the potential ...

  4. Impact of Tolypocladium cylindrosporum (Hypocreales: Ophiocordycipitaceae) on eggs of Aedes aegypti and Aedes albopictus at low temperature

    USDA-ARS?s Scientific Manuscript database

    We examined the potential of Tolypocladium cylindrosporum IBT 41712 to infect eggs of Aedes aegypti Linnaeus and Aedes albopictus (Skuse) mosquitoes at low temperature (15 deg C). To determine the optimum temperature for the fungus, we cultured the fungus at eight temperatures (4, 12, 15, 21, 28, 33...

  5. The entomopathogenic fungus Isaria fumosorosea and its compatibility with buprofezin: effects on the rugose spiraling whitefly Aleurodicus rugioperculatus

    USDA-ARS?s Scientific Manuscript database

    The gumbo limbo or rugose spiraling whitefly is a new invasive pest of palms, woody ornamentals, and fruits in Florida. The pathogenicity of a naturally occurring entomopathogenic fungus, Isaria fumosorosea (PFR 97) is well known for its activity against commonly found whiteflies species in the regi...

  6. Utilization of high performance liquid chromatography coupled to tandem mass spectrometry for characterization of 8-O-methylbostrycoidin production by species of the fungus Fusarium

    USDA-ARS?s Scientific Manuscript database

    The pigment, 8-O-methylbostrycoidin is a polyketide metabolite produced by multiple species of the fungus Fusarium that infects plant crops, including maize. A technique was developed for the analysis of 8-O-methylbostrycoidin by high performance liquid chromatography coupled to electrospray ionizat...

  7. Changes in wood microstructure through progressive stages of decay

    Treesearch

    W. Wayne Wilcox

    1968-01-01

    Successive stages of decay in the sapwood of sweetgum (Liquidambar styraciflua L.), a hardwood, and of southern pine (Pinus sp.), a softwood, were observed microscopically. The white-rot fungus. Polyporus versicolor L., and the brown-rot fungus, Poria monticola Murr., were the fungi used or the observations, light microscopy, plus the techniques of polarization and...

  8. Diplodia Blight of Pines

    Treesearch

    Glenn W. Peterson

    1981-01-01

    The fungus Diplodia pinea (Desm.) Kickx is most damaging to plantings of both exotic and native pine species in the United States. The fungus is seldom found in natural pine stands. Diplodia pinea kills current-year shoots, major branches, and ultimately entire trees. The effects of this disease are most severe in landscape, windbreak, and park plantings in the Central...

  9. Transcriptome analysis of a Ustilago maydis ust1 deletion mutant uncovers involvement of laccase and polyketide synthase genes in spore development

    USDA-ARS?s Scientific Manuscript database

    Ustilago maydis, causal agent of corn smut disease, is a dimorphic fungus alternating between a saprobic budding haploid, and an obligate pathogenic filamentous dikaryon. Maize responds to U. maydis colonization by producing tumorous structures, and only within these does the fungus sporulate, produ...

  10. Use of real-time O2 concentration measurements in shake-flask fermentations of the bioinsecticidal fungus Isaria fumosorosea for improved yields of blastospores

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Isaria fumosoroseus (formerly Paecilomyces fumosoroseus) is capable of dimorphic growth (hyphal or yeast-like) in submerged culture. For use in spray applications as a biological control agent against insect pests, the yeast-like (blastospore) mode of growth is preferred....

  11. Monitoring the establishment and prevalence of the fungal entomopathogen Entomophaga maimaiga in two Lymantria dispar L. populations in Bulgaria

    Treesearch

    D. Pilarska; M. McManus; P. Pilarska; G. Georgiev; P. Mirchev; A. Linde

    2005-01-01

    The establishment and prevalence of the entomopathogenic fungus Entomophaga maimaiga, (Zygomycetes, Entomophthorales), introduced into two gypsy moth populations in Bulgaria, was monitored during 2000-2004. In the Karlovo Region population, where E. maimaiga was introduced in 1999, the fungus was recovered every year and the...

  12. Development of pilot-scale fermentation and stabilization processes for the production of microsclerotia of the entomopathogenic fungus Metarhizium brunneun strain F52

    USDA-ARS?s Scientific Manuscript database

    Using 100L stirred-tank bioreactors, we evaluated the effect of fermentation parameters and drying protocols on the production and stabilization of microsclerotia (MS) of the entomopathogenic fungus Metarhizium brunneum (formerly M. anisopliae F52). Results showed that stirred-tank bioreactors can ...

  13. Fungus cultivation by ambrosia beetles: Behavior and laboratory breeding success in three Xyleborine species

    Treesearch

    Peter Biedermann; Kier Klepzig; Taborsky Michael

    2009-01-01

    Fungus cultivation by ambrosia beetles is one of the four independently evolved cases of agriculture known in animals. Such cultivation is most advanced in the highly social subtribe Xyleborina (Scolytinae), which is characterized by haplodiploidy and extreme levels of inbreeding. Despite their ubiquity in forests worldwide, the behavior of these beetles remains poorly...

  14. Genetically divergent types of the wheat leaf fungus Puccinia triticina in Ethiopia, a center of tetraploid wheat diversity

    USDA-ARS?s Scientific Manuscript database

    Collections of Puccinia triticina, the wheat leaf rust fungus, were obtained from tetraploid and hexaploid wheat in the central highlands of Ethiopia, and a smaller number from Kenya from 2011 to 2013, in order to determine the genetic diversity of this wheat pathogen in a center of host diversity. ...

  15. A New Metabolite with a unique 4-pyranone-ylactam-1,4-thiazine moiety from a Hawaiian-plant associated fungus

    USDA-ARS?s Scientific Manuscript database

    An endophytic fungus Paraphaeosphaeria neglecta FT462 isolated from the Hawaiian-plant Lycopodiella cernua (L.) Pic. Serm produced one unusual compound (1, paraphaeosphaeride A) with the 4-pyranone-'-lactam-1,4-thiazine moiety, along with two new compounds (2 and 3, paraphaeosphaerides B and C, resp...

  16. Potential use of the fungus Beauveria bassiana against the western flower thrips Frankliniella occidentalis without reducing the effectiveness of its natural predator Orius sauteri (Hemiptera: Anthocoridae)

    USDA-ARS?s Scientific Manuscript database

    Orius sauteri (Poppius) (Hemiptera: Anthocoridae) is an important predator of western flower thrips, Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Orius sauteri would be directly exposed to the entomopathogenic fungus Beauveria bassiana (Bals.) Vuillemin in the field should the fu...

  17. Mechanisms of resistance to an azole fungicide in the grapevine powdery mildew fungus, Erysiphe necator

    USDA-ARS?s Scientific Manuscript database

    We studied the mechanisms of azole resistance in the grapevine powdery mildew fungus, Erysiphe necator, by quantifying the sensitivity to myclobutanil (EC50) in 65 isolates from the eastern U.S. and 12 from Chile. From each isolate, we sequenced the gene for sterol 14a-demethylase (CYP51), and measu...

  18. Canker Stain Affects Delaware Sycamores Pest Alert

    Treesearch

    Alan Iskra; Gary Schwetz; Michael Valenti

    2001-01-01

    An often fatal disease of American sycamore (Platanus occidentalis), known as canker stain, is caused by the fungus, Ceratocystis fimbriata f.sp. platani. This fungus, indigenous to the United States, occurs in urban and forested areas from New Jersey to Georgia and west to Missouri and Louisiana. Other trees affected are the Oriental plane (Platanus orientalis) and...

  19. Genetic dissection of fusiform rust and pitch canker disease traits in loblolly pine

    Treesearch

    Gogce C. Kayihan; Dudley A. Huber; Alison M. Morse; Timothy L. White; John M. Davis

    2005-01-01

    Loblolly pine (Pinus taeda L.) exhibits genetic resistance to fusiforrn rust disease (incited by the biotrophic fungus, Cronartiurn quercuum f. sp. fusifom) and pitch canker disease (incited by the necrotrophic fungus, Fusarium circinatum). In this study, a total of 14,015 loblolly pine cuttings from 1,065 clones were screened in...

  20. Australasian sequestrate fungi 18: Solioccasus polychromus gen. & sp. nov., a richly colored, tropical to subtropical, hypogeous fungus

    Treesearch

    J. M. Trappe; M. A. Castellano; R. E. Halling; T. W. Osmundson; M. Binder; N. Fechner; N. Malajczuk

    2013-01-01

    Solioccasus polychromus gen. & sp. nov., the most brightly colored hypogeous fungus known, is described from Papua New Guinea and tropical northern Australia south into subtropical forests along the Queensland coast and coastal mountains to near Brisbane. Phylogenetic analysis of molecular data places it as a sister genus to Bothia...

  1. Spread of beech bark disease in the eastern United States and its relationship to regional forest composition

    Treesearch

    Randall S. Morin; Andrew M. Liebhold; Patrick C. Tobin; Kurt W. Gottschalk; Eugene Luzader

    2007-01-01

    Beech bark disease (BBD) is an insect-fungus complex involving the beech scale insect (Cryptococcus fagisuga Lind.) and one of two canker fungi. Beech scale was introduced to Halifax, Nova Scotia around 1890, presumably with the fungus Neonectria coccinea var. faginata Lohm. The disease has subsequently spread...

  2. Compartmentalization of decayed wood associated with Armillaria mellea in several tree species

    Treesearch

    Alex L. Shigo; Joanna T. Tippett

    1981-01-01

    Decayed wood associated with Armillaria mellea was compartmentalized according to the CODIT (Compartmentalization Of Decay In Trees) model. Compartmentalization in the sapwood began after the tree walled off the area of dead cambium associated with the inflection of the fungus. The fungus spread into dying sapwood beneath and beyond the area of...

  3. Antileukemic alpha-pyrone derivatives from the endophytic fungus Alternaria phragmospora

    USDA-ARS?s Scientific Manuscript database

    Four new (1–4) and two known (5 and 6)a-pyrone derivatives have been isolated from Alternaria phragmospora, an endophytic fungus from Vinca rosea, leaves. The isolated compounds were chemically identi'ed to be 5-butyl-4-methoxy-6-methyl-2H-pyran-2-one (2) 5-butyl-6-(hydroxymethyl)-4-methoxy-2H-py...

  4. Carbon availability for the fungus triggers nitrogen uptake and transport in the arbuscular mycorrhizal symbiosis

    USDA-ARS?s Scientific Manuscript database

    The arbuscular mycorrhizal (AM) symbiosis is characterized by a transfer of nutrients in exchange for carbon. We tested the effect of the carbon availability for the AM fungus Glomus intraradices on nitrogen (N) uptake and transport in the symbiosis. We followed the uptake and transport of 15N and ...

  5. Production of AM fungus colonized seedlings under organic management; suitablity of hydrolyzed fish vs. blood meal as options for N addition

    USDA-ARS?s Scientific Manuscript database

    The potential benefits of the arbuscular mycorrhizal [AM] symbiosis to crop growth and overall farm sustainability make effective utilization of AM fungus inoculum of particular interest to organic farmers. An important consideration in ensuring the colonization of vegetable seedlings by AM fungi d...

  6. First report of Laurel Wilt caused by Rafffaelea lauricola on sassafras in Mississippi

    Treesearch

    J.J. Riggins; S.W. Fraedrich; T.C. Harrington

    2011-01-01

    Laurel wilt is caused by the fungus Raffaelea lauricola T.C. Harrin., Aghayeva & Fraedrich and is lethal to redbay (Persea borbonia (L.) Spreng.), sassafras (Sassafras albidum (Nutt.) Nees), and other species in the Lauraceae (1). The fungus is carried by the redbay ambrosia beetle (Xyleborus glabratus Eichh.), which is native to Asia.

  7. Response of ectomycorrhizal fungus sporocarp production to varying levels and patterns of green-tree retention.

    Treesearch

    Daniel L. Luoma; Joyce L. Eberhart; Randy Molina; Michael P. Amaranthus

    2004-01-01

    Forest management activities can reduce ectomycorrhizal fungus diversity and forest regeneration success. We examine contrasts in structural retention as they affect sporocarp production of ectomycorrhizal fungi (EMF)--functional guild of organisms well suited as indicators of disturbance effects on below-ground ecosystems. Our results are from an experiment that tests...

  8. Fusiform Rust of Southern Pines

    Treesearch

    W. R. Phelps; F. L. Czabator

    1978-01-01

    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  9. RNA sequencing of contaminated seeds reveals the state of the seed permissive for pre-harvest aflatoxin contamination and points to a potential susceptibility factor

    USDA-ARS?s Scientific Manuscript database

    Pre-harvest aflatoxin contamination (PAC) is a major problem facing peanut production worldwide. Produced by the ubiquitous soil fungus, Aspergillus flavus, aflatoxin is the most potent naturally occurring known carcinogen. The interaction between fungus and host resulting in PAC is complex, and b...

  10. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance

    Treesearch

    Dolores Linde; Francisco J. Ruiz-Dueñas; Elena Fernández-Fueyo; Victor Guallar; Kenneth E. Hammel; Rebecca Pogni; Angel T. Martínez

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus...

  11. A meiotic drive element in the maize pathogen Fusarium verticillioides is located within a 102-kb region of chromosome V

    USDA-ARS?s Scientific Manuscript database

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny f...

  12. Chytrid Fungus, Batrachochytrium dendrobatidis , in Wild Populations of the Lake Titicaca Frog, Telmatobius culeus, in Peru.

    PubMed

    Berenguel, Raul A; Elias, Roberto K; Weaver, Thomas J; Reading, Richard P

    2016-10-01

    The Lake Titicaca frog (Telmatobius culeus) is critically endangered, primarily from overexploitation. However, additional threats, such as chytrid fungus ( Batrachochytrium dendrobatidis ), are poorly studied. We found moderate levels of chytrid infection using quantitative PCR. Our results enhance our understanding of chytrid tolerance to high pH and low water temperature.

  13. Deciphering the cryptic genome: Genome-wide analyses of the rice pathogen Fusarium fujikuroi reveal complex regulation of secondary metabolism and novel metabolites

    USDA-ARS?s Scientific Manuscript database

    The fungus Fusarium fujikuroi is agriculturally important because it produces the phytohormones gibberellic acids (GAs) and causes bakanae (“foolish seedling”) disease of rice. The fungus also produces multiple other secondary metabolites, including pigments and mycotoxins. Here, we present a high-q...

  14. [Features of interaction bacterial strains Micrococcus luteus LBK1 from plants varieties/hybrids cucumber and sweet pepper and with fungus Fusarium oxysporum Scelecht].

    PubMed

    Parfeniuk, A; Sterlikova, O; Beznosko, I; Krut', V

    2014-01-01

    The article presents the results of studying the impact of bacterial strain M. luteus LBK1, stimulating the growth and development of plant varieties/hybrids of cucumber and sweet pepper on the intensity of sporulation of the fungus F. oxysporum Scelecht--fusariose rot pathogen.

  15. A case of Candida albicans fungus balls in the urinary tract appeared during the course of antifungal treatment for Candida endophthalmitis.

    PubMed

    Onozawa, Kyoko; Miyake, Noriko; Iwasaki, Noriko; Nishida, Ruriko; Chong, Yong; Shimoda, Shinji; Shimono, Nobuyuki; Akashi, Koichi

    2015-09-01

    Fungus balls have been rarely implicated as a cause of urinary tract obstruction. Here, we report a case of Candida albicans fungus balls in the urinary tract after the treatment of Candida endophthalmitis that has enough periods and adequate amount of antifungal agents. The patient completely recovered from this rare complication by irrigating through single-J stent and changing antifungal agents. Here we emphasize that we should take into account not only the susceptibility test results but also the difference in excretion route and tissue distribution of antifungal agents. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  16. Fungus mediated biosynthesis of WO3 nanoparticles using Fusarium solani extract

    NASA Astrophysics Data System (ADS)

    Kavitha, N. S.; Venkatesh, K. S.; Palani, N. S.; Ilangovan, R.

    2017-05-01

    Currently nanoparticles were synthesized by emphasis bioremediation process due to less hazardous, eco-friendly and imperative applications on biogenic process. Fungus mediated biosynthesis strategy has been developed to prepare tungsten oxide nanoflakes (WO3, NFs) using the plant pathogenic fungus F.solani. The powder XRD pattern revealed the monoclinic crystal structure with improved crystalline nature of the synthesized WO3 nanoparticles. FESEM images showed the flake-like morphology of WO3, with average thickness and length around 40 nm and 300 nm respectively. The Raman spectrum of WO3 NFs showed their characteristic vibration modes that revealed the defect free nature of the WO3 NFs. Further, the elemental analysis indicated the stoichiometric composition of WO3 phase.

  17. Decolorization and degradation of xanthene dyes by a white rot fungus, Coriolus versicolor.

    PubMed

    Itoh, Kiyoharu; Yatome, Chizuko

    2004-01-01

    The decolorization of six xanthene dyes (conc. 100 microM) by a white rot fungus, Coriolus versicolor (C. versicolor), was investigated in liquid culture. The decolorization of Fluorescein, 4-Aminofluorescein, and 5-Aminofluorescein by the fungus was 85.0, 95.0, and 91.9% after 14 days incubation, respectively. However, no decolorization of Rhodamine B, Rhodamine 123 hydrate, and Rhodamine 6G was observed. The first three dyes also were decolorized with cell-free extracts from C. versicolor. The decolorization activity was 10.2, 6.7, and 7.2 microM min(-1)mg(-1), respectively. Thin layer chromatography (TLC) analyses indicated that degradation of Fluorescein was occurring with the detection of three degradation products.

  18. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    PubMed

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Yarsagumba Fungus: Health Problems in the Himalayan Gold Rush.

    PubMed

    Koirala, Pranawa; Pandit, Bidur; Phuyal, Pratibha; Zafren, Ken

    2017-09-01

    Seasonal migration of people in search of Yarsagumba fungus creates a population of collectors that faces hardship and health risks in austere high-altitude settings. In 2016, our 4-person team performed a 2-day health-needs survey of people collecting Yarsagumba fungus near the village of Yak Kharka (4020 m) in the Manang District of Nepal. There were approximately 800 people, both male and female, from age 10 to over 60, collecting Yarsagumba fungus. They had paid high prices for permits, hoping to recoup the cost and make a profit by selling specimens of Yarsagumba, but the fungus seemed scarce in 2016, resulting in a bleak economic forecast. Most collectors were living in austere conditions, walking long hours to the collection areas early in the morning and returning in the late afternoon. Most were subsisting on 1 daily meal. Health problems, including acute mountain sickness as well as respiratory and gastrointestinal illnesses, were common. Yarsagumba has become harder to find in recent years, increasing hardships and risk of injury. Medical care was almost nonexistent. As abundance decreases and demand increases, there is increasing pressure on collectors to find Yarsagumba. The collectors are an economically disadvantaged population who live in austere conditions at high altitude with poor shelter and sanitation, strenuous work, and limited availability of food. Health care resources are very limited. There are significant risks of illness, injury, and death. Targeted efforts by government entities and nongovernmental organizations might be beneficial in meeting the health needs. Copyright © 2017 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  20. Evaluation for rock phosphate solubilization in fermentation and soil-plant system using a stress-tolerant phosphate-solubilizing Aspergillus niger WHAK1.

    PubMed

    Xiao, Chunqiao; Zhang, Huaxiang; Fang, Yujuan; Chi, Ruan

    2013-01-01

    A strain WHAK1, identified as Aspergillus niger, was isolated from Yichang phosphate mines in Hubei province of China. The fungus developed a phosphate solubilization zone on modified National Botanical Research Institute's phosphate growth (NBRIP) agar medium, supplemented with tricalcium phosphate. The fungus was applied in a repeated-batch fermentation process in order to test its effect on solubilization of rock phosphate (RP). The results showed that A. niger WHAK1 could effectively solubilize RP in NBRIP liquid medium and released soluble phosphate in the broth, which can be illustrated by the observation of scanning electron microscope, energy-dispersive X-ray microanalysis, and Fourier transform infrared spectroscopy. Acidification of the broth seemed to be the major mechanism for RP solubilization by the fungus. Indeed, multiple organic acids (mainly gluconic acid) were detected in the broth by high-performance liquid chromatography analysis. These organic acids caused a significant drop of pH and an obvious rise of titratable acidity in the broth. The fungus also exhibited high levels of tolerance against temperature, pH, salinity, and desiccation stresses, although a significant decline in the fungal growth and release of soluble phosphate was marked under increasing intensity of stress parameters. Further, the fungus was introduced into the soil supplemented with RP to analyze its effect on plant growth and phosphate uptake of wheat plants. The result revealed that inoculation of A. niger WHAK1 significantly increased the growth and phosphate uptake of wheat plants in the RP-amended soil compared to the control soil.

  1. Interactions of Trametes versicolor, Coriolopsis rigida and the arbuscular mycorrhizal fungus Glomus deserticola on the copper tolerance of Eucalyptus globulus.

    PubMed

    Arriagada, C; Aranda, E; Sampedro, I; Garcia-Romera, I; Ocampo, J A

    2009-09-01

    The presence of high levels of Cu in soil decreases the shoot and root dry weights of Eucalyptus globulus. However, higher plant tolerance of Cu has been observed in the presence of the arbuscular mycorrhizal (AM) fungus Glomus deserticola. The hyphal length of G. deserticola was sensitive to low Cu concentrations, and the percentage of AM root colonisation and the metabolic activity of the AM fungus were also decreased by Cu. Therefore, a direct effect of Cu on the development of the AM fungus inside and outside the root cannot be ruled out. E. globulus colonised by G. deserticola had higher metal concentrations in the roots and shoots than do non-mycorrhizal plants; however, the absence of a higher root to shoot metal ratio in the mycorrhizal plants (1.70+/-0.11) indicated that G. deserticola did not play a filtering/sequestering role against Cu. The saprobe fungi Coriolopsis rigida and Trametes versicolor were able to remove Cu ions from the asparagine-glucose growth media. However, plants inoculated with C. rigida and T. versicolor did not accumulate more Cu than non-inoculated controls, and the growth of the plant was not increased in the presence of these fungi. However, C. rigida increased the shoot dry weight, AM root length colonisation, and metabolic mycelial activity of plants colonised with G. deserticola in the presence of Cu; only this saprobe-AM fungus combination increased the tolerance of E. globulus to Cu. Inoculation with G. deserticola and C. rigida increased the E. globulus Cu uptake to levels reached by hyperaccumulative plants.

  2. Evaluation of the time-concentration-mortality responses of Plutella xylostella larvae to the interaction of Isaria fumosorosea with the insecticides beta-cypermethrin and Bacillus thuringiensis.

    PubMed

    Nian, Xiao-ge; He, Yu-rong; Lu, Li-hua; Zhao, Rui

    2015-02-01

    Entomopathogenic fungi are potential candidates for controlling Plutella xylostella, a cosmopolitan pest of crucifers. In this study, bioassays were conducted to evaluate the interaction between Isaria fumosorosea and sublethal doses of two insecticides, beta-cypermethrin and Bacillus thuringiensis, against P. xylostella. Data of each assay were in good agreement with the time-concentration-mortality model, indicating a strong dependence of the fungus and insecticide interaction on both concentration and post-exposure time. Using beta-cypermethrin 58-116 µg mL(-1) or B. thuringiensis 222.5-890 µg mL(-1) with the fungus significantly enhanced fungal efficacy. The LC50 values of the fungus declined over a 1-7 day period after exposure, and the LT50 values decreased with increasing concentration. Based on LC50 or LC90 estimates, synergism between the fungus and beta-cypermethrin resulted in a 2.7-28.3-fold reduction in LC50 values and a 12.1-19.6-fold reduction in LC90 values, while synergism of the fungus with B. thuringiensis led to a 2.4-385.0-fold reduction in LC50 values and a 4.4-151.7-fold reduction in LC90 values. Results show that sublethal doses of B. thuringiensis and beta-cypermethrin can synergise I. fumosorosea activity on P. xylostella, suggesting that combination of I. fumosorosea with the two insecticides might offer an integrated approach to controlling P. xylostella in practice. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  3. The Genome Sequence of the Leaf-Cutter Ant Atta cephalotes Reveals Insights into Its Obligate Symbiotic Lifestyle

    PubMed Central

    Suen, Garret; Holt, Carson; Abouheif, Ehab; Bornberg-Bauer, Erich; Bouffard, Pascal; Caldera, Eric J.; Cash, Elizabeth; Cavanaugh, Amy; Denas, Olgert; Elhaik, Eran; Favé, Marie-Julie; Gadau, Jürgen; Gibson, Joshua D.; Graur, Dan; Grubbs, Kirk J.; Hagen, Darren E.; Harkins, Timothy T.; Helmkampf, Martin; Hu, Hao; Johnson, Brian R.; Kim, Jay; Marsh, Sarah E.; Moeller, Joseph A.; Muñoz-Torres, Mónica C.; Murphy, Marguerite C.; Naughton, Meredith C.; Nigam, Surabhi; Overson, Rick; Rajakumar, Rajendhran; Reese, Justin T.; Scott, Jarrod J.; Smith, Chris R.; Tao, Shu; Tsutsui, Neil D.; Viljakainen, Lumi; Wissler, Lothar; Yandell, Mark D.; Zimmer, Fabian; Taylor, James; Slater, Steven C.; Clifton, Sandra W.; Warren, Wesley C.; Elsik, Christine G.; Smith, Christopher D.; Weinstock, George M.; Gerardo, Nicole M.; Currie, Cameron R.

    2011-01-01

    Leaf-cutter ants are one of the most important herbivorous insects in the Neotropics, harvesting vast quantities of fresh leaf material. The ants use leaves to cultivate a fungus that serves as the colony's primary food source. This obligate ant-fungus mutualism is one of the few occurrences of farming by non-humans and likely facilitated the formation of their massive colonies. Mature leaf-cutter ant colonies contain millions of workers ranging in size from small garden tenders to large soldiers, resulting in one of the most complex polymorphic caste systems within ants. To begin uncovering the genomic underpinnings of this system, we sequenced the genome of Atta cephalotes using 454 pyrosequencing. One prediction from this ant's lifestyle is that it has undergone genetic modifications that reflect its obligate dependence on the fungus for nutrients. Analysis of this genome sequence is consistent with this hypothesis, as we find evidence for reductions in genes related to nutrient acquisition. These include extensive reductions in serine proteases (which are likely unnecessary because proteolysis is not a primary mechanism used to process nutrients obtained from the fungus), a loss of genes involved in arginine biosynthesis (suggesting that this amino acid is obtained from the fungus), and the absence of a hexamerin (which sequesters amino acids during larval development in other insects). Following recent reports of genome sequences from other insects that engage in symbioses with beneficial microbes, the A. cephalotes genome provides new insights into the symbiotic lifestyle of this ant and advances our understanding of host–microbe symbioses. PMID:21347285

  4. The influence of surface carbohydrates during in vitro infection of mammalian cells by the dermatophyte Trichophyton rubrum.

    PubMed

    Esquenazi, Daniele; Alviano, Celuta S; de Souza, Wanderley; Rozental, Sonia

    2004-04-01

    In order to better understand the role played by surface glycoconjugates during host cell adhesion and endocytosis of Trichophyton rubrum, we looked for the presence of carbohydrate-binding adhesins on the microconidia surface and their role on cellular interaction with epithelial and macrophages cells. The interaction of T. rubrum with chinese hamster ovary epithelial cells and their glycosylation-deficient mutants demonstrated a higher adhesion index in Lec1 and Lec2 mutants, that express mannose and galactose, respectively. Endocytosed fungi were shown preferentially in Lec2 cells. Addition of the carbohydrates to the interaction medium, pretreatment with lectins and with sodium periodate decreased the adhesion and endocytic index for all mutants. The ability of the fungus to penetrate into mammalian cells was confirmed in experiments using macrophages treated with cytochalasin D. Flow cytometric analysis showed that this fungus recognizes mannose and galactose. The binding was inhibited by the addition of methyl alpha-D-mannopyranoside and methyl alpha-D-galactopyranoside, and showed higher fluorescence intensity at 37 than at 28 degrees C. Trypsin treatment and heating of the cells reduced the binding, suggesting a (glyco) protein nature for the microconidia adhesins. The presence of lectin-like molecules in fungus cell could be observed by scanning electron microscopy of the fungus incubated with colloidal-gold labeled neoglycoproteins. Our results suggest that T. rubrum has the ability to invade mammalian cells and expresses carbohydrate-specific adhesins on microconidia surface that recognize mannose and galactose. These adhesins may play an important role on the adhesion and invasion of the fungus during the infectious process of dermatophytosis.

  5. Trichodiene production in a Trichoderma harzianum erg1-silenced strain provides evidence of the importance of the sterol biosynthetic pathway in inducing plant defense-related gene expression

    USDA-ARS?s Scientific Manuscript database

    Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both ...

  6. Mla- and Rom1-mediated control of microRNA398 and chloroplast copper/zinc superoxide dismutase regulates cell death in response to the barley powdery mildew fungus

    USDA-ARS?s Scientific Manuscript database

    Barley Mla (Mildew resistance locus a) confers allele-specific interactions with natural variants of the ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of powdery mildew disease. Significant reprogramming of host gene expression occurs upon infection by this obligate biotrop...

  7. Occurrence of mycorrhizae after logging and slash burning in the Douglas-fir forest type.

    Treesearch

    Ernest Wright; Robert F. Tarrant

    1958-01-01

    The association of certain fungi with plant roots results in formation of an organ called a mycorrhiza. There are two principal types of mycorrhizae: those with the fungus confined internally in the root, or endotrophic mycorrhizae, and those with both internal fungus development and an external fungal mantle enveloping the root tips, or ectotrophic mycorrhizae....

  8. BIODEGRATION OF 2,4,5-TRICHLOROPHENOXYACETIC ACID IN LIQUID CULTURE AND IN SOIL BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    EPA Science Inventory

    Extensive biodegradation of [14C]-2,4,5-trichlorophenoxyacetic acid ([[14C]-2,4,5-T) by the white rot fungus Phanerochaete chrysosporium was demonstrated in nutrient nitrogen-limited aqueous cultures and in [14C]-2,4,5-T-contaminated soil inoculat...

  9. Exopisiod B and farylhydrazone C, two new alkaloids from the Antarctic-derived fungus Penicillium sp. HDN14-431.

    PubMed

    Zhang, Ting; Zhu, Mei-Lin; Sun, Guang-Yu; Li, Na; Gu, Qian-Qun; Li, De-Hai; Che, Qian; Zhu, Tian-Jiao

    2016-10-01

    Two new compounds, exopisiod B (1) and farylhydrazone C (2), together with two known compounds (3-4), were isolated from the Antarctic-derived fungus Penicillium sp. HDN14-431. Their structures including absolute configurations were elucidated by spectroscopic methods and TDDFT ECD calculations. The cytotoxicity and antimicrobial activities of all compounds were tested.

  10. New Eudesmane-Type Sesquiterpenoids from the Mangrove-Derived Endophytic Fungus Penicillium sp. J-54.

    PubMed

    Qiu, Liuming; Wang, Pei; Liao, Ge; Zeng, Yanbo; Cai, Caihong; Kong, Fandong; Guo, Zhikai; Proksch, Peter; Dai, Haofu; Mei, Wenli

    2018-03-28

    Four new eudesmane-type sesquiterpenoids, penicieudesmol A-D ( 1 - 4 ), were isolated from the fermentation broth of the mangrove-derived endophytic fungus Penicillium sp. J-54. Their structures were determined by spectroscopic methods, the in situ dimolybdenum CD method, and modified Mosher's method. The bioassays results showed that 2 exhibited weak cytotoxicity against K-562 cells.

  11. Response of progeny bred from Bolivian and North American cultivars in integrated management systems for leaf spot of peanut (Arachis hypogaea)

    USDA-ARS?s Scientific Manuscript database

    Early leaf spot caused by the fungus Cercospora arachidicola, and late leaf spot caused by the fungus Cercosporidium personatum, are major yield-reducing diseases of peanut (Arachis hypogaea L.) in the southeastern U.S. Effective control of both leaf spots can be reached with integrated disease man...

  12. Fulfillment of Koch’s postulates and partial host range of Septoria lepidii Desm., a fungal pathogen for potential biological control of hoary cress (Lepidium spp.)

    USDA-ARS?s Scientific Manuscript database

    We have fulfilled Koch’s postulates and conducted host range tests with Septoria lepidii Desm. on five geographical accessions of hoary cress. Host range results showed the fungus specific to Lepidium spp. and damaging to hoary cress. This fungus is potentially an important biological control agent ...

  13. Red Rot of Ponderosa Pine (FIDL)

    Treesearch

    Stuart R. Andrews

    1971-01-01

    Red rot caused by the fungus Polyporus anceps Peck is the most important heart rot of ponderosa pine (Pinus ponderosa Laws.) in the Southwest (in Arizona and New Mexico), the Black Hills of South Dakota, and some localities in Colorado, Montana, and Idaho. It causes only insignificant losses to this species elsewhere in the West. The red rot fungus rarely attacks other...

  14. An expedited method to isolate DNA for PCR from Magnaporthe oryzae stored on filter paper

    USDA-ARS?s Scientific Manuscript database

    The fungus Magnaporthe oryzae is the causal agent for a wide range of cereal diseases. For long-term preservation, the fungus is grown and stored desiccated on filter papers at -20° C. Inoculated filter papers were cut into pieces from 0.5-1 cm diameter prior to storage. In the present study, a quic...

  15. Seasonal dynamics of ectomycorrhizal fungus assemblages on oak seedlings in the southeastern Appalachian Mountains

    Treesearch

    John F. Walker; Orson K. Jr. Miller; Jonathan L. Horton

    2008-01-01

    The potential for seasonal dynamics in ectomycorrhizal (EM) fungal assemblages has important implications for the ecology of both the host trees and the fungal associates. We compared EM fungus distributions on root systems of out-planted oak seedlings at two sites in mixed southeastern Appalachian Mountain forests at the Coweeta Hydrologic Laboratory in North Carolina...

  16. Thermomyces lanuginosus STm: a source of thermostable hydrolytic enzymes for novel application in extraction of high-quality natural rubber from Taraxacum kok-saghyz (rubber dandelion)

    USDA-ARS?s Scientific Manuscript database

    Hydrolytic enzymes from a newly isolated strain of the thermophilic fungus Thermomyces lanuginosus were used to extract rubber from Taraxacum kok-saghyz commonly known as rubber (or Russian or Kazak(h)) dandelion. The fungus was isolated from garden soil and identified as Thermomyces lanuginosus STm...

  17. Short-Read Sequencing for Genomic Analysis of the Brown Rot Fungus Fibroporia radiculosa

    Treesearch

    J. D. Tang; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; S. C. Burgess; S. V. Diehl

    2012-01-01

    The feasibility of short-read sequencing for genomic analysis was demonstrated for Fibroporia radiculosa, a copper-tolerant fungus that causes brown rot decay of wood. The effect of read quality on genomic assembly was assessed by filtering Illumina GAIIx reads from a single run of a paired-end library (75-nucleotide read length and 300-bp fragment...

  18. Co-ordinated Changes in the Accumulation of Metal Ions in Maize (Zea mays ssp. mays L.) in Response to Inoculation with the Arbuscular Mycorrhizal Fungus Funneliformis mosseae

    USDA-ARS?s Scientific Manuscript database

    Arbuscular mycorrhizal symbiosis is an ancient interaction between plants and Glomeromycotan fungi. In exchange for photosynthetically fixed carbon, the fungus provides the plant host with greater access to soil nutrients via an extensive network of root-external hyphae. Here, to determine the impac...

  19. Inheritance of the bark reaction resistance mechanism in Pinus monticola infected by Cronartium ribicola

    Treesearch

    Ray J. Hoff

    1986-01-01

    Necrotic reactions in branch or main stems of western white pine (Pinus monticola Dougl.) caused by infection by the blister rust fungus (Cronartium ribicola J. C. Fisch. ex Rabenh.) are a major mechanism of resistance. Overall, 26 percent of the seedlings eliminated the fungus via this defense system. Heritability based upon crossing family groups averaged 33 percent...

  20. Three Colopterus beetle species carry the oak wilt fungus to fresh wounds on red oak in Missouri

    Treesearch

    Maya Hayslett; Jennifer Juzwik; Bruce Moltzan

    2008-01-01

    Beetles in the family Nitidulidae can transmit the oak wilt fungus, Ceratocystis fagacearum, to fresh wounds on healthy oak trees, leading to infection and disease development. Historically, nitidulid beetles have not been considered important vectors of the pathogen in Missouri. Studies were conducted in the spring of 2005 and 2006 to determine...

  1. Cumulative impact of a clover cover crop on the persistance and efficancy of Beauveria bassiana in suppressing the pecan weevil (Coleoptera: Curculionidae)

    USDA-ARS?s Scientific Manuscript database

    Curculio caryae (Horn), is a key pest of pecans. Endemic levels of the entomopathogenic fungus Beauveria bassiana can occur in pecan orchards and contribute to natural control of C. caryae. Commercial formulations of the fungus can also be applied for suppression of C. caryae. We hypothesized tha...

  2. Estimation of median lethal concentration of three isolates of Beauveria bassiana for control of Megacopta cribraria (Heteroptera: Plataspidae) bioassayed on solid Lugys Spp. Diet²

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Beauveria bassiana is a potential candidate for biological control of a variety of pests. The objectives of this study were isolate and identify the fungus from Kudzu bugs and determine its infectivity comparing with two highly pathogenic isolates including the Mississipp...

  3. Sulfuryl fluoride fumigation of red oak logs eradicates the oak wilt fungus

    Treesearch

    Elmer L. Schmidt; Jennifer Juzwik; Brian Schneider

    1997-01-01

    Preliminary field trials using red oak logs from trees dying from oak wilt disease were successful in eliminating oak wilt fungus from sapwood after fumigation with sulfuryl fluoride for 72 h under tarp. These results support earlier laboratory data on the fungitoxicity of sulfuryl fluoride as a potential replacement for methyl bromide of exported red oak veneer logs....

  4. Elm diseases

    Treesearch

    John W. Peacock

    1989-01-01

    Dutch elm disease was found in Cleveland, Ohio, in 1930, and is now in most of the contiguous 48 states. The disease is caused by a fungus that has killed millions of wild and planted elms. Losses have been the greatest in the eastern United States. The fungus attacks all elms, but our native species, American, slippery, and rock elm have little or no resistance to the...

  5. The fungus Raffaelea lauricola modifies behavior of its symbiont and vector, the redbay ambrosia beetle (Xyleborus glabratus), by altering host plant volatile production

    USDA-ARS?s Scientific Manuscript database

    The redbay ambrosia beetle, Xyleborus glabratus, is the vector of a symbiotic fungus, Raffaelea lauricola that causes laurel wilt, a highly lethal disease to members of the Lauraceae. Pioneer Xyleborus glabratus beetles infect live trees with Raffaelea lauricola, and only when trees are declining be...

  6. Fomes annosus - what it is and how to recognize it

    Treesearch

    Paul V. Mook; Harold G. Eno

    1961-01-01

    The fungus Fomes annosus has caused a great deal of damage to coniferous forests and plantations in Europe. The disease caused by this fungus is now widespread in the United States. In the past few years we have become increasingly aware of its threat in the Northeast. It is particularly damaging to 20- to 30-year-old conifer plantations on formerly...

  7. Assessing host specialization among aecial and telial hosts of the white pine blister rust fungus, Cronartium ribicola

    Treesearch

    Bryce A. Richardson; Paul J. Zambino; Ned B. Klopfenstein; Geral I. McDonald; Lori M. Carris

    2007-01-01

    The white-pine blister rust fungus, Cronartium ribicola Fisch. in Rabenh., continues to spread in North America, utilizing various aecial (primary) and telial (alternate) hosts, some of which have only recently been discovered. This introduced pathogen has been characterized as having low genetic diversity in North America, yet it has demonstrated a...

  8. How to identify and manage oak wilt in Texas

    Treesearch

    D.N. Appel; R.S. Cameron; A.D. Wilson; J.D. Johnson

    2008-01-01

    Transporting unseasoned firewood from diseased red oaks is a potential means of spreading the oak wilt fungus. Oak wilt cannot be transmitted by burning infected firewood, but fungal mats may form on firewood in storage. Presently, no vectors have been proven to transmit the fungus from live oaks to other oak trees, but diseased wood fromany oak species should never be...

  9. White-nose syndrome in bats: an overview of current knowledge for land managers

    Treesearch

    Roger W. Perry

    2013-01-01

    White-nose syndrome recently emerged as a disease affecting bats that hibernate in caves and abandoned mines during winter. This disease is caused by the fungus Pseudogymnoascus destructans, and has caused the death of millions of bats in the Eastern United States and Canada. This fungus grows in relatively cold conditions with high humidity, which...

  10. Molecular characterization of a heterothallic mating system in Pseudogymnoascus destructans, the fungus causing white-nose syndrome of bats

    Treesearch

    Jonathan M. Palmer; Alena Kubatova; Alena Novakova; Andrew M. Minnis; Miroslav Kolarik; Daniel L. Lindner

    2014-01-01

    White-nose syndrome (WNS) of bats has devastated bat populations in eastern North America since its discovery in 2006. WNS, caused by the fungus Pseudogymnoascus destructans, has spread quickly in North America and has become one of the most severe wildlife epidemics of our time. While P. destructans is spreading rapidly in North...

  11. Polyketide-Terpene Hybrid Metabolites from an Endolichenic Fungus Pestalotiopsis sp.

    PubMed Central

    Ding, Gang; Wang, Hai-Ying; Guo, Yu-Hua; Shang, Hai

    2017-01-01

    Five new polyketide-terpene hybrid metabolites (1–5) with highly functionalized groups, together with six known derivatives (6–11), were isolated from the endolichenic fungus Pestalotiopsis sp. Their structures were elucidated by extensive NMR experiments including 1H, 13C, HMQC, COSY, and HMBC. The relative configurations of the new compounds were determined by analysis of coupling constants and ROESY correlations. The absolute configurations especially the secondary alcohol at C-15 in 1 and secondary alcohol at C-14 in 5 were established via the CD experiments of the in situ formed [Rh2(OCOCF3)4] complex with the acetonide derivatives. These compounds were tested for their inhibition activity against six plant pathogens. Compounds 1 and 5 exhibited pronounced efficiency against Fusarium oxysporum, and compounds 5 and 6 potently inhibited Fusarium gramineum with MIC value of 8 µg/mL, which revealed the plausible ecological role of endolichenic fungus in providing chemical protection for its host lichen in the fungus-plant relationship. The biosynthetic pathway of compounds 1–11 was postulated for the first time, which paved the way for its further biosynthesis research. PMID:28593175

  12. Thermostable Acid Protease Produced by Penicillium duponti K1014, a True Thermophilic Fungus Newly Isolated from Compost

    PubMed Central

    Hashimoto, Hikotaka; Iwaasa, Takashi; Yokotsuka, Tamotsu

    1972-01-01

    A thermophilic fungus, K1014, newly derived from a compost was selected on the basis of protease productivity as the only one of 81 isolates to produce high levels of acid protease. The fungus was named Penicillium duponti K1014 based on taxonomical studies. It grew in the temperature range of 28 to 58 C, and the optimum was 45 to 50 C. These temperature characteristics showed that the fungus was the most strongly thermophilic of all the fungi next to Humicola lanuginosa. When P. duponti K1014 was grown on moistened wheat bran, maximal accumulation of acid protease occurred after 2 days at 45 to 50 C. The addition of ammonium salts, but not nitrate, was effective for the production of the acid protease. The acid protease of P. duponti K1014 was stable at 60 C for 1 hr and retained more than 65% of original activity after the treatment for 1 hr at 70 C at pH 4.7. This thermal property was different from those of the ordinary acid proteases, indicating that the enzyme is a thermostable protein. Images PMID:4650601

  13. Identification of genes that regulate phosphate acquisition and plant performance during arbuscular my corrhizal symbiosis in medicago truncatula and brachypodium distachyon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harrison, Maria J; Hudson, Matthew E

    Most vascular flowering plants have the ability to form symbiotic associations with arbuscular mycorrhizal (AM) fungi. The symbiosis develops in the roots and can have a profound effect on plant productivity, largely through improvements in plant mineral nutrition. Within the root cortical cells, the plant and fungus create novel interfaces specialized for nutrient transfer, while the fungus also develops a network of hyphae in the rhizosphere. Through this hyphal network, the fungus acquires and delivers phosphate and nitrogen to the root. In return, the plant provides the fungus with carbon. In addition, to enhancing plant mineral nutrition, the AM symbiosismore » has an important role in the carbon cycle, and positive effects on soil health. Here we identified and characterized plant genes involved in the regulation and functioning of the AM symbiosis in Medicago truncatula and Brachypodium distachyon. This included the identification and and characterization of a M. truncatula transcription factors that are required for symbiosis. Additionally, we investigated the molecular basis of functional diversity among AM symbioses in B. distachyon and analysed the transcriptome of Brachypodium distachyon during symbiosis.« less

  14. Direct ethanol production from starch, wheat bran and rice straw by the white rot fungus Trametes hirsuta.

    PubMed

    Okamoto, Kenji; Nitta, Yasuyuki; Maekawa, Nitaro; Yanase, Hideshi

    2011-03-07

    The white rot fungus Trametes hirsuta produced ethanol from a variety of hexoses: glucose, mannose, cellobiose and maltose, with yields of 0.49, 0.48, 0.47 and 0.47 g/g of ethanol per sugar utilized, respectively. In addition, this fungus showed relatively favorable xylose consumption and ethanol production with a yield of 0.44 g/g. T. hirsuta was capable of directly fermenting starch, wheat bran and rice straw to ethanol without acid or enzymatic hydrolysis. Maximum ethanol concentrations of 9.1, 4.3 and 3.0 g/l, corresponding to 89.2%, 78.8% and 57.4% of the theoretical yield, were obtained when the fungus was grown in a medium containing 20 g/l starch, wheat bran or rice straw, respectively. The fermentation of rice straw pretreated with ball milling led to a small improvement in the ethanol yield: 3.4 g ethanol/20 g ball-milled rice straw. As T. hirsuta is an efficient microorganism capable of hydrolyzing biomass to fermentable sugars and directly converting them to ethanol, it may represent a suitable microorganism in consolidated bioprocessing applications. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Genetic stability of ectomycorrhizal fungi is not affected by cryopreservation at -130 °C or cold storage with repeated sub-cultivations over a period of 2 years.

    PubMed

    Crahay, Charlotte; Munaut, Françoise; Colpaert, Jan V; Huret, Stéphanie; Declerck, Stéphane

    2017-08-01

    Cryopreservation is considered the most reliable method for storage of filamentous fungi including ectomycorrhizal (ECM) fungi. A number of studies, however, have reported genetic changes in fungus cultures following cryopreservation. In the present study, the genetic stability of six ECM fungus isolates was analyzed using amplified fragment length polymorphism (AFLP). The isolates were preserved for 2 years either by cryopreservation (at -130 °C) or by storage at 4 °C with regular sub-cultivation. A third preservation treatment consisting of isolates maintained on Petri dishes at 22-23 °C for 2 years (i.e., without any sub-cultivation) was included and used as a control. The differences observed in AFLP patterns between the three preservation methods remained within the range of the total error generated by the AFLP procedure (6.85%). Therefore, cryopreservation at -130 °C and cold storage with regular sub-cultivation did not affect the genetic stability of the ECM fungus isolates, and both methods can be used for the routine storage of ECM fungus isolates over a period of 2 years.

  16. Detection of Batrachochytrium dendrobatidis in endemic salamander species from central Texas.

    PubMed

    Gaertner, James P; Forstner, Michael R J; O'Donnell, Lisa; Hahn, Dittmar

    2009-03-01

    A nested PCR protocol was used to analyze five endemic salamander species from Central Texas for the presence of the emerging pathogen, chytrid fungus (Batrachochytrium dendrobatidis). Chytrid fungus was detected from samples of each of the five species sampled: with low abundance, in the Texas salamander (Eurycea neotenes) (1 positive out of 16 individuals tested; 1/16), the Blanco River Springs salamander (E. pterophila) (1/20), the threatened San Marcos salamander (E. nana) (1/17), and the endangered Barton Springs salamander (E. sosorum) (1/7); much higher abundance was obtained for the Jollyville Plateau salamander (E. tonkawae) (6/14), which has recently been petitioned for addition to the USA endangered species list. With one exception, sequences of PCR products were identical to the 5.8S rRNA gene, and nearly so for the flanking internal transcribed spacer (ITS) regions of B. dendrobatidis which confirmed the detection of chytrid fungus, and thus demonstrated the presence of this pathogen in populations of endangered species in Central Texas. These confirmations were obtained from nonconsumptive tail clippings which confirms the applicability of historically collected samples from other studies in the examination of the fungus across time.

  17. Symbiotic Fungus of Marine Sponge Axinella sp. Producing Antibacterial Agent

    NASA Astrophysics Data System (ADS)

    Trianto, A.; Widyaningsih, S.; Radjasa, OK; Pribadi, R.

    2017-02-01

    The emerging of multidrug resistance pathogenic bacteria cause the treatment of the diseaseshave become ineffective. There for, invention of a new drug with novel mode of action is an essential for curing the disease caused by an MDR pathogen. Marine fungi is prolific source of bioactive compound that has not been well explored. This study aim to obtain the marine sponges-associated fungus that producing anti-MDR bacteria substaces. We collected the sponge from Riung water, NTT, Indonesia. The fungus was isolated with affixed method, followed with purification with streak method. The overlay and disk diffusion agar methods were applied for bioactivity test for the isolate and the extract, respectively. Molecular analysis was employed for identification of the isolate. The sponge was identified based on morphological and spicular analysis. The ovelay test showed that the isolate KN15-3 active against the MDR Staphylococcus aureus and Eschericia coli. The extract of the cultured KN15-3 was also inhibited the S. aureus and E. coli with inhibition zone 2.95 mm and 4.13 mm, respectively. Based on the molecular analysis, the fungus was identified as Aspergillus sydowii. While the sponge was identified as Axinella sp.

  18. Potential of endophytic fungus Phomopsis liquidambari for transformation and degradation of recalcitrant pollutant sinapic acid.

    PubMed

    Xie, Xing-Guang; Huang, Chun-Yan; Fu, Wan-Qiu; Dai, Chuan-Chao

    2016-03-01

    The biodegradation potential of sinapic acid, one of the most representative methoxy phenolic pollutants presented in industrial wastewater, was first studied using an endophytic fungus called Phomopsis liquidambari. This strain can effectively degrade sinapic acid in flasks and in soil and the possible biodegradation pathway was first systematically proposed on the basis of the metabolite production patterns and the identification of the metabolites by GC-MS and HPLC-MS. Sinapic acid was first transformed to 2,6-dimethoxy-4-vinylphenol that was further degraded via 4-hydroxy-3,5-dimethoxybenzaldehyde, syringic acid, gallic acid, and citric acid which involved in the continuous catalysis by phenolic acid decarboxylase, laccase, and gallic acid dioxygenase. Moreover, their activities and gene expression levels exhibited a 'cascade induction' response with the changes in metabolic product concentrations and the generation of fungal laccase significantly improved the degradation process. This study is the first report of an endophytic fungus that has great potential to degrade xenobiotic sinapic acid, and also provide a basis for practical application of endophytic fungus in the bioremediation of sinapic acid-contaminated industrial wastewater and soils. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. De novo biosynthesis of cytokinins in the biotrophic fungus Claviceps purpurea.

    PubMed

    Hinsch, Janine; Vrabka, Josef; Oeser, Birgitt; Novák, Ondřej; Galuszka, Petr; Tudzynski, Paul

    2015-08-01

    Disease symptoms of some phytopathogenic fungi are associated with changes in cytokinin (CK) levels. Here, we show that the CK profile of ergot-infected rye plants is also altered, although no pronounced changes occur in the expression of the host plant's CK biosynthesis genes. Instead, we demonstrate a clearly different mechanism: we report on the first fungal de novo CK biosynthesis genes, prove their functions and constitute a biosynthetic pathway. The ergot fungus Claviceps purpurea produces substantial quantities of CKs in culture and, like plants, expresses enzymes containing the isopentenyltransferase and lonely guy domains necessary for de novo isopentenyladenine production. Uniquely, two of these domains are combined in one bifunctional enzyme, CpIPT-LOG, depicting a novel and potent mechanism for CK production. The fungus also forms trans-zeatin, a reaction catalysed by a CK-specific cytochrome P450 monooxygenase, which is encoded by cpp450 forming a small cluster with cpipt-log. Deletion of cpipt-log and cpp450 did not affect virulence of the fungus, but Δcpp450 mutants exhibit a hyper-sporulating phenotype, implying that CKs are environmental factors influencing fungal development. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. [Effects of endophytic fungi from Dendrobium officinale on host growth and components metabolism of tissue culture seedlings].

    PubMed

    Zhu, Bo; Liu, Jing-Jing; Si, Jin-Ping; Qin, Lu-Ping; Han, Ting; Zhao, Li; Wu, Ling-Shang

    2016-05-01

    The paper aims to study the effects of endophytic fungi from D. officinale cultivated on living trees on growth and components metabolism of tissue culture seedlings. Morphological characteristics and agronomic characters of tissue culture seedlings infected and uninfected by endophytic fungus were observed and measured. Polysaccharides and alcohol-soluble extracts contents were determined by phenol-sulfuric acid method and hot-dipmethod, respectively. Monosacchride composition of polysaccharides and alcohol-soluble extracts components were analyzed by pre-column derivatives HPLC and HPLC method, respectively. It showed that effects of turning to purple of stem nodes could be changed by endophytic fungus. Besides, the endophytic fungus could affect the contents and constitutions of polysaccharides and alcohol-soluble extracts. The strains tested, expect DO34, could promote growth and polysaccharides content of tissue culture seedlings. The strains tested, expect DO12, could promote the accumulation of mannose. Furthermore, DO18, DO19 and DO120 could increase alcohol-soluble extracts. On the basis, four superior strains were selected for mechanism research between endophytic fungus and their hosts and microbiology engineering. Copyright© by the Chinese Pharmaceutical Association.

Top